Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 is a top view diagram of a registration guide 15 for positioning a hand for imaging according to the principles of the present invention . at the core of registration guide 15 is base 10 . base 10 is optionally made of a polymer material having a thickness of approximately five millimeters to maintain an optimal distance between the palm of a hand resting in registration guide 15 and a scanner device disposed beneath registration guide 15 . as shown , base 10 includes window 50 for viewing surface patterns of a palm aligned in registration guide 15 . typically , base 10 is made of a soft plastic material so that it will not scratch or damage the glass surface of a scanner upon which the registration guide rests . base 10 can be flat or contoured depending on a particular application and , of course , can be made of almost any material . fig4 a and 4b illustrate a cross - sectional and perspective view of base 10 . a thickness of base 10 can vary depending on how far away an object is to be held from a scanner device during the scanning process . some scanners devices require that an object be disposed closer to a surface of the scanner than others . for example , if the scanner is a standard copier machine capable of copying paper resting on its surface , the thickness of registration guide 15 must be minimal so that a biometric pattern to be scanned is as close to the scanning surface as possible without touching . minimal touching of the scanned pattern can still produce an image that can be matched to a pattern stored in memory . palm window 50 can be cut in base 10 for viewing the palm of a hand as discussed . as shown in fig5 , registration guide 15 can be placed on a scanning surface while a palm resting on base 10 is scanned through palm window 50 . the size and shape of palm window 50 can vary depending upon which region of a hand is to be scanned . referring again to fig1 , five base finger tracks 20 and corresponding slidable finger rails 30 are provided so that fingers of a hand are properly registered for viewing . each finger rail 30 includes a finger window 70 for viewing fingerprints or biometric surface patterns . accordingly , five fingers and a palm can be scanned simultaneously in their natural state using registration guide 15 . biometric patterns , therefore , are not deformed due to pressure of the finger or palm against glass . the thickness of a finger rail 30 and finger track 20 is approximately three millimeters thick in order to maintain optimal distance between the surface region of a finger to be scanned and corresponding scanner device . notably , this thickness can vary depending on the application as previously discussed . finger rails 30 and finger track 20 also can be made from plastic or any suitable material . one aspect of the present invention involves providing a universal registration guide 15 so that different sized hands can be registered for scanning using the same hand registration guide 15 . similar or same surface patterns on an object can be viewed each time the object is registered for imaging . some hands have wider spacings between fingers than others . to accommodate for such a variation in hand characteristics , base 10 includes pin slots 60 so that base finger tracks 20 can be spaced depending on finger spacing and hand size . more specifically , each base finger track 20 is movably connected to base 10 via a slidable pin 40 . accordingly , the angle of base finger track 20 is adjustable relative to the base 10 . also , the location of base finger track 20 where it meets base 10 via slidable pin 40 can be shifted in a slot 60 to accommodate finger spacing of a particular hand . another aspect of the present invention involves providing base finger tracks 20 that adjust to the length of corresponding fingers to be scanned . for example , slidable finger rail 30 is engaged with base finger track 20 . depending on the length of a finger , each finger rail 30 slides so that the tip of finger rail 30 can be lined up with the end of a corresponding finger to be scanned . finger rail window 70 is preferably open as shown by the cross - hatched region so that a scanning device can view a biometric pattern of an object registered in finger rail 30 . one application of registration guide 15 is the registration of a hand or object above a scanner for viewing portions of a hand in their natural state . more specifically , registration guide 15 can be formed so that certain portions of a hand are appropriately positioned at a distance above a scanner for viewing biometric patterns as they appear in their natural , undeformed state . in a specific application , the biometric matter to be scanned is supported three millimeters above the surface of a scanner based on an appropriate thickness of registration guide 15 . another application of the registration guide according to the principles of the present invention is to measure absorbed or reflected light from an exposed part of a hand . in such an application , the registration guide removes the pressure induced change in intensity of absorbed or scattered light . fig2 a and 2b more particularly illustrate a finger rail 30 according to the principles of the present invention . as shown , finger rail 30 can include angled edges 220 so that a finger can be comfortably registered for viewing through finger window area 70 . grooved slots 210 on the underside of finger rail 30 engage with outer tracks 320 of finger track 20 as shown in fig3 a and 3b . notably , finger window 70 is an open window so that the base portion of a finger can also be scanned as well as the tip of a finger . as previously mentioned , finger rail 30 can slide in an axial length of finger track 20 so that it can be adjusted to the size of a finger . as shown , finger base track 20 includes a bore hole 310 through which a slidable pin 40 secures finger base track 20 to base 10 . this was shown and discussed in fig1 . fig5 is a diagram illustrating the use of a hand registration guide 15 for contactless scanning of multiple biometrically patterned regions according to the principles of the present invention . as shown , a human hand 510 is placed in hand registration guide 15 . finger rails 30 are then adjusted to the length of each corresponding finger as previously discussed . scanner device 520 such as a high resolution scanner then captures images of biometric patterns through palm window 50 and finger windows 70 . depending on a particular application , scanner device 520 captures color or merely black and white images . it is preferred that scanning device 520 is capable of detecting pores and other patterns in human skin so that a corresponding person can be identified based on , for example , finger and / or palm prints . support structure 530 is preferably glass so that scanner device 520 can shine light towards hand 510 and capture a corresponding image that is thereafter processed by image processing device 528 and stored in memory 540 . of course , two hands can be scanned simultaneously using a right and left hand registration guide 15 . based on the application of registration guide 15 as discussed , a common region can be scanned for many different sized hands . in addition to the advantages as previously discussed , registration guide 15 can accommodate any physical size of a palm and / or fingers even if they deviate from the norm in terms of size and shape . more specifically , registration guide 15 can be quickly and easily adjusted to fit many sizes , even in a case where a hand to be scanned includes at least one partially amputated finger . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	6
to investigate the tactic of signal transduction , affecting survival of tumor cells which have developed in a previously healthy host , a system and method in accordance with the present invention employs a computational modeling system and method that contains cells residing and moving in a three dimensional grid . the cells follow the healthy cell cycle and they may mutate during proliferation . the system described routes to tumor development in terms of disruption to system regulation and accumulation of mutations associated with the malignant process . the system and method of the present invention employs rescue algorithms that have been designed based on “ citizenship properties ” of the cells , with the goal to eradicate the aberrant cells or confine them and restore the full functionality of the biological system being monitored . in other words , the rescue algorithms initiate induction of apoptosis in transformed cells while not reducing the regeneration abilities of the normal cells . a system and method in accordance with the present invention enables an operator to pause the natural development at any point , store the state where it is , and continue from that point with various optional treatment algorithms in order to determine the best choice for the given dynamic configuration . the treatments may include simulations of surgery , radiotherapy , and chemotherapy ( hormone and biological therapy simulations are also possibilities ), to the extent wanted , or their combinations , and also various rescue protocols . the rescue protocols are parameterized by different properties such as the signals &# 39 ; strength and the distance they travel , the sensitivity level of the cells that initiate these signals , as well as the amount of such signals required to wake an otherwise problematic apoptosis . in such a way it is possible to design combination algorithms for best fighting of the particular tumor based on its level of aggressiveness and its size at the time of starting the treatment . a computational modeling system and method in accordance with the present invention enables the simulation and analysis of different signaling protocols . two protocols were found most sufficient to eradicate tumors when working together . one protocol is initiated by healthy cells that sense aberrant cells around them and initiate signals to alert cells and to initiate apoptosis . the other protocol is initiated by the death of ( aberrant or normal ) cells ( which are dying due to this combination protocol ). it was previously found that the death of ( healthy ) cells entices increases in the local cells proliferation . use of a computational modeling system and method in accordance with the present invention suggests that the death of ( both aberrant and normal ) cells can also initiate communication and entices the death of other aberrant cells . a computational system and method in accordance with the present invention and exemplary experimental citizenship protocols studied to restore biological system regularity using such a system and method will now be discussed in further detail . an exemplary computer based system 20 for implementing a computational modeling system and method in accordance with the present invention is illustrated in , and will be described with reference to , fig1 . a computational modeling system and method in accordance with the present invention may preferably be implemented in a conventional computer 22 , such as a conventional pc or mac or any other type of computer or group of computers connected together in any form , such as via a wired or wireless network . the computer 22 on which the system and method of the present invention is implemented preferably includes conventional input devices 24 , such as a keyboard , mouse , etc ., and output devices 26 , such as a monitor , printer , etc ., connected thereto . the input 24 and output 26 devices allow an operator of the system 20 to interact with the computational modeling system and method of the present invention and to view the results provided by the system and method , in a manner to be described in more detail below . system memory 28 preferably is provided as part of and / or connected to the computer 22 . the system memory 28 , which may include ram , removable or hard disc memory and / or other memory devices , preferably includes tissue modeling software 30 to implement a computational model of malignant transformation in tissue in accordance with the present invention . system memory 28 preferably also contains conventional operating system and other general software applications required or desired for operation of the computer 22 . based on the detailed description and drawings provided herein , a person of ordinary skill in the art of computer programming of medical or biological simulations will be able to implement a computational modeling system and method in accordance with the present invention using conventional programming languages , such as c ++, and programming techniques on conventional computer hardware running conventional operating systems , such as windows . a detailed description of the structure and operation of a computational model of malignant transformation in tissue in accordance with the present invention will first be provided . a computational modeling system and method in accordance with the present invention provides for the modeling and simulation of a multi - cell biological system which enables the study of cell damage , as well as the design and testing of a battery of rescue protocols , which work as stand alone or together with existing therapies . the central modeled element of a system and method in accordance with the present invention is a cell . each modeled cell may be stored within the system using any conventional or convenient data structure . each modeled and stored cell is defined by several characteristics . each cell is defined as either a normal cell or a mutated or aberrant cell . whether a cell is normal or aberrant defines other characteristics of the cell . the type of cell may be established by a flag set for the cell data or a master list of normal and aberrant cells . each cell is defined by a location in virtual three dimensional space . any coordinate system may be employed , but a conventional three dimensional orthogonal ( x , y , z ) coordinated system is convenient . the coordinate position of each cell may be stored with each cell &# 39 ; s data using the preferred data structure . note that since each cell is uniquely defined by its position ( only one cell may occupy any one position in virtual space ) the cell coordinate may be used as the cell identifier ( i . e ., no separate cell identification number or the like need be used , although a cell i . d . for each cell may be used if convenient ). a computational modeling system in accordance with the present invention may preferably simulate a three - dimensional structure of cells residing in a membrane . the membrane defines the maximize size or borders of the virtual three dimensional space in which the cells live and die . the membrane size may be user selectable and may be of any size desired depending on the desired simulation to be run , available computational resources and processing time , etc . the membrane size may be defined in terms of units of locations in space at which a cell may reside . for example , a membrane size of 40 × 40 × 20 units would have 32 , 000 possible cell locations . here we will discuss the first difference between modeled normal cells and aberrant cells . healthy normal cells do not impede on other cells &# 39 ; space . thus , in a preferred embodiment of the present invention , healthy cells may not occupy adjacent positions within the membrane space . thus , in the 40 × 40 × 20 membrane space defined above there may be at most 4000 healthy cells , where every other spot within the membrane space represents the natural spacing between neighbors . aberrant cells are not under such a spacing limitation , and thus may occupy any spot in the membrane space without regard to adjacent normal or aberrant cells . fig2 is a schematic two dimensional representation showing the exemplary relative positional spacing between normal 32 and aberrant 34 cells in a computational model in accordance with the present invention as just described . each modeled cell also contains a life protocol in terms of a list of factors that control its functioning and behavior . a mutation causes a factor to cease regulation , unless it is repaired . six exemplary core factors are : replication . controls whether a cell will replicate . replication is based on an inherent probability , the cell &# 39 ; s age and its generation , as well as the need or availability of the modeled system for more cells . replication suppressant . checks that the cell does not replicate above threshold probability , which is the mark of a severe problem . check point . verify that the cell contains no mutations , done before replication . repair . if any regulation factor is mutated or otherwise not functioning correctly the cell will try to repair itself . apoptosis . controls the death of a cell . cells can die due to age , un - repaired damage , or a fixed probability . self death can be initiated internally , when an internal check shows un - repairable mutation , or may be initiated by signals external to the cell itself . the later will be the basis of the rescue protocols . concentration threshold . ensures that cells do not over - populate by setting a threshold for concentration or distance among cells . this enables every cell to have its necessary resources available . in some applications , cells may move to distribute concentration as desired . such cell movement will introduce further complexity of any concurring tumor . information among cells is transferred via different mechanisms . one such mechanism is diffusion , in which each cell emits to the environment a fixed value , and the value itself propagates away , becoming smaller with distance . this will be used by the cells to recognize spatial concentrations . another information transfer mechanism is by direct communication among cells , where cells alert each other about the existence of irregular ones in the area and send messages to initiate apoptosis . this direct communication mechanism is the basis of the rescue protocols . in the simulation , at each time step each cell performs an action . repair . if the cell noticed that it was damaged during the previous time tick , it will attempt to repair itself in the current one . death . if the cell has been trying to repair and has failed in previous ticks , it may attempt to kill itself . there is also a random death in the system that can happen at the beginning of a time tick , as well as death due to external signaling . replication . a “ daughter ” cell is formed and sent to a neighboring space that is not over - populated , with a copy of the regulation factors intact . replication preferably occurs only after the cell is checked for health . at replication , a mutation to any of the life protocols may occur , governed by a probability . the mutation probability is adaptable to environmental conditions . movement . in some applications , a cell can move by one space in any direction , as long as that space is not populated . participating in rescue protocols . at each step a cell is capable of initiating a rescue signal , of receiving signals , and of propagating signals that have arrived to it . aberrant cells have all the regulation factors ( replication , replication suppressant , check point , repair , apoptosis , and concentration threshold ) ruined . their replication is not controlled : no check - points , no concentration threshold , and no replication suppressant . they will push the healthy cells away and take over all nutrients . in the simulation , aberrant cells may be introduced by both natural development of collective mutations , and by externally planting them . rescue protocols are the way a biological system being simulated avoids being killed by aberrant cells . the underlying assumption is that cells share the citizenship responsibility to care for the whole system and they transfer alert messages for this aim . alert messages can be initiated in different ways . the following were found most effective : a message initiated by a cell which senses irregularity in its environment . this may be modeled by a cell noticing elevating levels of over - population . the level of sensitivity ( e . g ., to concentration ) controls the initiation of such messages , and can change with time . for example , knowing of the existence of aberrant cells in the vicinity may raise the cell &# 39 ; s sensitivity . we call this message initiated by sensing local irregularity “ please die .” a cell that was convinced to die by external signaling will announce it in an “ i died ” message . this message can be sent only once in the life cycle of a cell , since it occurs during its death . note that aberrant cells may create any false messages . their effect is minimized by the manner of setting threshold or trust values at the recipient cells . it will thus require highly coordinated signaling from a team of aberrant cells to convince healthy cells to die from enticed apoptosis . signaling is characterized by various parameters including signal strength , the distance it can travel , the duration of the active signaling and the quiet (“ refractory ”) period between successive signaling by the same cell . other parameters include sensitivity parameters to initiate signaling and the suicide threshold at the receiving side which includes the accumulative strength of signals required before the cell will execute self death . the parameters are tuned to maximize their efficiency based on the tumor characteristics . “ please die ” is meant to be targeted towards the irregular cells that caused the local changes ( e . g ., over - population ). the default distance and strength are low , so that only cells within a short radius from the sending cell will count it towards the suicide threshold , and the distant cells will receive it in such small values that it will only elevate their future alertness . this signal is likely to be sent by healthy cells due to the presence of irregular ones . if , however , an aberrant cell initiates a false “ please die ”, it will kill its neighboring cells faster , and due to the cluster property of the growing tumor , many of its neighbors are aberrant . furthermore , due to the death threshold in the healthy cells , a coordinated team of “ please die ” messages is required to overcome the threshold , which means that an aberrant cell does not easily kill with this technique . the “ i died ” signal is especially useful to fight a cluster of aberrant cells from inside . if too weak it will not affect enough and if too strong it will also kill healthy cells outside the cluster . the default distance of this signal is slightly higher than for the “ please die .” this signal causes the dying cells to again be part of the citizenship of the system ( even if they are not doing it intentionally ). for this signal to be effective it is important that aberrant cells can send and receive signals as well . cells that receive enough alert signals will consider themselves to be problematic and will activate their own apoptosis . these are considered the suicide thresholds . suicide thresholds are chosen so as to increase the probability that aberrant cells die and decrease the probability that healthy cells die due to signaling . the efficient rules were found to be : consider only signals that arrive within a window of time , where the window corresponds with the duration of a signal between quiet periods , and let the effect of previous signals fade . this technique will prevent a single cell from causing the death of another one . consider combinations of thresholds for the two signals as well as a common accumulative ( non - differentiating ) threshold . if cells have identity , count a signaling cell once towards the suicide threshold . it is possible that the aberrant cells were not diagnosed on time and the rescue protocols cannot handle the amount of the harm already done or the level of aggressiveness of the aberrant cells . in this case the system will call for external help , e . g ., surgery , radiotherapy , and / or chemotherapy . these outside treatments will attack the aberrant cells in a more violent way . unfortunately , they will also harm the healthy cells to some extent since they are not specific enough . best results for these techniques are achieved when combined with the rescue protocols . exemplary methods for the set - up and initiation of a cellular tumor simulation using a computational modeling system and method in accordance with the present invention will now be described . set - up and initiation may be performed by an operator or user on the computer system 20 preferably using graphical user interfaces provided by the system . preferably intuitive windows - type graphical user interfaces may be provided . it should be understood that various other graphical user interfaces , differing in form and content from those to be described by example herein , may be used in accordance with the present invention . an exemplary main control graphical user interface 36 is illustrated in fig3 . the main control 36 provides for overall simulation controls 38 and cellular controls 40 . the simulation controls 38 allow the operator to select graphical visualization output 42 of the simulation . such exemplary graphical visualization outputs ( 44 , 46 ) are illustrated in fig4 . as illustrated , the visualizations are three - dimensional representations of the cell structure being simulated with dots representing cells at the various cell locations in the virtual space . the dots may be of different colors to represent healthy ( e . g ., red , green ) cells versus aberrant ( e . g ., black ) cells and to enhance the visualization . in this case , the top visualization 44 is a healthy system . the bottom visualization 46 is the system in the middle of fighting aberrant cells , where the black cells are being killed and the healthy ones are going to start growing to take over the newly empty areas . continuing with the simulation controls 38 , the user may select a starting cell configuration 48 by specifying a file defining such a configuration . this may be a manually created configuration or one saved from a previous simulation run . in the absence of selecting such a starting configuration 48 a default starting configuration may be used . for example , the default starting configuration may be a single healthy cell located at the center of the membrane space . the operator may also specify 50 how often , i . e ., after how many simulation cycles , the state of the simulation is saved . a default value of every 100 , for example , cycles of the simulation may be provided for this parameter . note that a new simulation may be restarted from any saved simulation . the operator may manually add 52 a tumor into the cellular simulation by specifying a coordinate location for an aberrant cell . alternatively , the operator may allow the system to randomly position a tumor cell in the membrane space . note that if a tumor is not manually added 52 in this manner , either at a specified or random position , it is still possible for tumors to develop given that each cycle of the simulation there is a small probability chance that each normal cell will mutate into an aberrant cell . turning now to the various cellular controls 40 . the operator may specify a death probability 54 for the cells . the death probability 54 is applied each cycle to each normal and aberrant cell and is the probability that each cell will die in any given cycle . a default death probability 54 of 0 . 0024 may , for example , be used . the operator may specify a mutation probability 56 . the mutation probability 56 is applied each cycle to each normal cell and is the probability that a normal cell will mutate into an aberrant cell in any given cycle . the operator may specify a proliferation probability 58 . the proliferation probability 58 is applied each cycle to each normal and aberrant cell and is the probability that each cell will generate another cell having the same characteristics in any given cycle . the difference between normal and aberrant cells in this respect is that normal cell splitting is subject to other constraints , as discussed above , such as normal cell spacing , aberrant cell division is not subject to such restraints . in the presence of dieing cells and the “ i died ” signal healthy cell proliferation can be elevated . an exemplary graphical user interface 60 for specifying signal parameters is illustrated in fig5 . an operator preferably may specify signal parameters for tumor or aberrant cells 62 and / or regular or normal cells 64 . the “ i died ” signal may be activated for all cells ( tumor cells 66 or normal cells 78 ) for when such cells die by enticed apoptosis . the characteristics of the “ i died ” signal that may be specified include how far the signal will travel 68 , e . g ., specified in units of coordinate distance , and for how long after the cell dies will the signal be present 70 , e . g ., specified in simulation time steps . the operator may also specify the “ i died ” 72 and “ please die ” 74 killing thresholds for tumor cells and the “ i died ” killing threshold 75 for normal cells . these are the cumulative strengths of “ i died ” and / or “ please die ” signals that must be received by each tumor or normal cell before causing it to die . the selected signal parameters apply to all tumor cells or normal cells , as appropriate , in the simulation . for regular cells 64 , the operator may also select activation of the “ please die ” signal 76 and specify parameters thereof . these selected signal parameters apply to all regular cells in the simulation . an exemplary graphical user interface 90 for introducing external therapies into a biological system being simulated in accordance with the present invention is illustrated in fig6 . external therapies 92 that may be selected include chemotherapy , surgery , and radiation therapy . ( additionally or alternatively , a change in therapy may be simulated by changing other parameters in the simulation such as the death , mutation , and proliferation probabilities as selectable using the main controls 36 graphical user interface ( fig3 )). for chemotherapy a life span 94 of the chemotherapy may be selected . chemotherapy affects all cells in the model . for radiation therapy 96 a location of the center of the radiation in the three dimensional model space is specified along with a distance from this center point and a strength . the radiation therapy only affects cells within the specified distance from the defined center of therapy . for surgery 98 a location of the surgery in the modeled space is specified . all cells in the defined region of the modeled space are removed . after all of the desired simulation parameters have been selected and defined , the simulation may be run by selecting the “ run ” button at the bottom of any of the graphical user interfaces described . exemplary use of a computational modeling system and method in accordance with the present invention to model malignant transformation in tissue under various conditions , and the results achieved thereby , will now be presented . the computational modeling system was initialized by one cell that was wrapped by a membrane . the membrane restricts the size of the biological system being modeled . in this case , the membrane enabled cells to fill up a volume that can hold 4000 healthy cells that respect healthy cell separation distance or 32 , 000 aberrant cells which touch each other . the output of the computational modeling system included 3d visualization where the colors green to red show healthy cells in different depths and aberrant cells are black . in a first test of the simulation only the “ please die ” signal was enabled . this signal was found to be unsatisfactory on its own . as shown in fig7 , if only the “ please die ” signal is used and not the “ i died ” signal , there is an exponential growth of tumor cells until they reach a total of 30 , 000 . the number of healthy cells decreased to less than 1 , 000 after only 161 steps , and they decrease to a single cell within 2363 steps . the simulation was repeated after including the “ i died ” signal as well . ( testing with only the “ i died ” signal is not an option since there is no initial external - initiated dying without the “ please die ” signal .) for each signal we changed the initiating signal strength as well as the distance it can travel . fig8 - 12 demonstrate how increasing the strength and distance of the different signals from 1 to 2 improves the effectiveness of the protocol in both eliminating tumor cells as well as in maintaining healthy cells . fig8 depicts a basic situation where the strength / distance of the “ i died ” signal was 1 / 1 and the strength / distance for the “ please die ” was 1 / 0 . 5 . in fig9 we increased the strength and distance of the “ i died ” signal initiated at tumor cells . in fig1 we increased the strength and distance of the “ please die ” signal . in fig1 we increased the strength and distance of the regular cell &# 39 ; s “ i died ” signal . fig1 depicts the most robust scenario where the strengths and distances of all “ i died ” and “ please die ” signals were increased to 2 and 2 respectively . the replication rate in all these runs were 0 . 1 , and death threshold was 2 . various threshold values to entice apoptosis were tried . in fig1 a cell starts enticed apoptosis when either the accumulated strength of the received “ please die ” signals is 2 or the accumulated strength of the received “ i died ” signals is 2 . this situation is compared with fig1 where the “ please die ” threshold is 3 , fig1 where both thresholds are 3 , and fig1 where both thresholds are 4 . the best result is reached with a threshold of 2 ( fig1 ) with 3889 healthy cells and 66 tumor ones at the end of the simulation . in a further set of experiments the modeled cells did not differentiate between the messages from the two types of protocols , thus applying “ combined thresholds .” as shown in fig1 , when the two signals were undifferentiated by the receiving cell with a threshold of 2 , the final result was just a little less robust than when signals where accumulated separately . all above runs used an inherent replication rate of 0 . 1 for healthy cells , which was utilized when environmental conditions enabled replications . this rate does not affect tumors cells as they replicate aggressively . in fig1 , the parameters of fig9 were repeated except that the healthy replication rate was down to 0 . 01 . we then experimented with a new effect of the “ i died ” signal on healthy cells : whenever a healthy cell receives an “ i died ” signal it increases its probability of replication . ( note that this will be affective as long as the threshold for enticing apoptosis has not been reached in which case the cells die . so the “ i died ” entices increased replication rates in healthy cells only when received in small quantities .) in fig1 the replication probability increased by 0 . 01 with each signal received , while in fig1 the replication rate increased by 0 . 03 . we observe that systems with more conservative ( lower ) replication probabilities can be as successful in fighting tumors as highly replicating systems , if the cells have the ability of increasing their replication probability when observing increases of environmental enticed deaths . this property is thus suggested as highly beneficial for increasing the modeled system &# 39 ; s robustness . delayed start of the rescue protocols treatment was simulated , and was found to strongly compromise the health of the modeled system . when treatment starts too late the system may be unable to overcome the harm that was done initially , even with more aggressive parameters of the protocols . in fig2 , the “ please die ” signal was stalled until either 500 or 1000 aberrant cells existed in the system . these delays were small enough and did not cause much harm . however , in fig2 the “ please die ” signal was stalled until counts of 10 , 000 or 25 , 000 and the effect on the system became significant . the effect is most pronounced for the delay of 25 , 000 , as a tumor is taking over the whole system . fig2 depicts the ratio of healthy cells to total cells that occur for the various parameter settings of the rescue protocols discussed above . each scenario is measured at two points in time : to the left is the ratio at the first peak of tumor cells ( typically the worse situation ), and to the right the ending equilibrium when the protocol was enabled . a ratio of 1 is ideal , meaning that the system contains 100 % healthy cells . from all parameter settings tried above the most robust protocol is when all signals are strong ( distance / strength is 2 / 2 ) with a threshold of 2 for the “ i died signal ” and either 2 or 3 for the “ please die ” threshold ; the final ratio of healthy to total cells is 0 . 98 for both cases . the next best setting was with only strong “ i died ” signals ( for both tumor and healthy cells ) and with thresholds of 2 for signals , this had a final ratio of 0 . 89 . the case where all signals had distance / strength of 212 and were combined for the calculation of enticing threshold was close with a ratio of 0 . 88 . after that was a tie between the cases of a delay of 1000 and when all thresholds were 3 , with the final ratio of 0 . 84 . a ratio of 0 . 83 occurred with a delay of 500 , a ratio of 0 . 67 for the delay of 10 , 000 , and the delay of 25 , 000 brought about the fatal ratio of 0 . the above results demonstrate the proof of concept that a computational modeling system and method in accordance with the present invention can be used to demonstrate that rescue algorithms are able to confine aberrant cells and isolate them . systems parameters are identifiable by a system and method in accordance with the present invention in a case - by - case basis based on cell characteristics . having described certain embodiments , numerous alternative embodiments or variations can be made . as shown and described , the system and method disclosed herein is directed to the treatment of cancer . however , this is merely an example . alternatively , the teachings disclosed herein may be directed to any number of diseases or anomalous conditions , such as infected cells or cells that have become defective due to metabolic changes , such as atherosclerosis , for example . therefore , the invention is not limited to applications involving cancer but may be extended to a host of other conditions involving normal and aberrant cells . as shown and described , various adjustable parameters are provided for simulated cells . some parameters apply to all cells , others apply to all normal cells , and still others apply to all aberrant cells . alternatively , however , each individual cell may be provided with its own set of adjustable parameters . for example , rather than having a single killing threshold applicable to all tumor cells , as shown in fig5 , each individual tumor cell may be provided with its own killing threshold setting , which may be different from , or the same as , the killing threshold settings of other tumor cells . it should be noted , therefore , that the present invention is not limited to the particular exemplary applications and embodiments illustrated and described herein .	6
it should be understood at the outset that although an illustrative implementation of one or more embodiments are provided below , the disclosed systems and / or methods may be implemented using any number of techniques , whether currently known or in existence . the disclosure should in no way be limited to the illustrative implementations , drawings , and techniques illustrated below , including the exemplary designs and implementations illustrated and described herein , but may be modified within the scope of the appended claims along with their full scope of equivalents . the disclosure describes systems and methods to permit web applications to dynamically dereference layered uris in web browsers using javascript without pre - composed protocol stacks , e . g ., by permitting web browsers to dynamically assemble protocol stacks from the javascript to access the resources identified by the layered uris . using the disclosed systems and methods may reduce the web browser footprint , since only core transport stacks require implementation ; may reduce javascript code size , since only message formatting is required ; may improve interoperability and performance , since web applications may mix and match protocols at runtime ; and may permit web applications to experiment with new protocols and architectures using javascript without changing browsers . fig1 illustrates an embodiment of a user device 100 . the user device 100 may communicate with a server 102 , e . g ., by sending requests for and receiving html documents containing uris . the user device may be coupled to the server 102 via a network 104 , e . g ., an internet protocol ( ip ) network , an intranet , or any other network , such as a local area network ( lan ). the user device 100 may be a fixed or mobile user - oriented device , e . g ., a desktop computer , a notebook or laptop computer , a netbook computer , a tablet computer , a smart phone , a personal digital assistant ( pda ), or a cellular telephone . the user device 100 may comprise a processing block 110 and a browser or search application 112 . the processing block 110 may be any software ( e . g ., operating system ) and / or hardware that allows a user to configure or access the different features of the user device 100 and to install and operate other software or programs on the user device 100 , e . g ., the general purpose network component 700 of fig7 and an operating system . the processing block 110 may include an operating system windows ®, mac ™ os , and android ™. the browser / search application 112 may be a software or program that runs on the processing block 110 and allows the user to send search queries and receive search results on the user device 100 . the browser / search application 112 may communicate with the server via a first network ( e . g ., the internet ) using corresponding codes , apis , languages , or interfaces . the browser / search application 112 may comprise a browser that may be used to access remotely a search application , e . g ., via the internet , or may comprise an integrated browser and search application . the browser / search application 112 may have a visual user interface for displaying search queries and results to the user . examples of the browser / search application 112 may include google chrome ™, internet explorer ®, mozilla firefox ®, and widgets . fig2 depicts an embodiment of a complex connector 200 for dereferencing layered uris in web browsers , e . g ., the browser / search application 112 of fig1 , using javascript . complex connector 200 , which may be instantiated in a browser , contains simple connector 202 , e . g ., an http connector , a binder 204 , e . g ., an http / xmpp binder , and a simple connector 206 , e . g ., an xmpp connector . simple connectors may comprise a pointer or link between two data structures , or may otherwise be defined as objects that implement particular protocol stacks , e . g ., http connectors , sctp connectors , etc . simple connectors , e . g ., simple connectors 202 and 206 , are known in the art , and may be implemented in javascript or in web browsers , or both , as explained further below in connection with fig3 . additionally , connectors implemented in javascript may be loaded into web browsers from remote web servers . binders , e . g ., binder 204 , may be objects which combine simple connectors , e . g ., by mapping the two protocol stacks . binders are discussed further herein in connection with fig4 . complex connectors , e . g ., complex connector 200 , may comprise two simple connectors and a binder . example uri 208 is a two layer uri , having a first http layer and a second xmpp layer . upon a uri related event , e . g ., clicking a hyperlink or submitting a form , the uri 208 may be received by a browser . once identified as a layered uri , the browser ( not pictured ) may call the complex connector 200 using a dereference extension to dereference the layered uri 208 . the complex connector 200 may invoke the interceptor chain of the simple connectors 202 and 206 and binder 204 . interceptor chain invokation may comprise passing uri 208 through a simple http connector 202 via an http request to http / xmpp binder 204 . http / xmpp binder 204 may pass an xmpp stanza to simple xmpp connector 206 , which with binder 204 may extract the http information passed back to simple http connector 202 via an http response . simple http connector 202 may complete the complex connector 200 dereferencing of the uri by passing the payload data back to the browser , e . g ., the html document object model ( dom ). connectors and binders may be created and registered with a user agent using javascript . techniques for creating and registering connectors and binders may be apparent to those of skill in the art , and may be used separately or in connection with other known techniques . for example , one javascript snippet may contain an instruction to get an http connector , e . g ., connector 408 of fig4 , from a user agent , e . g ., a browser , e . g ., var connector1 = new httpconnector ( ). another snippet may contain an instruction to implement a second connector , e . g ., connector 414 of fig4 , namely , by creating a new xmpp client with an xmpp library , e . g ., loaded into the browser by a remote web server , e . g ., var xmpp = new xmpp (“ talk . google . com ”). another snippet may contain an instruction for creating a connector for xmpp in javascript , e . g ., var connector2 = new connector ( xmpp ). yet another snippet may contain instructions to implement a third connector , e . g ., connector 418 of fig4 , namely , by creating a ws from a user agent , e . g ., var socket = new websocket ( . . . ), and by creating a connector for the ws in javascript , e . g ., var connector3 = new connector ( socket ). still another snippet may contain an instruction for creating and implementing a first binder , e . g ., binder 416 of fig4 , for binding the second and third connectors , e . g ., var binder12 = new binder ( connector2 , connector3 ). another snippet may contain an instruction for implementing a fourth connector , e . g ., second complex connector 412 of fig4 , comprising the first binder , e . g ., var connector12 = new connector ( binder12 ). yet another snippet may contain instructions for creating and implementing a second binder , e . g ., binder 410 of fig4 , e . g ., var binder01 = new binder ( connector0 , connector12 ), and a new connector , e . g ., first complex connector 400 of fig4 , e . g ., var connector01 = new connector ( binder01 ). still another snippet may contain an instruction for informing the user agent of the http / xmpp connector , e . g ., connectors . register (“ http / xmpp ”, connector01 ). since the connector objects are exchanged between the user agent and user javascript , the connector interface should be agreed upon by all browsers and all web applications . for this reason , standardization may be desired . fig3 is an implementation matrix 300 for an example complex connector . as stated above , simple connectors may be implemented either in javascript or in the web browser . further , each complex connector may comprise two or more simple connectors to dereference a layered uri . matrix 300 shows the combinations and permutations for implementing simple connectors p 1 and p 2 , e . g ., simple connectors 202 and 206 of fig2 , for dereferencing a layered uri , e . g ., layered uri 208 of fig2 . as shown in matrix 300 , and as stated above under fig2 , either simple connector may be implemented in javascript or implemented in the browser . thus , p 1 is associated with a javascript row and a browser row , and p 2 is also associated with a javascript column and a browser column . the overlapping boxes of matrix 300 show the p 1 / p 2 combination for the given row / column . where a layered uri has more than two layers , thus requiring more than two simple connectors for dereferencing , the matrix 300 may be expanded , accounting for the recursive nesting explained further under fig4 . where simple connectors are implemented in javascript , ultimately calling a simple connector implemented in the browser may be necessary to dereference the uri . fig4 depicts another embodiment of a first complex connector 400 for dereferencing layered uris in web browsers using javascript . fig4 contains layered uri 402 , which contains http and xmpp layers . fig4 assumes that the browser does not support xmpp , and also that ws is the underlying transport protocol for the xmpp layer . consequently , dereferencing the uri requires at least three connectors . fig4 contains a call to dereference the uri 404 , e . g ., a call made by a web browser upon a uri event , a uri dereference extension 406 , a simple http connector 408 , e . g ., the connector 202 of fig2 , an http / xmpp binder 410 , e . g ., binder 204 of fig2 , and second complex connector 412 , such that the second complex connector 412 is recursively nested within the first complex connector 400 . second complex connector 412 comprises a simple xmpp connector 414 , an xmpp / ws binder 416 , and a simple ws connector 418 . fig4 assumes that the browser ( not pictured ) supports http and ws layer stacks , but not xmpp . consequently , first complex connector 400 may comprise a javascript xmpp connector 414 , web browser ws connector 418 , and http connector 408 . nesting complex connectors may thus form a recursively nested interceptor chain used by the uri dereference extension 406 to dereference layered uri 402 . fig5 is a flowchart describing the process 500 of dereferencing the layered uri of the embodiment of fig4 . the components referenced in the blocks of fig4 correspond to the identical components of fig4 . the two columns of fig5 are shown separated by a line 501 , with blocks in the first column occurring at a sender device , e . g ., user device 100 of fig1 , and the blocks in the second column occurring at a recipient device , e . g ., server 102 of fig2 . process 400 may begin at 402 with a uri event , e . g ., clicking a button , submitting a form , etc ., which causes a browser on the sending user &# 39 ; s side to attempt to dereference the layered http / xmpp / ws uri . because fig4 assumes that the browser does not support xmpp , at block 404 a uri dereference extension may be called . the uri dereference extension may dynamically compose or instantiate the complex http / xmpp connector from a simple http connector , e . g ., connector 202 of fig2 , an http / xmpp binder , e . g ., binder 204 of fig2 , and a second complex xmpp / ws connector ( comprising two simple connectors and a binder ) to form an interceptor chain based on the layers contained in the layered uri . as will be understood to those of skill in the art , differing layered uri dereference constructs may be dynamically constructed in different ways based on the uri - specific protocol stacks based on this disclosure , illustrated below in fig5 . the uri dereference extension may pass raw data , e . g ., the form , etc ., through block 406 to the http connector at block 408 . the http connector may issue an http request through block 510 to the http / xmpp binder at block 512 , which may encode an http / xmpp stanza based on the mapping contained in the binder . at block 514 the http / xmpp stanza created by the http / xmpp binder may be passed to the xmpp connector of block 516 , which may encode an xmpp stanza based on the mapping contained in the binder . as stated under fig4 , xmpp generally requires an underlying two - way communication protocol . consequently , although not explicitly set out in the uri , xmpp may establish the needed two - way connection using ws ; other embodiments may employ alternate protocols . thus , at block 518 an xmpp stanza may be passed by the xmpp connector to the xmpp / ws binder of block 520 , which at block 522 sends a ws message to the ws connector of block 524 . the ws connector of block 524 may pass a ws message at block 526 to a receiving user having a correspondingly constructed uri dereference extension . upon receipt of the ws message , the xmpp / ws binder of block 528 may extract the xmpp stanza of block 430 from the ws message and send it to the xmpp connector of block 532 . similarly , the xmpp connector may extract the http / xmpp stanza of block 534 from the xmpp stanza of block 530 and may pass the http / xmpp stanza to the http / xmpp binder of block 536 . the http / xmpp binder may send the http response of block 538 to the http connector of block 540 . the http connector may process the http response and may send the payload data of block 542 to the uri dereference extension of block 544 . at block 546 , the dom may update based on the payload data . fig6 depicts still another embodiment of a first complex connector 500 for dereferencing layered uris in web browsers using javascript . fig6 illustrates an embodiment of a system and method for dynamically constructing differing layered uri dereference constructs in different ways based on the uri - specific protocol stacks . fig6 contains a layered uri 602 , e . g ., layered uri 402 of fig4 , a call to dereference the uri 604 , a uri dereference extension 606 , a simple connector 608 , e . g ., the connector 408 of fig4 , a first binder 610 , e . g ., binder 410 of fig4 , a second complex connector 612 , e . g ., second complex connector 412 of fig4 . second complex connector 612 comprises a simple connector 614 , a second binder 616 , and a third complex connector 618 , which third complex connector 618 comprises simple connectors 620 and 624 and a third binder 622 . the third complex connector 618 may be required , e . g ., if the browser , e . g ., the browser of fig4 , did not support ws . thus , as stated above , nesting complex connectors may form a recursively nested interceptor chain used by the uri dereference extension 606 to dereference layered uri 602 . the components described above may be implemented on any general - purpose computer component , such as a computer or network component with sufficient processing power , memory resources , and network throughput capability to handle the necessary workload placed upon it . fig7 illustrates a typical , general - purpose network component 700 suitable for implementing one or more embodiments of the components disclosed herein . the network component 700 includes a processor 702 ( which may be referred to as a central processor unit or cpu ) that is in communication with memory devices including secondary storage 704 , read only memory ( rom ) 706 , random access memory ( ram ) 708 , input / output ( i / o ) devices 710 , e . g ., cameras , microphones , display screens , etc ., and network connectivity devices 712 . the processor 702 may be implemented as one or more cpu chips , or may be part of one or more application specific integrated circuits ( asics ) and / or digital signal processors ( dsps ). the secondary storage 704 is typically comprised of one or more disk drives or erasable programmable rom ( eprom ) and is used for non - volatile storage of data . secondary storage 704 may be used to store programs that are loaded into ram 708 when such programs are selected for execution . the rom 706 is used to store instructions and perhaps data that are read during program execution . rom 706 is a non - volatile memory device that typically has a small memory capacity relative to the larger memory capacity of secondary storage 704 . the ram 708 is used to store volatile data and perhaps to store instructions . access to both rom 706 and ram 708 is typically faster than to secondary storage 704 . at least one embodiment is disclosed and variations , combinations , and / or modifications of the embodiment ( s ) and / or features of the embodiment ( s ) made by a person having ordinary skill in the art are within the scope of the disclosure . alternative embodiments that result from combining , integrating , and / or omitting features of the embodiment ( s ) are also within the scope of the disclosure . where numerical ranges or limitations are expressly stated , such express ranges or limitations should be understood to include iterative ranges or limitations of like magnitude falling within the expressly stated ranges or limitations ( e . g ., from about 1 to about 10 includes , 2 , 3 , 4 , etc . ; greater than 0 . 10 includes 0 . 11 , 0 . 12 , 0 . 13 , etc .). for example , whenever a numerical range with a lower limit , r l , and an upper limit , r u , is disclosed , any number falling within the range is specifically disclosed . in particular , the following numbers within the range are specifically disclosed : r = r l + k *( r u − r l ), wherein k is a variable ranging from 1 percent to 100 percent with a 1 percent increment , i . e ., k is 1 percent , 2 percent , 3 percent , 4 percent , 5 percent , . . . 50 percent , 51 percent , 52 percent , . . . , 95 percent , 96 percent , 97 percent , 98 percent , 99 percent , or 100 percent . moreover , any numerical range defined by two r numbers as defined in the above is also specifically disclosed . the use of the term about means ± 10 % of the subsequent number , unless otherwise stated . use of the term “ optionally ” with respect to any element of a claim means that the element is required , or alternatively , the element is not required , both alternatives being within the scope of the claim . use of broader terms such as comprises , includes , and having should be understood to provide support for narrower terms such as consisting of , consisting essentially of , and comprised substantially of . all documents described herein are incorporated herein by reference . while several embodiments have been provided in the present disclosure , it should be understood that the disclosed systems and methods might be embodied in many other specific forms without departing from the spirit or scope of the present disclosure . the present examples are to be considered as illustrative and not restrictive , and the intention is not to be limited to the details given herein . for example , the various elements or components may be combined or integrated in another system or certain features may be omitted , or not implemented . in addition , techniques , systems , subsystems , and methods described and illustrated in the various embodiments as discrete or separate may be combined or integrated with other systems , modules , techniques , or methods without departing from the scope of the present disclosure . other items shown or discussed as coupled or directly coupled or communicating with each other may be indirectly coupled or communicating through some interface , device , or intermediate component whether electrically , mechanically , or otherwise . other examples of changes , substitutions , and alterations are ascertainable by one skilled in the art and could be made without departing from the spirit and scope disclosed herein .	6
as shown in fig2 and 4 - 5 , unlike a conventional lithium ion cell charging system , a battery pack 138 of a portable computer system 10 uses pulses to charge eight lithium ion battery cells 210 of the battery pack 138 in a way that does not directly limit the terminal voltages of the cells 210 being charged . therefore , circuitry to tightly regulate the terminal voltages of the cells 210 being charged is not required . the computer system 10 includes a central processing unit ( cpu ) 100 , a level two ( l2 ) cache 102 and a system memory 108 , all which are coupled to a local bus 104 . a system controller / host bridge circuit 106 controls access to the system memory 108 and interfaces the local bus 104 to a peripheral component interconnect ( pci ) bus 110 . a small computer systems interface ( scsi ) controller 114 and a video interface 116 are coupled to the pci bus 110 . the scsi controller 114 interfaces the pci bus 110 to a scsi bus 120 which has coupled to it a hard disk drive 122 and a cd rom drive 124 . the video interface 116 is coupled to a monitor 118 . a pci - extended industry standard architecture ( eisa ) circuit 112 couples the pci bus 110 to an eisa bus 126 . a keyboard / mouse controller 130 interfaces the eisa bus 126 to a keyboard 132 and a mouse 134 . the keyboard / mouse controller 130 communicates with other peripheral devices ( e . g ., the battery pack 138 ) over an i 2 c bus 150 . when ac power is available from an external ac power source , an ac / dc converter 128 furnishes power to a positive input line 140a of a dc / dc converter 136 . the battery pack 138 also furnishes power to the input line 140a , and when ac power is available , any residual power that is available from the ac / dc converter 128 is used to charge the battery pack 138 when the computer system 10 is turned on . a negative input line 140b of the dc / dc converter 136 is connected to ground , and the dc / dc converter 136 is coupled to the eisa bus 126 . the dc / dc converter 136 furnishes power to the computer system 10 via power lines 141 . as seen in fig3 the cells 210 are arranged in a cell unit 213 having four cell banks 211a - d connected in series . each cell bank 211 has two cells 210 connected in parallel . when charging the cells 210 , the battery pack 138 receives power from the ac / dc converter 128 and furnishes a pulsed charging current i -- cells to the cell banks 211a - d . as seen in fig4 - 5 , it has been found to be permissible to allow the terminal voltage of each of the cells 210 to exceed a manufacturer specified , critical voltage level v -- thresh because , during charging , an internal electrochemical potential e of each of the cells 210 remains below the critical voltage threshold level v -- thresh until the cells 210 are fully charged at time t c . the difference between the observed terminal voltage of one of the cells 210 and the internal potential e is attributable to the product of the cell &# 39 ; s 210 internal resistance 612 and the charging current flowing through the cell 210 being charged . when the pulsed charging current i -- cells is pulsed high , a terminal voltage of one or more of the cell banks 211a - d is permitted to exceed the voltage threshold level v -- thresh by the amount specified below . conventional lithium ion cell charging systems limit , or clamp , the terminal voltages of the cell banks 211a - d to the voltage threshold level v -- thresh . when the pulsed charging current i -- cells is removed at the end of each pulse , the terminal voltages of the cells 210 return to their electrochemical potential e . for purposes of assuming that the electrochemical potential e does not exceed the critical voltage threshold level v -- thresh , the terminal voltages of the cell banks 211a - d are monitored when the current i -- cells is removed from the cell banks 211a - d , i . e ., between pulses . control of the charging current i -- cells is done by a microcontroller 200 ( fig3 ) of the battery pack 138 as follows . during an initial stage of charging , the microcontroller 200 allows the charging current i -- cells to continuously ( not pulsed ) flow until the terminal voltage of one of the cell banks 211a - d reaches the threshold voltage level v -- thresh at time t o . alternatively , the microcontroller 200 may allow continuous charging to continue beyond v -- thresh when one of the cell banks 211a - d exceeds the voltage level v -- thresh as long as the charging current i -- cells is large enough such that the potential e does exceed the voltage level v -- thresh . the microcontroller 200 then begins a series of successive pulse cycles with all cycles having a predetermined duty cycle time interval t duty ( fig6 ). each pulse cycle has an off time interval t off during which the battery pack 138 inhibits the flow of the charging current i -- cells and allows the terminal voltage of at least one of the cell banks 211a - d to level off to a relaxation voltage level v -- relax which is close to and falls slowly to be exactly the potential e . the relaxation voltage level v -- relax is the voltage of one of the cell banks 211a - d measured at a fixed point in time ( a time interval t off after the charge pulse is turned off ). when the voltage level v -- relax is reached at the end of the interval t off , the microcontroller 200 triggers the beginning of the next pulse cycle during which the microcontroller 200 allows the charging current i -- cells to flow for an on time interval t on of the pulse cycle . the microcontroller 200 subsequently inhibits the flow of the charging current i -- cells which begins another off time interval t off and another pulse cycle . the on time interval t on and the off time interval t off comprise the duty cycle time interval t duty . therefore , the microcontroller 200 determines the on time interval t on by subtracting the off time interval t off from the duty cycle time interval t duty . as seen in fig4 the relaxation voltage level v -- relax increases and the off time interval t off increases with successive pulse cycles . as the off time interval t off increases with successive pulse cycles , the on time interval t on decreases accordingly . the pulse cycles continue until the cells 210 are deemed fully charged when the measured relaxation voltage level v -- relax from one of the cell banks 211a - d reaches the critical voltage threshold level v -- thresh . the microcontroller 200 determines the off time interval t off by multiplying a terminal voltage v -- cells of the complete cell unit 213 by a constant . as shown in fig3 the battery pack 138 includes a p - channel , metal - oxide - semiconductor field - effect - transistor ( mosfet ) 202 that furnishes the charging current i -- cells at its drain terminal and is controlled by the microcontroller 200 . the transistor 202 has its source - drain current path coupled between the positive input line 140a and a positive terminal 213a of the cell unit 213 . when the microcontroller 200 asserts , or pulls low , a charging signal charge # furnished to the gate of the transistor 202 , the transistor 202 conducts and then the charging current i -- cells flows to the cell unit 213 . when the microcontroller 200 deasserts , or drives high , the charging signal charge #, the transistor 202 inhibits the flow of the charging current i -- cells . in this way , the microcontroller 200 can control the start and end of each time interval t off and t on . the microcontroller 200 selectively monitors the voltages of the cell banks 211a - d through a four input multiplexer 212 which has four signal inputs . each of the inputs of the multiplexer 212 is coupled to the positive terminal of different ones of the cell banks 211a - d . the select input of the multiplexer 212 receives a two bit select signal sel 1 : 0 ! from the microcontroller 200 . the output of the multiplexer 212 is coupled to a unity gain voltage buffer circuit 214 which furnishes a cell voltage signal vcell to the microcontroller 200 that is indicative of the voltage at the positive terminal selected by the multiplexer 212 . the microcontroller 200 determines the terminal voltage of any one cell bank 211 by selectively measuring and subtracting the positive terminal voltages of the cell banks 211a - d . in order to supply power to the computer system 10 , the microcontroller 200 controls the discharging of the cells 210 through a p - channel , mosfet 204 which has its current drain - source path coupled between the positive input line 140a and the source of the transistor 202 . when the microcontroller 200 asserts , or negates , a discharging signal disch # furnished to the gate of the transistor 204 , discharge current flows through the transistor 204 . when the microcontroller 200 deasserts , or drives high , the discharging signal disch #, the discharge current does not flow . when the charging signal charge # is asserted , the charging current i -- cells flows from the positive input line 140a to the negative terminal 213a through a diode 205 . the anode of the diode 205 is connected to the drain of the transistor 204 , and the cathode of the diode 205 is connected to the source of the transistor 204 . when the discharging signal disch # is asserted , the discharging current flows initially from the positive terminal 213a to the positive terminal line 140a through a diode 203 . subsequent to the assertion of the discharging signal disch #, the charging signal charge # is asserted to shunt the diode 203 with the drain - source path of the transistor 202 and reduce power losses attributable to the diode 203 . the anode of the diode 203 is connected to the drain of the transistor 202 , and the cathode of the diode 203 is connected to the source of the transistor 202 . the diodes 203 and 205 may either be intrinsic or extrinsic to the transistors 202 and 204 , respectively . for purposes of monitoring current flowing through the battery cell unit 213 , a current sensing resistor 220 is in series with a negative terminal 213b of the cell unit 213 and ground . an amplifier 222 has its input coupled to the resistor and furnishes a current sensing signal isense to the microcontroller 200 . as shown in fig7 when the microcontroller 200 begins charging the cell unit 213 , the microcontroller 200 asserts 700 the charging signal charge # and deasserts 700 the discharging signal disch #. the microcontroller 200 then measures 704 the terminal voltages of the cell banks 211a - d until the microcontroller 200 determines 706 that one of the measured terminal voltages has reached the threshold voltage level v -- thresh ( time t o ). then , the microcontroller 200 executes 708 a routine called pulse which controls the pulse charging cycles . after the cell unit 213 is charged , if ac power is not available , the microcontroller 200 asserts the discharging signal disch # allowing the cell unit 213 to furnish power to the computer system 10 . as shown in fig8 during execution of the pulse routine , the microcontroller 200 deasserts 800 the charging signal charge # and then measures 802 the terminal voltages of the cell banks 211a - d . the microcontroller 200 then calculates 804 the off time interval t off by multiplying the terminal voltage v -- cells of the complete cell unit 213 by a constant . consequently , the lower the terminal voltage v -- cells , or more depleted the cell banks 211a - d , the shorter the off time interval t off or longer the on time interval t on . the microcontroller 200 then delays 806 for the off time interval t off and subsequently measures 808 the terminal voltages of the cell banks 211a - d again . if the microcontroller 200 determines 810 that one of the measured terminal voltages has reached the threshold voltage level v -- thresh , then the routine pulse is terminated because the battery is fully charged . otherwise , the microcontroller 200 asserts 812 the charging signal charge # to begin the next interval t on and calculates 814 the on time interval t on which is the difference of the duty cycle time interval t duty and the previously calculated off time interval t off . the microcontroller 200 then delays 816 for the on time interval t on before once again deasserting 800 the charging signal charge #. other embodiments are within the scope of the following claims . for example , as shown in fig9 the functional relationship of the intervals t duty , t on , and t off to each other and to circuit conditions ( e . g ., the cell unit voltage v -- cells ) can be varied as shown by algorithms a - g . for example , the pulse routine described above ( algorithm a ) has the duty cycle interval t duty that is of a fixed duration , the interval t off that varies independently of the durations of the other time intervals ( but is a function of the voltage v -- cells ), and the interval t on that is dependent on the duration of the intervals t off and t duty . in each of these cases , the pulse routine would be modified accordingly .	7
the present invention provides an adaptive control methodology that is stable in the sense of lyapunov ( theoretically proven stability ), yet explicitly accounts for control constraints to completely avoid input saturation . this adaptive control methodology may be better understood with reference to the conventional flight control of fig1 . as discussed with respect to fig1 , aircraft 10 includes actuators 15 that respond to commanded inputs u c with an actual or achieved input u as discussed previously . in response to actual input u , aircraft 10 achieves a state x as measured by sensors 20 . given the state x and actual input commands u , an equation for model system dynamics is as follows : { dot over ( x )} ( t )= ax ( t )+ bλu ( t ), xεr n , uεr where a is an unknown matrix , b is a known control direction , λ is an unknown positive constant , r is any real number , and r n is an n - dimensional vector . should there be no saturation of control surfaces , actual or achieved input commands u and the commanded input u c are identical . however , a typical control surface can only achieve a certain amount of deflection . for example , a rudder or elevator may only be deflectable through a certain angle or limit , which may be denoted as u max . thus , should u c exceed this limit , the actual input u will equal u max . this relationship between u c and u may be represented mathematically as : where u max is the saturation level . based upon this relationship , the equation for the system dynamics may be rewritten as { dot over ( x )}= ax + b λ ( u c + δu ), δ u = u − u c even if u c is limited to u max to avoid input saturation , it will be appreciated that u may approach u max too quickly such that undesired vibrations are incurred as u equals u max . accordingly , a new limit on actual command inputs is introduced as follows a commanded control deficiency δu c between the commanded input u c and the actual input may then be represented as the present invention introduces a factor μ into the commanded input u c as follows : where k x and k r are the gains for the actual state x and the reference state r , respectively . as discussed with respect to fig1 , u lin may be entirely adaptive or possess a nominal component . note that u c is implicitly determined by the preceding two equations . it may be solved for explicitly as : it follows that u c is continuous in time but not continuously differentiable . to assure lyapunov stability , it is sufficient to choose the factor μ as follows : where δk x max , δk r max are the maximum initial parameter errors , k x , k r are parameters that define the ideal control law for achieving the desired reference model for the given unknown system , and κ is a constant that depends upon the unknown system parameters , implementation of the factor μ within an adaptive flight control loop is shown in fig2 . a module 90 receives u c that is formed from the addition of u lin and u lin - nominal as discussed with respect to fig1 . the factors u max , μ and δ discussed with respect to equation ( 1 ) may be provided by an external system or stored within memory ( not illustrated ). given these factors , module 90 examines u c and implements equation ( 1 ) accordingly to provide a modified commanded input u c . from factors u max and δ , module 90 calculates u max δ so that u c may be compared to u max δ . if the absolute value of u c ( or equivalently , u lin ) is less than or equal to u max δ , then module 90 provides u c ′ as being equal to u c . if , however , u c exceeds u max δ or is less than − u max δ , module 90 provides u c ′ as being equal to the corresponding value from equation ( 1 ). it will be appreciated that module 90 may be implemented within hardware , software , or a combination of hardware and software . moreover , as seen in fig3 , module 90 may be implemented within an entirely adaptive control loop that does not possess a baseline controller 30 . a graphical illustration of the effect of module 90 with respect to the achieved command u and the saturation limits u max and − u max is illustrated in fig4 . consider the case if the factor μ equals zero . examination of equation ( 1 ) and fig2 and 3 shows that for such a value of μ , the modified input command u c ′ will simply equal u c . as discussed in the background section , the achieved input command u will thus saturate at u max as u c exceeds u max . such an input saturation may cause dangerous instability . conversely , if μ equals the minimum value required for lyapunov stability as discussed above , the achieved input command u does not saturate , thereby eliminating input saturation effects . however , it will be appreciated from examination of equation ( 1 ) that the factor μ may not simply be set to an arbitrarily high value much greater than 1 . in such a case , the achieved control u is so damped with respect to the commanded input u c that flight will also become unstable . the tradeoffs with respect to various values of the factor μ may be demonstrated by the following simulation example . suppose an unstable open loop system has the following system dynamics : the resulting simulation data may be seen in fig5 a through 5 d . in fig5 a , the μ factor is set to zero such that u c ′ may exceed u max . with μ equaling zero , it may be seen that modified commanded input u c ′ equals the conventional commanded input u c discussed with respect to fig1 . in fig5 b , μ equals 1 . this is still less than the minimum amount set by the lyapunov conditions discussed earlier . thus , u c ′ may again exceed u max . in fig5 c , μ equals 10 , which exceeds the minimally - required amount for lyapunov stability so that u c ′ does not exceed u max . thus , the tracking performance is significantly improved . however , μ cannot simply be increased indefinitely . for example , as seen in fig5 d for a value of μ equals 100 , the tracking performance has degraded significantly in that the modified commanded input u c ′ has become too damped in its response to changes in external conditions . those of ordinary skill in the art will appreciate that many modifications may be made to the embodiments described herein . accordingly , although the invention has been described with respect to particular embodiments , this description is only an example of the invention &# 39 ; s application and should not be taken as a limitation . consequently , the scope of the invention is set forth in the following claims .	6
fig1 depicts an example system 20 , which may provide an “ exercise and sing (“ exersing ”) service , exemplary of an embodiment of the present invention . for illustration purposes , “ exersing - spin ” [“ spinging ”] is used as an example . in particular , the “ exersing ” service may be a subscription - based service allowing access to stationary bike routines (“ spinging ” routines ) and other types of exercise and sing routines e . g . “ exersing - dance ”, “ exersing - aerobics ” which may be created and maintained by a central provider (“ exersing ” service provider ). e . g . subscribing individual members and / or fitness facilities offering such stationary bike classes may subscribe to and download “ spinging ” routines from the “ exersing ” service provider . the “ exersing ” service provider , in addition to providing the “ exersing ” service , may itself create the “ exersing ” routines e . g . “ spinging ” routines for distribution to subscribers of the “ exersing ” service . in particular , and as will be further explained below , the “ exersing ” service provider may itself create composite files made up of multiple audio , video , music , text , graphic and animation elements which files may be packaged to form the “ exersing ” routines that are distributed to subscribers of the “ exersing ” service . advantageously , these “ exersing ” routines may allow “ exersing ” class participants to sing along with the music during the exercise class in karaoke fashion . more particularly , central facility 29 may be a physical location , for example , an office , which houses central facility computer system 10 . central facility computer system 10 may host subscriber database 23 which , as further detailed below , may contain subscriber user records and a selection of exercise routines available to be downloaded . exercise facility 22 may be a physical location , for example , a fitness facility which houses an exercise facility computer system 14 . exercise facility computer system 14 may host facility database 28 . system 20 may further include individual computing device 12 , which may conveniently be a computer system integrated with a piece of exercise equipment such as a spinning bike . computing device 12 may also be a smartphone or tablet capable of receiving data and displaying information such as participant heart rate , rpms and resistance levels from a stationary bike , heart rate monitor etc capable of transmitting the required data . as required , computing device 12 may be in communication with one or more biometric monitors — e . g . a pulse rate monitor , or the like — in order to receive an indication of physical exertion , calories burned , etc . by a participant . computer systems / device 10 , 12 and 14 may be interconnected by network 100 . network 100 may be a wide area network , local area network or a combination thereof , and may be wired or wireless . exercise facility computer system 14 and bike 12 may optionally be interconnected via network 102 , which may be , for example , a wireless network ( e . g . one conforming to the ieee 802 . 11g protocol ) operated by exercise facility 22 and to which device ( s ) 12 may connect to while on the premises of exercise facility 22 or while within range of wireless network 102 . conveniently , network 100 may be the internet . thus , for example , in an exemplary embodiment of the present application , facility computer 14 may connect to central facility computer system 10 via the internet to download “ exersing ” routine packages onto facility computer system 14 . when onsite , for example , in preparation for or during an exercise class at exercise facility 22 , individual member 24 using his or her bike / computing device 12 may connect to facility computer system 14 to download or access a given “ exersing ” routine package . notably , and as shown in fig1 , individual member 24 may be a plurality of members of exercise facility 22 ( e . g . members 24 a , . . . , 24 n — collectively and individually member ( s ) 24 ), whose information may be stored in facility database 28 . in an exemplary embodiment of the present application , and as further detailed below , members 24 a , . . . , 24 n may be members of a group stationary bike class ( e . g . spinning class ) provided by exercise facility 22 . members 24 a , . . . , 24 n may ( optionally ) sign up for a given spinning class via their respective computing devices 12 a , . . . , 12 n — collectively computing devices 12 . preferably , computing device ( s ) may be integrated into the spinning ( exercise ) bike but may also be , for example , a tablet or smartphone which may communicate with the spinning bike . spinning bikes either with integrated computing systems and internet / network connectivity , or which are capable of communicating with external devices such as tablets or smartphone are known . spinning bikes with integrated computer systems exist e . g . http :// www . proform . com / fitness / en / proform / exercise - bikes / tour - de - france - pro . members 24 and their computing devices 12 and bikes may be co - located at a single gym or similar location . alternatively , one or more members 24 and computing devices 12 may be at a remote location , distant from the remaining device 12 , and interconnected by a computing network 100 , as further described below . as illustrated in fig2 , central facility computer system 10 may be a conventional computer having a processor 32 , a network interface 30 , memory 33 hosting operating system 34 ( e . g . windows 8 , linux , mac os ) and a database application 36 . memory 33 may also host “ exersing ” application 38 , an exemplary embodiment of the present application , as further explained below . central facility computer system 10 may also host subscriber database 23 , containing records of individuals and / or fitness facilities which subscribe to the “ exersing ” service . database application 36 may be a conventional relational database management system for managing subscriber database 23 , for example , oracle ™ or microsoft sql server , which may conveniently include a web interface . processor 32 may execute operating system 34 , database application 36 , “ exersing ” application 38 and other applications ( not shown ). network interface 30 may be any conventional piece of hardware used to interface central facility computer system 10 with network 100 , for example , an ethernet card , to allow central facility computer system 10 to communicate over network 100 . fig3 is a block diagram of exercise facility computer system 14 . exercise facility computer system 14 may be a conventional computer ( e . g . pc ) located onsite at exercise facility 22 , which may include network interface 40 ( e . g . ethernet card ), processor 42 and memory 43 . exercise facility computer system 14 may further host facility database 28 . as will be further explained below , facility database 28 may include records of registered members of exercise facility 22 and records relating to the types , dates and times of various exercise classes being offered by exercise facility 22 . conveniently , facility database 28 may further include records of “ exersing ” packages licensed from the “ exersing ” service provider , and in particular may be used to track the number of licensed workouts used and number of licensed workouts remaining . similar to central facility computer system 10 , memory 43 of exercise facility computer system 14 may include operating system 44 ( e . g . windows 8 , mac os ), database application 46 and “ exersing ” applications e . g “ spinging ”, “ exersing - dance ”. database application 46 may be a conventional relational database management system for managing facility database 28 . exercise facility computer system 14 may further include display 45 on which graphical elements relating to the “ exersing ” application , and in particular , relating to a particular “ exersing ” package e . g “ sping ”, may be displayed . an exemplary screenshot depicting such graphical elements is provided in fig5 . notably , “ exersing ” application 48 may be the client - side of “ exersing ” application 38 hosted on central facility computer system 10 . “ exersing ” application 48 may be , for example , downloaded from central facility computer system 10 and installed on exercise facility computer system 14 upon initial registration with the “ exersing ” service provider . referring to fig4 , an individual may access the “ exersing ” service , exemplary of an embodiment of the present application , using his or her personal computing device 12 . in the primary embodiment of the present application , computing device 12 may be integrated into a piece of exercise equipment ( e . g . stationary exercise bike ). alternatively , computing device 12 may be any form of conventional computing device , including , conveniently , a portable device such as a tablet or smartphone ( e . g . ipad , iphone , blackberry , android ) which may be used by a member 12 while onsite at exercise facility 22 to download , access and run a particular “ exersing ” package during e . g . a scheduled spinning class . additionally , if not integrated into the exercise bike , computing device 12 may be connectable to the exercise bike and may receive data transmitted from the exercise bike such as rpms and resistance levels and / or a biometric device such as a heart rate monitor . computing device 12 may include a network interface 50 allowing device 12 to interface with ( wireless ) network 102 ( or network 100 ) and may further include processor 52 and memory 53 . memory 53 may host operating system 54 ( e . g . ios , android , windows phone ) and “ exersing ” application 58 . an exemplary screenshot of such elements is depicted in fig6 . similarly , “ exersing ” application 58 may be the client - side of “ exersing ” application 38 hosted on central facility computer system 10 . “ exersing ” application 58 may be , for example , downloaded from central facility computer system 10 and installed on exercise facility computer system 14 upon initial registration with the “ exersing ” service provider . moreover , computing device 12 may include display 55 , which may be a touch screen display , for displaying graphics related to “ exersing ” application 58 , and more particularly , elements of the “ exersing ” package selected by the particular individual for display during a scheduled exercise class . notably , since each individual class participant is running his or her own version of “ exersing ” application 58 , although all class participants are following the same “ exersing ” exercise package , each person may select the elements of the package ( e . g . instrumentals only , sheet music for soprano part of song , etc .) that he or she wishes to see or hear . thus , in effect , each participant may experience a customized version of the common “ exersing ” exercise package . conveniently , central facility computer system 10 , exercise facility computer system 14 and personal computing device 12 may communicate with each other via the “ exersing ” applications 58 installed on the respective devices . in an alternate embodiment of the present application , the “ exersing ” service provider may sell “ exersing ” applications 48 and 58 on an online app store such as itunes ( e . g “ spinging app ”). users wishing to subscribe to a specific “ exersing ” service e . g . “ spinging ” may purchase the “ spinging ” application 58 from the online service in the conventional manner and thereby join and access the “ spinging ” service . more specifically , participants whether they be individual users [ e . g . that exercise alone e . g . at home ] or group class participants may register online with the central facility computing system 10 . once registered , participants may purchase and download an “ exersing ” file / song ; or purchase and download an “ exersing ” session including several files / songs ( analogous to purchasing an album of songs ). optionally , participants could possibly register and pay for future “ exersing ” class or classes at a licensed “ exersing ” facility . scheduled “ exersing ” classes at the “ exersing ” members “ favourite ” licensed “ exersing “ facility and / or nearby licensed “ exersing ” facilities may , for example , be visible using the “ exersing ” app . the central facility computing system 10 may further notify the licensed “ exersing ” facility &# 39 ; s system each time a member registers and pays for “ exersing ” class or classes at the facility . the central computer system 10 may provide numerous flexible options for both distributors , facilities , instructors and individuals ( whether they be participating as part of an organized group at a facility or alone ) in order to provide “ exersing ” content . an exemplary schema of subscriber database 23 is outlined and described in fig7 a - 7f . in particular , fig7 a shows an exemplary subscriber table 70 which contains records of individual members and fitness facilities which have subscribed to the “ exersing ” service . subscriber table 70 contains the following attributes : “ id ”, “ name ”, “ profile status ” and “ subscriber type ”. in this exemplary subscriber table 70 , the “ id ” attribute is the primary key . the value of the “ name ” attribute may be used to store the name of an individual subscriber or name of a fitness facility subscriber . the value of the “ profile status ” attribute may be either “ active ” or “ inactive ” and the value of the “ subscriber type ” attribute may indicate whether the subscriber is an individual or a facility . records 70 a - 70 d correspond to individual subscribers and records 70 f and 70 g correspond to facility subscribers . more specifically , record 70 a is a record related to an individual active subscriber named “ john doe ”. record 70 c corresponds to an inactive individual subscriber named “ don smith ”. record 70 e corresponds to a facility active subscriber , “ goodfun ”. thus , for example , as a facility subscriber , goodfun may access and download “ exersing ” routines for use during group stationary bike exercise classes offered in its facilities . in contrast , an individual subscriber may access and download “ exersing ” routines onto his or her personal computing device ( e . g . tablet , or internet - enabled exercise equipment ) and may thereby conveniently follow the routine individually and at his or her own leisure , without the need to attend a group class . as may be appreciated , this provides increased flexibility to an individual subscriber — for example , the individual subscriber may exercise at a time and place convenient to him or her but still enjoy the benefit of following a licensed “ exersing ” exercise package . fig7 b shows an exemplary subscriber_licenses table 72 which indicates the number of licensed workouts registered by a subscriber and the number of licensed workouts remaining . for example , row 72 a indicates that subscriber with id 000001 ( i . e . “ john doe ”, as determined by joining subscriber_licenses table 72 with subscriber table 70 ) has a total of 10 licensed workouts and of these , he has registered 1 licensed workout ( i . e . used up 1 licensed workout ) and has 9 licensed workouts remaining . similarly , row 72 b indicates that goodfun has licensed a total of 20 workouts , has used 10 of these , and has 10 remaining . fig7 c is an exemplary subscriber_sites table 74 which stores information about the facilities where individual subscribers attend group exercise classes . for example , row 74 a indicates that subscriber “ john doe ” ( as determined by joining subscriber_sites table 74 with subscriber table 70 ) attends ymca toronto ( facility 1 ) and ymca ottawa ( facility 2 ). fig7 d is an exemplary subscriber_preferences table 76 which includes records indicating each user &# 39 ; s preferred music and preferred social networking app preferences . so , for example , row 76 a indicates that subscriber “ john doe &# 39 ; s ” preferred music is “ dance ” and his preferred social networking app is “ facebook ”, and row 76 b indicates that subscriber “ don smith ” prefers “ 80 &# 39 ; s pop ” and his preferred social networking app is “ twitter ”. information about such preferences , may be used to , for example , present a user with a list of suggested packages ( in the case of john doe , packages containing dance music ) and / or send john doe updates through facebook . fig7 e and 7f shows exemplary package table 78 and package_cost table 79 , respectively . more specifically , package table 78 indicates which “ exersing exercise package ” ( i . e . package a , b . c , d , e or f ) each subscriber has subscribed to . thus , as indicated by exemplary record 78 a , subscriber id 000002 ( i . e . “ jane doe ”) has subscribed to package c ; subscriber id 100001 ( i . e . goodfun ) has subscribed to packages a , b and c ( as indicated by record 78 b ); and subscriber id 100003 ( i . e . university of toronto mississauga ) has subscribed to packages a , b , c , d and e ( as indicated by record 78 c ). as may be appreciated , each package may be in the form of a computer readable file format recognized by “ exersing ” applications 38 , 48 and 58 . more specifically , each package may comprise a playlist of multiple songs . for example , package a may be a 45 - minute exercise routine which includes a playlist of 12 songs each with an average playtime of approximately 4 minutes . conventionally , the playlist would simply consist of 12 songs and the songs would be played one after another during the exercise class . however , and in accordance with the present application , each package a - f may include other elements such as : sheet music corresponding to each song in the playlist ; lyrics to the song ; sheet music corresponding to different vocal parts of the song ( e . g . soprano , alto , tenor and bass parts ); instrumental part only of the song ; music video related to the song ; text instructions (“ position 1 ”, “ 70 % resistance level ”, “ 100 rpm ”, etc . ); overdubbed instructions ( e . g . “ position 1 ”, “ 70 % resistance level ”, “ 100 rpm ”, etc . ); and information transmitted on the fly from the bike or external devices ( e . g . heart rate , calories burned ). of course , elements other than those described may be included in an exercise package file . as will be further described below , the user may selectively turn each of the aforenoted elements “ on ” and “ off ”. thus , for example , the user may select to have only the instrumental part of the song and text instructions play , but not music video , overdubbed instructions , or any of the other elements . the cost of each of packages a - f may be stored in exemplary package_cost table 79 ( fig7 f ). in particular , table 79 may store information about the cost per use of each package and the amount of royalties to be paid on each package , to , for example owners of copyrighted materials in those packages ( e . g . royalties to be paid to the artists of the songs included in each package ). thus , for example , record 79 a indicates that exercise package a costs $ 10 per use ( i . e . a subscriber is charged $ 10 per license for package a ) and $ 5 of royalties are payable per use of package a . central facility 29 may manage , administer and account for the acquisition of licenses of the copyrighted content ( e . g . songs , music , video , etc .) and associated payment of royalties to the authorized agencies . ( e . g . socan in canada ). such centralized administration and accounting may ensure compliance and minimize leakage . of course , other schemas of subscriber database 23 , containing other types of tables , records and attributes , may be employed and would be apparent to those of ordinary skill in the art . returning to fig1 , facility database 28 may contain information regarding members of exemplary exercise facility 22 . exemplary members table 80 of facility database 28 is shown in fig8 . specifically , table 80 has six records , each corresponding to a member of exercise facility 22 : each of these members may , in the conventional fashion , check into exercise facility 22 , e . g . by swiping their membership card through a card reader of exercise facility 22 , and computer system 14 may verify that that member is in fact a member ( or an active member ) of exercise facility 22 by querying members table 80 of facility database 28 . of course , other schemas of facility database 28 , containing other types of tables , records and attributes , may be employed and would be apparent to those of ordinary skill in the art . exemplary classes table 90 and subscribed_packages table 92 which may be part of facility database 28 of exercise facility 22 is shown in fig9 a and 9b . as shown , classes table 90 may contain records 90 a , 90 b and 90 c , each corresponding to a different spinning class . for example , record 90 a provides that “ spinging level 1 ” class is scheduled to occur on may 1 , 2014 at 13 : 00 hours ( i . e . 1 pm ) and taught by instructor “ lucy ”. moreover , record 90 a indicates that “ spinging package a ” will be used during the class and that members with id &# 39 ; s 001 ( i . e . “ abigail jones ”) and 002 ( i . e . “ john smith ”) ( see members table 80 ) have signed up / registered for the class . referring to fig9 b , subscribed_packages table 92 may track the number of licensed workouts used up by exercise facility 22 and number of licensed workouts remaining . accordingly , exemplary record 92 a indicates that exercise facility 22 has used up 25 licenses for “ spinging package a ” and has 25 licenses remaining . of course , other schemas of facility database 28 , containing other types of tables , records and attributes , may be employed and would be apparent to those of ordinary skill in the art . operation of system 20 , exemplary of an embodiment of the present application , will now be described with reference to fig1 - 12 . flow diagrams 1000 ( fig1 a ) and 2000 ( fig1 b ) describe operation of central facility computer system 10 , more specifically , registration of an individual subscriber or facility subscriber for access to the “ exersing ” service of the present application . to begin , central computer system 10 , specifically , “ exersing ” application 38 running on central computer system 10 , may receive a request for registration from a prospective individual or facility subscriber ( s 1010 ). this request may , for example , be sent from “ exersing ” application 58 hosted on the individual &# 39 ; s computing device 12 , or from “ exersing ” application 48 hosted on exercise facility computer system 14 . “ exersing ” application 38 may next request and obtain the prospective subscriber &# 39 ; s data , for example , name , address , facility or facilities frequented , preferred music and preferred social networking app ( s 1012 ). then , “ exersing ” application 38 may receive an indication of the prospective subscriber &# 39 ; s desired exercise package ( s ) ( e . g . “ exersing package a ”) and desired number of licenses ( e . g . 10 licenses ) ( s 1014 ). based on this information , “ exersing ” application 38 may query subscriber database 23 , in particular , package_cost table 79 ( fig7 f ) to determine the cost of the selected package ( s ) and return to the prospective subscriber an indication of the cost of the selected exercise package ( s ) ( s 1016 ). for example , supposing the prospective subscriber indicates that she / he / it wishes to subscribe to 10 licenses to “ exersing package e ”, e . g . “ spinging ”, application 38 would return an indication of the total cost of $ 1000 ( 10 ×$ 100 ). “ exersing ” application 38 may then request a credit card number to which the $ 1000 can be charged ( not shown in fig7 f ). alternatively , other forms and methods of payment e . g . paypal , electronic funds transfer , etc . may be accepted . lastly , “ exersing ” application 38 may create new record ( s ) corresponding to the new member / subscriber in subscriber database 23 ( s 1018 ). thereafter , the subscriber may be considered to be properly registered in system 20 and permitted to access and / or download “ exersing ” packages to which he / she / it has paid for . operation of central computer system 10 upon receipt of a request from a subscriber is illustrated in flow diagram 2000 ( fig1 b ). upon receiving a request from a user for access to a given exercise package ( s 2010 ) “ exersing ” application 38 running on central computer system 10 may query subscriber database 23 to determine whether the user is registered ( s 2012 ). if the user is not registered , then “ exersing ” application 38 will deny access ( or alternatively , present an option allowing the user to register ). if the user is registered , then “ exersing ” application 38 may further query subscriber database 23 to determine whether that user has a non - zero number of licensed workouts remaining ( s 2014 ). if so , then the user may be permitted to access or download a copy of the “ exersing ” package which he / she / it has licensed ( s 2016 ). following the user &# 39 ; s access or download , subscriber database 23 , more specifically , subscriber_licenses table 72 may be updated accordingly . as may be appreciated , the operations described in flow diagrams 1000 and 2000 , and in particular , the operations requiring input and output to the user , may be presented via a conventional graphical user interface ( gui ) ( not shown ). as explained above , facility subscribers may , after obtaining and paying for licenses to particular “ exersing ” packages , use those packages during group exercise classes offered by the facility . advantageously , the subscribing facility may install “ exersing ” application 48 e . g . “ spinging ” on each of its exercise bikes so that each participant in the facility &# 39 ; s group exercise class may customize the “ spinging ” package to include or exclude elements as desired . alternatively , the facility may allow the simultaneous upload / download / transmit of a temporary file of the session &# 39 ; s “ exersing ” program / package to all participants thereby ensuring all participants are playing the same songs in sequence and the timing of the songs being played at any time is synchronized . fig1 is a flow diagram 3000 which illustrates operation of exercise facility computer system 14 , and more specifically , illustrates the use of an “ exersing ” exercise package during a group exercise class . to begin , “ exersing ” application 48 running on exercise facility computer system 14 may receive login credentials from an instructor ( s 3010 ). for example , and with reference to classes table 90 ( fig9 a ), row 90 a , on may 1 , 2014 in preparation for the 1 pm “ spinging level 1 ” class , instructor “ lucy ” may log into “ exersing ” application 48 running on exercise facility computer system 14 , from , for example , a computer or device located in the exercise room which is connected to computer system 14 via , for example , wired or wireless network 102 . instructor lucy may next provide an indication of a date and time of the class ( i . e . may 1 , 2014 and 1 pm , respectively ) ( s 3012 ). with this information , “ exersing ” application 48 may query facility database 28 to determine the exercise package to be used during the class ( s 3014 ) ( i . e . package “ a ”) and further to determine that list of members signed up for the class ( s 3016 ) ( i . e . members with id 001 (“ abigail jones ”) and 002 (“ john smith ”)). in particular , assuming that someone authorized by exercise facility 22 ( e . g . an employee of exercise facility 22 ) has previously downloaded package “ a ” from central facility 29 , and the package “ a ” file is already stored on a computer readable medium connected to or accessible by facility computer system 14 , package “ a ” may be selected ( s 3018 ), and initiated ( s 3020 ). at this point , notably , instructor lucy may select , via a gui of “ exersing ” application 48 ( for example , see fig1 ) which audio / visuals and other elements related to “ exersing package a ” to present on the class video screen and / or sound system ( s 3022 ). simultaneously , customized parts of the routine of “ exersing package a ” may be streamed to and displayed on abigail jones &# 39 ; and john smith &# 39 ; s individual devices ( e . g . their stationary bike console screens ) ( s 3024 ). alternatively , abigail and john &# 39 ; s bikes may access a copy of package “ a ” stored on exercise facility computer system 14 via network 100 or 102 . significantly , the audio / visuals presented on the class video screen / sound system may be elements common to both abigail and john ( e . g . a video of climbing hills ); however , the elements displayed on abigail &# 39 ; s individual screen may be customized to her preferences ( e . g . sheet music corresponding to the soprano part of the song ) and likewise for john ( e . g . sheet music corresponding to the bass part of the song ). in order to keep all class participants in synchrony , exercise facility computer system 14 may act as the “ master ” and the class participant &# 39 ; s bikes as the “ slaves ”. more specifically , “ exersing ” application 58 may transmit timing information to exercise bikes 12 ( via network 100 or 102 ) so that the participants &# 39 ; displays may be synchronized . in this manner , for example , john &# 39 ; s music lyrics for the bass part may scroll across his bike console screen at the same rate as abigail &# 39 ; s sheet music for the soprano part is scrolling across her bike console screen . as may be appreciated , this allows john and abigail to sing their respective parts in synchrony . fig5 , depicts an exemplary screenshot 60 a of the instructor &# 39 ; s display 45 during the “ exersing ” class . as shown , the instructor &# 39 ; s monitor ( for example , on the instructor &# 39 ; s bike console or computing device ), may display multiple elements comprising the playlist of songs , the segment of the exercise routine , and the songs &# 39 ; playtimes . for example , as shown on the left - hand side of screenshot 60 a ( section 60 a ( i )), the first song in the playlist is “ michelle ” and it plays during the “ warm up ” part of the exercise routine , and it lasts for 2 minutes and 32 seconds . the song “ boom boom ” plays during the “ hill ” part of the exercise routine , and it plays for 3 minutes 30 seconds , and so on . the right - hand side of screenshot 60 a ( section 60 a ( ii )) displays information and targets related to the current part of the exercise routine , namely , the “ mode ” ( i . e . “ warm up ”), the “ position ”, corresponding to the position on the bike that the exerciser is to assume ; “ resistance ” corresponding to the suggested resistance level that the exerciser should set his or her bike at ; the “ target cadence ” corresponding to the suggested rpms that the exerciser should maintain during the current mode ; and “ countdown ” corresponding to the time remaining in the current mode . section 60 a ( iii ) displays information and targets related to the next part of the exercise routine . section 60 a ( iv ) of screenshot 60 a , displays a musical score related to the music that is currently playing , as shown , the melody part of the song “ michelle ”, as well as the lyrics to the song . conveniently , the instructor , reading the music , may be able to lead the class participants in a sing along . in addition , the instructor may read off the resistance and target cadence levels displayed on his or her screen and call them out to the class participants . fig5 is an exemplary screenshot 60 b of what may be displayed on a common “ exersing ” class monitor / screen for all class participants to view . as can be seen , this may include a motivational video of people exercising and the music for the currently playing song , “ michelle ”. furthermore , as previously discussed , “ exersing ” application 48 may allow the user ( e . g . the class instructor or class participant ) to choose which elements he or she wishes to see presented on the common classroom screen / monitor ( display 45 ) or bike console display ( display 55 ) which , alternatively , may be a user &# 39 ; s smart phone or tablet , respectively . more specifically , and as further explained below , each “ exersing ” exercise package may comprise multiple elements such as audio , video , music , lyrics , text , graphics and animation , which elements may be selectively turned on or off at runtime by the user , via , for example , the gui illustrated in fig1 . thus , for example , if the user wishes only to experience the instrumental part of a song and no vocals ( i . e . lyrics ), he or she may select ( i . e . turn on ) the instrumental option and deselect ( i . e . turn off ) the vocal option . similarly , if the user wishes to have the sheet music accompanying the song scrolled across his or her screen , he may select this option . returning to the above example , each of abigail and john may , at the start of the class , select , via a gui presented by “ exersing ” application 58 running on his or her bike ( fig1 ), which elements he or she wishes to experience . fig1 is a screenshot of an exemplary screen that may be presented to john on his device e . g . stationery bike console display 55 . as may be seen , john has indicated , by selecting selection boxes 130 , 132 , 136 , 138 , that he wishes to have video , sheet music , resistance level and rpms displayed on his bike console display 55 . in particular , he has indicated by selecting radio button 134 that the sheet music should correspond to the tenor part of each song . fig6 illustrates what may be displayed on an individual class participant &# 39 ; s display 55 of his or her computing device or bike monitor during an “ exersing ” e . g . “ spinging ” class . more specifically , screenshot 70 a shows one possible view which includes the time elapsed in the exercise routine ( section 70 a ( i )); resistance level , target cadence , actual cadence , heart rate and calories / kwh ( section 70 a ( ii )); and music related to the currently playing song ( section 70 a ( iii )). notably , the information displayed in section 70 a ( ii ) may be information pertaining specifically to that individual class participant and may be obtained from that individual &# 39 ; s device e . g . bike console and / or external devices that are synced and in communication with that individual &# 39 ; s bike ( e . g . heart rate monitor strapped to that individual &# 39 ; s chest which transmits heart rate data to the bike ). screenshot 70 b illustrates an alternate view of a class participant &# 39 ; s display 55 . in particular , section 70 b ( i ) displays a diagram of the exercise room and indicates the name of each “ exersing ” class participant riding e . g . each stationary bike rider . upon logging in to his or her exersing computing device , each class participant may select to share their name and provide it to the facility &# 39 ; s computer system 14 , which in turn , may collect and consolidate and send back the information to each individual &# 39 ; s computing device . notably , section 70 b ( ii ) of screenshot 70 b displays music for the bass part of the song “ michelle ”, because that particular individual may sing in the bass range , in contrast to , for example , the music displayed in section 70 a ( iii ) of screenshot 70 a , which is for the soprano part of the song “ michelle ”, because that individual may sing in the soprano range . advantageously , the music and lyrics may scroll across each individual &# 39 ; s device e . g . bike console display at the same rate so that all of the class participants may sing their respective parts in synchrony . conveniently , and as discussed previously , instead of attending a group exercise class , an individual subscriber may choose to instead experience a particular “ exersing ” package to which he or she has licensed on his or her own time in his or her location of choice ( e . g . at home ) (“ single user mode ”). flow diagram 4000 ( fig1 ) illustrates operation of an individual user &# 39 ; s computing device . in this example , “ exersing ” application 58 on the user &# 39 ; s computing device 12 may receive the user &# 39 ; s credentials ( s 4010 , fig1 ) as well as an indication of the exercise package routine to be initiated ( s 4012 ). “ exersing ” application 58 may then access the package ( either stored on computing device 12 ), or over a network if stored remotely . “ exersing ” application 58 may include a gui similar to the gui presented by “ exersing ” application 48 hosted on facility computer system 14 ( see fig1 ), which allows the user to pre - select , or select at runtime , which elements of the “ exersing ” exercise routine he or she wishes to see or hear . “ exersing ” application 58 may then display a version of the exercise routine that may be customized to that particular user ( s 4014 ) based upon the options selected by the user . in addition , in accordance with an alternate embodiment of the present application , multiple individuals running “ exersing ” application 58 in single user mode may form an ad hoc group and may thereby experience a group exercise session without the needing a human instructor . more specifically , “ exersing ” application 58 running on one of the class participant &# 39 ; s devices may be designated as the “ master ” and the others as “ slaves ”. the “ master ” may send information , including timing information , to the “ slaves ”, and in this fashion , keep all the class participants in synchrony . implementation of “ exersing ” application 38 , 48 and 58 , and in particular , implementation of combining and superimposing streams of static text and graphics , subtitles and scrolling / dynamic text / graphics on a video or on a still background are known to those of ordinary skill in the art . in particular , implementation of “ exersing ” application 38 , 48 and 58 may include known and conventional technology and techniques , e . g . karaoke and video editing / display technology . for example , data structures for representing the components of a karaoke song ( e . g . . kar file format ) may be used . conversely , known techniques for reading and executing a . kar file may be employed . operation of system 20 with respect to the administration and distribution of pre - packaged exercise routines ( i . e . “ exersing ” exercise packages ) has been described above . however , significantly , system 20 may further allow users to create / compile new “ exersing ” routines ( i . e . new exercise packages ), so that new content may be supplied to subscribers of the “ exersing ” service . in particular , “ exersing ” application 38 hosted on the central facility computer system 10 ( server - side application ) may allow a user — for example , an employee or administrator of the “ exersing ” service provider — to create new exercise packages . in particular , “ exersing ” application 38 hosted on central facility computer system 10 ( server - side application ) may allow a content producer , for example , an employee of the “ exersing ” service provider to create new “ exersing ” exercise packages , including a single song , or a collection of songs ( analogous to an album ) synchronized to an exersing routine . optionally , a subscriber to the “ exersing ” service ( e . g . an individual subscriber or a facility ), may also create exercise packages . the “ exersing ” service provider may purchase or license content , specifically , songs , music videos , karaoke tracks , etc . to be included as part of one or more exercise packages . furthermore , the “ exersing ” service provider may purchase or create additional elements / content related to each song such as sheet music , lyrics associated with the songs , resistance levels , elapsed time , etc . techniques for separating a song into streams of data including melody , lyrics , harmony , beat and tempo are known . such content may be catalogued and stored in a content database ( not shown ) hosted on central facility computer system 10 for retrieval . the songs may be indexed in a conventional manner by various attributes , including type of music ( e . g . instrumental or song ); genre ; era ; beat count ( e . g . 180 beats / min ); vocal parts ; language ; artist / composer ; publishing company ; exercise type ( warm - up , interval , hill climb , cool down ); and others . conveniently , the additional elements / content associated with each song may be included in the “ exersing ” exercise package . it is these additional elements / content that may be selected or deselected for presentation by individual exercisers during an exercise class , as explained previously . in operation , a content producer may create new exersing packages by creating a playlist of songs . the content producer may design an exersing package according to various factors such as exercise type ; duration of exercise ; intensity of the exercise ; degree of difficulty ; etc . with this in mind , the content producer may first search for songs by one or more of the catalogued attributes indicated above ( e . g . a low beat count for a song to be played during the warm - up segment of the exercise routine ), via a conventional gui ( not shown ). for each song , the “ exersing application 38 may present the available additional content via a gui . fig1 is a screenshot of an exemplary gui 150 which presents the available additional elements / content related to the song “ michelle ”. in particular , fig1 indicates that the following additional elements / content related to the song “ michelle ” are available : a vocal track ( michelle_vocals . midi ); instrumental track ( michelle_instrumental . midi ); a video ( michelle_video . mp4 ); sheet music for the soprano , alto , tenor and bass parts ( michelle_soprano . jpg ; michelle_alto . jpg ; michelle_tenor . jpg ; michelle_bass . jpg , respectively ); and the lyrics ( as a subtitle file michelle_lyrics . srt ). via exemplary gui 150 , the content producer may select the additional elements / content to be associated with the song “ michelle ” in the “ exersing ” package . as shown , the content producer has chosen to include the vocal track , the video and the lyrics as indicated by selection boxes 152 , 154 , and 156 . the content producer may add another song to the playlist by clicking button 158 or indicate he or she is done creating the playlist by clicking button 160 . once done , “ exersing ” application 38 may compile the playlist , which as should now be apparent , may include songs and all additional elements / content selected by the content producer and package it into a composite file . this file may be named , e . g . “ exersing package a ”, and stored by central facility computer system 10 for download / access by subscribed users . as may be appreciated by those of ordinary skill in the art , system 20 may provide any number of additional features . for example , subscribers may choose to provide personal information ( e . g . medical information ) such as calories burned , maximum heart rate , medical conditions , age , etc . to central facility 22 . such information may be stored in subscriber database 23 , for example , as additional attributes in exemplary subscriber table 70 ( fig7 a ). moreover , central facility 22 may maintain a social networking site or members area website where subscribers may leave their comments , suggestions and communicate with each other . in particular , participants may , with other members &# 39 ; permission , be able to view who has registered for a class and / or who is attending a class in progress . a member may choose to allow other participants to view varying amount of information — e . g . friends , “ exersing ” classmates , information about themselves e . g . music interests , favourite music genre and artists , other interests and also invite communication e . g . “ meet for coffee ”, “ attend concert ”, “ make music ” from other members to varying degrees e . g . friends , “ exersing ” classmates . possibly , a camera may be placed at the exercise facility 22 and images of the members 24 exercising at a particular location may be captured , provided to computer system 10 , for distribution to other individual members 24 , remote from the exercise facility 22 by way of network 100 . the camera may encode and stream moving video , thereby allowing remote members to view activities at the exercise facility 22 . as will be apparent , the purpose of the described methods and system is to facilitate singing while exercising . this may conveniently be made possible by providing words and music for singing coupled to synchronized exercise instructions . the basic level of singing while exercising involves an individual participant ( or all participants in a group exercise class ) singing along to the music piece . advanced levels provide the words and music for multiple parts e . g . soprano , alto , tenor and bass to facilitate singing harmonies etc . health and other benefits of so singing while exercising are numerous and include : raising a participant &# 39 ; s heart rate several beats above exercising only levels ; increased enjoyment and , consequently , motivation to participate . singing while exercising with a group is fun and social . making music with others creates a bond and increases the opportunity for and encourages social interaction . this , in turn , may increase the market and appeal for combined exercising and singing , attracting a broader range of exercise participants . in addition the flexibility of “ exersing ” allows it to be marketed to a wide range of age groups and market segments to attract those who traditionally do not exercise . an area of significant public concerns currently is childhood obesity . creating “ exercising ” packages for schools , youth clubs etc . may provide benefits . retired and elderly people are also potential users . of course , the above - described embodiments are intended to be illustrative only and in no way limiting . the described embodiments of carrying out the invention are susceptible to many modifications of form , arrangement of parts , details and order of operation . the invention , rather , is intended to encompass all such modification within its scope , as defined by the claims .	6
in the it service industry , logical steps for delivering service often are organized into abstract “ disciplines ” that can be applied to any it service delivery model . within a given discipline , though , these steps are organized further into more narrow “ processes ,” and finally , into detailed “ methods .” thus , in this context , the invention described below comprises a “ method ” that applies it service delivery disciplines to the new and unique needs of the on - demand model . because this method has been designed to extend the reach of standard disciplines , some of the terms used in this description may be familiar to a person skilled in the art , but many of these terms are adapted to reflect the new and unique solutions that support the on - demand model . the performance management method ( pmm ) is a tactical methodology that addresses the activities in which an on - demand provider defines and monitors performance parameters for a customer , thereby supporting each customer &# 39 ; s performance within the on - demand environment . in this environment , the customers are boarded on shared platforms , where disk , tape , cpu and memory are shared by multiple customers . the method &# 39 ; s goal is to optimize the response time and throughput of existing it resources , as well as to enable appropriate actions to correct inefficient resource use . specifically , the method defines and maintains specific performance alerts for each customer in a shared environment , while being sensitive to the performance needs of all customers who share the environment . pmm includes alert definitions , requirements for performance reports , and activities for balancing and tuning the it resources and the workload requirements . to accomplish this , the method comprises a proactive set of activities , which includes interpreting performance statistics , responding to alerts , and resolving performance problems . the performance management method ( pmm ) has been designed as an integral part of a comprehensive “ on - demand data center services ( odcs ) delivery operational methods ” ( the “ odcs methods ”). the odcs methods encompass several other types of management methods , with which the pmm may interact . since the pmm does not depend on the internal operations of these other management methods , they are characterized as “ external ” methods and described completely by the data that the pmm provides to and receives from them . the odcs methods that operate externally with the pmm include : 1 ) the manage change operational process , which opens a change record when requested by the pmm ; 2 ) the manage problems operational process , which opens a problem record when requested by the pmm ; 3 ) the control odcs availability process , which implements recommendations when performance thresholds and reports are provided by the pmm ; 4 ) the supervise and control odcs methods , which provide completed requests , as submitted by the pmm , to assess , size , and implement required process improvements and to handle process compliance issues ; 5 ) the control odcs capacity process which , upon pmm &# 39 ; s request , completes a request or implements a recommendation to other methods to correct performance issues ; and 6 ) the control odcs technology strategy and refresh process , which provides odcs technology strategy when requested by the pmm . in the detailed description that follows , the inventive performance management method is carried out by a performance analyst , unless otherwise indicated . the performance analyst interacts with all methods external to the pmm ; with the provider &# 39 ; s customers ; with the internal users of the odcs methods , such as account managers and other service delivery support staff ; and with any other individuals requiring pmm data . the performance analyst has the overall responsibility of ensuring that performance service level agreements are met . additionally , the performance analyst is responsible for overseeing and executing internal pmm operations . for the sake of clarity , the references to a performance analyst assume that the performance analyst is an individual and that , unless otherwise indicated , the functions of the performance analyst are carried out manually . a person skilled in the art , though , will appreciate that many of the performance analyst &# 39 ; s functions may be automated with routine programming , and the use of this nomenclature in the following description should not be construed as a limitation on the scope of the present invention . to effectively implement the performance management method , a performance analyst must consider the dynamic demands of the various customer &# 39 ; s applications sharing the it resources , and the resources available to meet those demands . a person skilled in the art should appreciate that a performance analyst also must consider relevant policies , standards , and contracts when implementing the pmm . the present invention can be implemented in many different configurations , including software , hardware , or any combination thereof . the following detailed description of the preferred embodiment and the accompanying figures refer to a variety of software tools that the performance analyst , or the related external operational methods , may use to implement the inventive method . in particular , the accompanying figures illustrate the use of problem management software , such as tivoli problem management software ( tpm ), and change management software , such as tivoli change management software ( tcm ). additionally , a variety of reporting software tools are used including : esm / rt ; srm for distribution of pre - defined reports ; performance reporter ( pr ) for mainframe performance reports ; rmf ; and omegamon suite , which further includes cics , db2 , ims , and mvs , for most custom reports . a person skilled in the art should appreciate that a variety of software tools may be used to implement the inventive method , and the references to particular software tools are not intended to limit the scope of the invention . furthermore , a person of skill in the art should be familiar with the various embodiments of particular software tools that are available in the market , and they are not described in detail here . the following discussion and the accompanying figures also describe the use of a database in the preferred embodiment of the inventive method . a person of skill in the art will appreciate that a database may exist in many forms . as used herein , the term “ database ” means any collection of data stored together and organized for rapid search and retrieval , including without limitation flat file databases , fielded databases , full - text databases , object - oriented databases , and relational databases . fig2 a and 2b provide an overview of the performance management method ( 200 ). in accordance with fig2 a , the performance analyst invokes the pmm upon the request of a customer ( 201 ). the performance analyst also invokes the pmm when the performance analyst detects performance issues ( 202 ) or performs a comprehensive periodic performance review to ensure the overall system performance meets all objectives and no performance issues exist ( 203 ). if the performance analyst receives input , i . e ., information or communications , from the manage change operational process , the performance analyst also invokes the pmm ( 204 ). normally , the input from the manage change process consists of requests to review planned changes for performance impacts . the performance analyst then reviews the input record ( 205 ) to determine what is requested in order to proceed . as illustrated in fig2 a , the performance analyst selects the method path as required ( 206 ). to analyze and review the performance of the shared computing resources , the performance analyst selects the performance analysis / review path ( 207 ). to analyze and review process results , the process analysis / review path is selected . ( 214 ). as illustrated in fig2 b , if the performance analyst selects the perform performance analysis / review path ( 207 ), the performance analyst further selects one of four discrete sub - methods ( 208 ). to review and monitor performance data , the performance analyst invokes the predictive performance management sub - method 300 ( see fig3 a ) ( 209 ). to review planned events for performance impacts , the performance analyst invokes the preventative performance management sub - method 400 ( see fig4 ) ( 210 ). the performance analyst invokes the reactive performance management sub - method 500 ( see fig5 a ) to react to problem situations , such as a failing or poorly performing component , when prompted by a performance alert ( 211 ). if performance measurements , thresholds , or alerts need to be established or changed , the performance analyst invokes the service level agreement performance management sub - method 700 ( see fig7 a ) ( 212 and 213 ). each of these sub - methods is illustrated and discussed in detail below . referring again to fig2 a , the performance analyst invokes the process analysis review to analyze capacity requests or issues , and to analyze unresolved escalation issues that require further attention ( 214 ). if a problem requires a more formal review ( 215 ), the performance analyst invokes the manage problems operational process to address the problem ( 216 ). if no formal review is required , the performance analyst then must determine if any improvements are needed ( either to support the on - demand method or related processes ), or if any method compliance issues were identified ( 217 ). if the performance analyst determines that method improvements are needed , or identifies any method compliance issues , the performance analyst invokes the supervise and control odcs methods . through this process , the performance analyst initiates assessment , sizing , and implementation of the process improvements and handles compliance issues ( 218 ). the performance management method is then completed ( 219 ), as indicated in fig2 b . fig3 a and 3b depict the predictive performance management sub - method ( 300 ). this sub - method evaluates and monitors performance data in order to predict and minimize performance - related problems . no assumption is made that any specific problem exists . instead , this sub - method analyzes trends in existing performance data to avoid potential performance problems . the performance analyst invokes the predictive performance management sub - method when a review of data shows approaching degradation in system performance ( 301 ). the performance analyst uses several methods to identify system performance degradation . for example , the performance analyst reviews system key indicator reports to examine the key performance indicators at both the system and subsystem levels . key performance indicators show the utilization of critical system resources . the performance analyst isolates significant variables to determine key performance indicator exceptions , if any , and performs real - time monitoring of the system . the performance analyst also reviews the service level agreement metrics to identify system and subsystem performance degradation . the term “ metrics ” refers to numerical ratings used to measure the complexity and reliability of source code , the length and quality of the development process , and the performance of the application when completed . if additional reports are required to analyze system and subsystem performance , the performance analyst invokes the run ad hoc reports sub - method , as detailed below , to request and receive the additional reports ( 302 and 303 ). if additional reports are not required , the performance analyst identifies performance issues by analyzing trends and exceptions observed in historical reports , as well as by identifying anomalies and specific metrics that indicate a potential performance problem ( 304 ). after reviewing system parameters that are relative to the trend , the performance analyst proposes an appropriate course of remedial action ( 305 ). the performance analyst then determines if system parameters can be adjusted without adverse effect to other customers who share the resources ( 306 ). if the parameters cannot be adjusted due to system limitations , the performance analyst communicates this information to odcs management and to the control odcs capacity process and requests assistance ( 307 ). the performance analyst alerts the control odcs capacity process that a change request is forthcoming to resolve system or subsystem limitation issues ( 308 ). a “ change request to resolve system limitations ” is opened to request that the system limitation issue be addressed to resolve the performance issue ( 309 ). the performance analyst likewise invokes the manage change operational process , which tracks the system limitation change through completion ( 310 ). in contrast , if the performance analyst determines that the parameters of the system can be adjusted ( 306 ), the performance analyst analyzes the actual trending values against a hypothetical optimum to determine the correct adjustments needed to return the impacted component to an acceptable range while considering the impact to other customers sharing the resource ( 311 ). based on the correct adjustment to the impacted component , the performance analyst develops a recommendation for constraint relief and presents the recommendation to the primary support groups and affected account teams for approval ( 312 and 313 ). if the support groups and account teams do not approve the recommendation , the performance analyst develops a new recommendation for constraint relief and again presents the recommendation to the primary support groups and affected account teams for approval ( 312 thru 314 ). when the recommended actions are approved , the performance analyst determines if the performance issue causes an immediate delivery impact ( 315 ). if the performance issue causes an impact at this point , the performance analyst opens a problem ticket to implement the solution and invokes the manage problems operational process ( 316 and 317 ). if the performance issue does not cause an immediate delivery impact , the performance analyst opens a change request to implement the solution and invokes the manage change operational process to manage the change request to resolve the performance issue ( 318 and 319 ). the predictive performance management sub - method then ends ( 320 ). fig4 illustrates the preventative performance management sub - method 400 . to effectively provide preventative performance management services to on - demand customers sharing it resources , the performance analyst evaluates the impact of changes on the system as a means of avoiding negative performance effects . the effects of the changes , in terms of the potential impact on performance , result in accepting , rejecting , or conditionally approving the changes to avoid triggering performance problems . the performance analyst invokes the preventative performance management sub - method to review change reports and identify any changes that may impact performance ( 401 ). for each change that could potentially impact the system performance , the performance analyst must be listed as a change approver ( 402 ). if not listed as a change approver and the change could potentially impact the system performance , the performance analyst requests to be added as a change approver and the manage change process updates the change request to include the performance analyst ( 403 and 404 ). when listed as a change approver , the performance analyst obtains reports , as needed , by invoking the run ad hoc reports sub - method as described below ( 405 and 406 ). the performance analyst , acting as a change approver , reviews the change record text in detail , analyzes the change for performance impacts , and determines if the change impacts the system performance ( 407 and 408 ). if the change does not impact the performance , the performance analyst approves the change ( 409 ). otherwise , the performance analyst specifies that the change is modified , postponed , or rejected by updating the change record to document the review performed , the performance impacts found , and the performance recommendation for the change request ( 410 ). upon this event , the preventative performance management sub - method is complete and the performance management method continues . fig5 a and 5b illustrate the reactive performance management sub - method 500 , which handles problem situations that are reactive in nature . when the performance analyst receives a performance alert , the performance analyst analyzes the problem and makes recommendations . this process continues until the specific problem is resolved with complete documentation . the performance analyst , invoking the reactive performance management sub - method , collects all available data and performs a basic review of the problem ( 501 ). data reviewed includes the initial problem reports , system outputs , monitor data , and trace data . the performance analyst then determines the nature of the problem ( 502 ). for instance , the problem may be performance related , may be an incorrect alert needing adjustment , or may be an issue that should be addressed by another group ( 503 ). if the alert needs adjustment , the performance analyst opens a change request to document the alert changes needed to return the alert to compliance . the performance analyst then invokes the control odcs availability operational process , an external process , to perform the requested alert adjustments ( 504 and 505 ). if the nature of the problem is actually an issue that should be addressed by another service group , the performance analyst indicates in the documentation that the problem appropriately belongs to another primary support organization and routes the documentation to that organization ( 503 and 506 ). the external manage problems operational process reassigns the problem record to the appropriate support organization and tracks the problem record until the issue is resolved ( 507 ). if the problem is performance related , the performance analyst determines if any additional reports or data are required to resolve the performance problem , and then invokes the run ad hoc reports sub - method , described in detail below ( 508 and 509 ). if no additional reports or data are needed , the performance analyst isolates the failing or poorly performing component ( 510 ). the problem component may lie with an operating system , a subsystem , a database , the network , or other components . the performance analyst identifies significant variables within the components previously isolated , and documents the findings and recommendations ( 511 and 512 ). the performance analyst implements system modifications to resolve the performance problem , monitors the failing component to ensure the results are acceptable , and determines whether or not the results are acceptable ( 513 and 514 ). if the results are not acceptable , the performance analyst repeats the analysis process to identify the failing component , formulate and document recommendations , and implement the modifications until acceptable results are obtained ( 510 thru 514 ). once the performance analyst updates the problem record by documenting the problem found and the solution implemented , the reactive performance management sub - method terminates and the performance management method continues ( 515 and 516 ). fig6 illustrates the run ad hoc reports sub - method 600 . the performance analyst invokes this sub - method , as needed , in the predictive performance management sub - method ( 302 and 303 ), the preventive performance management sub - method ( 405 and 406 ), and reactive performance management sub - method ( 508 and 509 ). the performance analyst uses the run ad hoc reports sub - method to enter report specifications and produce individual reports to perform an in - depth analysis of a performance change or problem , or for future planning . the performance analyst invokes the run ad hoc reports sub - method using the appropriate reporting tools ( 601 ). the performance analyst then reviews the report and determines if the format and content of the report are correct ( 602 and 603 ). if the format and content are not correct , then the performance analyst makes the required changes and re - runs the reports before distributing the reports to the appropriate parties ( 604 thru 606 ). as noted above , the performance analyst uses a variety of reporting tools in the preferred embodiment of the pmm &# 39 ; s run ad hoc reports sub - method , but the invention should not be construed as being limited to these specific tools . fig7 a depicts the service level agreement ( sla ) management sub - method 700 . the objectives of this method are to determine the appropriate sla , to gain approval of the sla , and to determine the measurements , alerts , and reports to ensure the sla requirements are achieved . the performance analyst invokes the sla sub - method when performing sla related tasks . the performance analyst may perform these sla related tasks independently of the other sub - methods . additionally , the performance analyst may perform these sla related tasks in response to changes initiated during the preventative performance management sub - method or the reactive performance management sub - method . in the sla performance management sub - method , the performance analyst first accesses and reviews the applicable contracts and the required slas ( 701 ). as seen in fig7 , a customer &# 39 ; s contract and sla information is typically stored in database 750 to facilitate retrieval . additionally , the performance analyst accesses and reviews a technology strategy for performance related matters ( 702 ). the technology strategy is based upon the performance data provided by the control odcs technology strategy and refresh operational process . the performance analyst then determines the resources that should be monitored for performance metrics ( 703 ). system performance has many dimensions to be considered , including throughput , latency , utilization , efficiency , and effectiveness . typical system resources and components that should be monitored include cpu , memory , disk , network , and system applications . of course , the performance analyst always should consider how the performance of these system resources affects customers that share the resources . next , the performance analyst determines if a baseline definition is required , and , if so , analyzes the baseline using an automated report tool ( 704 and 705 ). the baseline is dependent upon many different factors , such as the systems , subsystems , applications , other customers , and performance measurement tools used . next , the performance analyst defines and reviews the performance thresholds that should trigger action . the performance thresholds definitions are based on contract and sla obligations , as well as the platform , operating system , subsystems , environment , and system role in the process ( 706 ). continuing with fig7 b , the performance analyst reviews the proposed slas with the account team to ensure the slas are acceptable and meet contractual requirements ( 707 and 708 ). if the account team does not agree with the proposed slas , the account team and performance analyst must negotiate and resolve the conflicts before the performance analyst may revise the performance thresholds ( 708 thru 710 ). when the account team agrees with the proposed slas , the performance analyst defines and updates the performance alerts ( 708 and 711 ). performance alerts occur when performance metrics cross the defined thresholds . the performance analyst may take several actions when a performance alert occurs , including analyzing performance problems , tuning the system , and invoking capacity planning ( 712 ). the performance analyst , aided by a reporting tool , defines and reviews the format of performance management reports ( 713 ). these reports may be in the form of text , tables , graphs , raw data , etc . the types of reports include technical reviews , executive summaries , and presentations . the performance analyst documents all proposed performance measurements and their interrelationships , and includes the slas , alerts and responses , and performance reports in the documentation ( 714 ). referring to fig7 c , the performance analyst identifies requirements and criteria for data collection , which may include the type of data to be collected and the length of time that the data must be retained ( 715 ). next , the performance analyst submits requests to the odcs measurements team to collect the required performance data , the report criteria , and the frequency for producing performance reports ( 716 ). the odcs measurement team obtains the data collection and report request from the performance analyst , and develops the data collection jobs and procedures . the odcs measurement team also provides samples of the data and reports to validate the request ( 717 ). then , the performance analyst receives and reviews the reports to ensure that the requirements are met . the performance analyst submits a change request to the availability group to implement the thresholds and develop or update the alerts ( 718 and 719 ). when the performance analyst invokes the control odcs availability operational process to implement the new or updated thresholds ( 720 ), the performance sla management sub - method ends and the performance management method continues . a preferred form of the invention has been shown in the drawings and described above , but variations in the preferred form will be apparent to those skilled in the art . the preceding description is for illustrative purposes only , and the invention should not be construed as limited to the specific form shown and described . the scope of the invention should be limited only by the language of the following claims .	6
the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which a preferred embodiment of the invention is shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete and will fully convey the scope of the invention to those skilled in the art . an exemplary embodiment of an electrical connector 100 according to the present invention is shown in fig1 and 2 . the electrical connector 100 is shown mated in fig1 and unmated in fig2 . the electrical connector 100 includes a plug 102 and a receptacle 104 . the plug 102 and receptacle 104 are configured to be releasably mated , as will be described in further detail below . the plug 102 and receptacle 104 are mechanically coupled by the use of a coupling ring 108 carried by the receptacle 104 . the plug 102 includes a plug housing 110 having an outer surface 111 . the outer surface 111 has bayonet slots 112 ( two additional bayonet slots are equally radially spaced , but not shown , on the housing 110 ) disposed thereupon for receiving corresponding bayonet pins 113 ( fig1 ) disposed within the coupling ring 108 as would be appreciated by one of ordinary skill in the art . in this exemplary embodiment , the housing 110 has three radially disposed bayonet slots 112 and corresponding bayonet pins 113 , however , other embodiments may use one or more bayonet slots 112 and corresponding bayonet pins 113 to secure the plug 102 and receptacle 104 . the plug 102 is drawn axially into fully mated engagement with the receptacle 104 as shown in fig2 by engagement between the bayonet pins 113 of the coupling ring 108 and the bayonet slots 112 of the plug 102 as the coupling ring 108 is rotated . in other embodiments , other locking and / or camming mechanisms may be used in place of the coupling ring 108 and bayonet slots 112 to secure and / or assist in the mating of the plug 102 and receptacle 104 . the non - conductive components of the electrical connector may be molded from any thermoplastic or similar material as would be appreciated by one of ordinary skill in the art . additionally , any conductive component may be formed from any conductive material as would be appreciated by one of ordinary skill in the art . fig3 and 4 show plug 102 in greater detail . the plug 102 includes a plug housing 110 , a plug housing shell 114 , a flexible cable connector 116 , and at least one plug contact sub - assembly 144 . the plug housing shell 114 includes a first plug housing shell portion 114 a and a second plug housing shell portion 114 b . the second plug housing shell portion 114 b includes posts 120 and the first plug housing shell portion 114 a includes corresponding openings ( not shown ) for securing the second plug housing shell portion 114 b to the first plug housing shell portion 114 a . in alternative embodiments , the first plug housing shell portion 114 a and the second plug housing shell portion 114 b may be provided with any corresponding combinations of tabs , slots , pins , screws , openings or other similar fasteners to secure the first plug housing shell portion 114 a and the second plug housing shell portion 114 b together as would be appreciated by one of ordinary skill in the art . in another embodiment , the plug housing shell 114 may be a single molded structure . the plug housing shell 114 further includes an outer surface 122 and an inner surface 124 . the plug housing shell 114 also includes a front engaging portion 126 having tabs 128 disposed thereupon ( a similar tab 128 is present but not shown on the opposite side of the plug housing shell 114 ). the tabs 128 engage corresponding slots 130 ( a similar slot 130 is present but not shown on the opposite side of the plug housing 110 ) in the plug housing 110 to secure the plug shell housing 114 to the plug housing 110 . in alternative embodiments , the plug housing shell 114 and the plug housing 110 may be provided with any corresponding combinations of tabs , slots , pins , openings or other similar fasteners to secure the plug housing 110 and the plug housing shell 114 together as would be appreciated by one of ordinary skill in the art . furthermore , in other embodiments , the engaging portion 126 may be provided over the plug housing 110 instead of being received within the plug housing 110 as in the exemplary embodiment . the plug housing shell 114 further includes a rear opening 132 for receiving and securing flexible cable connector 116 . in this exemplary embodiment , the flexible cable connector 116 includes a generally circular groove 134 that is secured in the rear opening 132 when the first shell portion 114 a and the second shell portion 114 b are assembled to each other . the flexible cable connector 116 may be of any length , and may be terminated and / or connected to another electrical device or connection ( not shown ) as would be appreciated by one of ordinary skill in the art . in another embodiment , the flexible cable connector 116 and the plug housing shell 114 may be otherwise configured with clamps , pins , slots or other fasteners to secure the flexible cable 116 to the plug housing shell 114 . additionally , while the rear opening 132 and groove 134 are shown having a generally circular geometry , it should be appreciated by one of ordinary skill in the art that the rear opening 132 and groove 134 may have any shape , including , but not limited to square , rectangular , and oval . in addition , flexible cable connector 116 may include a keying feature 137 . in operation , a cable or wire having a plurality of conductors ( not shown ) would be provided through the flexible cable connector 116 and terminated to pads , traces , the plurality of contacts 150 ( fig3 ) and / or other termination features on a surface including a top surface , bottom surface and / or edge surface as would be appreciated by one of ordinary skill in the art . as can be further seen in fig3 and 4 , the plug housing 110 further includes a front plug housing surface 134 having contact assembly slots 136 therethrough , and a contact sub - assembly support structure 138 . a rear view of the plug housing 110 showing greater detail of the contact assembly support structure 138 is shown in fig5 . as can be seen in fig5 , the contact assembly support structure 138 includes guide rails 140 and slot supports 142 configured to receive and support plug contact sub - assemblies 144 . in this exemplary embodiment , the plug 102 contains four contact sub - assemblies 144 , and the contact assembly support structure 138 is configured with guide rails 140 and a slot support 142 to support each contact sub - assembly 144 . in another embodiment , the plug housing 110 may be provided with one or more slots 136 , with guide rails 140 and slot supports 142 to receive and support a corresponding number of slots 136 . in yet another embodiment , not all slots 136 , guide rails , and slot supports 142 may necessarily support a sub - assembly 144 , or in other words , be left open . in another embodiment , interior surfaces 115 of the plug housing 110 , including the front plug housing surface 134 and the contact assembly support structure 138 may be plated with an electrically shielding material . a plug contact sub - assembly 144 is shown in greater detail in fig6 and 7 . the plug contact sub - assembly 144 includes a plug sub - assembly base 146 , a plug contact support housing 148 , a plurality of plug contacts 150 , and a plug contact alignment spacer 152 . in this exemplary embodiment , the plurality of plug contacts 150 are a plurality of stitched contacts , however , in other embodiments of the invention described below , other contacts which may be used in the invention as described . the plug sub - assembly base 146 may be a printed circuit board . the plug contact support housing 148 includes a plurality of openings 154 and a plurality of micro - channels 156 for receiving and supporting the plurality of contacts 150 , respectively . the plurality of plug contacts 150 are further received through another plurality of openings 158 in the plug contact alignment spacer 152 prior to the plurality of plug contacts 150 being received through yet another plurality of openings 160 in the plug sub - assembly base 146 . the plug contact alignment spacer 152 serves as an alignment aid for receiving and retaining the plurality of plug contacts 150 in the plug sub - assembly base 146 . in another embodiment , the plug contact alignment spacer 152 may be formed by overmolding the plug contacts 150 to form a plug contact alignment spacer assembly ( not shown ) including the plurality of contacts 150 . after the plurality of plug contacts 150 are received through the plurality of openings in the plug sub - assembly base 146 , the plurality of plug contacts 150 are terminated to pads , traces or other conductive paths ( not shown ) of the plug sub - assembly base 146 . the conductive paths may be present on a top surface 162 , a bottom surface ( not shown ), and interior surface ( not shown ), an edge surface 164 , or any combination thereof of the plug sub - assembly base 146 . a plurality of conductors ( not shown ) provided to the plug 102 through the flexible cable connector 116 are correspondingly terminated to the conductive paths and / or plurality of contacts 150 as would be appreciated by one of ordinary skill in the art . fig8 and 8a show another exemplary plug contact sub - assembly 800 that may be used with the plug 102 . plug contact sub - assembly 800 includes a printed circuit board ( pcb ) 810 and an optional overmold 830 . the pcb includes a plurality of contacts 820 disposed on a top surface 825 . the plurality of contacts 820 are terminated to pads , traces or other conductive paths ( not shown ) of the pcb 810 . the conductive paths may be present on a top surface 825 , a bottom surface ( not shown ), and interior surface ( not shown ), an edge surface 812 , or any combination thereof . a plurality of conductors ( not shown ) provided to the plug 102 through the flexible cable connector 116 are correspondingly terminated to the conductive paths and / or plurality of contacts 820 as would be appreciated by one of ordinary skill in the art . the pcb 810 includes through holes 827 for receiving projections 828 of the overmold 830 to attach to the overmold 830 to the pcb 810 . overmold 830 protects the plurality of spring contacts 200 ( fig1 b ) from damage and wear during the mating and unmating of the plug 102 and the receptacle 104 . in order to use the plug contact sub - assembly , the plug housing 110 is modified by replacing the plug contact assembly support structure 138 ( fig5 ) with another plug contact assembly support structure 905 as shown in fig9 . as can be seen in fig9 , the plug contact assembly support structure 905 includes a plurality of support walls 910 and insertion slots 915 . support walls 910 include retention tabs 930 for supporting and securing plug contact sub - assembly 800 ( fig8 ). in another embodiment , the plug housing 110 may be provided with one or more insertion slots 915 and corresponding support walls 910 corresponding to the number of plug contact sub - assemblies 800 used . fig1 and 10a show yet another alternative plug contact sub - assembly 1000 . plug contact sub - assembly 1000 includes a support board 1010 and a flexible film contact assembly 1020 . flexible film contact assembly 1020 includes a first surface 1022 having a plurality of contacts 1040 disposed thereupon . the flexible film contact assembly 1020 also includes a second surface ( not shown ) opposite side surface 1022 . the flexible film contact assembly 1020 further includes a plurality of conductive traces ( not shown ) providing an electrical path between the plurality of contacts 1040 and a plurality of contact pads 1050 . the plurality of conductive traces may be disposed on the first surface 1022 , second surface , between the first surface and the second surface , or any combination thereof . the plug contact sub - assembly 1000 is formed by applying the flexible film contact assembly 1020 to the support board 1010 . the flexible film contact assembly 1020 may be applied to the support board 1010 by gluing or other known fastening methods . the plug contact sub - assembly 1000 is supported in the plug housing 110 by the plug contact assembly support structure 910 shown in fig9 . fig1 and 12 show receptacle 102 in greater detail . receptacle 102 includes a receptacle housing gasket 109 , a receptacle housing 162 , a coupling ring 108 , a receptacle housing shell 164 , a flexible cable connector 166 , and at least one receptacle contact sub - assembly 168 . the receptacle housing gasket 109 provides an environmental seal between the receptacle 104 and the plug 102 . the receptacle housing gasket 109 may be formed of any elastomeric material as would be appreciated by one of ordinary skill in the art . in another embodiment , when an electrical shield material is used as discussed below , the receptacle housing gasket may be formed by a conductive elastomeric material to provide both electrical conduction / emi protection and environmental seal , or may be formed of a compliant metal if an environmental seal is not required . in addition , in an another embodiment when the receptacle shell 164 and / or the receptacle housing 162 is provided with a plated electrical shield coating ( not shown ) as discussed in the additional embodiments discussed below , the plug housing gasket 109 can provide an electrical pathway between the receptacle shielding and the plug shielding . the receptacle housing shell 164 includes a first receptacle housing shell portion 164 a and a second receptacle housing shell portion 164 b . the second receptacle housing shell portion 164 b includes tabs 170 and openings 172 and the first receptacle housing shell portion 164 a includes corresponding slots ( not shown ) and pins ( not shown ) for securing the second receptacle housing shell portion 164 b and the first receptacle housing shell portion 164 a together . in alternative embodiments , the first receptacle housing shell portion 164 a and the second receptacle housing shell portion 164 b may be provided with any corresponding combinations of tabs , slots , pins , screws , openings or other similar fasteners to secure the first receptacle housing shell portion 164 a and the second receptacle housing shell portion 164 b together as would be appreciated by one of ordinary skill in the art . in another embodiment , the receptacle housing shell 164 may be a single structure . the receptacle housing shell 164 further includes an outer surface 174 and an inner surface 176 . receptacle contact sub - assembly support surfaces 177 are disposed on the inner surface 176 . the receptacle housing shell 164 also includes a front engaging portion 178 having tabs 180 disposed thereupon ( a similar tab 180 is present but not shown on the opposite side of the receptacle housing shell 164 ). the tabs 180 engage corresponding slots 182 ( a similar slot 182 is present but not shown on the opposite side of the receptacle housing 162 ) in the receptacle housing 162 to secure the receptacle shell housing 164 to the receptacle housing 162 . in alternative embodiments , the receptacle housing shell 164 and the receptacle housing 162 may be provided with any corresponding combinations of tabs , slots , pins , openings or other similar fasteners to secure the receptacle housing 162 and the receptacle shell housing 164 together as would be appreciated by one of ordinary skill in the art . furthermore , in other embodiments , the engaging portion 178 may be provided over the receptacle housing 162 instead of being received within the receptacle housing 162 as in the exemplary embodiment . the receptacle housing shell 164 further includes a rear opening 184 for receiving and securing flexible cable connector 166 . in this exemplary embodiment , flexible cable connector 166 includes a generally circular groove 186 that is secured in the rear opening 184 when the first receptacle housing shell portion 164 a and the second receptacle housing shell portion 164 b are assembled to each other . in other embodiments , the flexible cable connector 166 and the plug housing shell 164 may be otherwise configured with clamps , pins , slots or other fasteners to secure the flexible cable connector 166 to the receptacle housing shell 164 . additionally , while the rear opening 184 and groove 186 are shown having a generally circular geometry , it should be appreciated by one of ordinary skill in the art that the rear opening 184 and groove 186 may have any shape , including , but not limited to square , rectangular , and oval . in another embodiment , groove 186 may contain a keying feature ( not shown ), with the rear opening 184 having a corresponding mating keying feature ( not shown ). in operation , a cable or wire having a plurality of conductors ( not shown ) would be provided through the flexible cable connector 166 and terminated to the plurality of spring contacts 200 ( fig1 a ) and / or other termination features as described below . as can be further seen in fig1 and 12 , the receptacle housing 162 further includes a front receptacle housing surface 190 having spring contact assembly slots 192 therethrough . a rear view of the receptacle housing 162 showing the spring contact assembly slots 192 is shown in fig1 . as can be seen in fig1 , the spring contact assembly support slots 192 includes guide rails 194 configured to receive and support a spring contact sub - assembly 168 . in this exemplary embodiment , the receptacle 102 includes four spring contact sub - assemblies 188 . in another embodiment , the receptacle housing 162 may be provided with one or more slots 192 to receive and support a corresponding number of spring contact sub - assemblies 168 . in yet another embodiment , not all slots 192 may necessarily support a spring contact sub - assembly 168 , or in other words , be left open . a spring contact sub - assembly 168 is shown in greater detail in fig1 a , 14 b and 14 c . the spring contact sub - assembly 168 includes a sub - assembly base 196 , a contact support housing 198 , a plurality of spring contacts 200 , and a contact alignment spacer 202 . the spring contact sub - assembly 168 may include an optional spring contact assembler 204 . the sub - assembly base 196 includes a top surface 212 , a bottom surface ( not shown ), and an edge surface 216 . in another embodiment , the spring contact assembler 204 may also be overmolded with the plurality of spring contacts 200 . the contact support housing 198 includes a retaining surface 206 ( fig1 d ) for receiving and supporting the plurality of spring contacts 200 in a preloaded configuration . the retaining surface 206 forces the plurality of spring contacts 200 open beyond the spring contacts natural free state but not to the total amount of travel when mated with the corresponding plurality of plug contacts 150 . the plurality of spring contacts 200 are further received through a plurality of openings 208 in the contact alignment spacer 202 prior to the plurality of spring contacts 200 being received through yet another plurality of openings 210 in the sub - assembly base 196 . the contact alignment spacer 202 serves as an alignment aid for receiving the plurality of spring contacts 200 in the sub - assembly base 196 . after the plurality of spring contacts 200 are received through the plurality of openings 210 in the sub - assembly base 196 , the plurality of spring contacts 200 are terminated to traces , contact pads , conductive paths ( not shown ), and / or any combination thereof provided on the top surface 212 , bottom surface ( not shown ) and / or edge surface 216 and / or any combination thereof of the sub - assembly base 196 . a plurality of conductors ( not shown ), provided to the receptacle 104 through flexible cable connector 166 , would correspondingly be terminated to the traces , contact pads , conductive paths , the plurality of spring contacts 200 or any combination thereof as would be appreciated by one of ordinary skill in the art . fig1 d shows an enlarged view of a portion of fig1 c including a contact 150 inserted therein . as can be seen in fig1 d , the spring contact 200 has been expanded by receiving contact 150 so as to disengage the spring contact 200 from the retaining surface 206 , thereby assuring a positive electrical connection between the contact 150 and spring contact 200 . a cross sectional view 4 - 4 of the mated connector 100 of fig1 taken along line 15 - 15 is shown in fig1 . as can be seen in fig1 , when the plug 102 and receptacle 104 are mated , contacts 150 are mated to corresponding spring contacts 200 . while the invention has been described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims .	7
hereunder , embodiments of the present invention will be described with reference to the accompanying drawings . fig1 is a perspective view inside a vehicle including a curtain airbag device according to an embodiment ; fig2 and 3 are cross - sectional views taken along lines 2 - 2 and 3 - 3 , respectively , in fig1 ; fig4 is a perspective view around a connection between an inflator and airbags ; fig5 is a perspective view inside the vehicle when the airbags are inflated ; and fig6 and 7 are cross - sectional views taken along lines 6 - 6 and 7 - 7 in fig5 , respectively . in the description below , front and back correspond to front and rear of a vehicle . with reference to fig1 , a vehicle including a curtain airbag device has an a pillar 2 ; a b pillar 3 serving as a center pillar ; a c pillar 4 ; a roof side rail 5 ; and the like . a b pillar garnish 6 is attached to the b pillar 3 . a roof lining 7 is provided along a roof of the vehicle . as shown in fig1 to 3 , the curtain airbag device includes a curtain airbag 10 folded in a slender shape ; a guide airbag 20 disposed along the folded curtain airbag 10 ; an inflator 30 for inflating the airbags 10 and 20 ; and a gas - distributing unit 40 . the curtain airbag 10 extends from an upper portion of the a pillar 2 to that of the c pillar 4 via the roof side rail 5 . a plurality of tabs 11 protrudes upwardly from an upper hem of the curtain airbag 10 with a predetermined spacing therebetween . the tabs 11 are fixed to the roof side rail 5 by fastenings 8 such as bolts and rivets . a gas inlet 12 extends from a rear portion of the curtain airbag 10 , and is connected to a first gas outlet 41 of the gas - distributing unit 40 . a size of the inflated curtain airbag 10 is large enough to cover substantially an entire window opening of a side door ranging from the vicinity of the a pillar 2 to the vicinity of the c pillar 4 . as shown in fig3 , the folded curtain airbag 10 is disposed above the b pillar garnish 6 . when the folded curtain airbag 10 is projected downwardly , at least a part of the folded curtain airbag 10 is disposed closer to the b pillar 3 than an end 6 a of the b pillar garnish 6 facing the cabin . the guide airbag 20 extends from a front end to a rear end of the curtain airbag 10 . the guide airbag 20 expands only along the vicinity of the upper hem of the inflated curtain airbag 10 , and a volume thereof is smaller than that of the curtain airbag 10 . a plurality of tabs 21 protrudes from the upper hem of the guide airbag 20 with a predetermined spacing therebetween so as to overlap the tabs 11 of the curtain airbag 10 . the tabs 21 are fixed to the roof side rail 5 by the fastenings 8 together with the tabs 11 . a gas inlet 22 extends toward a rear side from a rear portion of the guide airbag 20 , and is connected to a second gas outlet 42 of the gas - distributing unit 40 . the guide airbag 20 is folded so as to form a slender strip , disposed along the folded curtain airbag 10 , and integrated with the folded curtain airbag 10 by binding tools such as tapes ( not shown ). the binding tools can easily be torn when the airbags 10 and 20 are inflated . as shown in fig2 , the front and rear portions of the strip - shaped guide airbag 20 are disposed so as to cover a top and a side of the folded curtain airbag 10 facing the cabin . as shown in fig3 , a portion of the folded guide airbag 20 substantially in the middle position in a front - back direction of the vehicle body is disposed between the folded curtain airbag 10 and the roof side rail 5 . the middle position in the front - back direction of the vehicle body substantially corresponds to the upper area of the b pillar 3 . as shown in fig2 and 3 , the folded airbags 10 and 20 are covered with the roof lining 7 . the gas - distributing unit 40 includes the gas outlets 41 and 42 at the front side , and a gas outlet 43 at the rear side . the gas outlet 43 is connected to the inflator 30 via an adaptor 31 . the gas inlet 12 of the curtain airbag 10 and the gas inlet 22 of the guide airbag 20 are fitted onto the gas outlets 41 and 42 , respectively , and tied by bands 45 and 46 . the gas - distributing unit 40 and the inflator 30 are fixed to the c pillar 4 . an operation of the curtain airbag device 1 having the above - described structure will be described next . when the vehicle is involved in , for example , a side - on collision or rollover , the inflator 30 blows gas out so as to supply the gas to the airbags 10 and 20 , and the airbags 10 and 20 start expanding . since the guide airbag 20 is smaller than the curtain airbag 10 , the guide airbag 20 finishes expanding faster than the curtain airbag 10 , and changes the position or regulates the expanding direction of the curtain airbag 10 . in the upper areas of the front door and the rear door , the guide airbag 20 is inflated between the curtain airbag 10 and the roof lining 7 . as a result , the roof lining 7 is pushed open , and the curtain airbag 10 expands downwardly with the guide airbag 20 . in the upper area of the b pillar 3 , the guide airbag 20 expands between the curtain airbag 10 and the roof side rail 5 so as to push the roof lining 7 open and displace the curtain airbag 10 toward the cabin over the upper area of the end 6 a of the b pillar garnish 6 facing the cabin . as a result , as shown in fig7 , the curtain airbag 10 expands downwardly along the b pillar garnish 6 without interference of the b pillar garnish 6 . in this manner , the entire curtain airbag 10 expands downwardly smoothly . in the upper area of the b pillar garnish 6 , the guide airbag 20 may have a structure that expands both under the curtain airbag 10 and adjacent to the roof side rail 5 . in this embodiment , the airbags 10 and 20 are inflated by a common inflator 30 , thereby reducing cost and weight . another embodiment will be described with reference to fig8 and 9 . in this embodiment , a guide airbag 20 a is disposed only above the b pillar garnish 6 . a tab 21 a of the guide airbag 20 a extends between the folded curtain airbag 10 and the roof side rail 5 . a gas inlet of the guide airbag 20 a extends toward the rear side and is connected to the gas - distributing unit 40 ( not shown in fig8 and 9 ). structures other than these components are the same as in the above - described embodiment . in this embodiment , when the inflator starts operating , the guide airbag 20 a finishes expanding faster than the curtain airbag 10 . in the upper area of the b pillar garnish 6 , the guide airbag 20 a expands under the curtain airbag 10 . therefore , the curtain airbag 10 is pushed by the guide airbag 20 a so as to move toward the cabin over the end 6 a of the b pillar garnish 6 facing the cabin , and thus expands downwardly smoothly without the interference of the b pillar garnish 6 . in the embodiment shown in fig8 and 9 , the guide airbag 20 a is disposed only above the b pillar garnish 6 . the guide airbag may be disposed so as to cover the top and the side facing the cabin of the curtain airbag 10 in the upper areas of the front door and the rear door as shown in fig1 . in the embodiment shown in fig8 and 9 , the guide airbag 20 a expands under the curtain airbag 10 . the guide airbag may expand adjacent to the roof side rail 5 , or expand both under the curtain airbag and adjacent to the roof side rail 5 . in the above - described embodiments , the curtain airbag 10 is displaced toward the cabin over the b pillar garnish 6 in the upper area of the b pillar garnish 6 . to do so , a diameter d of the inflated guide airbag 20 or 20 a above the b pillar garnish 6 is desirably larger than a width w 1 of the b pillar garnish 6 in the left - right direction of the vehicle body . when the diameter d is larger than a width w 2 defined by projecting the width w 1 in a direction perpendicular to the side surface of the roof side rail 5 facing the cabin , the interference between the curtain airbag 10 and the b pillar garnish 6 is reliably prevented . a conventional jump base is not required in any of the above - described embodiments , and the common curtain airbag device can be attached to a vehicle regardless of a size thereof or a size and a shape of the b pillar garnish . fig1 is a perspective view inside a vehicle including a curtain airbag device 1 a according to a further embodiment . in the curtain airbag device 1 a , the folded curtain airbag 10 extends from the upper portion of the a pillar 2 to that of the c pillar 4 along the roof side rail 5 . in addition , the guide airbag 20 folded so as to form a strip shape extends from the front end to the rear end of the folded curtain airbag 10 . in this embodiment , the plurality of tabs 11 and 21 protrudes from the upper hems of the curtain airbag 10 and the guide airbag 20 , respectively , with a spacing therebetween in the front - back direction of the vehicle body . the tabs 11 and 21 are fixed together to the roof side rail 5 by the fastenings 8 such as bolts and rivets . in this embodiment , the tabs 11 and 21 are not provided at the upper hems of the curtain airbag 10 and the guide airbag 20 substantially in the middle position in the front - back direction of the vehicle body . thus , the curtain airbag 10 and the guide airbag 20 are not connected to the roof side rail 5 substantially in the middle position in the front - back direction of the vehicle body . the middle position in the front - back direction of the vehicle body substantially corresponds to the upper area of the b pillar 3 . in this embodiment , the front and rear portions of the guide airbag 20 are disposed so as to cover the top and the side facing the cabin of the folded curtain airbag 10 , and the portion in the upper area of the b pillar 3 is disposed between the folded curtain airbag 10 and the roof side rail 5 . the guide airbag 20 may be disposed under the folded curtain airbag 10 . moreover , the guide airbag 20 may be disposed between the folded curtain airbag 10 and the roof side rail 5 , and under the folded curtain airbag 10 . structures other than the curtain airbag device 1 a are the same as in the above - described curtain airbag device 1 shown in fig1 to 7 , and components having the same reference numerals or symbols correspond to the same components . when the curtain airbag device 1 a having the above - described structure is shipped from a manufacturing facility , the folded guide airbag 20 and the folded curtain airbag 10 are integrated together by the binding tools such as tapes in advance . first , the folded guide airbag 20 is disposed so as to cover the top and the side facing the cabin over the entire length , when the folded curtain airbag 10 is attached to the vehicle body . the front ends and the rear ends of both airbags are integrated together by the binding tools such as tapes . next , the middle portion of the guide airbag 20 is twisted so as to be disposed along a side adjacent to the roof side rail , when the folded curtain airbag 10 is attached to the vehicle body . the middle portions of both airbags are integrated together by the binding tools such as tapes . when the integrated structure of the folded guide airbag 20 and the folded curtain airbag 10 are attached to the vehicle body , the integrated structure is disposed along the roof side rail 5 , and the front and rear ends thereof are fixed to the roof side rail 5 by the fastenings 8 via the tabs 11 and 21 . in this manner , according to this embodiment , the curtain airbag 10 and the guide airbag 20 can be easily attached to the roof side rail 5 only by fixing the front ends and the rear ends of both airbags . according , to the curtain airbag device 1 a , the middle portions of the curtain airbag 10 and the guide airbag 20 in the front - back direction of the vehicle body are not connected to the roof side rail 5 . therefore , the middle portion of the guide airbag 20 in the front - back direction of the vehicle body may be tucked between the folded curtain airbag 10 and the roof side rail 5 after fixing the front ends and the rear ends of the curtain airbag 10 and the guide airbag 20 . according to the curtain airbag device 1 a , the curtain airbag 10 is not connected to the roof side rail 5 in the upper area of the b pillar 3 . accordingly , when the guide airbag 20 is inflated between the curtain airbag 10 and the roof side rail 5 , the curtain airbag 10 is pushed by the guide airbag 20 and moves smoothly and quickly toward the cabin . as a result , the interference of the b pillar garnish 6 with the curtain airbag 10 is reliably prevented . the above - described embodiments are merely examples for carrying out the present invention , and embodiments other than those shown in the drawings are permissible within the scope of the present invention . for example , the curtain airbag and the guide airbag may be inflated by separate inflators . moreover , the inflator may be disposed at a predetermined position of the roof side rail or on the a pillar . in the present invention , the center pillar refers to a pillar disposed between a front pillar at the forefront in the front - back direction of the vehicle body and a rear pillar at the rearmost position . in the above - described embodiments , the vehicle body includes three pillars , the a pillar , the b pillar , and the c pillar , from the front to the rear , and only the b pillar corresponds to the center pillar . when a vehicle body includes four pillars , an a pillar , a b pillar , a c pillar , and a d pillar , the b pillar and the c pillar correspond to the center pillars . the disclosure of japanese patent application no . 2004 - 273613 , filed on sep . 21 , 2004 , is incorporated in the application . while the invention has been explained with reference to the specific embodiments of the invention , the explanation is illustrative and the invention is limited only by the appended claims .	1
the present invention uses ink jet printing technology to dispense a variety of compositions including , but not limited to , fluids containing vitamins , minerals , or fluoride for use in connection with water treatment systems , liquid cosmetics such as lipstick , lip gloss , eyeliner , and blush ; fragrances ; personal care products such as lotions , creams , moisturizers , and sunscreens ; and home care products such as multi - purpose cleaners and air fresheners . the ink jet head may use a magneto - restrictive alloy , thermal , solenoid , or piezoelectric technology . for purposes of illustrating the present invention in detail , an exemplary piezoelectric system for custom formulating liquid foundation will be described . piezoelectric technology uses piezo crystals which receive a tiny electric charge causing the crystals to vibrate . at one instance , the crystal pulls back to allow fluid into the reservoir . at another instance , the crystal fires back into its original position exerting a mechanical pressure on the fluid which forces a tiny amount of fluid out of the nozzle . the typical ink jet head forces out small droplets of fluid , generally between 50 to 60 microns in diameter . now referring to fig1 a perspective view of one embodiment of the multi - chambered dispenser 2 is shown . the dispenser 2 has a cap 4 and a power button 6 . fig2 shows the back view of the dispenser . the dispenser has a device or control panel 8 for specifying a shade of liquid cosmetic . the control panel 8 may include several buttons that function to increase or decrease the amount of liquid that is dispensed from the cartridges 14 a - 14 d . a removable cover or door 10 may partially or wholly cover the control panel 8 . fig3 shows the bottom view of the dispenser 2 showing a dispensing port 12 . referring to fig4 the multi - chambered dispenser 2 houses four cartridges 14 a , 14 b , 14 c , 14 d that contain a different color of liquid foundation . each cartridge 14 a - 14 d may hold about 1 ml to about 15 ml of liquid foundation . the cartridges 14 a - 14 d are pressurized so the liquid foundation contained therein can easily pass out of the cartridges 14 a - 14 d and into its corresponding flow path 16 shown in fig5 . [ 0019 ] fig5 is a schematic drawing of a piezoelectric system showing only one cartridge 14 a and corresponding flow path 16 and a piezoelectric ink jet head 40 . although the four cartridges 14 a - 14 d in fig4 are not shown , this schematic drawing generally applies to each cartridge 14 a - 14 d . each flow path 16 empties into a corresponding chamber 42 . the cartridges 14 a may also include a plunger 20 for assisting in dispensing liquid from the cartridge to the flow path 16 . preferably , pressurized gas is disposed in a compartment 18 behind the plunger 20 to apply a force to the plunger 20 . in some applications , the pressurized gas can be replaced by a spring or other conventional biasing mechanism . alternatively , the cartridge 14 a may use capillary action to move the liquid foundation into the ink jet head 40 . the cartridge receiving end 22 of the flow path 16 may include a rod shaped plug 24 that breaks the cartridge seal when the cartridge 14 a is coupled to the receiving end 22 of the flow path 16 as well as an o - ring 26 . o - ring 26 surrounds the outside of the cartridge to prevent the liquid from leaking out around the edge of the cartridge 14 a . the seal may be a spring - loaded ball 28 as shown in fig5 a conventional foil seal , or natural surface tension . the cartridge 14 a may be threaded or otherwise coupled to the receiving end 22 of the flow path 16 . in another embodiment of the present invention , one cartridge 14 a may feed into multiple ink jet heads 40 . for example , each cartridge 14 a - 14 d might have three flow paths 16 , each leading into a separate ink jet head 40 ( not shown ). these multiple ink jet heads 40 are configured such that the colors of the liquid foundation are interlaced . because ink jet print heads dispense extremely small dots of color onto a printing surface , typically between 50 and 60 microns in diameter ( which is smaller than the diameter of a human hair ), dispersal of interlaced colors of foundation in the palm of a user &# 39 ; s hand will provide a more blended appearance than a non - interlaced pattern . an example of an interlaced pattern is illustrated below : in yet another embodiment , the orifice 46 of each ink jet head is angled such that each foundation color collides with another color upon dispersal out of the orifice 46 ( not shown ). in still yet another embodiment , the orifice 46 of ink jet head 40 is fluidly connected to a corresponding exit flow path . each exit flow path merges into a single mixing chamber allowing the colors to be mixed before exiting the dispensing port 6 ( not shown ). it will be apparent to those skilled in the art that depending on the type of composition dispensed from the present device , the number of cartridges will vary to satisfy the various shade , nutrients , sunscreen , or fragrances desired for that liquid composition . for example , if a dispenser for customized levels of sunscreen protection is manufactured , there may be a cartridge for the uva / uvb protectant composition and a cartridges for the other ingredients . the dispersal of uva / uvb would differ for each level of sunscreen a user desires . another example is water treatment systems having the present invention to add desired vitamins and minerals . a separate cartridge may exist for the various vitamins and minerals so a user can choose a desired formula for the water he / she obtains from the water treatment system . for liquid foundation , the colors that are necessary to achieve the array of shades to match various skin tones are red , white , yellow , and black . preferred ratios of the red , white , yellow , and black foundation pre - mixes for exemplary shades are as follows . all percentages are by total weight unless otherwise indicated . table 2 white pre - mix ( water in cyclomethicone ) in the oil phase cyclomethicone 11 . 75 cyclomethicone ( and ) 10 . 00 dimethicone copolyol sorbitan trioleate 0 . 20 tocopheryl acetate 0 . 25 acrylates copolymer 10 . 00 ( and ) cyclomethicone colorant section iron oxides , titanium dioxide ( and ) 10 . 00 magnesium myristate active ingredient zinc oxide ( and ) 3 . 0 dimethicone , hydrophobic ultra fine phenylbenzimidazole 3 . 00 sulfonic acid triethanolamine 1 . 93 methylparaben 0 . 20 propylparaben 0 . 06 glycerin , 96 % 2 . 00 green tea extract in 1 . 00 butylene glycol lactobacillus / acerola cherry 1 . 00 ferment alpha - glucan 2 . 00 oligosaccharide peg - 150 / decyl 1 . 00 alcohol / smdi copolymer in propylene glycol and water benzyl alcohol 1 . 00 in the water phase water , purified 41 . 61 total 100 % red pre - mix ( suspension ) di water 79 . 60 % gellan gum ( kelco gel ) ( monsanto ) 0 . 20 red iron oxide ( rnd - dc00 ) 20 . 00 49 . 1 % solids ( sun chemical ) diazolidinyl urea ( and ) iodopropynyl 0 . 20 butylcarbamate total 100 % yellow pre - mix ( water in oil emulsion ) in the water phase purified water 49 . 10 % sodium chloride 0 . 50 disodium edta 0 . 20 diazolidinyl urea and iodopropynyl 0 . 20 butylcarbamate colorant section yellow i . o ./ isononyl isononanoate / 14 . 81 isopropyl titanium triisostearate ( kobo ) in the oil phase peg - 30 dipolyhydroxystearate 3 . 00 polyglyceryl - 2 triisostearate 2 . 00 isononyl isononanoate 30 . 19 total 100 % black pre - mix ( oil in water emulsion ) in the water phase di water 66 . 73 % disodium edta 0 . 15 glycereth - 26 3 . 00 xanthan gum 0 . 15 in the oil phase capric / caprylic triglycerides 5 . 10 isononyl isononaoate 5 . 10 polyglyceryl - 2 triisostearate 1 . 82 polysorbate 60 1 . 75 colorant iron oxide and isononyl isononanoate and 16 . 00 titanium triisostearate ( kobo ) diazolidinyl urea and 0 . 20 iodopropynyl butylcarbamate total 100 % for the typical foundation in the medium range of shades , the most dominant color is white . although it takes white , yellow , red and black to permit the system to make all shades , most shades are predominantly white . if four cartridges of equal volume containing foundations of white , yellow , red and black were used to formulate the most common shades , white would be depleted very rapidly with black far outlasting the other colors . to account for this , a manufacturer may premix white with the other colors in an inverse ratio to frequency of use . for example , white would be 100 % white , yellow would be approximately 50 % white and 50 % yellow , red would be 35 % red and 65 % white , and black would be 20 % black and 80 % white . in this way , a fairly even use up rate can be achieved for all colors . still referring to fig5 when a user of the present invention uses the control panel 8 to input a formula comprising a ratio of each foundation from the cartridge , the formula is received by a microprocessor (“ cpu ”) 30 . the cpu 30 processes the inputted information and controls the amount of power generated from the power source 32 in activating the ink jet head 40 . fluid in the chamber 42 of the ink jet head 40 is subsequently dispelled by a change in the momentum of a momentum transferring device such as a piezo crystal 44 which is opposite the orifice 46 of the ink jet head 40 . this abrupt change in momentum is conferred to the static liquid within the chamber 42 causing it to assume this momentum and propel from the orifice 46 . a typical orifice of an ink jet head is about 0 . 002 inches in diameter . the orifice 46 of an ink jet head for dispensing liquid foundation is preferably about 0 . 007 inches to about 0 . 008 inches in diameter . further , due to the rheology of liquid foundation , it is preferable to incorporate more than one momentum transferring device to assist in propelling fluid out of the chamber 42 . the size of the orifice 46 and the use of multiple momentum transferring devices are distinctions in the present invention from conventional ink jet technology . this momentum can be conferred by a thermal system , solenoid actuator , piezo crystal or magneto - restrictive alloy . any combination of the aforementioned momentum transferring devices can be employed in the present invention . [ 0026 ] fig5 is a piezoelectric ink jet head 40 for the present invention and uses a piezo crystal 44 . the ink jet head 40 includes a piezo crystal 44 that reacts to an electrical impulse communicated through the cpu 30 by the power source 32 . when the piezo crystal 44 receives the electrical impulse , the impulse reconfigures the piezo crystal 44 . the continual reconfiguration results in the piezo crystal 44 oscillating up and down . the piezo crystal 44 may oscillate at about 2 , 000 hertz via electrical impulse from the power source 32 . the liquid foundation enters the ink jet head through a one way path on the uppermost layer of the piezo crystal 44 . a flexible film 48 may be provided near the entry of the chamber 42 of the ink jet head 40 to assist in controlling the flow of liquid foundation through the flow path 16 and chamber 42 until it reaches the orifice 46 . the force of the piezo crystal 44 while oscillating in a downward direction assists in transferring the liquid foundation out the orifice 46 of the ink jet head 40 . the piezo crystal 44 in this embodiment acts as the momentum transferring device . because the fluid is not being actively pumped from a nozzle , measuring the quantity of dispensed fluid is preferably not achieved by using a flow meter . rather , in a preferred embodiment , metering relies on a calculation of the volume of the chamber 42 in relation to the number of times it is struck by the momentum transferring device . some work may go into making sure that liquids of varying rheology consistently dispense with a fixed volume . once this volume is known , one can achieve a desired ratio of liquids simply by controlling the oscillations of the momentum transferring device . in a preferred embodiment , the liquid foundation dispenses from the orifice 46 in the form of spherical droplets of finite volume . in a preferred embodiment , there are approximately 50 , 000 drops that total approximately 0 . 1 ml for each cycle or for each time a user activates the dispenser . exemplary drops for each pre - mix foundation and volume of premix per drop for sample colors are shown in table 3 . this table represents values achieved in a preferred embodiment . droplet size may vary from application to application depending on the characteristics of the ink jet head ( e . g . ink jet orifice diameter ) and the dispensed liquid ( e . g . rheology and viscosity ). the values in table 3 are achieved by an enlarged ink jet having an orifice diameter of about 0 . 007 to about 0 . 008 inches . other types of ink jet head systems may be employed for the present invention . fig6 shows a single solenoid ink jet head 40 b . in this embodiment , the momentum transferring device is a solenoid actuator 44 b . the electrical impulse from the power source 32 activates a coil 50 that generates a magnetic field , causing the solenoid actuator 44 b to draw into the coil 50 . a flexible film 48 b may be provided near the entry of the chamber 42 b of the ink jet head 40 b to assist in controlling the flow of liquid foundation through the flow path 16 b and the chamber 42 b until it reaches the orifice 46 b . when the solenoid actuator 44 b releases from the coil 50 , the solenoid actuator 44 b assists in forcing the liquid foundation out of the orifice 46 b . [ 0030 ] fig7 shows a dual valve solenoid - piezo embodiment of an ink jet head 40 c . in this embodiment , a piezoelectric ink jet head 40 is used in combination with a solenoid ink jet head 40 b . the liquid foundation flows into the solenoid ink jet head 40 b and then into the piezoelectric ink jet head 40 for final momentum out of the orifice 46 . similarly , other multi valve ink jet systems can be employed for the present invention . one with ordinary skill in the art will appreciate that any combination of thermal , piezo , solenoid , and magneto - restrictive alloy may be incorporated into the ink jet head . it is envisioned that the present invention is adapted to be connected to a stand alone or remote computer . formula information may be stored in the computer &# 39 ; s hardware , software , or a website set up for the current dispenser . it is also contemplated that the computer having the stored formula information may be a colorimeter or a spectrophotometer . the dispenser may have a plug - in for hooking the computer up to the dispenser , such as a usb port , serial port , parallel port or other communications port . in operation , the user might choose a shade using the computer which would then download the particular formula into a cpu in the dispenser for immediate dispensing of the desired shade . the computer may include a database of pre - created formula or may create the formula in real time through user interaction . the computer may also permit the user to directly enter a formula . the dispenser cpu may include software for converting formulae received from the computer into ink jet head instructions . alternatively , the computer may convert the formulae into ink jet head instructions that are transmitted to and executed by the dispenser cpu . additionally , it is envisioned that the present invention can be programmed by a personal data assistant using infrared technology whereby the user can input the desired formula into the personal data assistant and transmit that data through an infrared receiving port of the multi - chambered dispenser . while in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof , and many details have been set forth for the purpose of illustration , it will be apparent to those skilled in the art that the invention is susceptible to alteration and that certain other details described herein can vary considerably without departing from the basic principles of the invention .	0
fig1 schematically describes the process for detecting the type of the code ( benign or malicious ) of a file . a file ( 101 ) which can be anywhere on a network e . g . : router , computer . . . and which while being check and parsed ( 103 ) to generate a set of n - grams ( 105 ). each n - gram ( for example 107 ) will be submitted to a classifier algorithm ( 111 ) which will define according to a prior learning of n - grams describing malicious code ( mc ) and benign code ( bc ) from a set of learning files ( 113 ). the answer ( 115 ) of the classifier is “ malicious code ” ( m ) or “ benign code ” ( b ) for the n - gram or a set of n - grams . if at least one n - gram is detected as mc the file is considered as a malicious file . a data set of malicious and benign executables for the microsoft windows operating system was build , as this is the system most commonly used and most commonly attacked . this collection is assumed to be large . the malicious files were downloaded from the vx heaven website ( http :// ux . netlux . org ). after removing obfuscated and compressed files , 7690 malicious files were considered . table 1 shows the distribution of the benign codes and the malicious codes which are included in the global set ( including files which are used is the training set and in the test set ). each main class of malcodes is represented significantly by at last few hundreds of files like it is detailed in table 2 . to identify the files , the kaspersky anti - virus and the windows version of the unix ‘ file ’ command were used for file type identification . the files in the benign set , including executable and dll ( dynamic linked library ) files , were gathered from machines running microsoft windows xp operating system , which is considered currently like one of the most used . the benign set contained 22 , 735 files . the kaspersky anti - virus program ( http :// www . kaspersky . com ) has been used to verify that these files were completely virus - free . the addition of the malicious code set and the benign code set constituted very large files set . the files ( both benign and malicious ) were parsed using several n - gram lengths moving windows , denoted by n vocabularies of 16 , 777 , 216 , 1 , 084 , 793 , 035 , 1 , 575 , 804 , 954 and 1 , 936 , 342 , 220 , for 3 - gram , 4 - gram , 5 - gram and 6 - gram , respectively , were extracted . later tf and tfidf representation were calculated for each n - gram in each file . in ml applications , the large number of features ( many of which do not contribute to the accuracy and may even decrease it ) in many domains presents a complex problem . moreover , in the current innovation problem , the reduction of the amount of features is crucial , but must be performed while simultaneously maintaining a high level of accuracy . this is due to the fact that , as shown earlier , the vocabulary size may exceed billions of features , far more than can be processed by any feature selection tool within a reasonable period of time . additionally , it is important to identify those terms that appear in most of the files , in order to avoid zeroed representation vectors . thus , the top features based on the df measure ( equation 2 ) were extracted and the features which appear in most of the files ( those with high df scores ) were selected according the approach introduced in the next lines . based on the df measure , two sets were selected , the top 5 , 500 terms and the top 1 , 000 to 6 , 500 terms . later , three feature selection methods were applied to each of these two sets . a filters approach was used , according to which , the measure was independent of any classification algorithm to compare the performances of the different classification algorithms . in a filters approach , a measure is used to quantify the correlation of each feature to the class ( malicious or benign ) and estimate its expected contribution to the classification task . as a baseline , the document frequency measure df ( equation 2 ), gain ratio ( gr ) [ mitchell , 1997 ] and fisher score ( fs ) [ golub et al ., 1999 ] were used and allow selecting the top 50 , 100 , 200 and 300 results from each feature selection . for evaluation purposes some values were computed like the true positive rate ( tpr ) measure , which is the number of positive instances classified correctly , as shown in equation 3 , false positive rate ( fpr ), which is the number of negative instances misclassified ( equation 4 ), and the total accuracy , which measures the number of absolutely correctly classified instances , either positive or negative , divided by the entire number of instances shown in equation 5 . two validation experiments were conducted in the first step , wide and comprehensive set of evaluation runs was designed including all the combinations of the optional settings for each of the aspects , amounting in 1536 runs in a 5 - fold cross validation format for all 8 classifiers . the files in the test - set were not in the training - set presenting unknown files to the classifier . in the second step , the global feature selection and the n - grams approach were compared . fig2 presents the mean accuracy of the combinations of the term representations and n - grams . while the mean accuracies are quite similar , the top 5 , 500 features performed better , as did the tf representation and the 5 - gram . having the tf out - performing has meaningful computational advantages . additionally , the 5 - grams outperformed the others . while their mean accuracies were quite similar , the top 5 , 500 features out - performed the top 1000 - 6500 , in which the tf outperformed tfidf and the 5 - gram treatment level out - performed the other n - gram treatment levels . in the third step , the top feature selection was treated . fig3 presents the mean accuracy of the three feature selections and the four top selections . generally , the fisher score was the best method , starting with high accuracy , even with 50 features . unlike the others , in which the 300 features outperformed , the df &# 39 ; s accuracy decreased after the selection of more than 200 features , while the gr accuracy significantly increased as more features were added . the fisher score was very accurate when used with just 50 features , and maintained this high performance level as the number of features increased . when more than 200 features were added , the accuracy of gr increased significantly and the accuracy of df decreased . the last step of the first experiment was related to evaluation of features classification by few classifiers . table 3 presents the results of each classifier under the best conditions observed for all the classifiers ( averaged ), including the top 300 fisher score - selected 5 - gram terms represented by tf from the top 5500 features . the bdt , dt and ann outperform and have low false positive rates , while the svm classifiers also perform very well . the poor performance of the naïve bayes , may be explained by the independence assumption of the nb classifier . the second set of experiments has been related to the imbalance problem to learn classes for malcodes detection . in these experiments , the best configuration and the top 300 fisher score - selected 5 - gram terms represented by tf from the top 5500 features were used . five levels of malicious files percentage ( mfp ) in the training set ( 16 . 7 %, 33 . 4 , 50 , 66 . 7 and 83 . 4 %) were defined . for example , 16 . 7 % means that 16 . 7 % of the files in the training set were malicious and 83 . 4 % were benign . the improved test set represents the real - life situation , while the training set represents the set - up of the classifier , which is controlled . a mfp above 30 % ( of the total files ) is not a realistic proportion in real networks , but high rates in order to gain insights into the behavior of the classifiers in these situations were exanimate . 17 levels of mfp ( 5 %, 7 . 5 , 10 , 12 . 5 , 15 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 85 , 87 . 5 , 90 , 92 . 5 and 95 %) were computed and analyzed . all the product combinations of five training sets and 17 test sets were computed for a total of 85 runs for each classifier . two sets of data sets were built in order to perform a 2 - fold cross validation - like evaluation to make the results more significant . fig4 presents the mean accuracy ( for each mfp level in the test - sets ) of each classifier for each training mfp level . ann , bnb and dt had the most accurate , and relatively stable , performance across the different mfp levels , while bnb generally performed poorly ( table 3 ). svm - rbf and svm - lin performed well , but not consistently . they were both most accurate at the 50 % level , while the accuracy of svm increased as more malicious examples were presented . fig5 presents the mean accuracy ( across all the malcode percentage levels in the training sets ) of each classifier for each malcode content level in the test sets . these results show how the classifiers &# 39 ; mean behavior reacts to the mfp levels of the test - sets , representing more realistic situations . the outperforming classifiers are more stable than those shown in fig4 . this means that the methods proposed by the present invention classify correctly in any situation independent of the mfp ratio in the training set . however , nb and bdt were not very accurate when presented with low levels of malicious file content and the accuracy of svm - pol decreased as the malicious file content of the test set increased . ann , bnb and dt achieved about 93 % stable accuracy across all the levels of malcode content in the test set , as shown in fig5 . in the next step , the 10 % mfp level in the test set as a realistic scenario were considered . fig6 presents the mean accuracy in the 2 - fold cross validation of each classifier for each malcode content level in the training set , with a fixed level of 10 % mfp in the test set . accuracy levels above 95 % were achieved when the training set had a mfp of 16 . 7 %, while a rapid decrease in accuracy was observed when the mfp in the training set was increased . thus , the optimal proportion in a training set for practical purposes should be in the range of 10 % to 40 % malicious files . to further the previous elements , related to the mean accuracy from the training set point of view ( fig4 and 6 ) and that of the test set ( fig5 ), a detailed description of the accuracy for the mfp levels in the 2 sets in a 3 - dimensional representation for each type of classifier is presented by fig7 to 14 . fig7 illustrates the accuracy for the mfp level in the two sets for the artificial neural networks ( ann ) classifier . fig8 illustrates the accuracy for the mfp level in the two sets for the decision tree classifier . fig9 illustrates the accuracy for the mfp level in the two sets in for the naïve bayes classifier . fig1 illustrates the accuracy for the mfp level in the two sets for the boosted decision tree ( bdt ) classifier . fig1 illustrates the accuracy for the mfp level in the two sets for the boosted naives bayes ( bnb ) classifier . fig1 illustrates the accuracy for the mfp level in the two sets for the linear svm ( svm - lin ) classifier . fig1 illustrates the accuracy for the mfp level in the two sets for the polynomial svm ( svm - pol ) classifier . fig1 illustrates the accuracy for the mfp level in the two sets for the rbf svm ( svm - rbf ) classifier . most of the classifiers behaved optimally when the mfp levels in the training - set and test - set were similar , except for nb and bdt , which showed low performance levels earlier . this indicates that when configuring a classifier for a real - life application , the mfp in the training - set has to be set accordingly . the present invention allows the detection and the acquisition of unknown malicious code . it is based on concepts from ir and more specifically text categorization . in the malcode detection problem , binary files ( which could be executables ) are parsed and n - gram terms are extracted . each n - gram term in the malcode detection problem is analogous to words in the textual domain . according to the present innovation , the implementation of the current method can be used anywhere on a network to allow detection of unknown malicious code and to reduce the risk of dissemination of malicious files . the method proposed by the present invention is able to detect a high number of malicious code files after a learning process based on a real life ratio between malcode and benign files . although embodiments of the invention have been described by way of illustration , it will be understood that the invention may be carried out with many variations , modifications , and adaptations , without exceeding the scope of the claims .	6
fig1 depicts a wooden sling pallet 11 made in a manner similar to ordinary wooden lift truck pallets . the sling pallet 11 is made by arranging three pieces of nominal 4 by 4 inch ( nominal 10 . 2 by 10 . 2 cm ) lumber 12 arranged in parallel with two such pieces of lumber 12 positioned adjacent the periphery of the pallet 11 and one piece 12 extending along its center line . the upper and lower surfaces 13 , 14 of the pallet are formed of comparatively flat boards 16 extending transversely to the three pieces of lumber 12 . these boards 16 may be , for example , a nominal one inch ( 2 . 54 cm ) in thickness , and may be affixed by nails , screws , or other means to the upper and lower sides of the three pieces of lumber 12 . open - top channels 17 are formed in at least the upper surface of the pallet by adjusting the spacing between the boards 16 . the channels 17 should be of a width greater than that of the slings to be used , and the depth of the channels 17 should likewise be greater than the thickness of the slings such that the slings ( including the eye portion ) may be inserted therethrough when a stack of cartons is loaded onto the pallet 11 . of course , sling pallets may be made of any of a variety of materials , such as plastics , metals and fiberglass , and the manufacture of pallets using such materials is known in the art of pallet manufacturing . likewise , molding , stamping , welding , bonding , forming or other known methods may be used to make the sling pallet . the material and method used to make the pallet , however , is of less importance than the provision of channels therein which can receive slings . in use , slings 31 may be prepositioned in the channels 17 prior to loading a stack of cartons thereon , or may be drawn through the channels after loading of the pallet by means of a rod with a hooked end or the like . of course , it is also possible to use a standard pallet , to preposition slings on the pallet , and thereafter load the pallet with the cartons . however , the channels provide a convenient means for positioning the slings and provide the ability to add the slings either before or after loading of the pallet . fig2 depicts a wooden landing pad 21 according to the present invention . the landing pad 21 is formed from a bottom sheet 22 of plywood . blocks of nominal 4 by 4 inch ( nominal 10 . 2 by 10 . 2 cm ) lumber 23 are affixed to the bottom sheet 22 by means of nails , screws , adhesive or other means in a pattern which provides two channels 24 which extend from one edge of the bottom sheet 22 to an opposite edge thereof between the blocks 23 . as with the channels 17 of the sling pallet 11 , these channels 24 should be of sufficient width and depth to allow a sling 31 to be drawn therethrough . as the preferred load push lift truck of the present invention has three blades , a second set of channels 26 is provided to receive the blades of the lift truck . these channels 26 extend transversely between the blocks 23 , and are of a depth sufficient to receive the blades of the load push lift truck . as with the sling pallet 11 , the landing pad 21 may be made of materials other than wood , and by methods other than the use of nails , screws and the like . the important consideration in making a suitable landing pad is the provision of the channels as discussed above . load push , side shift lift trucks are known in the art of specialty lift trucks . such lift trucks are discussed , for example , in u . s . pat . no . 4 , 752 , 179 to seaberg discusses such a lift truck . a preferred lift truck according to the present invention would include three relatively flat blades ( platens ) which may conveniently have a width of 4 to 8 inches ( 10 . 2 to 20 . 3 cm ), and would include side shift capability . the blades would be smooth and preferably polished , and would have rounded edges . the load push system should be sufficiently powerful to push a full stack of cartons of frozen chicken parts or the like off of the blades and onto another stack of cartons . one preferred embodiment of the present method involves the transportation and stowage of the cartons of frozen products in the following manner . the preferred embodiment will be described with reference to cartons of frozen chicken parts . however , it is applicable to other frozen animal products stored in similar cartons . a standard lift truck is used to remove stacks of cartons 30 of frozen chicken parts stacked on sling pallets 11 from the cold storage warehouse . if slings 31 have not already been provided , hooked rods are used to draw the slings 31 through the channels 17 in the pallets 11 . the palletloads of cartons are then placed on a flatbed truck trailer 32 . once the trailer 32 is fully loaded , an insulating blanket 33 is used to cover the cartons 30 and is held in place by straps 34 which overlie the blanket 33 and are fastened to the frame of the trailer 32 . any of a variety of insulating blankets may be used . an r - 2 insulating quilted blanket made of two sheets of a quilted water - resistant nylon with 10 ounce polyester insulation therebetween should be sufficient for most applications . preferably , the nylon outer layers are of a light color to reflect sunlight . blankets of this type are offered by refrigiwear , inc . of dahlonega , ga . under the weatherguard mark , for example . once the blanket 33 and cartons 30 have been secured in place , the tractor - trailer 32 is then driven to the dock . at the dock , once the vessel is ready to receive the stacks of cartons 30 from the trailer 32 , the straps 34 and insulating blanket 33 are removed , and the ship &# 39 ; s gear 36 ( or a shore crane ) is used to lift the stacks off the sling pallets and into the hold . preferably , the blanket 33 is rolled up as the stacks of cartons 30 are lifted from the trailer by the ship &# 39 ; s gear 36 . the insulating blanket 33 is then returned to the warehouse for use on the next load . the ship &# 39 ; s gear 36 deposits the stack of cartons in the ship &# 39 ; s hold 37 on a landing pad 21 situated in the square of the hold . the square of the hold is the volume space extending vertically downward from the open hatch 38 . once the stack of cartons 30 has been deposited on the landing pad , the slings 31 are released from the ship &# 39 ; s gear 36 and are drawn through the channels 24 in the landing pad 21 to remove them from the stack of cartons . a load push lift truck is then used to lift the stack of cartons off the landing pad 21 and to transport the cartons to the storage location . at this stage , either of two approaches may be taken . the load push lift truck may initially deposit the cartons 30 in their final stowage locations , with a view to stevedores subsequently filling the remaining space atop the stack from a lift - truck - deposited stack nearby , or the lift truck may deposit the stack in a convenient location with a view to the stevedores breaking down the stack into two or more shorter stacks on top of which the load push lift truck may deposit a full stack of cartons 30 , the combined height of the hand - stacked and lift - truck - deposited cartons filling the available vertical space . in order to deposit a stack of cartons 30 on the floor of the cargo hold , the lift truck operator moves the stack into the desired position and lowers the blades of the lift truck to the floor . if necessary , the side shift can be used to position the stack in abutting relation with an adjacent stack or wall . the lift truck operator then simultaneously actuates the load push mechanism and either backs the lift truck away from the location or allows the load push mechanism to push the lift truck back from the stack ( assuming the front of the stack is engaged with another stack or with a wall ). the process for depositing a stack of cartons 30 on top of another partial or full stack is the same , except the lift truck positions the blades immediately above the full or partial stack on top of which the full stack is to be deposited . for stowage in irregular spaces , such as adjacent a sloping wall , in spaces too small for a full stack to be inserted or the like , the lift truck may deposit a full stack of cartons near such stowage location and the stevedores can stow the cartons in such areas by hand . when substantially all of the cargo hold has been filled , apart from the square of the hatch 38 , the lift truck and landing pad 21 are removed from the hold , and the square of the hatch is filled by depositing stacks of cartons directly into the square of the hatch using the ship &# 39 ; s gear . some manual stowage of cartons will likely be necessary , of course , as the ceiling height under the closed hatch may not be fillable merely by loading full stacks of cartons one on top of another . of course , in the absence of the landing pad 21 , most of the slings used to load the stacks of cartons into the square of the hatch may have to be left in the cargo hold . however , this will facilitate the offloading of the vessel , and the cost of the cargo slings is offset by the lower labor and other costs achieved by the practice . it is important that the elements of the aforementioned method be used together for maximum efficiency . at present , using the prior art method of transportation and stowage , there are several critical bottlenecks that prevent the efficient handling of the cargo . the current manual method of stowage is capable of stowing not more than about 20 to 40 metric tons per hour per hatch . at this pace , the unloading process for the trucks , the extracting pallets from the cargo hold and handling thereof and other ship - side activities become extremely hectic . as the present method would permit an increase in the stowage rate to about 70 to 110 metric tons per hour per hatch , the prior art method of using enclosed trucks , unloading the trucks onto the dock , transporting the cartons into the hold together with pallets and the like would not be able to keep pace with the stevedores in the hold , even though the number of stevedores required for the practice of the present method is substantially less than required for the prior art method . similarly , the use of the present method speeds loading of the cartons onto the trucks and placing thereof under the ship &# 39 ; s gear , so that the transportation of the stacks of cartons from the warehouse to the dock can keep pace with the loading . while the present invention has been described with reference to the preferred embodiments , it will be apparent to those skilled in the art that modifications to the method may be made within the scope of the invention .	1
referring now to the figures of the drawings in detail and first , particularly to fig1 thereof , there is shown an overall assembly of a device for handling biological objects , which are cut out of a biological mass located on a carrier 2 by laser irradiation . the following embodiments , however , can easily be transferred to the handling of non - biological objects and a non - biological mass . the device is of modular construction and can be adapted individually to different experimental requirements . in the present case , the device includes a microscope structure with an illumination unit 11 and an image recording device 10 . the microscope structure is used in a conventional manner to produce an image of the carrier 2 and the objects located thereon . instead of the inverse microscope structure shown , in which the image recording device 10 is below the level of the carrier 2 , the use of an upright microscope structure is also conceivable . the system shown in fig1 includes a laser device 7 for producing a laser beam 6 . the laser beam 6 is coupled into the beam path of the microscope structure through a mirror 9 a and optics 9 b so that the laser beam 6 can be focused onto the plane of the objects on the carrier 2 . in the present case , a pulsed uv laser is used , the wavelength of which is , e . g ., 355 nm and the pulse energy of which is , e . g ., 150 μj . the pulse duration is approximately 1 ns , while the pulse frequency can be set between , e . g ., 1 - 200 pulses per second . the laser device 7 can be realized , for example , with a nitrogen laser . the laser device 7 emits a laser beam 6 of fixed laser energy . the laser beam 6 is used for purposes of so - called laser micromanipulation and laser micro - dissection . for such a purpose , the laser beam 6 is guided in the direction of a motorized and computer - controlled microscope table 15 , which serves as a holding device for the carrier 2 . the microscope table 15 facilitates exact positioning of the objects located on the carrier 2 with a precision in the nanometer range . due to the computer - controlled motorization of the microscope table 15 , laser - based micromanipulation procedures can be carried out automatically . the motorized microscope table 15 can be moved along two linear axes ( x - and y - direction ). the minimum increment size is 20 nm , so that objects on the microscope table 15 can be positioned with a very high level of accuracy . the accuracy and reproducibility of the movement process can be supported or increased by an optical positioning system . furthermore , a robotic head 14 is provided , which carries the illumination unit 11 for the microscope structure . the illumination unit 11 may also include a condenser and / or a diffuser of the microscope structure . the robotic head 14 can also be provided with a fine positioning device , which is based , e . g ., on piezoactuators and facilitates positioning with increased precision in the nanometer range . the robotic head 14 carries collecting devices 3 for the collection of objects , which are catapulted from the carrier 2 by a laser - induced transport process in the direction of the robotic head 14 . the collecting devices 3 are mounted on the robotic head 14 in a movable manner so that they can be positioned like the microscope table 15 in the x - and y - directions . in addition , mobility in the vertical direction or z - direction is also provided . the robotic head 14 also includes a gripping device 13 , by which the carrier 2 can be gripped on the microscope table 15 . the gripping device 13 is equipped with suitable vertical and horizontal mobility for this function . the gripping device 13 is , thus , suitable for loading and unloading the microscope table 15 with the carrier 2 . in addition , the gripping device 13 is also suitable for gripping a target vessel 5 and conveying it into a position provided for the vessel 5 . both the carriers 2 with the biological mass located thereon and the target vessels 5 are kept in an incubator 20 , which has a plurality of receiving positions . the receiving positions of the incubator 20 are suitable both for the target vessels 5 and for the carriers 2 . this flexibility is accomplished , for example , by having both the carrier 2 and the target vessel 5 correspond in their outer dimensions to a standard microtitre tray and are accommodated in a receiving device with corresponding dimensions . the incubator 20 is provided with a loading and unloading device 17 , which is displaceable along a rail 16 in the vertical direction and can remove the carriers 2 and the target vessels 5 automatically from the incubator 20 or insert them therein . thus , in the device shown in fig1 , both the carriers 2 and the target vessels 5 can be exchanged in an automatic manner . for the automated handling of the carriers 2 and the target vessels 5 , the robotic head 14 can be moved horizontally along a rail 18 . furthermore , the device includes a cooling tank 22 , in which heat - sensitive or perishable process media are kept . in particular , a liquid collecting medium or collecting fluid may be kept in the cooling tank 22 , which medium is used to collect the objects catapulted from the carrier 2 . to this end , the liquid collecting medium is drawn up into the collecting devices 3 formed as nozzles and positioned in the form of a drop relative to the carrier 2 . due to the laser - induced transport process , an object is transported from the carrier 2 into or onto the drop of the collecting medium on the tip of the collecting device 3 . then the tip of the collecting device 3 is positioned above the target vessel 5 and the object is transferred by a targeted drop - like dispensing of the collecting medium from the tip of the collecting device 3 into the target vessel 5 . to achieve the drop - like dispensing of the collecting medium from the tip of the collecting device 3 , the robotic head 14 is provided with a control and actuation device 12 for the collecting devices 3 configured as nozzles . with the control and actuation device 12 , a predetermined amount of collecting medium can be dispensed for each of the collecting devices 3 from an opening located on its tip so that the drop is detached from the collecting device 3 and , in an exemplary embodiment , further collecting medium is supplied to achieve a flushing process . naturally , a jet - like dispensing of the collecting medium is also possible . the entire configuration including the robotic head 14 , the microscope table 15 , and the target vessel 5 is located under a so - called laminar flow box 24 , in which , for reasons of cleanliness , a laminar air flow is conducted over the components of the device . however , the device may be structured such that the laminar air flow is deflected in the area below the robotic head 14 so that the laser - induced transport process is not adversely affected by the air flow . the procedure for automatic handling of objects by the overall assembly shown in fig1 is explained in greater detail below . first objects to be separated for the procedure are selected with reference to an image of the biological mass on the carrier 2 produced by the microscope structure . this may take place with the aid of a computer as proposed in international publication wo 01 / 73398 a of the applicant , corresponding to u . s . pat . no . 7 , 044 , 008 to schuetze et al ., or automatically based upon electronic image processing . if necessary , the selected objects are separated from the mass on the carrier 2 by laser radiation , i . e ., micro - dissection is carried out . the separation may be carried out by moving the carrier 2 relative to the laser beam 6 with the microscope table 15 so that the laser beam circumscribes a selected area on the carrier to expose an object contained therein . suitable control of the laser beam 6 can also be carried out , for example , by a scanning system with a so - called salvo or prism scanner . then , the laser - induced transport process of the object from the carrier 2 to the collecting device 3 takes place . for such a purpose , the laser beam is directed onto a suitable target point of the object and a laser pulse or laser shot is discharged , which transports the object from the carrier 2 to the collecting device 3 . because the transport takes place in the manner of a pulse or catapult due to irradiation with the laser beam ( i . e . ballistic flight occurs following an acceleration phase , which flight is substantially only influenced by the surrounding medium ( typically air )), it is possible to speak of catapulting of the object respectively irradiated by the laser beam . fig2 shows schematically the configuration of carrier 2 , biological mass 4 located thereon and collecting device 3 during the laser - induced transport process . as already mentioned , the laser beam 6 is directed onto a suitable target point and a laser pulse or laser shot is discharged . due to this action , the selected object is catapulted from the carrier 2 to the collecting device 3 , as illustrated by the arrow in fig2 . the collecting device 3 is configured as a nozzle , in which a reservoir is located with collecting medium 3 a . at the tip of the collecting device 3 is an opening through which the collecting medium 3 a can be dispensed . during the laser - induced transport process , a defined quantity of collecting medium 3 a is held in the form of a drop on the tip of the collecting device 3 . this drop serves as a target for the laser - induced transport process . due to automatic execution of a list of positions on the carrier 2 , a fixed number of objects may be cut out of the mass 4 and catapulted into the drop of the collecting medium 3 a . depending on the surface tension of the collecting medium 3 a and on the nature of the objects catapulted , the objects can remain on the surface of the drop , where they stick due to adhesion . fig3 shows the drop of collecting medium 3 a located on the tip of the collecting device 3 with the objects 4 ′ located therein . the collecting device 3 is moved in this state by the robotic head 14 to the target vessel 5 . fig4 illustrates the discharge of the objects 4 ′ into the target vessel 5 . to this end , a predetermined quantity of collecting medium may be dispensed targetedly from the collecting device 3 so that the drop of collecting medium 3 a detaches from the collecting device 3 and falls into the target vessel 5 . further collecting medium 3 a may also be supplied from the collecting device 3 to flush the collecting device 3 and / or to fill the target vessel 5 with the collecting medium 3 a for a further processing step . the latter is particularly advantageous if the collecting medium 3 a is compatible with the following processing step or represents a preferred carrier solution for this processing step . subsequently further steps can be taken to select and separate objects . the same collecting device 3 can be used for this , or the collecting device 3 can be exchanged . the robotic head 14 may contain several collecting devices 3 , which can be filled for example with different types of collecting medium 3 a , so that they are suitable for different following processing steps . the target vessel 5 can , for example , be a so - called microtitre tray with six recesses or wells , which may be suitable for recultivation . alternatively , it can be a so - called petriperm dish . the collecting medium 3 a can be a denaturing liquid , for example , or another process liquid , e . g ., a medium for living cells . the process described above can also include further production of images of the carrier 2 to monitor whether or not the laser - induced transport process was successful . for this , it can be checked in the image of the carrier 2 ( for example , at the end of a series of micro - dissection processes with subsequent laser - induced transport process ) whether or not the selected objects were successfully removed . in addition , a photograph of the target vessel can be taken to determine whether or not all selected objects were transferred into the target vessel 5 . moreover , optical monitoring of the collecting medium 3 a may take place at the collecting device 3 . documentation regulations for the medical sphere , for example , 21 cfr 58 . 185 and 21 cfr 58 . 195 , can be taken into account in this way . the collecting medium 3 a is held on the collecting device 3 due to adhesion and / or surface tension . for this purpose the collecting device 3 is provided with a suitable geometry . in addition , holding of the collecting medium 3 a can be influenced by the surface composition of the collecting device 3 or of its tip . possible exemplary geometries for the tip of the collecting device 3 are shown in fig5 a and 5b . fig5 a shows a tip which is configured to hold a drop of collecting medium 3 a with an enlarged lateral dimension . the enlarged lateral dimension of the drop has the effect that the target accuracy of the laser - induced transport process is less critical . the tip of the collecting device 3 has a generally cylindrical shape , which tapers in an end region close to the tip . the tip ends with a generally circular opening , through which the collecting medium 3 a can be dispensed and which serves to receive the drop of collecting medium 3 a . inside the tip is a duct for feeding the collecting medium 3 a . disposed in the middle of the duct is an inset 3 b , which has an end surface located in the area of the opening of the tip . the end surface of the inset 3 b acts as an additional holding surface for the drop of collecting medium 3 a . furthermore , the shaping of the drop of collecting medium 3 a can also be influenced through the positioning of the end surface of the inset 3 b and its shape . fig5 b shows a tip of an alternative collecting device 3 ′. in this case , a substantially cylindrical configuration of the tip is provided , the inner surfaces of the tip configured in the shape of a tube having a surface composition that causes the formation of an inwardly curved meniscus of the collecting medium 3 a in the tip . the shape of the surface of the collecting medium can be influenced by suitable measures . thus , a high affinity of the inner surface of the tip with reference to the collecting medium 3 a causes an inwardly curved meniscus , as shown in fig5 b . conversely , an outwardly curved meniscus can be achieved by a reduced affinity of the inner surface of the tip with reference to the collecting medium 3 a . naturally it is also possible to combine the inset 3 b described with reference to fig5 b with a targeted setting of the surface affinity . thus the shaping of the surface of the collecting medium 3 presented to the carrier 2 can be influenced targetedly through the geometry or the surface composition of the collecting device 3 . fig6 illustrates schematically monitoring of the collecting medium 3 a on the collecting device 3 . the monitoring measures shown schematically in fig6 include a light barrier , which has a light source 8 a and a sensor 8 b . the drop of collecting medium 3 a is positioned in the light path so that the signal strength detected by the sensor 8 b changes depending on the loading of the drop with objects . furthermore , in this way whether or not a drop of collecting medium 3 a is present on the tip of the collecting device 3 can also be checked . the latter can be used to ensure also that sufficient collecting medium 3 a is present on the tip of the collecting device 3 prior to the laser - induced transport process . furthermore , in this way , the process of dispensing the collecting medium 3 a into the target vessel 5 illustrated with reference to fig4 can also be monitored . alternative configurations of the monitoring measures can be based , for example , on optical imaging of the collecting medium 3 a using automatic image processing or on an ultrasound - based monitoring method . furthermore , various options exist for configuring the transport of the separated objects by the collecting medium 3 a . thus , alternatively or in addition to the drop - like transfer of the collecting medium 3 a into the target vessel 5 explained with reference to fig3 and 4 , a number of further approaches can be followed . these can include conveying of the collecting medium 3 a , evacuation by suction of the collecting medium 3 a or a flow movement achieved in another way . the collecting medium 3 a can also be transported on special chips by acoustic surface waves . thus , a direct feed of the collecting medium 3 a with the objects 4 ′ contained therein on an analysis chip is possible for certain applications . the concept described previously of catapulting onto or into a liquid collecting medium is by no means limited to a stationary collecting medium , for example , in the form of a drop . for example , a continuous flow of collecting medium may be provided , into which the object or objects is / are catapulted . the solutions shown for handling micro - dissected biological objects according to exemplary embodiments may offer various advantages . for example , they may provide low material consumption , easy automatability , the possibility of a high throughput , a reduced risk relative to contamination , and lower storage costs for consumables . for a plurality of preparation and analysis processes , a considerably more effective overall sequence may be facilitated . any autoclaving processes of consumer products used in the conventional methods can be dispensed with because , in particular , no collecting vessels or collector substrates provided specially for this are needed . due to precise liquid management , a high level of accuracy and reliability of investigations and preparations may be achieved .	1
isobutyraldehyde ( 554 . 7 mmol ), triethylamine ( 27 . 7 mmol ), paraformaldehyde ( 527 . 0 mmol ) and niobium oxide ( 5 . 6 mmol ) were charged into a 250 ml rbf containing a magnetic stirbar and fitted with a reflux condenser . the rbf portion of the apparatus was submerged in a 80 ° c . oil bath with magnetic stirring . the reaction was continued under an argon purge until the isobutyraldehyde no longer refluxed ( generally about 1 to 3 hours ) at which point the molten solution was allowed to slowly cool to room temperature . after the niobium oxide settled , the reaction mixture was decanted off and was allowed to stand at room temperature for about 2 days . solidification occurred ( normally about 1 to about 3 days is required ); the solid was recovered by suction filtration , pulverization , and washing with hexane . hydroxypivaldehyde dimer ( 450 mmol ) was observed as a white powder ( m . p . 88 °- 90 ° c .) giving an isolated yield of 85 % based on reacted paraformaldehyde ; the hpa dimer was 92 % pure by g . c . analysis . higher purity dimer was obtained by recrystallization from methanol , and gave material melting at 106 °- 108 ° c . example 1 was repeated without niobium oxide , yielding 403 mmol of hydroxypivaldehyde dimer with a melting point of 84 °- 86 ° c . in 76 % isolated yield based on reacted paraformaldehyde at 82 % purity by g . c . analysis . hydroxypivaldehyde dimer made by the specific reaction described in the summary of the invention was dissolved in methanol to give 15 . 2 % by weight solution . the solution was hydrogenated in an autoclave reaction over barium activated copper chromite at 150 ° c . and 200 lb hydrogen pressure giving quantitative conversion of hydroxypivaldehyde to neopentyl glycol , i . e ., & gt ; 99 % purity was obtained as measured by gas chromatography without any special treatment such as the commonly used caustic purification treatment . the reactions were terminated 1 hour after the ibal stopped refluxing and then analyzed by g . c . everything else was done as similarly as possible so that the effect of the metal oxides could be compared . hpa selectivity was calculated as the monomer . table i______________________________________ % % ibal hpa % &# 34 ; 44g &# 34 ; reactionco - catalyst conv . sel . sel . * time ( h ) comments______________________________________1 . none 92 92 3 . 7 2 . 42 control2 . nb . sub . 2 o . sub . 5 97 96 1 . 3 2 . 083 . zro . sub . 2 98 97 1 . 0 2 . 004 . mno . sub . 2 97 90 7 . 3 1 . 925 . as . sub . 2 o . sub . 3 97 97 1 . 3 2 . 006 . cuo 97 96 2 . 4 1 . 927 . tio . sub . 2 99 98 0 . 3 1 . 178 . cdo 97 66 29 . 0 1 . 089 . ceo . sub . 2 97 94 0 . 6 1 . 3310 . nio 96 91 7 . 0 1 . 5811 . sm . sub . 2 o . sub . 3 99 91 1 . 1 2 . 0012 . silica gel 97 97 1 . 7 2 . 5013 . cr . sub . 2 o . sub . 3 99 95 2 . 7 1 . 5814 . bi . sub . 2 o . sub . 3 99 96 2 . 1 2 . 5015 . y . sub . 2 o . sub . 3 95 58 31 . 5 1 . 75______________________________________ ## str2 ## the hydroxypivaldehyde may be hydrogenated to neopentyl glycol using known chemical methods such as sodium borohydride reduction or catalytic techniques which involve conventional hydrogenation catalysts like copper chromite , nickel or alumina , or ruthenium on carbon . for example , an aldol reaction was performed using a stoichiometric amount of isobutyraldehyde and paraformaldehyde in the presence of 5 equivalent percent of triethylamine and 1 equivalent percent nb 2 o 5 . the stirred mixture was heated under an argon purge until a moderate isobutyraldehyde reflux was achieved . the reaction was terminated when isobutyraldehyde reflux ceased . the reaction solution was cooled to approximately 50 ° c . and filtered to remove the nb 2 o 5 . the clear , faintly yellow filtrate was diluted to make a 15 wt . % solution in methanol and was then transferred into a 2 liter autoclave reactor . copper chromite was added ( 3 wt . % based on aldol charge ). batch hydrogenation at 130 ° c . for two hours at 3000 p . s . i . g . h 2 followed by a reduced pressure , 10 - tray fractional distillation of the hydrogenation effluent gave neopentyl glycol product in . sup .˜ 90 % yield at & gt ; 99 . 5 % purity .	2
fig4 shows a section of a compact disk 40 having a track including pits 42 ( of course , these pits are not to scale ) near its outermost circumference . the portions of disk on the track which are not pits are known as lands . assuming the pits are so - called i 11 pits which are about 3 . 3 microns long , and further assuming a 50 % duty cycle , in the case of a 3 . 5 inch diameter optical disk approximately 42 , 316 pits can be placed along the outer circumference . by employing conventional compact disk reading technology ( described below ), this disk can be used in an optical encoder providing 42 , 316 pulses per turn . if the pits are conventional i 3 pits , which are presently the smallest pits at about 0 . 8 microns in length , approximately 155 , 159 pulses per turn can be provided . this is approximately one turn every 0 . 00232 °. in contrast , as described above , conventional encoders are in the range of 9000 pulses per turn or one pulse every 0 . 04 °; an entire order of magnitude less . as noted above , prior art encoders provide an a and b channel output . this type of output can also be easily incorporated into the present invention . in particular , a second track of pits 44 can optionally be added such that two pulse trains , a and b , can be generated . the second track of pits 44 , track b , is a quadrature track 90 ° shifted from the first track of pits 42 . if two tracks of pits 42 and 44 are employed , two pickups would likely be required so that the two tracks could be read simultaneously , i . e ., in parallel . fig5 shows an exemplary arrangement for an optical encoder in accord with the present invention . although numerous alternative arrangements are possible , the arrangement shown in fig5 employs an optical pick - up mounted on an electrically movable sled that is designed to move laterally across an optical disk 90 . the optical disk could be of the type shown in fig4 . a shaft 92 is attached to the optical disk 90 . the shaft 92 is analogous to the shaft 12 of fig1 and attached to a device ( not shown ) of which it is desired to measure the rotary motion thereof . the device operates as follows : a low powered semi - conductor laser 52 emits coherent light of a single wave length . after leaving the laser , the beam first goes through a collimator lens 54 that makes the light beams parallel so they can be properly focused onto the disk by an objective lens 56 ( described below ). after the collimator lens 54 , the light goes through a diffraction grating plate 58 where two small side beams are formed on either side of the main beam . this produces the popular &# 34 ; three beam &# 34 ; style used for radial tracking described below . a single beam type of system could also be used . after being diffracted , the light encounters a polarized beam splitter 60 . the job of the polarized beam splitter 60 is to allow the incident beams to pass through to the disk but to redirect the reflected beam 90 ° to the photodiodes 62 where the reflections can be interpreted . as such , the polarized beam splitter 60 is designed to allow horizontally polarized light to pass directly through unchanged . because the light beam from the laser 52 is at this point polarized horizontally , it will pass through on the way to the disk unaltered . however , the beam passes through a quarter - wave plate 64 after the polarized beam splitter 60 that gives the light a 90 ° phase shift . the reflected beam passes through the quarter - wave length plate 64 a second time on its way back from the disk giving it another 90 ° phase shift . the beam has now gone through a total 180 ° in - phase shift and is polarized vertically . the polarized beam splitter 60 does not allow the reflected vertically polarized beam to pass through . instead , it is reflected 90 ° to the photodiodes 62 . returning to the light traveling to the disk , the light reaches the objective lens 56 after the quarter - wave length plate 64 and right - angle prism 66 and just before reaching the optical disk 90 . the objective lens 56 in conjunction with the transparent substrate of the optical disk 90 focuses the light to be small enough to read the tiny pits and lands , but not too small to be effected by dirt and small scratches on the surface of the disk . the reflection of the finely focused light beam travels back through the objective lens 56 , right - angle prism 66 , quarter - wave length plate 64 and is deflected by the polarized beam splitter 60 onto the photodiodes 62 to a convex lens 68 and a cylindrical lens 70 . in general the characteristics of the reflected light indicate the presence of a pit or land . the a and b pulse trains can be determined from the output of the photodiodes in conventional fashion . the convex lens 68 and cylindrical lens 70 , together with the objective lens 56 are used to obtain the proper focus of the spot on the disk . as known by those skilled in the art , since the range of focus of the optical pick - up is or by four microns , a greater variation in the flatness of the disk would result in errors . because disk warp can cause high variations as large as 500 - 1000 microns in flatness , an automatic focus correction servo system must be employed . this type of focus correction servo is well - known to those skilled in the art and found in conventional cd players . in addition to the focusing servo , conventional cd players typically employ a tracking or radial tracking servo to address the problem of radial mistracking since the width of each pit is only 0 . 6 microns , and the radial distance between tracks ( track pit ) is only 1 . 6 microns . because of these very small distances and eccentricities in the disk , , which can cause radial swings as large as 300 microns , a servo system is required to keep the laser on the proper track . these types of systems are also well - known by those skilled in the art . the system described in fig5 employs a so - called three beam system that uses two side beams to maintain proper tracking . accordingly , when a disk of the type shown in fig4 is employed , i . e ., a disk having one or two discrete tracks , a radial tracking servo is necessary in order to insure that the tracks are followed . as noted above , such servos are well - known by those skilled in the art and incorporated into almost every commercial cd player . advantageously , however , in another embodiment of the present invention , no tracking servo is required . in particular , fig6 shows a portion of an optical disk 100 designed for use in an optical encoder without requiring a radial tracking servo . the disk of fig6 is designed for use in a constant angular velocity type of arrangement where the tracks of pits 102 - 124 are arranged radially in phase . in an actual device preferably about 250 of these tracks arranged radially in phase would be suitable . if there were two channels , a and b as described above , each would require a set of about 250 tracks , with the sets being out of phase by 90 °. further , the track pitch ( t ) is reduced far below the typical 1 . 6 microns , to as low as 0 . 6 microns . as can be observed , each track contains an identical number of pits at identical angular positions . as such , no radial servo is required since the same information could be read from any number of parallel tracks . thus , whether the pits on track 104 , 112 or 122 , for example , are read is irrelevant as they are equivalent . further , since cross talk would be very desirably high in this type of arrangement , mistracking due to radial run out would not cause appreciable hf signal loss . additionally , the three beam type of system exemplified in fig5 would not be required . thus far , the above discussion has related to so - called incremental encoders . these b encoders employ outboard counters and determine the relative distance from a zero reference point based on the number of pulses received . should a noise glitch , a power down or a failed counter situation occur , the process must be restarred as the reference is lost . other types of encoders , known as absolute encoders , always retain their position even if the power goes off , the position being indicated by the information on the disk . such an absolute encoder could also be embodied by the present invention by providing an optical disk having , for example , ten parallel tracks read simultaneously . the read - out from each of the tracks would then correspond to one bit of a ten bit code word representing the absolute position angular position of the disk . while this situation would typically require ten optical pick - ups as well as appropriate tracking servos to read the ten separate tracks , it is possible that a properly arranged laser / diode array pick - up could be used to read multiple tracks , e . g ., four tracks , at the same time . these details are all within the purview of one of ordinary skill in the art . an example of such an optical disk is shown in fig7 . in this embodiment , a ten bit word is provided to indicate the absolute angular position of an optical disk 150 . the number of bits is chosen at random and can be adapted to the particular situation . as there are ten bits from the least significant bit ( lsb ) to the most significant bit ( msb ), 1024 discrete angular positions can be represented in binary . in this embodiment , the presence of a pit , e . g ., 142 , 144 , indicates a binary zero and the presence of a land , e . g . 146 , 148 , indicates a binary one . accordingly a first position indicated by line &# 34 ; a &# 34 ; has a pit at each bit position ( or tracks 1 - 10 ) and is therefore represents the binary output 00 0000 0000 ( note that only a portion of the first bit for the bit positions 6 - 10 is shown as each of these first bits would exceed the portion of the arc shown ). a second position indicated by line &# 34 ; b &# 34 ; would have a binary output of 00 0000 0001 . the eleventh position , indicated by &# 34 ; c &# 34 ;, would have the binary output 00 0000 1011 , up to the one thousand and twenty - fourth position ( not shown ) represented by the binary output 11 1111 1111 . as can be observed , lsb + 1 ( track 2 ) has half as many pits as lsb ( track 1 ), lsb + 2 ( track 3 ) has half as many pits as lsb + 1 ( track 2 ), etc . if sixteen bits are used instead of ten , 65 , 536 angular positions can be represented ; far exceeding the count of conventional rotary encoders . note that while 16 separate optical pick - ups can be employed , one for each track , it is possible to use less with a laser / diode array pick - up arranged to read more than one track . for example , our such pick - ups can be employed each reading four tracks . with this type of absolute incremental encoder , should the power go off or some other disruption take place , the absolute position of the encoder can be determined by simply reading the parallel word . again , this type of arrangement is based on a constant angular velocity theory and requires a number of pits and lands , in phase , on each track . furthermore , while the above - described absolute encoder used simple binary coding , other coding techniques could be employed . for example , a so - called grey coding scheme could be employed . the grey code insures that only one bit changes state for each increment of the encoder . this avoids common counting problems associated with multiple bit transitions , e . g ., from 11 1111 1111 to 00 0000 0000 . fig8 shows a possible application for the optical encoder of the present invention in controlling the radial tracking of a cd rom drive . because the typical track pitch of a cd rom is only 1 . 6 microns , very precise monitoring of motion is required . thus , the high resolution provided by the optical encoder of the present invention provides the required precision for this type of arrangement . specifically , fig8 shows a cd rom drive which uses an optical pick - up 200 mounted to a rotating arm 202 that sweeps across the cd 204 . this drive is similar to the type of drive employed in the present invention except that it sweeps across the disk in a radial direction and , except , of course , that it is used to read the actual data on the disk . in this design , the radial tracking servo adjusts the radial tracking errors by moving the entire arm 202 in very small increments . the arm itself is mounted on a track 206 , and a so - called radial tracking coil 208 is typically employed to measure the radial motion . instead of the radial tracking coil , however , the optical encoder of the present invention can be mounted to the rotating arm 202 . this is accomplished by affixing the shaft 92 of the optical encoder shown in fig5 ( only shaft 92 depicted in fig8 ) to the rotary arm 202 so that rotation of the arm 202 will result in corresponding rotation of shaft 92 and disk 90 . as the arm rotates , the a and b pulse trains will be generated , indicating motion of the arm . any of the optical disks shown in fig4 or 7 could be used . similarly , the arrangement shown in fig8 could be used in the compact disk mastering process to take measurements of , for example , the radial position where the lead - in of a sample disk 204 stops and / or starts to insure that the disk conforms to specification . thus , it is apparent that in accordance with the present invention , an apparatus that fully satisfies the objectives , aims and advantages is set forth above . while the invention has been described in conjunction with specific embodiments , it is evident that many alternatives , modifications , permutations and variations will become apparent to those skilled in the art in light of the foregoing description . accordingly , it is intended that the present invention embrace all such alternatives , modifications and variations as fall within the scope of the appended claims .	6
referring to fig9 a block diagram of a circuit 200 is shown in accordance with a preferred embodiment of the present invention . the circuit 200 generally comprises a memory array block ( or circuit ) 202 , a reference block ( or circuit ) 204 , a column select block ( or circuit ) 206 and a sense amplifier block ( or circuit ) 208 and an enable control block 209 . the memory array block 202 may have an input 210 that generally receives a wordline signal ( e . g ., wl & lt ; 0 : m & gt ;). the reference block may have an input 212 that may receive a signal ( e . g ., dwl ) from a dummy wordline . the signal dwl generally has transitions that may be synchronized with the transitions of each of wordline signals wl & lt ; 0 : m & gt ; ( to be described in more detail in connection with fig1 ). the column select block 206 may have an input 214 that may receive a column select input ( e . g ., col & lt ; 0 : x & gt ;). the memory array 202 generally presents a plurality of bitline signals ( e . g ., bl & lt ; 0 : n & gt ;) to an input 216 of reference block 204 . the reference block 204 generally presents a signal blref & lt ; 0 : p & gt ; to an input 218 of the column select block 206 , a signal bl & lt ; 0 : q & gt ; to an input 220 of the column select block 206 and a signal dwlout to an input 228 of the enable control block 209 . the number of bits in the signal blref & lt ; 0 : p & gt ; plus the number of bits in the signal bl & lt ; 0 : q & gt ; is generally equal to the number of bits in the signal bl & lt ; 0 : n & gt ;. the column select block 206 generally presents a signal vg & lt ; 0 : n & gt ; to an input 222 of the reference block 204 , a signal tbref & lt ; 0 : y & gt ; to an input 224 of the sense amplifier block 208 and a signal tbus & lt ; 0 : y & gt ; to an input 226 of the sense amplifier block 208 . the enable control block 209 generally presents a signal saen to an input 230 of the sense amplifier block 208 . the sense amplifier block 208 generally presents a signal ( e . g ., saout & lt ; 0 : y & gt ;). referring to fig1 , a timing diagram of the circuit of fig9 is shown illustrating a signal wl & lt ; 0 & gt ;, a signal wl & lt ; l & gt ;, a signal col & lt ; 0 & gt ;, a signal vg & lt ; 0 & gt ;, a signal bl & lt ; 0 & gt ;, a signal blref & lt ; 0 & gt ;, a signal tbus & lt ; 0 & gt ;, a signal tbref & lt ; 0 & gt ;, a signal dwl , a signal dwlout , a signal saen and a signal saout & lt ; 0 & gt ;. consider a first cycle where wordline signal wl & lt ; 0 & gt ; has a positive transition 260 which may select wordline & lt ; 0 & gt ; and a negative transition 262 which may deselect wordline & lt ; 0 & gt ;. the signal col & lt ; 0 & gt ; has a positive transition 268 which may select column & lt ; 0 & gt ;, a negative transition 270 which may deselect column & lt ; 0 & gt ;. the signal vg & lt ; 0 & gt ; has a negative transition 276 that may respond to the positive transition 268 of the signal col & lt ; 0 & gt ;, and a positive transition 278 that may respond to the negative transition 270 of the signal col & lt ; 0 & gt ;. the signal blref & lt ; 0 & gt ; has a negative transition 286 that may respond to the positive transition 314 of the signal dwl . the signal bl & lt ; 0 & gt ; has a negative transition 284 that may respond to the positive transition 260 of the signal wl & lt ; 0 & gt ;. the signal tbref & lt ; 0 & gt ; has a negative transition 290 that may respond to the negative transition 286 of the signal blref & lt ; 0 & gt ;. a signal tbus & lt ; 0 & gt ; has a negative transition 288 that may respond to the negative transition 284 of the signal bl & lt ; 0 & gt ;. the signal dwl may have a positive transition 314 and a negative transition 316 which are generally synchronized with the positive and negative transitions 260 and 262 of the signal wl & lt ; 0 & gt ;, respectively . the signal dwlout may have a positive transition 318 and a negative transition 320 that may respond to positive and negative transitions 314 and 316 of the signal dwl , respectively . the signal saen has a positive transition 322 and a negative transition 324 that may respond to the positive and negative transitions 318 and 320 of the signal dwlout . the signal saout & lt ; 0 & gt ; has a negative transition 326 that may respond to the positive transition 322 of the signal saen . a typical pulsed wordline scheme initiates a negative transition 262 of the signal wl & lt ; 0 & gt ;, a negative transition 270 of the signal col & lt ; 0 & gt ; and a negative transition 316 of the signal dwl , which may each respond to the positive transition 322 of the signal saen . the signal blref & lt ; 0 & gt ; has a positive transition 297 that may respond to the positive transition 278 of the signal vg & lt ; 0 & gt ;. the signal tbref & lt ; 0 & gt ; has a positive transition 298 that may respond to the positive transition 297 of the signal blref & lt ; 0 & gt ;. the signal bl & lt ; 0 & gt ; has a positive transition 296 that may respond to the negative transition 262 of the signal wl & lt ; 0 & gt ;. the signal tbus & lt ; 0 & gt ; has a positive transition 300 that may respond to positive transition 296 of the signal bl & lt ; 0 & gt ;. the signal dwlout has a negative transition 320 that may respond to a negative transition 316 of the signal dwl . the signal saen has a negative transition 324 that responds to the negative transition 320 of the signal dwlout . the signal saout & lt ; 0 & gt ; does not transition relative to the negative transition 324 of the signal saen because the state of saout is latched after the positive transition 322 of the signal saen occurs . the state of signal saout & lt ; 0 & gt ; cannot change until another positive transition 336 of the signal saen occurs . a second cycle may begin with a positive transition 264 of the signal wl & lt ; 1 & gt ; and a positive transition 272 of the signal col & lt ; 0 & gt ;. the positive transition 272 of the signal col & lt ; o & gt ; may cause a negative transition 280 of the signal vg & lt ; 0 & gt ;. the signal blref & lt ; o & gt ; has a negative transition 291 that may respond to the positive transition 328 of the signal dwl . the signal tbref & lt ; o & gt ; has a negative transition 304 that may respond to the negative transition 291 of the signal blref & lt ; o & gt ;. the signal dwlout has a positive transition 332 that may respond to a positive transition 328 of the signal dwl , where the signal dwl is generally synchronized with the signal wl & lt ; 1 & gt ;. the signal saen has a positive transition 336 that may respond to the positive transition 332 of the signal dwlout . the signal saout & lt ; 0 & gt ; has a positive transition 340 that may respond to the positive transition 336 of the signal saen . the pulsed wordline scheme initiates a negative transition 266 of the signal wl & lt ; 1 & gt ;, a negative transition 274 of the signal col & lt ; 0 & gt ; and a negative transition 330 of the signal dwl each in response to the positive transition 336 of the signal saen . the signal vg & lt ; 0 & gt ; has a positive transition 308 that may respond to the negative transition 274 of the signal col & lt ; 0 & gt ;. the signal blref & lt ; 0 & gt ; has a positive transition 310 that may respond to the positive transition 308 of the signal vg & lt ; 0 & gt ;. the signal tbref & lt ; 0 & gt ; has a positive transition 312 that may respond to the positive transition 310 of the signal blref & lt ; 0 & gt ;. the signal dwlout has a negative transition 334 that may respond to the negative transition 330 of the signal dwl . the signal saen has a negative transition 338 that may respond to the negative transition 334 of the signal dwlout . the advantage of the reference scheme shown in fig9 and fig1 is related to when the signal saen is activated . the positive transition 322 of the signal saen is generally activated earlier than in the circuit of fig5 and fig6 since the negative transitions 288 and 290 of the signals tbus & lt ; 0 & gt ; and tbref & lt ; 0 & gt ;, respectively , are generally synchronized so that a differential voltage is generated without waiting for a crossing event . the additional delay associated with the scheme of fig5 and fig6 may be avoided and the circuit 200 may sense and latch the correct state . referring to fig1 , a diagram of a portion of the reference block 204 of fig9 and portions of the memory array of fig9 is shown . the portion of the reference block 204 generally comprises a transistor 400 , a transistor 402 , a transistor 404 , a transistor 406 , a transistor 408 , a transistor 410 , a transistor 412 , a transistor 414 . the portion of the memory array block 202 may be represented by a transistor 416 and a transistor 418 . the transistors 400 , 402 , 404 , 406 , 408 , 410 , 412 and 414 may represent reference elements , while the transistors 416 and 418 may represent memory elements . the dummy wordline dwl and the wordline wl are also shown . the wordline wl may be coupled to a gate of the transistor 416 and a gate of the transistor 418 . the source / drain of the transistor 416 may be coupled to the signal vg & lt ; 0 & gt ;. the other source / drain of the transistor 416 may be coupled to the signal bl & lt ; 0 & gt ;. the source / drain of the transistor 418 may be coupled to the signal vg & lt ; 1 & gt ;. the other source / drain of the transistor 418 may be floating . the transistor 416 may be connected to bl & lt ; 0 & gt ; which may indicate a &# 34 ; 0 &# 34 ; is stored in the memory cell . transistor 418 is not connected to bl & lt ; 1 & gt ; which may indicate a &# 34 ; 1 &# 34 ; is stored in the memory cell . the transistor 400 may have a gate coupled to the signal vg & lt ; 0 & gt ;, a source / drain that may be coupled to a power supply ( e . g ., vcc ) and another source / drain that may be coupled to the signal bl & lt ; 1 & gt ;. the transistor 408 may have a gate coupled to a power supply ( e . g ., vcc ), a source / drain that may be coupled to the signal bl & lt ; 1 & gt ; and another source / drain that may be coupled to a source / drain of the transistor 410 . the transistor 410 may have another source / drain that may be coupled to the signal vg & lt ; 0 & gt ; and a gate that may be coupled to the signal dwl . the transistors 406 , 412 and 414 may be connected similarly to the transistors 400 , 408 , and 410 , respectively , with respect to the signals dwl , vg & lt ; 1 & gt ; and bl & lt ; 1 & gt ;. the transistors 402 and 404 may each have a gate coupled to ground ( e . g ., vss ) and a source / drain coupled to a power supply ( e . g ., vcc ). the other source / drain of the transistors 402 and 404 may be coupled to the signals bl & lt ; 0 & gt ; and bl & lt ; 1 & gt ;, respectively . referring to fig1 , a timing diagram illustrating the wordline wl , the dummy wordline dwl , the virtual ground vg & lt ; 0 & gt ;, the virtual ground vg & lt ; 1 & gt ;, the bitline bl & lt ; 0 & gt ; and the bitline bl & lt ; 1 & gt ; is shown . the signal bl & lt ; 1 & gt ; reference is shown having a negative transition 282 &# 39 ; that responds to the positive transition 314 &# 39 ; of the dummy wordline dwl . the signal bl & lt ; 0 & gt ; is shown having a negative transition 284 &# 39 ; that may respond to the positive transition 260 &# 39 ; of the signal wl . since the signal wl and the signal dwl generally transition at the same time , the signal bl & lt ; 1 & gt ; reference and the signal bl & lt ; 0 & gt ; generally begin to transition at the same time , which generally synchronizes the generation of the voltage swing between the two signals , and may result in faster access time . since the bitline ( e . g ., bl & lt ; 0 & gt ;) is not required to cross over the reference ( e . g ., bl & lt ; 1 & gt ;), the signals generally diverge , allowing differential sensing to occur sooner . the signal bl & lt ; 1 & gt ; does not generally transition after the positive transition 264 &# 39 ; of the signal wl or the negative transition 266 &# 39 ; of the signal wl . additionally , the signal bl & lt ; 0 & gt ; generally has a negative transition 290 &# 39 ; and a positive transition 310 &# 39 ;. in this example , the bl & lt ; 0 & gt ; acts as the reference voltage for the signal bl & lt ; 1 & gt ;. referring to fig1 , a timing diagram illustrating the circuit of fig9 as compared with the circuit of fig5 is shown . the waveforms of the signal dwl , tbus , tbref , saen and saout are shown . the waveforms for the signal tbus are generally shown as a signal tbus dwl ( for the circuit of fig9 ) and tbus col ( for the circuit of fig5 ). the waveforms for the signal tbus ref are generally shown as a signal tbusref dwl ( for the circuit of fig9 ) and tbusref col ( for the circuit of fig5 ). the waveforms for the signal saen are generally shown as a signal saen dnl ( for the circuit of fig9 ) and saen col ( for the circuit of fig5 ). the waveforms for the signal saout are generally shown as a signal saout dwl ( for the circuit of fig9 ) and saout col ( for the circuit of fig5 ). a cross - point push - out is generally shown , which may generally indicate the time it takes for the signal tbref col to reach a point where sensing can occur . an access push - out generally occurs in the waveforms relating to the circuit of fig5 ( which is an additional delay necessary to provide proper sensing of the signal in the cell ) which results from the signal tbref col having the transition 88 before the signal tbus col has a negative transition 90 . the access push - out can be seen as the time difference between the positive transition 322 of the signal saen dwl and the positive transition 122 of the signal saen col . since the circuit of fig9 does not have the access push - out , additional margin and / or reduced access time may be achieved . while the invention has been particularly shown and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention .	6
according to the method of the invention a microfilament can be gripped at either one end or both ends using a droplet of softened resin into which the fiber is inserted . after the resin hardens , a satisfactory grip is achieved which can hold a specimen adequately to permit testing of the fiber &# 39 ; s tensile strength characteristics . advantages associated with this method of gripping include minimizing stress placed on the fiber as a result of gripping , and in the context of the best mode described here , the capability to achieve gripping of the microfilament without interfering with the load train of a tensile testing apparatus . this is illustrated in fig1 . in a preferred embodiment , insertion is achieved by means of a translation stage supporting the load train which , at a minimum , is capable of movement along the axis of the fiber , permitting movement of the resin droplet from a position wherein the fiber is outside the resin droplet to a position wherein the end of the fiber penetrates the resin droplet . in the best mode , the translation stage , in addition to moving in a direction parallel to the axis of the fiber , is capable of movement within a plane perpendicular to the fiber permitting greater freedom in aligning the droplet with respect to the fiber . as mentioned , due to the small . size and delicate nature of the fibers to be tested using the method and apparatus of this invention , it may be appropriate to use the resin gripping technique at both ends of the fiber . in other instances , however , small diameter fibers may be of sufficient length to allow affixing one end to components by welding , for example , and then gripping the remaining end with the resin gripping technique of this invention . such a case is illustrated in fig2 . in addition , the resin gripping technique may be adapted for gripping and pulling microfilaments in evaluating post - mortem weld integrity or testing microfilament attachment within a matrix such as in the case of fiber glass . fig1 illustrates a preferred embodiment for application of the resin gripping technique within the load train of a tensile testing apparatus . in the figure , a microfilament 5 is affixed to a base 10 . a precision load cell 15 is affixed to a translation stage 12 capable of movement according to an axis z which is in alignment with the microfilament . the load cell supports a load wire 20 positioned in alignment with said axis z . at the end of the load wire distal from the load cell is an irregularity 25 in the wire capable of supporting a droplet of resin . the irregularity in the example illustrated in fig1 is in the form of a &# 34 ; shepherd &# 39 ; s hook &# 34 ; although other forms of irregularity may suffice equally well . the load wire attached to the load cell and microfilament attached to the base define a load train aligned with the axis z . positioned about the load wire in proximity to the distal end bearing the irregularity is the coil of a resistance heater 30 . according to the best mode , the coil is a nickel - chrome resistance heater , however , in other embodiments contemplated by this disclosure , other heating means may serve to adequately soften resin . according to the preferred embodiment of the method , the coil of the resistance heater 30 is heated to allow the irregularity 25 in the loading wire 20 to attain a temperature sufficient to soften low - melting point resin . a sufficient quantum of such low - melting point resin is then allowed to touch the irregularity such that a droplet 35 of the resin forms and adheres to the wire 20 . according to the best mode , glycol phthalate ( gp ) polyester resin is used as the gripping media . gp is commercially available as stronghold ™ 7036 ( j . h . young company , inc ., rochester , n . y .). this type of polyester resin has a low softening temperature and hardens within a few seconds after a heat source is removed . in other embodiments contemplated by this disclosure , other gripping media may adequately serve the gripping function . after a droplet of softened resin is formed in the region of the distal end of the load wire 20 , the free end of the microfilament 5 is inserted into the droplet 35 . the resistance heater 30 is then turned off and the microfilament is held in the inserted position long enough to allow the resin droplet to cool and harden sufficiently to grip the inserted microfilament . finally , the tensile strength of the microfilament 5 may be tested by pulling the load cell 15 in a direction along the axis z away from the base 10 sufficiently to generate desired data . the tensile strain associated with the testing may or may not be sufficient to break the microfilament , depending on the test requirements . referring to fig2 a component 40 with a microfilament 45 attached at one end is supported in a vise and v - block assembly 50 which in turn is supported by a magnetic base 55 . for the purpose of clarity in this schematic illustration , the microfilament is shown much larger than it would otherwise be according to the scale of the figure . the vise and v - block assembly is used for convenience of gross manipulation of the component 40 . although the vise and v - block assembly provides great flexibility for specimen positioning for microfilament specimen testing , this disclosure also contemplates the use of other appropriate means for adjoining the microfilament to the translation stage , depending on the particular application . the magnetic base 55 in this instance is capable of two - dimensional movement according to the axis x depicted in the figure and a second axis y passing through the plane of the figure . the axis x and the axis y together define a plane which is perpendicular to the axis z . in the best mode contemplated by this disclosure , the load cell 65 and associated translation stage 68 are capable of three - dimensional movement according to the axes x , y and z . the x - axis positioning of the load cell 65 is motor driven and controlled remotely by a stage controller 60 in operative association with the translation stage 68 . also depicted in the figure is the precision load cell 65 in operative association with a digital load readout 85 and a plotting system 90 . attached to the load cell is a load wire 70 which is in alignment with the axis z . similar to the arrangement depicted in fig1 the load wire bears a shape irregularity 75 at the end distal to the load cell , and a resistance heater 80 in the shape of a coil is positioned about the load wire in proximity to the irregularity . the coil of the resistance heater is positioned such that it does not touch the load wire or otherwise interfere with the load train defined by the load cell , the load wire and the microfilament . according to the method of the invention , the resistance heater 80 is activated and the load wire 70 is heated sufficiently to soften resin applied to the shape irregularity 75 . the resin thus forms a droplet 95 into which the free end of the microfilament 45 is inserted . insertion of the microfilament is achieved by manipulating the position of the load cell 65 and consequently the position of the load wire 70 and droplet 95 . finally , the figure illustrates the use of a stereo microscope 100 to provide magnification and to assist the operator in the insertion effort . after appropriate insertion of the microfilament into the resin droplet is achieved , the resistance heater is turned off , the resin is allowed to cool , and the microfilament specimen may then be tested for tensile strength by moving the load cell 65 along the axis z in a direction away from the magnetic base 55 . the foregoing description of the invention has been presented for purposes of illustration . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiments were chosen and described in order to best illustrate the principles of the invention and its practical application to thereby enable one of ordinary skill in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated , as long as the principles described herein are followed . thus , changes can be made in the above - described invention without departing from the spirit and scope thereof . it is also intended that the scope of the invention be defined by the claims appended hereto . the invention is intended to encompass all such variations as fall within its spirit and scope .	6
turning now descriptively to the drawings , in which similar reference characters denote similar elements throughout the several views , the attached figures illustrate a 2d to 3d facial recognition system , which comprises of single or multi - processor electronic devices ( 3 ), a database ( 4 ), a camera ( 2 ), 2d to 3d ( facial ) image conversion system ( 6 ), facial recognition system ( 7 ) and 3d ( facial ) image processing system ( 8 ). the 2d facial image ( 5 ) can exist as a photograph , a 2d image in electronic format , or an image taken and or stored by a digital camera which contains a human face . the electronic device ( 3 ) can be any single or multi - processor machine capable of performing the process , storing and retrieving data as well as transmitting an electronic message . the 2d image to 3d conversion system ( 6 ) must be capable converting a 2d image of a human face into 3d . the facial recognition system ( 7 ) must be capable of recognizing a human face after accepting a series of two dimensional images , accepting a moving electronic representation of the generated 3d image or accepting the generated 3d image itself . in all instances the images are the bases of enrollment of the individual into the facial recognition system ( 7 ). the method consists of taking the generated 3d image of human face ( 6 ) and presenting it electronically to the facial recognition system ( 7 ) so as to simulate as if the person in the original 2d image ( 5 ) had stood in front of a camera ( 2 ). to achieve this , the facial recognition system ( 7 ) may be presented with images in a variety of ways . the 2d image ( 5 ) can be in digital picture format either , but not limited to , jpeg , gif , tiff , or bitmap . the 2d image ( 5 ) may already be in digital picture format , either stored in an electronic device , on electronic media or stored on a digital camera ( 1 ). if the existing image is a photograph , it can be converted to digital picture format through the use of a scanner ( 1 ). once the 2d digital image of a face ( 5 ) is transferred ( 12 ) to the 2d to 3d conversion system ( 6 ) a 3d image of a human face is created . if ( 13 ) the facial recognition system ( 7 ) accepts a 3d image it is transferred ( 17 ) to the facial recognition system ( 7 ). if ( 13 ) the facial recognition system ( 7 ) does not accept a 3d image or if ( 13 ) the 3d image needs a combination of lighting conditions , shadows , aging , facial hair , weight loss , weight gain , eyeglasses and other facial expressions to be simulated , the 3d image is transferred ( 21 ) to the image processing system ( 8 ). if ( 14 ) a combination of lighting conditions , shadows , aging , facial hair , weight loss , weight gain , eyeglasses and other facial expressions are to be simulated , the 3d image is transferred ( 22 ) to an image manipulation process ( 9 ) which performs the desired combination . if ( 15 ) the facial recognition system ( 7 ) can accept 3d images , the image or images are transferred ( 18 ) to the facial recognition system ( 7 ). if ( 15 ) the facial recognition system ( 7 ) can not accept 3d images , the 3d image or images are transferred ( 24 ) to a process ( 10 ) where multiple 2d perspectives of the 3d image or images are generated . if ( 16 ) the facial recognition system ( 7 ) can accept multiple 2d images , the images are transferred ( 19 ) to the facial recognition system . if ( 16 ) facial recognition system ( 7 ) can not accept multiple 2d images , the images are transferred ( 25 ) to a process where they are converted into a animated 3d image ( 11 ) either , but not limited to , mpeg , avi or animated gif . the animated 3d image is presented electronically to the facial recognition system ( 7 ) internally or through an external electronic feed ( 20 ), so as to simulate as if the person in the original 2d image ( 5 ) had stood in front of a camera ( 2 ). if ( 14 ) a combination of lighting conditions , shadows , aging , facial hair , weight loss , weight gain , eyeglasses and other facial expressions are not to be simulated , the 3d image is transferred ( 23 ) to a process ( 10 ) where multiple 2d perspectives of the 3d image are generated . if ( 16 ) the facial recognition system ( 7 ) can accept multiple 2d images , the images are transferred ( 19 ) to the facial recognition system . if ( 16 ) facial recognition system ( 7 ) can not accept multiple 2d images , the images are transferred ( 25 ) to a process where they are converted into a animated 3d image ( 11 ) either , but not limited to , mpeg , avi or animated gif . the moving electronic presentation is presented ( 20 ) electronically to the facial recognition system ( 7 ), so as to simulate as if the person in the original 2d image ( 5 ) had stood in front of a camera ( 2 ). the facial recognition system ( 7 ) running on a single or multi - processor electronic device ( 3 ) then converts the images into , but not limited to , an algorithm or any mathematical identifier that identifies the individual in the original 2d image ( 5 ) and stores the said individual &# 39 ; s unique mathematical identifier into its database ( 4 ). once the facial recognition system has the individual in its database ( 4 ) the single or multi - processor electronic device ( 3 ) it is now capable of identifying the individual in the 2d image ( 5 ) through the use of a camera ( 2 ). further in fig5 , fig6 and fig7 , the database ( 4 ) can be accessed ( 26 ) by multiple electronic devices ( 27 ) either locally or in separate locations , who may or may not have a camera ( 2 ) and more specifically in fig5 , the database ( 4 ) shared with other databases either locally or in separate locations . other electronic hardware such as , but not limited to , different types of storage media , networking hardware and electronic peripherals have not been illustrated for the purpose of simplicity . as to a further discussion of the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the relationships for the parts of the invention , to include variations in materials , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principals of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	6
during minimally invasive surgical intervention made in the abdominal zone ( or laparoscopy ), a trocar 1 , a trocar 2 , and a trocar 3 are placed in the abdomen 4 of a patient , as shown in fig1 . the trocars 1 and 2 generally have an inner diameter of less than or equal to 8 mm ( operating trocar ) and the trocar 3 ( optical trocar ) has an inner diameter of less than or equal to 12 mm . the trocars 1 and 2 allow use of surgical tools such as forceps and the trocar 3 allows use of a laparoscope , for example . fig2 shows the trocar 1 divided into its lower part and the carrier shaft 5 of the surgical tool , the distal part 6 of which is to receive functional modules inside the abdomen of the patient . the modular surgical tool according to the invention is in fact assembled from a set of functional modules capable of being connected to the carrier shaft or to another functional module . modular in this text means that the tool is assembled case by case with the degrees of freedom or the functions preferred by the surgeon . it is also specified in this text that a degree of freedom is associated with translation or rotation ; the operating movements of the tool ( for example opening and closing of forceps ) are not considered as degrees of freedom . the shaft 5 serves as a base for assembly / disassembly of a series of modules belonging to one of the following classes : module having a degree of freedom in rotation ( or “ rotation module ”) 7 , module having a degree of freedom in translation ( or “ translation module ”) 8 or module having a functional end - piece , such as forceps module 9 . of course , the functional end - piece can be any instrument which the surgeon may need during intervention , such as for example a hook , a scalpel , a needle , etc . for this purpose , each module has means for being connected to the carrier shaft or to another module . for example , each module can have a female form such as the orifice 14 shown in fig2 , this female form being capable of being fitted in and held on a male form 15 complementary to the carrier shaft 5 or another functional module ( a motor shaft , for example ). the modules with functional end - piece which are designed to form the end of the modular tool can simply have an orifice 14 . of course , any other form of attachment means is feasible ( complementary male / female forms , clips , screws , magnetic means , electromechanical means , etc .). also , the attachment means are likewise designed to enable transmission of energy and operating commands to each of the modules . in particular , the tool is controlled from an electromechanical interface , such as a haptic interface , by means of which the surgeon indicates selected movements and which transmits via a controller control signals to each functional module . the carrier shaft 5 must be designed such that its inner part contains transmission supports ( electric , fluid or other ) for power feed and for information exchange and control signals between the actuators , the sensors and the system controller . also , the proximal part ( external to the surgical cavity ) and distal part ( in the surgical cavity ) of the carrier shaft 5 comprise contactors or connectors ensuring links between both the shaft and the functional modules ( actuators ) and the carrier shaft and the controller . according to a variant , it is possible for each of the functional modules to have its own power supply means , for example in the form of miniature batteries . also , according to another embodiment of the invention , the carrier shaft 5 is a simple passive shaft and power supply , information exchange and control signals between the actuators , the sensors and the system controller are sent wirelessly ( radio frequency , ultrasound , bluetooth , wifi , induction , magnetic , etc .). the orifice 14 helping with installation of the modules can be located on the most appropriate face of each module . if , as in fig2 , the functional module has a cylindrical shape , for example , the orifice 14 can be placed in the base or in the lateral surface of the cylinder . if the functional module is a cube , the orifice 14 can be placed on one of the five surfaces of the cube not containing the motor axis of the module . alternatively , adhesion surfaces by magnetic contact will be used in place of complementary male and female parts . the length of each module can be over 12 mm ; however , its width is to be under 12 mm as assembly of the tool is based on use of the trocar 3 of inner diameter less than or equal to 12 mm to allow modules defining the desired architecture to reach the interior of the abdomen 4 . other modules can be assembled or disassembled on each rotation module 7 or on each translation module 8 , without any class restriction . the forceps module 9 takes up no other modules , and can be mounted on the carrier shaft 5 as first and last module , but also on a rotation module 7 or on a translation module 8 . the architecture of the assembled tool can thus have the required number of degrees of freedom to offer the best dexterity for the doctor in making his surgical gesture . according to a variant , a functional module having several degrees of freedom and also integrating a functional end - piece is feasible . this system of “ single module ” class 10 will also have a width of less than 12 mm and its architecture will depend of medical needs . fig3 shows the general principle of two modules of the single module class 10 ; however , the design of this class of modules is not restricted to these two examples of single module . the first module 10 a has a configuration of rotation - rotation - rotation - forceps type where r 1 , r 2 and r 3 are rotations which can be made relative to axes a 1 , a 2 and a 3 , respectively . the second module 10 b has a configuration of the type rotation - rotation - translation - forceps where r 1 and r 2 are rotations made relative to the axes a 1 , a 2 , respectively , and t 1 is translation made along the axis a 3 . the parts 11 in fig3 are those which will be mounted on the carrier shaft 5 in orifices 14 . fig3 shows a forceps module 9 as the final part of each single module 10 . as a function of surgical needs and / or of the degree of dexterity required during operation , the system can be updated or reconfigured as required by the surgeon , that is , rotation modules 7 or translation modules 8 can be added or removed . fig4 illustrates an example of installation at two degrees of freedom , constituted by a rotation module 7 , a translation module 8 and a forceps module 9 . fig5 illustrates a module 10 a of “ single module ” class mounted on the carrier shaft 5 . the recovery of modules of “ single module ” class 10 will be completed after it has been dismantled from the carrier shaft 5 , by one of the means mentioned later in this document . according to another set variant a particular class of single module 12 constituted by a series of independent sub modules 12 a as illustrated in fig6 can be provided . this module 12 is also sent to the surgical cavity 4 via the trocar 3 . the initial part 11 of this series of sub modules is the part which will be mounted on the carrier shaft ( not shown in this figure ). once assembled on the carrier shaft , this module 12 could assume particular configuration of , a priori , any number of possible configurations , as a function of surgical needs . so , fig7 illustrates the module 12 in a configuration c 1 before and after three rotations r 12 - 1 , r 12 - 2 and r 12 - 3 of sub modules . a second configuration c 2 of the module 12 is also shown in fig7 where the module 12 has assumed a configuration with two branches , the first bearing forceps at the end of the series of sub modules and the second bearing shears . the surgeon intervenes only in installing the module 12 on the carrier shaft 5 . a junction module was designed to increase the number of installations of modules inside the surgical cavity . fig1 illustrates two versions of the junction module : a female - female module 13 a and a female - male module 13 b . the junction module 13 a or 13 b can take up the various classes of modules 7 , 8 , 9 , 10 or 12 . in fact , using the junction module enables multiple installations such as that of two modules 12 , illustrated in the right part of fig7 where a junction module 13 b ( mounted previously in the carrier shaft 5 ) takes up a first module 12 bearing forceps and a second module 12 bearing shears . use of the junction module thus increases the number of instruments inside the surgical cavity but without increasing the number of surgical orifices . the left part of fig7 illustrates the module 12 before and after three rotations r 12 - 1 , r 12 - 2 and r 12 - 3 of the sub modules , which defines a change in configuration . these rotations are made inside the surgical cavity after installation of the module 12 in the carrier shaft 5 or in the junction module and are made by way of a command issued outside the surgical cavity . in this case , the surgeon intervenes only in the installation of the module 12 on the carrier shaft 5 or of the junction module on the carrier shaft 5 and the modules 12 on the junction module . relative to the single module 10 , the module 12 has a larger number of degrees of freedom due to the number of independent sub modules 12 a which constitute it and which can be selected in advance by the doctor ; this module 12 is thus redundant . this illustrates an increase in the degree of dexterity of the surgical tool and allows having the preferred mobility according to the operation , without having to change instruments or to add modules . forceps , shears , etc . of the module 12 are folding tools also forming a sub module , as is illustrated in fig8 . fig9 illustrates the different steps necessary for assembling the tool inside the abdomen . in step ( a ), the modules are passed through the trocar 3 , showing , in dotted lines , a rotation module 7 passing via the trocar 3 and a forceps module 9 about to be inserted into the trocar 3 . the modules can be inserted into the interior of the abdomen of the patient for installation of the tool and their recovery after disassembly by using mechanical , magnetic , pneumatic or other means . the modules can be sent to the interior of the abdomen by gravity where they will be recovered for their assembly . step ( b ) corresponds to recovery of the modules inside the abdomen , for example by using another surgical tool placed in the trocar 2 , not shown in this figure . according to another embodiment of the invention , illustrated in fig1 , an auxiliary device 16 comprising gripping means for handling the different modules is used . the auxiliary device 16 is for example adapted to the laparoscope 17 without obstructing the visual field 18 of the camera . in fact , this auxiliary device 16 must have well researched architecture to assist locating and handling of modules per region , without interference of the visual field 18 . for the assembly phase of the surgical tool , the auxiliary device 16 is mounted on the laparoscope 17 before the first module is sent to the interior of the abdomen and disassembled after completion of assembly of the tool so as not to block the view available for the doctor . in step ( c ), the modules are assembled one after the other on the carrier shaft 5 , terminating in a forceps module 9 . once assembled , the tool is ready for use in a surgical procedure defined by the surgeon and which does not form the subject matter of the present invention . the number and class of modules to be used as well as the order of installation or configuration of the module depend on the dexterity preferred by the doctor and on the inner space available in the abdomen of the patient . any sort of power can be used to actuate the different modules . selection of the type of power to be used will depend on the medical restrictions for each application and on the technological availability of the moment . the carrier shaft 5 is designed as a function of the nature of the power selected to ensure power supply for all the modules defining the final architecture of the surgical tool . as explained earlier , the means used to provide power and exchange information and control signals between the controller and the functional modules can be conventional means ( electric , pneumatic wires , etc .) or else wireless ( radio frequency , induction , magnetic , bluetooth , ultrasound , etc .). in the case of conventional transmission , the means for connecting each functional module is designed such that they receive and transmit ( with the controller and with all modules ) information and control signals as well as the required power . compared to tools of the prior art , the tool according to the invention can accordingly dispense with actuation by cables , which minimises equipment bulk around the surgeon . the tool is disassembled by uninstalling the modules used one by one . the modules are then withdrawn from the interior of the abdomen via the trocar 3 . for example , the auxiliary device 16 is mounted on the laparoscope 17 prior to disassembly of the surgical tool and disassembled after all modules have been collected . other means for recovering the modules from the interior of the abdomen of the patient is a hollow magnet 20 mounted on the laparoscope , as illustrated in fig1 . the orifice of the magnet frees up the visual field of the laparoscope 17 . this system recovers the modules one by one by simple contact with the adequate face to guarantee passage through the trocar 3 . other means for depositing and recovering the modules from the interior of the abdomen and for assembling / disassembling them can also be used , such as for example bolt systems , ball - connected systems , clip systems or any other type of connecting system having qualities such as quick installation / disassembly , ease of use and safety . of these module - recovery means , an endoscopic bag , normally used for extracting part of an organ separated by ablation from the surgical cavity , can also be used . the materials used for making the different elements such as the carrier shaft 5 , the modules 7 , 8 , 9 , 10 12 and 13 a or 13 b , the auxiliary device 16 , the magnet 20 or another connecting device for executing the invention are compatible with sterile and safety conditions required in an operating theatre . the modular tool just described can be used particularly advantageously in relation with the robotic positioning system forming the subject matter of international application wo 03 / 094 579 . the proximal end of the carrier shaft 5 is attached to appropriate support means . in this way , the surgeon can benefit from the functionalities and minimal bulk of such a robotic system , while benefiting from all degrees of freedom allowed by the modular tool . of course , the dimensions of the trocars have been given by way of example , given that trocars of larger diameter can be used to allow passage of larger modules . finally , the invention has been described within the scope of laparoscopy , where the surgical cavity is the abdomen , but it is understood that it applies to all interventions feasible in minimally invasive surgery .	8
referring now to the accompanying drawings , fig1 shows a plastic casting mold , designated generally by the numeral 10 , in which a contact lens is formed . the mold 10 , fabricated from nylon for example , includes a body portion 12 having an integrally formed cup 14 adapted to contain lens material . the base 16 of the cup is finished so as to have a surface finish to yield a complimentary surface finish of a predetermined optical quality , for example according to a particular lens prescription . moreover the diameter of the cup 14 at its base is selected to be substantially equal to the desired diameter of the lens to be formed ( e . g ., 6 - 13 mm ). during fabrication of a contact lens , the cup 14 of the casting mold 10 is filled with a monomer of the material 18 from which the lens is to be formed . the material 18 is polymerized such as by irradiation with light of the particular wave lengths to induce such polymerization . thereafter the cup 14 is cut off and the lens material 18 is polished to the desired optical quality . this results in a contact lens 20 finished on its convex surface 20a ( see fig2 ). since the concave surface of the lens is formed to the desired optical quality finish during the molding process , lens fabrication is completed just by removing the lens from the body portion 12 of the casting mold 10 . removal of the contact lenses from respective casting molds successfully without damage to the lenses is accomplished according to this invention as follows . the body portion 12 of the casting mold , with the attached contact lens is positioned in a die 22 of a compression apparatus 24 ( see fig3 ). the apparatus 24 may be of the pneumatic or hydraulic cylinder type . of course other apparatus developing compressive force , such as spring or lever based mechanisms , are suitable for use with this invention . the die 22 holds the body portion 12 such that it is substantially coaxially located with respect to the longitudinal axis of the piston rod 26 of the compression cylinder of the apparatus 24 . a series of plungers 28a - 28f , preferably made of brass , are mounted on a turret assembly 30 . the turret assembly 30 is rotatable ( either manually or by an automatically indexing mechanical mechanism ) about an axis 30a to selectively locate a particular plunger between the end 26a of the piston rod 26 and the die 22 . on activation of the compression cylinder by a control mechanism 32 , the selected plunger is forced into engagement with the casting mold body portion 12 on the opposite side from the attached contact lens 20 . the control mechanism 32 , which may include a programmable microprocessor for example , controls the amount of force , and the time duration and speed of its application by the compression cylinder through the plunger on the body portion of the casting mold in the die . the parameters of force application are selected , dependent in part on mold and lens composition and configuration so as to be sufficient to cause the beginning of plastic flow of the body portion material for permanent deformation of the body portion 12 of the casting mold ( see fig5 ). the permanent deformation of the body portion 12 is progressively continued , in descrete steps , utilizing successive plungers 28b - 28f rotated into position by the turret 30 . the plungers are arranged such that their respective diameters are of incrementally decreasing size so that , as can be seen in fig6 - 8 , the lens 20 progressively detaches from the body portion 12 on each successive deformation until the lens finally self - detaches from the body portion . as an illustrative example , the apparatus 24 may include an air cylinder of a diameter of approximately 10 cm utilizing air at a pressure of between 5 - 80 psi . depending upon the material of the casting mold , the resultant force to be applied to the body portion 12 of the casting mold is in the range of between approximately 100 - 1400 pounds for a time of approximately between 2 - 10 sec . with a contact lens diameter of approximately between 4 - 16 mm , the diameter of the plunger 28 starts at approximately 1 . 2 cm and decreases in 0 . 15 cm increments down to 0 . 35 cm . of course other arrangements for the apparatus 24 for carrying out the progressive permanent deformation are suitable for use with this invention . for example , the plungers may be successively manually located in position on the end of the piston rod of a compression cylinder to be engaged sequentially with the casting mold . alternatively , the plungers may be in an in - line arrangement to be moved in a stepped manner for sequential activation , and progressive compressive application , on a single stroke of the compression cylinder . the above process can be carried out in a fluid bath if so desired . this has the advantage of dampening the compressive action to further prevent damage to the contact lens 20 as it separates from the body portion 12 of the casting mold 10 . it has also been found that preheating the body portion prior to subjecting it to the progressive compressive steps also facilitates lens removal . while the reasons for this are not yet completely understood , it is felt that such preheating encourages the onset of plastic flow necessary for the start of permanent deformation of the casting mold body portion . as an illustrative example , baking of the casting mold for 1 / 2 hour at 230 ° has resulted in an increase in the yield of contact lenses successfully removed by the process according to this invention . the invention has been described in detail with particular reference to a preferred embodiment thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	8
for purpose of illustration , and not to limit generally , the present invention will now be described with specific reference to a synthetic drainable base course with drainage and impact attenuation properties for use with synthetic turf systems . one skilled in the art will appreciate , however , that embodiments of the present invention are not limited to synthetic turf systems and may , for example , be used with natural turf and other systems . the present structure consists of selecting a gradation of polyethylene (“ pe ”) foam in order to allow vertical fluid transmission . once the gradation is selected , it is randomly adhered together with either heat and or adhesives such that the end product retains a dimension stability of sufficient tensile and compressive strength that allows it to achieve 50 % of its originally specified thickness and mechanical values even after 10 , 000 hours of exposure . sufficient pressure is placed upon the particulate matter such that a desirable thickness is achieved . once the particulate material has been bonded , drainage channels are molded into the present invention in order to allow horizontal fluid transmission . lastly , the materials are planed to achieve a uniform thickness with only one mm variation across the width of a roll . as shown in fig1 and 2 , a synthetic turf system 10 comprises a synthetic playing surface 20 . the synthetic playing surface 20 is installed over a synthetic drainable base course 30 , which in turn rests on a subgrade 40 . in the present embodiment , the synthetic drainable base course 30 comprises a layer of cross - link , closed cell polyethylene foam . the synthetic drainable base course 30 includes an upper surface 32 and a lower surface 34 . in a preferred embodiment , the synthetic drainable base course 30 is formed by first selecting a gradation of polyethylene foam that allows vertical fluid transmission through the synthetic drainable base course 30 . once the gradation is selected , it is randomly adhered together with heat and or adhesives such that the end product retains a dimension stability of sufficient tensile and compressive strength that allows it to achieve 50 % of its originally specific thickness and mechanical values even after 10 , 000 hours of exposure . the desired thickness of the synthetic drainable base course 30 is achieved by applying pressure to the particulate matter . once the particulate matter has been bonded , a series of drainage channels 36 are molded or otherwise formed in the synthetic drainable base course 30 , which provide horizontal fluid transmission . drainage channels 36 may be of sufficient width and depth to maximize draining while providing desired shock absorbing characteristics . spacing of drainage channels 36 may also be adjusted to provide superior draining characteristics while maintaining desired shock absorbing characteristics . the upper surface 32 and the lower surface 34 may be planed to achieve a uniform thickness with preferably only 1 mm of variation across several feet of the material . in certain embodiments the selected material is shredded , ground , or grated , with a ¾ mesh screen . this screen will not allow larger particles , similar to a sieve size . the shredding process does not allow larger particles to pass through the screen . also the material is not likely to produce fines when shredded . in this embodiment , the present invention is similar to asshto 57 stone , ¾ inch , no fines , same size particles . in certain embodiments , various particles of the present invention are gap graded during manufacturing to maximize permeability as well as maintain long - term stability within the structure . this method of manufactures promotes long - term stability , which assures tensile properties will also be maintained . in certain embodiments of the present invention the edge detail , or in other words the distance from the edge from which a first drainage channel 36 is placed , is between 3 ″ to 6 ″ with certain embodiments showing superior results with a 4 ″ detail . this allows for the edge to have ballast resulting in a superior flatness coefficient and no curling . rolls of the present invention are preferably 4 ′ wide at a minimum to decrease longitudinal seams although other widths are contemplated . rolls of the synthetic drainable base course 30 are preferably delivered and assembled in lengths that span an entire width of a field to eliminate any attachment , or seaming of materials end to end . in certain embodiments of the present invention , the synthetic drainable base course 30 is created form like materials , i . e . hope to eliminate or minimize expansion and contraction . schmitz uses a polypropylene netting , which reacts differently than hdpe at temperature . also , the synthetic drainable base course 30 may include a textured bottom surface , winch minimizes movement on subgrade or membrane also , in certain embodiments the synthetic drainable base course 30 is produced from selected high - density cross - link pe foam . certain prior art systems such as schmitz do not have access to high density . other prior art systems such as sirex never differentiate between density , which tends to make their products soft and injury prone for field use . in certain embodiments , drainage channels 36 are maximized to 2 . 5 to 3 ″ centers to provide excellent drainage and maximize fluid evacuation . preferably the synthetic drainable base course 30 is manufactured under load or compression of 500 psf to minimize variance in thickness and maximize long - term durability . installation efficiency of the present invention is maximized because unlike certain prior art systems , there is no seaming and no friction fit puzzle design , which allows for a much faster install , up to five times faster , than any other prior art synthetic drainage layer . certain prior art products , such as schmitz , must be kept at a constant temperature during assembly . further , these systems require wetting and rewetting of their material during construction . in one or more embodiments of the present invention the materials are formed to achieve a uniform thickness with only one mm variation across roll width . drainage grooves are molded into the present invention in order to allow horizontal fluid transmission . the structure consists of selecting a gradation of hope cross - link pe foam in order to allow vertical fluid transmission . after gradation is selected , it is randomly adhered together with either heat and or adhesives such that the end product retains a dimension stability of sufficient tensile and compressive strength that allows it to achieve 50 % of its originally specified thickness and mechanical values even after 10 , 000 hours of exposure . the present embodiment of the invention is produced with a flatness coefficient . this flatness coefficient allow the present invention the ability to perform in sport fields application where the overlying normal loads are only 5 to 10 lbs per sf . is highly resistant to thermal coefficient of expansion and contraction provided long - term gmax and energy absorption properties , is easy to install , provides long term vertical fluid infiltration and long term horizontal fluid transmission . the present invention will last the lifetime of the field and will not degrade or densify over time . the present invention has an excellent gmax on it own , as well it will enhance any turf system by providing a shock attenuation layer directly under the turf system . the cushion properties of the present invention will actually make the synthetic turf system last longer . similar to any carpet material , utilizing a pad underneath will reduce the wear of the structure . the present invention is produced in a quality controlled environment , ensuring the client will get a consistent , uniform system throughout his sport field . the present invention will not store water , it is a flat pipe completely under your field . it can flow a minimum of 2 . 35 gallon / minute / foot to handle the most severe rainfall event . transmissivity tested by manufacturer every 100 , 000 square feet of product per astm d4716 . testing conditions are : steel plate / geocomposite / geomembrane / steel plate . the transmissivity of certain embodiments of the present invention are reflected below : sdm is produced in roils typically 48 ′″× 210 ′, to maximize speed of installation and minimize a . material selection / composition . . . materials selected are a mix of medium and high density cross - link pe foam shredded to a minimum of ½ ″ to a maximum gradation of ¾ ″, this gradation provides the optimum density of the invention while maintaining the required hydraulic and mechanical properties . desired thickness . . . thickness is controlled by skiving , a process of planing the bottom of the invention or producing a product that minimizes tolerance of the overall thickness of 25 mm with a thickness tolerance +/− 1 mm the desired thickness for the sport field product . any thickness deviation greater than +/− 2 mm will result in a finished turf system that could be unsafe or visually defective . weight . . . weight of the structure is 6 - 14 ounces / sf for a thickness of 25 mm this weight allows for ease of installation minimizing the use of specialized equipment and provide the needed weight to maintain intimacy with the underlying layer . density . . . medium and high - density crosslink pe foam , selected and sourced from recycled content to create a structure with minimum density of x to y . this density allows the materials to intimately conform to the subgrade , maintaining a semi - rigid structure while providing the necessary softness for impact attenuation . this density allows for the minimum of expansion and contraction related to the thermal coefficient of synthetic materials produced from pp , hdpe , and ildpe . spacing of drainage grooves . . . minimum groove spacing of 2 . 5 ″ oc to a maximum spacing of 3 ″ oc rhombus shaped grooves . . . to maximize transmissivity while maintaining intimate contact with the subgrade or membrane protection layer . drainage grooves are formed within the structure during the forming process in the machine direction , i . e . with the roll . these drainage grooves are removed or not formed from the structure on the outside edge of each side of the roll . this allows the invention to ultimately lay flat on the subgrade . this smooth edge allows rolls to easily be seamed or joined in the field if so desired . . . this smooth edge allows for ease of installation in the field . tensile strength . . . machine direction average values of 40 lbs / inch . . . md . cross machine average values of 39 lbs / inch . td using astm d 4595 . having thus described multiple illustrative embodiments of the invention , various alterations , modifications and improvements will readily occur to those skilled in the art . such alterations , modifications and improvements are intended to be within the scope and spirit of the invention . accordingly , the foregoing description is by way of example only and is not intended as limiting . the invention &# 39 ; s limit is defined only in the following claims and the equivalents thereto .	4
referring to fig1 and 2 , the bonding clip 10 of the present invention is illustrated . the bonding clip can be constructed from a continuous piece of metallic material , such as a piece of wire having a gauge that is capable of conducting electric current within specified ranges . example materials that can be used for the bonding clip include stainless steel , bronze , and copper . the bonding clip 10 has a bridge portion 12 that passes over the coupler , and the rise or height of the bridge portion 12 is defined by opposing leg portions 14 that can be selectively sized to provide a gap or clearance between the bridge portion 12 and the exterior surface of the coupler , as discussed further below . the legs 14 each connect to respective arcuate shaped contacts 16 . the arcuate shaped contacts 16 are mounted over and make frictional contact with the respective flanges of fluid conveying members joined by the coupler . the arcuate shaped contacts 16 also sized such that they maintain adequate frictional engagement with the respective flanges to prevent inadvertent shifting or movement of the bonding clip when installed . accordingly , the arcuate shaped contacts can be bent to a specified angularity and / or diameter such that the contacts 16 maintain adequate frictional engagement with the respective flanges . optionally , the ends of the bonding clip 10 may include respective bends 18 and distal extensions 20 that may assist a user in manipulating the bonding clip for mounting or for removal of the bonding clip . referring specifically to fig2 , it is shown that the arcuate shaped contacts 16 and leg portions 14 extend substantially linearly or planar , and the corners 22 interconnecting the ends of the bridge portion 12 and the respective leg portions 14 can be bent so that the leg portions 16 and contacts 16 are slightly angled toward one another . referring to fig3 and 4 , these figures illustrate the bonding clip 10 as if installed over a coupler . as best seen in fig4 , the leg portions 14 and contacts 16 extend more parallel to one another in which the bends formed at the corners 22 enable the clip to provide a compressive spring force against the ends of the coupler , as further discussed in reference to the other figures . in order to ensure a secure connection between the bonding clip 10 and the portions of the coupler contacted by the bonding clip , the particular angle at which the corners 22 are bent can be adjusted to provide an optimal spring force . the spacing and size of coupling components will differ among fluid conveying systems , and accordingly , the bend angles at the corners 22 may be modified to accommodate these different components . referring to fig5 and 6 , the bonding clip 10 is shown in a mounted position over a coupler 40 and secured to respective flanges 42 . the flanges 42 connect to the ends of respective fluid conveying lines ( not shown ). typically , the flanges 42 are connected to their respective fluid conveying tubes / members by swage connections . the type of coupler 40 illustrated in fig5 and 6 represents what has been referred to herein as a full circumferential coupler ; however , the coupler 40 is intended to represent any type of coupler used to interconnect to fluid conveying members . therefore , the particular configuration of the coupler 40 should not be deemed as limiting with respect to the bonding clip of the present invention . the design of the coupler 40 as illustrated more specifically corresponds to positive lock coupling designs , and one example of such a design is disclosed in the u . s . pat . no . 5 , 871 , 239 . this reference is incorporated herein by reference in its entirety for purposes of disclosing an example coupling device used to interconnect fluid conveying members , to specifically include those types of fluid conveying members especially adapted for conveying fuel . the coupler 40 includes a first coupler member 44 , a second coupler member or nut 46 , and a lock ring 48 used to lock or hold the first and second coupler members in place . as further shown in fig5 and 6 , the arcuate shaped contacts 16 are fitted over and frictionally engage the respective flanges 42 . the legs 14 extend radially away from the longitudinal axis of the coupler 40 , and to a distance that allows the bridge 12 to pass longitudinally over the coupler 40 . the lower ends of the legs 14 contact the opposite exposed side edges of the coupler 40 , and a compressive spring force is provided by the legs 14 that are urged normally toward one another . accordingly , also referring to fig7 and 8 , one leg 14 contacts the side edge 45 of the first coupler member 44 , and the other leg 14 contacts the opposite side edge 47 of the nut 46 . the bridge 12 of the bonding clip 10 should preferably not contact the coupler 40 so that the electrical charges to be conducted can be directly transferred between the connected fluid conveying members , and to prevent an inadvertent electrical path for the electrical charge to return to the coupler 40 . fig5 and 6 also illustrate the relatively unobtrusive mounting arrangement for the bonding clip 10 in which the profile of the coupler is not substantially altered , thereby enabling the bonding clip 10 to be used within tight spaces . in testing , it is been found that maintaining a clearance or gap of approximately 0 . 25 inch between the elements of the bonding clip and the coupler is adequate to prevent inadvertent arcing of electrical charge from the bridge of the bonding clip to the coupler in a typical installation ; however this dimension can be varied based on electrical current requirements for specific lightning waveforms . referring again to fig7 and 8 , cross - sectional views of the coupler 40 are illustrated for purposes of further viewing the spacial relationship between the bonding clip 10 and the coupler . as mentioned , the particular design of the coupler 40 illustrated is similar to that shown and described in u . s . pat . no . 5 , 871 , 239 ; however , it again shall be understood that the bonding clip 10 of the invention is not limited to use of any particular coupler design . the buildup of electrostatic charges is a consequence for the great majority of couplers that must maintain fluid tight seals to prevent leakage of fluid . a compressible element must typically be used to seal the coupler elements , such as use of compressible o - rings that have limited electrical conductivity . in the example of fig7 and 8 , o - rings ( not shown ) are placed within the peripheral grooves 54 of the flanges 42 . when installed , the o - rings provide a fluid tight seal between the flanges 42 and the interior surface of the first coupler member 44 . additional details are also illustrated in fig7 and 8 for the coupler 40 , namely , the presence of interiorly mounted bonding wires 52 for achieving electrical conductivity across the coupler 40 . the bonding wires 52 are held within respective retaining rings 53 and the retaining rings 53 are mounted within the respective annular grooves as shown . in the example coupler 40 , the interiorly mounted bonding wires may not be adequate for achieving the required electrical conductivity and the bonding clip 10 is therefore used to supplement bonding capabilities of the coupling to handle wider ranges of voltages and amperages . in the case of a coupler having no integral bonding wire components , the bonding clip of the present invention can be used as the single and primary means to dissipate electrostatic charge within the coupler . referring to fig9 and 10 , end views of the bonding clip 10 mounted to the flanges 42 are provided for better illustrating the manner in which the arcuate contacts 16 mount to their respective flanges , as well as to further illustrate the non - obtrusive manner in which the bonding clip resides in its mounted position . from these views , it is apparent that the cross - sectional profile of the coupler 40 is only altered by the relatively small height to which the bridge portion 12 extends above the coupler 40 . as also shown , the bends 18 and distal extensions 20 of the bonding clip are formed so that they do not protrude beyond the diameter of the coupler 40 . the invention also includes a method for dissipating electrostatic charge across a coupling used to interconnect fluid conveying members . according to the method , a bonding clip is provided , and is selectively mounted over a coupler / coupling used to interconnect fluid conveying members . the bonding clip includes two contact portions that contact the respective fluid conveying members or contact respective flanges of the fluid conveying members attached to confronting ends of the fluid conveying members . the bonding clip further includes a bridge portion that passes over the coupler , and is separated from the coupler to prevent contact between the coupler and bridge portion , and to prevent arcing of an electrostatic charge between the coupler and bonding clip . the contact portions of the bonding clip are secured to the respective fluid conveying members / flanges , and the bridge portion is therefore placed in a position such that it passes over the coupler and not in contact with the coupler . the bonding clip has two geometric configurations ; a first geometric configuration prior to being installed , and a second geometric configuration after installation in which one or more of the elements of the bonding clip deflect or bend . the second configuration results in the creation of a compressive spring force used to assist in maintaining the bonding clip in a securely mounted position to prevent undesirable shifting of the bonding clip when installed . there are a number of advantages to the bonding clip of the present invention . the bonding clip has a relatively simple construction , and can be conveniently mounted over standard fluid conveying couplers without the need for special installation tools . the bonding clip is a one - piece element ; therefore , there is no assembly or disassembly required . the bonding clip is easily visually inspected to ensure that the clip is properly installed . use of a geometrically configured wire material enables the particular shape of the bonding clip to be easily adapted for different types of couplers not only to achieve adequate frictional engagement with flanges of the fluid conveying lines , but also to provide different arrangements by which the bridge portion may pass over the coupler . although the bonding clip and method of the invention have been disclosed with respect to preferred embodiments , it is contemplated that the bonding clip and method can be modified commensurate with the scope of the claims appended hereto .	5
in fig1 of the accompanying drawings there is schematically depicted an overall view of a printhead assembly . fig2 shows the core components of the assembly in an exploded configuration . the printhead assembly 10 of the preferred embodiment comprises eleven printhead modules 11 situated along a metal “ invar ” channel 16 . at the heart of each printhead module 11 is a “ memjet ” chip 23 ( fig3 ). the particular chip chosen in the preferred embodiment has a six - color configuration . the “ memjet ” printhead modules 11 are comprised of the “ memjet ” chip 23 , a fine pitch flex pcb 26 and two micro - moldings 28 and 34 sandwiching a mid - package film 35 . each module 11 forms a sealed unit with independent ink chambers 63 ( fig9 ) which feed the chip 23 . the modules 11 plug directly onto a flexible elastomeric extrusion 15 which carries air , ink and fixative . the upper surface of the extrusion 15 has repeated patterns of holes 21 which align with ink inlets 32 ( fig3 a ) on the underside of each module 11 . the extrusion 15 is bonded onto a flex pcb ( flexible printed circuit board ). the fine pitch flex pcb 26 wraps down the side of each printhead module 11 and makes contact with the flex pcb 17 ( fig9 ). the flex pcb 17 carries two busbars 19 ( positive ) and 20 ( negative ) for powering each module 11 , as well as all data connections . the flex pcb 17 is bonded onto the continuous metal “ invar ” channel 16 . the metal channel 16 serves to hold the modules 11 in place and is designed to have a similar coefficient of thermal expansion to that of silicon used in the modules . a capping device 12 is used to cover the “ memjet ” chips 23 when not in use . the capping device is typically made of spring steel with an onsert molded elastomeric pad 47 ( fig1 a ). the pad 47 serves to duct air into the “ memjet ” chip 23 when uncapped and cut off air and cover a nozzle guard 24 ( fig9 ) when capped . a camshaft 13 that typically rotates throughout 180o actuates the capping device 12 . the overall thickness of the “ memjet ” chip is typically 0 . 6 mm which includes a 150 - micron inlet backing layer 27 and a nozzle guard 24 of 150 - micron thickness . these elements are assembled at the wafer scale . the nozzle guard 24 allows filtered air into an 80 - micron cavity 64 ( fig1 ) above the “ memjet ” ink nozzles 62 . the pressurized air flows through microdroplet holes 45 in the nozzle guard 24 ( with the ink during a printing operation ) and serves to protect the delicate “ memjet ” nozzles 62 by repelling foreign particles . a silicon chip backing layer 27 ducts ink from the printhead module packaging directly into the rows of “ memjet ” nozzles 62 . the “ memjet ” chip 23 is wire bonded 25 from bond pads on the chip at 116 positions to the fine pitch flex pcb 26 . the wire bonds are on a 120 - micron pitch and are cut as they are bonded onto the fine pitch flex pcb pads ( fig3 ). the fine pitch flex pcb 26 carries data and power from the flex pcb 17 via a series of gold contact pads 69 along the edge of the flex pcb . the wire bonding operation between chip and fine pitch flex pcb 26 may be done remotely , before transporting , placing and adhering the chip assembly into the printhead module assembly . alternatively , the “ memjet ” chips 23 can be adhered into the upper micro - molding 28 first and then the fine pitch flex pcb 26 can be adhered into place . the wire bonding operation could then take place in situ , with no danger of distorting the moldings 28 and 34 . the upper micro - molding 28 can be made of a liquid crystal polymer ( lcp ) blend . since the crystal structure of the upper micro - molding 28 is minute , the heat distortion temperature ( 180 ° c .- 260 ° c . ), the continuous usage temperature ( 200 ° c .- 240 ° c .) and soldering heat durability ( 260 ° c . for 10 seconds to 310 ° c . for 10 seconds ) are high , regardless of the relatively low melting point . each printhead module 11 includes an upper micro - molding 28 and a lower micro - molding 34 separated by a mid - package film layer 35 shown in fig3 . the mid - package film layer 35 can be an inert polymer such as polyimide , which has good chemical resistance and dimensional stability . the mid - package film layer 35 can have laser - ablated holes 65 and can comprise a double - sided adhesive ( i . e . an adhesive layer on both faces ) providing adhesion between the upper micro - molding , the mid - package film layer and the lower micro - molding . the upper micro - molding 28 has a pair of alignment pins 29 passing through corresponding apertures in the mid - package film layer 35 to be received within corresponding recesses 66 in the lower micro - molding 34 . this serves to align the components when they are bonded together . once bonded together , the upper and lower micro - moldings form a tortuous ink and air path in the complete “ memjet ” printhead module 11 . there are annular ink inlets 32 in the underside of the lower micro - molding 34 . in a preferred embodiment , there are six such inlets 32 for various inks ( black , yellow , magenta , cyan , fixative and infrared ). there is also provided an air inlet slot 67 . the air inlet slot 67 extends across the lower micro - molding 34 to a secondary inlet which expels air through an exhaust hole 33 , through an aligned hole 68 in fine pitch flex pcb 26 . this serves to repel the print media from the printhead during printing . the ink inlets 32 continue in the under surface of the upper micro - molding 28 as does a path from the air inlet slot 67 . the ink inlets lead to 200 - micron exit holes also indicated at 32 in fig3 . these holes correspond to the inlets on the silicon backing layer 27 of the “ memjet ” chip 23 . there is a pair of elastomeric pads 36 on an edge of the lower micro - molding 34 . these serve to take up tolerance and positively located the printhead modules 11 into the metal channel 16 when the modules are micro - placed during assembly . a preferred material for the “ memjet ” micro - moldings is a lcp . this has suitable flow characteristics for the fine detail in the moldings and has a relatively low coefficient of thermal expansion . robot picker details are included in the upper micro - molding 28 to enable accurate placement of the printhead modules 11 during assembly . the upper surface of the upper micro - molding 28 as shown in fig3 has a series of alternating air inlets and outlets 31 . these act in conjunction with the capping device 12 and are either sealed off or grouped into air inlet / outlet chambers , depending upon the position of the capping device 12 . they connect air diverted from the inlet slot 67 to the chip 23 depending upon whether the unit is capped or uncapped . a capper cam detail 40 including a ramp for the capping device is shown at two locations in the upper surface of the upper micro - molding 28 . this facilitates a desirable movement of the capping device 12 to cap or uncap the chip and the air chambers . that is , as the capping device is caused to move laterally across the print chip during a capping or uncapping operation , the ramp of the capper cam detail 40 serves to elastically distort the capping device as it is moved by operation of the camshaft 13 so as to prevent scraping of the device against the nozzle guard 24 . the “ memjet ” chip assembly 23 is picked and bonded into the upper micro - molding 28 on the printhead module 11 . the fine pitch flex pcb 26 is bonded and wrapped around the side of the assembled printhead module 11 as shown in fig4 . after this initial bonding operation , the chip 23 has more sealant or adhesive 46 applied to its long edges . this serves to “ pot ” the bond wires 25 ( fig6 ), seal the “ memjet ” chip 23 to the molding 28 and form a sealed gallery into which filtered air can flow and exhaust through the nozzle guard 24 . the flex pcb 17 carries all data and power connections from the main pcb ( not shown ) to each “ memjet ” printhead module 11 . the flex pcb 17 has a series of gold plated , domed contacts 69 ( fig2 ) which interface with contact pads 41 , 42 and 43 on the fine pitch flex pcb 26 of each “ memjet ” printhead module 11 . two copper busbar strips 19 and 20 , typically of 200 - micron thickness , are jigged and soldered into place on the flex pcb 17 . the busbars 19 and 20 connect to a flex termination which also carries data . the flex pcb 17 is approximately 340 mm in length and is formed from a 14 mm wide strip . it is bonded into the metal channel 16 during assembly and exits from one end of the printhead assembly only . the metal u - channel 16 into which the main components are placed is of a special alloy called “ invar 36 ”. it is a 36 % nickel iron alloy possessing a coefficient of thermal expansion of 1 / 10 th that of carbon steel at temperatures up to 400 ° f . the invar is annealed for optimal dimensional stability . additionally , the invar is nickel plated to a 0 . 056 % thickness of the wall section . this helps further to match it to the coefficient of thermal expansion of silicon which is 2 × 10 − 6 per ° c . the invar channel 16 functions to capture the “ memjet ” printhead modules 11 in a precise alignment relative to each other and to impart enough force on the modules 11 so as to form a seal between the ink inlets 32 on each printhead module and the outlet holes 21 that are laser ablated into the elastomeric ink delivery extrusion 15 . the similar coefficient of thermal expansion of the invar channel to the silicon chips allows similar relative movement during temperature changes . the elastomeric pads 36 on one side of each printhead module 11 serve to “ lubricate ” them within the channel 16 to take up any further lateral coefficient of thermal expansion tolerances without losing alignment . the invar channel is a cold rolled , annealed and nickel - plated strip . apart from two bends that are required in its formation , the channel has two square cut - outs 80 at each end . these mate with snap fittings 81 on the printhead location moldings 14 ( fig1 ). the elastomeric ink delivery extrusion 15 is a non - hydrophobic , precision component . its function is to transport ink and air to the “ memjet ” printhead modules 11 . the extrusion is bonded onto the top of the flex pcb 17 during assembly and it has two types of molded end caps . one of these end caps is shown at 70 in fig1 a . a series of patterned holes 21 are present on the upper surface of the extrusion 15 . these are laser ablated into the upper surface . to this end , a mask is made and placed on the surface of the extrusion , which then has focused laser light applied to it . the holes 21 are evaporated from the upper surface , but the laser does not cut into the lower surface of extrusion 15 due to the focal length of the laser light . eleven repeated patterns of the laser - ablated holes 21 form the ink and air outlets 21 of the extrusion 15 . these interface with the annular ring inlets 32 on the underside of the “ memjet ” printhead module lower micro - molding 34 . a different pattern of larger holes ( not shown but concealed beneath the upper plate 71 of end cap 70 in fig1 a ) is ablated into one end of the extrusion 15 . these mate with apertures 75 having annular ribs formed in the same way as those on the underside of each lower micro - molding 34 described earlier . ink and air delivery hoses 78 are connected to respective connectors 76 that extend from the upper plate 71 . due to the inherent flexibility of the extrusion 15 , it can contort into many ink connection mounting configurations without restricting ink and air flow . the molded end cap 70 has a spine 73 from which the upper and lower plates are integrally hinged . the spine 73 includes a row of plugs 74 that are received within the ends of the respective flow passages of the extrusion 15 . the other end of the extrusion 15 is capped with simple plugs which block the channels in a similar way as the plugs 74 on spine 17 . the end cap 70 clamps onto the ink extrusion 15 by way of snap engagement tabs 77 . once assembled with the delivery hoses 78 , ink and air can be received from ink reservoirs and an air pump , possibly with filtration means . the end cap 70 can be connected to either end of the extrusion , i . e . at either end of the printhead . the plugs 74 are pushed into the channels of the extrusion 15 and the plates 71 and 72 are folded over . the snap engagement tabs 77 clamp the molding and prevent it from slipping off the extrusion . as the plates are snapped together , they form a sealed collar arrangement around the end of the extrusion . instead of providing individual hoses 78 pushed onto the connectors 76 , the molding 70 might interface directly with an ink cartridge . a sealing pin arrangement can also be applied to this molding 70 . for example , a perforated , hollow metal pin with an elastomeric collar can be fitted to the top of the inlet connectors 76 . this would allow the inlets to automatically seal with an ink cartridge when the cartridge is inserted . the air inlet and hose might be smaller than the other inlets in order to avoid accidental charging of the airways with ink . the capping device 12 for the “ memjet ” printhead would typically be formed of stainless spring steel . an elastomeric seal or onsert molding 47 is attached to the capping device as shown in fig1 a and 12 b . the metal part from which the capping device is made is punched as a blank and then inserted into an injection molding tool ready for the elastomeric onsert to be shot onto its underside . small holes 79 ( fig1 b ) are present on the upper surface of the metal capping device 12 and can be formed as burst holes . they serve to key the onsert molding 47 to the metal . after the molding 47 is applied , the blank is inserted into a press tool , where additional bending operations and forming of integral springs 48 takes place . the elastomeric onsert molding 47 has a series of rectangular recesses or air chambers 56 . these create chambers when uncapped . the chambers 56 are positioned over the air inlet and exhaust holes 30 of the upper micro - molding 28 in the “ memjet ” printhead module 11 . these allow the air to flow from one inlet to the next outlet . when the capping device 12 is moved forward to the “ home ” capped position as depicted in fig1 , these airways 32 are sealed off with a blank section of the onsert molding 47 cutting off airflow to the “ memjet ” chip 23 . this prevents the filtered air from drying out and therefore blocking the delicate “ memjet ” nozzles . another function of the onsert molding 47 is to cover and clamp against the nozzle guard 24 on the “ memjet ” chip 23 . this protects against drying out , but primarily keeps foreign particles such as paper dust from entering the chip and damaging the nozzles . the chip is only exposed during a printing operation , when filtered air is also exiting along with the ink drops through the nozzle guard 24 . this positive air pressure repels foreign particles during the printing process and the capping device protects the chip in times of inactivity . the integral springs 48 bias the capping device 12 away from the side of the metal channel 16 . the capping device 12 applies a compressive force to the top of the printhead module 11 and the underside of the metal channel 16 . an eccentric camshaft 13 mounted against the side of the capping device governs the lateral capping motion of the capping device 12 . it pushes the device 12 against the metal channel 16 . during this movement , the bosses 57 beneath the upper surface of the capping device 12 ride over the respective ramps 40 formed in the upper micro - molding 28 . this action flexes the capping device and raises its top surface to raise the onsert molding 47 as it is moved laterally into position onto the top of the nozzle guard 24 . the camshaft 13 , which is reversible , is held in position by two printhead location moldings 14 . the camshaft 13 can have a flat surface built in one end or be otherwise provided with a spline or keyway to accept gear 22 or another type of motion controller . 1 . the “ memjet ” chip 23 is dry tested in flight by a pick and place robot , which also dices the wafer and transports individual chips to a fine pitch flex pcb bonding area . 2 . when accepted , the “ memjet ” chip 23 is placed 530 microns apart from the fine pitch flex pcb 26 and has wire bonds 25 applied between the bond pads on the chip and the conductive pads on the fine pitch flex pcb . this constitutes the “ memjet ” chip assembly . 3 . an alternative to step 2 is to apply adhesive to the internal walls of the chip cavity in the upper micro - molding 28 of the printhead module and bond the chip into place first . the fine pitch flex pcb 26 can then be applied to the upper surface of the micro molding and wrapped over the side . wire bonds 25 are then applied between the bond pads on the chip and the fine pitch flex pcb . 4 . the “ memjet ” chip assembly is vacuum transported to a bonding area where the printhead modules are stored . 5 . adhesive is applied to the lower internal walls of the chip cavity and to the area where the fine pitch flex pcb is going to be located in the upper micro - molding of the printhead module . 6 . the chip assembly ( and fine pitch flex pcb ) are bonded into place . the fine pitch flex pcb is carefully wrapped around the side of the upper micro - molding so as not to strain the wire bonds . this may be considered as a two - step gluing operation if it is deemed that the fine pitch flex pcb might stress the wire bonds . a line of adhesive running parallel to the chip can be applied at the same time as the internal chip cavity walls are coated . this allows the chip assembly and fine pitch flex pcb to be seated into the chip cavity and the fine pitch flex pcb allowed to bond to the micro - molding without additional stress . after curing , a secondary gluing operation could apply adhesive to the short side wall of the upper micro - molding in the fine pitch flex pcb area . this allows the fine pitch flex pcb to be wrapped around the micro - molding and secured , while still being firmly bonded in place along on the top edge under the wire bonds . 7 . in the final bonding operation , the upper part of the nozzle guard is adhered to the upper micro - molding , forming a sealed air chamber . adhesive is also applied to the opposite long edge of the “ memjet ” chip , where the bond wires become ‘ potted ’ during the process . 8 . the modules are ‘ wet ’ tested with pure water to ensure reliable performance and then dried out . 9 . the modules are transported to a clean storage area , prior to inclusion into a printhead assembly , or packaged as individual units . this completes the assembly of the “ memjet ” printhead module assembly . 10 . the metal invar channel 16 is picked and placed in a jig . 11 . the flex pcb 17 is picked and primed with adhesive on the busbar side , positioned and bonded into place on the floor and one side of the metal channel . 12 . the flexible ink extrusion 15 is picked and has adhesive applied to the underside . it is then positioned and bonded into place on top of the flex pcb 17 . one of the printhead location end caps is also fitted to the extrusion exit end . this constitutes the channel assembly . 13 . the channel assembly is transported to an excimir laser ablation area . 14 . the assembly is put into a jig , the extrusion positioned , masked and laser ablated . this forms the ink holes in the upper surface . 15 . the ink extrusion 15 has the ink and air connector molding 70 applied . pressurized air or pure water is flushed through the extrusion to clear any debris . 16 . the end cap molding 70 is applied to the extrusion 15 . it is then dried with hot air . 17 . the channel assembly is transported to the printhead module area for immediate module assembly . alternatively , a thin film can be applied over the ablated holes and the channel assembly can be stored until required . 18 . the channel assembly is picked , placed and clamped into place in a transverse stage in the printhead assembly area . 19 . as shown in fig1 , a robot tool 58 grips the sides of the metal channel and pivots at pivot point against the underside face to effectively flex the channel apart by 200 to 300 microns . the forces applied are shown generally as force vectors f in fig1 . this allows the first “ memjet ” printhead module to be robot picked and placed ( relative to the first contact pads on the flex pcb 17 and ink extrusion holes ) into the channel assembly . 20 . the tool 58 is relaxed , the printhead module captured by the resilience of the invar channel and the transverse stage moves the assembly forward by 19 . 81 mm . 21 . the tool 58 grips the sides of the channel again and flexes it apart ready for the next printhead module . 22 . a second printhead module 11 is picked and placed into the channel 50 microns from the previous module . 23 . an adjustment actuator arm locates the end of the second printhead module . the arm is guided by the optical alignment of fiducials on each strip . as the adjustment arm pushes the printhead module over , the gap between the fiducials is closed until they reach an exact pitch of 19 . 812 mm . 24 . the tool 58 is relaxed and the adjustment arm is removed , securing the second printhead module in place . 25 . this process is repeated until the channel assembly has been fully loaded with printhead modules . the unit is removed from the transverse stage and transported to the capping assembly area . alternatively , a thin film can be applied over the nozzle guards of the printhead modules to act as a cap and the unit can be stored as required . 26 . the printhead assembly is transported to a capping area . the capping device 12 is picked , flexed apart slightly and pushed over the first module 11 and the metal channel 16 in the printhead assembly . it automatically seats itself into the assembly by virtue of the bosses 57 in the steel locating in the recesses 83 in the upper micro - molding in which a respective ramp 40 is located . 27 . subsequent capping devices are applied to all the printhead modules . 28 . when completed , the camshaft 13 is seated into the printhead location molding 14 of the assembly . it has the second printhead location molding seated onto the free end and this molding is snapped over the end of the metal channel , holding the camshaft and capping devices captive . 29 . a molded gear 22 or other motion control device can be added to either end of the camshaft 13 at this point . 30 . the capping assembly is mechanically tested . 31 . the printhead assembly 10 is moved to the testing area . inks are applied through the “ memjet ” modular printhead under pressure . air is expelled through the “ memjet ” nozzles during priming . when charged , the printhead can be electrically connected and tested . 32 . electrical connections are made and tested as follows : 33 . power and data connections are made to the pcb . final testing can commence , and when passed , the “ memjet ” modular printhead is capped and has a plastic sealing film applied over the underside that protects the printhead until product installation .	1
a very narrow - band krf laser utilizing the features of the present invention is described below : the discharge chamber 8 of a preferred embodiment of the present invention , shown in fig3 a , is the same as prior art discharge chambers . the chamber 8 is a vessel , designed to hold several atmospheres of corrosive gases . a discharge region is defined by the two electrodes 6 separated by a gap of 1 . 2 to 2 . 5 cm . the cathode is supported by an insulating structure since it is connected to the high voltage , while the anode is attached to the metal chamber which is at ground potential . preionization is done by corona discharge preionizers located on either side of the discharge region . due to the corrosive nature of the laser gas , the chambers use particular metals chosen to resist fluorine attack . the fluorine gas however , still reacts with the chamber internal parts such as chamber walls and electrodes , thus consuming fluorine and generating metal fluoride contaminants . metal fluoride dust is trapped by means of an electrostatic precipitator not shown . a small amount of laser gas is extracted from the chamber and is passed over negatively charged high field wires to trap the dust . the dust - free gas is then released over the windows to keep them clean . this preferred embodiment utilizes a solid state pulsed power module ( ssppm ) circuit shown in fig3 b . it switches the energy of capacitor c 0 charged by a 1 kv power supply into a pulse compression circuit formed by capacitors c 1 , c 2 , c 3 , a step - up transformer , and three saturable inductors l 1 , l 2 and l 3 . the operation of this circuit is as follows . the dc charge stored on c 0 is switched through the scr and the inductor l 0 into c 1 . the saturable inductor , l 1 , holds off the voltage on c 1 for approximately 2 . 5 μs and then becomes conducting , allowing the transfer of charge from c 1 to c 2 . the second saturable inductor , l 2 , holds off the voltage on c 2 for approximately 500 ns and then allows the charge on c 2 to flow through the primary of 1 : 20 step - up transformer . the output from the step - up transformer is stored on c 3 until the saturable inductor l 3 becomes conducting in approximately 100 - 150 ns . the charge is then finally transferred through l 3 into c p and laser discharge occurs . spectral narrowing of a krf laser is complicated by its short pulse duration ( 15 to 25 ns , fwhm ) and uv wavelength . the short pulse results in very high intra - cavity power (˜ 1 mw / cm 2 ), and the short wavelength can thermally distort optical materials due to their high absorption co - efficient at 248 nm . also , the total number of round trips through the resonator ( which includes the line narrowing optical elements ) for a typical laser is small , about 3 to 5 . if the single pass line width through the resonator is denoted by δλ 1 , then an estimate of the final line width δλ f after n passes is given by : ## equ1 ## therefore , the single pass line width of the optical system is only about a factor of two higher than the final line width . therefore , the efficiency of converting the broadband spectrum to line narrowed spectrum ( i . e . from 300 pm to & lt ; 1 pm ) of the optical system must be very high . the common technique of line - narrowing the krf laser is by introducing wavelength dispersive optical elements in the resonator . three types of dispersive elements can be used : prisms , etalons and gratings . the use of a high dispersive grating in a littrow configuration has been the most effective spectral line narrowing technique . because the grating is a dispersive element , to get a narrow line - width , the laser beam should have a small divergence where the beam illuminates the grating . three prisms beam expanders 30 , 32 and 34 as shown in fig5 are inserted in the line narrowing module in order to expand the beam and thus reduce its divergence . two apertures at both ends of the laser ( not shown ) are used to further reduce divergence . the principal elements of a preferred line narrowing module are shown in fig5 . these include three prisms 30 , 32 and 34 , a tuning mirror 36 , and an eschelle grating 38 . the mirror is pivoted to select the wavelength of the laser . when this line - narrowing module 18 is used as the only line selecting module , the linewidth of krf laser can be reduced to about 0 . 8 pm ( fwhm ) and 3 . 0 pm ( 95 %). the use of the etalon output coupler 44 permits further reduction of the bandwidth of the laser . a tunable etalon is an etalon , the free spectral range ( fsr ) of which can be adjusted . fsr is determined by : ## equ2 ## where : n = refractive index of the gas in the gap commercially available tunable etalons consist of two parallel plates with a space between them . that space is filled with air , nitrogen , or other suitable gas . the fsr can be changed by either changing the size of air space gap , or changing the gas pressure in the gap , and thus changing refractive index n in formula ( 2 ). the preferred etalon output coupler has a reflectivity of the plates of about 4 %. in this embodiment , the gas is nitrogen with an n of 1 . 0003 . the gap size is about 15 mm and the wavelength is about 248 nm . in this case , the total reflectivity of the etalon is determined by an interference of the light waves , reflected from both parallel surfaces and is shown in fig6 as a function of wavelength . for comparison , a curve a in fig2 shows transmission of the same etalon . the minimum reflection is about 0 % and the maximum is about 15 %. if one of the reflection peaks is matched to the grating maximum , then about 15 % of the light at the grating maximum is reflected ( 85 % is transmitted ). portions of the beam which are higher or lower in wavelength than the grating maximum by about 1 pm are not reflected at all . light which deviates from the grating maximum by about 2 pm would be reflected at about 15 %. however , the grating is effective in controlling about 95 % of the light to within about 1 . 5 pm of the grating maximum . therefore , for the best line - narrowing , one of the maximums of the etalon reflection should be at the same wavelength as the maximum reflection of the grating in line narrowing module as shown in fig7 . in this case , the laser will generate at the central wavelength λ 0 , and it will have the minimum line - width as wavelength selection effects of the etalon adds to the wavelength selection effects of the grating . when the laser wavelength needs to be changed , the mirror 36 is tuned at the different angle , thus moving the maximum of diffraction grating reflection to a different λ 0 &# 39 ;. the etalon output coupler then needs to be tuned also , so that the new center wavelength λ 0 &# 39 ; coincides with one of the etalon maximums . the reader should understand that this etalon is considerably different from the more conventional &# 34 ; transmissive &# 34 ; etalon . in the latter case , the reflectivity of the parallel plates is chosen between 20 % and 99 % of the light , and the line - narrowing is done for the transmitted light through the etalon . the multiple reflections ( about 5 to 50 ) of the light between the parallel plates greatly increases the light intensity inside the etalon , thus causing a number of serious problems when high power laser operation is required . such problems include , for example , thermal distortions of the beam , failure of the reflective coatings , etc . all these problems are insignificant in the etalon output coupler of the present invention because there is no multiple reflection of the light between the parallel plates . instead , essentially single reflection from one plate interferes with a single reflection from the other plate . the preferred technique for tuning etalon is shown by reference to fig4 a , 9b , 9c and 10 . fig1 shows the distribution of the laser spectrum across the output beam of laser 2 when line narrowed by line narrowing module 18 . each curve is a spectrum of the laser light when only small vertical slice of the beam is cut . one can see , that the spectrum of the left side of the beam is shifted towards smaller wavelengths , while the spectrum of the right side of the beam is shifted toward larger wavelengths . fig4 shows the elements of a preferred output coupler . the output coupler comprises etalon 44 , aperture 45 and three partially reflecting mirrors 46 , 47 and 48 , each of them reflecting less than 1 % of the light . the light 55 coming from the chamber goes through the partially reflecting mirror 46 and through the aperture 45 . aperture 45 determines the output size of the beam and in the preferred embodiment is about 3 . 5 mm × 16 mm . then the light hits the etalon output coupler 44 . spectrally line - narrowed light is reflected from the etalon back to the laser chamber for further amplification . small portion of that light is reflected by partial reflector 46 and directed to photo - diode array 52 . the photodiode array is positioned to measure the horizontal beam profile . here and everywhere in this patent we assume the vertical plane is the plane passing through both the cathode and the anode of the laser , and the horizontal plane is perpendicular to it . the rest of the light goes through the etalon and is shown as 50 . small portion of that light is reflected by partial reflectors 47 and 48 . partially reflected mirror 47 reflects less than 1 % of the light to the photo diode array 51 . this array 51 measures the horizontal beam profile of the transmitted light . the information on transmitted and reflected beam profiles is transmitted from arrays 51 and 52 to the computer controller 22 ( fig3 a ). this controller measures relative position of reflected and transmitted profiles . fig9 shows three different situations . fig9 a is when the etalon is tuned to the same wavelength λ as the grating . fig9 b and 9c show the situation when there is a small misalignment between the etalon and diffraction grating . one can see that small misalignment causes shift of the reflected beam profile relative to transmitted beam profile . in fig9 the shift of reflected light to the right is when the maximum of the etalon is at a slightly larger wavelength then the maximum of the grating . the shift of reflected light to the left is when the maximum of the etalon is at a slightly smaller wavelength . these beam profiles are analyzed by a computer controller 22 , and the error correction signal is generated . in the situation of fig9 b , it generates the correction signal to reduce the optical length between the plates of the etalon , and in the situation of fig9 c it generates the correction signal to increase the optical length . the author of the present invention used a pressure tuned etalon with a space between the plates of about 15 mm to spectrally line - narrowed krf excimer laser . the detection technique of the present invention was capable of detecting the misalignment of the grating and the etalon to better than 0 . 1 pm which satisfies the requirements for micro - lithography . the minimum pressure adjustment used was about 0 . 5 torr , which shifts the etalon to about 0 . 05 pm . very stable operation of the laser with a bandwidth of less than 0 . 4 pm ( fwhm ) and 1 . 0 pm ( 95 % integral ) was achieved . the position of the laser center wavelength was controlled by using a wavemeter 20 which measures the absolute wavelength of the emitted light and this value is used by computer controller 22 to position the reflecting mirror 36 in the line - narrowing module ( fig7 ). thus the tuning of the laser was done in a &# 34 ; master - slave &# 34 ; mode , where the master control of the central wavelength was done by a mirror 36 ( fig7 ), and the ` slave ` control of the etalon was done based on optimizing beam profiles of reflected and transmitted beams . when such a beam as is shown in fig1 hits the etalon , the left and right portions of the beam will be reflected depending on the tuning of the etalon . if the etalon is tuned correctly , then the maximum reflectivity will be for the central part of the beam , which has a wavelength close to central wavelength λ of the laser . the left and right parts of the beam will have their wavelengths detuned slightly from the center , so they will have somewhat smaller reflection from the etalon . that reduction of the reflection is about the same for both left and right sides of the beam , so there is no overall shift of the reflected beam profile . on the other side , when the etalon detuned slightly , the center part of the beam would have small detuning from the maximum position of the etalon . one side ( for example , left ) would have even larger detuning , but the other side ( right ) would be right at the etalon maximum position . therefore , the right side would have the maximum reflection , the center would have smaller reflection , and the left side would have the smallest reflection . this will effectively shift the reflected beam profile to the right . on the other hand , the shift in the output beam of the laser is rather small as it was experimentally observed . this can be understood , if one remembers , that in transmitted light , the relative difference between the maximum and the minimum is very small , as the maximum is 100 %, and the minimum is 85 %, while in reflected light the relative difference is much larger , as the maximum is 15 %, but the minimum is 0 %. fig8 shows a second preferred embodiment of the present invention . in this embodiment , a single partially reflecting mirror 46 is used to collect a small portion of the incident light on the etalon as well as reflected spectrally line - narrowed light . in this embodiment , the beam profiles of the incident and reflected beams are compared rather than transmitted and reflected beams . the rest of the technique is similar to the first preferred embodiment . although this very narrow band laser has been described with reference to a particular embodiment , it is to be appreciated that various adaptations and modifications may be made . for example , the techniques described for use on a krf laser which operates at a nominal wavelength can also be applied to arf lasers ; however , the optics must be designed for 193 nm . in addition , to pressure - tuned etalons and piezoelectric - tuned etalons , there are commercially available etalons which are compression - tuned using mechanical force to widen or narrow the gap between the plates of the etalon . etalons with reflectances other than 4 % could be used . preferably , however , the reflectance of the reflecting surfaces should be between about 2 and about 20 %. persons skilled in the art will recognize that the grating based line narrowing module described above could be replaced with many other prior art line narrowing modules , such as modules comprised of a plurality of prisms and a totally reflecting mirror , a diffraction grating without beam expanders , and a diffraction grating and a totally reflecting mirror . transmissive etalons could also be included in the line narrowing module . therefore , the invention is only to be limited by the appended claims .	7
during the normal operation of the storage controller , certain events , called unsolicited events , may occur . unsolicited events include unsolicited status , such as a state change or an attention interrupt , and unsolicited sense , such as a redrive sense when a failover occurs or a service information message ( sim ) sense when a hardware failure threshold is reached . when the storage controller generates an unsolicited sense , it uses internal resources , such as buffers , in which to store information related to the unsolicited sense . the buffers are subsequently freed up when the lpar in the host sends a sense command to the storage controller to retrieve the unsolicited sense data . the application software being executed in the lpar might handle the unsolicited status like unit check for sense data presentation properly , but may not take the steps necessary to close the unsolicited event , such as sending a sense command to the storage control unit to retrieve the sense data . the resources in the storage controller which were used to build the sense data would not be freed . eventually , the storage controller may run out of resources if all of the buffers remain allocated , preventing new sense data from being built . after an lpar has undergone its ipl , a running application may only need to be aware of certain unsolicited events which occur in the storage controller or attached devices but not all of them . for example , the application may only need to be aware of state change interrupts of devices in a peer - to - peer remote copy ( pprc ) relationship . however , the storage controller currently transmits information about all unsolicited events to the lpar . and if , as noted above , the application fails to direct that the sense data in the storage controller be freed , resources in the storage controller may become limited and prevent further sense data from being generated . fig1 is a block diagram of a data processing system 100 in which the present invention may be implemented . the system 100 includes one or more hosts , collectively represented by a host 110 , one or more storage controllers , collectively represented by a storage controller 120 , and one or more storage devices , collectively represented by the storage device 140 . the storage device 140 may be any type of storage device , such as hard disk drives , or a combination of devices . the host 110 includes a memory 112 for storing computer - readable code containing program instructions and a processor 114 which executes the instructions stored in the memory 112 . the host 110 can create multiple logical partitions ( lpars ), two of which are illustrated in fig1 as 116 a and 116 b . each lpar 116 a , 116 b is capable of running one or more applications 118 a , 118 b , respectively . the storage controller 120 includes a memory 122 for storing computer - readable code containing program instructions and a processor 124 which executes the instructions stored in the memory 122 . the storage controller also includes host adapters , represented by a host adapter 126 , through which communications with the host 110 pass , and device adapters , represented by a device adapter 128 , through which communications with the storage device 140 pass . the storage controller 120 further includes one or more buffers 130 for storing unsolicited events and a data structure 500 containing an indication of which unsolicited events an application , such as the application 118 a , is to be made aware . the buffers 130 or data structure 500 , or both , may be stored in the memory 122 or may be stored in other memory . a method of the present invention will now be described with reference to the flowcharts of fig2 and 3 . the method may be executed by the processors 114 , 124 from program instructions stored in the memory devices 112 , 122 , may performed by hardware , such as asics in the host 110 and storage controller 120 , or by any combination . an ipl is performed on the lpar 116 a ( step 200 ) and the application 118 a commences on the lpar 116 a ( step 202 ). the application 118 a then specifies the unsolicited events of which it is to be notified ( step 204 ). unsolicited events from which the application 118 a may select may include , but are not limited to , pprc - related state change interrupts , device state change interrupts , attention interrupts , multipath lock facility attention interrupts , service information message sense , pprc - related sense , warmstart - related sense , failover - related sense and failback - related state changes . the application 118 a may select any , all or none of the possible unsolicited events , depending on the needs of the application 118 a . after the unsolicited events are selected , the lpar 116 a transmits a command to the storage controller 120 containing an indication of which unsolicited events have been selected ( step 206 ). the storage controller 120 receives the command ( step 300 , fig3 ) and stores the information in the data structure 400 ( step 302 ). the data structure 400 may be a bit map , as illustrated in fig4 , in which each bit represents one of the possible unsolicited events . a bit in a first state , such as logical 1 , indicates that the unsolicited event represented by the bit is among those selected by the application 118 a . conversely , a bit in a second state , such as logical 0 , indicates that the unsolicited event represented by the bit is not among those selected by the application 118 a . it will be appreciated that a logical 0 may be used to indicate that an unsolicited event is one which has been selected by the application 118 a . instead of specifying individual unsolicited events , the command may include suborders which indicate which of several categories of unsolicited status events are to be allowed or to be disallowed . categories may include ( but are not limited to ), for example , all unsolicited events related to pprc , multi - path lock facility ( mplf ), sense changes related to device status , and state changes related to device status . it will also be appreciated that other types of data structures , such as a lookup table , parameter flags or any other structure to indicate the identity of which unsolicited events are allowed or disallowed , may be used instead of the bitmap . moreover , the data structure may have a default state to be used if the lpar does not transmit a selection command . the default state may indicate that all of the possible unsolicited events or categories have been selected ; alternatively , the default state may indicate that none of the possible unsolicited events or categories have been selected . it will be appreciated that the default state may indicate any other combination of selected and unselected unsolicited events and categories . upon the occurrence of an unsolicited event in the storage controller 120 ( step 304 ), a determination is made as to whether the unsolicited event ( or the group of which the unsolicited event is a member ) is one which is indicated in the data structure 400 as having been selected by the application 118 a ( step 306 ). if so , information about the unsolicited event is transmitted to the lpar 116 a ( step 310 ); otherwise , the information prevented from being transmitted ( step 312 ). in this manner , the application 118 a only receives information about those specific unsolicited events which it has requested and resources are not wasted on other unsolicited events . additionally , if , while the application 118 a is running on the lpar 116 a , the needs of the application 118 a change , the lpar 116 a may send a new command to the storage controller 120 with an updated request to reselect unsolicited events . the data structure will then be updated and the modification can take immediate effect without performing a new ipl . thus , individual lpar applications are able to fine tune event presentations . it is important to note that while the present invention has been described in the context of a fully functioning data processing system , those of ordinary skill in the art will appreciate that the processes of the present invention are capable of being distributed in the form of a computer readable medium of instructions and a variety of forms and that the present invention applies regardless of the particular type of signal bearing media actually used to carry out the distribution . examples of computer readable media include recordable - type media such as a floppy disk , a hard disk drive , a ram , and cd - roms and transmission - type media . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art . the embodiment was chosen and described in order to best explain the principles of the invention , the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . moreover , although described above with respect to methods and systems , the need in the art may also be met with a method for deploying computing infrastructure comprising integrating computer readable code into a computing system for managing a logical partition .	6
referring now to fig1 , there is shown a perspective view illustrating the present invention and showing an infant care apparatus 10 constructed in accordance with the present invention . although the invention is shown and described specifically in relation to an infant care apparatus , it will be seen that the present invention can be applicable to other types of patient care apparatus , including other types of infant care apparatus , and still carry out the purposes of the present invention . in fig1 , therefore , the infant care apparatus 10 includes a canopy 12 shown in its upper position . the infant care apparatus 10 is but one example of an infant care apparatus , such as an incubator or infant warmer , and will be described herein as an apparatus that can function both as an incubator when the canopy 12 is in a lower position and an infant warmer when the canopy 12 is in its upper position as shown in fig1 . the apparatus itself can be of the type that is shown and described in u . s . pat . no . 6 , 231 , 499 of jones entitled lift mechanism for infant care apparatus canopy and u . s . pat . no . 6 , 585 , 636 of jones et al and entitled heater door mechanism for infant warming apparatus , and the disclosures of those u . s . patents are hereby incorporated herein by reference in their entirety . as shown , the infant care apparatus 10 includes an infant pedestal 14 that underlies and supports an infant . as is also seen , a plurality of walls 16 are provided to contain the infant safely within the infant care apparatus 10 and are located at all of the four sides of the infant pedestal 14 . the walls 16 are preferable constructed of transparent plastic material and , as will be explained , cooperate with other components in order to provide an incubator function to the infant care apparatus 10 when the infant care apparatus 10 is functioning as an incubator . the infant pedestal 14 is mounted to a moveable vertical base member 18 which , in the preferred embodiment , is movably affixed to a stationary vertical base member 20 , which , in turn , is mounted to a base 22 having wheels 24 for ready movement of the infant care apparatus 10 . the vertical movable base member 18 is preferably mounted so that the user can adjust the height of the infant pedestal 14 by raising and lowering the movable vertical member 18 as desired , thus the infant pedestal 14 can be adjusted to the preferred height by the user . as further standard features , the walls may have handholes ( not shown ) to afford access to the infant 26 when in the incubator configuration and which generally have doors 28 that can be opened to obtain access to the infant 26 and , of course , closed when the particular intervention has been completed to preserve the desired environment surrounding the infant . another convenient feature includes a drawer 30 to retain supplies or other devices needed to carry out some operation on the infant and which is normally located beneath the infant pedestal 14 . other features include the maneuverability of the walls 16 that are pivotally mounted at their bases to the infant pedestal 14 such that the doors can be swung outwardly and downwardly and , as a further alternative , can be easily fully removed from the infant pedestal 14 . as such , therefore , when the canopy 12 of the infant warming apparatus 10 is in its upper position as shown in fig1 , the walls 16 can be dropped downwardly or removed altogether so that the attending personnel can have unlimited access to an infant resting on the infant pedestal 14 to perform interventions on that infant . further structural components of the infant warming apparatus 10 include stationary frame members 32 that are affixed to the base member 18 and , as shown , there are two vertical stationary frame members 32 in the preferred embodiment although there may be only one or there may be further numbers of such members . two vertical movable frame members 34 are movably fitted into the stationary frame members 32 and which can be moved upwardly and downwardly by the user in converting the infant care apparatus 10 between its function as an incubator and its function as an infant warmer . a control module 36 is conveniently positioned intermediate the stationary frame members 32 and may include displays of various monitored parameters as well as include the various controls for operation of the functions of the infant warming apparatus 10 . as may now be seen in general , in the operation of the infant warming apparatus 10 , the canopy 12 , in the preferred embodiment , houses a radiant heater ( not shown . the canopy 12 can be moved between its upper position , as shown in fig1 , wherein the infant care apparatus acts as an infant warmer and a lower position wherein the infant care apparatus acts as an infant incubator where the infant 26 is provided with warm air and controlled humidity in the normal functioning of an incubator . as also can be seen in fig1 , there is a personal digital assistant ( pda ) 38 that is used in connection with the present invention . the pda 38 can be of the conventional and commercially available type such as a palm pilot , and which includes a display 40 , an input device such as a keyboard 42 and which also has an internal central processing unit ( cpu ) and a transducer to carry out the transmitting and receiving of data as will be later explained . the pda 38 generally communicates and receives electronic signals bi - directionally using an infrared ( irda ) communications protocol . there is also , preferably , an input / output or i / o port 44 that enables the pda 38 to upload data and information to a computer such as a laptop or portable computer and also have information and data downloaded from a computer to the pda 38 . as noted , the form of communication used by the pda 38 is preferably an infrared protocol , however , other suitable forms of radiation transmission can be used , including rf elements or other means . there is a corresponding electronic module 46 that is located in the infant care apparatus 10 in a position so as to readily receive and send communications between the electronic module 46 and the pda 38 . the electronic module 46 can thus internally transfer data and information to and from various internal components of the infant care apparatus 10 , such as internal software , read only memory , and to the operating processor or processors that carry out the operation of the infant care apparatus 10 . turning now to fig2 , there is shown a block schematic diagram of the components utilized in carrying out the present invention . in particular , the pda 38 can be seen to have an input device , such as a keyboard 42 , a display 40 as well as a microprocessor 48 contained therein . the pda 38 also includes a transmitter 50 , a receiver 52 and an antenna 54 to enable the bi - directional communications with the pda 38 . in the electronic module 46 there are also various components to carry out the bi - directional communications and which include an antenna 56 that carries the signals to and from a transmitter 58 and a receiver 60 in effecting those communications . additionally , as can be seen , there is also a central processing unit 62 in the electronic module 46 and which is in communication with a display 64 , an internal memory 66 , the operational software 68 of the infant care apparatus 10 and an input device 70 . the display 64 ′, internal memory 66 , operational software 68 and input device 70 normally will be a part of the infant care apparatus 10 and therefore positioned at one or more locations thereon , including within the control module 36 . as such , the operation of and functioning of the present invention can be explained . as a function of the present invention , it is normal that the software used in the control and operation of the infant care apparatus 10 needs to be upgraded from time to time and the present upgrading procedures require the removal of programmable read only memory units ( proms ) and the installation of new proms having the upgraded software and that procedure requires the services of a qualified technician and also involves downtime for the infant care apparatus and thus , the removal of the apparatus from active service while that replacement is being carried out . with the present invention , however , the upgraded software can simply be downloaded into the pda 38 via the i / o port 44 from a computer and the pda 38 put in wireless communication with the electronic module 46 located on the infant care apparatus 10 . that upgraded software can , therefore , be transmitted by mean of the transmitter 50 of the pda 38 to the receiver 60 of the electronic module 46 and the cpu 62 can enter that upgraded software into the operational software 68 of the infant care apparatus 10 such that there is no invasion of the electronic module 46 or physical replacement of an prom thereby resulting in little or no downtime for the apparatus and the procedure can be carried out easily with a person having basic computer qualifications . as another function of the present invention , the electronic module 46 , can , by means of the internal memory 66 , maintain a continual log of the operational data of the infant care apparatus 10 , that is , there may be continually kept , a data log of the electrical and functional status , such as recorded voltages , service history of a particular apparatus , data relating to failures , calibration dates and the like and which relate to the operational history of the infant care apparatus 10 and that information can be , by a query from the pda 38 , sought by the cpu 62 and sent by the transmitter 58 of the electronic module 46 to the receiver 52 of the pda 38 where that service and history information and data can be , again , uploaded to a personal computer where the data can be used with commercial software , such as excel , to create a table of information and data or to formulate curves indicative of the performance of the particular infant care apparatus 10 in a form that is readily understandable . as a still further function of the present invention , patient information can be inputted by the input device 70 located at or on the infant care apparatus 10 such as name , weight , and other personal information by the caregiver form time to time to upgrade the status of the patient or to enter other such information and , again , that personal information and data relating to the patient can be sent to the pda 38 from the electronic module 46 so that such information can be entered by the personal computer to a central record keeping file for patient undergoing treatment at the facility . as a still further function , there can be a continuous maintaining of operational data in the internal memory 66 of the electronic module 46 , such as trending information including thermal or humidity information to maintain a trend of the data and that information can be transmitted to the pda 38 for uploading to a personal computer when the trending data can also be organized into a recognized format by an excel or other commercial software program . thus , as can be seen , with the present invention there is a bi - directional communication between the pda 38 and the infant care apparatus 10 that enables the easy , wireless transfer of data and information therebetween , such that a number of advantageous functions and operations can be carried out without taking the apparatus out of service . those skilled in the art will readily recognize numerous adaptations and modifications which can be made to the bi - directional wireless data and information communication system for a patient care apparatus of the present invention which will result in an improved system , yet all of which will fall within the scope and spirit of the present invention as defined in the following claims . accordingly , the invention is to be limited only by the following claims and their equivalents .	0
a preferred embodiment of the invention will now be described in detail with reference to the accompanying drawings . because the embodiment described below is a preferred specific example of the invention , various technologically desirable limitations have been attached thereto ; however , the scope of the invention is not limited to these forms as long as there is no mention of a feature particularly limiting the invention in the description below . fig1 to 3 show a preferred embodiment of a biaxial actuator for an objective lens according to the invention . in fig1 to 3 , a biaxial actuator 10 includes a lens holder 11 , a coil bobbin 12 , a plurality of elastic supporting members 13 a , 13 b , 13 c , 13 d , a fixed part 14 and a yoke 31 . the lens holder 11 , in this embodiment , as shown in fig3 preferably is split by a horizontal split line ( parting line ) into an upper part 11 u and a lower part 11 l , and mutually adhered with an adhesive . also , as shown in fig3 an opening 11 a in which the coil bobbin is mounted and a recess 11 b in which an objective lens 11 c is mounted are formed in the lens holder 11 . a hole through which a light beam emitted from a semiconductor laser or a returning light beam from the recording surface of an optical disc passes is formed in the bottom of this recess 11 b . an objective lens 11 c is mounted in the recess 11 b of the lens holder 11 by means of an adhesive or the like . also , the lens holder 11 is supported movably in a focusing direction fcs and a tracking direction trk by the elastic supporting members 13 a , 13 b , 13 c , 13 d . the coil bobbin 12 has formed therein an opening 12 a into which is inserted a magnetic circuit made up of the yoke 31 integral with a base and a magnet 32 mounted on the inner surface of an inner yoke 31 a of the yoke 31 . the coil bobbin 12 is provided with a coil for focusing 12 b and a pair of coils for tracking 12 c . the coil for focusing 12 b is wound on the coil bobbin 12 along an axis parallel with the optical axis of the objective lens 11 c . the coils for tracking 12 c are formed by winding coils elliptically or rectangularly . the coils for tracking 12 c are mounted on one side surface of the coil for focusing 12 b . the upper surface of the coil bobbin 12 is covered by a yoke bridge 36 . this yoke bridge 36 may constitute a closed circuit together with the yoke part of the above - mentioned magnetic circuit . the coil bobbin 12 is mounted in the opening formed in the lens holder 11 with the coil for focusing 12 b and the coils for tracking 12 c mounted thereon . the elastic supporting members 13 a , 13 b , 13 c , 13 d preferably have electrical conductivity and furthermore have elasticity . for example , a material such as phosphor bronze , beryllium copper , titanium copper , tin - nickel alloy , stainless steel is used for the elastic supporting members 13 a - 13 d . in the preferred embodiment , the elastic supporting members are formed from thin sheet metal as sheet spring suspensions fixed between the lens holder 11 and the fixed part 14 in parallel with each other . fig6 is a view schematically showing the fixing structure of these elastic supporting members 13 a and 13 b . the elastic supporting members 13 c and 13 d are provided on the side surface on the opposite side from the supporting members 13 a and 13 b and are also of the same construction . the elastic supporting members 13 a and 13 b have one end fixed to the lens holder 11 at fixing places 45 , 46 , respectively . the other ends of these elastic supporting members 13 a and 13 b are fixed to the fixed part 14 at fixing places 47 , 48 . as a result , these elastic supporting members 13 a and 13 b become a pair lined up in the optical axis direction of the objective lens 11 c and are fixed to side surfaces of the lens holder 11 and the fixed part 14 . the spacing hi of the fixing places 45 and 46 of the elastic supporting members 13 a and 13 b on the lens holder side is narrower than the spacing h 2 of the fixing places 47 and 48 on the fixed part 14 side . when the elastic supporting members 13 a and 13 b are extended toward the lens holder 11 front end side ( to the left in the drawing ) these imaginary extension lines intersect at a certain point p as shown with dotted lines . the elastic supporting members 13 a , 13 b , 13 c , 13 d may be constructed so as to supply driving currents from an outside current supplying means ( not shown in the drawings ) to the coil for focusing 12 b and the coils for tracking 12 c wound on the coil bobbin 12 . with the lens holder 11 and the mounting part 14 linked by the four elastic supporting members 13 a , 13 b , 13 c , 13 d , the mounting part 14 is mounted on an adjusting plate 30 . this adjusting plate 30 is for adjusting the fixed position of the mounting part 14 when the biaxial actuator is being assembled . the adjusting plate 30 is fixed to a base 31 formed integrally with the yoke by soldering or the like . the mounting part 14 is mounted to the adjusting plate by inserting a boss provided on the fixed part 14 into a hole in the adjusting plate 30 , as shown in the drawing , and fixing it with adhesive or the like . here , a pair of yokes 31 a , 31 b constituting the above - mentioned magnetic circuit are provided on the base 31 by bending end portions of the base 31 on the objective lens side respectively upward . there is provided a permanent magnet 32 mounted on the surface of the yoke 31 a facing the other yoke 31 b . as a result , a magnetic circuit is formed by the pair of yokes and the permanent magnet . when the mounting part 14 is mounted on the base , as described above , the coil for focusing 12 b and the coils for tracking 12 c mounted on the coil bobbin 12 are inserted into a gap between the permanent magnet 32 and the other yoke 31 b . at the same time , one yoke 31 a and the permanent magnet 32 are inserted into the opening of the coil bobbin 12 . the elastic supporting members 13 a , 13 b , 13 c , 13 d are constructed in their fixed part 14 side end part regions , as shown in fig4 and 5 . that is , as shown in fig4 and 5 , the fixed part 14 side end part region of the elastic supporting member 13 a is , for example , formed overall in a rectangle . the end part region 15 has a first non - moving part 15 a as a first part fixed to the fixed part 14 , and a movable part 15 b as a second part connected to the main part of the elastic supporting member 13 a . the end part region 15 has an elastic part 15 c as a third part extending from near the rear part ( in the drawing , the right edge part ) of the non - moving part 15 a in the shape of a crank and connected to the movable part 15 b . the end part region 15 also has a first viscous body receiving part 15 e disposed on the rear part of the movable part 15 b and connected to the non - moving part 15 a by way of an angle part 15 d . the above - mentioned movable part 15 b is formed relatively wide , and the surface thereof is provided as a second viscous body receiving part . the first viscous body receiving part 15 e does not displace during focusing or during tracking and is fixedly held because it is connected to the non - moving part 15 a . the body receiving part 15 e is formed facing the movable part 15 b across a small gap 17 formed parallel with a direction intersecting orthogonally with the direction in which the elastic supporting member 13 a extends . a gap 15 k is formed between the non - moving part 15 a and the elastic part 15 c , in a direction intersecting orthogonally with the direction in which the elastic supporting member 13 a extends . a gap 15 l is provided between this elastic part 15 c and the first viscous body receiving part 15 e . the gaps 17 , 15 k , 15 l , together with the elastic part 15 c , constitute an expanding / contracting part 41 that expands and contracts within the range of the widths of the gaps when the lens holder 11 is moved in the focusing direction fcs . with respect to the first viscous body receiving part 15 e and the movable part 15 b , which is a second viscous body receiving part , a viscous body 16 is provided so as to extend across the gap 17 and connect the two viscous body receiving parts 15 e , 15 b . this viscous body 16 is , for example , an ultraviolet ray hardening type viscous body . the viscous body 16 extends over the whole of the first viscous body receiving part 15 e and the second viscous body receiving part 15 b and is stable at a substantially constant thickness . in this state , by irradiating ultraviolet rays , the above - mentioned viscous body 16 is hardened , and the first viscous body receiving part 15 e and the second viscous body receiving part 15 b are connected by the hardened viscous body 16 . with respect to this , as shown in fig2 and 4 , the fixed part 14 is provided with a viscous body flow preventing wall 14 b where it is adjacent to the end part region 15 of the elastic supporting member 13 a . this viscous body flow preventing wall 14 b is preferably formed integrally with respect to the fixed part 14 . the viscous body flow preventing wall 14 b is formed with respect to the peripheral edge 15 f of the elastic supporting member 13 a extending beyond the peripheral edge 15 f . the biaxial actuator 10 of this embodiment is constructed as described above . driving currents controlled on the basis of a focusing servo signal and a tracking servo signal are respectively supplied to the coil for focusing 12 b and the coils for tracking 12 c wound on the coil bobbin 12 . in this way , by a direct current electromagnetic field of the magnetic circuit and an alternating electromagnetic field arising from the coil for focusing 12 b and the coils for tracking 12 c , the lens holder 11 , that is , the objective lens 11 c , is driven in the focusing direction fcs and the tracking direction trk . in the biaxial actuator of this embodiment , when the lens holder 11 is driven in the above - mentioned focusing direction fcs , behavioral characteristics of the kind shown in fig7 are imparted . fig7 is a principle drawing for explaining the behavioral characteristics of the lens holder 11 . in the drawing , an example is shown wherein an electromagnetic driving force acts on the lens holder 11 , and a force acts in the direction shown by the arrow h , i . e ., the direction approaching the disc d in the focusing direction . here , one end of the elastic supporting members 13 a and 13 b is fixed to the lens holder 11 at fixing places 45 and 46 , as described above . the other end side of the elastic supporting members 13 a and 13 b is fixed to the fixing places 47 and 48 . for purposes of illustration in fig7 it will be assumed that the elastic supporting members 13 a and 13 b do not expand and contract . in fig7 the angle formed by the elastic supporting member 13 a and the vertical front surface of the fixed part 14 is represented by a . when this elastic supporting member 13 a has become horizontal in the drawing , because the length of this elastic supporting member 13 a does not change , the lens holder 11 side fixing place 45 moves to a position farthest away from the fixed part 14 . the angle formed by the elastic supporting member 13 a and the vertical front surface of the fixed part 14 in this state will be made θ . when the lens holder 11 is moved for focusing in the direction approaching the disc d , the elastic supporting member 13 a moves to the position shown with broken lines in the drawing . at this time the angle α formed by the elastic supporting member 13 a and the vertical front surface of the fixed part 14 gradually approaches θ and consequently the fixing place 45 moves upward in the drawing and moves away from the fixed part 14 . the elastic supporting member 13 b , on the other hand , when the lens holder 11 receives a force in the arrow h direction , the angle β formed by the elastic supporting member 13 b and the vertical front surface of the fixed part 14 decreases and the difference between it and θ increases . because of this , as shown in the drawing , the lens holder side fixing place 46 of the elastic supporting member 13 b gradually moves upward and the distance between it and the fixed part 14 gradually decreases . in this way , the lens holder side fixing places 45 and 46 of the elastic supporting members 13 a and 13 b , when it is assumed that the elastic supporting members 13 a and 13 b do not expand and contract , follow a locus j in the shape of a circular arc having the point p as its center . as a result the lens holder 11 is imparted with a characteristic that it gives rise to a minus side tangential skew . also , when the lens holder 11 is moved in a focusing direction opposite the direction h so that it moves away from the optical disc d ( downward in the drawing ), the lens holder 11 is imparted with a characteristic that it gives rise to a plus side tangential skew . however , when the elastic supporting members 13 a and 13 b , as explained with fig4 are provided with the expanding / contracting part 41 and the elastic supporting members have this kind of expanding and contracting function , as explained with fig1 ( a ) and 12 ( b ) and fig1 ( a ) and 13 ( b ), behavioral characteristics opposite to those described above are imparted to the lens holder 11 . therefore , the biaxial actuator 10 of this embodiment , by the fixing places of the elastic supporting members being made of the construction altered as described above , even if they are provided with the expanding / contracting part 41 , because the tangential skews arising on the basis of their respective constructions are opposite , these characteristics cancel each other out . thus , during focusing movement the lens holder 11 is moved in parallel without the objective lens 11 c giving rise to optical axis falling . in this way , with the biaxial actuator of this embodiment , it is possible to effectively prevent tangential skew , of which the level of tolerance in fulfilling signal readout performance of the optical pickup is extremely low , and excellent optical performance can be provided . also , with the biaxial actuator 10 of this embodiment , by providing the expanding / contracting part 41 , it is also possible to provide the following kind of advantageous action . that is , because as a damper the viscous body 16 is coated in the fixed part 14 side end part region 15 of the elastic supporting members 13 a , 13 b , 13 c , 13 d so as to extend across the gap 17 between the first viscous body receiving part 15 e and the second viscous body receiving part 15 b and hardened , a desired damping characteristic can be obtained . as a result , for example during focusing , the movable part 15 b deforms in the vertical direction with respect to the first viscous body receiving part 15 e , and vibration caused by that deformation is damped by the viscous body 16 . also , during tracking , the movable part 15 b deforms so as to oscillate with respect to the first viscous body receiving part 15 e . vibration caused by that deformation is damped by the viscous body 16 . here , when the viscous body 16 is coated and hardened , even if unhardened portions have arisen in the surface of the viscous body 16 due to oxygen obstruction , these hardened portions sometimes flow out onto the non - moving part 15 a of the end part region 15 of the elastic supporting member . in particular , when as in this embodiment the lens holder 11 , as shown in fig3 is split by a horizontal split line ( parting line ) into an upper part 11 u and a lower part 11 l , and mutually adhered with an adhesive , it is conceivable that unhardened portions of the viscous body 16 will flow along this parting line . however , because these unhardened portions of the viscous body are obstructed by the viscous body flow preventing wall 14 b formed in the fixed part 14 , they do not flow out onto the side edge 15 f of the elastic supporting member positioned at the side of the fixed part 14 . therefore , because unhardened portions of the viscous body 16 do not flow from the side edges 15 f of the elastic supporting members at the side of the fixed part 14 along outsert lines or parting lines of the fixed part 14 and also the border of the upper part 11 u and the lower part 11 l , it does not flow into the adhered surface 14 b , i . e ., the adhered surface of the border of the upper part 11 u and the lower part 11 l . in this way , a decrease in the adhesive strength of this adhered surface and the adhered parts coming apart can be prevented . in the embodiment described above , the elastic supporting members 13 a , 13 b , 13 c , 13 d were described as simply being respectively fixed to the lens holder 11 and the fixed part 14 , but it is clear that they may be formed integrally with the lens holder 11 and the fixed part 14 by insert molding or the like . also , although the lens holder 11 is split into an upper part 11 u and a lower part 11 l , it is clear that it may alternatively be integrally formed . as described above , according to this invention , it is possible to provide a biaxial actuator wherein when moved in the focusing direction , shifting of the optical axis of the objective lens , especially the occurrence of tangential skew , is prevented , and the optical performance is thereby improved . it will be appreciated that the present invention is not limited to the exact construction that has been described above and illustrated in the accompanying drawings , and that various modifications and changes can be made without departing from the spirit and scope of the present invention . it is intended that the scope of the invention only be limited by the appended claims .	6
fig1 illustrates a conventional scanner 10 which may be used in the production of paper sheet 12 by a paper making machine ( not shown ). as the paper sheet 12 exits the paper making machine in the direction of arrow 14 , carriages 16 and 18 are driven by a motor ( not shown ) back and forth in opposing relation on beams 20 and 22 . one or more sensors , such as basis weight sensors , moisture sensors and sheet caliper sensors ( not shown ) may be mounted to the carriages 16 , 18 and are thus scanned back and forth across the sheet 12 . in fig1 a portion of the sheet 12 has been removed to better illustrate the spacial relationship between carriages 16 and 18 . fig2 illustrates a beam , such as , for example , beam 20 which is mounted between two fixed vertical supports ( not shown in fig2 ) by means of connecting plates 24 and 26 . plate 24 may be flexibly connected to the vertical web of beam 20 by means of a loose fitting single pin 25 , as shown , while , according to the invention , the vertical web of beam 20 may also be connected to plate 26 by means of a similar loose fitting single pin 28 . both plates 24 , 26 are held to beam 20 in a manner to permit beam 20 to undergo vertical and horizontal deflections without imposing undue strains on the plates 24 , 26 , and while maintaining the position of the ends of beam 20 substantially constant . beam 20 may be provided with any suitable structure presenting a track for displacement of a scanner carriage along the length of the beam 20 . in an environment where large temperature differentials exist , it is quite common for such a beam to be unequally heated transverse to its length . for example , in the case of a beam disposed above a paper sheet in a paper making machine , the lower flange of the beam will be heated substantially more than the upper flange thereof . moreover , conditions can exist which will cause one side of the beam to be heated to a higher temperature than the other side . according to the invention , a laser 32 ( or other source of highly collimated light ), is mounted at one end of beam 20 in order to emit a narrow , collimated light beam in the direction of the opposite end of the beam 20 . at that opposite end , there is disposed a light responsive target 30 mounted to the beam 20 and composed of four quadrants ( labeled t , b , l and r for top , bottom , left and right , respectively ), each quadrant having a separate electrical output . each quadrant may include a separate photovoltaic cell . initially , laser 32 and target 30 are positioned so that when beam 20 is perfectly straight , i . e ., experiences no deflection either in a horizontal plane or vertical plane , the narrow collimated laser light beam illuminates all four quadrants equally . for example , the laser beam and target may both be 0 . 25 inch in diameter . as beam 20 experiences a thermally induced deflection or bending , which will cause its end faces to be inclined to one another , the laser beam will travel across the face of target 30 so that the four quadrants are no longer uniformly illuminated . target 30 is a light sensitive device having a respective output conductor 34 , 36 , 38 and 40 connected to each quadrant ( see fig3 ), with each conductor 34 , 36 , 38 and 40 being supplied by the associated quadrant with a current proportional to the amount of the quadrant which is illuminated . thus , the direction of any deflection experienced by beam 20 can be indicated by comparing the current outputs from the four quadrants . beam 20 further carries a plurality of electric resistance heater elements tl1 , tl2 , tr1 . . . br1 and br2 . each of these elements may be constituted by a conventional electric heater strip or wire bonded to an associated beam flange . according to a preferred embodiment of the invention , there are a total of eight such heater elements , only six of which are visible in fig2 it being understood that another pair of such elements , which , if visible , would be denoted bl1 and bl2 mounted on the bottom flange at the far side of the vertical web . the notation employed in fig2 for the heater elements has the following significance : t = top ; b = bottom ; l = left ; and r = right . the heater elements are connected to power sources 56 ( fig3 ) which are controlled by the output signals from the four quadrants of target 30 . the basic electronic components of one embodiment of a beam bending control system according to the present invention are illustrated in fig3 where each quadrant of target 30 has an output conductor 34 , 36 , 38 and 40 connected to a control circuit 42 , 44 . such a control system may be used to counteract thermally induced bending in a horizontal scanner support beam . the control circuit 42 compares the output of the top and bottom quadrants . when a greater portion of the top quadrant is illuminated relative to the bottom quadrant , control circuit 42 produces an output voltage on line 48 proportional to the difference in illumination of these two quadrants . conversely , when a greater portion of the bottom quadrant is illuminated relative to the top quadrant , control circuit 42 produces an output voltage on line 50 proportional to the difference in illumination of these two quadrants . many simple analog and / or digital electronic circuits for comparing two input currents and producing voltages on different wires dependent on the difference between such currents are well - known and can be easily constructed by those skilled in the art . accordingly , such circuits will not be described in detail herein . control circuit 44 functions in a similar manner . when a greater portion of the left quadrant is illuminated relative to the right quadrant , control circuit 44 produces an output voltage on line 52 proportional to the difference in illumination between these two quadrants . conversely , when a greater portion of the right quadrant is illuminated relative to the left quadrant , then control circuit 44 produces an output voltage on line 54 proportional to the difference in illumination between these two quadrants . the output voltages from control circuits 42 and 44 are then supplied to associated amplifiers 56 which are each connected to supply a respective pair of heater elements with operating power proportional to the magnitude of the signal supplied by the associated control circuits 42 and 44 . amplifiers 56 perform primarily a signal isolation function and each has a fixed gain which may be equal to unity or which may produce a voltage amplification , depending on the level of the output signals supplied by the control circuits 42 , 44 and the requirements of the heating elements . as can be appreciated from a consideration of fig3 each control circuit 42 , 44 controls the delivery of operating power to those heating elements which must be operated in order to compensate for a thermal deflection experienced by beam 20 in a given direction . thus , by way of example , if the lower flange of beam 20 ( fig2 ) should be heated to a higher temperature than the upper flange thereof , beam 20 will deflect downwardly at its center , causing the laser light beam from laser 32 to preferentially illuminate the bottom quadrant of target 30 relative to the top quadrant . to compensate for this deflection , heating power is supplied to heating elements tl1 , tl2 , tr1 and tr2 bonded to the upper flange of beam 20 . as the temperature of the upper flange is raised and the upper flange thermally expands , beam 20 returns to its undeflected condition , accompanied by a displacement of the laser beam toward the top of target 30 . thus , all four quadrants are again uniformly illuminated . as beam 20 returns to its undeflected condition , the supply of operating power to the associated heaters is progressively diminished . this helps to prevent overshooting in the heating supplied to beam 20 . it can correspondingly be seen that if unequal heating of beam 20 causes the center of the beam to be deflected toward the right , the laser beam will illuminate a greater portion of the right quadrant of target 30 , relative to the left quadrant , resulting in an output signal from control circuit 44 which increases the supply of heating power to the heating elements along the left - hand side of beam 20 . it will be appreciated that if beam 20 is to be disposed at a location where the environmental temperature gradients will produce deflections in only certain directions , then some of the heating elements and the associated control circuitry can be eliminated . in addition , for certain applications , the two heating elements along each edge of beam 20 can be replaced by a single heating element . rather than using discrete analog and / or digital control circuits 42 , 44 , the target 30 may be coupled to the paper mill central process control computer , via appropriate analog to digital converters , and the computer programmed to control the heaters in the manner previously described . when beam 20 experiences bending deflections of the type described above , it is preferable that these deflections not introduce significant strains in the vertical support members . for this purpose , as mentioned above , the support plate 26 at one end of beam 20 supports the beam 20 by means of a single pin 28 , as shown in greater detail in fig4 which also shows a vertical support member 58 carrying plate 26 . pin 28 may extend through a longitudinal slot 60 in the vertical web of beam 20 in order to allow beam 20 to experience longitudinal expansion and contraction . support plate 24 , pin 25 and an associate vertical support member ( not shown ) are held together in this same manner . according to other embodiments of the invention , various known types of deflection sensors can be mounted in place of the laser 32 and target 30 to sense beam deflection in one or more directions transverse to the beam axis and can be connected to control the supply of heating power to suitably positioned heating elements . for example , one or more inductive proximity sensors ( not shown ) may be coupled to the scanner carriages 16 , 18 ( fig1 ) and used to continuously monitor the spacing between such carriages as the carriages scan back and forth along the support beams 20 , 22 . if , for example , a different spacing is detected between the carriages 16 , 18 near the center of the beam 20 than at the beam ends , then the heating of the beam 20 could be adjusted to deflect the beam back to a more nearly uniformly spaced configuration . such inductive proximity sensors are well - known in the art and include a coil having an impedence which varies with distance from a conductive reference surface or opposing coil . therefore , an inductive coil mounted on one carriage can be used to measure the spacing to the opposing carriage . an example of such an inductive proximity sensor is disclosed in commonly assigned u . s . pat . no . 4 , 678 , 915 , entitled system and process for measuring and correcting the values of a parameter of a sheet material , issued jul . 7 , 1987 to dahlquist , et al . this patent is incorporated herein by reference . in this situation , the inductive proximity sensor is preferably coupled to the paper mill process control computer which is programmed to control the heaters to achieve the desired beam shape . while the present description refers to an i - beam , it will be appreciated that the invention is applicable to any suitable beam cross - section , which will be selected on the basis of the function the beam is to perform . while the description above refers to two particular embodiments of the present invention , it will be understood that many modifications may be made without departing from the spirit thereof . for example , the present invention may be used with many types of beams and sheet material other than those beams used as horizontal scanning sensor supports in the paper making industry . thus , the present invention may be used with beams disposed vertically as well as horizontally , or at any other angle . moreover , the present invention may be used to create and maintain beam curvatures , as well as to counteract such curvature . the accompanying claims are intended to cover such modifications as would fall within the true scope and spirit of the present invention . the presently disclosed embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims , rather than the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .	6
chondrogenesis is induced by an extracellular matrix composition of type i collagen , type ii collagen , type i collagen plus hyaluronate , or type ii collagen plus hyaluronate containing gdf - 5 . type i and ii collagen represent the most abundant ecm protein in bone and cartilage , respectively . collagen may be obtained from bone , tendons , skin , or the like . the collagen source may be any convenient animal source , mammalian or avian , including bovine , porcine , equine , or the like , or chicken , turkey or other domestic source of collagen . hyaluronic acid is a naturally - occuring polysaccharide containing alternating n ˜ acetyl ˜ d ˜ glucosamine and d ˜ glucuronic acid monosaccharide units linked with beta 1 - 4 bonds and disaccharide units linked with beta 1 - 3 glycoside bonds . it occurs usually as the sodium salt and has a molecular weight range of about 50 , 000 to 8 × 10 6 . the collagen or collagen - hyalurate mixture is provided as a matrix , typically by lyophilization . the collagen - hyaluronate is formed by treating collagen with an active formyl aldehyde hyaluronate , formed as described in u . s . pat . no . 5 , 866 , 165 , incorporated by reference herein . the collagen hyaluronate composition is also provided as a matrix by lyophilization . the matrix is preferably implanted with an effective amount of gdf - 5 , which is about 1 mg to 10 mg / ml of matrix protein . to show in vitro application , fetal rat calvarial cells ( frc &# 39 ; s ) were plated on various purified extracellular matrix proteins in the presence of recombinant human gdf - 5 ( 100 ng / ml ) for 3 weeks and scored for differentiation at the level of morphology , overall proteoglycan synthesis and deposition , and aggrecan and type ii collagen expression . results show that gdf - 5 stimulated chondrogenic nodule formation of frc &# 39 ; s plated only on type i or type ii collagen . chondrogenic nodules stained heavily with alcian blue and were positive for type ii collagen and aggrecan - expression , as judged by immunohistochemical and transcriptional analyses . cells in monolayer that surround the nodules were negative for the chondrogenic markers . in sharp contrast , gdf - 5 failed to stimulate chondrogenesis in frc &# 39 ; s plated on fibronectin , type iv collagen or tissue culture plastic . plastic plates were first coated with different ecm proteins including type i and ii collagen , type iv collagen , or fibronectin . the results show that gdf - 5 stimulated the formation of chondrogenic cell aggregate that bind heavily to the alcian blue stain . under these conditions gdf - 5 fails to stimulate the formation of characteristic nodules in frc cultured in the presence of vehicle alone , type iv collagen , or fibronectin . plastic culture 12 well ( costar , cambridge , mass .) were coated with 0 . 01 % ( w / v ) of the indicated extracellular matrix proteins for 2 hours at 37 ° c . after removal of nonadsorbant protein , fetal rat calvarial cells were plated at a density of 2 × 10 5 cells / well in dmem containing 10 % fbs . culture plates were then maintained for 21 days in culture media supplemented with or without gdf - 5 ( 100 ng / ml ). plates were then stained overnight with alcian blue stain ( 0 . 5 % w / v in 3 % acetic acid ), washed and photographed . for quantitation of alcian blue , cells were solubilized in 8m urea , and the amount of stain was quantitated using spectrophotometer ( molecular devices , sunnyvale , calif .). since alcian blue is a cationic dye which has been shown to bind to anionic proteins including proteoglycans , these results suggest that gdf - 5 induces a change in cellular morphology of a subpopulation of frc . to examine correlation of changes in cellular morphology with the process of chondrogenesis , total cellular rna and protein were isolated from frc culture treated with gdf - 5 in the presence of type i collagen . total cellular rna isolated from frc cells was subjected to a semiquantitative pcr analysis using specific primers designed to amplify aggrecan , type ii collagen or type i collagen . results show that expression of type ii collagen and aggrecan mrna is increased by around 2 and 3 respectively in cultures treated with gdf - 5 . under these conditions , type i collagen mrna expression decreased by about 20 %. the expression of aggrecan and type ii collagen was confirmed using slot blot analysis . total cell lysates ( 100 ug ) were electrophoretically separated on a 8 % or 5 % sdspage , transferred to immobilon - p and immunoblotted using antibody specific to type ii collagen or aggrecan . the results show that gdf - 5 stimulated a significant increase in the steady state level of type ii collagen and aggrecan . under these conditions gdf - 5 fails to stimulate expression of type ii collagen or aggrecan when frc cells are cultured in the absence of type i collagen . the collagen is also provided in matrix form for in vivo use . type i collagen fibers were dispersed at 2 % weight % ratio in distilled water and homogenized 3 times for 5 seconds each at low speed in a heavy duty blender . the ph of the slurry was then adjusted to a ) ph 3 . 0 ; b ) ph 70 ; or c ) ph 10 . 0 by adding hcl or naoh as necessary . the slurry was then cast into molds and frozen at the following temperatures prior to lyophilization : a ) ph 3 . 0 slurry : − 78 ° c ., − 40 ° c . or − 20 ° c . b ) ph 7 . 0 slurry ; − 40 ° c . c ) ph 10 . 0 slurry ; − 40 ° c . the lyophilization cycle for the above matrices was as follows : 0 ° c . for 2 hours ; − 40 ° c . for 2 hours ; − 20 ° c . for 2 hours ; − 4 ° c . for 4 hours ; and 25 ° c . for 1 hour . hyaluronate containing active formyl aldehyde groups , prepared as disclosed in u . s . pat . no . 5 , 866 , 165 , was added to the above collagen matrices by immersion of the collagen matrix in a 2 % weight % solution , ph 7 - 8 of the hyaluronate polyaldehyde . the immersed matrices were shaken at room temperature for 4 hours , washed 3 times and lyophilized using the lyophilization cycle described above for the collagen matrix preparation . a porous matrix fabricated from type i collagen was seeded by , 1 × 10 5 cell per implant ( 2 × 3 × 3 mm ). cells embedded in matrices were then cultured for 3 weeks in culture supplemented with or without gdf - 5 ( 100 ng / ml ). total rna isolated from each implant were then subjected to rt - pcr . results indicate that gdf - 5 induced expression of aggrecan and type ii collagen , two well known markers of chondrogenesis . in parallel the implant material was subject to histological evaluation followed by alcian or toludine blue staining . results show that gdf - 5 was capable of inducing marked changes in cellular morphology of frc underscored by increase in alcian blue staining and changes in cell shape . under these conditions frc cells were not able to proliferate and differentiate in the ecm in the absence of gdf - 5 as measured by histological evaluation total dna , rna or protein content . these findings suggest that the gdf - 5 biological response may be significantly enhanced by type i collagen possessing 3d matrix structure . the surface property or the porosity of 3d collagen - based matrices were examined by preparing a series of implantable material possessing different porosity . each matrix composite was either coated with or without hyaluronic acid , a major component of cartilage . the implants were then seeded with 1 × 10 5 cells per implant and cultured for 3 weeks in the presence of gdf - 5 ( 100 ng / ml ). total rna extracted from each implant were then subjected to semi - quantitative pcr analysis . results indicate that frc cells showed significant increase in the expression level of type ii collagen and aggrecan when implanted only in matrices which were coated with hyaluronic acid and possessed the highest porosity ( about 300 micron ). together these findings indicate that gdp - 5 chondrogenesis activity is fully and potently synergized by a matrix which contain 1 ) high pore size ( about 100 - 300 micron ); and 2 ) is composed of type i collagen which is coated with hyaluronic acid . the molecular signaling mechanism by which gdf - 5 induces chondrogenesis in the context of type i collagen was also examined using well - characterized inhibitors of intracellular signaling mediators . results show that the ligand - dependent chondrogenesis was completely inhibited by the calcium ionophore a23187 and rapamycin not by dibutyryl - camp , na 3 vo 4 , or egta . the known inhibitory effect of rapamycin on activation of p70s6 kinase indicate that gdf - 5 / type i collagen - induced chondrogenesis is mediated through p70s6 kinase activation . the known effects of a23187 on intracellular calcium concentrations suggest that the gdf - 5 / type i collagen - induced chondrogenesis is mediated through a sustained decrease of intracellular calcium concentration . these results indicate that cellular interaction with type i collagen significantly enhances the chondro - inductive activity of gdf - 5 . this effect is likely mediated by the convergence of downstream matrix and factor receptor signaling pathways . the data indicates that gdf - 5 biological function is modulated by a type i collagen extracellular matrix composition and structure containing gdf - 5 that this event is regulated both temporally and spatially whereby one may regulate cellular morphogenesis and joint development in vivo . the growth and differentiation factor - induced chondrogenesis is highly specific to gdf - 5 . it was shown that ecm - dependent chondrogenesis by gdf - 5 is highly specific , by evaluating the ability of several mitogens and prototype differentiation factors under the following conditions . chondrogenesis was assessed by monochromatic staining of frc cultured in the presence of type i collagen and various growth factors . the results show that crude preparations of bmps and tgfb , two other member of this class of differentiation factors , completely failed to stimulate chondrogenesis . in addition , growth factors including bfgf or igf - i , igf - ii failed to stimulate chondrogenesis under these conditions . together these findings suggest that the gdf - 5 biological response may be distinguished from that shown by other members of tgfb superfamily . in vivo activity of rhgdf - 5 on collagen - based matrices . collagen / hyaluronan matrices ( cn / ha ) loaded with rhgdf - 5 ( 1 , 5 and 50 % g ) and implanted intramuscularly in rats for 14 days resulted in a dose - depended increase in alkaline phosphatase activity and chondrogenesis . under these conditions , very little evidence of chondrogenesis and full terminal differentiation was detected with mineralized collagen combined with rhgdf - 5 . alp activity implant ( intramuscular ) ( n = 4 per group ) ( mean ∓ sd ) cn / ha 0 . 82 − 0 . 27 + 1 μg rhgdf - 5 3 . 25 ∓ 0 . 76 + 5 μg rhgdf - 5 20 . 8 ∓ 7 . 23 + 50 μg rhgdf - 5 48 . 9 ∓ 11 . 3 mineralized collagen matrix 0 . 77 ∓ 0 . 55 + 1 μg rhgdf - 5 0 . 89 ∓ 0 . 20 + 5 μg rhgdf - 5 2 . 68 ∓ 0 . 30 + 50 μg rhgdf - 5 6 . 21 ∓ 1 . 67 alp activity = nmoles / min / mg wet wgt . implant in vivo assays , rat soft tissue implants : matrix / growth factor combinations were implanted either subcutaneously in the thoracic region or intramuscularly in posterior tibial muscle pouches created by blunt dissection in 8 week old male sprague - dawley rats . at 14 days post - surgery , implants were harvested , weighed and processed for routine histology ( fixed in 10 % formalin , paraffin - embedded , sectioned to 6 μm , and hematoxylin and eosin stained ). alternatively , implants were extracted and assayed for alkaline phosphatase activity .	2
referring to fig1 , and 3 , an interlocking tab of a zipper according to the present invention comprises two rows of engaging teeth 1 and a cloth tape 2 1 o associated with the engaging teeth 1 . wherein , the engaging teeth 1 is conventional and each row of the engaging teeth 1 is made by way of nylon filament , polyester filament , or other polymeric filament being curled to form a continuous coil shape as the preceding description does . the engaging teeth 1 can be provided with suitable flexure of bending based on the property of the material itself to cope with the requirement of processing a curve shape . because , this is a conventional art and no further detail will be described . the difference between the present invention and conventional tooth tab resides in that the cloth tape 2 shown in fig2 is provided with a plurality of side openings 21 . each side opening 21 can be made as a pierced through aperture or a detached spot instead . the side openings 2 preferably are equally spaced apart to one another and line up to constitute two parallel rows of side openings 21 . in practice , the side openings 21 can be located near the respective lateral edge of the interlocking tab without breaking the lateral edge as shown in fig1 or breaking the lateral edge into sections as shown in fig2 . furthermore , the side openings 21 can be holes formed by way of punching or tears formed by way of stamping and the cloth tape 2 can be made of the polyester or chemical fiber in order to damage the fiber structure for loosening the yam in the cloth tape 2 . if the cloth tape 2 is made from polyester or blending , the formation of the side openings 21 can be performed by way of the supersonic wave , sintering or heat melting such that the cloth surrounding the side openings 21 may solidify or be in a state of maturing to prevent the yarn from loosening . fig4 shows reference shapes of side openings 21 possible to be made in practice , and these shapes are for taking examples and not for limiting the technical scope of the present invention . that is , other shapes of side openings 21 are still in the technical scope of present invention . moreover , the side openings 21 may be preset during the strip being processed . referring to fig3 in case of a curve work being conducted for the cloth tape 2 , the side openings 21 make the cloth tape 2 extend outward to compatible with the bent engaging teeth 1 and then be positioned after sewing such that the zipper can be formed with a curve . in addition , it is possible make the curve smoother through a step of vapor setting . it is appreciated that the present invention has broken through the bottleneck with regard to the working of curve zipper to solve a problem of the conventional zipper . therefore , it leads to a wider scope of designing a zipper and this is an advantage not possible for the conventional zipper to reach . while the invention has been described with reference to preferred embodiments thereof , it is to be understood that modifications or variations may be easily made without departing from the spirit of this invention , which is defined by the appended claims .	0
referring to fig1 , there is shown a simplified block diagram of an animal identification and security system 10 in accordance with the principles of the present invention . the animal identification and security system 10 makes use of first coded indicia 12 identifying the owner of an animal to be registered in the system . the format and content of this first coded indicia 12 is described in detail below . the first coded indicia 12 associated with a respective animal owner is affixed to a tag or marker 16 for permanent attachment to the animal . marker 16 may take on various forms , with a preferred embodiment for the marker described in detail below . the animal identification and security system 10 also makes use of second coded indicia 14 which uniquely identifies each animal . the second coded indicia 14 is also clearly and permanently affixed to the marker 16 for attachment to the animal . the first coded indicia 12 and second coded indicia 14 are also input to a data processing system 18 . date processing system 18 includes , among other things , a memory 20 for storing the first and second coded indicia 12 , 14 for the animals of each registered animal owner . data processing system 18 may be conventional in design and operation and is preferably disposed at its central location . memory 20 in which animal owner identification as well as coded indicia associated with each individual animal is stored is also of conventional design and operation . memory 20 could typically be in the form of a random access memory ( ram ) which allows for the entry and update of animal ownership data stored in the memory . data processing system 18 is connected to a global information network 22 , such as the internet , to allow for universal accessing of the animal ownership and identification information in the form of the first and second coded indicia 12 , 14 stored in the data processing system &# 39 ; s memory 20 . this permits individuals as well as various organizations , such as regulatory agencies and healthcare organizations , around the world to check the animal owner and animal identification coded indicia stored in the data processing system &# 39 ; s memory 20 to determine or verify ownership of a given animal as well as to determine the history of an animal . by storing this information and making it available on a universal basis , animal ownership determination and animal identification can be accomplished faster , more easily and more reliably than heretofore available . referring to fig2 , there is shown a simplified flow chart illustrating the series of steps involved in carrying out an animal identification and security system method in accordance with the principles of the present invention . at step 30 , a request is received from a new client , or member , to mark an animal with coded indicia uniquely identifying the client as the owner of the animal . the first coded indicia 12 is comprised of a combination of alphanumeric characters identifying the state and county of residence or location of the owner . for example , the first two characters of the first coded indicia 12 are comprised of a two letter abbreviation of the state in which the owner resides or is located . more specifically , the first two characters of the first coded indicia 12 for an indiana resident are “ in ”, while the first two characters for an illinois resident are “ il ”. the next two characters in the first coded indicia 12 are in the form of a number representing the county of residence or location of the owner within a given state . all states make use of a numerical system for designating each county within that state . an example of a numerical listing employed by the state of indiana for counties in that state is shown in table i . for example , the first four characters in the first coded indicia 12 for a resident of porter county in indiana would be “ in64 ”. finally , a last set of characters in the first coded indicia 12 identifies the ranch or farm of the owner within the designated state and county . a “ slash ” separates the county designation number and the ranch or farm designation number . as each new owner is registered , a number is assigned to that owner &# 39 ; s ranch or farm . thus , a complete first coded indicia for a new owner residing in porter county , ind . might be represented as “ in64 / 201 ”, where the number 201 indicates that the client resides or is located on ranch or farm number 201 within porter county , ind . table i 1 . adams 2 . allen 3 . bartholomew 4 . benton 5 . blackford 6 . boone 7 . brown 8 . carroll 9 . cass 10 . clark 11 . clay 12 . clinton 13 . crawford 14 . daviess 15 . dearborn 16 . decatur 17 . dekalb 18 . delaware 19 . dubois 20 . elkhart 21 . fayette 22 . floyd 23 . fountain 24 . franklin 25 . fulton 26 . gibson 27 . grant 28 . greene 29 . hamilton 30 . hancock 31 . harrison 32 . hendricks 33 . henry 34 . howard 35 . huntington 36 . jackson 37 . jasper 38 . jay 39 . jefferson 40 . jennings 41 . johnson 42 . knox 43 . kosciusko 44 . lagrange 45 . lake 46 . laporte 47 . lawrence 48 . madison 49 . marion 50 . marshall 51 . martin 52 . miami 53 . monroe 54 . montgomery 55 . morgan 56 . newton 57 . noble 58 . ohio 59 . orange 60 . owen 61 . parke 62 . perry 63 . pike 64 . porter 65 . posey 66 . pulaski 67 . putnam 68 . randolph 69 . ripley 70 . rush 71 . st . joseph 72 . scott 73 . shelby 74 . spencer 75 . starke 76 . steuben 77 . sullivan 78 . switzerland 79 . tippecanoe 80 . tipton 81 . union 82 . vanderburgh 83 . vermillion 84 . vigo 85 . wabash 86 . warren 87 . warrick 88 . washington 89 . wayne 90 . wells 91 . white 92 . whitely the second coded indicia 14 is also comprised of a combination of alphanumeric characters , with these latter alphanumeric characters identifying the type , or species , of the animal , the specific number of the animal within the owner &# 39 ; s herd or flock , and the country of origin of the animal . thus , the second coded indicia 14 may take the form of “ bd175ca ”, where “ bd ” designates a bovine dairy animal , or cow , “ 175 ” designates the 175th animal in the owner &# 39 ; s herd or flock , and “ ca ” designates canada as the country of origin of the animal . table ii is a partial alphabetic listing of letters representing various types of animals contemplated for use in the animal identification and security system of the present invention . similarly , table iii is a partial listing of country codes which could be used for identifying the country of origin of the animal . while the present invention is disclosed primarily for use with animals used in commercial businesses such as in agriculture , the inventive animal identification and security system may be used in identifying and tracking virtually any type of animal owned by man . table ii letter designation animal a alpacas bb bovine beef ( cattle ) bd bovine dairy ( cows ) c d donkeys e equine f g geese h hogs i j k l llamas m n o ostriches p poultry q r rabbits s sheep t turkeys u v vicunas w x y yaks z zebras referring to fig2 , there is shown a simplified flowchart illustrating the series of steps involved in carrying out an animal identification and security system and method in accordance with the principles of the present invention . at step 30 , a request is received from a new client , or animal owner , to mark an animal for uniquely identifying the animal &# 39 ; s owner , the residence or location of the animal &# 39 ; s owner , the type and identity of the specific animal being marked , and the origin of the animal . the request received in step 30 may also come from an animal owner already registered in the system who would like to register additional animals in the system . after a request is received from a new or existing client at step 30 , the next step 32 involves a client signing a statement to the effect that the animal , or animals , to be registered and marked is the property of the client . this statement would preferably be in the form of an affidavit made under oath before a notary public or other person of authority . the next step 34 in the inventive process is to determine the client &# 39 ; s state and county of residence or location and the client &# 39 ; s ranch / farm identifying number . the client &# 39 ; s state and county of residence or location is assigned an alphanumeric code as described above , while the client &# 39 ; s ranch / farm may be assigned a numerical identifier in accordance with the order in which the client registers in the animal identification and security system . after the client &# 39 ; s state and county of residence or location is determined as well as the client &# 39 ; s ranch / farm identifier at step 34 the type , number in the owner &# 39 ; s herd / flock , and country of origin of the animal to be marked is determined at step 36 . the client indicia ( first coded indicia ) and the animal indicia ( second coded indicia ) are then stored in memory in a paired relationship for uniquely identifying the owner as well as the animal being marked at step 38 . at step 40 , the client indicia and animal indicia are permanently applied to the marker to be attached to the animal . the marker is then attached to the animal at step 42 as described below and the client indicia and animal indicia assigned to that specific animal are made available on a global information network for worldwide dissemination . referring to fig3 , there is shown a side elevation view of one embodiment of a marker , or tag , 50 for use in the animal identification and security system of the present invention . an end - on view of the marker 50 is shown in fig4 . marker 50 is preferably comprised of a high strength , lightweight material such as plastic and is on the order of ⅝ ″ long and ¼ ″ wide at its maximum width . marker 50 is preferably white and unitary in structure and includes a semi - spherical end member 52 having a semi - spherical distal end 52 a , a rectangular member 56 disposed on a second , opposed end , and a cylindrical shaft 54 connecting the cylindrical end and the rectangular end . in a preferred embodiment , the semi - spherical end member 52 is ¼ ″ in length and ¼ ″ in diameter ; the cylindrical shaft 54 is ⅛ ″ in diameter and ¼ ″ long ; and the rectangular member 56 is ¼ ″ on each lateral side and ⅛ ″ thick . disposed on each of the four ( 4 ) lateral faces of the rectangular member 52 is a first indicia line 58 and a second indicia line 60 . as previously described , the first indicia line contains information uniquely identifying the animal &# 39 ; s owner , while the second indicia line 60 contains information uniquely identifying the animal to which the marker 50 is attached . the first and second indicia lines 58 and 60 are permanently placed on the marker 50 by conventional means , such as by molding into the rectangular member 52 , but may be changed if ownership of the animal changes . this indicia could be changed by imprinting or affixing new indicia on the marker 50 by any of various well known processes or techniques . a camera 71 is shown in fig5 for photographing the indicia on a marker attached to each animal while the animals are eating or drinking water for making a permanent record of the owner &# 39 ; s animals . over time , the cartilaginous material in the cow &# 39 ; s muzzle 68 will overgrow and cover the marker &# 39 ; s semi - spherical end member 52 and will be in tight fitting engagement with the marker &# 39 ; s cylindrical shaft 54 for permanent attachment of the marker 50 to the animal . referring to fig5 , there is shown the manner in which a marker 70 in accordance with the present invention is permanently attached to an animal such as a cow 62 . the marker 70 shown in fig4 is of the same configuration and size as the marker shown in fig3 and described in detail above . the semi - spherical end of marker 70 is inserted in the muzzle , or snout , 68 of the cow 62 intermediate its nostrils as shown in fig4 . marker 70 is preferably attached to the cow when the cow is a young calf , which allows the cartilaginous material of the cow &# 39 ; s muzzle to grow around the spherical end and cylindrical shaft portions of the marker 70 to permanently embed the marker in the cow . the size of the marker &# 39 ; s rectangular end is such as to allow the owner and animal indicia disposed thereon to be easily read , with the marker not interfering with the eating , drinking or breathing of the cow . this location of the marker 70 on the cow &# 39 ; s muzzle facilitates reading of the indicia on the marker &# 39 ; s flat plate end when the cow is eating or drinking water . marker 70 is inserted in an opening made in the cow &# 39 ; s muzzle 68 by a sharp cutting instrument perhaps after administering a local anesthetic to the animal . the cutting instrument may preferably form an “ x ” shaped incision in the muzzle to facilitate insertion of semi - spherical end member 52 of the marker . also shown in fig5 is another embodiment of a marker 66 for permanently affixing animal and animal owner information to an animal in accordance with the present invention . marker 66 is also comprised of a high strength , rigid or semi - rigid material such as plastic and is permanently affixed to the cow &# 39 ; s right ear 64 by conventional means such as staples or wire ( not shown for simplicity ). the location of marker 66 on cow 62 also facilitates reading of the animal and animal owner indicia on the marker when the cow is eating or drinking water . referring to fig6 , there is shown another embodiment of a marker 76 ( shown in dotted line form ) for use with a cow 72 . marker 76 is implanted in the cow &# 39 ; s muzzle 74 by means of an incision in the muzzle , which may be closed by conventional means such as stitches or staples . marker 76 is thus permanently installed in the cow 72 . marker 76 preferably includes an integrated circuit ( ic ) chip which is responsive to an rf inquiry signal from an animal identifier apparatus 78 which includes a transmitter for directing an rf inquiry signal to the marker 76 and a receiver for receiving a response emitted by the marker . the response provided to the animal identifier apparatus 78 includes the aforementioned animal and animal owner identifier information . by merely scanning the marker 76 with the animal identifier apparatus 78 , the animal and the animal owner may be uniquely identified . the animal identifier apparatus 78 may be handheld , or may be mounted to a structure disposed adjacent to where the animals are located or adjacent to a path along which the animals travel . the ic chip marker 76 is preferably re - programmable after being implanted in an animal to accommodate for changes in animal ownership and identification of a new owner . while particular embodiments of the present invention have been shown and described , it will be obvious to those skilled in the relevant arts that changes and modifications may be made without departing from the invention in its broader aspects . therefore , the aim in the appended claims is to cover all such changes and modifications as fall within the true spirit and scope of the invention . the matter set forth in the foregoing description and accompanying drawings is offered by way of illustration only and not as a limitation . the actual scope of the invention is intended to be defined in the following claims when viewed in their proper perspective based on the prior art .	6
with reference to the figures fig1 partially illustrates a plant designated as a whole by reference number 10 comprising a conveyance plant made up of an overhead rail 11 on which run conveyance means 12 which are advantageously conveyors or self - propellers and have motors 13 and bearing hangers 14 for supporting the bodies 15 to be processed e . g . welded . the hanger conveyors convey the bodies or cars among a plurality of work stations or cells of which one designated by reference number 16 is shown in fig1 . a similar conveyor system and the processing equipment in the stations are well known to those skilled in the art and are therefore not further described or shown . to support the body the hanger 14 comprises a frame 19 , 20 with arms 18 from which support or reference members 17 on which the body is rested project above . as may be seen better in fig2 and 3 each support 17 includes a vertical stem 22 with a positioning pin 35 at its top end . the pin 35 has a tapered end — conical for example — and is designed to engage with minimal side play in an appropriate reference seat 23 in the body 15 . at the base of the coupling pin 35 the stem 22 defines a table 34 for supporting the body . the combination of the table 34 and the pin 35 supplies a precise positioning reference for the body with respect to the stem 22 . as may be seen in fig2 and enlarged in fig3 the stem 22 is hollow and inside it are a pair of rods 37 , 38 extending along the axis of the stem to end above in a clamp 39 , 40 each and below in a handling end pivoted at 46 to a sleeve 47 mounted in a running manner on the outside of the stem 22 . in an intermediate position between its ends each rod has a slot 41 , 42 shaped as a cam to run on a pin 43 fastened in the stem . the slot 41 , 42 has a first vertical upper section and a second lower section inclined outwardly in the direction of the extension of the clamp associated with the rod . the slot is shaped so that when the sleeve 47 is in its lower rest position as shown in fig2 and hence when the pin 43 is in the vertical section of the slot the clamps 39 , 40 are arranged at the two sides of the positioning pin 35 with the grasping end resting on the positioning table 34 as may be seen in fig3 . as shown in dash - dot lines for the left - hand clamp in fig3 by raising the sleeve 47 the cams provided by the slots 41 , 42 and the pin 43 cause return of the clamps 39 , 40 into the positioning pin 35 . to move the sleeve , actuators 44 are placed in the stations to grasp a corresponding sleeve upon arrival of a body and open or close the clamps as required for body loading , unloading or processing . advantageously as clarified below , the supports 17 are assembled transitorily on the hanger and protrude below with one of their spherical ends 26 to be grasped by grasping and positioning devices 27 arranged in the work stations . for support of the stem 22 on the hanger the stem 22 has a hemispherical fifth wheel 24 resting in a complementary seat 25 in the respective hanger arm 18 . the stem 22 continues downward beyond the seat 25 and ends below in the above mentioned spherical end 26 . the grasping devices 27 are made with a pair of movable jaws 28 powered by a kinematic mechanism 36 to close on the lower end of the positioning member 17 . each jaw comprises vertical rollers or bearings 29 , 30 and a pair of rollers or bearings 31 arranged horizontally . the two rollers 31 of the pair of which only one is visible in the figs are arranged symmetrically with respect to a vertical plane passing through the two clamps . the rollers 29 , 30 are designed to be arranged above and below the equatorial diameter of the sphere 26 and the rollers 31 are designed to rest on the sphere 26 side by side and in an intermediate position between the rollers 29 , 30 . in this manner upon closing of the jaws the center of the sphere 26 is positioned accurately in the device 27 . the holding position is slightly raised over the position of the sphere 26 when the fifth wheel 24 is resting in the hanger seat 25 so that the positioning member 17 is raised and released by the hanger when it is grasped by the jaws 28 . to prevent rotation of the sphere between the jaws and then position the upper end of the stem accurately the jaws have ends 33 which grasp the stem . advantageously one of the jaws 28 supports the actuator 44 which operates a fork 45 to slide it axially to the stem 22 between the two positions shown respectively in solid and dash - dot lines in fig2 . the two positions allow the fork to position itself above or below the sleeve when the jaws are closed . in use , to unload a body from the hanger or load a body on the hanger the hanger reaches a station 16 where grasping means 27 grasp the positioning members with the forks 45 lowered and then raise the forks to move the sleeves 47 upwards and draw in the clamps 39 , 40 as shown in fig4 . in this manner a body can be freely placed on or removed from the pins 35 . after this the grasping means 27 are opened and the hanger can convey the body among the various processing stations . during conveyance the clamps are rested on the edges of the positioning hole 23 of the body ( fig2 ). when the hanger reaches a processing station the grasping means 27 of the station close on the positioning members 17 to raise them from the seats 25 in the hanger and position them accurately with respect to the station . closing of the jaws is however performed after operation upward of the actuator 44 so that the fork 45 is located over the sleeve 47 . the actuator 44 is then operated downward so that the clamps 39 , 40 firmly hold the body between them and the supporting table 34 to prevent all possibility of movement of the body with respect to the positioning members . after the station has performed the programmed processing the actuator 44 raises the fork 45 and the grasping means 27 are opened so that the hanger can resume its travel towards the next station . it is now clear that the predetermined purposes have been achieved to secure safe and accurate holding in accordance with all cartesian axes . as the body is firmly grasped opposite the support and positioning members 17 the body remains fully accessible for processing in the various stations . in addition since the supporting points are standardizable and to a high degree independent of the body configuration different bodies can be treated without the need of modifying the support and holding structure . even if body details require modifications in the position of the supports 17 the structure of the supports remains the same since the configuration of the bodies near the positioning holes does not vary significantly . the additional characteristic of using body supports mounted transitorily on the conveyor plant allows high precision regardless of the design and positioning accuracy of the conveyor system . naturally the above description of an embodiment applying the innovative principles of the present invention is given by way of non - limiting example of said principles within the scope of the exclusive right claimed here . for example the structure of the conveyance means can vary depending on specific exigencies . in particular overhead conveyor systems with or without incorporated vertical hoisting members for the load bearing support can be employed as well as skid , roller , chain , push - conveyor et cetera conveyance systems .	1
presently preferred embodiments of the x - ray imaging spectrometer of the present invention are set forth herein with reference to the accompanying drawings . the embodiment comprises four primary components ; a coded aperture , a large format detector unit ; a processor ; and a display unit . while conventional x - ray detectors provided either imaging or spectroscopic information , the embodiment performs imaging and spectroscopy simultaneously . as a result , with the embodiment , high resolution images of an x - ray source can be produced in selected energy bands . fig1 shows a diagram of the x - ray imaging spectrometer 10 of the embodiment . the x - ray imaging spectrometer 10 comprises an aperture known as a &# 34 ; coded aperture &# 34 ; 12 , which is disposed to receive x - rays 14 from a source 15 . the source may comprise , for example , the aperture of an instrument receiving x - rays from an object in space . an x - ray detector 16 is disposed a distance l from the coded aperture 12 to receive those x - rays 14 which have passed through the coded aperture . the x - ray detector 16 is a two dimensional , large - format , position sensitive , deeply - depleted , high purity silicon detector array . in the preferred embodiment , the x - ray detector 16 employs on - pixel , low noise , preamplifiers . there is one detector located at each pixel . each detector 16 senses the number of x - ray photons received , as well as their energy . this information is sent to a series of amplifiers 18 which amplify the signals . the amplified signals are then transmitted to an analog to digital converter 20 , which converts the analog signals into digital signals . these digitized signals are then sent on line 22 to a processor 24 which performs signal processing and deconvolution . in effect , the deconvolution process unfolds the image , which is distorted by convolution after passing through the coded aperture . this results in the reconstruction of the original image . the resulting information is then transmitted to a display unit 26 for viewing and analysis . the coded aperture 12 in the preferred embodiment is of the type known as a uniformly redundant array ( ura ). the reason that coded apertures are employed in x - ray imaging is that conventional optics , such as lenses and mirrors , cannot be used because x - rays penetrate conventional materials due to their high energies . the coded aperture is a substitute for conventional optics . coded apertures are based on the extension of the well known concept of a pin hole camera . a pin hole camera with only a single opening would have to have a very large opening in order to obtain a reasonable signal - to - noise ratio , because of the weak signals of most x - ray sources . on the other hand , a large hole precludes good angular resolution . therefore , in order to increase the signal strength , a single pin hole is replaced by many pin holes , collectively called the coded aperture . when light passes through several pin holes in an aperture , each pin hole will deposit a shadow of the aperture on a self illuminating object . this will produce many overlapping images of the object to be imaged , thus achieving , in effect , the signal strength of a larger aperture . however , the resulting overlapping images must be decoded to reconstruct a single image of the x - ray source . the reconstructed image will be of a higher quality than that obtained by the use of a single pin hole because of the larger effective aperture . the reconstruction procedure gives the location and intensity of each source in the field of view . basically this is accomplished by detecting the location and strength of aperture patterns in the picture . reconstruction procedures , discussed in more detail below , generally can be categorized as either deconvolutions , or correlations . the reconstruction process is performed in the processor 24 , shown in fig1 . in the preferred embodiment , the coded aperture 12 is constructed out of gold , which is used because of its superior ability to stop x - rays and its ease in fabrication . however , other materials may be used such as tungsten or tantalum . one method of fabricating the coded aperture uses standard semiconductor processing techniques . a chrome - on - glass reticle containing the mathematically generated coded aperture pattern is fabricated using standard electron - beam lithography . this reticle is then used to expose the coded aperture pattern onto a beryllium substrate coated with a thick - film photoresist . the exposed substrate is then developed to reveal the coded aperture pattern in the photoresist . an electroplate process is used to plate gold into the exposed pattern . the remaining photoresist is then removed . with this process , coded apertures with features size well below 20 μm in size are possible . coded aperture to detector separation distances from millimeters to meters can be considered in the instrument design . this permits a broad choice of possible spatial resolutions and instrument fields of view . also , it is preferred that the coded aperture 12 be of the type known as a uniformly redundant array . for further details regarding uniformly redundant arrays and other types of coded apertures , see the article , e . e . fenimore and t . m . cannon , &# 34 ; coded aperture imaging with uniform redundant arrays &# 34 ;, applied optics , volume 17 , february 1978 pages 337 - 347 , which is hereby incorporated by reference . the x - ray detector 16 is separated from the coded aperture 12 by distance l . it will be appreciated that spatial resolution is determined by the ratio d / l , where d is the individual pixel pitch and l is the coded aperture - to - detector separation . this separation can be varied to meet different application requirements . for example , increasing l will increase the spatial resolution but will decrease the field of view . conversely , decreasing l will increase the field of view , but will decrease spatial resolution . the detector 16 is a large format detector , which , in the preferred embodiment , is an array of 1024 × 1024 detectors . it will be appreciated that various sizes of detectors may be used . even a one dimensional array could be employed . with a one dimensional array the system would reconstruct a series of one dimensional images into two dimensions , using well - known computer aided tomography techniques . it is well known that x - ray detection in the field of x - ray spectroscopy is very difficult due to the high energies of x - rays , which penetrate deeply in most materials . consequently x - ray spectroscopy techniques are quite different from visible spectroscopy . in visible light spectroscopy , light is broken up into its constituent colors , and each color is imaged or detected separately . x - ray spectroscopy processes the electromagnetic radiation by treating the energy as particles , and not as waves as in visible spectroscopy . individual photons are counted , and the energy of each individual photon is measured . by plotting the photon count versus energy , a spectrum of the x - ray beam is produced . bands or spikes in this energy diagram will reveal information about the source of the x - rays . as discussed above , the present invention uses deeply depleted detectors , which are detectors having a deep depletion region . this is needed because high energy photons , such as x - rays , penetrate relatively deeply into silicon , and x - rays will only be detected in the depletion region of the silicon . the detectors are fabricated on thick n - type silicon wafers . for example , the preferred silicon wafer is 300 - 500 microns thick . also , the silicon used will preferably be a high receptivity ( 6 to 8 kohm - cm ) n - type silicon . also , it is desired that the silicon be fully depleted so that it is sensitive to x - rays over its entire thickness . this is achieved by the use of a relatively high voltage across the silicon . for further details about x - ray detectors of the type used in the present invention and their construction , refer to b . ludewigt , et al ., &# 34 ; a high rate , low noise , x - ray silicon strip detector system &# 34 ;, i . e . e . e . transactions on nuclear science , volume 41 august 1994 , pages 1037 - 1041 , which is hereby incorporated by reference . for more specific details regarding techniques used to fabricate these detectors , see s . holland , &# 34 ; fabrication of detectors and transistors on high resistivity silicon &# 34 ;, nucl . instr . meth ., volume a275 , pages 507 - 541 , march 1989 , which is hereby incorporated by reference . x - ray detectors function as diodes and are typically connected to subsequent electronic devices such as amplifiers , located apart from each detector . while the advantages of the present invention can be achieved by the use of this conventional arrangement , an alternative embodiment of the present invention will employ low noise preamps attached to each detector pixel . this design reduces stray capacitance caused by the distance between the detector and the amplifier . stray capacitance results in increased noise . the result is a limiting of the sensitivity of the detector . by fabricating the low noise preamps directly on each pixel detector , the sensitivity of each detector is significantly improved . the signal from each detector preamp ( not shown ) is then sent to a series of amplifiers 18 which may comprise for example pulse shaping amplifiers . the analog signal is transmitted from the amplifiers to an analog - to - digital converter 20 for conversion to a digital signal . the analog to digital converters 20 may comprise , for example , a successive approximate analog to digital converter . the digital signals are transmitted from the analog - to - digital converter along line 22 to a processor 24 . as discussed above , the coded aperture 12 is preferably a uniformly redundant array ( ura ). ura &# 39 ; s are a class of arrays known as pseudo - noise arrays . in pseudo - noise arrays the number of occurrences of a particular separation distance between a pair of holes , or ones , is a constant , regardless of the separation distance . that is , the separations are uniformly redundant . the processor 24 is a programmable computer capable of performing the necessary calculations discussed below with the desired speed . for example , the processor 24 may comprise a digital signal processor ( dsp ) computer . the processor 24 contains a reconstruction program which establishes the relationship between the object to be imaged , the aperture , and the resulting image . this reconstruction process , in a sense , will unfold the object from the detected signal . this process is referred to as deconvolution . one type of deconvolution method used with uniformly redundant arrays is described in the above discussed article by e . e . fenimore and t . m . cannon . fig2 shows two diagrams illustrating the information gathered by the detector 16 and sent to the processor 24 . diagram 28 shows a representation of the two dimensional array 16 . in the preferred embodiment , where the detector has 1024 × 1024 individual detectors , there will be over 1 million individual detectors . each pixel is represented by the variable &# 34 ; j &# 34 ;. as x - rays are transmitted through the coded aperture 12 , each pixel will respond to each individual x - ray photon . in particular , the detector will include a semiconductor crystal in which moving electrons and electron hole clouds will be generated by the ionizing radiation of the x - rays . the electron and hole clouds create charge - pulse signals . the amplitude of these charge - pulse signals will be proportional to the energy of the x - ray photons . by measuring the number of pulses and the amplitude of each pulse , the processor 24 will know the number of photons and their energy for each pixel . in particular , the processor 24 collects information from each pixel that can be represented by diagram 30 . that is , the strength of each signal is categorized into discrete energy levels , which represent specific ranges of energy . energy is plotted in diagram 30 along the x axis in units of kev . the letter k will represent the particular energy band . the number of photons counted by the detector is plotted on the y axis . the number of photons counted is represented by the variable n . the time frames for measuring counts will depend on the source and can vary from seconds to hours . while processor 24 has , for each pixel , the information which is in the histogram in diagram 30 , it is not necessary to actually construct this histogram . for example , it can be seen in diagram 30 that photons of energy level 1 , 2 , 3 , 4 , 6 , and 7 kev are received at relatively low rates while a much higher number of photons are detected at energy level 5 . the manner in which this data is analyzed is illustrated in fig3 . raw digital data output from the detector array 16 is accumulated as a data set , n jk , where n jk is the integrated number of counts in detector pixel j in energy bin k . an energy bin is a predetermined , relatively narrow , range of energies . this data is represented by matrix 32 where each column contains the number of counts for each pixel in a given energy bin . the data is corrected by a signal correction unit 34 . in general , the signal correction unit performs an algorithm that modifies the raw data to express the values of the signals in terms of signal strength per unit area for each pixel . also , in this procedure the data is corrected to remove the effects of background x - ray signals . this algorithm calculates a corrected signal s j , k , using the equation : where s j , k is the corrected signal , b j , k k is the background signal determined by calibration , and a j , k is the effective area of each detector pixel , determined by calibration . the corrected signal will then comprise a corrected signal matrix 36 . the reconstruction of the image data gathered from the x - rays passing through the coded aperture 12 , is accomplished by a deconvolution process 38 . deconvolution of the corrected signal matrix 36 into a spectral image is performed by solving the set of equations : θ i , k is the set of unknown photon fluences for each image pixel i in energy bin k of the spectral image . d i , j is a forward response matrix derived from theory . these equations are solved with the constraint that θ i , j is greater than or equal to zero . it should be noted that the constraint that θ i , k be greater than zero is made because the deconvolution calculation can result in negative values . since intensity values on an image can only be perceived as being either zero , or having some positive value , negative values of intensity cannot be displayed on display unit 26 . accordingly , by solving the deconvolution equation with this constraint , more useful information will be available to generate spectral images because there will be a positive value for each pixel . this increases the spatial resolution . the forward response matrix is a mathematical representation of the expected response in an ideal instrument detector array after modulation through coded aperture from a point source of unit signal strength positioned at infinity on the instrument centerline . the forward response matrix can be generated mathematically using an ideal description of the instrument or empirically using quantitative methods to include non - ideal effects . the collected data along with the forward response matrix can be thought of as representing the above set of equations . the data from each detector pixel gives rise to one equation . the image field ( or sky field ) is the set of unknowns where each field ( sky ) pixel is one unknown . the deconvolution process can be considered as the process of solving a set of simultaneous equations for a set of unknowns . for further information regarding deconvolution processes use with uniformly redundant arrays , see the above - discussed article by e . e . fenimore , et al . the deconvolution process 38 yields spectral image matrix 40 which contains all of the values necessary to reconstruct the original image in each energy bin . for example , resulting images 42 , 44 , 46 and 48 each comprise images constructed from all j pixels in a single energy bin , e 1 , e 2 , e 3 and e 4 respectively . it will be appreciated that the exact number of energy bins will depend on numerous factors , including the constraints of the application , and the energy resolution of the detector 16 . the processes depicted in fig3 will be implemented by a program operating on processor 24 . the spectral images 42 - 48 may then be displayed on display unit 26 . a flow chart of the overall process of one embodiment of the present invention is shown in fig4 . this process 60 begins with the passing of x - rays through the coded aperture 12 from the source 15 , in step 52 . at step 54 each detector in the array 16 determines the number and energy of photons impinging on the detector . at step 56 the processor 24 collects the all n j , k , which comprises the number of photon counts in each energy band k for each pixel . at step 58 the signal is corrected using the above - described signal correction algorithm 34 . next , at step 60 the corrected signal is deconvolved into a spectral image by the deconvolution process 38 . in step 62 , separate two dimensional spectral images 42 - 48 are displayed using the deconvolution results for each energy bin k . it should be noted that the output of the present invention is four dimensional data . that is , it contains two dimensional image information comprising the x , y location of each pixel ( two dimensions ), plus the intensity of that pixel . in addition , the data includes a spectrograph of intensity values throughout the energy spectrum for each pixel . although only a few embodiments have been described in detail , those having ordinary skill in the art will certainly understand that many modifications are possible in the preferred embodiment without departing from the teachings thereof . for example , various kinds of x - ray detectors may be used including those without on - pixel preamps . also , other types of coded apertures , besides uniformly redundant arrays may be used . furthermore , different deconvolution algorithms can be used . in addition , the techniques of the present invention may be applied to electromagnetic radiation outside of the x - ray region . for example , high energy x - rays above 20 - 50 kev , and even gamma rays may be detected by modifying the detector so that it adequately detects these photons . all such modifications are intended to be encompassed within the following claims .	6
referring to the drawings , wherein like reference numbers refer to like components , in fig1 a multi - speed transmission 10 is depicted . the transmission 10 includes an input member 12 and an output member 14 . in the present embodiment , input member 12 and output member 14 are shafts , and will be referred to as such . those skilled in the art will appreciate that the input and output members 12 , 14 may be components other than shafts . the input shaft 12 is continuously connected to an engine ( not shown ) or to a turbine of a torque converter ( not shown ). the output shaft 14 is continuously connected with the final drive unit or transfer case ( not shown ). transmission 10 includes four planetary gear sets 16 , 18 , 20 and 22 . the planetary gear sets 16 , 18 , 20 and 22 are connected between the input shaft 12 and the output shaft 14 . in a preferred embodiment of the present invention , planetary gear set 16 is a simple planetary gear set that includes a sun gear member 24 , a ring gear member 26 and a carrier member 28 that rotatably supports a set of pinion gears 30 ( only one shown ). sun gear member 24 is connected for common rotation with first outer shaft 32 and first intermediate shaft 34 . ring gear member 26 is connected for common rotation with second outer shaft 36 . pinion gears 30 are configured to intermesh with sun gear member 24 and ring gear member 26 . carrier member 28 is connected for common rotation with second intermediate shaft 38 . in a preferred embodiment of the present invention , planetary gear set 18 is a simple planetary gear set . more specifically , planetary gear set 18 includes a sun gear member 42 , a ring gear member 44 and a carrier member 46 that rotatably supports a set of pinion gears 48 ( only one shown ). sun gear member 42 is connected for common rotation with first intermediate shaft 34 . ring gear member 44 is connected for common rotation with a third intermediate shaft 50 . carrier member 46 is connected for common rotation with an input shaft 12 . pinion gears 48 are configured to intermesh with both sun gear member 42 and ring gear member 44 . in a preferred embodiment of the present invention , planetary gear set 20 is a simple planetary gear set that includes a sun gear member 52 , a ring gear member 54 and a carrier member 56 that rotatably supports a set of pinion gears 58 ( only one shown ). sun gear member 52 is connected for common rotation with a third intermediate shaft 50 . ring gear member 54 is connected for common rotation with fourth intermediate shaft 60 . carrier member 56 is connected for common rotation with fifth intermediate shaft 62 . pinion gears 58 are configured to intermesh with both sun gear member 52 and ring gear member 54 . in a preferred embodiment of the present invention , planetary gear set 22 is a simple planetary gear set that includes a sun gear member 72 , a ring gear member 74 and a carrier member 76 that rotatably supports a set of pinion gears 78 ( only one shown ). sun gear member 72 is connected for common rotation with sixth intermediate shaft 64 and seventh intermediate shaft 66 . ring gear member 74 is connected for common rotation with second intermediate shaft 38 . carrier member 76 is connected for common rotation with an output shaft 14 . pinion gears 78 are configured to intermesh with both sun gear member 72 and ring gear member 74 . the transmission 10 includes a variety of torque - transmitting mechanisms or devices including a first intermediate clutch 80 , a second intermediate clutch 82 , a third intermediate clutch 84 , a first brake 90 and a second brake 92 . first intermediate clutch 80 is selectively engageable to connect seventh intermediate shaft 66 to carrier member 46 and input shaft 12 . second intermediate clutch 82 is selectively engagable to connect sixth intermediate shaft 64 to sun gear member 52 . third intermediate clutch 84 is selectively engagable to connect fourth intermediate shaft 60 to sixth intermediate shaft 64 . brake 90 is selectively engageable to connect outer shaft 32 to transmission housing 100 to restrict rotation of shaft 32 relative to housing 100 . brake 92 is selectively engageable to connect outer shaft 36 to housing 100 to restrict rotation of shaft 36 relative to housing 100 . the transmission 10 is capable of transmitting torque from the input shaft 12 to the output shaft 14 in at least eight forward torque ratios and one reverse torque ratio as indicated in the truth table of fig2 . each of the forward torque ratios and the reverse torque ratios is attained by engagement of one or more of the torque - transmitting mechanisms ( i . e . first intermediate clutch 80 , a second intermediate clutch 82 , a third intermediate clutch 84 , a brake 90 and a brake 92 ). those skilled in the art will readily understand that a different speed ratio is associated with each torque ratio . thus , at least eight forward speed ratios and at least one reverse speed ratio may be attained by transmission 10 . an example of the gear ratios that may be obtained using the embodiments of the present invention are also shown in fig2 . of course , other gear ratios are achievable depending on the gear diameter , gear tooth count and gear configuration selected . a lever diagram 10 a is shown in fig3 that is representative of transmission 10 of fig1 , as well as the connections for the clutches 80 , 82 , 84 and brakes 90 , 92 . the nodes 24 a , 26 a , 28 a , 42 a , 44 a , 46 a , 52 a , 54 a , 56 a , 72 a , 74 a and 76 a of the lever diagram 10 a represent the gear members 24 , 26 , 28 , 42 , 44 , 46 , 52 , 54 , 56 , 72 , 74 and 76 of fig1 such that the same numerical designation with the addition of an a suffix is used to identify the corresponding node . for example , the nodes 24 a and 42 a shown in fig3 represent sun gears 24 and 42 respectively shown in fig1 . other components of fig3 have the same numbering convention for the corresponding components in fig1 . moreover , the operation or engagement of clutches 80 , 82 , 84 and brakes 90 , 92 to establish the various forward and reverse gear speeds will now be described with continuing reference to fig1 , 2 and 3 . to establish the reverse torque ratio ( rev ), the torque - transmitting mechanisms or clutches are selected as set forth in the table of fig2 . as shown in fig2 , first and second brakes 90 , 92 and third intermediate clutch 84 are engaged to achieve the reverse torque ratio ( rev ). in neutral , none of the clutches or brakes are carrying torque . as noted in fig2 , in this gear state , the first and second brakes 90 and 92 are engaged but not carrying torque . a first forward torque ratio ( listed as 1st ( first gear ) in the truth table of fig2 ), is achieved by engaging first and second brakes 90 and 92 and first intermediate clutch 80 . an arrow is provided in fig2 that emanates from third intermediate clutch 84 that is released and points to the clutch that is engaged ( clutch 80 ), when transitioning from reverse through neutral to first gear . a subsequent forward torque ratio , indicated as 2 nd ( second gear ) in fig2 , is established by engagement of first and second brakes 90 , 92 and second intermediate clutch 82 . the shift from first gear to second gear occurs as follows : releasing first intermediate clutch 80 and engaging second intermediate clutch 82 while maintaining engagement of brakes 90 , 92 . an arrow is provided in fig2 that emanates from the clutch that is released ( clutch 80 ) and points to the clutch that is engaged ( clutch 82 ). the subsequent torque ratio , indicated as 3 rd ( third gear ) in the truth table of fig2 , is established by the engagement of second brake 92 , first and second intermediate clutches 80 and 82 . the shift from second gear to third gear occurs as follows : clutch 82 and brake 92 remain engaged , brake 90 is released and clutch 80 is engaged . an arrow is provided in fig2 that emanates from the brake that is released ( brake 90 ) and points to the clutch that is engaged ( clutch 80 ). the next subsequent forward torque ratio , indicated as 4 th ( fourth gear ) in the truth table of fig2 , is established with the engagement of second brake 92 , second and third intermediate clutches 82 , 84 . the shift from third gear to fourth gear is achieved as follows : engagement of clutch 82 and brake 92 are maintained , clutch 80 is released and clutch 84 is engaged . an arrow is provided in fig2 that emanates from the clutch that is released ( clutch 80 ) and points to the clutch that is engaged ( clutch 84 ). a subsequent forward torque ratio indicated as 5 th ( fifth gear ) in fig2 , is established with the engagement of second brake 92 and first and third intermediate clutches 80 and 84 . the shift from fourth gear to fifth gear occurs as follows : the engagement of clutch 84 and second brake 92 are maintained , clutch 82 is released and clutch 80 is engaged . an arrow is provided in fig2 that emanates from the clutch that is released ( clutch 82 ) and points to the clutch that is engaged ( clutch 80 ). a subsequent forward torque ratio indicated as 6 th ( sixth gear ), in the truth table of fig2 , is established with the engagement of first , second and third intermediate clutches 80 , 82 and 84 . the shift from fifth gear to sixth gear occurs as follows : the engagement of clutches 80 and 84 are maintained , brake 92 is released and clutch 82 is engaged . an arrow is provided in fig2 that emanates from the brake that is released ( brake 92 ) and points to the clutch that is engaged ( clutch 82 ). the next subsequent torque ratio , indicated as 7 th ( seventh gear ) in the truth table of fig2 , is established with the engagement of brake 90 and first and third intermediate clutches 80 , 84 . the shift from sixth gear to seventh gear occurs as follows : the engagement of clutches 80 and 84 are maintained , clutch 82 is released and brake 90 is engaged . an arrow is provided in fig2 that emanates from the clutch that is released ( clutch 82 ) and points to the brake that is engaged ( brake 90 ). the next subsequent torque ratio , indicated as 8 th ( eight gear ) in the truth table of fig2 , is established with the engagement of brake 90 and second and third intermediate clutches 82 , 84 . the shift from seventh gear to eighth gear occurs as follows : the engagement of clutch 84 and brake 90 are maintained , clutch 80 is released and clutch 82 is engaged . an arrow is provided in fig2 that emanates from the clutch that is released ( clutch 80 ) and points to the clutch that is engaged ( clutch 82 ). the present invention contemplates that downshifts follow the reverse sequence of the corresponding upshift ( as described above ), and several power - on skip - shifts that are single - transition are possible ( e . g . from 1st to 3rd ). while the best modes for carrying out the invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention within the scope of the appended claims .	5
theoretical considerations and experimental procedures for the quantitative determination of dissolved oxygen in liquid fuels according to the invention are described in gord et al , &# 34 ; dissolved oxygen quantitation in fuel through measurements of dynamically quenched fluorescence lifetimes ,&# 34 ; ieee publication 95ch3482 - 7 , pp 39 . 1 - 39 . 6 ( jul . 1995 ), the entire teachings of which are incorporated by reference herein . in accordance with a governing principle of the invention , the oxygen molecule ( o 2 ) efficiently quenches the luminescence of a variety of luminophors in fuels as a result of an energy match between the single - triplet gap in o 2 and the energies of the first excited state of many polycyclic aromatic hydrocarbons and of many metal complexes . luminophors of interest in the practice of the invention exhibiting luminescence which is quenched by o 2 include pyrene , anthracene and napthalene and the derivatives thereof , or others as would occur to the skilled artisan practicing the invention . variations in oxygen concentration will result in variations in the collision rate between oxygen and a luminophor ( probe ) present in a solution . both the quantum yield and lifetime of the luminescence of the probe exhibit an inverse oxygen concentration dependence . the principle of the invention may be illustrated by considering the photoexcitation of probe molecule a , the excited state a * which decays by luminescence with rate constant k l or is quenched by o 2 with a rate constant k q ( q ): the overall first order rate constant k s for eq ( 1 ) is given by : the integrated rate expression for the decay of the excited states of a is : a single excited state will show a simple exponential decay . eq ( 2 ) shows that determination of the rate constant for the decay of the excited state at a series of oxygen concentrations yields a straight line . for the best operating mode in the invention the lifetime τ for the decay of the excited state equals 1 / k . eq ( 2 ) can be expressed using the lifetime of the unquenched excited state τ 0 and the lifetime of the excited state at a concentration q of quencher τ q as : eq ( 4 ) is the stem - volmer equation ( see lakowica , principles of fluorescence spectroscopy , plenum press , ny ( 1983 ), incorporated by reference herein ), and can be used as a calibration equation with τ 0 / τ s plotted versus o 2 concentration . referring now to the drawings , fig1 is a schematic block diagram of representative system 10 useful in the determination of o 2 concentration in a liquid fuel according to the method of the invention . in system 10 , a liquid fuel sample 11 to be tested is disposed within a sample region 12 , which may include a cuvette , flask , cell , flowing fuel line , or other suitable disposition occurring to the skilled artisan practicing the invention . sample 11 comprises a liquid fuel such as cyclohexane , isooctane , jet - a , hexane , heptane , nonane , decane , kerosene , oil or other fuel the oxygen content of which is sought . sample 11 is doped with a known concentration of a probe 13 molecule selected from the class of luminophors known in the art as suitable for the intended purpose , including those listed above . a coherent light source such as laser source 14 provides light beam 15 for exciting probe 13 in sample 11 . sources 14 suitable for use in the method of the invention include pulsed nitrogen , eximer , nd : yag , nd : ylf , ti : sapphire , and nd : yvo 4 lasers , or other source as would occur to the skilled artisan practicing the invention . beam 15 is split by beamsplitter 16 into reference beam portion 15r directed onto detector 17 ( such as a photodiode , photomultiplier , external trigger or other equivalent purpose detector ) and sample beam portion 15s directed onto sample 11 . beam 15s may be directed onto sample 11 through any suitable number and type of optical elements comprising an optical train such as that suggested in fig1 as including iris 18 , mirror 19 and lens 20 . luminescence from the probe molecules within sample 11 in the form of beam 21 is directed through a second optical train ( such as lens 22 , neutral density filter 23 and color filter 24 illustrated in the non - limiting system 10 embodiment ) onto a second detector 25 ( in the form of photomultiplier tube , photomultiplier , micro - channel plate , or photodiode ). signals 26 , 27 respectively from detectors 17 , 25 are directed into suitable electronic data storage means represented in fig1 by digital storage oscilloscope 28 . signal 27 defines the luminescence output from probe 13 in sample 11 . the purpose of beam portion 15r directed onto detector 17 is to provide an output signal 26 from detector 17 to initiate data acquisition from oscilloscope 28 . it is noted , however , that data acquisition may be triggered directly by signal 27 from probe 13 . excess beam 15s energy passing through sample 11 may be absorbed by beam dump 29 . in demonstration of the method of the invention , cyclohexane and isooctane liquid fuels were tested for o 2 using pyrene as a luminophor probe . fig2 a shows decay of luminescence intensity of the excited pyrene as a function of time for a 9 ppm solution of pyrene in cyclohexane after sparging with nitrogen . fig2 b shows the data of fig2 a displayed as the natural logarithm of pyrene luminescence versus time . the lifetime of the luminescence may be obtained by directly fitting the exponential decays or by linearizing the data to determine lifetime using least squares . fig2 b shows the linearity of the logarithm of intensity decay over at least two orders of magnitude . fig3 is a plot of pyrene probe luminescence intensity decay in isooctane versus time for various oxygen concentrations illustrating the effect of luminescence quenching by oxygen . curve 31 represents the longest luminescence lifetime for oxygen - free isooctane ( 0 ppm o 2 concentration ). curves 32 , 33 , 34 , 35 , 36 are luminescence decay traces of pyrene in isooctane , respectively , for o 2 concentrations of 16 ppm , 30 ppm , 40 ppm , 67 ppm and 101 ppm . pyrene lifetime in isooctane clearly decreases with increased o 2 concentration in predictable fashion according to the principal teaching of the invention . fig4 is a stem - volmer plot for o 2 quenching in the pyrene - isooctane system showing good linear dependence . fig4 or the equivalent plot for other luminophor - liquicl fuel systems may be used as a calibration curve for o 2 determination in the fuel . the method of the invention was demonstrated on actual fuel samples in order to illustrate the best mode of operation of the invention . fig5 shows a calibration curve for determination of o 2 concentration in jet - a fuel at room temperature containing 10 ppm pyrene as the probe . the natural logarithm of the decay of luminescence intensity with time is linear . the lifetimes show a broad range from air saturated to fully unquenched giving good precision to the results . the pyrene could be decreased in concentration to the 1 ppm level without significantly diminishing the quality of results . all data were collected with a neutral density filter which reflects about 99 % of the luminescence intensity . the method of the invention was also demonstrated with flowing heptane fuel pumped through a heated tube simulating a jet fuel line . pyrene at 0 . 1 to 100 ppm levels were added to the fuel in separate runs . the fuel reacts with the initially dissolved o 2 , but system tightness prevents further absorption of o 2 into the fuel . by varying fuel flow rate through the tube the residence time of the fuel in the tube and hence the reaction time at high temperature may be varied . oxygen concentration as a function of flow rate was measured to yield an o 2 consumption plot . measurements using the method of the invention were compared against gc . the validity of the luminescence method of the invention was cross - checked by inserting an optical cell in - line with the gc . the fuel was returned to room temperature prior to the luminescence and gc measurements . it must be noted that the luminescence lifetime is temperature dependent , and control of temperature during comparative testing is therefore important . fig6 is a plot of o 2 concentration versus residence time showing absolute o 2 concentration during aviation fuel thermal stress tests comparing the method of the invention to gc . fig7 is the corresponding plot of relative o 2 concentration versus residence time . in fig6 and 7 , plots 61 , 71 ( defined by squares indicia ) define measurements using the luminescence method of the invention and two - point calibration . plots 63 , 73 ( defined by circle indicia ) define measurement results using gc . accuracy and reproduceability of measurements using the method of the invention is apparent , including the structure of the decay curves , which reflects passivation effects characteristic of the heated simulated fuel line . stem - volmer plots of τ 0 / τ q ( see fig5 supra ) were used as calibration curves for data in fig6 . however , two point calibration can also be used . all generated stern - volmer plots were linear so that accurate measurement of the air - saturated and fully unquenched measurements were sufficient to define the calibration curves . measurements of luminescence lifetime in the fuel at the slowest flow rate ( at which all oxygen is consumed ) and of the luminance lifetime of air - saturated fuel produces an accurate two - point calibration curve as illustrated in fig7 . the luminescence lifetime may be obtained using a frequency - resolved rather than a time - resolved analysis as suggested in gord et al , supra . the frequency - resolved method has lower cost and greater instrumental simplicity , but the time - resolved method gives better separation of background fuel luminescence from the probe luminescence . the invention therefore provides a method for quantitatively determining dissolved oxygen in fuel . it is understood that modifications to the invention may be made as might occur to one with skill in the field of the invention within the scope of the appended claims . all embodiments contemplated hereunder which achieve the objects of the invention have therefore not been shown in complete detail . other embodiments may be developed without departing from the spirit of the invention or from the scope of the appended claims .	8
reference will now be made in detail to the embodiments , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to the like elements throughout . the embodiments are described below to explain the present invention by referring to the figures . the proposed device has a rotor holding an amine support solid absorbent with a carbon dioxide absorption function , etc . the rotor is divided into a processing zone and a reproduction zone at least . the proposed device has such a function that the air to be processed is ventilated in the processing zone to separate and remove the carbon dioxide from the air to be processed , and the air to be reproduced is ventilated in the reproduction zone to desorb the carbon dioxide . the proposed device is constructed such that an enthalpy adjustment device is mounted to adjust the enthalpy ( both temperature and humidity ) of the air to be reproduced ventilated in the reproduction zone and / or the air to be processed ventilated in the processing zone . a first preferred embodiment of the absorption type removal / separation apparatus is described along with fig1 as follows . 1 denotes a honeycomb rotor , and the rotor is made by corrugated ( wave attachment ) processing of a nonflammable sheet of ceramic textiles paper , glass fiber paper , etc ., and by twisting processing in the shape of a rotor . the rotor supports organic system absorbents such as an amine installation porous material . specifically , the absorbent can be tri - ethanol amine , mono ethanolamine , etc ., weakly basic anion exchange resin of an amine system and amine support solid absorbents such as activated carbon holding amine and meso - porous silica . the honeycomb rotor 1 is divided into a processing zone 2 and a reproduction zone 4 . indoor air is supplied to the processing zone 2 in a blois ( not shown , since it is general ), etc . after carrying out enthalpy adjustment of the air to be processed through a temperature control device 8 and a humidity adjustment device 7 , the air to be processed is ventilated into processing zone 2 , and the absorbent of the rotor portion is made to absorb the carbon dioxide contained in the air to be processed , the separation and the removal of the carbon dioxide from the air to be processed are carried out , and the concentration of carbon dioxide is reduced in the air to be processed . in the reproduction zone 4 , after passing the air to be reproduced heated by a temperature control device 5 through a humidity adjustment device 6 to carry out enthalpy adjustment , the air is ventilated in the reproduction zone 4 to separate and remove the carbon dioxide absorbed in the rotor to the air to be reproduced , and then , the holding absorbent of the rotor portion in a process of passing through the processing zone is reproduced . also , a total heat exchanger of honeycomb rotor type or standstill type rectangular cross style element type may be provided in the inlet and the outlet of the passage of the air to be reproduced , which are ventilated in the reproduction zone 4 , to carry out all the heat recollection . fig9 shows an embodiment of the proposed absorption type removal / separation apparatus , which includes a total heat exchanger . if the weakly basic anion exchange resin which has especially a primary class amine and / or a second class amine as a functional group is used as a solid absorbent , reactions as shown by the above formula [ 2 a ], [ 2 b ], [ 4 a ] and [ 4 b ] occur , and it is thought that the continuation derivative model of an amine carbon dioxide - basin system is formed . that is , the solvent as a continuation dielectric is made into the surroundings of the hco 3 - molecule as solute , and electric charge distribution of a solute molecule causes polarization in a surrounding solvent . in the continuation derivative model , since the formulas [ 2 a ], [ 2 b ], [ 4 a ] and [ 4 b ] are promoted under low - temperature conditions by such an interaction between solute and solvent , the reactivity such as absorption speed , diffusion speed . etc , becomes high . therefore , in the continuation derivative model by humidifying at the reproduction temperature of the degree of low temperature , a different behavior shows from a conventional technology of the substitution desorption such that the heated air to be reproduced at a low temperature is made to be in a state of humidification and the material to be removed in a state of adsorption is driven out with moisture from the absorbent . as to the various examinations we have done so far , the acknowledge that the carbon dioxide can hardly be removed and condensed in the honeycomb rotor supporting the amine support solid absorbent which has the third class amine as a functional group is obtained , and it is thought that removal and concentration of carbon dioxide has taken place also from this at the above reactions . in a case where the inlet of the reproduction zone is not humidified , 50 - 60 ° c . or more of reproduction temperature is needed in order to demonstrate the suitable carbon dioxide removal performance as apparatus . even if the reproduction temperature is made to be low to about 30 - 40 after heating the reproduction air at 50 - 60 ° c . by carrying out evaporative cooling humidification , carbon dioxide removal performance can be maintained . thereby , it brings about the advantages that the heat deterioration of an amine support solid absorbent can be reduced and the reinforcement of the honeycomb rotor can be achieved . also , it becomes possible to suppress the odor emission from the honeycomb rotors by disassembly of amine , etc ., such as amine - like odor . in the preferred embodiment 1 , the humidity adjustment devices 6 and 7 and the temperature control devices 5 and 8 as an enthalpy adjustment device are provided in both the processing zone 2 and the reproduction zone 4 . this constitution enables to control enthalpy . however , it is not limited to this constitution , and the enthalpy adjustment devices may be provided only in one of the two zones . a placement of the humidity adjustment devices 6 and 7 and the temperature control devices 5 and 8 may be made reverse , and anyone of the humidity and the temperature may be adjusted by the adjustment device . in the case where the conditions of indoor air or the open air are settled in a predetermined range , if the enthalpy of the air sent to the reproduction zone 4 is larger than the air sent to the processing zone 2 , the indoor carbon dioxide will be emitted to the open air . therefore , in this case , the fixed state may be sufficient without adjusting enthalpy . it is not limited for the air flow of the preferred embodiment 1 to one way , and it may be made to raise the concentration levels of the carbon dioxide further by returning a part or the whole quantity of the air for reproduction which comes out from the reproduction zone 4 on a side of the inlet of the enthalpy adjustment device 5 to carry out reproduction circulation . also , it may be made to raise the amount of carbon dioxide removal by returning a part or the whole quantity of air which comes out from the processing zone 2 on a side of the inlet of the enthalpy adjustment device 8 to carry out processing circulation . furthermore , the absorption type removal / separation device which is combined the reproduction circulation described above and the processing circulation is sufficient . it is not limited to the honeycomb rotor 1 which is divided into the processing zone 2 and the reproduction zone 4 , the processing zone may be divided into two or more zones and the reproduction zone may be divided into two or more zones . thus , both of the zones may be constructed to be divided into two or more zones . the inventor &# 39 ; s proposal is not limited to the honeycomb rotor , instead of the honeycomb rotor as shown in fig7 , the rotor which has a net and a pellet type or a granular type amine support solid absorbent 9 , etc ., may be used . also , the rotor constructed such that the absorbent is filled in the column such as the shape of a pillar and the shape of a square pillar and the air and the absorbent can contact each other directly may be used . fig9 shows a column / pellet embodiment for the proposed absorption type removal / separation apparatus . although fig9 shows a co - current flow for the processing air and the air for reproduction , a counter current flow is also possible . furthermore , it is sufficient also as construction of a batch type which absorbs and desorbs carbon dioxide by turns using at least two or more kinds of rotors which are supported the amine support solid absorbent , etc . the result of the various experiments conducted by using absorption type removal / separation apparatus of the preferred embodiment 1 is described as follows . as to the honeycomb rotor , the width is 200 mm and the diameter is 200 mm . also , the rotor supports the amine support solid absorbent . the experiment was conducted under the following conditions . the carbon dioxide levels at the inlet of processing zone is 800 ppm , the surface ratio of the processing zone and the reproduction zone is 1 : 1 , and both of the treated surface wind velocity and the reproduction surface wind velocity are 2 m / s . fig2 shows the amount of carbon dioxide removal to the difference in enthalpy between the inlet of the reproduction zone and the inlet of the processing zone at the time of changing the temperature of the inlet of the processing zone . the carbon dioxide level of the inlet of the reproduction zone is fixed at 500 ppm . the graph shows the larger the difference in enthalpy between the inlet of the reproduction zone and the inlet of the processing zone is , the larger the amount of carbon dioxide removal is larger . therefore , it turns out to the followings . enthalpy control of the apparatus may be carried out so that the enthalpy of the air at the inlet of the processing zone may be made as low as possible and the enthalpy of the air at the inlet of the reproduction zone may be raised as much as possible in order to increase the amount of carbon dioxide removal . as such an example of operation , if air with a reproduction air absolute humidity of 20 g / kg ( summer air conditions ) is heated at 70 ° c . by using the exhaust heat of about 90 ° c . such as the exhaust heat from the carbon dioxide heat pump , warm water from a boiler and exhaust heat from other equipment , etc . and cooled by carrying out evaporative cooling to 45 ° c . with an evaporation type humidifier , the enthalpy of the air for reproduction will become 128 kj ( s )/ kg &# 39 ;. the larger the amount of carbon dioxide removal is , the lower the temperature at the inlet of the processing zone temperature is . fig3 shows the amount of carbon dioxide removal to the difference in temperature between the inlet of the reproduction zone and the inlet of the processing zone at the time of changing the difference in enthalpy between the inlet of the reproduction zone and the inlet of the processing zone in the conditions that the temperature of the inlet of the processing zone is made to be constantly at 20 ° c . and the carbon dioxide levels at the reproduction zone is made to be constantly at 800 ppm . the graph shows the larger the difference in temperature between the inlet of the processing zone and the inlet of the reproduction zone , the larger the amount of carbon dioxide removal is . then , it turns out that the amount of removal is dependent on the difference in temperature between the inlet of the reproduction zone and the inlet of the processing zone . fig4 shows the amount of carbon dioxide removal in a condition that absolute humidity at the inlet of the reproduction zone is changed and in a constant condition that the temperature at the inlet of the processing zone is 20 ° c ., absolute humidity at the inlet of the processing zone is 3 . 8 g / kg &# 39 ; and carbon dioxide level at the inlet of the reproduction zone is 800 ppm . also , fig5 shows the amount of carbon dioxide removal in a constant condition that temperature at the inlet of the processing zone is 20 ° c ., absolute humidity at the inlet of the reproduction zone is 17 . 0 g / kg &# 39 ; and carbon dioxide level at the inlet of the reproduction zone is 800 ppm and in a condition that the absolute humidity at the inlet of the processing zone is changed . these graphs show that the larger the absolute humidity difference between at the inlet of the processing zone and at the inlet of the reproduction zone is , the larger the amount of carbon dioxide removal is larger . it turned out that the amount of carbon dioxide removal increases by lowering the humidity on the side of processing . therefore , the apparatus may be controlled to lower the enthalpy of air at the inlet of the processing zone as much as possible in order to increase the amount of carbon dioxide removal . in view of fig3 through fig5 , it is thought that the enthalpy swing absorption which performs absorption and desorption of an object by an enthalpy difference has occurred with the combination of temperature swing and humidity swing . fig6 shows the amount of carbon dioxide removal to absolute humidity difference δx between at the inlet of the processing zone and at the outlet of the processing zone . this graph shows that the amount of carbon dioxide removal is not dependent on absolute humidity difference δx between at the inlet of the processing zone and at the outlet of the processing zone . if carbon dioxide is desorbed by substitution desorption as a conventional technology that the high moisture air such as vapor is used as the air for reproduction , the regular tendency should be seen by the carbon dioxide extraction ratio to absolute humidity difference δx . however , since such a tendency is not seen , substitution desorption does not arisen . from the above results , it turned out the followings . as to the absorption type removal / concentration apparatus , which utilizes the principle of enthalpy swing absorption with the honeycomb rotor holding absorbent of carbon dioxide , it is effective for the apparatus to control the enthalpy of the air at the inlet of the processing zone as low as possible and the enthalpy of the air at the inlet of the reproduction zone as much as possible . especially , in a case that the styrene system gel resin supported primary and secondary amine is used as an absorbent , the price will become cheap as compared with other solid - carbon - dioxide adsorbent . as compared with the removal apparatus using amine solution , its handling becomes easy and its initial cost or its running cost is lower . although there is a disadvantage that the heat resistance of the styrene system gel resin supported this primary and secondary amine is weak . however , since reproduction temperature can be made low by using the apparatus using the principle of esa according to the inventors &# 39 ; proposals , this problem is also solvable . if weakly basic anion exchange resin and weak acidic cationic exchange resin are mixed and it supports on the honeycomb rotor , acidic gas such as sox and nox and alkaline gas such as ammonia are also removable besides carbon dioxide . in addition , it may combine with the rotor using activated carbon , hydrophobic zeolite and a synthetic adsorbent material . in this case , the honeycomb rotor also comes to have a function which can carry out adsorption removal of an indoor bad smell and voc . the apparatus utilizes the principle of esa with the rotor holding the absorbent of carbon dioxide . since the apparatus absorbs the carbon dioxide contained in the air to be processed in the processing zone and desorbs the carbon dioxide absorbed in the processing zone with the air for reproduction at 30 - 80 ° c ., the energy is saved , compared with the case where the high temperature air for reproduction is used in the reproduction zone . since the carbon dioxide levels of the air at the outlet of the processing zone , which has passed through the processing zone of absorption type removal / concentration device are low , if the air is supplied into the interior of room of the buildings , etc ., the carbon dioxide levels of the air in the interior of room can be made low . in this case , since the amount of open air introduced in order to reduce indoor carbon dioxide levels can be reduced sharply , compared with the usual ventilation , it becomes energy saving . also , since the carbon dioxide levels of the air at the outlet of the reproduction zone , which has passed through the reproduction zone of the absorption type removal / concentration apparatus is high , if the air is led into the growing room for plants such as a vinyl house and a plant factory , the plants grow early and it can control discharge of the carbon dioxide to environment . the high - concentration carbon dioxide in the reproduction zone may be supplied to a vinyl house with the indoor carbon dioxide removed by using both the air in the outlet of the reproduction zone and the air in the outlet of the processing zone . the absorption type removal / concentration apparatus can perform circulation air - conditioning of carbon dioxide . for example , a building is air - conditioned with the air at the outlet of the processing zone , which is removed the carbon dioxide generated from humans , etc . from the indoor air , and the air at the outlet of the reproduction zone which becomes high concentration in the carbon dioxide levels is supplied into the vinyl house provided in the roof of the building , etc ., to promote growth of a plant . although a few embodiments have been shown and described , it would be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention , the scope of which is defined in the claims and their equivalents .	8
in the following , the present invention will be explained in detail for one embodiment thereof in reference to the drawings . first of all , one embodiment of the reproduction apparatus constituting a part of the present invention will be described . the recording device according to this embodiment is a powder - development - and - image - transfer type reproduction apparatus , in which an image original to be reproduced may be of any type such as sheet as in general documents , books or like other bound papers , and so forth . referring to fig1 and 2 , a reference numeral 1 designates a machine casing , 3 refers to an automatic document feeder ( adf ) which sequentially feeds the image originals onto an image original mounting table 16 to be described later , and 2 denotes an image original stacking table , on which image originals to be fed to the original mounting table are stored in stack . 4 1 and 4 2 designate cassettes for accommodating therein image transfer paper 5 1 and 5 2 as the sheet recording medium , and 6 refers to a tray , on which the image transfer paper discharged out of the reproduction apparatus is temporarily stored after the image transfer operations . 7 refers to a main switch 8 , warning indicator sections , 10 paper size indicator sections , 11 an image density adjusting dial , 12 a continuous reproduction sheet number selection key , 13 a continuous or multiple copy button inter - connected with the continuous reproduction sheet number selection key 12 , 14 a single copy button which is not inter - connected with the continuous reproduction . a hopper to accommodate therein developer for replenishment and to supply the same depending on necessity is disposed at a position of a front right door . the operations of this reproduction apparatus will now be explained in reference to fig2 . an original to be reproduced is placed by the automatic original feeder 3 on the original mounting table 16 made of glass with the tip end thereof being registered with the extreme end 161 of the glass table . next , when the single copy button 14 is depressed , or the continuous or multiple copy button 13 is depressed after the copy sheet numbers are set by the selection key 12 , a photosensitive drum 17 commences its rotation in the clockwise direction as shown by an arrow . when the photosensitive drum 17 reaches a predetermined position and a signal for commencing image exposure is emitted , an illuminating lamp 18 and a first mirror 19 , both of which are the movable parts in the optical system , begin to move in the right direction as arrowed in the drawing at the same speed as the circumferential speed of the rotating photosensitive drum 17 , while a second mirror 20 also commences movement in the rightward direction at a speed half that of the circumferential speed of the drum . the image of the original which has been illuminated by the illuminating lamp 18 from below is focussed on the photosensitive drum 17 at its designated exposure section 24 as an information light . when the image exposure is completed , the movable parts of the optical system detect their positions , stop further rightward movement , and immediately return in the opposite direction , i . e ., leftward . the speed at this returning motion is made faster than that at the forward motion so as to increase efficiency in reproduction operations . as soon as the movable parts have returned to their initial positions , the driving force to the movable optical system is interrupted and the operations stop . in case multiple copies are to be obtained continuously from one and the same image original , the numbers of copy sheets as desired may be designated in the reproduction apparatus by means of the continuous reproduction sheet number selection key 12 , followed by commencement of the reproduction operations through depression of the continuous or multiple copy button 13 . also , when the reproduction operations are started by means of the single copy button 14 , such single copy can be obtained irrespective of the copy sheet numbers as instructed by the reproduction sheet number selection key 12 . the photosensitive drum 17 is of a three - layer structure consisting of an electrically conductive substrate coated thereon with a photosensitive layer , on which a transparent insulative layer is overlaid . this drum 17 rotates clockwise as shown in fig2 . this photosensitive drum 17 is first charged in the positive ⊕ polarity by a positive charger 26 which is supplied with an electric current in the positive polarity from a high voltage power source . after rotation , when the drum arrives at the image exposure section 24 , it is exposed with an image of the original through a slit at this section , and , at the same time , subjected to an a . c . electric charge ( charge removal ) by an a . c . charger 27 which is supplied with an a . c . electric current from the high tension power source . subsequently , by an overall exposure to be rendered thereon by an overall exposure lamp 28 , an electrostatic latent image is formed on the surface of the photosensitive drum 17 . after formation of the electrostatic latent image thereon , it further rotates to a position of a developing device 29 . in this developing device 29 , a magnet brush consisting of a carrier and a toner on a sleeve 31 rotating around a magnet 30 contacts the drum surface , whereby the electrostatic latent image on the photosensitive drum 17 is developed , and rendered visible . subsequently , an image transfer paper 5 which has been forwarded from the paper feeding section closely contacts the peripheral surface of the photosensitive drum 17 , and the developed image on the drum surface is transferred onto the image transfer paper 5 by electric charging of positive ⊕ current from the high voltage power source through an image transfer charger 32 . the image transfer paper 5 which has completed its image transfer is separated from the photosensitive drum 17 with its one end being restrained by a separating belt , and led to an image fixing device 34 . in the meantime , the the toner remaining on the photosensitive drum is wiped off with an edge 35 1 of a cleaning blade 35 , which press - contacts against the drum surface , so as to be ready for repeating the next reproduction cycle . the toner which has been wiped off the drum by the cleaning blade 35 rides thereon to be taken away from the area of the photosensitive drum 17 by a screw conveyor 36 to the front side of the drum , and is then led into the developing device 29 through a duct , and re - used for the development . the image transfer paper 5 1 is placed in the cassettes 4 1 , and the image transfer paper 5 2 in the cassette 4 2 , respectively . these cassette 4 1 and 4 2 are loaded in paper feeding sections 38 1 and 38 2 at the lower left portion of the production apparatus in a detachable attachable manner . the cassettes are various in size in conformity with sizes of the image transfer paper , and can be readily replaced depending on necessity . selections of the paper feeding from the paper feeding sections 38 1 or 38 2 are effected by an automatic cassette selection device to be described hereinafter . when the photosensitive drum 17 arrives at a predetermined position to emit a paper feeding signal , a paper feeding roller 39 1 or 39 2 which is constantly rotating is urged on the top surface of the image transfer paper 5 1 or 5 2 , whereby the paper is fed out in the rightward direction as shown in the drawing . then , while it is being forwarded , the image transfer paper is rectified of its slant movement , if any , by first register rollers 40 1 , 41 1 , or 40 2 , 41 2 , so as to be forwarded in the correct , straightforwarded direction . continuously , the image transfer paper 5 , after it has taken synchronism with the image on the photosensitive drum 17 with a signal from the movable optical part by means of second register rollers 42 , 43 , is closely contacted on the drum surface to be subjected to the image transfer . after completion of the image transfer , the image transfer sheet is peeled off the surface of the photosensitive drum 17 by the separation belt , and sent into the image fixing device 34 . in this image fixing device 34 , the image transfer sheet having on its suface a non - fixed transferred image passes between a resilient image fixing roller 46 which has been heated by a heating roller 45 incorporating therein a heater 44 and an opposite roller 48 also having therein a heater 47 , during which the paper and non - fixed image thereon are heated , the toner is fusion - bonded to the paper , and the image is firmly fixed on the image transfer paper 5 . the paper which has passed through the image fixing device 34 is finally removed of any electric charge remaining on its surface by an electric charge remover 49 , and is then discharged onto a guide plate 103 of a sheet folding device by means of discharge rollers 50 , 51 . the photosensitive drum 17 of this reproduction apparatus is capable of performing reproduction of an a - 3 paper size having a width of 297 mm and a length of 420 mm , and the circumference of the drum is slightly longer than the paper length of 420 mm . the return motion of the movable optical system followed by its forward motion ( i . e ., exposure process ) is required to be somewhat shorter than the forward movement . accordingly , in the case of a - 3 size reproduction , the image - recording can be done per two revolutions of the photosensitive drum , while , in the case of a - 4 size reproduction , the image recording can be done per one revolution of the drum with the image transfer paper being fed with its longer side as the width ( breadthwise forwarding ). the difference in the rotational cycle of the photosensitive drum due to the paper size as mentioned above is discriminated by a signal from the cassette 4 1 or 4 2 as selected by the automatic cassette selecting device , thereby controlling the moving quantity of the movable optical system . after completion of the reproduction operations , the photosensitive drum stops its rotation when the rear end of the image transfer paper 5 has finished passing through the discharge rollers 50 , 51 . in this case , the drum is so made to stop at a position where the edge 35 1 of the cleaning blade 35 may come to the vicinity of a seam of the photosensitive layer , i . e ., to a portion where no image appears , in order to avoid may undesirable influence on the image arising from constant press - contact of the cleaning blade 35 on the surface of the photosensitive drum 17 . incidentally , reference numerals 52 , 53 designate storage spaces for the image transfer paper 5 , cassettes 4 , developing agents , and other supplies . in the following , detailed explanations will be given as to the automatic document feeder ( adf ) in reference to fig3 a and 3b . an original switch 121 consisting of a detection element such as a microswitch is provided on one part of the original stacking table 2 of the adf so as to detect whether the image original 202 is present on the table 2 , or not . the original to be used may be a full size ( e . g . a - 3 ( 297 mm × 420 mm ), b - 4 ( 257 mm × 364 mm ) sizes ), or a half size ( i . e . half of the abovementioned full size such as a - 4 ( 210 mm × 297 mm ), b - 5 ( 182 mm × 257 mm ) sizes ). the originals are placed on the original stacking table 2 in such a manner that , in the case of the full size original , it may be placed with its short side being conformed to the forwarding direction of the original , i . e . breadthwise forwarding , and , in the case of the half size original , it may be placed with its long side being conformed to the forwarding direction of the original , i . e ., lengthwise forwarding . the original placed on the original stacking table 2 is lifted by a rotor 204 , held between the rotor 204 and a roller 205 , and carried to a conveyor belt 211 . timing for feeding out the image original is determined by lowering a timing roller 206 from its illustrated position . passage of the image original fed out onto the conveyor belt 211 is detected by a switch 123 consisting of a light emitting element 208 and a light receiving element 209 . that is , as shown in fig3 b , the switch 123 is disposed at a position where both full size original 202 - 1 ( in solid line ) and half size original 202 - 2 ( in dot line ) pass through without exception . this is shown in fig8 as an image original detection switch 123 . juxtaposed with this switch 123 , is a switch 124 of the same construction , as shown in fig3 b . this switch 124 is disposed at a position where the full size original passes , but the half size original does not pass therethrough . in fig8 this is shown as an image original size detection switch 124 . it goes without saying that , when the half size original is forwarded breadthwise , and the full size original lengthwise , the size of the original can be detected from its passing time , and presence of the original can also be detected , whereby the abovementioned light emitting element and the light receiving element can be in a single set . owing to presence of urging rollers 210 , 212 on the top surface of the conveyor belt 211 , the original placed on this belt 211 is conveyed to the rightward direction in fig3 a and 3b and sent to the original mounting table 16 made of glass plate through a guide member 214 , rollers 215 , 217 , a guide member 216 , rollers 217 , 218 and a guide member 219 . between the abovementioned roller 217 and another roller 223 , there is further extended a belt 221 . since the roller 223 moves up and down as shown by an arrow f , the original which has been sent to the original mounting table 16 can be further transferred to the leftward direction in the drawing by lowering the roller 223 . a stopper 225 is provided at the left end of the original mounting table 16 , which works to stop further movement of the original when it collides with the stopper . at the same time , the rotation of a motor ( not shown ) is stopped by a detected output of the edge of the original from an original edge detector 122 to thereby stop driving of the conveyor belt and rollers for the original . after completion of a predetermined reproduction of the original , a plunger 255 - 1 is driven by application of a stopper retraction signal , whereby the abovementioned stopper 225 retracts from the image original conveying path , the roller 223 moves downward and rotates to convey the original in the leftward direction in the drawing , and the original is discharged onto an original discharge tray 228 by means of a discharging roller 226 . in the following , explanations will be made as to the sheet feeding device in reference to fig2 , 5 and 6 . the image transfer paper 5 discharged by the rollers 50 , 51 to a position lower than the level of the abovementioned original mounting table 16 is led by a guide plate 103 , lifted upward by a forwarding roller 102 and a conveyor belt 104 , and guided to the sheet folding section ( or folding means ) by urging rollers 105 through guide plates 102 - 1 , 102 - 2 . as shown in fig4 a and 5b , the sheet folding section consists of a pair of rollers 107 , 108 , a roller 106 to be controlled by a plunger 119 as in fig5 a or 5b , a sheet receiving and storing section 109 which temporarily stores any of the designated sizes of the image transfer paper 5 when it is to be folded , and a guide plate 118 fixed at one end of an arm 118 - 2 which is in turn held at the other end thereof on a shaft 118 - 1 in a freely rotatable manner . the operations of this sheet folding section will be explained in the following . when the image transfer paper 5 , which has been upwardly transported by the conveyor belt 104 and the urging rollers 105 , is in the half size , no folding signal shown in fig8 is emitted . accordingly , the guide plate 118 ( regulating member ) is at a position shown in fig5 b by a spring 118 - 2 , while the roller 106 is at a position ( shown in fig5 b ) where an arm 113 and a stopper 116 contact each other as shown by a dot line in fig4 by force of a spring 114 which pulls the arm 113 holding the roller 106 in a freely oscillatable manner by a shaft 112 . accordingly , the image transfer paper 5 which has been brought upward from below as shown in fig5 b is guided by the guide plate 118 between the rollers 107 , 108 , and discharged to a tray 6 as it is . since this tray 6 is at a higher position than the original mounting table 16 , the operator of the reproduction apparatus can take out the image transfer paper thereon very easily . in contrast to this , when the image transfer paper 5 is in the full size , a &# 34 ; folding signal &# 34 ; is emitted from the circuit shown in fig8 . when this folding signal is emitted , the guide plate 118 moves to a position shown in fig5 a by means of a plunger 118 - 3 which is an electro - magnetic actuating device , and , at the same time , the plunger 119 is driven in the direction of an arrow s against force of the spring 114 by means of a solenoid 111 , and kept at a position where the arm 113 contacts the stopper 117 and stops further movement . in this consequence , the image transfer paper 5 is held between the rollers 106 , 107 , and is sent into the sheet receiving and storing section 109 . as shown in fig5 a , when the image transfer paper 5 is further transported upward by the rollers 106 , 107 , even after the tip end thereof collides with an end part 110 of the sheet receiving and storing section 109 ( this end part constituting the engaging and stopping member of the image transfer paper ), a part 53 of the image transfer paper 5 is bent , and gripped between the rollers 107 , 108 to be folded , and then discharged onto the tray 6 . accordingly , by appropriately setting a distance between the engaging and stopping member 110 and the rollers 107 , 108 , the image transfer paper in the full size can be folded in half . fig6 shows another embodiment of the sheet folding section , wherein separate discharging sections are provided , the one for the folded image transfer paper 5 , and the other for such image transfer paper which is not folded . in more detail , a pair of direction changing guide plates 80 - 1 , 80 - 2 are pivotally provided on shafts 91 , 91 at the end parts of the abovementioned guide plates 107 - 1 , 107 - 2 . the direction changing guide plates 80 - 1 , 80 - 2 are so controlled that they may take two positions selectively by means of a plunger 92 . that is , as shown in fig6 they are controlled in such a fashion that the opening of the guide plates may be directed to a meeting point of the rollers 82 - 1 , 82 - 2 , and in such other fashion that the opening thereof may be directed to an opening of the guide plates 81 - 1 , 82 - 2 . since the rollers 82 - 1 , 82 - 2 and 83 - 1 , 83 - 2 are constantly rotating in the arrowed directions , the image transfer paper 5 which has been guided between the guide plates 107 - 1 , 107 - 2 is further guided between the guide plates 80 - 1 , 80 - 2 to reach the rollers 82 - 1 , 82 - 2 , if and when the abovementioned direction changing guide plate 80 is in a state as shown in the drawing by force of a spring 96 without their being driven by the plunger 92 . the image transfer paper 5 held between the rollers 82 - 1 , 82 - 2 is further guided by the guide plates 93 - 1 , 93 - 2 to the rollers 83 - 1 , 83 - 2 , after which it is discharged on the tray 6 . on the other hand , since rollers 84 , 85 , and 86 are also constantly rotating in the arrowed direction , if the abovementioned plunger 92 is driven against the force of the spring 96 so as to shift the opening of the direction changing guide plates 80 - 1 , 80 - 2 to meet the opening of the guide plates 81 - 1 , 81 - 2 ( i . e ., if the direction changing guide plates 80 - 1 , 80 - 2 are shifted to the position indicated by dot lines in the drawing ), the image transfer paper 5 passes through the guide plates 107 - 1 , 107 - 2 , the direction changing guide plates 80 - 1 , 80 - 2 , and the guide plates 81 - 1 , 81 - 2 , and then is led to the rollers 85 , 86 . the image transfer paper 5 held between the rollers 85 , 86 is forwarded into the sheet receiving and storing section 87 , and is folded when its forward end contacts the engaging and stopping member 88 , or 89 . the folded end part of the paper is then held between the rollers 84 , 85 , after which it is discharged onto the tray 6 through the guide plates 94 - 1 , 94 - 2 and the rollers 83 - 1 , 83 - 2 . the engaging and stopping member 89 is so constructed that it may be projected into , or retracted from , the abovementioned sheet receiving and storing section 87 by a plunger 90 in accordance with a size of the image transfer paper 5 to be folded . while it is desirable that the folding section shown in fig4 to 6 should fold the image transfer paper 5 in half with respect to the conveying direction of the paper , if a distance between the engaging and stopping member 110 and the rollers 107 , 108 is constant as shown in fig4 and 5 , a folding length also becomes constant with the consequent inability to fold the same in half , when the paper size is changed . in order to avoid such inconvenience , the embodiment shown in fig6 is so designed that , by changing the position of the engaging and stopping member depending on the paper size , it may always be folded exactly in half . for instance , when an a - 3 size image transfer paper is fed , the plunger 90 is driven against the spring 95 to retract the engaging and stopping member 89 from the conveying path in the sheet receiving and storing section 87 , whereupon the innermost wall 88 of the section 87 becomes the engaging and stopping member . also , when a b - 4 size image transfer paper is fed , the plunger 90 is not driven , but the engaging and stopping member 89 is caused to project into the sheet receiving and storing section 87 by force of the spring 95 . the control of the abovementioned plunger 92 can be done by use of a folding signal applied to the abovementioned plunger 111 . also , the control of the plunger 90 can be done in such a manner that outputs 1 , 2 , and 3 , from a selector 142 to be described later , be decoded to discriminate a size of the selected cassette , and , when the size is , for example , a - 3 , the plunger 92 be driven . fig7 is a timing chart for obtaining two copies each for every original forwarded to the original mounting table from the adf by means of the reproduction apparatus according to the present invention . first , the timing 1 indicates that the operator pushed the copy button b , but no operation of the apparatus is effected , because there is no original set in the adf . the timing 2 indicated that the operator , noticing that no original is set , has placed the originals on the original stacking table 2 . the timing 4 indicates that the operator has again depressed the copy button , and that , as the result of this depression , the copying conditions have been set and the adf original feeding motor is driven to take out one original from the stack and send it to the original mounting table . the timing 5 indicates that an original in full size ( e . g . a - 3 size ) has been fed , the original detection switch 123 and original size detection switch 124 are actuated , and the original size memory element has been set . the timing 6 indicates that the abovementioned original has passed through the abovementioned switches 123 and 124 . the timing 7 indicates that the tip end of the original which has been sent to the original mounting table has arrived at an adequate position to actuate an &# 34 ; original home position &# 34 ; switch 122 . as the result of this , the &# 34 ; adf original forwarding motor &# 34 ; is stopped to cause the original to stand still on the original mounting table . further , this stoppage causes a &# 34 ; copy signal &# 34 ; to be turned on , thereby driving the reproduction apparatus . simultaneously with this driving , a &# 34 ; folding solenoid 111 &# 34 ; is excited in response to the operation of the original size memory element at the timing 5 . the timing 8 indicates that the photosensitive drum has entered the post - rotating cycle after completion of the image transfer , wherein it is further rotated for one revolution to clean the drum surface , and the set number of copy sheet established by the operator has coincided with the copy sheet number . the timing 9 indicates that the photosensitive drum has arrived at its home position within the reproduction apparatus , while a &# 34 ; coincidence signal &# 34 ; is being generated . when these two conditions are met , the reproduction apparatus is stopped , and the &# 34 ; copy signal &# 34 ; is thereby turned off . further , by this stoppage of the apparatus , the &# 34 ; adf original forwarding motor &# 34 ; is again driven to discharge the original from the original mounting table , and to feed a new original thereto . in addition , the original size memory element set at the timing 5 is cleared so as to be prepared for storing therein a size of the subsequently fed original . at the timing 10 , feeding of a full size original ( e . g . a - 3 size ) is again detected to store the full size . the timing 11 indicates that the original which has so far been on the original mounting table is discharged outside the table perfectly . further , by this discharge signal , a &# 34 ; timer &# 34 ; is set . this signal is actuated for the purpose of turning off the &# 34 ; adf image original forwarding motor &# 34 ; with a trailing of this timer signal , when there is no original to follow subsequently with lapse of time set in &# 34 ; timer &# 34 ;. the timing 12 indicates that the original has passed through the abovementioned image original detection switch 123 and the image original size detection switch 124 . the timing 13 indicates that the second original has arrived at a predetermined position on the original mounting table within a time while the &# 34 ; timer &# 34 ; is not yet turned off to actuate the &# 34 ; original home position &# 34 ; switch 122 . by this , the &# 34 ; adf original forwarding motor &# 34 ; is turned off , as is the case with the timing 7 , whereby the &# 34 ; copy signal &# 34 ; to actuate the reproduction apparatus is turned on . also , since the original size memory element is set again to store therein that the original is in full size , the &# 34 ; folding solenoid 111 &# 34 ; is kept in an excited condition , and the copy cycle is repeated in the same manner . at the timing 14 , the starting operation for the original feeding is being done same as in the timing 4 . the timing 15 indicates that an original in a half size ( e . g . a - 4 size ) is being fed , since only the original detection switch 123 is set , whereby the original size memory element is not set , but the situation wherein the original is in a half size is stored . the timing 16 indicates that the abovementioned original has passed through the abovementioned switch 123 . the timing 17 indicates that the second original is discharged from the original mounting table , the third and last original is fed thereinto from the original stacking table of the adf , and the &# 34 ; remaining original detection &# 34 ; switch 121 is turned off , whereby the original remains on the original stacking table 2 . the timing 18 functions the same as the timings 7 and 13 , wherein , in response to the memory of the half size original , the &# 34 ; folding solenoid 111 &# 34 ; is turned off . the timing 19 indicates that the &# 34 ; adf original forwarding motor &# 34 ; is turned off , and the entire operations of the apparatus have been stopped , since no original appears even after lapse of the time set in the &# 34 ; timer &# 34 ; since the third and last original has been discharged from the original mounting table . now consider a relationship between the operation of the original size memory element and the time , in which the image transfer paper reaches the sheet folding section . since the circuit according to the present invention is to constructed that it may respond to the rising time of the copy signal , i . e ., the time instant when the reproduction apparatus commences the copying operations , and , also , as is apparent from the timing chart , since the time instant b &# 39 ;, in which the last copy sheet for each original reaches the sheet folding section , is one , during which the adf is feeding a subsequent image original to the original mounting table , there is no possibility of such an inconvenience to take place that the &# 34 ; folding solenoid 111 &# 34 ; is changed over during any arbitrary time , in which the copy paper is subjected to the folding operation in the apparatus . fig8 shows a circuit embodying the timings in fig7 according to the preceding explanations . the control circuit shown in fig8 takes thereinto various input signals from a copy button switch 120 to instruct the copying operations ( the output waveform of which is shown by a in fig7 ), a remaining quantity detection switch 121 to detect whether the originals still remain in the stack ( the output waveform of which is shown by b in fig7 ), an original switch 122 to detect whether the original is rightly placed at its home position ( the output waveform of which is shown by d in fig7 ), an original detection switch 123 to detect presence of the original ( the output waveform of which is shown by l in fig7 ), an original size detection switch 124 to detect a size of the original ( the output waveform of which is shown by m in fig7 ), a drum detection switch 125 to detect whether the photosensitive drum is at its home position ( the output waveform of which is shown by f in fig7 ), and a cassette switch 126 to be actuated in accordance with the size of the image transfer paper stored in the cassette , when the cassette is loaded in the reproduction apparatus . each of the above - mentioned switches , when it contacts to the side of &# 34 ; present &# 34 ; or &# 34 ; on &# 34 ; as in fig8 leads out a high level signal to the contact , and a low level signal when it contacts to the other side , i . e . &# 34 ; absent &# 34 ; or &# 34 ; off &# 34 ;. in the case of the cassette switch , however , the situation is just the opposite to the above . since these switches are of such types that have already been explained , or of well known types , detailed explanations thereof will be dispensed with . the control circuit shown in fig8 leads out various output signals with the abovementioned various switches as the input signals therefor : &# 34 ; adf signal &# 34 ; ( a waveform c in fig7 ) to instruct driving of the adf original forwarding motor ; &# 34 ; copy signal &# 34 ; ( a waveform e in fig7 ) to instruct execution of the copy cycle ; &# 34 ; folding signal &# 34 ; ( a waveform j in fig7 ) to instruct actuation of the folding solenoid in order to discharge the image transfer paper to the tray 6 after it is image - transferred and folded ; and &# 34 ; upper cassette feeding signal &# 34 ; or &# 34 ; lower cassette feeding signal &# 34 ; to instruct driving of the paper feeding roller 39 1 or 39 2 in order to feed out the image transfer paper stored in the upper stage cassette or the image transfer paper stored in the lower stage cassette . the abovementioned adf signal is formed by a set output in the rs flip - flop 127 . there can be considered two kinds of timing , wherein this adf signal is led out . they are represented by the timings 4 and 9 in fig7 . the case represented by the timing 4 is such that a low level signal output is led out into the input 1 of an and gate 128 ( this and gate is in such a logic that it leads out a low level output when a low level signal ( l signal ) is applied to either input 1 or 2 to set the flip - flop 127 ). the case represented by the timing 9 is such that the low level signal is introduced into the input 2 of the and gate 128 . in the above - described case represented by the timing 4 , the logic is constructed by an and gate 129 , so that , when the copy button switch is turned on in the state of the original remaining quantity detection switch 121 being set to the side &# 34 ; present &# 34 ; and the original switch 122 being set to the side &# 34 ; absent &# 34 ;, the entire inputs 1 , 2 , and 3 of the and gate 129 take the high level , while its input takes the low level , thereby setting the flip - flop 127 . in the above - described case represented by the timing 9 , the abovementioned flip - flop 127 is set by actuating a differentiation circuit 131 by an output q of the rs flip - flop 130 which leads out the &# 34 ; copy signal &# 34 ;, and then introducing the low level differential pulse corresponding to the trailing of the flip - flop 130 into the input 2 of the and gate 128 as an input . there can be considered two cases , wherein the flip - flop 127 is reset and the adf signal stops its emission . they can be represented by the timings 7 and 19 in fig7 . the case represented by the timing 7 is such that the low level signal is applied to the input of the and gate 132 in fig8 while the case represented by the timing 19 is such that the low level signal is applied to the input 2 of the and gate 132 . the and gate 132 is constructed in such a logic that it may lead out a low level output signal when a low level signal is introduced into any of the inputs 1 and 2 to reset the flip - flop 127 . in the abovementioned case represented by the timing 7 , the flip - flop 127 is reset by actuating the differential circuit 134 with an inverter output when the original switch 122 has been changed over to the side &# 34 ; present &# 34 ;, i . e ., when the output of the inverter 133 has changed from the high level to the low level , and then by applying a low level pulse signal generated in the differential circuit 134 to the input 1 of the and gate 132 . in the above - described case represented by the timing 19 , a timer 135 is set when the original switch 122 has been changed from &# 34 ; present &# 34 ; to &# 34 ; absent &# 34 ;, and a high level signal is led out therefrom for a predetermined time period . when this timer 135 changes its output from the high level to the low level with lapse of a predetermined time , the differential circuit 136 is actuated to apply the low level pulse signal to the input 2 of the and gate 132 , thereby resetting the flip - flop 127 . although the abovementioned &# 34 ; copy signal &# 34 ; is constructed with an output signal of the rs flip - flop 130 , there may also be such a case that this flip - flop 130 is set as represented by the timing 7 in fig7 . in this case , an output of a nand gate 137 is applied to the set terminal of the flip - flop 130 , and an output of the abovementioned original switch 122 is applied to the input 1 of this nand gate 137 . as described above , such application of the output from the original switch 122 is to cause the flip - flop 130 to be set only when the original switch 122 is at the side of &# 34 ; present &# 34 ;, and to cause the flip - flop 130 not to be set by , for example , the timing 19 in fig7 . the trailing of the output q of the flip - flop 127 is differentiated by the differentiation circuit 138 , and a low level differentiation pulse is generated at an instant when the output changes from the high level to the low level . this differentiation pulse is further inverted by the inverter 139 , after which it is applied to the input 2 of the nand gate 137 . an output of a coincidence circuit 140 is applied to the input 3 of the nand gate 137 , and an output of an rs flip - flop 141 as the original size memory element is applied to the input 1 of the coincidence circuit 141 , and a size signal output of the cassette selected by the selector 142 is applied to the input 2 thereof . accordingly , only when the original size signal applied to the input 1 of this coincidence circuit 140 meets the size ( which means both the full size and the half size ) of the image transfer paper stored in the cassette selected by the selector 142 , a high level signal can be led out in the output of the coincidence circuit 140 , and this high level signal is applied to the input 3 of the abovementioned nand gate 137 . as the result , the abovementioned flip - flop 130 is set when the original switch 122 is at the side of &# 34 ; present &# 34 ;, the original size signal coincides with the size of the image transfer paper , and the flip - flop 127 changes from its set condition to its reset condition . the resetting of the flip - flop 130 and stoppage in emission of the copy signal are represented by the timing 9 as shown in fig7 . in more detail , this flip - flop 130 is reset by an output from the nand gate 143 , wherein an output of the drum detection switch 125 is applied to the input 1 thereof , and an output of the coincidence circuit 146 , which leads out the high level signal when the contents of the counters 144 , 145 are coincided as the result of comparison , is applied to the input 2 thereof . incidentally , the counter 144 is to store therein the number of copy sheet set by the abovementioned copy sheet number setting key 12 , while the counter 145 is to count the number of copy sheet to be copied from one and the same original . the folding signal is composed of an output q of a jk flip - flop 147 . to the j - terminal of this flip - flop 147 , there is applied an output q of the abovementioned flip - flop 141 , while an output q of the flip - flop 130 is applied to the cp - terminal thereof . the flip - flop 141 receives an output of the nand gate 148 to its set terminals . to the input 1 of this nand gate 148 , there is applied an output of the original detection switch 123 , and to the input 2 thereof , there is applied an output of the original size detection switch 124 . therefore , the flip - flop 141 can be set only when the outputs of both switches 123 , 124 are at the side of &# 34 ; present &# 34 ;. in other words , while the flip - flop 141 is leading out the output q , the original size is shown to be in the full size ( which is required to be discharged in a folded state ). on the other hand , when output q is not being led out therefrom ( a state , wherein the original detection switch 123 is at the side of &# 34 ; present &# 34 ;, and the switch 124 is at &# 34 ; absent &# 34 ;), no output q is led out , and the original size is shown to be in the half size ( which is not required to be discharged in the folded state ). as is apparent from the foregoing explanations , the folding signal is led out when the full size signal is led out of the flip - flop 141 , and the copy signal is led out of the flip - flop 130 . since an output of the abovementioned differentiation circuit 131 is applied to the reset input of the flip - flop 141 , and the output q of this flip - flop 141 is applied to the k - terminal of the flip - flop 147 through the inverter 149 , the flip - flop 147 stops emission of the output q ( emission of the solenoid signal ) by the level change in the copy signal from low to high in the state of the original size having been detected to be in the half size , as shown in the timing 18 of fig7 . the abovementioned size signal is applied to the abovementioned coincidence circuit 140 through a signal line 150 . in the following , more detailed explanations will be given as to leading out of the upper cassette feeding signal and the lower cassette feeding signal . the abovementioned cassette switch 126 has a group of three switches ms1 to ms3 to be actuated when the cassette 4 1 is loaded in the upper cassette mount , and another group of three switches ms4 to ms6 to be actuated when the cassette 4 2 is loaded in the lower cassette mount . each of the switches ms1 to ms6 is controlled as shown in the following table in accordance with the size of the image transfer paper stored in the cassette as loaded ( i . e ., cassette size ). table______________________________________switchcassette ms1 or ms2 or ms3 orsize ms4 ms5 ms6______________________________________a3 off off off f s u ib4 on off off l zu1 off on off l ea4 off off on h s a ib5 on off on l zu2 off on on f e______________________________________ ( note : &# 34 ; u &# 34 ; denotes a universal cassette .) a selector 142 is so constructed that the outputs of the switches ms1 to ms3 may be produced at the outputs 1 to 3 thereof , when the outputs of the switches ms to be controlled as mentioned above are applied to the selector 142 , while a low level signal is led out to the signal line 151 to be applied to the terminal a thereof , and that the outputs of the switches ms4 to ms6 may be produced at the outputs 1 to 3 thereof , when a high level signal is led out to the signal line 151 to be applied to the terminal a . therefore , paying attention to the output 3 of the selector 142 , if the high level signal is led out of this output 3 due to turning off of the switches ms , the full size cassette is selected , as is apparent from the above table , and , if the low level signal is led out thereof due to turning on of the switches ms , the half size cassette is selected . accordingly , in case the output q of the abovementioned flip - flop 141 is applied to the input 1 of the coincidence circuit 140 , and the signal of the output 3 of the selector 142 is applied to the input 2 thereof , the coincidence circuit 140 leads out the high level signal when the original size and the cassette size are coincided ( e . g ., both in the full size ), and it leads out the low level signal when the original size and the cassette size are not coincided , ( e . g ., one in the full size and the other in the half size ). accordingly , when the original size and the cassette size are not coincided , no set signal input is introduced into the flip - flop 130 , hence no copy signal is led out , because a low level signal is applied to the nand gate 137 through the signal line 152 . this low level signal is also applied to the input 1 of the and gate 154 , after it is rendered a high level signal by the inverter 153 . further , as an oscillating output of an oscillator 155 ( the oscillating output varies between the high level and the low level ) is applied to the input 2 of the and gate 154 , a pulse having a higher level than that of the and gate 154 is applied to the cp - terminal of the jk flip - flop 156 by application of an initial high level pulse in the oscillating output . then , the flip - flop 156 is inverted by application of such pulse , whereby the signal level on the signal line 151 also changes , and the cassette to be selected is changed from the upper cassette mount to the lower cassette mount , or vice versa . as the result of changing the cassette to be selected as mentioned in the preceding , when the original size and the cassette size become coincident , the low level signal is applied to the input 1 of the and gate 154 , so that the oscillating output of the oscillator 155 is not applied to the cp terminal of the flip - flop 156 , and this coincided state is maintained . since the output q of the flip - flop 156 is applied to the input 2 of the and gate 157 , the output q thereof is applied to the input 2 of the and gate 158 , and the image transfer paper forwarding signal ( such signal is well known in the ordinary reproduction apparatus ) is applied to the inputs 1 of the respective and gates 157 , 158 , there can be realized automatic cassette selection depending on the size of the original , when the output from the and gate 157 is made a solenoid actuating signal for actuating an electro - magnetic driving device ( not shown ) to urge the paper feeding roller 39 2 onto the image transfer paper 5 2 in fig2 and the output from the and gate 158 is made the solenoid actuating signal for actuating an electromagnetic driving device ( not shown ) to urge the paper feeding roller 39 1 onto the image transfer paper 5 1 in fig2 . it should , however , be noted that , in the abovedescribed embodiment , the original is in either the full size or the half size , although the paper size belonging to the full size and the half size , respectively , is of three kinds as exemplified in the foregoing , hence it cannot always be said that the original size accurately coincides with the paper size . in order to avoid such inconvenience in the practical operation , the reproduction apparatus of the present embodiment is so constructed that a full size original of one kind and a half size to this full size original are placed on the abovementioned original stacking table , while two kinds of paper cassettes corresponding in size to the full and half size originals are loaded in the apparatus . by this arrangement , the image transfer from the original to the transfer paper can be carried out in exact conformance in size , and , moreover , the full size recording paper can be folded into two , whereby all the recording paper to be discharged to the tray 6 can be made the same size . further , when a plurality of the original size detection switches are provided , by the outputs of which the original size is made to be discriminated such as a - 3 , b - 4 , etc ., it is possible to select the accurately coincided paper from the cassette loaded in the reproduction apparatus , thereby successfully recording the original onto the paper . fig9 and 10 illustrate another embodiment of the control circuit for the recording apparatus according to the present invention . in the control circuit shown in fig8 the upper or low cassettes are selected by the cassette selection switch 170 which is controlled manually , and the folding signal is generated by the manually controlled folding switch 171 . in the control circuit of fig9 the switches 123 , 124 to discriminate the original size and the circuits related thereto as well as the coincidence circuit 140 and the circuits related thereto are all omitted . it should be noted that the circuit components in fig9 which function in the same manner as those in fig8 are designated by the same reference numerals with a suffix - 1 being added thereto , hence detailed explanations thereof will be dispensed with . explaining the differences in fig9 from fig8 only two inputs are applied to the inputs of the nand gate 173 connected to the set inputs of the flip - flop 172 which generates the copy signal . accordingly , when the original reaches its home position , and the adf signal trails , the copy signal is led out as indicated in the respective timings 5 , 9 and 12 in fig1 . also , an output of the and gate 175 is applied to the jk - terminals of the jk flip - flop 174 which generates the folding signal either directly or through the inverter 176 . to this and gate 175 , there are applied the output 3 ( when this output is at the high level , the full size cassette is selected , and when it is at the low level , the half size cassette is selected , as already mentioned in the foregoing ) of the selector , and the output of the folding switch 171 . accordingly , the folding instruction is issued from this and gate 175 by means of the folding switch 171 , and the high level signal is led out only when the full size cassette is selected . thus , in the state of the high level signal being led out , the copy signal is applied , and the folding signal is led out of the output q of the flip - flop 174 .	8
with more specific reference to fig1 it is there shown that an electric razor 10 with which this invention is concerned has a shaving head 12 comprised of two slotted shaving faces 14 and 16 . these faces are normally resilient to adjust to surface contours . they are designed so as to permit a drive shaft 18 ( see fig2 ) to rotate a blade means 20 therewithin . more particularly , and with reference to fig3 the blade has a disc ( hub ) 22 with a plurality of spokes 24 carrying blade cutting edges 26 which in the assembled shaver are located closely adjacent the inside of the slotted faces 14 and 16 . the disc ( hub ) 22 is provided with an elongated opening 28 to receive end 30 ( see fig2 ) of the drive shaft . any number of arrangements may be used to prevent the disc or hub 22 from falling off end 30 . the simplest such arrangement may be a conventional spring pin . for discussion of the sharpener of this invention for use with such blades , attention is directed to fig4 . therein , a base 32 is shown to be formed as a cylindrical member 34 having a face 36 closing one end of the cylinder and having a shaped hub or protrusion 38 projecting upwardly . a honing disc 40 of a commonly used abrasive material known in the art is removably affixed to the face 36 about the hub with the tip 42 above it . any one of a number of bonding agents that can be released can be used to affix the disc 40 to face 36 as will be well known in the art . referring now to fig5 there is shown a collar 50 with a top face 52 . the shaver body r seats against the top face . this arrangement prevents excessive pressure from being applied to the shaver blade . excessive pressure could have undesired effects . for example , excessive pressure could result in binding thereby preventing rotation of the blade or even in excessive abrasion of the blades . the remaining part of the sharpener of this invention is the cover 44 with its annular walls 46 and top 48 cooperatively formed as a cup that is designed to fig snugly over the base and telescope thereonto . a guide collar 50 is formed on cap 48 to be in registry with the hub 38 when assembled to the base . this collar will also be in alignment with opening 28 of blade 20 interposed during such assembly of cover 44 on base 32 . it will be understood that the drive shaft 18 is guided into the sharpener by collar 50 and that the tip 42 will engage the end 30 of shaft 18 to limit penetration of base 32 into cover 44 . this will automatically prevent the generation of forces which might deform the blade means and will insure proper honing . while there have been shown and described and pointed out the fundamental novel features of the invention as applied to a preferred embodiment thereof , it will be understood that various omissions , substitutions and changes in the form and details of the device illustrated and in its operation may be made by those skilled in the art without departing from the spirit of the invention . it is the intention , therefore , to be limited only as indicated by the scope of the claims appended hereto .	1
the terms below have the following definitions unless indicated otherwise . other terms that are used to describe the present invention have the same definitions as those terms which are generally used by those skilled in the art . the term “ alkyl ” is used herein to refer to a fully saturated monovalent hydrocarbon radical containing carbon and hydrogen , and which may be a straight chain , branched or cyclic . examples of alkyl groups are methyl , ethyl , n - butyl , n - heptyl , isopropyl , 2 - methylpropyl , cyclopropyl , cyclopropylmethyl , cyclobutyl , cyclopentyl , cyclopentylethyl and cyclohexyl . “ cycloalkyl ” groups refer to cyclic alkyl groups such as cyclopropyl , cyclobutyl , cyclopentyl and cyclohexyl . the term “ substituted alkyl ” refers to alkyl as just described which include one or more functional groups such as aryl , substituted aryl , acyl , alkylhalos ( e . g ., cf 3 ), halogen , hydroxy , alkoxy , alkoxyalkyl , amino , alkylamino , dialkylamino , acylamino , acyloxy , aryloxy , aryloxyalkyl , carboxyalkyl , carboxamido , thio , thioethers , both saturated and unsaturated cyclic hydrocarbons , heterocycles and the like . the term “ substituted cycloalkyl ” has essentially the same definition as and is subsumed under the term “ substituted alkyl ” for purposes of describing the present invention . in other instances where the term “ substituted ” is used , the substituents which fall under this definition may be readily gleaned from the other definitions of substituents which are presented in the specification as well the circumstances or context under which such substituents occur in a given chemical compound . the term “ aryl ” refers to a substituted or unsubstituted monovalent aromatic radical having a single ring ( e . g ., phenyl ) or multiple condensed rings ( e . g ., naphthyl ). other examples include heterocyclic aromatic ring groups ( heteroaryls ) having one or more nitrogen , oxygen , or sulfur atoms in the ring , such as imidazolyl , furyl , pyrrolyl , pyridyl , thienyl and indolyl , among others . the term “ substituted aryl ” refers to an aryl as just described that contains one or more functional groups such as lower alkyl , acyl , aryl , halogen , alkylhalos ( e . g ., cf 3 ), hydroxyl , alkoxyl , alkoxyalkyl , amino , alkylamino , dialkylamino , acylamino , acyloxy , aryloxy , aryloxyalkyl , carboxyalkyl , carboxamido , thio , thioethers , both saturated and unsaturated cyclic hydrocarbons , heterocycles and the like . a substituted aryl also describes an alkylene aryl group such as a benzyl or a related group . the term “ elimination agent ” refers to a chemical agent useful in the removal of one or more functional groups by elimination , resulting in or producing an unsaturated double bond . elimination agents useful in the processes of the instant invention include formamide acetals and other orthoamides , orthoesters , acid chlorides , activated carbonyls and carbonates , thionyl chloride and activated sulfites , sulfates , sulfonates , and sulfuranes , activated phosphites , phosphonates , and phosphates , selenium and tellurium reagents , and the like . the term “ functionalized pyranosides ” or more simply , “ functionalized ” refers to tetrahydropyrans which have been functionalized at one or more positions on the ring carbons ( e . g ., c1 , c2 , etc .) or preexisting functional groups ( e . g ., o1 , n2 , etc . ), derived from carbohydrates such as glucose , mannose , galactose , xylose , arabinose , ribose , fructose , fucose , rhamnose , and the like . “ heterocycle ” or “ heterocyclic ” refers to a carbocylic ring wherein one or more carbon atoms have been replaced with one or more heteroatoms such as nitrogen , oxygen or sulfur . examples of heterocycles include , but are not limited to , piperidine , pyrrolidine , morpholine , thiomorpholine , piperazine , tetrahydrofuran , dihydropyran ( dhp ), tetrahydropyran ( thp ), 2 - pyrrolidinone , δ - valerolactam , δ - valerolactone and 2 - ketopiperazine , among numerous others , including heteroaryls . the term “ substituted heterocycle ” refers to a heterocycle as just described that contains one or more functional groups such as lower alkyl , acyl , aryl , cyano , halogen , hydroxy , alkoxy , alkoxyalkyl , amino , alkyl and dialkyl amino , acylamino , acyloxy , aryloxy , aryloxyalkyl , carboxyalkyl , carboxamido , thio , thioethers , both saturated and unsaturated cyclic hydrocarbons , heterocycles and the like . substituted heterocycles include alkylene heterocycle groups . the term “ effective amount ” refers to the amount of a selected compound , intermediate or reactant which is used to produce an intended result . the precise amount of a compound , intermediate or reactant used will vary depending upon the particular compound selected and its intended use , the synthetic methods employed , and , in the case of pharmaceutical compounds , the age and weight of the subject , route of administration , and so forth , but may be easily determined by routine experimentation . in the case of the treatment of a condition or disease state , an effective amount is that amount which is used to effectively treat the particular condition or disease state . the term “ enantiomers ” refers to two stereoisomers of a compound which are non - superimposable mirror images of one another . “ stereoisomers ” refers to compounds which have identical chemical constitution , but differ with regard to the arrangement of their atoms or groups in space . a “ stereoselective process ” is one which favors production of one particular stereoisomer as a reaction product . “ enantiopure ” or “ enantomerically pure ” means a pure stereoisomer uncontaminated by its enantiomer . “ enantiomerically enriched ” means a compounds in which one of two ( or more ) enantiomers is found in greater concentrations in a given sample than another enantiomer . “ quantitative yields ” refers to the complete chemical conversion of a reactant to a product . “ facioselectivity ” refers to the strong preference of a chemical reagent to add across either the α or β face of a reaction intermediate . the term “ dioxirane ” is art - recognized and refers to a three - membered ring which consists of two oxygen atoms and one carbon atom , wherein the carbon atom bears two substituents that render it tetrahedral . “ dmdo ” refers to dimethyl dioxirane . “ lewis acid ” means any species that can coordinate with a lone pair of electrons from a conjugate base . lewis acids useful in processes of the instant invention include but are not limited to alkali and alkali - earth metal ions such as li , be , na , mg , k , and ca , bf 3 etherate , etalcl 2 , sicl 4 , mesi 3 , pcl 5 , and the like . the lewis acid may be cationic or a coordinatively unsaturated transition - metal or main - group compound ( e . g ., li salts , bf 3 etherate , etc .). “ oxidizing reaction medium ” refers to a reaction medium comprising a stoichiometric oxidant species , whose electron transfer is sometimes facilitated by a reduction - oxidation catalyst . examples of compounds which can be employed as catalysts are organic species such as 2 , 2 , 6 , 6 - tetramethyl - 1 - piperidinyloxy ( tempo ), 4 - phenyl - 2 , 2 , 5 , 5 - tetramethyl - 3 - imidazolin - 1 - yloxy - 3 - oxide , 3 -( aminomethyl )- 2 , 2 , 5 , 5 - tetramethyl - n - pyrrolidinyloxy , 3 - carbamoyl - 2 , 2 , 5 , 5 - tetramethyl - n - pyrrolidinyloxy ; transition - metal salts such as iron , chromium , manganese ; main - group elements such as boranes , aluminum ( iii ) species , and the like . “ oxidants ” include halogens , high - oxidation state halides such as hypochlorite , chlorite ; hypobromite , bromite , bromate ; hypoiodite , iodite , iodate , and periodate ; activated sulfonium species , peroxides and peroxy acids , persulfate , permanganate and related high - oxidation state main - group and transition metal ions , and the like . the term “ nucleophile ” is recognized in the art , and as used herein means a chemical moiety having a reactive pair of electrons . examples of nucleophiles include uncharged compounds such as amines , mercaptans and alcohols , and charged moieties such as alkoxides , thiolates , carbanions , and a variety of organic and inorganic anions . illustrative anionic nucleophiles include simple anions such as azide , cyanide , thiocyanate , acetate , formate or chloroformate , and bisulfite . organometallic reagents such as organocuprates , organozincs , organolithiums , grignard reagents , enolates , acetylides , and the like are also suitable nucleophiles . hydride may also be a suitable nucleophile when reduction of the substrate is desired . as used herein , the term “ substituted ” is contemplated to include all permissible substituents of organic compounds . in a broad aspect , the permissible substituents include acyclic and cyclic , branched and unbranched , carbocyclic and heterocyclic , aromatic and nonaromatic substituents of organic compounds . illustrative substituents include , for example , those described hereinabove . the permissible substituents can be one or more and the same or different for appropriate organic compounds . for purposes of this invention , the heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms . this invention is not intended to be limited in any manner by the permissible substituents of organic compounds . based on the iupac nomenclature of carbohydrates ( 1996 recommendations ), which is incorporated herein by reference , the following carbohydrate terminology is used herein “ parent monosaccharides ” are polyhydroxy aldehydes h —[ choh ] n — cho or polyhydroxy ketones h —[ choh ] n — co —[ choh ] m — h with three or more carbon atoms . the generic term “ monosaccharide ” ( as opposed to oligosaccharide or polysaccharide ) denotes a single unit , without glycosidic connection to other such units . it includes aldoses , dialdoses , aldoketoses , ketoses and diketoses , as well as deoxy sugars and amino sugars , and their derivatives , provided that the parent compound has a ( potential ) carbonyl group . monosaccharides with an aldehydic carbonyl or potential aldehydic carbonyl group are called “ aldoses ”; those with a ketonic carbonyl or potential ketonic carbonyl group , “ ketoses ”. the term ‘ potential aldehydic carbonyl group ’ refers to the hemiacetal group arising from ring closure . likewise , the term ‘ potential ketonic carbonyl group ’ refers to the corresponding hemiketal structure . cyclic hemiacetals or hemiketals of sugars with a five - membered ( tetrahydrofuran ) ring are called “ furanoses ”, those with a six - membered ( tetrahydropyran ) ring “ pyranoses ”. monosaccharides containing a ( potential ) aldehydic group and a ( potential ) ketonic group are called “ ketoaldoses ”. monosaccharides in which an alcoholic hydroxy group has been replaced by a hydrogen atom are called “ deoxy sugars ”. monosaccharides in which an alcoholic hydroxy group has been replaced by an amino group are called “ amino sugars ”. when the hemiacetal hydroxy group is replaced , the compounds are called glycosylamines . “ glycosides ” are mixed acetals formally arising by elimination of water between the hemiacetal or hemiketal hydroxy group of a sugar and a hydroxy group of a second compound . the bond between the two components is called a glycosidic bond . “ oligosaccharides ” are compounds in which monosaccharide units are joined by glycosidic linkages . according to the number of units , they are called disaccharides , trisaccharides , tetrasaccharides , pentasaccharides etc . the borderline with polysaccharides cannot be drawn strictly ; however the term ‘ oligosaccharide ’ is commonly used to refer to a defined structure as opposed to a polymer of unspecified length or a homologous mixture . when the linkages are of other types , the compounds are regarded as oligosaccharide analogues . “ polysaccharide ” ( glycan ) is the name given to a macromolecule consisting of a large number of monosaccharide ( glycose ) residues joined to each other by glycosidic linkages . the term poly ( glycose ) is not a full synonym for polysaccharide ( glycan ), because it includes macromolecules composed of glycose residues joined to each other by non - glycosidic linkages . for polysaccharides containing a substantial proportion of amino sugar residues , the term polysaccharide is adequate , although the term glycosaminoglycan may be used where particular emphasis is desired . polysaccharides composed of only one kind of monosaccharide are described as “ homopolysaccharides ( homoglycans )”. similarly , if two or more different kinds of monomeric unit are present , the class name heteropolysaccharide ( heteroglycan ) may be used . the term “ glycan ” has also been used for the saccharide component of a glycoprotein , even though the chain length may not be large . the term polysaccharide has also been widely used for macromolecules containing glycose or alditol residues in which both glycosidic and phosphate diester linkages are present . names of examples are given with an initial capital letter ( e . g . ‘ l - glycero - β - d - gluco - heptopyranose ’) to clarify the usage in headings and to show which letter controls the ordering in an alphabetical index . the following abbreviations are commonly used for substituent groups in structural formulae : ac ( acetyl ), bn or phch 2 ( benzyl ), bz or phco ( benzoyl ), et ( ethyl ), me ( methyl ), me 3 si ( not tms ) ( trimethylsilyl ), bu t me 2 si ( not tbdms ) ( tert - butyldimethylsilyl ), ph ( phenyl ), tf ( triflyl = trifluoromethanesulfonyl ), ts ( tosyl = toluene - p - sulfonyl ), tr ( trityl ). a new center of chirality generated by hemiacetal ring closure is called the “ anomeric center ”; the related two stereoisomers are referred to as anomers , designated α or β according to the configurational relationship between the anomeric center and a specified anomeric reference atom . the anomeric reference atom is the configurational atom of the parent , unless multiple configurational prefixes are used . if multiple configurational prefixes are used , the anomeric reference atom is the highest - numbered atom of the group of chiral centers next to the anomeric center that is involved in the heterocyclic ring and specified by a single configurational prefix . in the α anomer , the exocyclic oxygen atom at the anomeric center is formally cis , in the fischer projection , to the oxygen attached to the anomeric reference atom ; in the β anomer these oxygen atoms are formally trans . the anomeric symbol α or β , followed by a hyphen , is placed immediately before the configurational symbol d or l of the trivial name or of the configurational prefix denoting the group of chiral carbon atoms that includes the anomeric reference atom . for simple aldoses up to aldohexoses , and ketoses up to hept - 2 - uloses , the anomeric reference atom and the configurational atom are the same . the conformational symbols for enantiomers are different . it is therefore important to state in the context whether the d or the l form is under consideration . enantiomers have the same reference plane , and it should be noted that the mirror image of α - d - glucose - 4 c 1 is α - l - glucose - 1 c 4 . mirror images : α - d - glucopyranose - 4 c 1 ( upper ) and α - l - glucopyranose - 1 c 4 ( lower ) “ chairs ”: the reference plane is defined by two parallel ring sides , so chosen that the lowest - numbered carbon atom in the ring is exoplanar . “ boats ”: the reference plane is defined by the two parallel ‘ sides ’ of the boat . “ skews ”: each skew form has two potential reference planes , containing three adjacent atoms and the remaining non - adjacent atom . the reference plane is so chosen that the lowest - numbered carbon atom in the ring , or the atom numbered next above it , is exoplanar , in that order of preference . “ half - chairs ”: the reference plane is defined by the four adjacent coplanar atoms . “ envelopes ”: the reference plane is defined by the five adjacent coplanar atoms . the term “ reaction product ” means a compound which results from the reaction of the two substrate molecules . in general , the term “ reaction product ” will be used herein to refer to a stable , isolable compound , and not to unstable intermediates or transition states . the abbreviations me , et , ph , tf , nf , ts , and ms , represent methyl , ethyl , phenyl , trifluoromethanesulfonyl , nonafluorobutanesulfonyl , p - toluenesulfonyl and methanesulfonyl , respectively . a more comprehensive list of the abbreviations utilized by organic chemists of ordinary skill in the art appears in the first issue of each volume of the journal of organic chemistry ; this list is typically presented in a table entitled standard list of abbreviations . the abbreviations contained in said list , and all abbreviations utilized by organic chemists of ordinary skill in the art are hereby incorporated by reference . compounds of the instant invention which are basic in nature are capable of forming a wide variety of different pharmaceutically - acceptable salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate a compound of the instant invention from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent , and subsequently convert the free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the base compounds of this invention are readily prepared by treating the base compound with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is obtained . the acids which are used to prepare the pharmaceutically acceptable acid addition salts of the base compounds of this invention are those which form non - toxic acid addition salts , i . e ., salts containing pharmacologically acceptable anions , such as hydrochloride , hydrobromide , hydroiodide , nitrate , sulfate or bisulfate , phosphate or acid phosphate , acetate , lactate , citrate or acid citrate , tartrate or bitartrate , succinate , maleate , fumarate , gluconate , saccharate , benzoate , methanesulfonate and pamoate [ i . e ., 1 , 1 ′- methylene - bis -( 2 - hydroxy - 3 - naphthoate )] salts . those compounds of the instant invention which are also acidic in nature are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline - earth metal salts and particularly , the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the herein described acidic compounds of the instant invention . these non - toxic base salts include those derived from such pharmacologically acceptable cations as sodium , potassium , calcium and magnesium , etc . these salts can easily be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , preferably under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are preferably employed in order to ensure completeness of reaction and maximum product yields . the compositions of the present invention may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers . pharmaceutically acceptable carriers that may be used in these pharmaceutical compositions include , but are not limited to , ion exchangers , alumina , aluminum stearate , lecithin , serum proteins , such as human serum albumin , buffer substances such as phosphates , glycine , sorbic acid , potassium sorbate , partial glyceride mixtures of saturated vegetable fatty acids , water , salts or electrolytes , such as prolamine sulfate , disodium hydrogen phosphate , potassium hydrogen phosphate , sodium chloride , zinc salts , colloidal silica , magnesium trisilicate , polyvinyl pyrrolidone , cellulose - based substances , polyethylene glycol , sodium carboxymethylcellulose , polyacrylates , waxes , polyethylene - polyoxypropylene - block polymers , polyethylene glycol and wool fat . the compositions of the present invention may be administered orally , parenterally , by inhalation spray , topically , rectally , nasally , buccally , vaginally or via an implanted reservoir . the term “ parenteral ” as used herein includes subcutaneous , intravenous , intramuscular , intra - articular , intra - synovial , intrasternal , intrathecal , intrahepatic , intralesional and intracranial injection or infusion techniques . preferably , the compositions are administered orally , intraperitoneally , or intravenously . for purposes of this invention , the chemical elements are identified in accordance with the periodic table of the elements , cas version , handbook of chemistry and physics , 67th ed ., 1986 - 87 , inside cover . also for purposes of this invention , the term “ hydrocarbon ” is contemplated to include all permissible compounds having at least one hydrogen and one carbon atom . in a broad aspect , the permissible hydrocarbons include acyclic and cyclic , branched and unbranched , carbocyclic and heterocyclic , aromatic and nonaromatic organic compounds which can be substituted or unsubstituted . all reactions discussed hereinafter proceed at atmospheric pressure unless otherwise noted . in accordance with reaction scheme 6 below , 4 - dps 2a - f were prepared from their corresponding α - d - glucosides in 60 - 80 % isolated yield by a tandem oxidation - decarboxylative elimination . the reaction conditions were as follows : ( i ) tempo ( 5 mol %), et 4 nbr ( 5 mol %), 3 : 3 : 4 5 % aq naocl : aq satd nahco 3 : ch 2 cl 2 , 0 ° c . ; ( ii ) dineopentyl n , n - dimethylformamide acetal ( 5 equiv ), toluene , 120 ° c . or xylenes , 150 ° c . epoxypyranosides 3a - f were obtained from 4 - dps 2a - f by stereoselective reaction with dmdo at low temperatures , which proceeded quantitatively with facioselectivity varying as a function of substituents at c1 , c2 , and c3 as determined by 1 h nmr spectroscopy ( 300 mhz , c 6 d 6 ). for example , epimerization at c1 or c2 to β resulted in high selectivity for epoxidation of the α face ( see table 1 ). in all instances , selectivities for α vs . β epoxidation were directed anti to two out of the three substituents at c1 - c3 . this may be due to the influence of the transannular substituents on the dhp ring conformation as well as the local steric environment . epoxypyranosides 3a - f are stable in a range of solvents and at elevated temperatures . several of these have been evaluated for their reactivity with nucleophiles under s n 2 and lewis - acid mediated conditions . ring - opening of β - epoxide 3a by anionic nucleophiles proceeds with complete regioselectivity and inversion of stereochemistry at c5 , producing the corresponding l - altro derivatives in good to excellent yields in accordance with reaction scheme 3 . in particular , cu ( i )- assisted grignard additions proceed with both high yields and stereocontrol . it is interesting to note that the high levels of inversion of configuration observed here are better in some cases than the corresponding nucleophilic additions to α - epoxy glycals and related intermediates . additions to the minor α - epoxide accompanying 3a also proceed with inversion at c5 to yield the corresponding d - gluco derivatives . coupling constant analysis indicates that both epoxide isomers are predisposed to 1 , 2 - diaxial ring opening at c5 ; in the case of the α - epoxide , the opposite half - chair is favored with o2 and o3 pseudoaxial configurations . heteroatomic nucleophiles also add in an s n 2 fashion , yielding novel 1 , 5 - bisacetals . the table in fig1 lists the conditions of various nucleophilic additions to 3a and their conversions into the corresponding l - altro derivatives in accordance with the invention .	2
an objective of the present invention is to provide a process which can be used to prepare solid tdpi without the disadvantages of prior art processes and which is both efficient and relatively inexpensive for large - scale production . the process should also offer economic and environmental advantages in industrial synthesis . these objectives are acheived by a process for the preparation of solid precipitates of tris ( 2 , 3 - dibromopropyl ) isocyanurate , in which the compound is brought into contact , in an organic solvent , with an adsorbent which is porous and solid under reaction conditions , which has a bet surface area of from 50 to 700 m 2 / g , and which is isolated . a particular advantage of this procedure is that tdpi , which is difficult to crystallize , can be converted quantitatively into solid material . the resultant precipitates are non - tacky and can very easily be freed from the solvent due to the surprising solidification of the tdpi on the adsorbent . thus , the process eliminates problems associated with the handling of liquid precipitants . concentrations of 80 % or more of tdpi are obtainable with porous adsorbents . although the tdpi solidifies on the adsorbent , after a short time two solid phases are present , but , surprisingly , no migration or separation is observed . the porous adsorbent for initiating the formation of solid precipitates of tdpi may , in principle , be any material available to a person skilled in the art , as long as it maintains a solid consistency under process conditions . advantageous materials are those which do not react with the reagents and solvents used . preferred materials include polymer granules , silica , and silicates . polymer granules are microporous polymeric products which are produced from commercially available polymers , such as pp , pe , and pa . the microporous structures act like miniature sponges and can take up more than their own weight of liquids via capillary action . these granules remain surprisingly dry and flowable during use . by way of example , granules of this type are produced under the trademark accurel ® by membrana gmbh , obernburg , germany . it is particularly advantageous to use granulated , microporous polypropylene , because tdpi is mainly used as flame retardant in items manufactured from polypropylene . silicas are autocondensation products of orthosilicic acids ( h 4 sio 4 ) with the general formula ( sio 2 ) m xh 2 o . their large - scale industrial preparation entails precipitation of alkali metal silicate solutions with acids , and as a result , they are called precipitated silicas . fine - particle products can also be obtained via combustion of sicl 4 in a stream of hydrogen and oxygen . precipitated silicas are preferably used for the absorption of tdpi . these products have bet surface areas of from 50 to 700 m 2 / g . silicas which can be used with advantage can be found in the product catalogues of , for example , degussa . silicates are metal salts of orthosilicic acid and condensates thereof . pulverulent calcium silicate can be used with advantage in the present invention . the adsorbents used are intended to have a solid consistency under reaction conditions , i . e ., the adsorbent is intended to have structural integrity at least over the period of adsorption and isolation , so that solid precipitates can be obtained . because the adsorption process is advantageously carried out in the range of 0 to 100 ° c ., preferably from 15 to 80 ° c . and very particularly preferably from 20 to 50 ° c ., the adsorbent should have structural integrity over the abovementioned period at a temperature of at least 100 ° c . as mentioned previously , the bet surface area of the adsorbents should be in the range of from 50 to 700 m 2 / g , in order to give cost - effective results . the bet surface area can preferably be from 60 to 500 m 2 / g and particularly preferably from 80 to 200 m 2 / g . the presence of pores in the adsorbent is essential for the process . these pores should have an average pore diameter which permits the efficient penetration of tdpi into the adsorbent . particularly advantageous materials are those whose average pore diameter is from 1 to 100 μm , preferably from 3 to 50 μm and very preferably from 5 to 20 μm . the pore diameter is determined to din 66133 and din 66134 . organic solvents which may be used in the adsorption process are those which are inert towards the reagents present . because the preparation process advantageously proceeds by way of free - radical bromination of trially isocyanurate , preference is to be given to organic solvents which can also be used for free - radical bromination reactions . in particular , these are solvents selected from the group consisting of : dichloromethane , tetrachloroethane , acetic acid , carbon tetrachloride , chloroform or mixtures of the same . preferably , the porous adsorbent is added to the finished tdpi reaction solution to precipitate the material . in principle , it is also possible to use the reverse procedure . the process takes place at temperatures which permit efficient isolation of tdpi , in particular within the temperature limits stated above . once the adsorbent has been added , stirring is generally continued for a time sufficient to complete adsorption of tdpi on the adsorbent . the material may then be isolated and dried . for isolation , the reaction solution may be removed by distillation and the remaining solid precipitate may be further processed . the present invention likewise provides a solid which is obtainable as described immediately above . this solid is composed of a solid precipitate of tris ( 2 , 3 - dibromopropyl ) isocyanurate , which has been bound by adsorption on the solid porous adsorbent . the solid described above may be used for providing flame retardancy to plastic products . in one preferred embodiment , the form in which the solid is incorporated into such products is that obtainable after isolation and drying . preferably , the solid is used to provide flame retardancy to polypropyene , polyethylene and polystyrene and to the products produced therefrom . as stated , the inventive process can be used to produce tdpi ( which is otherwise difficult to isolate in solid form ), in practically quantitative yield and purity via adsorption on porous adsorbents . the product is in a form which permits improved isolation and allows for simple further processing of the materials into articles . the good handling characteristics of the product , and the rapid and simple conduct of the process , especially on a large scale , are essential advantages of the inventive process and the solid produced . 60 g of triallyl isocyanurate form an initial charge in 150 ml of dichloromethane in a flask , and 114 g of bromine are added in such a way as to give gentle reflux . stirring is continued for 1 h until the bromine colour has disappeared , and 170 g of porous polypropylene ( e . g . accurel ® mp 100 or mp 1000 ) are introduced . the dichloromethane is driven off via application of a slight vacuum at about 40 ° c ., and the residue comprises about 50 % by weight of tdpi in the form of practically colourless , free - flowing granules , with no formation of tacky deposits . alternatively , the reaction solution may be added to an initial charge of polymer , and the solvent may be evaporated simultaneously . a brominated triallyl isocyanurate solution , prepared according to example 1 , is added to an initial charge of precipitated silica ( e . g ., sipernat 50 , produced by degussa ag ), and the solvent is removed by distillation . the residue comprises a non - tacky and free - flowing tdpi preparation comprising 70 % by weight . all references cited herein are fully incorporated by reference . having now fully described the invention , it will be understood by those of skill in the art that the invention may be practiced within a wide and equivalent range of conditions , parameters and the like , without affecting the spirit or scope of the invention or any embodiment thereof .	2
the following description is based on embodiments of the invention and should not be taken as limiting the invention with regard to alternative embodiments that are not explicitly described herein . structural material types and methods of construction identified are examples only . it will be appreciated that relative terms such as top and bottom , upper and lower , and so on , are used merely for ease of reference to the figures , and these terms are not limiting as such , and any two differing directions or positions and so on may be implemented . fig1 is a schematic illustration ( not to scale ) of an exploded view of an example aircraft wing 2 in which an embodiment of a hydrodynamic ram reducing assembly is implemented . the aircraft wing 2 comprises a substructure 4 comprising a plurality of spars 6 and ribs 8 . the spars 6 are spaced apart from one another and are aligned along the length of the aircraft wing 2 . the spars 6 are coupled together by the spaced apart ribs 8 which are substantially perpendicular to the spars 6 . the spars 6 and ribs 8 are connected together by fasteners ( not shown in the figures ). the spars 6 and ribs 8 are made of carbon fibre composite ( cfc ) material , i . e . a composite material comprising a polymer matrix reinforced with carbon fibres . in other examples , the spars 6 and ribs 8 are made of a different appropriate material , for example , aluminium . the aircraft wing 2 further comprises external skins , namely an upper skin 10 and a lower skin 12 . the upper skin 10 comprises a plurality of panels made of cfc material . the upper skin 10 is attached to an upper surface of the substructure 4 by fasteners ( not shown in the figures ). the lower skin 12 comprises a plurality of panels made of cfc material . the lower skin 12 is attached to a lower surface of the substructure 4 by fasteners ( not shown in the figures ). the external skin 10 , 12 may each be , for example , 8 mm thick . when the substructure 4 and the external skins 10 , 12 are attached together ( and , for example , bonded with a sealant ), a cavity defined by the substructure 4 and skins 10 , 12 is formed . such a cavity is used as a fuel tank for storing aircraft fuel and is indicated in fig1 by the reference numeral 14 . the fuel tank is described in more detail later below with reference to fig2 . the aircraft wing 2 further comprises a leading edge structure , a trailing edge structure and a wing tip structure , which are not shown in fig1 for reasons of clarity . fig2 is a schematic illustration ( not to scale ) showing a cross section through the fuel tank 16 in the aircraft wing 2 . in this embodiment , the outer walls of the fuel tank 16 are provided by spars 6 , ribs 8 , and the upper and lower skins 10 , 12 . aircraft fuel is stored in the cavity 14 defined by the fuel tank outer walls . in this embodiment , the fuel tank 16 comprises a hydrodynamic ram reducing assembly comprising a first inner tank wall 18 a , a second inner tank wall 18 b , a first plurality of coupling elements 20 a , and a second plurality of coupling elements 20 b . the first inner tank wall 18 a is located within the cavity 14 . the first inner tank wall 18 a comprises a base wall that is substantially parallel with the upper skin 10 and is coupled to , and spaced apart from , the upper skin 10 by the first plurality of coupling elements 20 a . the first inner tank wall 18 a further comprises side walls that extend from the edges of the base wall of the first inner tank wall 18 a and are substantially parallel to , and spaced part from , the ribs 8 . the first inner tank wall 18 a further comprises further side walls ( not shown in fig2 ) that extend from the edges of the base wall of the first inner tank wall 18 a and are substantially parallel to , and spaced part from , the spars 6 . the first inner tank 18 a comprises an opening opposite the base wall of the first inner tank wall 18 a , the opening of the first inner tank wall 18 a being proximate to the lower skin 12 . the second inner tank wall 18 b is located within the cavity 14 . the second inner tank wall 18 b is located within the first inner tank wall 18 a . the second inner tank wall 18 b comprises a base wall that is located within the opening of the first inner tank wall 18 a . the base wall of the second inner tank wall 18 b is substantially parallel with the lower skin 12 and is coupled to , and spaced apart from , the lower skin 12 by the second plurality of coupling elements 20 b . the second inner tank wall 18 b further comprises side walls that extend from the edges of the base wall of the second inner tank wall 18 b and are substantially parallel to , and spaced part from , the ribs 8 . the side walls of the second inner tank wall 18 b are located within the first inner tank wall 18 a and are substantially parallel with the side walls of the first inner tank 18 a . the second inner tank wall 18 b further comprises further side walls ( not shown in fig2 ) that extend from the edges of the base wall of the second inner tank wall 18 b and are substantially parallel to , and spaced part from , the spars 6 . the further side walls of the second inner tank wall 18 b are located within the first inner tank wall 18 a and are substantially parallel with the further side walls of the first inner tank 18 a . the second inner tank wall 18 b comprises an opening opposite the base wall of the second inner tank wall 18 b , the opening of the second inner tank wall 18 b being proximate to the base wall of the first inner tank wall 18 a and the upper skin 10 . in this embodiment , the first and second inner tank walls 18 a , 18 b are substantially rigid , i . e . is resistant to flexing or deforming . in this embodiment the first and second inner tank walls 18 a , 18 b are made of the same material from which the spars 6 and ribs 8 are made , i . e . cfc . in other embodiments , one or both of the first and second inner tank walls 18 a , 18 b are made of one or more different materials instead of or in addition to cfc , for example , aluminium aluminum , plastic , or an aramid or para - aramid synthetic fibre - based material such as poly - paraphenylene terephthalamide ( which is more commonly known as kevlar ® or twaron ®, or uhmwpe fibres ( e . g . spectra ®, dyneema ®). in this embodiment , the inner tank walls 18 a , 18 b have thicknesses less than or equal to those of the aircraft skins 10 , 12 . in some embodiments , the inner tank walls 18 a , 18 b are between 2 mm and 5 mm thick . in this embodiment , the inner tank walls 18 a , 18 b are sufficiently permeable to allow the fluid within the fuel tank 16 ( i . e . aircraft fuel ) to flow through those walls 18 a , 18 b . in some embodiments , the inner tank walls 18 a , 18 b may comprise a plurality of small holes , perforations , or cut - outs so as to permit the flow of a liquid therethrough . such holes or perforations may have diameters of between 10 mm and 30 mm . thus , flow of the fluid into , within , and out of ( e . g . to the aircraft engine ) the fuel tank 16 tends not to be detrimentally affected by the presence of the hydrodynamic ram reducing assembly within the fuel tank 16 . in some embodiments , the inner tank walls 18 a , 18 b may be made of a permeable or semi - permeable material . in this embodiment , the coupling elements 20 a , 20 b space apart the outer tank walls ( i . e . the skin 10 , 12 , spars 6 and ribs 8 ) from the inner tank walls 18 a , 18 b . preferably , the coupling elements 20 a , 20 b are deformable such that , as described in more detail later below with reference to fig3 , under application of a force or forces to the inner tank walls 18 a , 18 b , the coupling elements 20 a , 20 b permit movement of the inner tank walls 18 a , 18 b with respect to the outer tank walls . for example , the coupling elements 20 a , 20 b may be made of crushable foam that is configured to compress upon application of a compressive force . more preferably , the coupling elements 20 a , 20 b are elastically deformable such that , as described in more detail later below with reference to fig3 , under application of a force or forces to the inner tank walls 18 a , 18 b , the coupling elements 20 a , 20 b permit movement of the inner tank walls 18 a , 18 b with respect to the outer tank walls and then act so as to move the inner tank walls 18 a , 18 b back to their original positions with respect to each other and the outer tank walls . for example , the coupling elements 20 a , 20 b may be made of damped resilient springs . in this embodiment , the inner tank walls 18 a , 18 b may move independently from one another . preferably , the size of the components of the hydrodynamic ram reducing assembly is such that the assembly occupies less than 15 % of the total internal volume ( i . e . capacity ) of the fuel tank 16 . in other embodiments , the assembly occupies a different proportion of the fuel tank capacity . as will now be described in more detail , the hydrodynamic ram reducing assembly is operable to reduce hydrodynamic ram pressure in the fuel contained within the fuel tank 16 resulting from impact of a projectile with an external surface of the fuel tank 16 . fig3 is a schematic illustration ( not to scale ) illustrating effects of a projectile 24 impacting with the lower skin 12 of the fuel tank 16 . the path of the projectile 24 through the lower skin 12 is indicated in fig3 by the reference numeral 26 . the projectile 24 may be any appropriate projectile or foreign object such as a bullet , warhead fragment , a vehicle part , a rock , a maintenance tool , hail , ice , a bolt , etc . an example projectile has a weight of approximately 3 . 5 g , is substantially spherical in shape having a diameter of approximately 9 . 5 mm , and travels with a velocity of 1500 m / s . a further example projectile is a 44 g 12 . 5 mm bullet that travels with a velocity of 500 m / s . in this example , the projectile 24 initially impacts with an external surface of the lower skin 12 and travels through the lower skin 12 . the projectile 24 causes high strain rate shear damage to the lower skin 12 resulting in a hole in the lower skin 12 approximately the size of the projectile 24 . in this example , after passing through the lower skin 12 , the projectile 24 impacts with the base wall of the second inner tank wall 18 b . the second inner tank wall 18 b tends to be deflected and accelerated at least to some extent ( e . g . in the direction indicated in fig3 by solid arrows and the reference numerals 28 ) by the impacting projectile 24 . the projectile 24 impacting with the second inner tank wall 18 b tends to retard the passage of the projectile 24 into the fuel tank 16 . furthermore , impact kinetic energy of the projectile 24 tends to be used to deflect and accelerate the second inner tank wall 18 b through the fluid in the fuel tank 16 , thereby reducing the energy introduced into the fluid directly by the projectile 24 . this movement of the second inner tank wall 18 b through the fluid is permitted by the second plurality of coupling elements 20 b being deformable . advantageously , in embodiments in which the second coupling elements 20 b are elastic , the second inner tank wall 18 b is returned to its original position within the fuel tank 16 . this returning of the second inner tank wall 18 b to its original position uses energy absorbed from the impacting projectile 24 . thus , elastic coupling elements 20 b tend to more gradually dissipate the energy of the projectile 24 into the fluid within the fuel tank 16 . in this example , the projectile 24 travels through the second inner tank wall 18 b . the projectile 24 causes high strain rate shear damage to the second inner tank wall 18 b resulting in a hole in the second inner tank wall 18 b approximately the size of the projectile 24 . impact kinetic energy of the projectile 24 tends to be used to penetrate the second inner tank wall 18 b , thereby reducing the energy introduced into the fluid directly by the projectile 24 . in some examples , the projectile 24 does not fully penetrate the second inner tank wall 18 b and the projectile 24 is prevented from travelling further into the fuel tank 16 , thereby reducing the energy of shockwaves and / or a cavitation pressure caused by the projectile 24 . in this example , after travelling through the second inner tank wall 18 b , the projectile 24 impacts with the fluid within the inner tank ( which is defined by the inner tank walls 18 a , 18 b ). the impacting projectile 24 tends to generate one or more high pressure shock waves 30 within the fluid in the fuel tank 16 . these shock waves 30 tend to be of lower energy than a shock wave or shock waves experienced in a conventional system due to at least some of the impact energy of the projectile 24 being absorbed by the second inner tank wall 18 b . in this example , the shock waves 30 generated by the projectile 24 impinge on the first inner tank wall 18 a . the first inner tank wall 18 a tends to be deflected and accelerated at least to some extent ( e . g . in the direction indicated in fig3 by solid arrows and the reference numerals 32 ) by the incident shockwaves 30 . energy of the shockwaves 30 tends to be used to deflect and accelerate the first inner tank wall 18 a through the fluid in the fuel tank 16 , thereby reducing the shockwave energy transferred to at least the upper skin 10 . this movement of the first inner tank wall 18 a through the fluid is permitted by the first plurality of coupling elements 20 a being deformable . advantageously , in embodiments in which the first coupling elements 20 a are elastic , the first inner tank wall 18 a is returned to its original position within the fuel tank 16 . this returning of the first inner tank wall 18 a to its original position uses energy absorbed from the shockwaves 30 . thus , elastic coupling elements 20 a tend to more gradually dissipate the shockwave energy into the fluid within the fuel tank 16 . furthermore , the first inner tank wall 18 a may reflect incident shock waves 30 at least to some extent . also , the first inner tank wall 18 a tends to be a relatively poor transmitter of impinging shock waves 30 . thus , the amplitude of the shock waves 30 impinging upon the upper skin 10 tends to be reduced and consequently the pressure experienced by the upper skin 10 tends to be diminished by the presence of the first inner tank wall 18 a . the assemblies 18 a , 18 b advantageously tend to decouple the fluid from walls of the fuel tank 16 . the inner tank walls 18 a , 18 b tend to disrupt the shockwaves 30 travelling through the fluid in the fuel tank 16 and thereby tend to insulate the upper and lower skins 10 , 12 at least to some extent . thus , pressures resulting from the shock waves 30 exerted on the walls of the fuel tank 16 tend to be lower than the shock wave pressures experienced in conventional fuel tanks . thus , the likelihood of damage to the walls of the fuels tank 16 ( e . g . decoupling of the external skin 10 , 12 from the spars 6 or ribs 8 ) tends to be reduced . in this example , as the projectile 24 passes through the fluid in the fuel tank 16 , a cavitation “ wake ” may form behind the projectile 24 , i . e . a region of low pressure ( e . g . a vapour or a vacuum ) may form in the wake of the projectile 24 . this causes a fluid displacement and an increase in the pressure of the fluid in the fuel tank 16 . due to the passage of the projectile 24 through the fuel tank 16 being retarded at least to some degree by the second inner tank wall 18 b , the increased fluid pressure resulting from cavitation caused by the projectile 24 tends to be decreased compared to conventional systems . thus , pressures resulting from cavitation exerted on the walls of the fuel tank 16 tend to be lower than in conventional systems . thus , the likelihood of damage to the walls of the fuels tank 16 ( e . g . decoupling of the external skin 10 , 12 from the spars 6 or ribs 8 ) tends to be reduced . additionally , the increased pressure resulting from cavitation caused by the projectile 24 tends to be absorbed by the hydrodynamic ram reducing assembly at least to some extent . in particular , the increased pressure in the fluid tends to cause the inner tank walls 18 a , 18 b to be deflected and accelerated at least to some extent , e . g ., the first inner tank wall 18 a may be moved in the direction indicated in fig3 by solid arrows and the reference numerals 32 while the second inner tank wall 18 b may be moved in the direction indicated in fig3 by solid arrows and the reference numerals 34 . energy tends to be used to deflect and accelerate the inner tank walls 18 a , 18 b in this way , thereby reducing the energy transferred to outer walls of the fuel tank 16 . additionally , were the projectile 24 to continue through the cavity 14 and impact with the first inner tank wall 18 a , the first inner tank wall 18 a would tend to cause further retardation of the projectile 24 , thereby further reducing impact energy and reducing the force experienced by at least the upper skin 10 . an advantage provided by the above described assembly is that hydrodynamic ram damage to a fuel tank caused by an object impacting with an external surface of the fuel tank tends to be reduced or eliminated . hydrodynamic pressures and their associated structural responses tend to be reduced or eliminated . thus , the likelihood of catastrophic failure of the fuel tank and corresponding aircraft loss tends to be reduced or eliminated . the above described assembly advantageously tends to be relative easy and cheap to manufacture . the above described assembly tends to be relatively easy to retrofit to existing aircraft fuel tanks . the above described assembly tends to provide protection against hydrodynamic ram damage whilst occupying a relatively small amount of the fuel tank &# 39 ; s capacity . in the above embodiments , the hydrodynamic ram reducing assembly is implemented in an aircraft wing fuel tank . however , in other embodiments , the assembly is used in a different type of container for containing fluid . in some embodiment , one or more walls of the container may be made of a different material to that described above . in the above embodiments , the inner tank walls are coupled to the upper and lower aircraft skins . however , in other embodiments an inner tank wall may be coupled to a different surface of the fuel tank instead of or in addition to one or both of the upper and lower aircraft skins . for example , in some embodiments , the inner tank walls may be coupled to the ribs and / or the spars . in the above embodiments , the inner tank walls are made of a solid material that may comprise a plurality of holes or perforations . however , in other embodiments , one or both of the inner tank walls is of a different construction . for example , an inner tank wall may comprise two spaced apart walls coupled together to define therebetween at least one chamber . this chamber may , for example , be filled with a gas or may contain a vacuum . preferably , the two spaced part walls of such an inner tank wall are sufficiently strong to resist at least the maximum and minimum hydrostatic pressures of a liquid in the fuel tank . also , preferably , the at least one chamber has a volume sufficient to allow a shock wave or waves in the liquid in the tank resulting from compression of the liquid by impact of a projectile on the tank and thus on the liquid to be reduced by expansion of the compressed liquid into the chamber . also , preferably , the at least one chamber contains a material having a density sufficiently different from the density of a liquid in the tank to provide substantially total reflection within the inner tank wall of the shock wave or waves impinging on the inner tank wall thereby to reduce the hydraulic ram pressure in the liquid .	1
as shown in fig1 a suspension insulator generally designated 1 of design according to the prior art comprises a central member 10 composed of resin bonded glass fibers to which metallic fittings 11 have been secured to the lower and upper ends . these metallic fittings 11 may be secured to the central member 10 any number of ways , but a cast epoxy cone 12 has been shown and is typical . the central member 10 is encased in a sheath 14 which may be sealed to a lip 15 of the end fitting 11 . the sheath 14 has bonded to it a series of weathersheds 16 which are generally identical . the construction for a suspension insulator is well known in the art but because of high field fluxes near the end fitting at higher voltages , in service radio noise will be present at those higher voltages , particularly above 138 kv system voltage . as shown in fig2 we have found that a suitable polymer insulator design embodying the principle of a semiconducting &# 34 ; skin &# 34 ; over an insulating body can be achieved . one embodiment of the design according to the present invention consists of an insulating sheath 17 over the length of a fiberglass rod 18 , over which sheds 19 with collars 20 are placed . the design of the sheds 19 with integral collars 20 in such that each shed with its collar contacts the next shed 19 ( with collar 20 ). as clearly shown in fig2 each collar 20 engages in a groove formed by the next adjacent shed . the shed ( with collar 20 ) which is closest to a metallic end fitting 11 , must extend to the end fitting . in fig2 this contact is accomplished by means of a sleeve 22 . by this expedient a continuous shed 19 ( with collar 20 ) surface entirely covers the sheath 17 . both the sheath 17 and sheds 19 ( with collars 20 ) can be of materials found suitable for outdoor use as high voltage insulators , for example ethylenepropylene rubber . the sheds 19 ( with collars 20 ) must be bonded adequately to the sheath 17 and the sheath 17 to the rod 18 in order to avoid any interfacial path for current flow , moisture accumulation , etc . this bonding may be accomplished by means of adhesives or by vulcanization of an unvulcanized sheath 17 to previously vulcanized sheds 19 ( with collars 20 ) and to the rod 18 . if the sheds 19 ( with collars 20 ) are all of an insulating formulation , no effect of stress dissipation will be found . however , when a shed 21 ( with collar 20 ) and a contact sleeve 22 nearest the end fitting are semiconducting , the high electrical stress spreads out over a greater area , with significant reduction in corona intensity . the invention also has been found to be effective when a plurality of sheds 21 ( with collars 20 ) and a contact sleeve 22 all are made semiconductive . another embodiment of the invention , shown in fig3 eliminates the need for entirely voidfree construction between the elastomers of the insulator and the end fitting . by surrounding a void with equipotential surfaces , no partial discharges will occur within that void . with the contacting elastomer 23 of shed 24 made conducting , it and the end fitting are both at the same electric potential with consequent reduction of radio noise when energized . insulators using the corona shed 21 and sleeve 22 design of fig2 and the corona shed 23 , 24 design of fig3 have been tested and it has been found that these polymer suspension insulators can be used through system voltages of at least 230 kv with very low levels (& lt ; 100 μv ) of radio interference voltage ( riv ) and without visible corona . the same insulators without the invention , at those same test voltages , not only generate far higher riv but also go into visible corona . these corona sheds are of modest cost compared to a corona grading ring and are far less bulky and obtrusive . the corona sheds have the same general outward appearance as unmodified insulators and , therefore , the corona sheds give a pleasing appearance to the observer . furthermore , the semiconductive corona shed of fig3 adds to the leakage distance of the insulator , thereby improving its performance in contamination conditions . the specific design of the corona shed 23 , 24 of fig3 merits further comment . it is desirable to prevent erosion damage to the semiconducting elastomer portion 23 due to high leakage currents . toward this objective the semiconducting elastomer portion 23 is disposed within a recess in and thereby substantially enclosed by track / erosion resistant nonconducting elastomer 24 on all sides exposed to weather and to surface leakage currents . this design of the corona shed 23 , 24 is highly resistant to erosion and provides the desired answer to the radio noise problem and the problem of corona incident to high field flux at the rubber to metal to air junction . a piece closely related to the corona shed 23 , 24 of fig3 is shown in fig4 and may be called a &# 34 ; corona shield &# 34 ;. the corona shield differs from the corona shed only in that the corona shield has no protruding weathershed . the corona shield serves the same purpose of avoiding the radio noise problem and the corona activity . the corona shield is used in applications wherein a top end fitting needs such protection . as can be seen readily , were the corona shed to be used at the top end , it would be upside down and would collect rain water . it will be understood by those skilled in the art to which this invention pertains that various deviations may be made from the embodiments of the corona shed and corona shield shown and described herein , without departing from a main theme of invention pertaining thereto as covered by the claims .	7
fig1 illustrates the lower end of an exemplary wellbore 10 that is being drilled into the earth 12 by a drill bit 14 and bottom hole assembly 16 that are suspended by a drill string , indicated generally at 18 . the drill string 18 , as is known , is made up of a plurality of subs and drill pipe sections that are threaded together to form a single tubular string . the drill string 18 defines a central drilling mud conduit 20 therein . during a drilling operation , drilling mud is flowed from the surface of the wellbore 10 downward through the mud conduit 20 and out through the bit 14 in order to lubricate the drilling operation . the drilling mud then returns to the surface of the well via the annulus 22 ( as indicated by arrows 24 ) that is defined between the inner surfaces of the wellbore 10 and the outer surfaces of the drill string 18 . a drill collar assembly 26 is schematically illustrated in fig1 and shown integrated within the drill string 18 just above the bha 16 . the drill collar 26 is an exemplary sensor sub constructed in accordance with the present invention and which features an improved packaging arrangement for the sensor and detector components of an mwd system above the drill collar 26 is a tubular sub ( the lower end of which is shown at 28 in fig1 ) that carries additional mwd or lwd system components , including a processor and storage medium . as such components are known in the art and , thus , will not be described further herein . the sub 28 also includes a turbine ( not shown ), of a type known in the art that is powered by flow of drilling mud through the mud channel 20 . the turbine is used to provide electrical power to the drill collar assembly 26 for actuation of sensor components therewithin . suitable turbines for this application are available commercially from baker hughes , inteq division at 2001 rankin rd ., houston , tex . 77267 . it is noted as well that the present invention is not limited to use of a turbine and that other power sources known in the art could as easily be used to supply power to components within the drill collar assembly 26 . such power sources include , but are not limited to batteries and cables that extend from the surface of the wellbore 10 . the sub 28 may also include a telemetry device , such as a pulser that is capable of transmitting data via a fluid column using encoded pulses . an exemplary drill collar assembly 26 is shown in greater detail in fig2 , 3 , 4 , and 5 . the drill collar assembly 26 includes a generally cylindrical drill collar housing , or body , 30 with a first , upper end 32 having a box - type threaded connection 34 and a second , lower end 36 having a pin - type threaded connection 38 . the upper end of the drill collar housing 30 presents three radially outwardly extending stabilizer blades 39 . the drill collar housing 30 defines a central mud flow channel 40 along its length . when the drill collar assembly 26 is integrated into a drill string , the mud flow channel 40 aligns with and become a portion of the mud conduit 20 . a pair of sensor module cavities 42 , 44 are defined within the drill collar housing 30 . one module cavity 42 is located upon the outer radial surface of the drill collar assembly 26 , while the other module cavity 44 is located on the outer radial surface of a stabilizer blade 39 . both module cavities 42 , 44 are open to the radial exterior of the drill collar assembly 26 , essentially providing recesses therewithin . while two cavities 42 , 44 are shown in fig2 - 5 , it should be understood that there might be more or fewer , depending upon the needs of the user and the desired number of sensor modules . it is also noted that , although the cavities 42 , 44 are shown disposed upon one side of the drill collar housing 30 , in practice these cavities might be spaced from one another angularly about the circumference of the drill collar housing 30 . for example , it might be desirable to house a module in each of the three stabilizer blades 39 to ensure that the modules are positioned in close proximity to the wall of the borehole 10 during use . sensor modules 46 , 48 are releasably secured within the cavities 42 , 44 , respectively . clamps 50 are disposed over the modules 46 or 48 , as illustrated , and screws 52 are used to secure the clamps against the body 30 . as an alternative to the clamps 50 , a unitary hatch cover might be used to enclose the modules 46 , 48 within the cavities 42 , 44 . fig7 illustrates use of an exemplary hatch cover 51 to secure a module 48 within cavity 44 . the hatch cover 51 is secured to the body 30 using suitable connectors , in the same manner as the clamps 50 described previously , but may be more desirable when , for example , the wellbore 10 contains extremely corrosive fluids and it is desired to protect the modules from such fluid . the hatch cover 51 includes a window 53 that allows formation signals to more easily be transmitted to the module 48 through the hatch 51 . the window 53 may comprise an opening in the hatch cover 51 , but more preferably is a solid material that permits passage of energy and signals . an example is a beryllium metal window that allows low energy gamma rays to pass through and reach the module 48 . the window 53 is located upon the hatch cover 51 so that it will be aligned with the sensor 60 of the module 48 when affixed to the housing body 30 . the drill collar housing 30 further includes a data and power transmission line 54 ( visible in fig3 ) that provides electrical power to the sensor modules 46 , 48 . the transmission line 54 also provides a means for data that is obtained by the sensor modules 46 , 48 to be transmitted to a processor and storage medium , which is contained within a neighboring sub . a suitable current data and power transmission line for this application is that which is ordinarily referred to in the industry as the “ m - 30 ” arrangement , meaning “ modem and 30 volts .” additionally , a power and data transmission cable 56 ( see fig3 ) is disposed within the body 30 to permit transmission of power and data between the two cavities 42 and 44 . electrical plug receptacles , schematically indicated at 58 are located on the upper portion of each sensor module cavity 42 and 44 . the sensor modules 46 , 48 each include a plurality of sensors , schematically indicated at 60 in fig3 . the modules 46 , 48 also include an electrical plug member 62 that is complimentary to the electrical plug receptacle 58 within the respective cavity 42 or 44 . while the sensors 60 are shown in fig3 to be a point source , in fact , the sensors 60 may be of any configuration and may actually cover a large portion of the surface area of the sensor module 46 or 48 . the sensors 60 of each module 46 , 48 are of a type known in the art for sensing a variety of wellbore or logging conditions ( hereinafter , merely referred to as “ wellbore conditions ”), such as , principally , resistivity or porosity . other wellbore conditions might also be detected in addition to or instead of these parameters , including velocity , imaging , photoelectric effect , acoustics , temperature , pressure , gamma radiation , position , and density . the modules 46 , 48 each feature a housing , or sensor body , 64 that is shaped and sized to fit within one of the cavities 42 , 44 of the drill collar housing 30 in a complimentary fashion . in the exemplary embodiment depicted in fig2 - 5 , the sensor body 64 is cylindrical . however , other shapes and configurations may be used as well . as best illustrated by fig4 , the outer diameter of the drill collar assembly 26 is not affected by insertion of the modules 46 , 48 , thereby not restricting the ability of the drill collar assembly 26 to be inserted into a borehole . fig4 a illustrates that the module 48 will reside within a stabilizer blade 39 of the drill collar housing body 30 . this placement is desirable where the sensor must be positioned very close to the wall of the wellbore 10 during use in order to properly collect data . the use of standardized sizes and plugs for the sensor modules 46 , 48 greatly improves the logistics associated with mwd and lwd tools . standardized modules are usable with drill collar housings of all hole sizes . for example , the modules 46 , 48 might be removed from the first drill collar housing 26 , which for purposes of example , is a 9½ ″ diameter drill collar housing and then placed into a second larger drill collar housing 26 b ( a 12¼ ″ housing ) or , alternatively , a smaller drill collar housing 26 a ( an 8½ ″ housing ), as illustrated in fig6 . in this case , the size of the receptacle 44 remains the same among the various drill collar sizes despite the fact that the diameter of the drill collars does change . in addition , each of the various sizes of drill collars , 26 , 26 a , and 26 b , preferably accommodates a common size of clamp 50 and connector 52 without requiring changes in the spacing or sizes of these components . in operation , the sensor modules 46 , 48 are inserted into the cavities 42 , 44 of a properly sized drill collar 26 , 26 a , or 26 b . that drill collar is then integrated into the drill string 18 . the drill string 18 is disposed into the wellbore 10 until the drill collar assembly 26 , 26 a , or 26 b is located proximate a desired zone of interest within the wellbore , which may be the bottom of the hole 10 . electrical power is transmitted via the data and power transmission line 54 to the sensor modules 46 , 48 , which then detect one or more wellbore conditions , depending upon the particular type of sensors that are incorporated into them . data representative of the sensed wellbore conditions is then transmitted from the modules 46 , 48 via the data and power transmission line 54 to a neighboring sub , which transmits the data uphole , in a manner known in the art . in an alternative embodiment , the sensor modules 44 , 48 are self contained so that they do not require an external power source or communication of data to portions of the drill collar housing . fig8 schematically depicts an exemplary self - contained sensor module 80 of this type . the module 80 includes a body 82 that carries a sensor 84 upon the outside surface . the sensor 84 is operably interconnected with a data storage and processing means 86 , of a type known in the art . an internal power source 88 , such as a battery , provides power to the data storage and processing means 86 . when a self - contained module , such as module 80 is used , there is no need for an electrical plug member 62 to be included on the module or for the electrical plug receptacle 58 or for a data and power transmission line 54 or a power and data transmission cable 56 to be included in the body 30 of the drill collar housing . in this instance , the drill collar housing is merely “ dumb ” iron and serves only as a carrier for the module 80 . in operation , the module 80 senses wellbore information with the sensor 84 and transmits the sensed data to the internal data storage and processing means 86 where the data resides until after the drilling operation is completed and the drill string removed from the wellbore 10 . the module 80 may then be removed from the drill collar housing and the information retrieved from the data storage and processing means 84 . other variations of the above - described constructions are possible utilizing the modular concepts described herein . for example , the drill collar housing 26 might , itself , have incorporated therein a bus wire , mud turbine power generator and mud telemetry pulser for transmitting sensed data to the surface . additionally , the drill collar housings might be formed with or without stabilizer blades , such as blades 39 described previously . the present invention improves log quality since there is no need to adapt a tool that is principally designed to operate in a different size hole for an orphaned hole size . the invention also improves utilization of the capital cost of a tool . sensor components may be easily changed out or repaired without the necessity and cost of shipping the drill collar off - site for repair work . those of skill in the art will recognize that numerous modifications and changes may be made to the exemplary designs and embodiments described herein and that the invention is limited only by the claims that follow and any equivalents thereof .	4
fig1 , 2 and 3 illustrate a carpenter &# 39 ; s pencil 10 sharpened on one end to achieve a selected profile . while the invention is primarily intended to provide a sharpened end on a carpenter &# 39 ; s pencil , the invention may be utilized with any elongated object of material capable of being sharpened with a blade and having a uniform cross section along an object axis 12 . as shown in fig3 , the carpenter &# 39 ; s pencil comprises a wooden sheath 14 around a lead core 16 of substantially rectangular cross section . as seen in fig3 , the carpenter &# 39 ; s pencil 10 has a non - circular cross section with oppositely disposed wide sides 18 and oppositely disposed narrow sides 20 separated by chamfered surfaces 22 . the desired profile , viewed looking at the wide side in fig1 is an isosceles trapezoid 24 . the desired profile viewing the narrow side 20 in fig2 is either a narrow isosceles trapezoid or an isosceles triangle 26 . referring to fig4 - 8 of the drawing , the sharpening device , according to the preferred embodiment of the invention comprises a housing shown generally as 28 , which is preferably , but not necessarily , made up of two identical joining halves 28 a , 28 b . as seen in fig7 , the housing half 28 b is roughly in the shape of one - quarter of a circle with an arcuate flange 30 formed about a pivoting axis 32 and an adjacent sloping interior wall 34 . the other housing half 28 a , as seen in the cross - section view of fig8 , is identical and also has a circular flange 31 and an adjacent sloping wall 35 . the two adjacent halves are assembled by means of screws 36 , 38 , 40 passing through the flanges 30 , 31 to join the housing halves together . when the two halves are joined , they define a recess in housing 28 with an opening 42 at the top . the interior walls 34 , 35 are convergent toward one another reaching their narrowest distance apart at flanges 30 , 31 . it is not necessary that walls 34 , 35 intersect one another ; they approach until they almost intersect . a guide member 44 is rotatably mounted in the housing 28 on pins 45 in bearing journals 46 a , 46 b in the respective halves 28 a , 28 b . guide member 44 is arranged to pivot in the housing about the pivoting axis 32 . guide member 44 defines a passage 48 through the guide member 44 . preferably passage 48 is of a cruciform cross section , with a portion 48 a extending at right angle to a portion 48 b , so that it will accept the carpenter &# 39 ; s pencil 10 in either of two rotated positions . however , the shape of passage 48 is immaterial so long as it is of uniform cross section permitting the elongated object to slide through the passage 48 toward the convergent walls 34 , 35 . each of the housing halves 28 a , 28 b have a blade opening through the wall . this opening is shown generally as 50 on the half 28 a . blade opening 50 leads from a wide rectangular entrance 50 a on the outside , leading to a narrow rectangular exit 50 b in the inside wall into the recess . a sharpening blade 52 is mounted on the sloped surface between 50 a , 50 b with its cutting edge 52 a extending slightly into the recess . blade 52 may be secured by any suitable means such as screw 54 . referring to fig7 , the corresponding exit 51 b is seen with a blade cutting edge 52 b protruding into the recess beyond the convergent wall 34 . the operation of the invention will best be understood by reference to fig9 - 13 showing the carpenter &# 39 ; s pencil 10 being sharpened in one rotated position , and fig1 - 18 showing the carpenter &# 39 ; s pencil 10 being sharpened when it is positioned in the other rotated position . the reference numbers in fig9 - 13 and 14 - 18 correspond to those in fig4 - 8 . in fig9 - 13 , the pencil 10 is placed in portion 48 a of cruciform passage 48 . pencil 10 is grasped by a user and used to pivot the guide member 44 back and forth around the pivoting axis 32 , while also maintaining pushing pressure to cause the pencil 10 to slide toward the convergent walls 34 , 35 as material is removed . reference to fig1 shows the guide member 44 being pivoted in a counterclockwise direction so that the cutting edge 52 b removes material to achieve the selected profile on the end of pencil 10 . when the pencil 10 is pivoted in the opposite direction , material is removed on the other side of the pencil by the cutting edge 52 a of blade 52 ( fig1 ). in a similar manner , referring to fig1 - 18 , the pencil 10 is placed in portion 48 b of cruciform passage 48 . pencil 10 is now disposed in a position rotated about its axis with the narrow sides of the pencil facing the convergent walls . the guide member 44 is pivoted back and forth by means of pencil 10 while pressure is maintained . fig1 illustrates material being removed from pencil 10 as it is pivoted in a counterclockwise direction . when it is pivoted in the opposite direction , material is removed from the other side of the pencil by the cutting edge 52 a ( fig1 ). while the blade opening 50 and blade 52 are disposed in a radial direction from the pivoting axis 32 , the blade and opening may also be disposed at an angle to a radial direction to achieve different cutting characteristics . it will be observed that the portion of the recess between convergent walls 34 , 35 where the cutting action takes place is arcuate and generated by a generatrix in the shape of an isosceles triangle moving with a fixed radius about the pivoting axis . the blade edges are straight and extend into the recess in opposite directions , so that material is removed from one side of the elongated object as it is pivoted in one direction and removed from the other side of the object as it is pivoted in the opposite direction . during this time , the object slides through the passage of the guide member , until the desired profile is achieved .	1
fig1 is a schematic circuit diagram of high voltage power supply ( hvps ) 100 configured to prevent a spark event occurrence in a high voltage device such as electrostatic fluid accelerator . hvps 100 includes a high voltage set - up transformer 106 with primary winding 107 and the secondary winding 108 . primary winding 107 is connected to an a . c . voltage provided by dc voltage source 101 through half - bridge inverter ( power transistors 104 , 113 and capacitors 105 , 114 ). capacitor 102 is connected between power input terminal 1 of gate signal controller 111 and ground . gate signal controller 111 produces control pulses that are applied through resistors 103 and 117 to the gates of the transistors 104 , 113 , the frequency of which is determined by the values of resistor 110 and capacitor 116 forming an rc timing circuit . capacitor 112 is connected from a terminal of gate signal controller 111 to a common connection of the gates of transistors 104 and 113 . secondary winding 108 is connected to voltage rectifier 109 including four high voltage ( hv ), high frequency diodes configured as a full - wave bridge rectifier circuit . hvps 100 generates a high voltage between terminal 120 and ground that are connected to a hv device or electrodes ( e . g ., corona discharge device ). an ac component of the voltage applied to the hv device , e . g ., across an array of corona discharge electrodes , is sensed by high voltage capacitor 119 through diode 118 and the sensed voltage is limited by zener diode 122 . when the output voltage exhibits a characteristic voltage fluctuation preceding a spark , the characteristic ac component of the fluctuation leads to a comparatively large signal level across resistor 121 , turning on transistor 115 . transistor 115 grounds pin 3 of the signal controller 111 and interrupts a voltage across the gates of power transistors 104 and 113 . with transistors 104 and 113 rendered nonconductive , an almost instant voltage interruption is affected across the primary winding 107 and , therefore , transmitted to the tightly coupled secondary winding 108 . since a similar rapid voltage drop results at the corona discharge device below a spark onset level , any imminent arcing or dielectrical breakdown is avoided . the spark prevention technique includes two steps or stages . first , energy stored in the stray capacitance of the corona discharge device is discharged through the corona current down to the corona onset voltage . this voltage is always well below spark onset voltage . if this discharge happens in time period that is shorter than about 0 . 1 msec ( i . e ., less than 100 mksec ), the voltage drop will efficiently prevent a spark event from occurring . it has been experimentally determined that voltage drops from the higher spark onset voltage level to the corona onset level may preferably be accomplished in about 50 mksec . after the power supply voltage reaches the corona onset level and cessation of the corona current , the discharge process is much slower and voltage drops to zero over a period of several milliseconds . power supply 100 resumes voltage generation after same predetermined time period defined by resistor 121 and the self - capacitance of the gate - source of transistor 115 . the predetermined time , usually on the order of several milliseconds , has been found to be sufficient for the deionization process and normal operation restoration . in response to re - application of primary power to transformer 106 , voltage provided to the corona discharge device rises from approximately the corona onset level to the normal operating level in a matter of several microseconds . with such an arrangement no spark events occur even when output voltage exceeds a value that otherwise causes frequent sparking across the same corona discharge arrangement and configuration . power supply 100 may be built using available electronic components ; no special components are required . fig2 is a schematic circuit diagram of an alternative power supply 200 with reed contact 222 and an additional load 223 . power supply 200 includes high voltage two winding inductor 209 with primary winding 210 and secondary winding 211 . primary winding 210 is connected to ground through power transistor 208 and to a d . c . power source provided at terminal 201 . pwm controller 205 ( e . g ., a uc 3843 current mode pwm controller ) produces control pulses at the gate of the transistor 208 , an operating frequency of which is determined by an rc circuit including resistor 202 and capacitor 204 . typical frequencies may be 100 khz or higher . secondary winding 211 is connected to a voltage doubler circuit including hv capacitors 215 and 218 , and high frequency hv diodes 216 and 217 . power supply 200 generates a hv d . c . power of between 10 and 25 kv and typically 18 kv between output terminals 219 ( via resistor 214 ) and 220 that are connected to a hv device or electrodes ( i . e ., a load ). control transistor 203 turns on when current through shunt resistor 212 exceeds a preset level and allows a current to flow through control coil 221 of a reed type relay including reed contacts 222 . when current flows through coil 221 , the reed contact 222 close , shunting the hv output to hv dumping resistor 223 , loading the output and decreasing a level of the output voltage for some time period determined by resistor 207 and capacitor 206 . diode 213 is connected between resistor 207 and the junction of resistors 212 and 214 . using this spark management circuitry in combination with various efa components and / or device results in a virtual elimination of all sparks during normal operation . reed relay 203 / 222 may be a zp - 3 of ge - ding information inc ., taiwan . fig3 is a schematic circuit diagram of another hvps arrangement similar to that shown in fig2 . however , in this case hvps 300 includes reed contact 322 and an additional load 323 connected directly to the output terminals of the hvps . hvps 300 includes high voltage transformer 309 with primary winding 310 and secondary winding 311 . primary winding 310 is connected to ground through power transistor 308 and to a dc source connected to power input terminal 301 . pwm controller 305 ( e . g ., a uc 3843 ) produces control pulses at the gate of the transistor 308 . an operating frequency of these control pulses is determined by resistor 302 and the capacitor 304 . secondary winding 311 is connected to a voltage doubler circuit that includes hv capacitors 315 and 318 and high frequency hv diodes 316 and 317 . hvps 300 generates a high voltage output of approximately 18 kv at output terminals 319 and 320 that are connected to the hv device or electrodes ( the load ). spark control transistor 303 turns on in response to a voltage level supplied by diode 313 when current through the shunt resistor 312 ( and resistor 314 forming a voltage divider circuit with resistor 312 ) exceeds some predetermined preset level and allows current to flow through control coil 321 . when current flows through coil 321 , reed contact 322 closes to shunt the hv output of the hvps to hv dumping resistor 323 , thereby reducing a level of the output voltage for a time period determined by resistor 307 and capacitor 306 . use of this incipient spark detection and mitigation arrangement results in virtually no spark production for extended periods of operation . fig4 shows a power supply configuration similar to that depicted in fig2 , hvps 400 further including relay including normally open contacts 422 and coil 421 , and power dumping load 423 . hvps 400 includes power transformer 409 with primary winding 410 and the secondary winding 411 . primary winding 410 is connected to ground through power transistor 408 and to a d . c . power source at terminal 401 . pwm controller 405 ( e . g ., a uc 3843 ) produces a train of control pulses at the gate of the transistor 408 . an operating frequency of these pulses is set by the resistor 402 and capacitor 404 . secondary winding 411 is connected to supply a high voltage ( e . g ., 9 kv ) to a voltage doubler circuit that includes hv capacitors 415 and 418 , and high frequency hv diodes 416 and 417 . power supply 400 generates a high voltage output at terminals 419 and 420 that are connected to the hv device or corona electrodes ( load ). control transistor 403 turns on in response to a voltage level supplied by diode 413 when current through shunt resistor 412 ( and series resistor 414 forming a voltage divider with resistor 412 ) exceeds some preset level predetermined to be characteristic of an incipient spark event , allowing current to flow through coil 421 . when current flows through the coil 421 , relay contact 422 closes , shortening primary winding 410 through dumping resistor 423 . the additional load provided by dumping resistor 423 rapidly decreases the output voltage level over some period of time determined by resistor 407 and capacitor 406 . fig5 is an oscilloscope display including two traces of a power supply output in terms of a corona current 501 and output voltage 502 . as it can be seen corona current has a characteristic narrow spike 503 indicative of an incipient spark event within a time period of about 0 . 1 to 1 . 0 msec , herein shown at about 2 . 2 msec after the current spike . detection of current spike 503 in corona discharge or similar hv apparatus triggers a control circuit , turns the hvps off and preferably dumps any stored energy necessary to lower an electrode potential to or below a dielectric breakdown safety level . thus , in addition to interrupting primary power to the hvps by , for example , inhibiting an operation of a high frequency pulse generator ( e . g ., pwm controller 205 ), other steps may be taken to rapidly lower voltage applied to the hv apparatus to a level below a spark initiation or dielectric breakdown potential . these steps and supportive circuitry may include “ dumping ” any stored charge into an appropriate “ sink ”, such as a resistor , capacitor , inductor , or some combination thereof . the sink may be located within the physical confines of the hvps and / or at the device being powered , i . e ., the hv apparatus or load . if located at the load , the sink may be able to more quickly receive a charge stored within the load , while a sink located at the hvps may be directed to lower a voltage level of the hvps output . note that the sink may dissipate power to lower the voltage level supplied to or at the load using , for example , a hv resistor . alternatively , the energy may be stored and reapplied after the spark event has been addressed to rapidly bring the apparatus back up to an optimal operating . further , it is not necessary to lower the voltage to a zero potential level in all cases , but it may be satisfactory to reduce the voltage level to some value known or predicted to avoid a spark event . according to one embodiment , the hvps includes processing and memory capabilities to associate characteristics of particular pre - spark indicators ( e . g ., current spike intensity , waveform , duration , etc .) with appropriate responses to avoid or minimize , to some preset level , the chance of a spark event . for example , the hvps may be responsive to an absolute amplitude or an area under a current spike ( i . e . , ∫ t ⁢ ⁢ 1 t ⁢ ⁢ 2 ⁢ ( i t - i average ) ⁢ ⅆ t ) for selectively inserting a number of loads previously determined to provide a desired amount of spark event control , e . g ., avoid a spark event , delay or reduce an intensity of a spark event , provide a desired number or rate of spark events , etc . referring again to fig5 , if an output of the hvps is totally interrupted , with no current flowing to the corona discharge apparatus , the voltage across the corona discharge device rapidly drops as shown in the fig5 and described above . after some short period , a current spike 504 may be observed that indicates the moment when actual spark event would have occurred had no action been taken to reduce the voltage level applied to the hv device . fortunately , since the output voltage is well below the spark level , no spark or arc is produced . instead , only a moderate current spike is seen which is sufficiently small as to not cause any disturbances or undesirable electrical arcing sound . after a certain period on the order of 2 - 10 msec after detection of current spike 504 or 1 - 9 msec after current spike 503 , the hvps turns on and resumes normal operation . fig6 is a diagram of hvps 601 according to an embodiment of the invention connected to supply hv power to an electrostatic device 602 , e . g ., a corona discharge fluid accelerator . electrostatic device 602 may include a plurality of corona discharge electrodes 603 connected to hvps 601 by common connection 604 . attractor or collector electrodes 605 are connected to the complementary hv output of hvps 601 by connection 606 . upon application of a hv potential to corona discharge electrodes 603 , respective corona discharge electron clouds are formed in the vicinity of the electrodes , charging the intervening fluid ( e . g ., air ) molecules acting as a dielectric between corona discharge electrodes 603 and the oppositely charged attractor or collector electrodes 605 . the ionized fluid molecules are accelerated toward the opposite charge of collector / attractor electrodes 605 , resulting in a desired fluid movement . however , due to various environmental and other disturbances , the dielectric properties of the fluid may vary . this variation may be sufficient such that the dielectric breakdown voltage may be lowered to a point where electrical arcing may occur between sets of corona discharge and attractor electrodes 603 , 605 . for example , dust , moisture , and / or fluid density changes may lower the dielectric breakdown level to a point below the operating voltage being applied to the device . by monitoring the electrical characteristics of the power signal for a pre - spark signature event ( e . g ., a current spike or pulse , etc . ), appropriate steps are implemented to manage the event , such as lowering the operating voltage in those situations wherein it is desirable to avoid a spark . while the embodiment described above is directed to eliminating or reducing a number and / or intensity of spark events , other embodiments may provide other spark management facilities capabilities and functionalities . for example , a method according to an embodiment of the invention may manage spark events by rapidly changing voltage levels ( for example , by changing duty cycle of pwm controller ) to make spark discharge more uniform , provide a desired spark intensity and / or rate , or for any other purpose . thus , additional applications and implementations of embodiments of the current invention include pre - park detection and rapid voltage change to a particular level so as to achieve a desired result . according to embodiments of the invention , three features provide for the efficient management of spark events . first , the power supply should be inertialess . that means that the power supply should be capable of rapidly varying an output voltage in less time than a time period between a pre - spark indicator and occurrence of a spark event . that time is usually in a matter of one millisecond or less . secondly , an efficient and rapid method of pre - spark detection should be incorporated into power supply shut - down circuitry . third , the load device , e . g ., corona discharge device , should have low self - capacitance capable of being discharged in a time period that is shorter than time period between a pre - spark signature and actual spark events . it should be noted and understood that all publications , patents and patent applications mentioned in this specification are indicative of the level of skill in the art to which the invention pertains . all publications , patents and patent applications are herein incorporated by reference to the same extent as if each individual publication , patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety .	7
in general the conventional limit - torque coupling device has a pre - compressed force reversing mechanism . it is understood that , when the limit - torque coupling device is situated at a normal transmission coupling state , i . e ., within the scope of normal torque , the loss is extremely little ; when it is situated at an over - torque and relatively sliding state , a reversing pressure is thus formed arising from the pre - compression of the over - pressure reversing mechanism whereby sliding friction loss and noise increases between the force reversing mechanism and gyrator . the present invention provides the aforesaid forced reversing mechanism with one - way or bilateral damping by means of a specific damping mechanism , and particularly the one - way is related to the direction of restoring to normal coupling from the over - torque state so as to reduce friction loss during over - torque sliding . the aforesaid limit - torque coupling mechanism with delay restoring function is characterized in that , a restoring damping effect is achieved after over - loaded reversing so as to reduce friction loss arising from residual coupling torque on the conventional limit - torque coupling device , and its delay restoring function relies on mechanical friction damping , magnetic damping , or fluid damping produced from a specific structure during the travel of displacement for limit - torque forced reversing element . owing to a delay effect that reduces restoring displacement and restoring pressure , sliding loss after over - torque is decreased . various basic structures and principles are as shown in fig1 thru 4 . each embodiment of the present limit - torque coupling mechanism with delay restoring function is described as below : at least one first relative motion body 101 with a groove or hole , which may resemble a shaft type , conical form or disc type , and the groove or hole thereon is provided for coupling the forced reversing mechanism 102 ; at least one forced reversing mechanism 102 , which may be a sliding or rolling device for normally coupling with the groove or hole on the aforesaid relative motion body 101 , when the action of both does not exceed a coupling torque , it is engaged in synchronous transmission and there arises sliding or rolling differential action between with relative motion body after it is forcibly reversed ; a second relative motion body 104 which appears in motion or stoppage relatively or simultaneous motion / stoppage with the aforesaid first relative motion body 101 ; the second relative motion body 104 has an inner air chamber 110a for the piston 103 connected to the forced reversing mechanism 102 sliding therein so as to force a fluid , a spring 105 is provided for producing static pressure against the piston 103 and forced reversing mechanism 102 ; separation wall 106 for separating and outer air chamber 110b from the inner air chamber 110a , including a guide hole 107 with a greater bore in the intermediate portion and a one - way reed 108 thereon , the one - way reed 108 having a guide hole 109 with a smaller bore . when the aforesaid forced reversing mechanism is reversed forcibly , the piston 103 immediately compresses the fluid within the inner air chamber 110a whereby the fluid swiftly passing by the guide hole with greater bore on the wall will force the one - way reed 108 open ; when the spring 105 forces the piston to return , as the one - way reed 108 is closed whereby the fluid within the outer air chamber 110b has to pass through the smaller guide hole 109 on the one - way reed 108 whereby the fluid is damped to delay the piston return , such delay function may reduce the depth and static pressure of groove or hole coupling / setting with the forced reversing mechanism and further decrease friction loss when the two relative motion bodies undergo high speed sliding . the delay function for the aforesaid forced reversing mechanism may be accomplished by means of a gas or liquid type fluid , or friction or magnetic eddy delay effect . fig2 a and 2b show an embodiment of a mechanical damping type structure applied to the present limit - torque coupling mechanism wherein it comprises : at least one first relative motion body 201 with a groove or hole , which may resemble a shaft type , conical form or disc type , and the groove or hole thereon is provided for coupling with the forced reversing mechanism 202 ; at least one forced reversing mechanism 202 , which may be a sliding or rolling device for normally coupling with the groove or hole on the aforesaid relative motion body 202 , when the reversing action of both does not exceed a coupling torque , it is engaged in synchronous transmission and there arises sliding or rolling differential action with the first relative motion body 201 after it is reversed forcibly ; a second relative motion body 204 which appears in motion or stoppage relatively or simultaneous motion / stoppage with the aforesaid first relative motion body 201 ; the relative motion body 204 has an air chamber 210 for the piston 203 connected to the forced reversing mechanism 202 sliding therein ; a spring 205 is provided for producing a static pressure against the piston 203 to set the forced reversing mechanism 202 in the groove or hole on the first relative motion body 201 so as to produce a coupling torque ; there is an air hole 206 on top side of air chamber 210 ; at least one transverse hole located in the side of air chamber 210 of second relative motion body 204 for incorporating a packing friction block type or ball type body 208 , packing spring 209 and packing screw 211 for packing by the side of aforesaid piston 203 so as to delay the return of piston 203 once it has been upwardly displaced to decrease friction loss on the groove or hole setting between the relative motion bodies ; when aforesaid piston 203 is displaced from a coupling state , the position to aforesaid packing friction block type or ball type body may engage a groove or hole 215 in the piston 203 to delay the piston return subject to the requirement , and together with aforesaid packing friction block type or ball type body to produce a damping force as damping effect to delay piston return . fig3 a and 3b illustrate another embodiment of a mechanical damping type structure applied to the present limit - torque coupling mechanism with delay restoring function wherein it comprises : at least one first relative motion body 301 with a groove or hole , which body may resemble a shaft type , conical form or disc type , and the groove or hole thereon is provided for coupling with a forced reversing mechanism 302 ; at least one forced reversing mechanism 302 , which may be a sliding or rolling device for normally coupling with the groove or hole on the aforesaid first relative motion body 301 , when the action of both does not exceed a coupling torque , it is engaged in synchronous transmission and there arise sliding or rolling differential action between with relative motion body after it is forcibly reversed ; a second relative motion body 304 which appears in motion or stoppage relatively or simultaneous motion / stoppage with the aforesaid first relative motion body 301 ; the relative motion body 304 has an air chamber 310 for the piston 303 connected to the forced reversing mechanism 302 sliding therein ; a spring 305 is provided for producing a static pressure against the piston 303 to set the forced reversing mechanism together with the groove or hole on the relative motion body 301 ; there is an air hole 306 on the top of air chamber 310 to prevent reversing response interference against the piston 303 ; the main body of the second relative motion body 304 has recessed portions 370 for inserting a side - compression spring 372 between separation posts 371 to force a friction block 373 against the piston 303 to produce a damping function when the piston 303 is forced to return so as to reduce the depth and static pressure of groove or hole coupling / setting with the force reversing mechanism and further decreasing friction loss . fig4 a and 4b illustrate an embodiment of an eddy - effect damping type structure applied to the present limit - torque coupling mechanism with delay restoring function wherein it comprises : at least one first relative motion body 401 with a groove or hole , which may resemble a shaft type , conical form or disc type , and the groove or hole thereon is provided for coupling with a forced reversing mechanism 402 ; at least one forced reversing mechanism 402 , which may be a sliding or rolling device for normally coupling with the groove or hole on the aforesaid first relative motion body 401 , when the action of both does not exceed a coupling torque , it is engaged in synchronous transmission and there arises sliding or rolling differential action between with relative motion body after it is forcibly reversed ; a second relative motion body 404 which appears in motion or stoppage relatively or simultaneous motion / stoppage with the aforesaid first relative motion body 401 ; the relative motion body 404 has an air chamber 410 for the piston 403 connected with the forced reversing mechanism 402 sliding therein ; a spring 405 is provided for producing static pressure against the piston 403 to set the forced reversing mechanism together with the groove or hole on the relative motion body 401 and to produce a coupling torque ; there is an air hole 406 on top side of air chamber 410 to prevent reversing response interference against the piston 403 ; the main body of the relative motion body 404 has recessed notch portions 470 for insertion of permanent magnets 472 , and separation posts 471 . ; the piston 403 is enclosed by a ring type eddy damper 407 ( or closed net type or railing type conductor ) fabricated from a quality conductor such as copper or aluminum , for producing an eddy damping force to delay the return response of the piston 403 when the forced reversing mechanism is forcibly reversed or the spring is in restoring motion , as well as to reduce the depth and static pressure of the groove or hole coupling / setting with the forced reversing mechanism and further decrease friction loss during over - torque sliding . based on aforesaid descriptions , the present invention provides a new design for reducing friction losses when the conventional limit - torque coupling mechanism is over - torque sliding and to prolong the life span of coupling mechanism .	5
embodiment in accordance with the present invention will be described below by referring to the drawings . a superimposing apparatus for broadcasting a 3dcg image , as shown in fig2 , includes a multiprocessor system . the multiprocessor system includes a three - dimensional graphics accelerator 1 for processing a high speed 3dcg image , a superimposer 2 for superimposing the 3dcg image on an input tv signal , a system memory 3 disposed between the three - dimensional graphics accelerator 1 and the superimposer 2 , and two central processing units ( cpu ) 4 and 5 for controlling the three - dimensional graphics accelerator 1 and superimposer 2 , respectively . the cpus 4 and 5 control the respective three - dimensional graphics accelerator 1 and superimposer 2 individually . a single cpu may be used to control them , if the cpu has a performance that can complete a process described below within a given period of time . a cpu that controls an operating system ( os ) in the present apparatus may be diverted to control them . it will be easily understood for a person skilled in the art that a microprocessor unit ( mpu ) can be substituted for a plurality of cpus . a display monitor 6 is provided to confirm an operation of the multiprocessor system by an operator . the operator manually controls the operation of the multiprocessor system in accordance with information on the display monitor 6 . it should be noted that such construction can be realized not by using a special device designed for broadcasting application but by attaching a general board of the three - dimensional graphics accelerator 1 to an accelerated graphics port ( agp ) slot and also attaching a board of the superimposer 2 to a protocol control information ( pci ) slot in a general purpose computer having a plurality of cpus , a work station , or the like . a three - dimensional graphics accelerator board that can calculate a 3dcg image at high speed and high quality is commonly universalized in a general application except for a broadcasting application . the board improves its performance day by day . accordingly , it should be noted that the three - dimensional graphics accelerator can be selected and changed in compliance with applications and costs . a method for transmitting 3dcg image as a superimposed image by using the above constructed apparatus of the present invention will be described below by referring to fig3 . the method comprises : a process ( s 1 ) of pre - processing information necessary for a rendering process ; a process ( s 2 ) of forming a 3dcg image having one frame by carrying out a rendering process in the three - dimensional graphics accelerator 1 ; a process ( s 3 ) of loading a frame buffer by storing a 3dcg image datum in a frame memory ( video memory ) in the three - dimensional graphics accelerator 1 ; a process ( s 4 ) of reading out the 3dcg image datum stored in the frame memory ( video memory ) in the three - dimensional graphics accelerator 1 into the system memory 3 ; a process ( s 5 ) of pre - mixing the image datum read out into the system memory 3 ; a process ( s 6 ) of transferring the pre - mixed image datum to the frame memory in the superimposer 2 to superimpose the datum on the input tv signal ; and a process ( s 7 ) of transmitting the mixed signal from the superimposer 2 . such processes in the three - dimensional graphics accelerator 1 and superimposer 2 are carried out as a chain of a work . in the present invention , the three - dimensional graphics accelerator 1 operates together with the superimposer 2 . that is , it is one of the most significant features in the present invention that the mixing process is proceeded in the superimposer 2 when the rendering process is proceeded in the three - dimensional graphics accelerator 1 . in order to effect the processes from the rendering process to the mixing process in a concurrent mode , a rendering frame in the three - dimensional graphics accelerator 1 is delayed by one frame from a mixing frame in the superimposer 2 . in the prior art , when a smooth animation in a field unit described above is realized within a time limit of period t determined by the number of frames to be transmitted , serial processes including the rendering and mixing processes must be carried out within the time limit of period in accordance with ntsc broadcasting system or pal broadcasting system . the time limit of period t is about 16 . 67 msec per second ( about 60 field / second ) in the case of the ntsc system . however , in the present invention , the rendering process and mixing process are carried out within the time limit of period t , respectively . in more detail , the cpu 4 designates information necessary to render the 3dcg image datum to the three - dimensional graphics accelerator 1 ( pre - calculating process s 1 ), causes the three - dimensional graphics accelerator 1 to start the rendering process s 2 , and causes the system memory 3 to read out the 3dcg image stored in the frame memory ( video memory ) in the three - dimensional graphics accelerator 1 ( frame buffer loading process s 3 ). the present invention can be applied to transmission of a superimposed image using the 3dcg image by completing the processes from pre - calculating process s 1 to the frame buffer loading process s 3 within the time limit of period t . the cpu 5 operates a pre - mixing process s 5 for mixing the 3dcg image ( s 4 ) read out into the system memory 3 , transfers the pre - mixed datum to a mixing frame in the superimposer 2 , operates a mixing process s 6 in accordance with an input tv signal s in the superimposer 2 , and transmits them ( s 7 ). in an embodiment shown in fig3 , the apparatus of the present invention has a third cpu 7 . the cpu 7 covers a basic process of a system such as an os or the like in the above serial processes . the cpu 4 or 5 may cover the basic process in its idle time in lieu of the cpu 7 . in another aspect , the concurrent processes shown in fig3 can be realized by alternately repeating a process of odd fields and a process of even fields , as shown in fig4 . rendering r 1 , r 2 , r 3 , r 4 , . . . shown in fig4 unify the pre - calculating process s 1 , rendering process s 2 , frame buffer loading process s 3 shown in fig3 as a single block . similarly , mixing and transferring c 1 , c 2 , c 3 , . . . unify the pre - mixing process s 5 , transferring process , frame mixing process s 6 shown in fig3 as a single block . the above processes are explained in accordance with time series direction . firstly , rendering r 1 for the first even field f 2 starts in the three - dimensional graphics accelerator 1 . the first odd field f 1 is transmitted as a blank image cleared before hand , since the image to be transferred by the superimposer 2 is not prepared when the rendering ri is completed . after completing the rendering r 1 , rendering r 2 for the second odd field f 3 starts and mixing and transferring process c 1 for the first even field f 2 in the superimposer 2 starts . when the rendering r 2 is completed , the first even field f 2 for broadcasting processed in the mixing and transferring process c 1 is transmitted . by sequentially repeating the processes in the odd fields and even fields , the second odd field f 3 , the second even field f 4 , the third odd field f 5 . . . are sequentially transmitted . since reading and writing processes conflict with each other if the same memory space is designated when transferring a frame memory to the system memory after completing the rendering process and when transferring a frame memory from the system memory to the superimposer as a pre - mixing process in the case of effecting the concurrent action , a memory bank to be used should be changed for an odd field process and an even field process . fig5 shows a more actual process flow to achieve this object . a flag 8 is a flag for changing the memory bank . a memory bank 3 a is used for the even field process while a memory bank 3 b is used for the odd field process . the flag 8 is changed in accordance with an input tv signal transferred into the superimposer 2 . in more detail , as shown in fig6 , the flag 8 ( see fig4 ) is cleared into zero ( 0 ) in an resetting s 10 and a system memory having a resolution required for transferring and having two banks is reset into a blank state . an operator inputs operating information in an external operation s 11 to reflect the information in a pre - rendering process s 12 . this includes , for example , a change of display contents of superimposed images , a displacement of a display position , and the like . in rendering s 13 , the three - dimensional graphics accelerator 1 renders the 3dcg image . the rendered image is transferred to the system memory bank 3 a or 3 b ( s 15 a or s 15 b ) on the basis of a condition branch s 14 . then , after waiting for a result of a permitting process s 16 , it is decided whether rendering of a next frame should be started or not in accordance with a condition of the condition branch s 17 . these processes are controlled by one of the cpus . the result of the permitting process s 16 is obtained from the process in the superimposer 2 shown in fig7 . the result is a protective measure by which the process in the rendering is prevented from preceding the mixing and transferring process in the superimposer . when being permitted , a process returns to the external operation s 11 and pre - rendering process s 12 again . if a system stopping process is carried out in the external operation s 11 , an ending process is done rapidly to bring any process into coming out from the loop . then , the process is ended safely . simultaneously with the start of the rendering process in the three - dimensional graphics accelerator 1 shown in fig6 , the other cpu starts a mixing and transferring process in the superimposer 2 shown in fig7 . a process for waiting for intervening of an input tv signal from the external is performed firstly in the superimposer . when the intervening signal is received , the 3dcg image datum rendered from the system memory bank 3 a or 3 b can be loaded ( s 22 a or s 22 b ) in accordance with a state ( s 21 ) of the flag 8 ( see fig4 ). then , a flag inversion process is carried out in accordance with an indication of a flag set s 23 a or s 23 b . next , switching of the memory bank to be used is effected . a permitting process s 24 is issued to the process s 17 for waiting for permission of rendering pursuance shown in fig6 . this synchronizes serial rendering processes shown in fig6 with the trailing image mixing process s 25 and transmitting process s 26 . the concurrent action processes shown in fig2 are completely synchronized . on the other hand , the basic process of the os and the like by using the cpu 7 shown in fig3 can be carried out during the process s 17 for waiting for permission of rendering pursuance shown in fig6 or during the process s 20 for waiting for the input tv signal shown in fig7 . the idle time of the cpu 4 or cpu 5 can be utilized in lieu of the cpu 7 . the os can automatically select this action . according to the present invention , it is possible to combine a generally universalized three - dimensional graphics accelerator and a broadcasting board used currently for broadcasting that can be utilized in a multiprocessor personal computer ( pc ) or working storage ( ws ) even if there is not a hardware for mixing a high quality 3dcg image in real time for the purpose of broadcasting . consequently , it is possible to construct a apparatus for broadcasting a superimposed image that can superimpose a 3dcg image on an input tv signal in real time without designing a new hardware . further , this means that a high quality 3dcg image can be obtained by exchanging a conventional three - dimensional graphics accelerator for a new three - dimensional graphics accelerator if a performance of the accelerator is improved in the future . this is a great merit in cost in comparison with production of a hardware having a broadcasting function . a period of time for preparing a tv program can be extremely reduced , since a software if or transferring a superimposed image is not altered to meet a new hardware . from the above description of the invention , those skilled in the art will perceive improvements , changes and modifications . such improvements , changes and modifications within the skill of the art are intended to be covered by the appended claims . the entire disclosure of japanese patent application no . 2002 - 137391 filed on may 13 , 2002 including specification , claims , drawings and summary is incorporated herein by reference in its entirety .	6
the present invention provides polymers and copolymers that are functionalized with at least one hydroxy ester functional group that can serve as a protected acid group . the polymers and copolymers of the present invention are useful as photoresist components for use at 193 and 157 nm . such protected acid groups can yield , by catalysis of acids or bases generated photolytically from photoactive compounds ( pacs ), hydrophilic acid groups which enable development of resist coatings , especially under aqueous conditions . the hydroxy ester functional group of this invention has the formula — co 2 — c ( r 1 )( r 2 )—[ c ( r 3 )( r 4 )] n — c ( r 5 )( r 6 )— oh , r 1 , r 2 = c 1 - c 6 alkyl , c 1 - c 6 alkyl substituted with an ether oxygen ; or r 1 and r 2 taken together form a 3 - to 8 - membered ring , optionally substituted with an ether oxygen , provided that the carbon attached to r 1 and r 2 is not at a bridgehead position ; r 3 , r 4 = h , c 1 - c 6 alkyl , c 1 - c 6 alkyl substituted with an ether oxygen ; or r 3 and r 4 taken together form a 3 - to 8 - membered ring , optionally substituted with an ether oxygen ; r 5 , r 6 = h , c 1 - c 6 alkyl , or c 1 - c 6 alkyl substituted with an ether oxygen ; or r 5 and r 6 taken together form a 3 - to 8 - membered ring , optionally substituted with an ether oxygen ; or r 1 and r 5 taken together with —[ c ( r 3 )( r 4 )] n — form a 4 - to 8 - membered ring , provided that the carbon attached to r 1 and r 2 is not at a bridgehead position . r 1 , r 2 = c 1 - c 6 alkyl , or r 1 and r 2 taken together form a 5 - or 6 - membered ring , provided that the carbon attached to r 1 and r 2 is not at a bridgehead position ; r 3 , r 4 = h , c 1 - c 6 alkyl , or r 3 and r 4 taken together form a 5 - or 6 - membered ring ; r 5 , r 6 = h , c 1 - c 6 alkyl , or r 5 and r 6 taken together form a 5 - or 6 - membered ring ; and the hydroxy ester functional group of the formula — co 2 — c ( r 1 )( r 2 )—[ c ( r 3 )( r 4 )] n — c ( r 5 )( r 6 )— oh can be incorporated into polymers and copolymers by any of the several methods known to those skilled in the art . for example , acid - functionalized polymers can be reacted with a diol , ho — c ( r 1 )( r 2 )—[ c ( r 3 )( r 4 )] n — c ( r 5 )( r 6 )— oh to give the corresponding ester . alternatively , the hydroxy ester functional group of the present invention can be incorporated into an ethylenically unsaturated compound that is either homopolymerized , or polymerized with other monomers , to form the desired hydroxy ester functionalized polymer . for example , the acrylate , h 2 c ═ c ( h ) co 2 — c ( r 1 )( r 2 )—[ c ( r 3 )( r 4 )] n — c ( r 5 )( r 6 )— oh , can be homopolymerized , or copolymerized with other acrylates , to form acrylate polymers , or copolymerized with other monomers , such as styrenics . suitable acrylate comonomers include acrylic acid , methyl acrylate , ethyl acrylate , propyl acrylate , tert - butyl acrylate , 2 - methyl - 2 - adamantyl acrylate , 2 - methyl - 2 - norbornyl acrylate , 2 - methoxyethyl acrylate , 2 - hydroxyethyl acrylate , 2 - cyanoethyl acrylate , glycidyl acrylate , and 2 , 2 , 2 - trifluoroethyl acrylate , as well as the corresponding methacrylate monomers . such acrylate , as well as methacrylate , monomers can also be polymerized with other ethylenically unsaturated compounds such as fluoro - olefins and polycyclic olefins . suitable hydroxy esters include 2 - propenoic acid , 2 - hydroxy - 1 , 1 , 2 - trimethylpropyl ester ( pinac ) and the analogous methacrylate monomer ( pinmac ), and the mono - acrylate and mono - methacrylate derivatives of 2 , 5 - dimethyl - 2 , 5 - hexanediol . suitable hydroxy esters can also be prepared from the products of the reductive dimerization of a wide variety of aliphatic and cycloaliphatic ketones , such a cyclohexanone , cyclopentanone and methyl ethyl ketone . most preferably , the hydroxy ester is pinac . in a preferred embodiment of this invention , the photoresist composition further comprises a repeat unit derived from at least one polycyclic ethylenically unsaturated compound . the ethylenically unsaturated group may be contained within the polycyclic moiety as in norbornene or may be pendant to the polycyclic moiety as in 1 - adamantane carboxylate vinyl ester . suitable polycyclic ethylenically unsaturated compounds for use in this invention include , but are not limited to , the compounds shown below : the photoresist and copolymers of this invention may also contain a repeat unit derived from at least one ethylenically unsaturated compound containing a fluoroalcohol , or a protected fluoroalcohol , which has fluoroalkyl groups present as part of the fluoroalcohol functional group . these fluoroalkyl groups are designated as r f and r f ′, which can be partially fluorinated alkyl groups or fully fluorinated alkyl groups ( i . e ., 10 perfluoroalkyl groups ). broadly , r f and r f ′ are the same or different fluoroalkyl groups of from 1 to about 10 carbon atoms or taken together are ( cf 2 ) n wherein n is 2 to 10 . ( in the last sentence , the terms “ taken together ” indicate that r f and r f ′ are not separate , discrete fluorinated alkyl groups , but that together they form a ring structure .) r f and r f ′ can be partially fluorinated alkyl groups without limit , except that there must be a sufficient degree of fluorination present to impart acidity to the hydroxyl (— oh ) of the fluoroalcohol functional group , such that the hydroxyl proton is substantially removed in basic media , such as in aqueous sodium hydroxide solution or tetraalkylammonium hydroxide solution . preferably , there will be sufficient fluorine substitution present in the fluorinated alkyl groups of the fluoroalcohol functional group such that the hydroxyl group will have a pka value of 5 & lt ; pka & lt ; 11 . preferably , r f and r f ′ are independently perfluoroalkyl group of 1 to 5 carbon atoms , and , most preferably , r f and r f ′ are both trifluoromethyl ( cf 3 ). wherein r f and r f ′ are the same or different fluoroalkyl groups of from 1 to about 10 carbon atoms , or taken together are ( cf 2 ) n wherein n is 2 to 10 . some illustrative , but nonlimiting , example of representative comonomers containing a fluoroalcohol functional group and within the scope of the invention are presented below : some suitable comonomers containing the fluoroalcohol functionality are also polycyclic compounds . in a preferred embodiment of this invention , the photoresist comprises a repeat unit derived from at least one ethylenically unsaturated compound containing at least one fluorine atom covalently attached to an ethylenically unsaturated carbon atom . representative ethylenically unsaturated compounds that are suitable for this invention include , but are not limited to , tetrafluoroethylene , chlorotrifluoroethylene , hexafluoropropylene , trifluoroethylene , vinylidene fluoride , vinyl fluoride , perfluoro -( 2 , 2 - dimethyl - 1 , 3 - dioxole ), perfluoro -( 2 - methylene - 4 - methyl - 1 , 3 - dioxolane , cf 2 ═ cfo ( cf 2 ) t cf ═ cf 2 , where t is 1 or 2 , and r f ocf ═ cf 2 wherein r f is a saturated fluoroalkyl group of from 1 to about 10 carbon atoms . preferred comonomers are tetrafluoroethylene , chlorotrifluoroethylene , hexafluoropropylene , trifluoroethylene and r f ocf ═ cf 2 , wherein r f is a saturated fluoroalkyl group of from 1 to about 10 carbon atoms . more preferred are tetrafluoroethylene , chlorotrifluoroethylene , hexafluoropropylene , and r f ocf ═ cf 2 , wherein r f is a saturated perfluoroalkyl group of from 1 to about 10 carbon atoms . in the sections that follow , the photoresist compositions of this invention are described in terms of their component parts . the photoresist compositions of this invention contain at least one photoactive component ( pac ) that usually is a compound that affords either acid or base upon exposure to actinic radiation . if an acid is produced upon exposure to actinic radiation , the pac is termed a photoacid generator ( pag ). if a base is produced upon exposure to actinic radiation , the pac is termed a photobase generator ( pbg ). suitable photoacid generators for this invention include , but are not limited to , 1 ) sulfonium salts ( structure i ), 2 ) iodonium salts ( structure ii ), and 3 ) hydroxamic acid esters , such as structure iii . in structures i - ii , r 7 - r 9 are independently substituted or unsubstituted aryl or substituted or unsubstituted c 1 - c 20 alkylaryl ( aralkyl ). representative aryl groups include , but are not limited to , phenyl and naphthyl . suitable substituents include , but are not limited to , hydroxyl (— oh ) and c 1 - c 20 alkyloxy ( e . g ., c 10 h 21 o ). the anion x − in structures i - ii can be , but is not limited to , sbf 6 -( hexafluoroantimonate ), cf 3 so 3 -( trifluoromethylsulfonate = triflate ), and c 4 f 9 so 3 -( perfluorobutylsulfonate ). various dissolution inhibitors can be utilized in this invention . ideally , dissolution inhibitors ( dis ) for far and extreme uv resists ( e . g ., 193 nm resists ) should be designed / chosen to satisfy multiple materials needs including dissolution inhibition , plasma etch resistance , and adhesion behavior of resist compositions comprising a given di additive . some dissolution inhibiting compounds also serve as plasticizers in resist compositions . a variety of bile - salt esters ( i . e ., cholate esters ) are particularly useful as dis in the compositions of this invention . bile - salt esters are known to be effective dissolution inhibitors for deep uv resists , beginning with work by reichmanis et al . in 1983 . ( e . reichmanis et al ., “ the effect of substituents on the photosensitivity of 2 - nitrobenzyl ester deep uv resists ”, j . electrochem . soc . 1983 , 130 , 1433 - 1437 .) bile - salt esters are particularly attractive choices as dis for several reasons , including their availability from natural sources , their possessing a high alicyclic carbon content , and particularly for their being transparent in the deep and vacuum uv region , ( which essentially is also the far and extreme uv region ), of the electromagnetic spectrum ( e . g ., typically they are highly transparent at 193 nm ). furthermore , the bile - salt esters are also attractive di choices since they may be designed to have widely ranging hydrophobic to hydrophilic compatibilities depending upon hydroxyl substitution and functionalization . representative bile - acids and bile - acid derivatives that are suitable as additives and / or dissolution inhibitors for this invention include , but are not limited to , those illustrated below , which are as follows : cholic acid ( iv ), deoxycholic acid ( v ), lithocholic acid ( vi ), t - butyl deoxycholate ( vii ), t - butyl lithocholate ( viii ), and t - butyl - 3 - α - acetyl lithocholate ( ix ). bile - acid esters , including compounds vii - ix , are preferred dissolution inhibitors in this invention . other types of dissolution inhibitors , such as various diazonaphthoquinones ( dnqs ) and diazocoumarins ( dcs ), can be utilized in this invention in some applications . diazanaphthoquinones and diazocoumarins are generally suitable in resists compositions designed for imaging at higher wavelengths of uv light ( e . g ., 365 nm and perhaps at 248 nm ). these dissolution inhibitors are generally not preferred in resist compositions designed for imaging with uv light at 193 nm or lower wavelengths , since these compounds absorb strongly in this region of the uv and are usually not sufficiently transparent for most applications at these low uv wavelengths . some embodiments of this invention are negative - working photoresists . these negative - working photoresists comprise at least one binder polymer comprised of acid - labile groups and at least one photoactive component that affords photogenerated acid . imagewise exposure of the resist affords photogenerated acid which converts the acid - labile groups to polar functionality ( e . g ., conversion of ester functionality ( less polar ) to acid functionality ( more polar )). development is then done in an organic solvent or critical fluid ( having moderate to low polarity ), which results in a negative - working system in which exposed areas remain and unexposed areas are removed . a variety of different crosslinking agents can be employed as required or optional photoactive component ( s ) in the negative - working compositions of this invention . ( a crosslinking agent is required in embodiments that involve insolubilization in developer solution as a result of crosslinking , but is optional in preferred embodiments that involve insolubilization in developer solution as a result of polar groups being formed in exposed areas that are insoluble in organic solvents and critical fluids having moderate / low polarity ). suitable crosslinking agents include , but are not limited to , various bis - azides , such as 4 , 4 ′- diazidodiphenyl sulfide and 3 , 3 ′- diazidodiphenyl sulfone . preferably , a negative - working resist composition containing a crosslinking agent ( s ) also contains suitable functionality ( e . g ., unsaturated c ═ c bonds ) that can react with the reactive species ( e . g ., nitrenes ) that are generated upon exposure to uv to produce crosslinked polymers that are not soluble , dispersed , or substantially swollen in developer solution , which consequently imparts negative - working characteristics to the composition . the compositions of this invention can contain optional additional components . examples of additional components which can be added include , but are not limited to , resolution enhancers , adhesion promoters , residue reducers , coating aids , plasticizers , and t g ( glass transition temperature ) modifiers . the photoresist compositions of this invention are sensitive in the ultraviolet region of the electromagnetic spectrum and especially to those wavelengths & lt ; 365 nm . imagewise exposure of the resist compositions of this invention can be done at many different uv wavelengths including , but not limited to , 365 nm , 248 nm , 193 nm , 157 nm , and lower wavelengths . imagewise exposure is preferably done with ultraviolet light of 248 nm , 193 nm , 157 nm , or lower wavelengths ; is more preferably done with ultraviolet light of 193 nm , 157 nm , or lower wavelengths ; and is still more preferably done with ultraviolet light of 157 nm or lower wavelengths . imagewise exposure can either be done digitally with a laser or equivalent device or non - digitally with use of a photomask . suitable laser devices for digital imaging of the compositions of this invention include , but are not limited to , an argon - fluorine excimer laser with uv output at 193 nm , a krypton - fluorine excimer laser with uv output at 248 nm , and a fluorine ( f2 ) laser with output at 157 nm . since , as discussed supra , use of uv light of lower wavelength for imagewise exposure corresponds to higher resolution ( lower resolution limit ), the use of a lower wavelength ( e . g ., 193 nm or 157 nm or lower ) is generally preferred over use of a higher wavelength ( e . g ., 248 nm or higher ). the resist compositions of this invention must contain sufficient functionality for development following imagewise exposure to uv light . preferably , the functionality is acid or protected acid such that aqueous development is possible using a basic developer such as sodium hydroxide solution , potassium hydroxide solution , or ammonium or substituted ammonium hydroxide solution . the hydroxy ester group of this invention may function as the protected acid group . some polymers in the resist compositions of this invention may further comprise at least one acid - containing or protected acid - containing monomer of structural unit : in which e 1 is h or c 1 - c 12 alkyl , f or cf 3 ; e 2 is co 2 e 3 , so 3 e 3 , or other acidic functional group ; and e 3 are h or c 1 - c 12 alkyl , which is unsubstituted or hydroxyl - substituted . alkyl groups can contain one to twelve carbon atoms and preferably one to eight . a preferred acid - containing binder polymer for aqueous processability ( aqueous development ) in use is a carboxylic acid - containing copolymer . the level of carboxylic acid groups is determined for a given composition by optimizing the amount needed for good development in aqueous alkaline developer . a fluoro alcohol group , if present in the polymer , can contain a protecting group that protects the fluoro alcohol group from exhibiting its acidity while in this protected form . an alpha - alkoxyalkyl ether group is a preferred protecting group for the fluoro alcohol in order to maintain a high degree of transparency in the photoresist composition . the resulting protected fluoroalcohol group has the structure : in this protected fluoroalcohol , r f and r f ′ are as described above and r 10 is hydrogen or a linear or branched alkyl group of 1 to 10 carbon atoms . an illustrative , but non - limiting , example of an alpha - alkoxyalkyl ether group is methoxy methyl ether . a fluoro alcohol with this protecting group can be obtained by reaction of the fluoroalcohol with chloromethylmethyl ether . when an aqueous processable photoresist is coated or otherwise applied to a substrate and imagewise exposed to uv light , development of the photoresist composition may require that the binder material should contain sufficient acid groups ( e . g ., carboxylic acid groups ) and / or protected acid groups that are at least partially deprotected upon exposure to render the photoresist ( or other photoimageable coating composition ) processable in aqueous alkaline developer . in case of a positive - working photoresist layer , the photoresist layer will be removed during development in portions which are exposed to uv radiation but will be substantially unaffected in unexposed portions during development by aqueous alkaline liquids such as wholly aqueous solutions containing 0 . 262 n tetramethylammonium hydroxide ( with development at 25 ° c . usually for less than or equal to 120 seconds ) or 1 % sodium carbonate by weight ( with development at a temperature of 30 ° c . usually for less than or equal to 2 minutes ). in case of a negative - working photoresist layer , the photoresist layer will be removed during development in portions which are unexposed to uv radiation but will be substantially unaffected in exposed portions during development using a critical fluid , an organic solvent , or an aqueous alkaline solution . a critical fluid , as used herein , is one or more substances heated to a temperature near or above its critical temperature and compressed to a pressure near or above its critical pressure . critical fluids in this invention are at least at a temperature that is higher than 15 ° c . below the critical temperature of the fluid and are at least at a pressure higher than 5 atmospheres below the critical pressure of the fluid . carbon dioxide may be used for the critical fluid in the present invention , including use as a developer . various organic solvents can also be used as developer in this invention . these include , but are not limited to , halogenated solvents and non - halogenated solvents . halogenated solvents are preferred and fluorinated solvents are more preferred . the substrates employed in this invention include silicon , silicon oxide , silicon nitride , silicon oxynitride , and various other materials used in semiconductor manufacture . glossary analytical / measurements bs broad singlet δ nmr chemical shift measured in the indicated solvent g gram nmr nuclear magnetic resonance 1 h nmr proton nmr 13 c nmr carbon - 13 nmr 19 f nmr fluorine - 19 nmr s singlet sec . second ( s ) m multiplet ml milliliter ( s ) mm millimeter ( s ) t g glass transition temperature m n number - average molecular weight of a given polymer m w weight - average molecular weight of a given polymer p = m w / m n polydispersity of a given polymer absorption coefficient ac = a / b , where a , absorbance , = log 10 ( 1 / t ) and b = film thickness in microns , where t = transmittance as defined below . transmittance transmittance , t , = ratio of the radiant power transmitted by a sample to the radiant power incident on the sample and is measured for a specified wavelength λ ( e . g ., nm ). chemicals / monomers mada 2 - methyl - 2 - adamantyl acrylate ( 2 - propenoic acid , 2 - methyltricyclo [ 3 . 3 . 1 . 13 , 7 ] dec - 2 - yl ester ) [ cas reg number 249562 - 06 - 9 ] ohka america , inc ., milpitas , ca mek 2 - butanone aldrich chemical co ., milwaukee , wi perkadox ® 16 n di -( 4 - tert - butylcyclohexyl ) peroxydicarbonate noury chemical corp ., burt , ny pgmea propylene glycol methyl ether acetate aldrich chemical co ., milwaukee , wi pinac 2 - propenoic acid , 2 - hydroxy - 1 , 1 , 2 - tri - methylpropyl ester [ cas reg number 97325 - 36 - 5 ] solkane 365 mfc 1 , 1 , 1 , 3 , 3 - pentafluorobutane solvay fluor , hannover , germany t - buac tert - butyl acrylate aldrich chemical company , milwaukee , wi tcb trichlorobenzene aldrich chemical co ., milwaukee , wi tfe tetrafluoroethylene e . i . du pont de nemours and company , wilmington , de thf tetrahydrofuran nb — me — oh nb — me — f — oh nb — me — f — omom x ═ oh x ═ och 2 c ( cf 3 ) 2 oh x ═ och 2 c ( cf 3 ) 2 och 2 och 3 nb — oac nb — oh nb — f — oh nb — f — omom x ═ ococh 3 x ═ oh x ═ och 2 c ( cf 3 ) 2 oh x ═ och 2 c ( cf 3 ) 2 och 2 och 3 ve — f — oh ch 2 ═ choch 2 ch 2 och 2 c ( cf 3 ) 2 oh ve — f — omom ch 2 ═ choch 2 ch 2 och 2 c ( cf 3 ) 2 och 2 och 3 nb - oac and nb - oh were prepared as described by posner et al . tetrahedron , vol . 32 , page 2281 ( 1976 ) and davies et al . j . chem . soc . perkin i , page 433 ( 1973 ). nb - f - oh , nb - f - omom , nb - me - f - oh and nb - me - f - omom were prepared as described by feiring and feldman , pct int . appl . wo 2000067072 ( nov . 9 , 2000 ). ultraviolet extreme uv region of the electromagnetic spectrum in the ultraviolet that ranges from 10 nanometers to 200 nanometers far uv region of the electromagnetic spectrum in the ultraviolet that ranges from 200 nanometers to 300 nanometers uv ultraviolet region of the electromagnetic spectrum which ranges from 10 nanometers to 390 nanometers near uv region of the electromagnetic spectrum in the ultraviolet that ranges from 300 nanometers to 390 nanometers unless otherwise specified , all temperatures are in degrees celsius , all mass measurements are in grams , and all percentages are weight percentages . unless otherwise indicated , n , appearing within structure ( s ) given in the examples , represents the number of repeat units in the polymer . throughout the specification , p , appearing within structure ( s ), represents the number of repeat units in the polymer . glass transition temperatures ( t g ) were determined by dsc ( differential scanning calorimetry ) using a heating rate of 2 ° c ./ min , data is reported from the second heat . the dsc unit used is a model dsc2910 made by ta instruments , wilmington , del . the term “ clearing dose ” indicates the minimum exposure energy density ( e . g ., in units of mj / cm 2 ) to enable a given photoresist film , following exposure , to undergo development . a 3 neck round bottom flask fitted with overhead stirrer , dropping funnel , reflux condenser , nitrogen atmosphere , and thermowell , was charged with pinacol ( 23 . 6 g , 0 . 20 mol ), ether ( 150 ml ), and triethylamine ( 10 . 6 g , 0 . 105 mol ; freshly distilled ). acryloyl chloride ( 9 . 05 g , 0 . 10 mol ) was added dropwise at room temperature ( 220 - 27 ° c . ), adjusting the addition rate to accommodate the exotherm . the mixture was stirred at room temperature for 18 hr . the mixture was added to cold water ( 100 ml ) and the entire resulting mixture was filtered . the organic phase was washed with additional water ( 50 ml ), dried ( na 2 so 4 , mgso 4 ), and stripped to give 5 . 8 g of yellow oil . kugelrohr distillation provided two fractions , 3 . 44 g , bp 35 - 45 ° c ./ 0 . 05 mm ; ca . 1 . 0 g , bp 60 - 80 ° c ./ 0 . 5 mm . nmr ( c 6 d 6 ) of crude yellow oil is consistent with a ca . 2 / 1 mixture of desired ester / residual diol , contaminated with ca . 6 mol % of the bis - acrylate . a 3 neck round bottom flask fitted with overhead stirrer , dropping funnel , and thermowell , and nitrogen atmosphere was charged with pinacol ( 47 . 2 g , 0 . 40 mol ) and ethylene glycol dimethyl ether ( 175 ml ). the solution was cooled to − 15 ° c . and treated dropwise with a solution of methyl lithium in ether ( 125 ml , 1 . 6 m , 0 . 20 mol ). when addition was complete , the mixture was warmed to 0 ° c . and stirred for 10 minutes . the mixture was cooled to − 20 ° c . and treated dropwise over 0 . 5 hr with acryloyl chloride ( 19 . 0 g , 0 . 21 mol ). after a 15 minute hold time at − 20 ° c ., a mixture of 0 . 5 g phenothiazine , 0 . 5 g monomethylhydroquinone and 0 . 1 g tempo was added . the mixture was then treated dropwise with water ( 4 ml ), warmed to 0 ° c ., and stirred for 15 min before work - up . the mixture was filtered ( n 2 pressure ) to remove solids . the solid was washed with additional ether ( 75 ml ) which was combined with the first filtrate . another portion of 0 . 5 g phenothiazine and 0 . 5 g monomethylhydroquinone and 0 . 1 g tempo was added to the filtrate . evaporation provided 28 . 4 g of thick yellow oil which was kugelrohr distilled to give 17 . 3 g of colorless oil , bp 45 - 55 ° c ./ 0 . 2 mm . 1 h nmr showed ca . 92 % monoadduct , ca . 8 % bis ( acrylate ). kugelrohr distilled material combined from two runs was subjected to spinning band distillation to provide 17 . 1 g of pure product , bp 40 - 42 ° c ./ 0 . 05 mm . a metal pressure vessel of approximate 270 ml capacity was charged with 71 . 05 g nb - f - oh , 0 . 8 g pinac and 25 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 340 psi and a pressure regulator was set to maintain the pressure at 340 psi throughout the polymerization by adding tfe as required . a solution of 82 . 57 g of nb - f - oh and 9 . 58 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of hexane while stirring . the precipitate was filtered , washed with hexane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to hexane . the precipitate was filtered , washed with hexane and dried in a vacuum oven overnight to give 57 . 4 g of white polymer . from its 13 c nmr spectrum , the polymer composition was found to be 39 % tfe , 47 % nb - f - oh and 14 % pinac . dsc : tg = 135 ° c . gpc : mn = 4800 ; mw = 8400 ; mw / mn = 1 . 77 . anal . found : c , 44 . 86 ; h , 3 . 85 ; f , 38 . 27 . a metal pressure vessel of approximate 270 ml capacity was charged with 69 . 6 g nb - f - oh , 1 . 72 g pinac and 25 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 320 psi and a pressure regulator was set to maintain the pressure at 320 psi throughout the polymerization by adding tfe as required . a solution of 78 . 54 g of nb - f - oh and 13 . 14 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of hexane while stirring . the precipitate was filtered , washed with hexane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to hexane . the precipitate was filtered , washed with hexane and dried in a vacuum oven overnight to give 51 . 6 g of white polymer . dsc : tg = 143 ° c . gpc : mn = 6200 ; mw = 9900 ; mw / mn = 1 . 59 . anal . found : c , 46 . 77 ; h , 4 . 56 ; f , 33 . 94 . a metal pressure vessel of approximate 270 ml capacity was charged with 71 . 05 g nb - f - oh , 0 . 48 g t - buac , 0 . 22 g pinac and 25 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 340 psi and a pressure regulator was set to maintain the pressure at 340 psi throughout the polymerization by adding tfe as required . a solution of 82 . 57 g of nb - f - oh , 5 . 33 g t - buac and 3 . 58 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of heptane while stirring . the precipitate was filtered , washed with heptane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to heptane . the precipitate was filtered , washed with heptane and dried in a vacuum oven overnight to give 45 . 3 g of white polymer . from its 13 c nmr spectrum , the polymer composition was found to be 34 % tfe , 45 % nb - f - oh , 12 % t - buac and 8 % pinac . dsc : tg = 141 ° c . gpc : mn = 6800 ; mw = 10100 ; mw / mn = 1 . 49 . anal . found : c , 46 . 14 ; h , 4 . 43 ; f , 36 . 91 . a metal pressure vessel of approximate 270 ml capacity was charged with 71 . 05 g nb - f - oh , 0 . 72 g mada , 0 . 30 g pinac and 50 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 325 psi and a pressure regulator was set to maintain the pressure at 325 psi throughout the polymerization by adding tfe as required . a solution of 85 . 59 g of nb - f - oh , 7 . 64 g mada and 3 . 00 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of hexane while stirring . the precipitate was filtered , washed with hexane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to hexane . the precipitate was filtered , washed with hexane and dried in a vacuum oven overnight to give 45 . 6 g of white polymer . from its 13 c nmr spectrum , the polymer composition was found to be 37 % tfe , 49 % nb - f - oh , 11 % mada and 3 % pinac . dsc : tg = 158 ° c . gpc : mn = 5300 ; mw = 9300 ; mw / mn = 1 . 76 . anal . found : c , 45 . 56 ; h , 4 . 07 ; f , 38 . 82 . a metal pressure vessel of approximate 270 ml capacity was charged with 71 . 05 g nb - f - oh , 0 . 39 g mada , 0 . 56 g pinac and 50 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 325 psi and a pressure regulator was set to maintain the pressure at 325 psi throughout the polymerization by adding tfe as required . a solution of 85 . 59 g of nb - f - oh , 3 . 82 g mada and 5 . 97 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of heptane while stirring . the precipitate was filtered , washed with heptane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to heptane . the precipitate was filtered , washed with heptane and dried in a vacuum oven overnight to give 50 . 5 g of white polymer . from its 13 c nmr spectrum , the polymer composition was found to be 36 % tfe , 46 % nb - f - oh , 4 % mada and 12 % pinac . dsc : tg = 127 ° c . ( very faint transition ). gpc : mn = 4900 ; mw = 8900 ; mw / mn = 1 . 84 . anal . found : c , 45 . 36 ; h , 4 . 03 ; f , 38 . 04 . a metal pressure vessel of approximate 270 ml capacity was charged with 78 . 3 g nb - f - oh , 3 . 96 g mada , 2 . 06 g pinac , 7 . 2 g tetrahydrofuran chain transfer agent and 35 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 270 psi and a pressure regulator was set to maintain the pressure at 270 psi throughout the polymerization by adding tfe as required . a solution of 58 . 0 g of nb - f - oh , 28 . 6 g mada and 14 . 91 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of hexane while stirring . the precipitate was filtered , washed with hexane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to hexane . the precipitate was filtered , washed with hexane and dried in a vacuum oven overnight to give 62 . 6 g of white polymer . dsc : tg = 157 ° c . gpc : mn = 6700 ; mw = 12900 ; mw / mn = 1 . 84 . anal . found : c , 56 . 04 ; h , 6 . 33 ; f , 22 . 91 . a metal pressure vessel of approximate 270 ml capacity was charged with 78 . 3 g nb - f - oh , 5 . 28 g mada , 1 . 03 g pinac , 7 . 2 g tetrahydrofuran chain transfer agent and 35 ml solkane 365 mfc . the vessel was closed , cooled to about − 15 ° c . and pressured to 400 psi with nitrogen and vented several times . the reactor contents were heated to 50 ° c . tfe was added to a pressure of 270 psi and a pressure regulator was set to maintain the pressure at 270 psi throughout the polymerization by adding tfe as required . a solution of 58 . 0 g of nb - f - oh , 38 . 13 g mada and 7 . 45 g of pinac diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 0 . 10 ml / minute for 12 hr . simultaneously with the monomer feed solution , a solution of 7 . 3 g perkadox ® 16n and 60 ml methyl acetate diluted to 100 ml with solkane 365 mfc was pumped into the reactor at a rate of 2 . 0 ml / minute for 6 minutes , and then at a rate of 0 . 1 ml / minute for 8 hours . after 16 hours of reaction time , the vessel was cooled to room temperature and vented to 1 atmosphere . the recovered polymer solution was added slowly to an excess of hexane while stirring . the precipitate was filtered , washed with hexane and air dried . the resulting solid was dissolved in a mixture of thf and solkane 365 mfc and added slowly to excess to hexane . the precipitate was filtered , washed with hexane and dried in a vacuum oven overnight to give 54 . 6 g of white polymer . dsc : tg = 175 ° c . gpc : mn = 7900 ; mw = 14300 ; mw / mn = 1 . 82 . anal . found : c , 58 . 07 ; h , 6 . 20 ; f , 21 . 94 . formulation and imaging of polymer of tfe , nb - f - oh , and pinac the following solution was prepared , magnetically stirred overnight , and filtered through a 0 . 45 μm ptfe syringe filter before use : component wt . ( gm ) tfe / nb — f — oh / pinac polymer from 1 . 938 example 5 2 - heptanone 12 . 356 solution prepared by diluting , 1 / 1 with 1 . 21 2 - heptanone , a 1 . 0 % ( wt ) solution of tetrabutylammonium hydroxide in ethyl lactate 6 . 82 % ( wt ) solution of triphenylsulfonium nonaflate 1 . 496 dissolved in heptanone which had been filtered through a 0 . 45 μm ptfe syringe filter . all imaging exposures were made using an exitech 157 nm microstepper . resist formulations were spin - coated on 8 inch si wafers which were first vapor primed at 90 ° c . with hexamethyidisilazane ( hmds ). the resulting films were soft baked , or post - apply baked ( pab ), at 150 ° c . for 60 sec , and then their thicknesses were measured using a prometrix interferometer which utilized cauchy coefficients determined by variable angle spectroscopic ellipsometry measurements using a j . a . woollam vu301 variable angle spectroscopic ellipsometer . after open frame exposure on the exitech stepper ( typically 100 exposure doses were made ), or imaging using either a binary mask with numerical aperture ( n . a . )= 0 . 6 and partial coherence ( σ )= 0 . 7 , or a levenson strong phase shift mask with n . a .= 0 . 6 and σ = 0 . 3 , the wafer was post - exposure baked ( peb ) at 110 ° c . for 60 sec followed by a 60 sec puddle develop with shipley ldd - 26w 2 . 38 % tetramethyl ammonium hydroxide . the open frame exposed wafers were then subjected to thickness measurements on the prometrix interferometer in order to determine the thickness loss versus exposure dose , and the imaged wafers were examined using a jeol 7550 top - down and tilt scanning electron microscope ( sem ), and in some cases cross - sections were made and examined using a hitachi 4500 sem . this resist formulation was spin cast on an 8 inch si wafer at a speed of 2032 rpm , yielding a film of measured thickness 2152 å after pab at 150 ° c . for 60 sec . this film was then exposed to 157 nm radiation in the exitech stepper using a phase shift mask to yield a latent image . after exposure the film was peb at 110 ° c . for 60 sec , and then puddle developed at 60 sec at room temperature using shipley ldd - 26w developer . the resulting image was examined using a jeol 7550 sem . at an exposure dose of 55 mj / cm 2 the image was found to exhibit dense and isolated features at 100 nm resolution . the following solution was prepared , magnetically stirred overnight , and filtered through a 0 . 45 μm ptfe syringe filter before use : component wt . ( gm ) tfe / nb — f — oh / tba / pinac polymer from 1 . 368 example 6 2 - heptanone 8 . 726 solution prepared by diluting , 1 / 1 with 0 . 850 2 - heptanone , a 1 . 0 % ( wt ) solution of tetrabutylammonium hydroxide in ethyl lactate 6 . 82 % ( wt ) solution of triphenylsulfonium nonaflate 1 . 056 dissolved in heptanone which had been filtered through a 0 . 45 μm ptfe syringe filter . the general imaging procedure in example 10 was used , except that the peb was 130 ° c . this resist formulation was spin cast on an 8 inch si wafer at a speed of 2032 rpm , yielding a film of measured thickness 2152 å after pab at 150 ° c . for 60 sec . this film was then exposed to 157 nm radiation in the exitech stepper using a phase shift mask to yield a latent image . after exposure the film was peb at 130 ° c . for 60 sec , and then puddle developed at 60 sec at room temperature using shipley ldd - 26w developer . the resulting image was examined using a jeol 7550 sem . at an exposure dose of 42 mj / cm 2 the image was found to exhibit dense and isolated features at 100 nm resolution . a solution was prepared as in example 10 , except that the polymer used was the tfe / nb - f - oh / mada / pinac polymer from example 6 . the general imaging procedure in example 11 was used , except that the peb was 105 ° c . this resist formulation was spin cast on an 8 inch si wafer , yielding a film of measured thickness 2158 å after pab at 150 ° c . for 60 sec . this film was then exposed to 157 nm radiation in the exitech stepper using a phase shift mask to yield a latent image . after exposure the film was peb at 105 ° c . for 60 sec , and then puddle developed at 60 sec at room temperature using shipley ldd - 26w developer . the resulting image was examined using a jeol 7550 sem . at an exposure dose of 74 mj / cm 2 the image was found to exhibit 100 nm dense and 60 nm isolated features . a solution was prepared as in example 11 , except that the polymer used was the tfe / nb - f - oh / mada / pinac polymer from example 7 . the general imaging procedure in example 11 was used , except that the peb was 10 ° c . this resist formulation was spin cast on an 8 inch si wafer , yielding a film of measured thickness 2158 å after pab at 150 ° c . for 60 sec . this film was then exposed to 157 nm radiation in the exitech stepper using a phase shift mask to yield a latent image . after exposure the film was peb at 105 ° c . for 60 sec , and then puddle developed at 60 sec at room temperature using shipley ldd - 26w developer . the resulting image was examined using a jeol 7550 sem . at an exposure dose of 74 mj / cm2 the image was found to exhibit 100 nm dense and 60 nm isolated features . the following solution was prepared , magnetically stirred overnight , and filtered through a 0 . 45 μm ptfe syringe filter before use : component wt . ( gm ) tfe / nb — f — oh / mada / pinac polymer from 0 . 869 example 9 2 - heptanone 5 . 822 solution prepared by diluting , 1 / 1 with 0 . 360 2 - heptanone , a 1 . 0 % ( wt ) solution of tetrabutylammonium hydroxide in ethyl lactate 6 . 82 % ( wt ) solution of triphenylsulfonium nonaflate 0 . 449 dissolved in heptanone which had been filtered through a 0 . 45 μm ptfe syringe filter . the general imaging procedure in example 11 was used , except that the peb was 120 ° c . t his resist formulation was spin cast on an 8 inch si wafer at a speed of 1918 rpm , yielding a film of measured thickness 2145 å after pab at 150 ° c . for 60 sec . this film was then exposed to 157 nm radiation in the exitech stepper using a phase shift mask to yield a latent image . after exposure the film was peb at 120 ° c . for 60 sec , and then puddle developed at 60 sec at room temperature using shipley ldd - 26w developer . the resulting image was examined using a jeol 7550 sem . at an exposure dose of 58 mj / cm 2 the image was found to exhibit 100 nm dense and 50 nm isolated features . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made without departing from the spirit and scope of the invention as defined in the appended claims .	8
the present invention provides a new method and system for transporting and sorting multiple reagent packs used in conjunction with an immunodiagnostic instrument . referring to fig1 through 4 , the transporting and storing system of the present invention includes a reagent pack 1 . the reagent pack 1 has an elongated body having a sufficient thickness and a slim profile with a wide middle portion , a narrow front portion with a pointed front end , and a narrow rear portion with a rounded rear end . one or more wells are provided on the elongated body for containing reagents , samples and / or other fluids . on the outer sides of the rear portion , a gripper mechanism 4 is provided as part of a means for positioning of and positively retaining the reagent pack . in a preferred embodiment , the facilitating means includes three conically tapered holes 2 and 3 . one conically tapered hole 2 is located at one outer side of the rear portion and the other two conically tapered holes 3 are located at the other ( substantially opposite ) outer side of the rear portion of the reagent pack 1 . in a preferred embodiment , the conically tapered holes are circular , or they can form elongated slots , or a combination of both . the gripper mechanism 4 of the transporting and storing system of the present invention may be pneumatic or another kind , and is vertically movably supported on a gantry 5 , which in turn is horizontally movably supported by a rack structure . the gripper mechanism 4 includes a pair of opposite gripping jaws 15 with synchronized motion . of course , the motion may be accomplished by utilizing other types of arrangement and power sources which are not limited to pneumatic power . the complementary part of the means for positioning of and positively retaining the reagent pack 1 is provided on the inner sides of the gripping jaws 15 . in the preferred embodiment , the complementary part includes three conically shaped pins 6 . one conically shaped pin 6 is located at the inner side of one of the gripper jaws 15 for engagement with the conically tapered hole 2 of the reagent pack 1 , and the other two conically shaped pins 6 are located at the inner side of the opposite gripper jaw 15 for engagement with the conically tapered holes 3 of the reagent pack 1 . of course , the holes 2 and 3 and the pins 6 of the complementary means for positioning and positively retaining the reagent packs by the gripper mechanism may be of other shapes , such as spherical , prismical , etc . what is important is that the entrance of the holes 2 and 3 on the reagent pack 1 are tapered ( e . g ., with a beveled larger opening ), thereby increasing the tolerance of the gripper mechanism 4 with regard to the position of the reagent pack 1 , and allowing for engagement between the pins 6 and the holes 2 and 3 , respectively , even when the reagent pack 1 is not precisely positioned . a slightly misaligned reagent pack 1 can still be engaged by the pins 6 because the tapered recess of the holes 2 and 3 provides an increased engagement area for the pins 6 . once the pins 6 begin engagement with the tapered recess of the holes 2 and 3 , the compression of the gripping jaws 15 will force the pins 6 to further extend into the holes 2 and 3 , respectively , thereby causing the reagent pack 1 to be aligned with the gripper mechanism 4 . of course , the amount of misalignment tolerable by the gripper mechanism depends on the amount of taper in the conically tapered holes 2 and 3 . in addition , in a preferred embodiment , each pin 6 has a straight cylindrical section at its end . this feature ensures positive retention of the reagent pack by the gripper mechanism 4 in the event that there is a loss in the power to the system , which may result in a loss of compression force of the gripping jaws 15 needed for engagement of the jaws 15 with the reagent pack 1 . with the cylindrical section of the pins 6 being extended into the holes 2 and 3 , the reagent pack 1 will be hanging on the pins 6 of the gripper mechanism , 4 even when it is not compressed by the gripping jaws 15 . furthermore , when the gripper mechanism 4 is engaged with the reagent pack 1 , the three pins 6 define a plane which precisely orients the reagent pack 1 during transportation by the gantry 5 from one position to another . in an alternative embodiment , the gripper mechanism 4 contains conically tapered holes which engage pins located on the reagent pack 1 . in other respects , the operation of the gripper mechanism and reagent pack for this embodiment is the same . the transporting and storing system of the present invention also includes a multi - unit storage nest 7 having a plurality of vertically and horizontally spaced compartments 8 , each adapted to receive and hold a reagent pack 1 . additionally , the system includes a pipetting nest 9 also having multiple compartments 10 for positioning a reagent pack 1 for pipetting . both nests 7 and 9 are designed to hold the reagent pack within the tolerance limits but without rigidly defining its position , as will be described in detail below . referring to fig4 the storage nest 7 has a multiplicity of compartments 8 arranged in multiple vertical columns , where the respective compartments in the multiple columns are also aligned in horizontal rows , thereby forming a two - dimensional matrix , such that when the reagent packs 1 are held in the storage nest 7 , they are aligned in vertical columns and horizontal rows . one or more empty or open vertical “ transport routes ” ( with no compartment ) are provided to allow the gripper mechanism 4 to transport the reagent packs 1 vertically within the storage nest 7 and between the storage nest 7 and the pipetting nest 9 . similarly , one or more empty or open horizontal “ transport routes ” are also provided to allow the gripper mechanism 4 to transport the reagent packs 1 horizontally . each compartment 8 of the storage nest 7 has a flat bottom 12 and two substantially opposite and vertical sidewalls 13 . the clearance between the retaining sidewalls 13 of the compartment 8 and the reagent pack 1 held therein provides limits to the horizontal motion of the reagent pack 1 . when a reagent pack 1 is sent into a compartment 8 by the gripper mechanism 4 , a small gap is intentionally maintained between the flat bottom 12 of the compartment 8 and the bottom of the reagent pack 1 , as long as the pins 6 of the gripper mechanism 4 are still engaged with the holes 2 and 3 of the reagent pack 1 . with this arrangement , any direct contact between the flat bottom 12 of the compartment 8 and the bottom of the reagent pack 1 is avoided , as the reagent pack 1 is sent into the compartment 8 of the storage nest 7 , thereby eliminating interference therebetween that is a result of mechanical part tolerances . once the reagent pack 1 is positioned within the compartment 8 between the two sidewalls 13 and above the flat bottom 12 , the pins 6 of the gripper mechanism 1 are synchronously disengaged from the holes 2 and 3 of the reagent pack 1 , which allows the reagent pack 1 to drop down the distance of the small gap and rest on the flat bottom 12 of the compartment 8 . when the reagent pack 1 needs to be removed from the compartment 8 , the gripping jaws 15 of the gripper mechanism 4 are moved in to be adjacent to the rear end of the reagent pack 1 and are ready to retrieve the reagent pack 1 . however , the pins 6 of the gripper mechanism 4 are intentionally positioned slightly higher than the center of the holes 2 and 3 of the reagent pack 1 but still within the range of tapered openings of the holes 2 and 3 , such that when the gripping jaws 15 are compressed , the pins 6 are engaged with and guided by the tapered surfaces to finally align with and insert into the holes 2 and 3 and , during this process of engagement , causes the reagent pack 1 to be lifted up slightly , such that the same small gap is left between the bottom of the reagent pack 1 and the flat bottom 12 of the compartment 8 . this arrangement prevents any direct contact between the flat bottom 12 of the compartment 8 and the bottom of the reagent pack 1 and thereby eliminates any interference therebetween as the reagent pack 1 is retrieved from the compartment 8 of the storage nest 7 . the pipetting nest 9 has a multiplicity of compartments 10 aligned in a horizontal row . each compartment 10 has a spring - loaded v - block 11 for engaging the pointed front end of the reagent pack 1 for its precise positioning . this is because , during pipetting , the reagent pack 1 has to be positioned with a relatively high precision and it has to be retained both horizontally and vertically . when the pins 6 of the gripper mechanism 4 are engaging the reagent pack 1 , the v - block 11 translates to a position defined by the retained reagent pack 1 . when the pins 6 are disengaged from the reagent pack 1 , the v - block 11 springs back against rigid stops , which are placed at a distance that is slightly greater than the length of the pack 1 . as a result , the reagent pack 1 moves into a position within the limits defined by the v - block 11 . the v - block 11 limits the motion of the reagent pack 1 when a pipetter tip is withdrawn from the pack as the elastomeric seal of the reagent pack 1 creates a drag , which tends to cause the reagent pack 1 to be lifted up . after the pipetter tip is withdrawn , the reagent pack 1 is free to fall back down into its position in the compartment 10 of the pipetting nest 9 , which prevents the pipetter tip from contacting the bottom of the wells of the reagent pack 1 during future assays . referring to fig4 through 15 , the transporting and storing method of the present invention includes the following steps : 1 . starting from its initial position , as shown in fig4 the gantry 5 with the gripper mechanism 4 moves horizontally through a horizontal transport route 14 a , positions itself over the desired column of reagent packs 1 , and opens its gripping jaws 15 , as shown in fig5 . 2 . the gripper mechanism 4 moves down vertically until it reaches the desired reagent pack 1 . it stops when the pins 6 of the gripping jaws 15 are positioned at approximately 0 . 03 inch above the center of the holes 2 and 3 of the reagent pack 1 , as shown in fig6 . 3 . the gripper mechanism 4 is actuated and the gripping jaws 15 move synchronously towards each other until the pins 6 are fully engaged with the holes 2 and 3 of the reagent pack 1 . as a result , the reagent pack 1 is raised an amount necessary to compensate for position error caused by tolerance accumulation at a position defined by the pins 6 above the flat bottom 12 of the compartment 8 of the storage nest 7 , as shown in fig7 . 4 . the gripper mechanism 4 moves vertically until the bottom of the reagent pack 1 is just above the sidewalls 13 of the compartment 8 of the storage nest 7 , as shown in fig8 . 5 . the gripper mechanism 4 then moves the reagent pack 1 horizontally to a nearest vertical transport route 16 a , as shown in fig9 . 6 . the gripper mechanism 4 moves the reagent pack 1 vertically up in the vertical transport route to the horizontal transport route 14 a , as shown in fig1 . 7 . the gripper mechanism 4 moves the reagent pack 1 horizontally in the horizontal row to a vertical transport route next to one of the available compartments 10 of the pipetting nest 9 , as shown in fig1 . 8 . the gripper mechanism 4 moves vertically in the transport route next to the available compartment 10 of the pipetting nest 9 until the bottom of the reagent pack 1 is above the bottom of the compartment 10 , as shown in fig1 . 9 . the gripper mechanism 4 moves the reagent pack 1 horizontally into the compartment 10 of the pipetting nest 9 and deflects the spring - loaded v - blocks 11 until the reagent pack 1 is centered in the compartment 10 of the pipetting nest 9 , as shown in fig1 . 10 . the gripper mechanism 4 reverses and its pins 6 disengage from the reagent pack 1 . the v - blocks 11 return to their hard stops and align the reagent pack 1 to its precise pipetting position . the reagent pack 1 lowers down a small distance under gravity to come to rest on the bottom of the compartment 10 of the pipetting nest , as shown in fig1 . 11 . the gripper mechanism 4 moves vertically down to the horizontal transport route 14 a to return to its initial position , as shown in fig1 . 12 . while one reagent pack 1 is retained in one of the compartments 10 of the pipetting nest 9 for the pipetting procedure , the gripper mechanism 4 may repeat the above steps to transport another one of the reagent packs 1 from the storage nest 7 to another available compartment 10 of the pipetting nest 9 for simultaneous pipetting . one of the novel features of the transporting and storing system and method of the present invention is the ability to transport a single desired pack from a storage to a pipetting position and to service multiple pipetting positions with a single transport system . another novel feature of the transporting and storing system and method of the present invention is the combination of the conically tapered holes on the reagent pack and the complementary matching pins on the gripper mechanism for positioning and positively retaining the reagent pack while transporting it from the storage position to the pipetting position . it is to be understood that the form of the system depicted in fig1 through 15 has been chosen only for the purpose of describing a particular embodiment and function of the invention , and that the arrangement of the invention can be addressed in various ways and incorporated in other types of devices , all of which will be evident to those skilled in the art . it is also to be understood that the particular arrangement of the transporting and storing system of the present invention may vary depending on the immunodiagnostic instrument it is incorporated or working together with , but that the determination of necessary variation is well within the skill in the art in view of the instant disclosure . suitable components that are commercially available would be known to those of ordinary skill in the art in view of this disclosure . the present invention may be embodied in other specific forms without departing from its essential characteristics . the described embodiment is to be considered in all respects only as illustrative and not as restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of the equivalence of the claims are to be embraced within their scope .	6
in one form , the system and method to help prevent medical errors by providing commonly needed medical information provides such information on the hospital garment . an object of the disclosed invention is the provision of new and improved system and method to help prevent medical errors by providing commonly needed medical information that is provided at the point of medical service by being placed at strategic points on the hospital garment . further objects and advantages of the present invention are apparent from the following detailed description made with reference to the accompanying drawings which form a part of the specification and wherein : fig1 is a front plan view of a form of the invention in the form of a hospital garment ; fig2 is a partial cutaway of the front plan view of the hospital garment of fig1 with the upper right hand pocket removed to show an opening for heart monitor cords or other things ; and fig3 is a back plan view of the hospital garment of fig1 . it should be noted that the terms patient garment , patient gown , and hospital gown mean the same thing as used throughout this application as they are really one and the same thing . a hospital gown can be utilized in places that are not hospitals , such as doctor &# 39 ; s offices and nursing homes . referring to fig1 - 3 , there is shown one form of a system to help prevent medical errors in the form of hospital gown 10 . in one form , hospital gown 10 can be constructed somewhat similarly to a standard hospital gown . hospital gown 10 can include a body portion 11 made out of a suitable washable cloth material . body portion 11 can terminate in neck opening 12 at the top , leg opening 14 at the bottom , and sleeves 20 and 22 on opposite sides of body portion 11 . sleeves 20 and 22 preferably include arm openings 16 and 18 at their ends opposite body portion 11 . hospital gown 10 can have a front 24 and a back 26 . in one form , hospital gown 10 has a body opening 28 in the back 26 that can be opened and closed to allow hospital gown 10 to be easily put on and removed . hospital gown 10 can also have a body opening 30 in the front 24 that can be opened and closed to allow hospital gown 10 to be easily put on and removed . such body opening 30 in front 24 can be in addition to , or instead of , body opening 28 in the back 26 . body openings 28 and 30 also provide the caregiver with any needed access to perform their duties such as listening to the wearer &# 39 ; s heart or lungs . one or more fasteners 32 or 34 can be provided to fasten body openings 28 or 30 in the closed position . in one form , fasteners 32 or 34 can be a single string that is tied together . in another form , fasteners 32 or 34 can be one or more snaps or buttons that can fasten the gown closed . in yet another form , fasteners 32 or 34 can include one or more hook and loop fastener devices , such as velcro , that can be used to close gown 10 . in the form depicted , a single hook and loop fastener 32 can be used to form a re - sealable seam to securely fasten the front body opening 30 , for example where the single hook and loop fastener 32 runs along the length of gown 10 from a point proximate to neck opening 12 to an area proximate to leg opening 14 . this form of fastener 32 running all , or most , of the length of gown 10 can aid the wearer &# 39 ; s spirits by providing them the confidence of knowing that their gown 10 provides adequate coverage and is unlikely to cause an accidental exposure . also in the form depicted , multiple hook and loop fasteners 34 can be used to close gown 10 . here , the multiple hook and loop fasteners 34 can be placed along the length of gown 10 from a point proximate to neck opening 12 to an area proximate to leg opening 14 . in one form , critical portions of gown 10 at opening 28 can be cut to overlap each other by an amount sufficient to prevent accidental exposure due to the gaping of material between adjacent fasteners 34 . in one form , the overlap can be from 4 - 12 inches of material that is overlapped . similar to more typical hospital gown , additional fasteners 36 and 38 can be provided along the length of sleeves 20 and 22 between the neck opening 12 and arm openings 16 and 18 to close sleeves 16 and 18 while allowing them to be opened when required . in a preferred form . fasteners 36 and 38 can be hook and loop type fasteners . such fasteners are typically easier to close than the more typical snaps used in many such gowns because they do not need to be as precisely aligned as the snaps require . in one form , opening 40 is provided on front 24 of gown 10 in an area that is preferably proximate to the heart of the wearer of gown 10 . in a preferred form , opening 40 can be in the form of the depicted slit , which is preferably covered by the outer material 42 that forms chest pocket 50 in a somewhat typical manner . an additional piece of outer material 44 can also be sewn or otherwise securely attached to gown 10 to form an additional chest pocket 52 . in a preferred form , one or more pieces of outer material , such as 46 and 48 , are securely sewn or otherwise attached to gown to form pockets , such as hip pockets 54 and 56 , that are closer to the wearer &# 39 ; s hands and more easily reached by the wearer when their arms are down in a normal at rest position . having pockets much lower on the gown makes it more comfortable because it is more convenient for the wearer to place and retrieve items and also gives them a place to warm their hands if their hands feel a bit chilly . in one form , a second opening is provided on front 24 of gown 10 in an area that is preferably covered by one of the pieces of outer material 46 and 48 that forms hip pockets 54 and 56 . in a preferred form , gown 10 can be personalized with preselected information concerning the intended wearer that can be very useful to the care giver , especially information ( including medical information ) that can help prevent medical errors . such information can include a person &# 39 ; s name 58 , blood type 60 , allergies or the absence of any allergies 62 , medical conditions or the lack of any medical conditions 64 , emergency contact information in case something happens to the patient 66 . additional information could be provided concerning particular procedures that are scheduled , such as identification of a limb to be amputated , identification of a specific artery to be un - blocked , or other information identifying the particulars of a scheduled surgery or other procedure . in one form , such information can be provided on the front 24 of gown 10 by permanently providing the information on gown 10 . in one form , such information can be embroidered on gown 10 , such as on one or more of the pieces of material 42 , 44 , 46 and 48 that can form pockets 50 , 52 , 54 , and 56 . if the wearer does not own gown 10 , pockets material 42 , 44 , 46 and 48 can be re - moveably attached to the gown , such as by using a hook and look type fastener . however , if the wearer owns gown 10 , such material forming pockets can be securely sewn on and then replaced if the information changes . some people may be concerned about keeping their information , including medical information , more private . in such instance , the information can remain covered until needed by a care giver . for example , a privacy screen , in the form of additional material can be provided to cover up such information until needed . such privacy screen 70 can be re - moveably secured to gown 10 over information 58 - 64 using a hook and loop type fastener along the privacy flaps entire perimeter , or at portions along such perimeter , so that they can be easily removed and / or replaced by the caregiver . alternatively , such privacy screen can be in the form of a privacy flap 70 , which can be securely sewn to gown 10 , for example , along its top portion 72 closest to neck 12 such that gravity causes the rest of the privacy flap to hang down and cover such medical information . this allows the caregiver to easily move the privacy flap 70 upward in order to view the information underneath . in a preferred form , privacy shield is made from a similar material as the rest of gown 10 and makes the information underneath unreadable or difficult to read at a particular distance . while gown 10 has been described above as being made from a cloth material , an alternative would be for patient gown 10 to be made out of a disposable material similar to a paper towel , such as a disposable cellulose based material . such gowns could be of particular use for providing information , including medical information , for a given surgery or other procedures . a marker could even be used to write on the patient gown 10 to identify a particular limb that required amputation or another body part that surgery was going to be performed in order to prevent medical errors . for example , if the patient &# 39 ; s right arm needed to be amputated the corresponding right arm 20 of gown 10 could contain information identifying the right arm was to be amputated . additionally , the left arm 22 of gown 10 might include information indentifying the right arm ( or at least not the left arm ) was to be amputated . in such case , right arm 20 might have written on it “ amputate this arm ” and left arm 22 might have written on it “ not this one , the other one ”. alternatively , such information could be provided by the removal of the right arm 20 of gown 10 while keeping left arm 22 intact . while the present invention has been illustrated and described herein assembled to form a patient gown , it should be apparent from the foregoing that other clothing may be assembled containing similar medical information , for example , pajamas , a nightgown , a bathrobe and other clothing .	0
the present invention provides food supplements which are composed of plant extracted water soluble plant tissues and antioxidant compounds or individual ingredients . the plants , mushrooms or herbs are enumerated below . it should be noted that the antioxidant present in the compounds also will aid in preserving other substances within said compounds from deterioration . this is in addition to their inherent beneficial effects on human beings and / or the mammalian family in general . after pulverizing of the plant materials by any mechanical method ; extraction of the water soluble antioxidants and / or active chemical ingredients may be accomplished by use of a plant to water ratio of about 2 : 1 weight to volume . extracted plant materials can be separated by any of the known methods in the art such as flotation , filtration , centrifugation and so on . in the discussion of this invention it is preferable to use the pulverized dried plants or mushrooms in their desiccated form . this also holds true for the antioxidant sources such as grape seed extracts or the bark of the merritime pine tree , re : pycnogenol ( tm ). the specific list of the components of this invention follow with a brief description of each of the ingredients or components in component form . 1 . adrenal gland bovine origin . 150 mg . cold pressed , source of dhea ( dehydroepiandrosterone ), known for its antitumor effect . dhea treatment inhibits tumor initiation as well as tumor promoter - induced epidermal hyperplasia and promotion of papillomas . there is much evidence that dhea produces its antiproliferative and tumor preventive effects by inhibiting glucose - 6 - phosphate dehydrogenase and the pentose phosphate pathway . this pathway is an important source of nadph , a critical reductant for many biochemical reactions that generate oxygen free radicals which may act as second messengers in stimulating hyperplasia . 2 . arctium lappa ( burdock ) 50 mg . dried & amp ; ground roots & amp ; seeds . contents : several volatile oils ; inulin ; tannin ; and a bitter glycoside called artiin . traditionally this herb is stated to act upon the respiratory , urinary , circulatory and lymphatic systems ; contains an antimutagenic lignin - like compound . 3 . commiphora mukul ; burseacea ( guggel ) 250 mg . resin of plant . traditionally in ayurvedic medicine this resin acts on the nervous , circulatory , respiratory and digestive systems . it is specifically indicated and used for tumors , bronchitis , whooping cough , respiratory infections , and many other conditions . the chemistry is unavailable . 4 . curcuma longa ( turmeric ) 100 mg . dried & amp ; ground rhizome traditionally this is a good natural antibiotic which also aids the digestion and the natural intestinal flora . contains bitter principles , curcumin ( a yellow pigment ) and a volatile oil . 5 . echinacea angustifolia or echinacea purpurea ( cone flower ) 200 mg . dried & amp ; ground root & amp ; rhizome . contents : it is viewed / stated that both angustifolia and purpurea have the identical chemistries but for the sake of stability i shall direct attention to e . angustifolia . there is a bacteriostatic principle termed echinacoside , a caffeic acid glycoside and a polysaccharide termed echinacin b , which forms a complex with hyaluronic acid that is resistant to attack by hyaluronidase . also a hydrocarbon in the root oil termed ( z )- 1 , 8 - pentadecadiene has definite in - vivo antitumor effects . 6 . ganoderma lucidum ( mushroom ) 100 mg . dried & amp ; ground in its entirety . traditionally known and used in oriental medicine for its antitumor effects . the chemistry is unavailable . 7 . hydrastis canadensis ( golden seal ) 50 mg . dried & amp ; ground rhizome . the chief compositions of this herb and mostly found in the rhizome are ; the alkaloids berberine about 4 % ( c - 20 , h - 17 , no4 ) which gives the yellow coloring to this chemical . also hydrastine , about 4 %; canadine ; resin , lignin and a small amount of a volatile oil . both berberine and hydrastine are noted for their astringent effect in inflammation of the mucous membranes ; thus a calming effect is created in the lungs to quell cough and induce expectoration of mucous , at the same time soothing said membranes . 8 . inula helenium ( elecampane or wild sunflower ). 100 mg . dried & amp ; ground rootstock & amp ; rhizome . the main chemical constituents are a chemical termed inulin also named alatin . this plant &# 39 ; s root is in fact the richest source of inulin . the specific breakdown of constituents are ; alanin ( c - 3 , h - 7 , no2 ); also termed amidopropionic acid ; also alant - camphor ( c - 10 , h - 18 , o ); and an oily liquid termed helenin ( c - 15 , h - 20 , o2 ). the traditional uses of the root are : diuretic , tonic , diaphoretic , expectorant , alterative , antiseptic , astringent and stimulant . the bitter active principle named helenin by korab in 1885 showed that it was a powerful bactericide in general but specifically used on the tubercle bacillus . 9 . lens esculenta ( lentil bean ). 100 mg . dried & amp ; ground bean . wolf , quoted in “ the death of cancer ,” dr . harold w . manner , 1979 discovered a proteolytic - lipolytic enzyme within this bean which specifically destroys the protein coat of tumors . the specific chemistry is unavailable . when cancer cells proliferate , the dna changes to single - stranded dna . the lens esculenta nucleases digest the single - stranded dna . also noted is the fact that proteases may facilitate metastasis of cancer cells ; lens esculenta protease inhibitors may prevent cancer metastasis , the same holds true for mung beans which may be used . 10 . lentinus edodes ( shiitake mushrooms ). 100 mg . dried & amp ; ground in its entirety . traditionally known for its antitumor effect in oriental medicine . the chemistry is unavailable . 11 . lymphoid masses bovine origin , from peyer &# 39 ; s patches of intestinal tract . 200 mg . freeze dried glands , ground . this has specific actions with increasing the immune system function and t - 4 helper cells as in helping aids patients and in all auto - immune diseases . 12 . pancreas , bovine . 50 mg . freeze dried gland ground . noted for its &# 39 ; aid in breaking down the protein coats of tumors and the dissolving of mucous . 13 . papain ( papaya enzyme ). 50 mg . extracted from dried fruit and leaves and then ground into powder . noted for its specific action in breaking down the protein coats of tumors and the dissolving of mucous . enzymatic chemistry is common knowledge . 14 . pisum sativum ( garden pea ). 50 mg . dried whole crushed pea . noted for its specific action in breaking down the protein coats of tumors and the dissolving of mucous . 15 . proanthocyanidins such as pycnogenol ( tm ) from merritime pine tree bark or grape seed extract ground & amp ; dried . 300 mg . noted as a strong antioxidant and free radical scavenger aiding in immunity . 16 . terminalia chebula ( haritaki ) 200 mg . dried & amp ; ground fruit . traditionally used in ayurvedic medicine on the digestive , excretory , nervous and respiratory systems . amongst its many uses are indicated uses in cough , asthma , parasitic infections , tumors , jaundice , heart diseases and many other conditions . the chemistry is unavailable . 17 . thymus gland , bovine origin . 150 mg . dried & amp ; ground / cold pressed . this glandular extract has specific actions regarding the immune system and enhancing it as well as increasing the t4 helper cells as in helping aids patients and all auto immune diseases . 18 . trifolium pratense ( red clover ). 50 mg . blossoms , dried & amp ; ground . traditionally used in ayurvedic medicine on the circulatory , respiratory and lymphatic systems . it is indicated for coughs , bronchitis , infections and cancer . its use as an anti - cancer agent is increased when used in conjunction with other herbs . prolonged use may cause leukopenia . 19 . ulmus fulva ( slippery elm ). 500 mg . the inner bark dried & amp ; ground . a well known natural remedy for lung conditions used for centuries . it is an emollient , expectorant , diuretic and nutritive . it aids in healing lung hemorrhages and in the restoration of mucous membranes particularly of the lungs and stomach . the constituents are primarily a mucilage containing starch rich in calcium oxalate . 20 . verbascum thapsus ( great mullein ). 200 mg . leaves & amp ; flowers dried & amp ; ground . this well known herb is used for its applications as a demulcent , emollient , antiseptic , astringent , pectoral , hemostatic , antispasmodic and anti - asthmatic amongst other uses . it is therefore specific for the lungs and other organs relative to healing mucous membranes . the leaves contain a mucilaginous bitter substance . this gum contains one to two percent of resin , a soluble bitter substance , an amoroid , tannin , saponin . the flowers contain a gum , resin , a yellow coloring principle , a green fatty substance resembling chlorophyll , a glucoside fatty matter , free phosphoric acid , uncrystalizable sugar , mineral salts mostly composed of potassium and calcium phosphates , a mucilaginous saponitic substance , a volatile oil and an astringent and sedative principles which are unidentified . the foregoing components can be administered by oral administration , in unit dosage form , such as capsules ( hard or soft ), tablets or in the form of an elixir or tea . the food supplement according to the invention can take the form of a dispersion , suspension , capsule , tablet , pill , solution , powder , tea , syrup concentrate , spray or injectionable delivery system . suitable pharmaceutical acceptable carriers , diluents and / or excipients maybe included to assist in tabletting , dissolution properties , etc . in the human adult , typical administration is one to three times daily as follows : total milligrams per capsule , tablets , or liquids is 2950 . dose at : two to three capsules , tablets , dried tea or liquid ( two teaspoons ) or any other delivery system three times per day , or as directed by your health care provider . to check for allergic reactions prior to use , open the contents of the capsule onto a drop or two of water which is placed on the wrist . then place capsule contents onto the water , rub in and wait for five minutes . remove the above . if a red rash appears this indicates a possible allergy to one of the above products . if this occurs do not use this product . this product is not to be used during pregnancy , breast feeding or self administered . if taking other medication consult with your health care provider . if a blood cell problem occurs such as a decrease in white blood cells discontinue use and seek a physicians &# 39 ; advise . optionally 100 mg . of cold pressed lung tissue of bovine origin may be added for a direct effect to aid healing lung tissue . it should be apparent that embodiments other than those specifically disclosed above come within the spirit and scope of the present invention . hence , the present invention is not limited by the above description , but , rather , by the claims appended hereto .	0
this invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . also , the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of “ including ,” “ comprising ,” or “ having ,” “ containing ”, “ involving ”, and variations thereof herein , is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . considering first fig1 - 4 , it will be seen that the game is one in which two opponents ( either two teams or two individuals ) hit a lightweight ball back and forth between them and over a net . points are scored by a team / player when the opponent fails to return the ball over the net after the ball has been hit to the opponent by the scoring team . the teams need not be evenly divided , and any reasonable number of players can participate . numerous variations on game play are contemplated . the exemplary matches are being played in a swimming pool , and the game and equipment were first developed by the inventors in a swimming pool environment . however , it is contemplated that the game can be played other than in the water , such as on a playground , in a yard , on grass , on artificial turf , on sand , on a beach , on blacktop or on any other convenient , reasonably level site where a net can be set up or the site can be divided visibly into two or more part - courts defended by two or more teams , and the players have adequate room to maneuver . the playing surface can be hard or soft . similarly , it can also be played indoors in any room large enough to allow for flight of the ball and movement of the players , such as in a gymnasium . it can also be played in water environments other than in a swimming pool , such as in shallow water at the edge of a beach or lake shore . although a net is shown in connection with the exemplary embodiment , other embodiments can be played without use of a net . indeed , other obstacles , such as walls , shrubbery , painted lines , etc . can serve to divide part - courts . moreover , games can be defined that include such objects as targets , and games can be defined that use no targets or dividers whatsoever . games can be played on a single half - court , bounded by at least one wall against which shots are directed . teams can be any convenient size , including one or more players . games can be defined and played by individuals alone , as a sort of solitaire . a template , printed on any convenient medium , such as paper or paperboard , or stored as software on a computer - readable medium , can set forth choices of alternative rules , such as court type , ball type , playing surface , part - court dividers or targets , etc . by which one or more players can agree to define their own game . rules other than the given choices can also be selected , as may be desired by the players . the equipment as used is seen in fig1 - 4 . each player has a racquet 2 whose details will be described below , which he / she uses to strike a lightweight ball 4 . in the water version illustrated , the inventors have used a beach ball , but other lightweight balls may be used . the ball for this version of the game should be large enough in diameter such that it cannot pass through the central opening in the racquet 2 . in versions of the game in which the hitting surface is more closed , for example covered by netting , strings or a planar panel of any suitable sort , the diameter of the ball may be selected so as to vary the difficulty and speed of play of the game . other games may be devised employing a ball 4 that can pass through the central opening in the racquet 2 , and where that may be desirable on the part of the serving player or the receiving player , as the game may be designed . the typical flight path of the ball 4 can be observed from fig1 - 4 . in fig1 a player on the foreground team is in the act of using a racquet 2 to strike the ball 4 to propel it over the net 6 dividing the two teams . in fig2 and 4 a player on the opposing team is preparing to receive the ball and propel it back over the net . the typical extent in height and length of the ball &# 39 ; s path is seen in fig2 and 3 for height over the net and fig4 for length of travel after passing over the net 6 . the racquet ( or paddle , or , when playing the game in water , a “ waddle ”) is illustrated in a number of aspects in fig5 - 18 . fig5 , 6 and 16 show complete racquets 2 , which are formed of a hitting portion 8 and a handle 14 . the handle is substantially rigid . the hitting portion has less rigidity than the handle , but is still stiff enough to be able to hit the ball 4 firmly . the hitting portion 8 is formed of an elongated plastic foam tube which has an axial central opening 28 running through it . any suitable foam material may be used . the exemplary material is water - tolerant foam used for such swimming pool products as the popular “ noodle ” or “ water worm ” floating pool toys . the foam tube has an elongated configuration similar to such toys . the foam should be sufficiently stiff to resist crushing when striking the ball 4 , but still be soft enough so that if one player accidentally hits another player with a racquet when swinging at the ball , the latter player will not be injured . inside the axial central opening 28 of the hitting portion 8 is positioned a piece of stiff tubing 10 , for example polyethylene tubing , as seen in fig1 . the tubing 10 should have a length essentially equal to the length of the hitting portion , i . e ., the length of the foam tube less the ends 24 of the tube that are used to form the handle 14 of the racquet . the tubing 10 provides the necessary stiffness to the hitting portion 8 of the exemplary embodiment of the racquet . the tubing 10 is attached to a tubular handle core 12 as seen particularly in fig7 , 11 and 17 . the core 12 may be a solid rod or a stiff tube . a hole 20 can be drilled through the core 12 near one end and the tubing 10 is passed through the hole . in the exemplary embodiment , approximately equal lengths of tube 10 extend on each side of hole 20 , as seen in fig6 , 8 and 9 . the tubing 10 is then secured to core 12 as by tying with thin tubing 18 . other means of securing the tubing 10 to core 12 may also be used , including but not limited to suitable adhesives or tying with other media such as monofilament fishing line . any other suitable reinforcing and stiffening system can be used instead of the one herein described . in the exemplary embodiment , the end portions 24 of the tubing 10 have one side cut away along the central opening 28 so that the remaining portion of the central opening appears as a groove 26 on the inside of each end portion 24 , as seen in fig1 . this will accommodate the handle core 12 when the handle 14 of the racquet is formed . once the tubing 10 is positioned within the foam material of the hitting portion 8 as seen in fig1 , 11 and 12 , cord 30 is used to pull the two end portions 24 together with the handle core 12 between them , as seen in fig1 and 17 . the cord 30 is tied off at one end at 32 as an anchor . holes 34 are drilled in the handle core 12 and the cord 30 is threaded though those holes 34 and through holes in the foam material of the ends 24 . since the cord material is moderately stiff , no holes need to be cut in the foam ; rather the free end of the cord 30 can simple be pushed through the foam and it will create its own hole for passage . in the exemplary embodiment , cord 30 is a single long cord which ends up being wrapped spirally around the handle cord 12 and foam ends 24 to pull them together and form the handle , as seen in fig1 and 17 , but alternatively several individual cords as indicated at 30 , 30 ′ and 30 ″ in fig1 and 14 may be used and the handle wrapped circumferentially rather than spirally . other suitable handle constructions can be used , as well , some of which are described further below . according to the exemplary embodiment , a leash or lanyard 16 will be attached to the handle core 12 , as by passing the leash cord through a hole 22 drilled into the outer end of the handle core 12 , as seen in fig6 and 14 , and then joining the two free ends of the leash cord . the leash loops over a player &# 39 ; s wrist during a game and prevents the player from dropping the racquet , or accidentally flinging the racquet across the court at the opposing team , if it should slip out of his / her hand during play . once the interior of the handle 14 according to the exemplary embodiment is pulled together and tied off , as shown in fig1 , it is wrapped with an appropriate tape 36 , which is can be a rubber or other elastic adhesive tape , as shown in fig1 . the tape 36 also can extend past the ends 24 of the foam and cover the handle core 12 all the way to its outer end , leaving only a small opening for the leash 16 to extend outwardly ; all as shown in fig1 . alternatively a second tape 36 ′ may be used to cover the outward extension of the handle core 12 , as shown in fig1 . the visible portions of the racquet 2 — i . e ., the hitting portion 8 and the tape covering 36 / 36 ′ of the handle — can be brightly colored , as indicated in 1 - 6 , 15 - 16 and 18 , both for an attractive appearance and also to make them readily visible during play so that players will be alerted to stay clear of a player who is using his / her racquet to serve or hit a ball . it is contemplated that sets of racquets will be commonly comprised of two different color schemes , so that each of two opposing teams will have a uniform color set for its players which contrasts in color with the racquets of the opposing team . the overall size of the racquets is readily apparent by comparison of the racquet sizes to the players in the matches illustrated in fig1 - 4 and similarly by comparison with the size of the balls in those figs . typically the racquets will be about 12 - 24 inches ( 30 - 60 cm ) across , although as evident in the figs ., the racquets are more tear - drop shaped than circular , and the hitting portion 8 foam materials will be about 3 - 6 in ( 7 . 5 - 15 cm ) wide . the handles 14 will be long and wide enough to be easily gripped by players , usually about 6 - 9 in ( 15 - 22 . 5 cm ) long by about 1 - 2 in ( 2 . 5 - 5 cm ) wide . smaller racquets with shorter handles may also be constructed for use by children playing the game . several variations are now described , the features of which are interchangeable under suitable circumstances to an extent that will be understood by the reader . in the embodiment shown in fig1 , the handles 1901 of the paddles 1900 house spring - actuated ball launchers 1902 that may be used to serve a ball 1903 , or at another time that may be desired during a game . this embodiment includes an elastic covering 1904 of any suitable mesh , woven or other material over the head of the racquet , providing a suitable hitting surface for smaller balls 1903 and greater return force . in the embodiment shown in fig2 , the handles 2001 of the paddles 2000 also serve as small storage containers 2002 , having screw - off or snap - off lids 2003 . lid 2003 can alternatively attach with a bayonet closure . lid 2003 can also include a lock feature , such as any suitable or known key lock or combination lock , so as to secure valuables stored therein . such storage containers 2002 can hold small objects such as the player &# 39 ; s cabana key , change , or even a deflated ball 2004 with which the game may be played . this embodiment includes a mesh covering 2005 over the head of the racquet , although other coverings including woven or other suitable materials could be used . embodiments of the invention as shown in fig2 , 22 and 23 can be made using materials that glow in the dark , change color with exposure to temperature changes , heat or cold , or moisture , or are printed with entertaining or attractive patterns , colors or other features . of course these features can be combined or interchanged . as shown in fig2 , when a suitable cover 2201 is provided for the racquet head , it can be equipped with a tethered ball 2202 , so single player games can also , optionally , be played . as shown in fig2 , the handle 2301 or hitting portion 2302 of the paddle 2300 can incorporate any suitable sound generating devices or sensors ( concealed in the handle or hitting portion ), which may be mechanical or electrical in nature . a sound generator in the handle might make a playful sound , such as “ boing ,” each time the ball 2303 is struck with the paddle . the sound generator can be a simple tubular bell , or can be any suitable electronic sound recording and reproducing device , e . g . a known solid state recording and reproducing device in which one or more sound clips are stored and played back on impact . in embodiments with such a solid state recorder , the player can record one or more short phrases , one or more to be played back on each impact , for example at random . an impact sensitive mechanical or electrical sensor in the handle or hitting portion 2302 might count the number of times the ball 2303 is struck between resets . such a counter might be useful , for example , in connection with single player games incorporating the cover and tethered ball shown in fig2 . alternatively , the sensor could use a light beam or other suitable means to detect the passage of a small ball through the opening in the racquet and count such passages or make a suitable noise . it has been described previously , herein , how the materials , characteristics thereof and shapes of the racquet and its parts , and the ball , may be varied to achieve different use and playing characteristics . additionally , the materials , characteristics thereof and shapes of the racquet , and the ball , may be varied to vary the speed and difficulty of games played therewith . for example , to create faster game play , a smaller , harder ball can be used with racquets having stiffer , more solid head coverings , while slower game play can be achieved using a large , light ball such as a beach ball , together with an uncovered or mesh - covered racquet . the shape of the racquet can be varied to achieve other goals or effects . varied shapes are achieved by varying the shape of the semi - rigid or rigid support to which the “ noodle ” material or the like will conform , or by employing multiple elements of supported or unsupported “ noodle ” material , which in combination form the desired shape . examples of such shapes include a hand or hand - like shape , or a heart shape . combinations of shapes with other game elements described above will now also be apparent to the reader . for example , a hand - shaped racquet might be combined with a sound generator that produces a funny “ boink ” or slapping sound upon each impact . as in the case of other examples given above , the size and shape of any opening formed by the racquet shape selected can be varied to vary the difficulty and speed of game play , or even to vary whether the game is based on hitting a ball or on passing the ball through such an opening in the racquet to score . the term “ ball ” is used here in a very broad sense . although the exemplary embodiments described so far use conventional balls of generally spherical shapes , other target objects can serve as the “ ball .” for example , a badminton birdie , as mentioned in the background , or other suitable birdie - like object can be used wherever a “ ball ” is mentioned . objects of other , arbitrary shapes can also be used . for example , a “ ball ” shaped like a rocket ship or airplane can be used , or even a “ ball ” shaped like a conventional football or other conventional ball of unusual shape . having thus described several aspects of at least one embodiment of this invention , it is to be appreciated various alterations , modifications , and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and scope of the invention . accordingly , the foregoing description and drawings are by way of example only .	0
in contrast to the conventional nuclear reactor coolant pump impeller / shaft assembly described above , and shown in fig2 and 3 , fig4 illustrates the preferred embodiment of the present invention . more particularly , the nuclear reactor coolant pump 60 of the present invention generally includes a housing or casing ( not shown in fig4 ), which is unchanged from the conventional housing 34 shown in fig2 and a shaft 64 located axially of the housing for rotation therein . the shaft 64 also includes a thermal sleeve , which is omitted from fig4 for purposes of clarity in describing the present invention . an impeller key 66 is interposed between the shaft 64 and an impeller or rotor 72 . the impeller 72 generally includes a central , cylindrical hub 73 to which is attached a plurality of blades or fins ( not shown ). the impeller 72 is also heated during installation to create a relatively tight tapered fit on the shaft 64 . the tapered mating area between the impeller 72 and the shaft 64 is indicated by reference numeral 75 . an impeller nut 68 and a lockbolt 70 are used to fixedly attach the impeller 72 to the shaft 64 . more particularly , the impeller nut 68 has left - hand threads 69 which mate with the left - hand threads 71 formed in the shaft 64 . the lockbolt 70 is inserted through a hole 77 formed centrally in the impeller nut 68 and anchors in the shaft 64 via right - hand threads 79 . the lockbolt 70 and impeller nut 68 are then welded together after assembly to secure the impeller nut 68 and the impeller 62 , as discussed above . the impeller nut 68 includes at least one passageway 78 formed therein . preferably , the at least one passageway 78 is formed in hole 77 between lockbolt 70 and impeller nut 68 and extends into contact with the exterior of the shaft 64 about the exterior of the impeller nut 68 . the preferred number of the at least one passageway 78 is two ; however , other numbers of passageways 78 are contemplated by the present invention . alternatively , a portion of the at least one passageway 78 can be formed internally of the impeller nut 68 , as indicated by reference numeral 78 &# 39 ; in fig4 . in addition , at least one other passageway 78 &# 34 ; can be formed , for example , skew to the passageway 78 &# 39 ;. a first plurality of conduits 80 is formed in a first area 82 of the impeller nut 68 and is in fluid communication with an end of the passageway 78 . the preferred number of the first plurality of conduits 80 is six , although the present invention contemplates any practicable number of conduits . the preferred diameter of each of the first plurality of conduits is approximately 1 / 2 inch . the impeller nut 68 also includes a second plurality of conduits 84 formed in a second area 86 thereof in fluid communication with the other end of the passageway 78 . the preferred number of the second plurality of conduits 84 is four , although any practicable number can be used . the preferred diameter of each of the second plurality of conduits is 3 / 4 inch . the first plurality of conduits 80 , passageway 78 , and second plurality of conduits 84 must be of a sufficient size so that flow resistance in the form of friction between the water and conduits 80 , passageway 78 , and conduits 84 can be overcome . proper sizing of the above - referenced passages guarantees a large enough flow to ensure that heat transfer from the water to the shaft interior is virtually independent of any external influences . an important consideration in choosing the number and location of passageways 78 is effecting balance in the pump 60 during rotation of the shaft 64 and the impeller 72 . accordingly , equally spaced passageways 78 formed in opposing relation in the impeller nut 68 are preferred . the same consideration regarding &# 34 ; balance &# 34 ; is pertinent to formation of the first and second plurality of conduits 80 and 84 , respectively , in the impeller nut 68 . the pump 60 , of course , also includes a fluid inlet 74 and a fluid outlet 76 . coolant enters the fluid inlet 74 and circulates around the impeller 72 as indicated by arrow &# 34 ; c &# 34 ;. in addition , an auxiliary flow , as indicated by arrow &# 34 ; d &# 34 ;, is created through the impeller 72 . in addition , because of : ( 1 ) the difference in the diameters and numbers between the first plurality of conduits 80 and the second plurality of conduits 84 ; ( 2 ) the fact that the pump 60 contains a continuous supply of fluid coolant , i . e ., there are no voids or air gaps in the pump 60 ; and ( 3 ) the relatively long distance the fluid coolant must travel through the passageway ( s ) 78 , 78 &# 39 ; and 78 &# 34 ;, a pumping action is effectively created . more particularly , coolant is effectively pumped out of the larger , second plurality of conduits 84 , through the path indicated by arrow &# 34 ; e &# 34 ; within the passageway ( s ) 78 , 78 &# 39 ; and 78 &# 34 ; of the impeller nut 68 , and in through the first plurality of conduits 80 from the main flow of coolant indicated by arrow &# 34 ; c &# 34 ;. it is to be understood that the above - described pumping action moving the coolant through the combination of conduits 80 and 84 , and the passageway ( s ) 78 , 78 &# 39 ;, 78 &# 34 ; is exclusive of and is unaffected by the traditional pumping action of the coolant pump 60 across the impeller 72 . the temperature of the impeller 72 during operation of the coolant pump 60 of the present invention is again about 550 ° f . on the other hand , due to the pumping of coolant through the passageway ( s ) 78 , 78 &# 39 ; and 78 &# 34 ; formed in the impeller nut 68 and into contact with the shaft 64 , the temperature of the shaft 64 is made close or equal to that of the impeller 72 . accordingly , no thermal imbalance exists between the impeller 72 and the shaft 64 . therefore , the potential for expansion of the impeller 72 relative to the cooler shaft 64 and the possible loosening of the impeller 72 from its tapered fit with the shaft 64 is eliminated . finally , the traditional , additional stress upon the impeller key , the impeller nut and the lockbolt caused by loosening is eliminated . accordingly , by providing a fluid passageway into contact with the shaft , the impeller / shaft assembly compliance is improved so that thermal transients ( generally impeller / shaft temperature differentials ) have a reduced impact on impeller / shaft interface pressure relative to the conventional impeller / solid shaft assembly with the same torque capacity at 70 ° f ., as shown in the following tables i and ii . table i______________________________________conventional impeller / solid shaft assembly - temperatures observed during steady stateand end of ramp ( e . o . r .) heat - up conditions 557 ° f . 557 ° f . * steady state e . o . r . heat up______________________________________impeller 548 . 5 ° f . 540 . 0 ° f . hub averagetemperatureshaft average 537 . 6 ° f . 511 . 5 ° f . temperaturehub / shaft δ t 10 . 9 ° f . 28 . 5 ° f . ______________________________________ * 100 ° f ./ hr . ramp . table ii______________________________________the present invention ( for the same stated conditions as in table i ) 557 ° f . 557 ° f . * steady state e . o . r . heat up______________________________________hub / shaft δ t 4 ° f . 7 ° f . ______________________________________ in addition , stress levels on the impeller hub 73 and shaft 64 are reduced according to the present invention , as shown in the following table iii . table iii______________________________________conventional impeller / solid shaft assembly versus the presentinvention : comparison of impeller hub and shaft maximumstress intensities for assembly conditions and identical e . o . r . heat up torque capacities ( stress intensities at 70 ° f .) hub stress shaft stresshub / shaft model intensity * intensity ** ______________________________________conventional 19 , 243 psi - 10 , 535 psiimpeller / solidshaft assemblypresent invention ( solid section of shaft ) 12 , 693 psi - 6 , 716 psi ( passageway section 9 , 597 psi - 8 , 171 psiabout shaft ) ______________________________________ * at hub bore surface ** at shaft center or inside diameter the present invention can also be used to improve an existing conventional , coolant pump impeller / shaft assembly without major modifications . that is , material can be removed from a conventional solid shaft 36 and a new impeller nut 68 and lockbolt 70 can be installed as taught by the present invention . impeller / shaft interference fit can then be increased to bring the 70 ° f . torque capacity up to the original value ( before modification ) without an increase in impeller hub stress levels . hot torque capacity will also increase significantly . the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention and the appended claims and their equivalents .	5
the use of the term “ approximately ” provides an additional determined range . the term is defined in the following manner . the additional range provided by the term is that of approximately + 10 %. as an example , but not limited to , is it states it is “ approximately 25 °”, the exact range lies between 23 . 5 to 27 . 5 °. the present invention refers to doors or covers for household appliances . specifically “ doors or covers ” shall be mentioned from here on after solely as “ doors 1 ”, however it should not be limited by any reason to doors for this invention , and it should be considered that the same characteristics are applicable for covers . the preferred household appliance for the present invention is household dryers 2 , such as can be seen in fig1 . however , other household appliances which use heat as their source of heating or drying can be included , such as ovens , dishwashers and industrial clothes dryers . additionally , the materials used to manufacture the door of the present invention can be substituted depending on the household appliance and depending on the needs of the operator . for example , plastic parts used in the present invention can be substituted by metal parts if it is foreseen that the door will be subject to temperatures higher than the smelting temperature of certain plastics . the fastening means used in the present invention can be those that exist in the field , such as coiled , for example , like in conventional screws . other fastening means available can be used , so that the type of fastening means is not seen as limitative . the following description makes general reference to fig2 through 5a . in the present invention , a door for household appliances is made known , preferably one for dryers 2 . the dryers 2 can be front loading , such as the one shown in fig1 , or rather can be top loading or inclined as was known in previous art . the main parts of the door 1 are an inner frame 10 , an outer frame 20 and a tempered glass pane 3 between the inner frame 10 and the outer frame 20 . fig2 and 3 are views in explosion which show the outer frame 20 , the inner frame 10 and the tempered glass 3 and the union between all these parts . such as its name denotes , the outer frame 20 , when the dryer door 1 is closed is outwardly oriented in relation to the dryer 2 , while the inner frame 10 is inwardly oriented in relation to the dryer 2 when the door is on a closed position . fig2 and 3 show the majority of the components necessary for the first embodiment . thus , the inner frame 10 , the outer frame 20 and the tempered glass pane 3 which is found between the inner frame 10 and the outer frame 20 can be seen . both the inner frame 10 as well as the outer frame 20 has a window 19 , 23 in a substantially central part of said frames 10 , 20 . the inner frame 10 has a first seal 11 applied which faces inwardly unto the dryer 2 when the door is oriented in a closed position , that is , the first seal 11 is placed on the inner face 14 of the inner frame and a second seal 12 is placed on the outer face 15 of the inner frame , same which faces the dryer &# 39 ; s 2 exterior when the door is oriented in a closed position . the seal 11 is placed over a gutter which is found in the inner frame 10 . the tempered glass 3 , which is of a substantially lesser size than the inner frame 10 and of a substantially greater size than the window 19 of the inner frame 10 , is placed over a second seal 12 , while there are at least four retainers 13 fastened unto the inner frame 10 by means of fasteners 4 . the retainers 13 press the tempered glass 3 to the inner frame 10 and more specifically , the retainers cause the tempered glass 3 to be pressed with a force in the direction of the inner frame 10 and against as second seal 12 . the retainers 13 are preferably steel . given that the retainers 13 will usually be made of a material which can scratch the tempered glass 3 , a packaging 16 is provided per each retainer 13 . additionally , said packaging can also prevent noise by vibration between the glass 3 and the retainer material 13 , decreasing in the same way the magnitude of thermal shock between the glass 3 and the retainer 13 , which as previously mentioned , is preferably made of steel . the packaging will have the same length or be greater than the length of the retainer 13 to avoid contact between the retainer 13 and the tempered glass 3 . the packaging 16 surrounds the tempered glass 3 at least partly . the compression forces between the inner frame 10 and the tempered glass 3 , specifically between the tempered glass 3 against the second seal 12 in light of the pressure applied by the retainers 13 against the tempered glass 3 , and subsequently the inner frame 10 against the dryer &# 39 ; s 2 cabinet , specifically the first seal 11 against the dryer &# 39 ; s 2 cabinet , avoids air leaks from the dryer &# 39 ; s 2 interior to the outside and guarantees a uniform heat seal in the dryer &# 39 ; s 2 inner part . such as is subsequently demonstrated in fig1 and 16a , an outer frame 20 , capable of receiving and fastening to a handle 21 mechanically assembled to the outer frame 20 , is fastened to the inner frame 10 by means of the fastening means distributed along the length of and close to the border of the inner frame 10 and are received by assembly holes 34 on the inner frame 10 and receptor cavities 65 , possibly coiled , on the outer frame 20 . the outer frame 20 covers at least part of the tempered glass 3 , and thus also covers the retainers 13 , packaging 16 and second seal 12 among others . fig4 and 4a show how the tempered glass 3 is fastened unto the inner frame 10 by means of the retainers 3 . the retainers 13 are fastened by means of fasteners 4 against the inner frame 10 . given that the retainers 13 , by means of the packaging 16 ( if they are present ), fasten the tempered glass 3 ; the tempered glass 3 creates pressure against the inner frame 10 . fig5 shows a cross section of the assembly between the inner frame 10 and the tempered glass 3 , while fig5 a shows in detail , what is shown in fig5 . fig5 a shows that a second seal 12 makes pressure against the tempered glass 3 . it also shows the relationship between the tempered glass and a fifth part 54 of the retainer 13 . once assembled , between the tempered glass 3 and at least one part of the outer face 15 of the inner frame 10 , a hollow space is left eh 1 with the end purpose of allowing the flow of hot air and thus avoiding the door &# 39 ; s 1 temperature to increase . in fig5 b a second embodiment can be seen . specifically , in the second embodiment , several pieces can be dispensed with . specifically , the retainers , the corresponding packaging for the retainers , the fastening means related to the retainers and the second seal , can be dispensed with . specifically , over a gutter 30 of the inner frame , a constant silicon based strip 80 is provided . the strip has a width of approximately between 0 . 5 centimeters to 10 centimeters , and is deposited at a constant velocity approximately varying between 120 mm / second to 180 mm / second , preferably approximately between 135 mm / second and 160 mm / second and even more preferably approximately between 145 mm / second and 152 mm / second . the silicon &# 39 ; s exit pressure varies approximately between 80 and 92 psi , more preferably between approximately 84 to 90 psi , and even more preferably approximately between 84 to 87 psi . after the strip 80 deposit over the gutter 30 , the tempered glass 3 is deposited over the outer face 15 of the inner frame , specifically over the strip 80 , said deposit being at a constant pressure varying between approximately 0 . 001 kg / cm2 to 0 . 1 kg / cm2 . the temperature at which this deposit needs to be carried out should be room temperature , preferably approximately at 25 ° c ., with a relative humidity varying approximately between 40 to 55 %, more preferably between approximately 45 to 52 % and even more preferably between approximately 48 to 51 %. fig6 is a view of the outer face of the outer frame 20 . similarly , in the figure , the handle 21 to said outer frame 20 can be identified . fig7 is a lateral view of both the inner frame 10 as well as the outer frame 20 . the hinges 22 can be identified , which by a means of fastening , shall be fastened to said frames 10 , 20 . such as can be seen in fig8 and 8a , on the outer frame 20 , specifically on a lateral 24 side of the outer frame 20 , two hinges 22 are placed . the hinges 22 are fastened to the lateral side 24 of the outer frame 20 by means of fastening means 4 . when they are in mounted position , the hinges 22 of the door will be near the dryer &# 39 ; s 2 cabinet , while the handle 21 of the outer frame will be distant from the dryer &# 39 ; s 2 cabinet . the hinges 22 can be seen with greater detail in fig8 a and 11a . the hinges 22 comprise two parts 25 , 26 . the first part 25 is fastened to the door by fastening means 4 and by two holes 5 in said first part , holes 5 which are collinear with cavities 5 on the lateral side 24 of the outer frame 20 . on the other hand , the second part 26 , which is fastened to the first part 25 , is composed of two holes 6 , where each one of the two holes 6 is composed of two forms substantially circular , where a first substantially circular form is of a lesser diameter than the second substantially circular form . both holes are substantially opposed , that is , while as an example , in the upper hole 6 the first form is in the upper part and the second form is in the lower part , in the lower hole , the second form is in the upper part and the first form is in the lower part . the inner frame 10 also has receptor cavities 9 to receive the first part 25 of the hinge . specifically , the inner frame 10 has receptor cavities 9 in both of its lateral parts , which are substantially opposite between them . this can be seen in fig3 . such as can be seen in fig8 and 8b specifically for the first part of the plate - 17 and fig8 c , in conjunction with fig1 specifically for the second plate - 18 , where a first plate 17 with two holes and a second plate 18 with three holes are fastened to the inner frame 10 in a plate receptor space 48 . both plates are fastened to the inner face 14 , specifically on the lateral part 41 of the inner face 14 of the inner frame 10 . two holes 5 on the first plate 17 , as well as two holes 5 on the second plate 18 are provided so that the fastening means 4 will fasten the plates 17 , 18 against the door &# 39 ; s inner frame 10 . specifically , each one of the holes 5 in the first and second plate 17 , 18 previously mentioned is collinear with a hole of the lateral part 41 of the inner face of the inner frame 10 . a third hole 7 of the second plate 18 is provided so that a safety latch 42 be fastened to the door assembly . the second plate 18 and the safety latch 42 can be seen in greater detail in fig8 c and 14 . specifically , the third hole is composed by two substantially parallel sections 43 and one substantially transversal section 44 . the safety latch 42 is composed of legs 45 capable of crossing the two substantially parallel sections 43 . the safety latch 43 is also composed of at least two resilient parts 36 on each one of the legs 45 . when the legs 45 are crossing the substantially parallel sections 43 , the resilient parts 46 are compressed reducing the width of the safety latch 42 . when the legs 45 have completely crossed the substantially parallel sections 43 , the resilient parts 46 are expanded jamming the safety latch 42 to the plate 18 . the hole 8 is set to receive at least a part of the safety latch &# 39 ; s legs 45 . finally , the safety latch 42 comprises a head 47 which has a substantially oval shape and which closes the door 1 with pressure force to the dryer &# 39 ; s 2 cabinet . fig9 shows the outer face 15 of the inner frame 10 . a gutter 30 can be seen which runs along the length and the width of the inner frame 10 , over which the second seal 12 or silicon strip 80 is placed . along the length of the gutter , grooves 31 are seen over which , the seal anchors 32 , such as can be seen in fig1 and 10a , are inserted . this will allow proper fastening and will avoid the detachment of the second seal 12 in relation to the gutter 30 and more generally regarding the inner frame 10 . alternatively , if the silicon strip 80 is installed over the gutter 30 , then the grooves can be excused . similarly , fig9 shows that in the inner frame 10 , specifically close to the border between the front wall and the lateral wall , a series of compression retainer holes 33 are provided as well as assembly holes 34 . at least four compression retainer holes 33 are destined to receive and fasten , by means of fastening means 4 , the retainers 13 , and as a consequence , the tempered glass 3 . on the other hand , at least six assembly holes 34 are destined to receive and fasten , by means of fastening means the outer frame 20 . fig1 is a detailed view of the retainers 13 . the retainer 13 is made up of five distinctive parts . a first part 50 contains at least two holes 5 which shall receive locators of the outer frame 20 . a second part 51 is substantially transversal to the first part . a third part 52 substantially parallel to the first part 50 and consequently substantially transversal to the second part 51 , which contains at least one hole 5 placed there to receive a fastening means which crosses the compression retainer hole 33 on the inner frame 10 . thus , the hole 5 on the third part 52 and the compression retainer holes 33 on the inner frame 10 are collinear when the door 1 is mounted . a fourth part 53 which is substantially transversal to the first and third parts 50 , 52 is substantially parallel to the second part 51 . finally , a fifth part 54 which is substantially parallel to the first and third part 50 , 52 , is placed to press the tempered glass pane 3 by means of the packaging 16 . upon fastening the retainer 13 to the inner frame 10 by means of a means of fastening 4 , specifically by means of the hole 5 on the third part 52 and the compression retainer hole 33 on the inner frame 10 , the fastening means 4 tends to bring near the retainer 13 to the inner frame 10 , creating a pressure force between the fifth part 54 and the packaging 16 , and consequently between the fifth part 54 and the tempered glass pane 3 . the packaging 16 is shown in a detailed view in fig1 . the packaging 16 is configured to embrace at least partly , the border of the tempered glass pane 3 . so that , the packaging 16 , has a first section 60 , a second section 61 substantially perpendicular to the first section 60 , and a third section substantially parallel to the first section 60 and substantially perpendicular to the second section 61 . thus , a form in a substantially “ c ” section is provided for the packaging 16 , even though the shape of the packaging can acquire other shapes already known and used in previous art . fig1 and 15 show a front view and a back view , respectively , of the outer frame 20 , while fig1 and 16a show both frames 10 , 20 and the manner in which they are joined . on the outer face , specifically on one of the two lateral parts 27 of the outer face of the outer frame 20 , there is a hollow space provided 28 to allow it to mechanically receive the handle 21 . on the inner face of the outer frame 20 , a locator 29 is provided per each hole 5 present in the first part 50 of the retainer 13 . the locators 29 are capable of penetrating said holes 5 in the first part of the retainer for an easy assembly between the outer frame 20 and the assembly of the inner frame 10 and the tempered glass 3 . in a similar manner , the outer frame 20 is provided with receptor cavities 65 , same which can be threaded and which are set there to receive the fastening means 4 which emanate and penetrate the assembly hole 34 of the inner frame 10 . thus , each assembly hole 34 of the inner frame 10 is found collinear to a receptor cavity 65 of the outer frame 20 . thus , a fastening means 4 penetrates the assembly hole 34 and the receptor cavity 65 and fastens both frames 10 , 20 . fig1 and 18 show the handle 21 form a back and front view , while fig1 shows a cross section of a substantially central part of the handle 21 being assembled in the hollow space 28 over the lateral part 27 of the outer frame 20 . on the back wall 70 of the handle 21 , there are at least three fasteners 74 in a substantially hook - like shape . the hooks of the three fasteners 74 are substantially in the same direction , that is , in a direction substantially towards the door &# 39 ; s 1 interior . equally , on the lower wall 71 , there are at least three fasteners 75 in a substantially hook - like shape . the hook of the first fastener 75 ′ is in a substantially lower direction regarding the door 1 . the hook of the second fastener 75 ″ is in a substantially opposed direction than that of the first fastener 75 ′. the hook of the third fastener 75 ″′ is in a substantially outwardly direction regarding the door 1 . such as shown in fig1 , the hollow space 28 provided on the lateral side 24 of the outer frame 20 , is composed of two transverse walls 38 , 39 , where each wall is provided with perforations 37 which receive said fasteners 74 , 75 . the handle is composed of the back wall 70 , a lateral wall 72 , a lower wall 71 as well as an upper wall 73 . to assemble the handle 21 to the hollow space 28 of the outer frame 20 , the fasteners 74 are inserted to the back wall 70 within the wall perforations 38 of the hollow space , that is , the handle 21 is inserted in a direction substantially towards the door &# 39 ; s 1 exterior ; followed by , the fasteners 75 are placed in the perforations of the wall 39 and a push force is exerted towards the doors &# 39 ; 1 interior , until the hook of the fasteners 75 is fastened to the ends of the wall perforations 39 . in this way , the handle 21 is fastened to the hollow space 28 and more specifically to the outer frame 20 . the assembly method of the first embodiment begins by mechanically assembling the handle 21 to the hollow space 28 of the outer frame 20 . subsequently , it is placed on the holes 5 of the first part 50 of the retainer 13 on the locators 29 of the inner face of the outer frame 20 . the packaging 16 is placed on the borders of the tempered glass pane 3 , borders of tempered glass pane 3 which subsequently are allowed to rest on the fifth part 54 of the retainer 13 . both seals are applied 11 , 12 on the respective faces 14 , 15 of the inner frame 10 . the inner frame 10 is allowed to rest on the tempered glass pane 3 ; specifically the second seal 12 is allowed to rest the tempered glass pane 3 . the co linearity between the hole 5 of the second part 52 of the retainer is checked against the compression retainer hole 33 of the inner frame 10 . a fastening means 4 penetrates the compression retainer hole 33 of the inner frame and the hole 5 of the second part of the retainer 13 . by this fastening means , the co linearity between the assembly hole 34 of the inner frame 10 and the receptor cavity 65 of the outer frame is assured . additionally , by way of this fastening means , a seal has been created between the second seal 12 and the tempered glass pane 3 . subsequently , a fastening means 4 penetrates the assembly hole 34 of the inner frame 10 and the receptor cavity 65 of the outer frame 20 . the three relevant parts of the door 1 assembly have been fastened between themselves . the hinges 22 are placed on the door assembly , in view of a fastening means 4 , which penetrates the holes 5 provided on the lateral part of both frames 10 , 20 , same which are collinear . both plates 17 , 18 are fastened unto the receptor space 48 by means of the respective receptor cavities . the door 1 assembly is mounted unto the dryer &# 39 ; s 2 cabinet by means of the first part 25 of the hinge 22 . the assembly method of the second embodiment begins by mechanically assembling the handle 21 to the hollow space 28 of the outer frame 20 . subsequently , over the gutter 30 of the inner frame 10 , the silicon strip 80 is placed under the conditions previously mentioned . the tempered glass pane 3 is rested on the silicon strip 80 of the inner frame 10 and is allowed to be cured according to the conditions previously described . the first seal 11 is placed over the inner face 14 of the inner frame 10 . by means of this curing a seal has been formed between the strip 80 and the tempered glass pane 3 . an outer frame 20 is placed over the inner frame 10 , thus assuring co linearity between the assembly holes 34 and the receptor cavities 65 . subsequently , a fastening means 4 penetrates the assembly hole 34 of the inner frame 10 and the receptor cavity 65 of the outer frame 20 . the three relevant parts of the door assembly 1 have been fastened amongst themselves . the hinges 22 are placed on the door assembly , in view of a fastening means 4 , which penetrates the holes 5 provided on the lateral part of both frames 10 , 20 , same which are collinear . the latch 42 is placed on the plate 18 . both plates 17 , 18 are fastened unto the receptor space 48 by means of the respective receptor cavities . the door 1 assembly is mounted unto the dryer &# 39 ; s 2 cabinet by means of the first part 25 of the hinge 22 . the following description shall reference fig2 through 33 . fig2 shows a dryer 2 with a door 1 which opens by rotating on an axis generally in a first direction . fig2 is a detailed view of the section shown in fig2 . as a first step , and in a way to ensure the door reversal , it is checked that the dryer be unplugged from the power source . the door 1 is rotated approximately 90 degrees in relation to the door &# 39 ; s 1 closed position and specifically in relation to the front wall 90 of the dryer &# 39 ; s 2 cabinet . the fastening means 4 which are found on the lower part of the first part 25 are removed from each one of the hinges 22 . these fastening means are inserted into approximately half of the upper holes are inserted per each hinge 22 on the opposite side of the dryer &# 39 ; s 2 mouth 91 . the fastening means 4 of both hinges 22 are detached . the door 1 is unlocked raising the door in an upwards direction and afterwards toward the outside . the fastening means which remain on the side of the dryer &# 39 ; s 2 mouth 91 are removed , where the door 1 has just been removed . with the door 1 assembly facing downwards , that is , the outer frame 20 faces the floor , on a flat and protected surface , the fastening means 4 are removed from the assembly holes 34 and the receptor cavity 65 , as well as the fastening means 4 which join the hinges 22 with the frames 10 , 20 are removed . the outer frame 20 is removed from the inner frame 10 by pulling the outer frame 20 from the inner frame 10 . the outer frame 20 is rotated 180 degrees in relation to the inner frame 10 . the exterior panel 20 is placed in such a way that the assembly holes 34 and the receptor cavities 65 be collinear . the fastening means 4 are secured once again to fasten the hinges 22 to the frames 10 , 20 on the lateral sides of the frames , being careful that the second part 26 is close to the door assembly 1 and that the first part 25 is free temporarily . the fastening means 4 are placed once again in such a way that they penetrate the assembly holes 34 and the receptor cavities 65 . both plates 17 , 18 are removed from the inner frame 10 and their position inverted . they are fastened once again to the plates 17 , 18 . they are inserted into the hole 6 of the first part 25 in the fastening means previously set on the opposite side of the dryer &# 39 ; s 2 mouth 91 where the door assembly 1 was originally set , and the door is allowed to fall . the door is secured to the dryer &# 39 ; s 2 cabinet and the remaining fastening means are installed . such as was previously stated , the door 1 of the present invention is targeted for household appliances . the preferred household appliances of the present invention are dryers 2 , such as can be seen in fig1 . however , other household appliances which use heat as their means of firing or drying may be included , such as ovens , dishwashers and industrial textile dryers . alterations to the structure described in the present , can be foreseen by those experts in the field . however , it should be understood that the present description is related with the preferred embodiments of the invention which is for the sole purposes of illustration and should not be construed as a limitation of the invention . all modifications which do not depart from the spirit of the invention are included within the body of the attached claims .	4
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . fig1 shows a sketch illustrating a scenario for the mobile use of location - dependent services . a mobile computer 101 , e . g . a personal digital assistant ( pda ), is operated by a user 109 in a mobile radio network , indicated by the radio interfaces 104 and 108 . in this case , the mobile computer 101 accesses a network , in particular a network group 110 , for example the internet . in the “ internet as network group ” scenario , it is customary for a subscriber , in this case the mobile computer 101 , to access a service provider ( provider ) on behalf of the network group 110 . in this case , the service provider 110 responds , in particular , to the query 104 from the mobile computer 101 and transmits an appropriate response 108 back to the mobile computer 101 . in fig1 , the location of the computer 101 is ascertained ( in block 105 , 106 ) and , on the basis of this location , particular services 107 are offered . data 103 which is particularly dependent on the location of the computer 101 may be : travel information , emergency services ( pharmacies , doctors ), tourist attractions , hire cars , entertainment ( cinema , theatre ), consumer goods ( department stores , shopping facilities ). fig2 shows a sketch illustrating a scenario for the display of location - dependent bookmarks on a computer , where the location information is ascertained by the computer . the computer 201 , in particular in the form of a mobile computer , ascertains its location 202 ( location information ) on the basis of data from a global positioning system ( gps ). on the basis of its location 202 , a selection 204 is made from the multiplicity of bookmarks 203 stored on a local basis , and hence the bookmarks 205 relevant to the location of the mobile computer 201 are displayed . preferably , the bookmarks offered are those whose distance from the location 202 is below a prescribed threshold value . in addition , bookmarks which are independent of the location can be offered ( e . g . bookmarks relating to world news ). the user 209 can select one of these relevant bookmarks 205 . a communications interface , in this case a gsm channel 206 , is used to transmit the address to a service provider 210 , where a query 207 is started . this query 207 produces a result which is again transmitted via the gsm channel 208 to the user 209 , in particular to the mobile computer 201 . fig3 shows a sketch illustrating a scenario for the display of location - dependent bookmarks on a computer , where the location information is ascertained by the network . again , a mobile computer 301 is provided which identifies itself to a service provider 315 using an identifier 302 ( identification data 102 — see fig1 ) which is unique to it . the service provider 315 issues a query and ascertains the position of the mobile computer 301 ( see blocks 304 and 305 ). the gsm network , in which it is possible to ascertain the position of a subscriber , is suitable for this purpose . the full duplex radio interface is identified in fig3 by the communication arrows 303 , 308 and 311 . the position data 305 ascertained by the service provider 315 is transmitted to the mobile computer 301 . there , on the basis of the location information 305 , a selection 307 is made from a multiplicity of bookmarks 306 stored on a local basis on the mobile computer 301 . this results in a selection of bookmarks 309 which are relevant to the location and which the user 310 can use to retrieve particular information ( indicated by the arrow 314 ). this query 314 is transmitted to the service provider 315 ( transmission arrow 311 ) and is processed there ( see block 312 ). the result 313 of the query 314 or 311 is transmitted back to the mobile computer 301 and is displayed to the user 310 . fig4 shows a sketch illustrating an extension of the above scenarios by time information . on the basis of fig2 or fig3 , a selection 402 from a multiplicity of bookmarks 401 is made on the basis of the location information 403 , of time information 404 and / or of a timetable 405 . the result of the selection is bookmarks 406 matching the selection filter . the selection on the basis of the location information 403 delivers bookmarks matching the location of the mobile computer . in addition , these bookmarks are filtered with regard to their time stamp . by way of example , this may be a filter function of the following type : “ the same bookmarks at the same location at the same time ”. in addition , time planning can be effected in connection with the location , so that an appointment reminder 405 is issued automatically when paying a visit to the noted place . this appointment reminder 405 relates , in particular , to the query for a particular address in the network group . by way of example : “ every monday , when visiting the xy area , start query with regional press service .” the filters 403 to 405 can be combined in any combination ( and / or ) with one another . fig5 shows a sketch illustrating a scenario in which fundamental functions of the computer 501 are removed to the network 502 . with a very low power mobile computer 501 , it is advantageous to remove the computation - and memory - intensive operations to the network 502 , which has plenty of resources . the mobile computer 501 transmits its identifier 503 to the network 502 . there , the position of the mobile computer 501 is firstly ascertained ( see block 504 ), and secondly the bookmarks 505 stored by the network 502 are filtered in the manner described above ( filter according to timetable 506 , time 507 and position 508 ). the selection 509 delivers some of the bookmarks 505 back to the mobile computer 501 . the user 512 selects a bookmark 511 , and a query in the network 502 is started ( block 510 ). the result is transmitted to the mobile computer 501 and hence to the user 512 . in this scenario , it is particularly advantageous for the mobile computer 501 , optimized in terms of weight and user friendliness , to remove functions to the network 502 . in the network 502 , the mobile computer 501 is given an area 513 ( domain ) created for it which comprises all its bookmarks 505 and the timetable 506 which is characteristic of it . preferably , other basic functionalities relating to additional storage of other bookmarks in the network 502 and to editing of these bookmarks are provided in the mobile computer 501 . fig6 shows a sketch illustrating two different methods for creating bookmarks . if the user is able to select information 601 , that is to say is able to visit its associated address , this is done by explicit selection , in conventional network browsers by clicking on a highlighted destination address . this specific selection 602 causes , in particular , the time 604 at which the information was requested and the location 603 , that is to say from where the information was requested , also to be logged . these two items of information — location 603 and time of the query 604 — are stored together 605 with the destination address of the information 601 . this is equivalent to automatic storage of bookmarks . one alternative is explicit storage of bookmarks 607 . in this case , for the bookmark which is to be stored , the location information 608 , that is to say the location of the mobile computer , is requested and both the address and the location address are stored together 609 in the bookmarks 610 . fig7 shows a processor unit prze . the processor unit prze comprises a processor cpu , a memory mem and an input / output interface ios which is used in various ways via an interface ifc : a graphics interface is used to visualize an output on a monitor mon and / or to output it on a printer prt . input is effected using a mouse mas or a keyboard tast . the processor unit prze also has a data bus bus ensuring connection of a memory mem , the processor cpu and the input / output interface ios . additional components can also be connected to the data bus bus , e . g . an additional memory , data store ( hard disk ) or scanner . the invention has been described in detail with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .	7
referring now to fig1 , an embodiment of a climate control system is illustrated and designated at 10 . the system 10 can include a thermoelectric module 12 , a heat exchanger 14 , an evaporator 16 , a heater core 18 , a valve 22 , a coolant pump 26 , and a controller 27 . as further discussed below , the thermoelectric module 12 , in conjunction with the heat exchanger 14 , allows the system 10 to provide heating or cooling with the internal combustion engine shut off , or alternatively , to provide supplemental heating or cooling while the internal combustion engine is running . now referring to fig2 , a sectional view of the thermoelectric module 12 is provided . the thermoelectric module 12 includes a series of thermoelectric elements 48 that generate a temperature change from electrical energy . if the electrical energy is provided in one polarity , the thermoelectric elements 48 will generate heat energy causing a rise in the ambient temperature around the thermoelectric elements 48 . alternatively , if electrical energy is provided to the thermoelectric elements 48 in an opposite polarity , the thermoelectric elements 48 will absorb heat energy , thereby cooling the ambient temperature around the thermoelectric elements 48 . to transfer heating or cooling from the thermoelectric elements 48 , a heat transfer medium , namely coolant , flows through a coolant tube 42 located proximate to the thermoelectric elements 48 . to aid in this heat transfer to the coolant , one or more blowers 40 generate an air flow across the thermoelectric elements 48 and the coolant tube 42 . in addition , an air scoop 50 may be provided to direct air leaving or entering the thermoelectric module 12 . the coolant is provided to the thermoelectric elements 48 circulates through an inlet connection 44 to the rest of the system through an outlet connection 46 , thereby enabling the transferring of the temperature change generated by the thermoelectric elements 48 . referring again to fig1 , the thermoelectric module 12 is in fluid communication , via the coolant , with the heat exchanger 14 along line 30 . the blower 15 creates an air flow 20 across the heat exchanger 14 , and the air flow 20 extracts heating or cooling from the coolant supplied by the thermoelectric module 12 thereby altering the temperature of the air flow 20 . in a heating mode , the thermoelectric module 12 provides heated coolant thereby heating the air flow 20 . alternatively in a cooling mode , the thermoelectric module 12 provides cooled coolant , thereby cooling the air flow 20 . from the heat exchanger 14 the air flow 20 is communicated over heat transfer surfaces of both the evaporator 16 and heater core 18 . the coolant exits the heat exchanger 14 along line 32 and is provided to valve 22 that selectively allows the coolant to flow along line 38 into the engine coolant system 24 or back to the coolant pump 26 . generally , the engine coolant system 24 will heat the coolant and return a portion of the coolant along line 36 to the heater core 18 and to the valve 22 which passes it back to the coolant pump 26 . alternatively , the valve 22 can solely direct the coolant from line 32 directly to line 34 , bypassing the engine coolant system 24 . this latter flow circuit is particularly beneficial in the cooling mode of the system 10 . the controller 27 allows the system to work in multiple heating and cooling modes . for example , the controller 27 can switch the polarity of the electrical energy provided to the thermoelectric module , thereby heating the coolant with one polarity , and cooling the coolant with the opposite polarity . in addition , the controller 27 can manipulate the valve 22 to bypass the engine cooling system 24 in cooling mode , thereby isolating the coolant from the heat generated by the engine in the engine coolant system 24 . the controller 27 is also connected to a regenerative braking system 29 . the regenerative braking system 29 generates electrical energy from the kinetic energy of the vehicle as the vehicle is slowed down . the controller 27 can direct the energy from the regenerative braking system 29 to an energy storage device , a battery , ( not shown ) or directly to the thermoelectric module 12 , providing an ample source of power to adjust the climate of the vehicle . if provided directly to the thermoelectric module 12 , the controller 27 can change the polarity of the electrical energy provided from the regenerative braking system 29 allowing the energy to be used by the thermoelectric module 12 in both heating and cooling modes . now referring to fig3 , the system 10 is shown in a supplemental cooling mode while the internal combustion engine is running . during “ engine on ” supplemental cooling , the thermoelectric module 12 is used in conjunction with the evaporator 16 to cool the passenger cabin of the vehicle . the combined use of the thermoelectric module 12 and the evaporator 16 provides a faster time to comfort . as illustrated in fig3 , the lines with a single small dash convey heated coolant from the heat exchanger 14 while the lines with two smaller dashes convey cooled coolant to the heat exchanger 14 . in the “ engine on ” supplemental cooling mode , the coolant flows through the thermoelectric module 12 , where heat is removed from the coolant , and thereafter along line 30 to the heat exchanger 14 . the heat exchanger 14 cools the air flow 20 which is then provided to the evaporator 16 for additional cooling before it flows to the passenger cabin of the vehicle . from the heat exchanger 14 , coolant flows along line 32 to the valve 22 , which is manipulated by the controller 27 to bypass the engine coolant system 24 thereby isolating the coolant from the heat generated by the engine . from the valve 22 the coolant flows along line 34 to the coolant pump 26 where the coolant flow is pressurized then provided back to the thermoelectric module 12 along line 28 . in this mode of operation , the thermoelectric module 12 operates for the first couple minutes to quickly pull down the temperature of the air flow 20 . if the temperature of the air coming into the heat exchanger 14 is less than the temperature of the air flowing into the thermoelectric module 12 , the thermoelectric module 12 and pump 26 are not operated thereby conserving vehicle energy . the system 10 in “ engine on ” supplemental heating mode is seen in fig4 . in the “ engine on ” supplemental heating mode , the thermoelectric module 12 is used in conjunction with the heater core 18 . using the thermoelectric module 12 in combination with the heater core 18 provides a faster time to comfort . warm coolant from the engine is pumped through the thermoelectric module 12 where further heat is added . the coolant flows from the thermoelectric module 12 along line 30 to the heat exchanger 14 , upstream of the heater core 18 . the heat exchanger 14 first heats the air flow 20 that is received by the heater core 18 . the heater core 18 emits heat from the engine coolant system 24 to further heat the air flow 20 before it is provided to the passenger cabin of the vehicle . coolant from the heat exchanger 14 is passed along line 32 to the valve 22 , which in the supplemental “ engine on ” heating mode , allows coolant to return to the engine coolant system along line 38 . the engine coolant system 24 provides heat from the engine to the coolant , some of which then flows to the heater core 18 and along line 36 to the valve 22 . from the valve 22 , the coolant flows along line 34 through the coolant pump 26 and returns along line 28 to the thermoelectric module 12 . if the engine coolant system 24 provides sufficient means for pumping the coolant through the system , the coolant pump 26 is deactivated in this mode . preferably , the thermoelectric module 12 operates for the first couple of minutes of heat up , and ceases to operate when the temperature of the coolant from the engine alone reaches the desired temperature to provide proper passenger cabin heating . now referring to fig5 , an “ engine off ” cooling mode is provided . the “ engine off ” cooling mode is used to maintain a comfortable cabin for a limited amount of time during an idle engine shutdown . in this mode , the evaporator is non - operative as the engine has been shut down . the cooling provided by the thermal inertia in the coolant and the thermoelectric module 12 allows the engine to shutdown and save fuel , while still allowing the passenger cabin to be cooled . coolant flows through the thermoelectric module 12 where heat is removed from the coolant . from the thermoelectric module 12 , the coolant flows along line 30 to the heat exchanger 14 . heat is absorbed by the coolant from the air flow 20 in the heat exchanger 14 . the coolant flows from the heat exchanger 14 along line 32 to the valve 22 . manipulated by the controller 27 to bypass the engine coolant system 14 , the valve 22 isolates the coolant from the engine heat . the coolant flows from the valve 22 along line 34 back to the coolant pump 26 , which generates coolant flow by pressurizing the coolant in the lines . the coolant is then received back by thermoelectric module 12 along line 28 , where heat is absorbed from the coolant again . the controller 27 monitors vehicle speed and braking to predict if a stop is imminent . if a stop is predicted , regenerating braking energy from the regenerative braking system 29 is used by the thermoelectric module 12 to cool the coolant . during the stop , the thermoelectric module 12 continues to operate to maintain the cool coolant temperature as heat is added from the cabin . now referring to fig6 , an “ engine off ” heating mode is schematically shown . the “ engine off ” heating mode is used to maintain a comfortable cabin temperature for a limited amount of time during an idle engine shutdown . the heat provided by the thermoelectric module 12 , the thermal inertia in the coolant , and the thermal inertia in the engine block allows the system 10 to heat the cabin of the vehicle while allowing the engine to shutdown and save fuel . in this mode of operation , warm coolant from the engine is pumped by the coolant pump 26 through the thermoelectric module 12 where heat is added . coolant flows from the thermoelectric module 12 along line 30 to the heat exchanger 14 . in the heat exchanger 14 , heat is absorbed by the air flow 20 from the coolant . the heated air flow 20 is then provided to the heater core 18 where before the air flow 20 is provided to the cabin , further heat is absorbed from the coolant provided by the engine coolant system 24 , the cooled coolant then flows from the heat exchanger 14 along line 32 to the valve 22 , which is opened to provide the coolant to the engine coolant system 24 . the engine coolant system 24 adds heat from the engine block to the coolant , which is returned to the heater core 18 and along line 36 to the valve 22 and the coolant pump 26 . if the engine coolant system 24 has a pump to provide sufficient coolant pressure through the system 10 , the coolant pump 26 is deactivated . from the pump 26 , the coolant flows along line 28 back to the thermoelectric module 12 where further heat is added . in addition , the controller 27 monitors the vehicle speed and braking to predict if a stop is imminent . if a stop is predicted , the regenerative braking energy from the regenerative braking system 29 is used by the thermoelectric module 12 to heat the coolant . during the stop , the thermoelectric module 12 continues to operate and maintain the warm coolant temperature as heat is removed from the cabin . as a person skilled in the art will readily appreciate , the above description is meant as an illustration of implementation of the principles this disclosure . this description is not intended to limit the scope or application of this disclosure in that the disclosure is susceptible to modification , variation and change , without departing from spirit of this disclosure .	1
illustrated in fig1 is a photoresponsive imaging member of the present invention comprising a supporting substrate 3 of a thickness of from about 50 microns to about 5 , 000 microns , a charge carrier photogenerating layer 5 of a thickness of from about 0 . 5 micron to about 5 microns comprised of photogenerating pigment s6 optionally dispersed in a resinous binder composition 7 , and a hole transport layer 9 of a thickness of from about 10 microns to about 60 microns comprised of an aryl amine dispersed in the polycarbonate illustrated herein resin binder 8 . illustrated in fig2 is a photoresponsive imaging member of the present invention comprised of about a 25 micron to about a 100 micron thick conductive supporting substrate 15 of aluminized mylar , a 0 . 5 micron to about 5 micron thick photogenerating layer 17 comprised of trigonal selenium photogenerating pigments 19 dispersed in a resinous binder 21 in the amount of 10 percent to about 80 percent by weight , and a 10 micron to about a 60 micron thick hole transport layer 23 comprised of the aryl amine charge transport n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl ) 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine dispersed in the polycarbonate resin binder 24 poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol carbonate with 10 weight percent of polydiphenyl siloxane blocks , based on the amount of polydiphenyl siloxane added to the polymerization , and comfirmed by nmr integration ; additionally , covalent incorporation of the polysiloxane blocks is supported by the absence of a separate low molecular weight peak in gpc studies of the polymer and by the low amount of free polysiloxane extracted by sfe / sfc studies , which polycarbonate has a number average molecular weight of about 21 , 000 , and a weight average molecular weight of about 67 , 500 , and a dispersity of about 3 . 25 as determined by a waters gel permeation chromatograph employing four ultrastyragel © columns with pore sizes of 100 , 500 , 500 , 10 4 angstroms and using thf as solvent . the polydiphenyl siloxane blocks are believed to be incorporated randomly along the polymer chain length . another photoresponsive imaging member of the present invention , reference fig3 is comprised of a conductive supporting substrate 31 of aluminum of a thickness of 50 microns to about 5 , 000 microns , a photogenerating layer 33 comprised of amorphous selenium or an amorphous selenium alloy , especially selenium arsenic alloy ( 99 . 5 / 0 . 5 ) or a selenium tellurium alloy ( 75 / 25 ), of a thickness of 0 . 1 micron to about 5 microns , and a 10 micron to about 60 micron thick hole transport layer 37 comprised of the aryl amine hole transport n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl ) 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine , 55 weight percent , dispersed in the polycarbonate resin binder 39 of fig2 . illustrated in fig4 is another photoresponsive imaging member of the present invention comprised of a 25 micron to 100 micron thick conductive supporting substrate 41 of aluminized mylar , a 10 micron to about 70 micron thick hole transport layer 47 comprised of n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl ) 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine hole transport molecules , 55 weight percent , dispersed in the polycarbonate resin binder poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol carbonate 48 with 10 weight percent of polydiphenylsiloxane blocks , and a 0 . 1 micron to about 5 micron thick photogenerating layer 50 comprised of vanadyl phthalocyanine photogenerating pigments 53 optionally dispersed in a polyester resinous binder 55 in an amount of about 10 percent to about 80 percent by weight . the supporting substrate layers may be opaque or substantially transparent and may comprise any suitable material possessing , for example , the requisite mechanical properties . the substrate may comprise a layer of an organic or inorganic material having a conductive surface layer arranged thereon or a conductive material such as , for example , aluminum , chromium , nickel , indium , tin oxide , brass or the like . the substrate may be flexible , seamless , or rigid and can be comprised of various different configurations such as , for example , a plate , a cylindrical drum , a scroll , and the like . the thickness of the substrate layer is dependent on many factors including , for example , the components of the other layers , and the like ; generally , however , the substrate is generally of a thickness of from about 50 microns to about 5 , 000 microns . examples of photogenerating layers , especially since they permit imaging members with a photoresponse of from about 400 to about 700 nanometers , for example , include those comprised of known photoconductive charge carrier generating materials , such as amorphous selenium , selenium alloys , halogen doped amorphous selenium , doped amorphous selenium alloys doped with chlorine in the amount of from about 50 to about 200 parts per million , and trigonal selenium , cadmium sulfide , cadmium selenide and cadmium sulfur selenide , and the like , reference u . s . pat . nos . 4 , 232 , 102 and 4 , 233 , 283 , the disclosures of each of these patents being totally incorporated herein by reference . examples of specific alloys include selenium arsenic with from about 95 to about 99 . 8 weight percent selenium ; selenium tellurium with from about 70 to about 90 weight percent of selenium ; the aforementioned alloys containing dopants , such as halogens , including chlorine in amounts of from about 100 to about 1 , 000 parts per million , ternary alloys , and the like . the thickness of the photogenerating layer is dependent on a number of factors , such as the materials included in the other layers , and the like ; generally , however , this layer is of a thickness of from about 0 . 1 micron to about 5 microns , and preferably from about 0 . 2 micron to about 2 microns , depending on the photoconductive volume loading , which may vary from about 5 percent to about 100 percent by weight . generally , it is desirable to provide this layer in a thickness which is sufficient to absorb about 90 percent or more of the incident radiation which is directed upon it in the imagewise exposure step . the maximum thickness of this layer is dependent primarily upon factors such as mechanical considerations , for example , whether a flexible photoresponsive device is desired . also , there may be selected as photogenerators organic components such as squaraines , perylenes , reference for example u . s . pat . no . 4 , 587 , 189 , the disclosure of which is totally incorporated herein by reference , metal phthalocyanines , metal free phthalocyanines , vanadyl phthalocyanine , dibromoanthanthrone , and the like . the hole transport layer can be comprised of one or a mixture of hole transporting molecules in the amount of from about 10 percent to about 60 percent by weight thereof in some embodiments of the transport molecules illustrated herein , and preferably the aryl amines of the formula illustrated herein . the thickness of the transport layer is , for example , from about 5 microns to about 50 microns with the thickness depending predominantly on the nature of intended applications . in addition , a layer of adhesive material located , for example , between the transport layer and the photogenerating layer to promote adhesion thereof can be utilized . this layer may be comprised of known adhesive materials such as polyester resins , reference 49 , 000 polyester available from e . i . dupont chemical company , polysiloxane , acrylic polymers , and the like . a thickness of from about 0 . 001 micron to about 0 . 1 micron is generally employed for the adhesive layer . hole blocking layers usually situated between the substrate and the photogenerating layer , and preferably in contact with the supporting substrate include , for example , those derived from the polycondensation of aminopropyl trialkoxysilane or aminobutyl trialkoxysilane , such as 3 - aminopropyltrimethoxy silane , 3 - aminopropyltriethoxy silane , or 4 - aminobutyltrimethoxy silane thereby improving in some embodiments the dark decay characteristics of the imaging member . typically , this layer has a thickness of from about 0 . 001 micron to about 5 microns or more in thickness , depending on the desired effectiveness for preventing or minimizing the dark injection of charge carriers into the photogenerating layer . with the layered imaging members of the present invention , wherein the photogenerating layer is comprised of trigonal selenium , this member when charged to a negative voltage of 800 volts with a corotron had a photosensitivity of 2 . 0 ergs per square centimeter . the residual voltage buildup for this imaging member was negligible as determined , for example , with a volt meter ( about 8 volts ) after 1 , 000 imaging cycles in a xerographic imaging test fixture . the overall electrical performance ( photosensitivity , cyclic stability , and dark decay ) was superior to a similar imaging member fabricated with a polycarbonate ( lexan ), 45 weight percent , as resin binder for the charge transport molecule . the aforementioned imaging member of the present invnetion exhibited an increase in yield strength and tensile toughness compared to a similar imaging member compared with a polycarbonate such as polycarbonate z . the imaging memebrs of the present invnetion can be selected for electrostatographic , especially xerographic , imaging and printing processes wherein , for example , a positively , or negatively charged imaging member is selected , and developing the image with toner comprised of resin , such as styrene acrylates , styrene methacrylates , styrene butadienes , and the like , pigment , such as carbon black , and a charge additive such as distearyl dimethyl ammonium methyl sulfate . the process of the present invention can be affected by heating as illustrated herein , which heating of reactants can be accomplished at a temperature of from about 180 ° to about 220 ° c . and wherein the temperature is maintained for a period of from about 30 minutes to about 150 minutes . the following examples , except for any comparative examples , are being supplied to further define specific embodiments of the present invention , it being noted that these examples are intended to illustrate and not limit the scope of the present invention . also , parts and percentages are by weight unless otherwise indicated . in the following examples , unless otherwise noted , there was selected a one liter stainless steel reactor equipped with a helical coil stirrer and a double mechanical seal . the stirrer was driven by a one - half horse power motor with a 30 : 1 gear reduction , and a torque meter was included on the stirrer drive . the reactor was heated electrically , and the pressure was monitored by both a pressure transducer , and a pirani gauge , while the temperature was determined by a platinum rtd . a specifically designed condensor ensures the efficient condensation of phenol and diphenylcarbonate ; these materials are both solids at room temperature and the condenser design ensures that when they solidify they do not plug a line between the reactor and the vacuum pump which would cause the reaction to cease . in addition , at the low pressures below from 0 . 1 to 100 mbar used at the reaction end phenol has sufficient vapor pressure at room temperature and above that it can interfere with the polymerization by either raising the lowest pressure achievable by the system or by subliming to other parts of the condenser and plugging a line . in this condenser , the diameter of the pipe from the reactor to the condenser was 3 / 8 &# 34 ;. the major fraction of the line consists of flexible steel piping to avoid having to exactly position both reactor and condenser . a heating mantle was used to wrap this line . the condensation takes place in a 6 inch diameter stainless steel pipe about 16 inches long . the condensing surface itself consists of five 12 inch flexible steel tubes running parallel to each other , hung vertically , with four tubes arranged around the central one . to cool the condensing surface , there was used cold nitrogen gas . the cold nitrogen enters the four outer tubes , descends to the bottom , then rises up the central tube . the nitrogen flow is controlled by a flow meter with a typical flow rate in the range of 20 to 30 liters minute - 1 . this tube assembly was hung from a weigh cell by a small universal joint . the inlet and outlet are long flexible steel tubes . this length along the horizontal axis should minimize the vertical force . since the load cell deflection is quite small , a uniform , consistent force shunt occurs that can be corrected for by calibrating the cell . the byproducts such as phenol , cresol , chlorophenol , a mixture of phenol and hydroquinone , a mixture of phenol and resorcinol , a mixture of phenol and biphenol , or a mixuture of phenol with one of 4 , 4 &# 39 ;- dihydroxyarylakanes , 4 , 4 &# 39 ;- dihydroxycycloalkanes , 4 , 4 &# 39 ;- dihydroxyethers , 4 , 4 &# 39 ;- dihydroxysulfides , 4 , 4 &# 39 ;- dihydroxysulfones , and the like drips as a liquid into the glass bottom portion of the condenser which was joined to the upper stainless steel portion by a ball valve . this glass piece at the bottom is a 250 milliliters graduated cylinder . through this glass the amount and rate of phenol condensation can be monitored . when the reaction pressure was low enough , usually between 10 about 100 mbars , that the vapor pressure of the phenol becomes a significant contribution to the reactor pressure , the ball valve is closed to isolate the bulk of the phenol and the temperature of the ntrogen gas in the condensing element is lowered to below - 80 ° c . in this manner , solid phenol was collected , and the rate and amount of collection can be monitored by the weigh cell electronic signal . the line leaving the condenser to the vacuum pump is 1 / 2 inch in diameter to further reduce any chance of plugging . since the polymerization is driven by the removal of phenol , which in turn is driven by pressure and temperature , control of these variables is most important . a series of valves , a rotary oil pump , and a surge tank provided controlled variations in reactor pressure . there was added to the above reactor 270 . 0 grams of bisphenol ( z )( 4 , 4 &# 39 ;- cyclohexylidenediphenol ) as obtained by the process as illustrated in example i of u . s . pat . no . 4 , 766 , 255 , the disclosure of which is totally incorporated herein by reference ; 30 grams of polydiphenylsiloxane , silanol terminated , obtained from petrarch systems ( now huls ); 273 . 4 grams of diphenylcarbonate and 0 . 50 milliliter of titanium ( iv ) butoxide . the reactor was then sealed and heated to 220 ° c ., and the pressure lowered from 1 , 000 millibar ( atmospheric pressure ) to about 500 mbar in a period of about 15 minutes . phenol began to collect in the condensor and the amount was observed through the lower glass portion of the condenser . the rate of pressure decrease was then slowed so that about 80 minutes were required to reach a pressure of 5 mbar . during the slow pressure drop about 110 to 130 milliliters of phenol was observed to collect in the lower glass portion of the condenser . when the pressure reached about 100 mbar , the temperature of the nitrogen gas cooling the condensing element was lowered from about 16 ° c . to about - 84 ° c . after 150 minutes at 220 ° c . the temperature was increased to 260 ° c . and heating was continued for 90 minutes . thereafter , the temperature was increased to 280 ° c . and heating was continued for 120 minutes . thereafter , the temperature was increased to 300 ° c . and heating was continued for 120 minutes , and the molten polymer resulting was drawn from the reactor by pulling with large forceps into a dry nitrogen atmosphere to prevent hydrolysis or oxidation of the heated polymer , which after cooling had a weight average molecular weight in polystyrene equivalents of 37 , 000 as determined by gpc . ten ( 10 ) grams of the obtained polycarbonate product was added to 100 milliliters of dimethylformamide as the polymer solvent containing 0 . 25 gram of tartaric acid as the complexing component . following the stirring of the mixture for 16 hours , the resulting polymer solution was precipitated into 3 liters of rapidly stirring deionized water . the polymer poly ( poly ( 4 , 4 &# 39 ;- cyclohexylidenebisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;- cyclohexylidenebisphenol ) carbonate ) with a gpc weight molecular weight of 55 , 300 and tg of 152 ° c . was recovered by filtration and dried overnight ( 18 hours ) in a vacuum oven at about 80 degrees celsius . this polymer was tested as a free standing film in an instron materials testing system ( model # 1123 ) and found to have a yield strength of 71 . 1 megapascals and a modulus of 2 . 4 gigapascals . this can be compared to a polymer without polysiloxane blocks , such as the homopolymer , poly ( 4 , 4 &# 39 ;- cyclohexylidenebisphenol ) carbonate with a gpc weight molecular weight of 57 , 400 prepared by the same polyesterification process of this example , that displayed , as a free standing film , a yield strength of 59 . 7 megapascals and a modulus of 2 . 0 gigapascals . the processes of example i were repeated with the exceptions that there were selected 270 grams of bisphenol ( z ) ( 4 , 4 &# 39 ;- cyclohexylidenediphenol ); 31 . 2 grams of ( 85 to 88 percent ) dimethyl -( 12 to 15 percent )- diphenyl siloxane , silanol terminated ( petrarch systems ps085 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;- cyclohexylidenebisphenol ) carbonate - block - poly ( diphenylsiloxane - co - dimethylsiloxane )- block - poly ( 4 , 4 &# 39 ;- cyclohexylidenebisphenol ) carbonate ) with a gpc weight molecular weight of 39 , 000 . the processes of example i were repeated with the exceptions that there were selected 270 grams of bisphenol ( ap ) ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ); 30 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate ) ( a : 10 : c mass percent ) with a gpc weight molecular weight of 68 , 000 . the processes of example i were repeated with the exceptions that there were selected 285 grams of bisphenol ( ap ) ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ); 15 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate ) ( a : 5 : c mass percent ) with a gpc weight molecular weight of 44 , 000 . the processes of example i were repeated with the exceptions that there were selected 255 grams of bisphenol ( ap ) ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ); 45 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate ( a : 15 : c mass percent ) with a gpc weight molecular weight of 68 , 000 and a tg of 157 ° c . the processes of example i were repeated with the exceptions that there were selected 240 grams of bisphenol ( ap ) ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ); 60 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate ) ( a : 20 : c mass percent ) with a gpc weight molecular weight of 52 , 000 and a bimodal distribution . the processes of example i were repeated with the exceptions that there were selected 270 grams of bisphenol ( ap ) ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ); 30 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate and the catalyst employed was tetramethyl ammonium tetraphenyl borohydride . there resulted a block copolymer poly ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate ) ( a : 20 : c mass percent ) with a gpc weight molecular weight of 9 , 000 . the processes of example i were repeated with the exceptions that there were selected 270 grams of bisphenol ( p ) ( 4 , 4 &# 39 ;-( 1 , 2 - phenylenebisisopropylidene ) bisphenol ); 30 grams of diphenyl siloxane , silanol terminated ( petrarch systems ps080 ); and 273 . 4 grams of diphenylcarbonate . there resulted a block copolymer , poly ( poly ( 4 , 4 &# 39 ;-( 1 , 4 - phenylenebisisopropylidene ) bisphenol ) carbonate - block - polydiphenylsiloxane - block - poly ( 4 , 4 &# 39 ;-( 1 , 4 - phenylenebisisopropylidene ) bisphenol ) carbonate ) with a gpc weight molecular weight of 68 , 900 . the polymer of example iii and a polycarbonate z comparative polymer obtained from mitsubishi chemical with viscosity average molecular weight of 26 , 000 of the same bisphenol structure but without the siloxane incorporation ( poly ( 4 , 4 &# 39 ;-( 1 - phenylethylidene ) bisphenol ) carbonate were comparatively tested as follows : two layered photoresponsive imaging members containing the hole transport molecule , n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl )- 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine in the above polycarbonate binders respectively as the charge transport layer and trigonal selenium as the photogenerator was prepared as follows : a solution for the charge transport layer was prepared by dissolving 1 . 0 gram of n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl )- 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine and 1 . 0 gram of the above polycarbonates , respectively , in 10 milliliter of methylene chloride . this solution was coated on top of a trigonal selenium generator layer by means of a bird film applicator . the resulting photoreceptor devices with an aluminized mylar substrate with a thickness of 75 microns was dried in a forced air oven at 135 ° c . for 20 minutes resulting in an 24 micron thick hole transport layer . mechanical testing was done with samples of the above prepared photoreceptor devices with a sample size of 5 centimeters in length and with a width of 1 . 5 centimeters . tensile tests were then conducted on an instron materials testing system ( model # 1123 ) employing a strain rate of 0 . 20 minute . the type of test used was a tensile test for films and coatings , astm test method d 882 , capable of calculating the young &# 39 ; s modulus , tensile strength , yield strength , percent elongation and tensile toughness . the tensile toughness is the area of the stress - strain curve when the sample is strained to the breaking point . the results are contained in the following table . the young &# 39 ; s modulus is the ratio of the tensile stress to the strain in the linear portion of the stress - strain curve . the result is expressed in force per unit area usually gigapascals ( gpa ) or pounds force per square inch ( psi ). the tensile strength is calculated by deviding the load at breaking point by the original cross - sectional area of the test specimen . the result is expressed in force per unit area usually megapascals ( mpa ) or pounds - force per square inch ( psi ). the yield strength is calculated by dividing the load at the yield point by the original cross - sectional area of the test specimen . the result is expressed in force per unit area , usually megapascals ( mpa ) or pounds - force per square inch ( psi ). the percentage elongation at break is calculated by dividing the elongation at the moment of rupture of the test specimen by the initial gauge length ( for example 5 centimeters in this example ) of the specimen and multiplying by 100 . the tensile toughness is the total energy absorbed per unit volume of the specimen up to the point of rupture . the result is expressed in units of joules cm - 3 . table 1______________________________________mechanical properties of polymer bindersfor p / r young &# 39 ; s tensile yield percent tensilepolymer modulus strength strength elonga - toughnessstructure gpa mpa mpa tion joules / cm . sup . 3______________________________________com - 3 . 73 94 . 74 87 . 85 4 . 58 2 . 67para - tivepolymerexample 4 . 24 165 . 64 68 . 51 85 . 08 93 . 22iiipolymer______________________________________ a photoresponsive imaging member was prepared by providing an aluminized mylar substrate in a thickness of 75 microns , followed by applying thereto with a multiple - clearance film applicator a solution of n - methyl - 3 - aminopropyl - trimethoxy silane ( obtained from pcr research chemicals ) in ethanol ( 1 : 20 volume ratio ). this hole blocking layer , 0 . 1 micron , was dried for 5 minutes at room temperature , and then cured for 10 minutes at 110 ° c . in a forced air oven . there was then applied to the above silane layer a solution of 0 . 5 percent by weight of 49 , 000 polyester ( obtained from e . i . dupont chemical ) in a mixture of methylene chloride and 1 , 1 , 2 - trichloroethane ( 4 : 1 volume ratio ) with a multiple - clearance film applicator . the layer was allowed to dry for one minute at room temperature , and 10 minutes at 100 ° c . in a forced air oven . the resulting adhesive layer had a dry thickness of 0 . 05 micron . a dispersion of trigonal selenium and poly ( n - vinylcarbazole ) was prepared by ball milling 1 . 6 grams of trigonal selenium and 1 . 6 grams of poly ( n - vinylcarbazole ) in 14 milliliters each of tetrahydrofuran and toluene . a 1 . 0 micron thick photogenerator layer was then fabricated by coating the above dispersion onto the above adhesive layer present on the mylar substrate with a multiple - clearance film applicator , followed by drying in a forced air oven at 135 ° c . for 5 minutes . a solution of 4 . 0 grams of the aryl amine n , n &# 39 ;- diphenyl - n , n &# 39 ;- bis ( 3 - methylphenyl ) 1 , 1 &# 39 ;- biphenyl - 4 , 4 &# 39 ;- diamine and 6 grams of a block copolycarbonate of bisphenol and polydiphenylsiloxane , obtained from example i , resin binder in 100 milliliters of methylene chloride was then coated over the photogenerator layer by means of a multiple - clearance film applicator . the resulting member was subsequently dried in a forced air oven at 130 ° c . for 30 minutes resulting in a 22 micron thick hole transport layer with 60 weight percent of the resin binder comprised of a block copolycarbonate of bisphenol and polydiphenyl siloxane of example ii . the above fabricated imaging member was electrically tested by negatively charging it with a corona , and discharged by exposing it to white light of wavelengths of from 400 to 700 nanometers . charging was accomplished with a single wire corotron in which the wire was contained in a grounded aluminum channel and was strung between two insulating blocks . the acceptance potential of this imaging member after charging , and its residual potential after exposure were recorded . the procedure was repeated for different exposure energies supplied by a 75 watt xenon arc lamp of incident radiation , and the exposure energy required to discharge the surface potential of the member to half of its original value was determined . this surface potential was measured using a wire loop probe contained in a shielded cylinder , and placed directly above the photoreceptor member surface . this loop was capacitively coupled to the photoreceptor surface so that the voltage of the wire loop corresponds to the surface potential . also , the cylinder enclosing the wire loop was connected to the ground . the above imaging member was negatively charged to a surface potential of 800 volts , and discharged to a residual potential of 15 volts . the dark decay of this device was about 20 volts / second . further , the electrical properties of the above prepared photoresponsive imaging member remained essentially unchanged for 10 , 000 cycles of repeated charging and discharging . a layered photoresponsive imaging member was fabricated by repeating the procedure of example viii with the exceptions that a 0 . 5 micron thick layer of amorphous selenium photogenerating components on a ball grained aluminum plate of a thickness of 7 mils ( 175 microns ) was utilized , and wherein conventional vacuum deposition techniques were selected . vacuum deposition of the selenium photogenerating layer was accomplished at a vacuum of 10 - 6 torr , while the substrate was maintained at about 50 ° c . thereafter , the resulting imaging device was dried in a forced air oven at 40 ° c . for 1 hour to form a 20 micron thick hole transport layer . subsequently , the imaging member was cooled to room temperature , followed by electrical testing by repeating the procedure of example viii with the exception that a 450 nanometer monochromatic light was selected for irradiation . this imaging member was negatively charged to 850 volts and discharged to a residual potential of 30 volts . the dark decay of this device was 5 volts / second . a layered photoresponsive imaging member was prepared by repeating the procedure of example viii by depositing a 0 . 5 micron thick layer of amorphous selenium on a ball grained aluminum plate of a thickness of 7 mils with the exception that the polycarbonate polymer resin binder of example iii was selected in place of the polymer resin binder of example ii . thereafter , the resulting device or imaging member was dried in a forced air oven at 40 ° c . for 1 hour to form a 25 micron thick hole transport layer . subsequently , the imaging member was cooled to room temperature , followed by electrical testing by repeating the procedure of example iii with the exception that a 450 nanometer monochromatic light was selected for irradiation . specifically , this imaging member was negatively charged to 800 volts and discharged to a residual potential of 90 volts . the electrical performance as indicated by photosensitivity , dark decay , and residual voltage of this imaging member remained essentially the same after 1 , 000 cycles of repeated charging and discharging . it is believed that images with excellent resolution with substantially no background deposits can be obtained with the imaging members of the present invention subsequent to development with known toner compositions comprised , for example , of styrene n - butyl methacrylate copolymer resin , 88 weight percent , 10 weight percent of carbon black , and 2 weight percent of the charge additive distearyl dimethyl ammonium methyl sulfate , reference u . s . pat . no . 4 , 560 , 635 , the disclosure of which is totally incorporated herein by reference . although the invention has been described with reference to specific preferred embodiments , it is not intended to be limited thereto , rather those skilled in the art will recognize variations and modifications may be made therein which are within the spirit of the invention and within the scope of the following claims .	2
referring first to fig1 a radar transmitter and receiver unit 10 is provided which may include a antenna 12 transmitting and receiving energy in range sweeps over azimuth positions that may be over an entire 360 ° or any desired portion thereof . the received energy from each transmitted pulse is received over a plurality of range bins along a selected range r . the video signal provided by the radar transmitter receiver unit 10 for each range bin is then applied in digital form through a composite lead 16 to a target detector memory 18 which may either detect the presence of a target signal above a threshold and utilize that as the on - time target signal or may in some arrangements include a memory utilized for azimuth summing . as is well known in the art for azimuth summing , the presence or amplitude of a target is combined from each range bin over a plurality of radar sweeps and when certain criteria are met for any one range bin the determination is made that a target is present at that particular range - bin time for that sweep . the system in accordance with the invention includes an acm ( area clutter mapper ) unit no . 1 as shown by a box 20 and an acm mapper unit no . 2 as shown by a box 22 , each receiving the detected target amplitude on a lead 26 and one arrangement in accordance with the invention and receiving a target code in another arrangement in accordance with the invention . a master trigger signal mt is applied from the radar unit 10 through a range counter 30 and a lead 37 , to the mapper unit 20 and is applied through an adder or delay unit 32 to the mapper unit 22 . an azimuth position signal is applied through a composite lead 36 through the mapper unit 20 and through the delay unit 32 to the mapper unit 22 . in a radar unit utilizing a range - bin counter , the delay unit 32 responds to the clock count from an azimuth counter 31 on the lead 36 by adding a value in a range add unit 40 and when the master trigger signal is an azimuth count value , the azimuth unit 42 responds to the lead 37 to provide the delay in the delay unit 32 . a target threshold or selector unit 46 responds to the clutter amplitude for each range bin from the acm units 20 and 22 through respective leads 48 and 50 and to the target signal in the target detector memory 18 through a composite lead 52 to select the larger clutter amplitude from the two mapper units , compare that with the target amplitude to determine the presence of a valid target . in another arrangement in accordance with the invention where a single bit or a code indicating the presence of clutter is derived from the mapper units 20 and 22 , the target selector 46 inhibits the passing of a target signal on the lead 52 if clutter is indicated in either the mapper unit 20 or the mapper unit 22 . targets in the absence of clutter are then applied through a composite lead 60 to a utilization device 62 which may be a display , a processing unit or both , or other units utilizing the target signal as is well known in the art . referring now to fig2 the relative positions of the original and the area overlap acm cell pattern will be further explained . an acm pattern 70 from acm mapper unit 20 for a portion of the surveillance area , has each of the azimuth and range sectors or areas divided up into substantially equal quantum areas . an area overlap acm pattern 72 for the same surveillance area is offset in azimuth by one - half of the azimuth width of an acm cell and is offset in range by one - half of the range distance of an acm cell . thus , each cell of the acm pattern 70 includes substantially a quarter of four acm cells of the overlap pattern 72 . clutter shown at 73 which is near the edge of the acm cells of pattern 70 is shown by the dots to fluctuate in position from scan - to - scan between acm cells 74 , 75 , 76 and 77 of the first acm pattern 70 . however , in each case , the clutter is still within the second acm pattern 72 in the acm cell 80 and may be detected as clutter . thus , scintillation of the clutter from scan to scan which is moving from one acm cell to the other of the acm pattern 70 is detected to a substantially high degree of accuracy in the offset or overlap acm cell of the pattern 72 , and because of the symmetry of the two acm patterns moving clutter from one cell to the other at the edge of pattern 72 is detected in the original acm cell of pattern 70 . referring now to fig3 as well as to fig1 the target threshold unit 46 for the arrangement in which the clutter amplitude is provided on composite leads 48 and 50 , includes a select larger signal circuit 86 in which for each range bin the larger clutter amplitude signal is selected and applied through a composite lead 88 to a summing unit 90 also receiving a digital offset value from a source 101 through a lead 100 . the offset larger clutter amplitude signal is then applied through a composite lead 102 to comparator 104 which also receives a target amplitude on the composite lead 52 to pass the target signal to the composite lead 60 when the target amplitude is larger than the clutter signal on the lead 102 . thus the target signal is passed to the utilization device when the target amplitude is larger than the bigger clutter amplitude plus the offset . referring now to fig4 as well as to fig1 the target threshold circuit for an area clutter - mapping system , in accordance with the invention , utilizing a code or a single bit in each area clutter - mapper unit is shown . the code or bit indicating the presence of clutter is applied from the two area clutter - mapper units 20 and 22 through leads 48 and 50 to an or gate 106 and in turn through an inverter gate 107 and then to an and gate 108 also receiving the target signal on the lead 52 to pass the target signal in the absence of clutter to the output lead 60 . referring now to fig5 an area clutter - mapping system to be used in area clutter - mapping units 20 and 22 is illustrated as an example of a clutter - mapping system that provides a clutter amplitude value for comparison . this illustrated clutter - mapper system is shown in pending patent application ser . no . 587 , 176 , infinite ratio clutter detecting system , by f . w . kowalski and r . d . wilmot filed june 16 , 1975 , but will be explained for further showing the operation of the improved system in accordance with the invention . the system includes a main memory 120 which may be of any suitable type of memory such as a magnetic storage memory or a dynamic type memory utilizing integrated circuits , for example . the main memory 120 is coupled to a write register 124 and to a read register 126 and is addressed by an address control circuit 128 for accessing any desired storage cell therein . the system also includes a temporary memory 130 which may be of any suitable type such as a magnetic storage memory or a dynamic memory utilizing integrated circuits and coupled to a write register 132 , a read register 134 and an address control unit 136 . the temporary memory 130 is utilized to store the target amplitude data received on the lead 126 for each of the plurality of area clutter mapper cells . the main memory 120 is utilized principally to store the target detection history or stc count code and the ca or reject code for each of the plurality of acm mapper cells , which data is utilized to detect the presence of clutter . an stc or clutter counter unit 140 is coupled to the write register 124 and to the read register 126 as well as to the ca or reject code write control unit 144 and a compare circuit 148 , the clutter counter 140 principally controlling the clutter count stored in the main memory 120 . the compare unit 148 is coupled to the stc counter 140 by a lead 147 as well as to the ca write control unit 144 for determining a signal stct representing the value of the reject code to be written into the acm cells of the main memory 120 and which is applied on a lead 149 to the stc counter 140 . a last range bin timing pulse z t is applied from the stc counter 140 on a lead 151 to the ca write control unit 144 for writing the maximum target amplitude into the memory 120 at the last range bin time of each quantum area . a threshold setting unit 150 which may be manual is coupled to the compare unit 148 for selecting an stc threshold which resets the counter bits . under certain conditions a scan counter 154 is provided responsive to a zero degree pulse on a lead 156 from the radar system 10 to apply a scan count on a lead 55 to the stc counter 140 . a manual unit 158 is provided for manual or automatic control of the scan threshold utilized in the scan counter 154 . a target amplitude or ta write control unit 162 is coupled to the write register 132 and the read register 134 for maintaining the largest amplitude for any target received in any area clutter mapping cell in the temporary memory 30 , that memory storing all of the area clutter mapping cells over the distance in one range sweep . the write control unit 162 supplies a maximum target amplitude signal mta on a composite lead 163 to the reject code write control unit 144 . a timing control unit 173 provides system timing in response to pulses from the range counter 30 and azimuth counter 31 of fig1 ( or from the delay unit 32 ), to the stc counter 140 , and the address control units 128 and 136 . range bin clock pulses c rb are applied from the timing control unit 173 to the read and write registers 124 , 126 , 132 , and 134 . referring now to fig6 which shows the clutter map area in a circle 181 or in a portion of a circle , in accordance with the invention from a point 180 which is the location of the surveillance radar system , the entire area is divided up into quantum areas or area clutter mapper ( acm ) cells such as 182 , each having a dimension of 2 . 8125 ° in azimuth and four miles in range as an illustrated size for purposes of explanation . in the illustrated system each scan starts from a north pulse or north position , scanning 360 ° with a range distance from 0 to 256 miles so that there are 64 area clutter mapping cells such as 182 in the range dimension . in the azimuth dimension for the 2 . 8125 ° intervals there are 128 area clutter mapping cells . referring now to fig7 which shows a typical acm cell 182 , it includes 16 range bins in the range dimension and 28 radar sweeps in the azimuth dimension . in the illustrated system a range bin represents a quarter mile and in the azimuth dimension each sweep covers an angle equal to 2 . 8125 ° divided by 28 or approximately 1 / 10th of a degree . in the last sweep passing through any acm cell , the timing signal z t is developed in a last range bin 186 for presetting the stored contents in the temporary memory 130 for that cell and for other timing control throughout the system . referring now to fig8 a word 190 shows the storage of the ca ( clutter amplitude ) or reject code in the first four bits in the storage cell of the memory with the stc count stored in the last six bits , this word 190 representing the clutter information stored in the main memory 120 for each acm cell of the entire surveillance area 181 as shown in fig6 . it is to be noted that a single word such as 190 represents the clutter condition in the entire clutter mapping quantum area such as 82 although targets are possibly detected in a number of range bins and in a number of sweeps . referring now to fig9 which shows the temporary memory 130 and the target amplitude write control unit 162 for determining the maximum target amplitude signal mta . the address control 136 responds to a pulse representative of the four mile range bin count for continually addressing the storage cell represetative of an acm cell during the period of 16 range dimensions for storing the maximum target amplitude signals in each of 64 cells , or quantum areas , and has an azimuth dimension of one cell , the total storage being four bits in each acm cell . the on - time target amplitude signal ta on the lead 26 is applied to a comparator 200 which for every range bin in each sweep receives the stored target amplitude from the temporary memory 130 that represents the entire cell . the read register and the write register each respond to a range bin clock so that reading and writing of the target amplitude signal for the entire acm cell occurs for each range bin . when the comparison in the comparator 200 is true the stored target amplitude is greater than or equal to the on time target amplitude , a signal is applied through a lead 202 to an and gate 204 and in coincidence with a stored target of any amplitude applied from the read register 134 through a lead 206 , a signal is applied through an or gate 210 to a lead 212 and in turn through an and gate 214 also receiving a z t timing signal , to apply a maximum target amplitude or mta signal to the output lead 163 . when a comparison is not true on the lead 202 , a signal is applied through an inverter 218 to an and gate 220 so that an on - time target signal ta on the lead 26 causes a signal to be applied through the or gate 210 and to the and gate 214 as the maximum amplitude target representing the detection of a larger target in a range bin of the mapping cell . the operation occurs for 28 sweeps by sequentially interrogating in each sweep all 64 acm cells and at the time of reading the stored word from the range bin of the last sweep for each acm cell the z t signal is true and is applied through an inverter 224 to the and gate 226 which writes zeros into that cell of the memory 130 through the write register 132 so as to clear the temporary memory for the next scan position . prior to this z t time range bin , the and gate 226 responds to the signal on the composite lead 212 to write the maximum target amplitude into the temporary memory 130 for each range bin . referring now to fig1 the stc or target counter unit 140 will be explained relative to the operation of the main memory 120 . the write register 124 and the read register 126 both operate in response to a range bin clock to read and write during each range bin of each sweep of each of the acm cells . the address control unit 128 responds to a four mile signal and a 2 . 8125 ° azimuth signal for addressing a single cell in the main memory 120 representative of the stored reject code and the stc count for that acm cell . the stc count read from the main memory 120 during each range bin is applied to a lead 240 and for incrementing stored stc count during the first or clutter searching mode an adder 242 is coupled to the lead 240 for receiving the stored count and to a source 244 of the binary value of decimal + 8 to apply the increased count to an and gate 246 which in coincidence with an a term applies the count to an or gate 248 and in turn to an and gate 250 . in the presence of an f term applied to the and gate 150 indicating that the count is not to be set to zero , the increased or other count is applied through a lead 254 to the write register 124 for being written into that acm cell during that range bin period . during any range bin period for incrementing the stored count by four which occurs in mode 2 which is the searching for clutter amplitude change when the stored reject code is greater than zero , an adder 156 is coupled to the lead 240 and receives a + 4 value from a source 258 to apply the increased count to an and gate 260 which in coincidence with a b term applies the increased count to the or gate 248 for being written into the memory 120 . for decrementing by one the stored count during any range bin which occurs in mode 2 for a stored reject code greater than zero and a target amplitude less than that of the reject code , a subtractor 266 is coupled to the lead 240 and to a + 1 value source 268 to apply a decremented count to an and gate 270 which in coincidence with a c term applies the decrementative count to the or gate 248 for being written into the main memory 120 . for mode 1 operation with the absence of a target in the temporary memory or for mode 2 with the target amplitude equalling the amplitude of the reject code , and and gate 274 is coupled to the lead 240 to provide no change to the stored target count in the presence of a d term and to apply the same value to the or gate 248 to be written into the main memory 120 . when it is desired to set the target count to one - half of the stc threshold and and gate 276 receives a one - half stc threshold value from the threshold setting unit 150 and in coincidence with a term e , writes this one - half threshold count into the main memory 120 . for determining the stct signal which is true when the stored stc count equals the stc threshold from the unit 150 a comparator 280 is coupled to the lead 240 and applied an stct signal to an output lead 147 . the comparator 280 may be formed from a fairchild semiconductor comparator five bit 93l24 interconnected as recommended in the ttl applications handbook of fairchild semiconductors dated august 1973 . the z t timing signal is generated by an and gate ( not shown ) receiving inputs from a first input and gate responding to the least to the most significant bits of the 16 range bin count for each sweep of each acm cell , and from a second input and gate responding to the least to the most significant bits of a sweep count representing the 28 sweeps of an acm cell . the output of the first and gate represents the last range bin of each acm cell and the output of the second and gate represents the last sweep of each acm cell . the stc counter terms a to f , utilized in fig1 may be provided by logic circuits interchanged in accordance by any suitable arrangement as is well known in the art to provide the following logical relationships : __________________________________________________________________________ (+ 8 ) a = ( sct ) ( cao ) ( mtao ) ( z . sub . t )(+ 4 ) b = ( cao ) ( mtg ) ( z . sub . t )(- 1 ) c = ( cao ) ( mtl ) ( z . sub . t )( 0 ) d = ( cao ) ( mte ) ( z . sub . t ) + ( sct ) ( cao ) ( mtao ) ( z . sub . t )( set stc e = ( cao ) ( mtao ) ( stct ) z . sub . t [ clutter presence detected ] to 1 / 2of stc + ( cao ) ( mtg ) ( stct ) z . sub . t [ clutter amplitude decreasethreshold detected ] + ( cao ) ( mtl ) ( stco ) z . sub . t [ clutter amplitude decrease detected ]( resets f = ( cao ) ( sct ) z . sub . t + ( cao ) ( mtao ) ( stco ) z . sub . t [ clutterto 0 ) faded ] __________________________________________________________________________ the cao term for the stc counter 140 indicating that the reject code is zero , may be formed in a suitable and gate receiving the stored ca bits ca1 , ca2 , ca3 and ca4 from the main memory after being applied through respective inverters 255 to 258 . the mtao signal ( indicating that the maximum target amplitude is zero ) which may be considered in the write control circuit 62 , may be developed from the ta bits from the temporary memory ta1 , ta2 , ta3 and ta4 . the count or stc bits s1 , s2 , s3 , s4 , s5 and s6 may be applied through suitable inverters ( not shown ) to and gate for developing the signal stco indicating that the stc count is equal to zero . a suitable comparator ( not shown ) responds during each range bin period to the target amplitude signals ta1 , ta2 , ta3 and ta4 and to the reject code ca1 , ca2 , ca3 and ca4 to develop the signal mtg which is true when ta is greater than ca , the signal mte which is true when ta equals ca and mtl which is true when ta is less than ca . referring now to fig1 , the ca write control circuit 144 has an and gate 390 responding during each range bin period to the ca code from the read register 126 and the signal stct indicating the absence of target count having reached its threshold , to apply the reject code through an or gate 392 to be written into the main memory 120 through the write register 124 during that range bin period . the ca signal supplied to the target threshold circuit 46 of fig1 is applied thereto through the leads 48 and 50 for rejecting target signals in the presence of clutter . an and gate 396 responds to the maximum target amplitude signal mta , the signal stct indicating the target count has reached its threshold and the timing signal z t to write the maximum target amplitude into the main memory 120 from the temporary memory at time z t . referring now principally to fig5 the operation of the automatic clutter system will be explained in further detail . the following table shows the control of the clutter count and of the reject code ca in the memory 120 for both searching for the presence of clutter in mode 1 and for searching for clutter amplitude changes in mode 2 . ______________________________________main memory write at z . sub . t time______________________________________stc searching for clutter - mode 1 searching for clutter amplitude changefor stored ca = 0000 for stored ca ≠ 0000increment by 8 for mta in increment by 4 fortemp . mem . ≠ 0000 - ta & gt ; ca . if stc thresholdrecirculate ca = 0000 is reached , write new mta into ca . if increment of stc causesstc threshold to be no change if ta = caexeeeded , set stc to 1 / 2 threshold - write mta into ca . stc no increment if mta in decrement by 1 iftemp . mem . = 0000 . if ta & gt ; ca . at stc = 0 , scan count = max . ( 44 ), write new ta into ca . reset stc to 0 - recirculate if new ta = 0000ca = 0000 . ( clutter gone ) revert to mode 1 . ______________________________________ in the first mode when ca equals 0000 the a logic increments the stc word by eight for the largest target amplitude in the temporary memory and recirculates the reject code ca equal to 0000 . when the word stc is incremented to cause it to reach the stc threshold the stc word is then set to one - half threshold by the e logic and the mta is written into the main memory at that quantum area cell for the ca reject code . if there are no detections of a target for an area cell , the mta in the temporary memory is equal to 0000and the stc word is not incremented . if the scan count equals its maximum value of 44 , the stc word is reset to zero . also , for this condition , the ca reject code 0000 is recirculated . for a stored reject code ca which is not equal to 0000 indicating the system is searching for clutter amplitude change , the stc word is incremented by four as a result of the b logic when the target amplitude is greater than ca . when the stc threshold for any area cell is reached , a new mta is written into main memory as the ca reject code . the stc count is not changed if the target amplitude equals the value of the ca reject code . the stc count is decremented by one in the mode 2 if target amplitude is less than ca which is performed by the c logic as previously described . the following example shows the operation of the system for a scan count of 44 showing the value of the target amplitude ta , target count stc and the reject code ca . ______________________________________example : scan counter & amp ; scan number ta stc ca______________________________________ 1 0000 0 . sub . ( 10 ) 0000 2 0011 8 . sub . ( 10 ) 0000mode i 3 0011 16 . sub . ( 10 ) 0000 4 0011 24 . sub . ( 10 ) 0000 5 0011 32 . sub . ( 10 ) 0000clutter 6 0011 40 . sub . ( 10 ) → 20 . sub . ( 10 ) 0000 → 0011detected 7 0011 20 . sub . ( 10 ) 0011 8 0011 20 . sub . ( 10 ) 0011 9 0011 20 . sub . ( 10 ) 0011 10 0101 24 . sub . ( 10 ) 0011 11 0101 28 . sub . ( 10 ) 0011 12 0101 32 . sub . ( 10 ) 0011 13 0101 36 . sub . ( 10 ) 0011clutter taincrease 14 0101 40 . sub . ( 10 ) → 20 . sub . ( 10 ) 0011 → 0101detected 15 0101 20 . sub . ( 10 ) 0101 16 0101 20 . sub . ( 10 ) 0101mode ii 17 0001 16 . sub . ( 10 ) 0101 18 0001 12 . sub . ( 10 ) 0101 19 0001 8 . sub . ( 10 ) 0101 20 0001 4 . sub . ( 10 ) 0101clutter tadecrease 21 0001 0 . sub . ( 10 ) → 20 . sub . ( 10 ) 0101 → 0001detected 22 0001 20 . sub . ( 10 ) 0001 23 0001 20 . sub . ( 10 ) 0001 24 0001 20 . sub . ( 10 ) 0001mode ii 25 0000 16 . sub . ( 10 ) 0001 26 0000 12 . sub . ( 10 ) 0001 27 0000 8 . sub . ( 10 ) 0001 28 0000 4 . sub . ( 10 ) 0001clutterfade 29 0000 0 → 0 0001 → 0000detected 30 0000 0 0000 31 0000 0 0000 32 0000 0 0000 33 1111 8 . sub . ( 10 ) 0000validtarget 34 1111 16 . sub . ( 10 ) 0000present 35 1111 24 . sub . ( 10 ) 0000 36 0000 24 . sub . ( 10 ) 0000 37 0000 24 . sub . ( 10 ) 0000 38 0000 24 . sub . ( 10 ) 0000mode i 39 0000 24 . sub . ( 10 ) 0000 40 0000 24 . sub . ( 10 ) 0000 41 0000 24 . sub . ( 10 ) 0000 42 0000 24 . sub . ( 10 ) 0000 43 0000 24 . sub . ( 10 ) 0000scancounter 44 0000 24 . sub . ( 10 ) → 0 . sub . ( 10 ) 0000thresholdreached______________________________________ in this example the stc threshold is 40 and the midrange stc threshold setting is 20 with the example being for a single acm cell in the clutter mapper memory 20 . during scans one to five which is operation in mode 1 input target signals ta are detected while ca remains 0000 until scan 6 at which time the stc count reaches the stc threshold of 40 and is reset to 20 with the maximum target amplitude being written into the main memory as the ca code of 0011 . the operation which during scan 6 goes into the second mode or clutter amplitude detection mode continues to scan 14 at which time the stc count again reaches the threshold is set to half of its threshold value and a new reject code 0101 is written into the main memory for that clutter mapper cell . the stc count is again increased by 8 as a result of target signals being received until at scan 21 the stc threshold is again reached the stc count being reset to half of threshold and a new ca reject code of lesser amplitude being written into the main memory . at this point in time , the clutter signals decrease or the clutter received by the radar is starting to fade and at scan 29 the stc count has been decremented by one until it reaches zero and the reject code ca is set to 0000 so that the operation goes back into mode 1 for clutter searching . during scans 33 , 34 and 35 , valid targets are present but the stc count only increases to decimal 24 and the system remains in the mode 1 operation for that clutter mapper cell . at scan 44 the scan counter threshold is reached and the stc count is reset to zero and the ca reject code of 0000 is recirculated . it is to be noted that the scan counter threshold resets the stc count only in mode 1 . the operation continues for that acm cell from this point with a new scan count of one . the illustrated example of fig5 provides clutter amplitude ca which is utilized in each acm mapper unit 20 and 22 of fig1 to inhibit invalid targets . however , the principles of the invention are not limited to any particular clutter determining system and may use any suitable arrangement such as a statistical clutter count of two out of three or four out of five for clutter detection or a clutter amplitude averaging technique with scan to scan smoothing . in another arrangement , in accordance with the invention , each acm mapper unit may provide an inhibit bit with either bit inhibiting a target signal as shown in fig4 . an illustrative example of a mapper system that provides a single inhibit bit for each quantum area is shown in fig1 which is shown in further detail in u . s . pat . no . 3 , 325 , 806 , video mapping device by r . d . wilmot et al , issued june 13 , 1967 . the clutter mapper unit operates in response to target and no target reports generated by the target detector memory 18 of fig1 and utilized in a write control and recirculate apparatus 400 . the acm unit may include a core memory 430 having associated write register 431 , write amplifier 432 together with sense amplifier 433 and read register 434 . the core memory 430 has , by way of example , 1024 words each of 12 bits . two bits of the 12 bits in each of the 1024 words are allocated to a 60 ° segment of the visual display . thus , for example , bits 1 , 2 ; 3 , 4 ; 5 , 6 ; 7 , 8 ; 9 , 10 ; and 11 , 12 of each 12 - bit word are allocated to the 60 ° segments 1 , 2 , 3 , 4 , 5 and 6 , respectively , of the area . further , the 1024 words of the memory 430 are divided into 16 groups of 64 words each . each of the 16 groups represents a single quantum sector which is 1 / 16 of 60 ° or 3 . 75 ° in azimuth . in the surveillance radar as illustrated , the range is 160 miles . thus , the 64 words in each 3 . 75 ° sector correspond to 160 miles , whereby each quantum area is 2 . 5 miles in range . it is , therefore , evident that the core memory 430 divides up the entire visual display into quantum areas 3 . 75 ° in azimuth and 2 . 5 miles in range with two bits in each word being allocated to each quantum area in the display . the core memory 430 is programmed by a memory address control 436 which operates in response to a range count input signal and an azimuth position signal available on leads 437 and 438 , respectively , from the radar transmitter - receiver 10 and in response to a 60 ° segment counter 440 . the 60 ° segment counter 440 , in turn , operates in response to the azimuth position signal available from the radar transmitter - receiver 10 . in general , the memory address control addresses the 1024 words of memory 30 every 60 °, with each group of 64 words being addressed by the number of times that there are azimuth sweeps in each quantum area of the visual display before proceeding to the next group of 64 words . by way of example , a typical radar system has one azimuth sweep for each 0 . 1 ° through each quantum area of the visual display . to create the proper timing for the memory recirculation , the memory address control 436 delays the write address by one count from the read address . this means that during the first range bin of the quantum area the data in a word m is transferred from the memory 430 to the read registers 434 , and during this same clock period , the data in the write register 431 is written into memory 430 at address ( m - 1 ) because the data contained in write register 431 was sampled in the last range bin of the previous quantum area whose address was ( m - 1 ). the write control and recirculate logic apparatus 400 operates in response to a 60 ° segment count signal from 60 ° segment counter 440 and from target reports from target detector memory 218 . the apparatus 400 recirculates without change each word of the core memory 430 corresponding to the five 60 ° segments of the visual display not being updated back to the write register 431 . during the updating scans , the two bits in each word of the core memory 430 corresponding to the segment under survelliance are passed through recirculate logic , and returned to write register 431 of core memory 430 . the two bits corresponding to the segment of the visual display being updated are designated as &# 34 ; a n - recirculate &# 34 ; and &# 34 ; b n - recirculate .&# 34 ; the b n - recirculate signal constitutes information concerning the initial appearance of one or more targets in the quantum areas of 3 . 75 ° sectors of the 60 ° segment and is used only in the automatic mode of operation . the a n - recirculate signal , on the other hand , constitutes inhibit information for both the automatic and manual operation . the operation of this type of acm mapper unit is further explained in the above - referenced u . s . pat . no . 3 , 325 , 806 and will not be explained in further detail . the inhibit control of a n - recirculate bit from each acm mapper unit of fig1 is applied to the or gate 106 of fig4 to inhibit clutter from passing through the and gate 108 . thus , there has been described an area overlap mapper system that rejects scintillating position clutter near the boundaries of the acm cells . the principles of the invention are not limited to any particular type of acm mapper unit and further may operate either by a comparison of mapper clutter amplitude or of inhibit bit or bits indicating clutter in certain area mapping cells . the overlap mapping concept in accordance with the invention has been found to substantially increase the amount of rejected clutter . the concepts of the invention are illustrated in a surveillance radar system but are equally applicable to any type of suitable system other than surveillance type and are applicable to radar or any interrogating system such as a laser systems or infrared systems .	6
embodiments of the present invention will now be described , which however shall not be construed as limiting the scope of the present invention . a resin composition of the present invention contains a predetermined polyoxazolidone resin ( a ), and optionally contains a flame retardant ( b ), and thermosetting resin ( c ) having three or more functional groups . a film or cured film of the resin composition is significantly superior in flexure fatigue life as well as is superior in heat resistance and processability . as long as polyoxazolidone resin ( a ) contains the oxazolidone structure , there are no particular limitations on the other structures of the polyoxazolidone resin . a polyoxazolidone resin having a repeat unit represented by the following general formula ( 1 ) can be exemplified . in general formula ( 1 ), r 1 and r 2 are independently c 1 - 60 divalent organic group . a specific example of r 1 is a group represented by any of the following formulas ( i ) to ( iv ): ( i ) — ch 2 — o — ar — o — ch 2 — ( where ar is a divalent aromatic group ); ( ii ) — ch 2 — oco — ar — coo — ch 2 — ( where ar is a divalent aromatic group ); ( iii ) — ch 2 — o — x — o — ch 2 — ( where x is a divalent aliphatic group ); and ( iv ) — ch 2 — oco — x — coo — ch 2 — ( where x is a divalent aliphatic group ). specific examples of the divalent aromatic group represented by ar in formulas ( i ) and ( ii ) include groups represented by the following formulas ( a ) and ( b ) and general formula ( c ). in general formula ( c ), y is a single bond , — ch 2 —, — o —, — s —, — so 2 —, — c ( ch 3 ) 2 —, or a moiety represented by the following formula ( c - 1 ): in formulas ( i ) and ( ii ), the divalent aromatic group represented by ar may have an alkyl group such as methyl or ethyl group ; and / or a halogen atom such as chlorine or fluorine . specific examples of the divalent aliphatic group represented by x in formulas ( iii ) and ( iv ) include a c 2 - 15 straight or branched alkylene group , a c 8 - 50 polyoxyalkylene group , and a c 2 - 50 unsaturated hydrocarbon group . specific examples of r 2 in general formula ( 1 ) include a c 6 - 20 divalent aromatic group ; a c 1 - 60 , preferably c 1 - 20 , divalent aliphatic group ; and a c 4 - 20 divalent alicyclic group . the “ c 6 - 20 divalent aromatic group ” among the specific examples of r 2 is preferably a group represented by any of the following formulas ( d ) to ( f ) and the general formula ( g ). in general formula ( g ), a is a single bond , — ch 2 —, or — c ( ch 3 ) 2 —. the aromatic ring of these aromatic groups may have one to four c 1 - 6 alkyl groups attached . the “ c 1 - 60 divalent aliphatic group ” among the specific examples of r 2 in general formula ( 1 ) is preferably a straight or branched alkylene such as methylene , tetramethylene , pentamethylene or 2 , 2 , 4 ( or 2 , 4 , 4 )- trimethyl - 1 , 6 - hexylene , or a group represented by the following formula ( h ). the “ c 4 - 20 divalent alicyclic group ” among the specific examples of r 2 in general formula ( 1 ) may be any of monocyclic , polycyclic and bridged cyclic groups . the “ c 4 - 20 divalent alicyclic group ” among the specific examples of r 2 is preferably a group represented by the following formula ( i ), ( j ), ( m ) or ( n ) or a group represented by the following general formula ( k ) or ( l ). r ′ and r ″ in general formula ( k ) are independently a c 1 - 4 alkylene group . a ′ in general formula ( 1 ) is a single bond , — ch 2 —, or — c ( ch 3 ) 2 —. in general formula ( 1 ), each r 3 is independently hydrogen or c 1 - 6 hydrocarbon group such as methyl or ethyl group . the polyoxazolidone resin ( a ) may be terminated with an epoxy group or — nhr 4 at a chain end , where r 4 is hydrogen or — coor 5 . r 5 is a c 1 - 12 alkyl group , a c 1 - 12 alkoxyalkyl group , or a c 1 - 12 monovalent organic group represented by r a —( or b ) m -, where r a is an alkyl group , r b is an alkylene group , and m is an integer of 1 - 11 . the repeat unit represented by general formula ( 1 ) in polyoxazolidone resin ( a ) preferably comprises 30 mol % or more , more preferably 50 mol % or more , of the total repeat units . when the amount of the repeat unit represented by general formula ( 1 ) is less than 30 mol % in the polyoxazolidone resin , the stiffness of a film made of the resin composition may be compromised , as well as heat resistance may be reduced and flexural fatigue life may be significantly reduced . the number of the repeat unit represented by general formula ( 1 ) contained in one molecule of polyoxazolidone resin ( a ) is preferably 30 or more , more preferably 50 or more , when the number of the repeat unit is too small , stiffness and / or heat resistance of polyoxazolidone resin ( a ) decrease , and the flexural fatigue life of a film made of the resin composition shortens as well . the weight - average molecular weight of polyoxazolidone resin ( a ) is 3 × 10 4 or more , preferably 3 × 10 4 to 2 × 10 5 , and more preferably 5 × 10 4 or more . by employing polyoxazolidone resin ( a ) having a weight - average molecular weight of 3 × 10 4 or more , the flexural fatigue life of a film made of the resin composition significantly improves . the molecular weight of polyoxazolidone resin ( a ) can be controlled for example by the numbers of equivalents of isocyanate and epoxy groups , the number of isocyanate and epoxy groups , or reaction conditions . by controlling the molecular weight of polyoxazolidone resin ( a ) it is also possible to appropriately adjust the tackiness and / or thermal bonding property of a film made of the resin composition . polyoxazolidone resin ( a ) containing the repeat unit represented by general formula ( 1 ) can be produced by the reaction of a dicarbamate compound represented by the following general formula ( 2 ) with a diepoxy compound represented for example by the following general formula ( 3 ): r 1 to r 3 in general formulas ( 2 ) and ( 3 ) are defined the same as those in general formula ( 1 ). r 5 in general formula ( 2 ) is a c 1 - 12 alkyl group , a c 1 - 12 alkoxyalkyl group , or a c 1 - 12 monovalent organic group represented by r a —( or b ) m -, where r a is an alkyl group , r b is an alkylene group , and m is an integer of 1 - 11 . the dicarbamate compound represented by general formula ( 2 ) can be produced by reacting the corresponding diisocyanate compound with a blocking agent to block the isocyanate group of the diisocyanate compound . as the diisocyanate compound , for example , aromatic , aliphatic and alicyclic diisocyanates can be used . specific examples of the aromatic diisocyanate include tolylene diisocyanate ( tdi ), 4 , 4 ′- diphenylmethane diisocyanate ( mdi - ph ), 1 , 5 - naphthalene diisocyanate ( ndi ), 3 , 3 ′- dimethyldiphenyl - 4 , 4 ′- diisocyanate ( todi ), o - xylylene diisocyanate , m - xylylene diisocyanate , and p - xylylene diisocyanate . aliphatic and alicyclic diisocyanates are a class of compounds having isocyanate groups bound to methylene , methine or isopropylidene . specific examples of the aliphatic and alicyclic diisocyanates include a c 4 - 18 ( preferably c 5 - 14 , more preferably c 6 - 12 ) aliphatic diisocyanate such as tetramethylene diisocyanate , pentamethylene diisocyanate , hexamethylene diisocyanate ( hdi ), 2 , 2 , 4 ( or 2 , 4 , 4 )- trimethyl - 1 , 6 - diisocyanatohexane , and lysine diisocyanate ; a c 8 - 22 ( preferably c 8 - 18 , more preferably c 8 - 16 ) alicyclic diisocyanate such as isophorone diisocyanate ( ipdi ), 1 , 4 - diisocyanatocyclohexane , 1 , 3 - bis ( isocyanatomethyl )- cyclohexane , 1 , 4 - bis ( isocyanatomethyl )- cyclohexane , 1 , 3 - bis ( 2 - isocyanatopropyl - 2 - yl )- cyclohexane , 4 , 4 ′- dicyclohexylmethane diisocyanate , norbornane dimethyl diisocyanate , and norbomane diisocyanate ; and a c 8 - 22 ( preferably c 8 - 18 , more preferably c 8 - 16 ) aromatic ring - containing aliphatic diisocyanate such as tetramethyl xylylene diisocyanate and xylylene diisocyanate . as the blocking agent , monoalcohols can be employed . specific examples of the monoalcohols include methanol , ethanol , propanol , isopropyl alcohol , n - butanol , 2 - ethylhexanol , butyl cellosolve , and polyethylene glycol monoethyl ether . in particular , 2 - ethylhexanol , butanol , and isopropanol are preferable . these monoalcohols can be used alone or in combination . the amount of the blocking agent to be reacted with the diisocyanate compound may be equal to or smaller than the equivalent of isocyanate groups on the diisocyanate compound . however , even when an amount of the blocking agent is used that is greater than the equivalent of the isocyanate groups , unreacted blocking agents ( monoalcohol ) can be recovered . the reaction temperature of the diisocyanate compound with blocking agent is typically 20 - 150 ° c . typically , the diisocyanate compound and blocking agent are reacted together , and then the resultant dicarbamate compound is allowed to undergo a condensation reaction with the diepoxy compound . alternatively , the diisocyanate compound may be added to a mixture of the diepoxy compound and blocking agent allowing the diisocyanate compound to be reacted with the blocking agent in the system so that the resultant dicarbamate compound undergoes a condensation reaction with the diepoxy compound . as the diepoxy compound , for example , diglycidyl ethers , diglycidyl esters , linear aliphatic epoxides , and alicyclic epoxides can be employed . specific examples of the diglycidyl ethers include bisphenol epoxy resins prepared by diglycidylation of such bisphenols as bisphenol a , bisphenol f , bisphenol ad , bisphenol s , tetramethyl bisphenol a , tetramethyl bisphenol f , tetramethyl bisphenol ad , tetramethyl bisphenol s , tetrabromobisphenol a , tetrachloro bisphenol a , and tetrafluoro bisphenol a ; and epoxy resins prepared by diglycidylation of such divalent phenols as biphenol , dihydroxy naphthalene , 9 , 9 - bis ( 4 - hydroxyphenyl ) fluorene , resorcinol , hydroquinone , and diglycidyl ether of o -, m -, or p - phthalic acid . specific examples of the diglycidyl esters include diglycidyl terephthalate , diglycidyl phthalate , and diglycidyl esters of hexahydrophthalic acid or dimer acid . specific examples of the linear aliphatic epoxides include diglycidyl ethers of c 2 - 15 alkanediol or c 8 - 50 polyalkylene glycol , neopentyl glycol diglycidyl ether , epoxidized polybutadiene , and epoxidized soybean oil . specific examples of the alicyclic epoxides include 3 , 4 - epoxy - 6 - methylcyclohexyl carboxylate , 3 , 4 - epoxycyclohexylcarboxylate , and products under the tradename “ celloxide 2021 ” and “ celloxide 3000 ” both manufactured by daicel corporation . the reaction between the dicarbamate compound and diepoxy compound may be accomplished by heating a mixture of the two compounds in the presence of a catalyst . in this reaction , the mole ratio of the dicarbamate compound to the diepoxy compound is preferably set within a desired range . more specifically , the dicarbamate compound is preferably added in an amount of 0 . 8 - 1 . 2 moles per 1 mole of diepoxy compound ( per two equivalents of epoxy groups ). when the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) is less than 0 . 8 , crosslinking of the diepoxy compound is facilitated which may result in the resultant resin ( a ) ( polyoxazolidone ) having a low molecular weight and being gelated . when the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) exceeds 1 . 2 , production of allophanate compounds derived from the excessive dicarbamate compound is facilitated which may result in the resultant resin ( a ) having insufficient heat resistance . more preferably , the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) is set to 0 . 9 - 1 . 2 . reacting the mixture of the dicarbamate compound and diepoxy compound in the above - described mole ratio under heating in the presence of a catalyst affords a polyoxazolidone terminated with an alkylcarbamate group at a chain end . the reaction can be carried out either in the absence of any solvent or in an aprotic polar solvent . specific examples of the aprotic polar solvent include n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide ( dmac ), n - methyl - 2 - pyrrolidone ( nmp ), tetrahydrofuran ( thf ), ethylene glycol dimethyl ether , ethylene glycol diethyl ether , ethylene glycol dipropyl ether , ethylene glycol ethylmethyl ether , diglyme ( diethylene glycol dimethyl ether ), diethylene glycol diethyl ether , propylene glycol dimetyl ether , propylene glycol diethyl ether , dipropylene glycol dim ethyl ether , cyclopentanone , cyclohexanone , 1 , 4 - dioxane , dimethyl sulfoxide ( dmso ), methyl isobutyl ketone , methyl cellosolve acetate , ethyl cellosolve acetate , propyl cellosolve acetate , butyl cellosolve acetate , propylene glycol monomethyl ether acetate , propylene glycol monoethyl ether acetate , and propylene glycol monopropyl ether acetate . the aprotic polar solvents can be used alone or in combination . nonpolar solvents which are compatible with the aprotic polar solvents can be used in combination . examples of the nonpolar solvent include aromatic hydrocarbons such as toluene , xylene , mesitylene , and solvent naphtha . a mixture of the aprotic polar solvent and nonpolar solvent preferably contains no greater than 30 wt % of the nonpolar solvent . a nonpolar solvent content of greater than 30 wt % reduces the dissolving power of the solvent which may cause precipitation of the polyoxazolidone . mixing of the dicarbamate compound and diepoxy compound may be accomplished by adding dropwise either stepwise or continuously the dicarbamate compound as it is or mixed with a solvent into the diepoxy compound which is pre - heated to an appropriate temperature . the catalyst may be pre - mixed with the dicarbamate compound . the dicarbamate compound is typically added dropwise over 30 minutes or longer , preferably 1 - 10 hours , and still more preferably 2 - 5 hours . when the addition time is too short , the concentration of the dicarbamate compound becomes non - uniform in the system , which may cause unwanted side reactions . on the other hand , when the addition time is too long , the self - reaction of the diepoxy compound may be facilitated . the reaction temperature is typically 100 - 230 ° c ., preferably 150 - 200 ° c ., and more preferably 160 - 180 ° c . when the reaction temperature is too high , the raw material may easily undergo self - reactions . on the other hand , when the reaction temperature is too low , the reaction is not easily completed which may make it difficult to increase the molecular weight of the resultant polyoxazolidine to a sufficiently high level . moreover , when the reaction temperature is too low , production of resin which has abundant isocyanurate rings is facilitated which may reduce the resultant resin &# 39 ; s physical properties such as flexibility and / or adhesion . the reaction time is typically 1 - 15 hours , preferably 2 - 10 hours , and more preferably 4 - 8 hours . examples of the catalyst include metal alcoholates such as lithium butoxide and sodium methoxide ; lewis acids such as lithium chloride and aluminum chloride ; mixtures of the above - mentioned lewis acids and lewis bases such as biphenyl phosphine oxide ; quarternary ammonium salts such as chloride , bromide , iodide or acetate of tetramethylammonium , tetraethylammonium , tetrabutylammonium , trilaurylmethylammonium , and benzyltributylammonium ; tertiary amines such as triethylamine , dibutylmethylamine , n , n - dimethylbenzylamine , n , n , n ′, n ′- tetramethylethylenediamine , 1 , 5 - diazabicyclo ( 4 , 3 , 0 ) nonene - 5 , 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undecene - 77 ( dbu ), 6 - dibutylamino - 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undecene - 7 , 1 , 4 - diazabicyclo [ 2 . 2 . 2 ] octane , and n - methylmorpholine ; and imidazoles such as 1 , 2 - dimethylimidazole , 1 - benzyl - 2 - phenylimidazole , 1 - benzyl - 2 - methylimidazole , 2 - undecylimidazole , 2 - heptadecylimidazole , 2 - ethyl - 4 - methylimidazole , 1 - cyanoethyl - 2 - ethyl - 4 - methylimidazole , 1 - cyanoethyl - 2 - methylimidazole , and 2 - phenylimidazole . among the above - described catalysts , 1 , 2 - dimethylimidazole , 1 - benzyl - 2 - phenylimidazole , 2 - heptadecylimidazole , 1 - cyanoethyl - 2 - ethyl - 4 - methylimidazole , and 1 - cyanoethyl - 2 - methylimidazole are preferable because of their high activity in the temperature range within which an oxyzolidone ring is formed . these catalysts can be used alone or in combination . the amount of catalyst used is typically 0 . 005 - 0 . 2 mol %, preferably 0 . 01 - 0 . 1mol %, with respect to the carbamate group . a dissociation promoter that promotes the dissociation of the blocking agent can be used in combination with the catalyst . examples of the dissociation promoter include salts of organic metals such as tin , zinc , and lead . the amount of dissociation promoter used is typically 0 . 005 - 0 . 1 mol % with respect to the carbamate group . a polyoxazolidone terminated with a primary amino group (— nh 2 ) at a chain end can be produced by reacting together the dicarbamate compound and diepoxy compound , followed by hydrolysis . the resin composition may contain various types of additives for conferring required characteristics to a film made of the resin composition . for example , addition of flame retardant ( b ) can provide a film having superior flame retardancy . examples of flame retardant ( b ) include halogen - containing compounds , phosphorus - containing compounds , and inorganic flame retardants , with phosphorus - containing compounds being preferable . when a phosphorus - containing compound is used as flame retardant ( b ), the resin composition is advantageously free from halogen atoms , and further advantageously , the processability of the resin composition and the flexural fatigue life of a film made of the resin composition improve . specific examples of the phosphorus - containing compounds include phosphazene compounds , 9 , 10 - dihydro - 9 - oxa - 10 - phosphaphenanthrene 10 - oxide ( hca ), 9 , 10 - dihydro - 9 - oxa 10 -( 2 , 5 - dihydroxyphenyl ) phosphaphenanthrene - 10 - oxide ( hca - hq ), n - butylbis ( 3 - hydroxypropyl ) phosphine oxide , n - bis ( 2 - hydroxycarbonylethyl ) phosphine oxide , diglycidylphenyl phosphine oxide , triglycidoxy methyl phosphine oxide , diglycidoxy phenyl phosphine oxide , triglycidyl ether of tri ( 3 - hydroxypropyl ) phosphine oxide , diglycidyl ether of di ( 3 - hydroxypropyl ) 2 - methyl phosphine oxide , tris ( p - glycidoxyphenynoxy ) phosphine oxide , dialkyl ( 2 , 5 - dihydroxyphenyl ) phosphine oxide ( where “ alkyl ” is a c 1 - 12 aliphatic alkyl ), and diphenylphosphinyl hydroquinone . these phosphorus - containing compounds can be used alone or in combination . an adduct of a particular compound with the above - described phosphorus - containing compound can also be used as flame retardant ( b ). specific examples of such an adduct include an adduct of triglycidyl ether of 4 , 4 ′-[ 1 -[ 4 -[ 1 -( 4 - hydroxyphenyl )- 1 - methyl ethyl ] phenyl ] ethylidene ] bisphenol with hca ; an addition copolymer of triglycidyl ether of 4 , 4 ′-[ 1 -[ 4 -[ 1 -( 4 - hydroxyphenyl )- 1 - methylethyl ] phenyl ] ethylidene ] bisphenol with 9 , 10 - dihydro - 9 - oxa - 10 -( 2 , 5 - dihydroxyphenyl ) phosphaphenanthrene - 10 - oxide ( hca - hq ); and an addition copolymer of triglycidyl ether of 4 , 4 ′-[ 1 -[ 4 -[ 1 -( 4 - hydroxyphenyl )- 1 - methylethyl ] phenyl ] ethylidene ] bisphenol with a reaction product of diglycidoxyphenyl phosphine oxide and bisphenol a . the amount of phosphorus atoms in the phosphorus - containing compound or adduct thereof is preferably 1 wt % or more , more preferably 5 wt % or more . by setting the phosphorus atom content to 1 wt % or more , preparing a resin composition having flame retardant effects is made possible . when the phosphorus - containing compound is singly used as flame retardant ( b ), the phosphorus - containing compound is preferably added such that the amount of phosphorus atoms ( p content ) in the resin composition is 0 . 7 - 4 . 0 wt %, more preferably added such that the amount of phosphorus atoms is 1 . 2 - 3 wt %. by setting the phosphorus atom content in the resin composition to 0 . 7 wt % or more , preparing a resin composition having flame retardant effects is made possible . by setting the phosphorus atom content in the resin composition to 4 . 0 wt % or less , it is possible to allow the phosphorus - containing compound to be kept compatible with the resin upon mixing , allowing the resin composition to stably exhibit its characteristics . for example , it is possible to prepare a resin composition that has stable flame retardancy and storage stability as well as high glass transition temperature ( tg ). when the halogen - containing compound is used as flame retardant ( b ), the halogen - containing compound is preferably added in an amount of 0 . 1 - 10 parts by weight in terms of halogen content per 100 parts by weight of the total resin components . when the phosphorus - containing compound is used in combination with one or more other flame retardants , the phosphorus - containing compound is preferably added in an amount of 0 . 1 - 4 parts by weight in terms of phosphorus content per 100 parts by weight of the total resin components . moreover , when the inorganic flame retardant is used as flame retardant ( b ), the inorganic flame retardant is preferably added in an amount of 25 - 150 parts by weight per 100 parts by weight of the total resin components . as flame retardant ( b ), the halogen - containing compound , phosphorus - containing compound , inorganic flame retardant and the like can be used alone or in combination . to the resin composition is preferably added thermosetting resin ( c ) having three or more reactive functional groups in one molecule thereof . addition of thermosetting resin ( c ) increases the resin composition &# 39 ; s adhesion . addition of thermosetting resin ( c ) also enables thermal curing of the resin composition to be carried out at relatively low temperatures ( e . g ., 230 ° c . or below ) and also improves flexural fatigue life of a film made of the resin composition . thermosetting resin ( c ) is preferably a non - thermoplastic resin , and thermosetting resin ( c ) preferably has three to four reactive functional groups in one molecule thereof . the reactive functional group refers to a thermally crosslinkable group ; examples thereof include epoxy group , isocyanate group , acrylic group , vinyl group , allyl group , amino group , carboxyl group , hydroxyl group , aldehyde group , carbonyl group , ester group , and imide . among different types of thermosetting resin ( c ), epoxy resins , thermosetting polyimides , acrylate compounds , and the like are preferable . as the epoxy resins , epoxy resins having three or more epoxy groups in one molecule thereof are preferable . as the thermosetting polyimides , polybismaleimide resins , bt resins , and polyimide resins terminated with nadic acid , and the like can be employed . as the acrylate compounds , acrylate compounds having three or more acrylic groups in one molecule thereof are preferable . these thermosetting resins can be used alone or in combination . the average molecular weight between crosslinks of thermosetting resin ( c ) is preferably 1 . 0 × 10 4 or less , more preferably 5 . 0 × 10 3 or less , addition of thermosetting resin ( c ) having an average molecular weight between crosslinks of 1 . 0 × 10 4 or less may improve the adhesion of the resin composition to various types of adhesion target . moreover , setting the average molecular weight between crosslinks to 1 . 0 × 10 4 or less increases the strength of a film or cured film of the resin composition and therefore improves the film &# 39 ; s flexural fatigue life as well as chemical resistance . the average molecular weight between crosslinks of thermosetting resin ( c ) is calculated using the following equation based on the measured value of its modulus of elasticity ( c ) at 250 ° c . where mc is average molecular weight between crosslink points ( g / mol ), μ is poisson &# 39 ; s ratio ( assumed to be 0 . 5 ), ρ is density ( g / m 3 ), r is gas constant ( 8 . 314 j / k / mol ), t is absolute temperature ( k ), and e ′ is modulus of elasticity ( pa ). the content amount of thermosetting resin ( c ) in the resin composition is preferably 5 - 90 wt %, more preferably 10 - 50 wt %, based on the total amount ( 100 wt %) of the resin components , i . e ., polyoxazolidone resin ( a ) and thermosetting resin ( c ). the adhesion of a film made of the resin composition increases with increasing thermosetting resin ( c ) content . however , when the thermosetting resin ( c ) content is too high , a cured article of the resin composition becomes less flexible which may reduce flexural fatigue life . preferably , additives such as curing agents and / or curing promoters are added to the resin composition in combination with thermosetting resin ( c ). by controlling the added amount of the curing promoter , it is possible to adjust the curing rate of a film made of the resin composition . the resin composition of the present invention can contain “ additional additives ” as needed without compromising the effects of the present invention . examples of the “ additional additives ” include inorganic fillers , antifoaming agents , leveling agents , and surface tension adjusters . examples of the inorganic fillers include silica , alumina , titanium oxide , talc , calcination talc , kaolin , burnt kaolin , mica , clay , aluminum nitride , and glass . addition of a coupling agent to the resin composition together with inorganic fillers will advantageously improve adhesion between the resin components ( including polyoxazolidone resin ( a ) and thermosetting resin ( c )) and the inorganic filler . the amount of the inorganic filler in the resin composition is typically 10 - 150 parts by weight per 100 parts by weight of the total amount of the resin components . the respective amounts of the antifoaming agent , leveling agent and surface tension adjuster in the resin composition are typically 0 . 0005 - 10 parts by weight per 100 parts by weight of the total amount of the resin components . a film made of the above - mentioned resin composition exhibits superior flexural fatigue life as well as superior heat resistance and processability . accordingly , the film is suitable as a protective film for the circuit of printed circuit boards . by employing a film made of the resin composition as the protective film , it is possible to provide a flexible circuit board or a flexible multilayer board that has superior flexural fatigue life . moreover , the film can be laminated onto a printed circuit board without providing any intervening layer such as an adhesive layer , making it possible to slim down the circuit board manufactured . because the film made of the resin composition can also be easily processed , e . g ., stamped , the film can be used as a protective film for the circuit of various types of printed circuit boards . further , since the resin composition has high heat resistance , the film can be used as a protective film that requires reflow heat resistance . after bonded to a circuit board or the like , the film made of the resin composition can maintain in film form without being broken into pieces , making the circuit board or multilayer circuit board in which the film is provided highly reliable . as illustrated in the schematic cross - sectional view depicted in fig1 a , a protective film made of the above - mentioned resin composition is for example film 10 to be disposed in contact with circuit 2 of printed circuit board 3 for protecting circuit 2 . for example , as illustrated in fig1 a , protective film 10 protects circuit 2 of printed circuit board 3 from impacts and the like from the outside and thereby prevents breakage of circuit 2 and / or provides electrical insulation between parts of circuit 2 . as illustrated in fig1 a , the protective film made of the above - mentioned resin composition can be used for example as film 10 laminated onto printed circuit board 3 of circuit board 20 . as illustrated in fig1 b , the protective film can also be used as interlayer dielectric 11 disposed between a pair of printed circuit boards 3 of multilayer circuit board 2 that includes a plurality of printed circuit boards 3 . typically , interlayer dielectric 11 is disposed in contact with circuit 2 ′ that is disposed in a through hole by which adjacent printed circuit boards 3 are coupled . additionally , the protective film made of the above - mentioned resin composition can be used for example as film 10 ′ that is directly laminated on printed circuit board 3 of multilayer circuit board 21 . lamination of the protective film on a printed circuit board or the like is accomplished for example by , as illustrated in fig2 , providing dry film 12 having protective film 10 formed on flexible support 11 and by bonding dry film 12 to printed circuit board 3 or the like . as illustrated in fig2 , the dry film includes for example flexible support ( carrier film ) 11 and protective film 10 disposed on flexible support 11 . on the side remote from flexible support 11 , the dry film may include an overcoat ( not shown ) for protecting protective film 10 . protective film 10 is a layer produced by forming the above - mentioned resin composition into a film , the thickness of protective film 10 is appropriately determined according to the intended application and is typically 5 - 100 μm , preferably 10 - 75 μm , and more preferably 20 - 50 μm , when the protective film has a thickness falling under the above - mentioned ranges , the dry film becomes easy to handle , and moreover , the protective film or protective film in cured form exhibits superior flexural fatigue life . flexible support ( carrier film ) 11 is preferably a film made of less moisture - permeable resin . less moisture - permeable resins usable herein include low density polyethylene , high density polyethylene , polypropylene , polyesters , polyethylene terephthalate , polycarbonate , polyarylate , and ethylene / cyclic olefin copolymers . the thickness of flexible support 11 is typically 15 - 100 μm , preferably 15 - 75 μm . when the thickness of the flexible support falls under the above - described ranges , the resin composition exhibits good coatability and / or adhesion . moreover , thicknesses of the flexible support falling under the above - described ranges not only allows the resultant dry film to be easily rolled up and exhibit improved stiffness , but are advantageous in terms of costs . the overcoat ( not shown ) is preferably made of less moisture permeable resin as with the above - mentioned flexible support . the overcoat needs not to be transparent . desirably , the overcoat can be easily peeled off , with the adhesion between the overcoat and protective film 10 being preferably smaller than the adhesion between flexible support 11 and protective film 10 . preferable examples of the resin constituting the overcoat include ethylene / cyclic olefin copolymers , polyethylene terephthalate , polyethylene , and polypropylene . it only suffices that the thickness of the overcoat is 5 - 100 μm . dry film 12 can be manufactured for example as follows : the resin composition is diluted with a solvent such that the solid content is 30 - 90 wt %, and applied to a uniform thickness over flexible support 11 . thereafter the coated film is dried to form protective film 10 . there are no particular limitations on the solvent for diluting the resin composition as long as the solvent does not compromise the solubility and drying rate of the resin . in order to ensure drying rate and surface level , it is preferable to employ such a solvent that has a boiling point similar to the boiling point of the solvent used for production of the polyoxazolidone . application of the resin composition over flexible support 11 can be accomplished by any of the methods known in the art using a reverse roll coater , a gravure roll coater , a comma coater , curtain coater , or the like . drying of the coated film may be accomplished using a hot dryer , a far infrared dryer , or a near - infrared dryer . drying temperature is typically 50 - 150 ° c ., preferably 70 - 120 ° c . drying time is typically 2 - 30 minutes , after drying of the resin composition , the dry film may be processed , e . g ., stamped to match the circuit pattern of a printed circuit board to which the dry film is to be bonded . printed circuit board 3 to be bonded to protective film 10 may include substrate 1 and circuit 2 formed of a metal layer on substrate 1 . printed circuit board 3 may include an additional layer where necessary . substrate 1 can be a polyimide film or the like and preferably has flexibility . when a commercially available non - thermoplastic polyimide film is used as the polyimide film , the film thickness is typically 3 - 75 μm , preferably 7 . 5 - 40 μm . the polyimide film may be subjected to plasma treatment , corona discharge treatment and / or the like on its surface . circuit 2 is preferably formed of a metal layer made of a material selected from copper , copper alloy , stainless steel , stainless steel alloy , nickel , nickel alloy ( including 42 alloy ), aluminum , aluminum alloy , and the like . the metal layer may be a metal foil bonded to substrate 1 or may be deposited onto substrate 1 by sputtering or the like , circuit 2 may be formed on either one side ( as illustrated in fig1 a ) or both sides ( as illustrated in fig3 ) of substrate 1 . there are no particular limitations on the thickness of the metal layer constituting circuit 2 as long as circuit 2 is thick enough not to cause breakage or the like ; the thickness of the metal layer is preferably 0 . 1 - 300 μm , more preferably 2 - 250 μm , and still more preferably 3 - 200 μm . when the protective film is to be laminated onto the printed circuit board , printed circuit board 3 and dry film 12 are first provided . lamination can then be accomplished by overlaying protective film 10 of dry film 12 onto circuit 2 of printed circuit board and pressure - bonding dry film 12 and printed circuit board 3 together . there are no particular limitations on the method of pressure - bonding ; for example , surface - to - surface pressure bonding , roll pressure bonding or the like may be employed . further , vacuum lamination is most preferable . the reason for this is that the patterned circuit is well buried in protective film by the vacuum lamination process . flexible support 11 may be peeled off after bonding protective film 10 to printed circuit board 3 . when , for example , the above - described resin composition contains thermosetting resin ( c ), it is preferable to thermally crosslink protective film 10 disposed on the circuit of the printed circuit board so that protective film 10 serves as a circuit protective film that is more reliable in terms of circuit protection . thermal crosslinking of protective film 10 increases the crosslinking density within protective film 10 and thus improves flexural fatigue life as the circuit protective film . heat treatment can be carried out either stepwise or continuously at typically 130 - 300 ° c ., preferably 150 - 230 ° c ., for 0 . 1 - 5 hours . when protective film 10 is used as an interlayer dielectric of a multilayer circuit board , two printed circuit boards are provided , and one of the printed circuit boards is overlaid onto protective film 10 of a dry film . thereafter , for example , flexible support 11 of the dry film is peeled off , and the other printed circuit board is overlaid on and heat - pressure bonded to protective film 10 to manufacture a multilayer circuit board in which the printed circuit board , interlayer dielectric , and printed circuit board are sequentially layered . when a through - hole is to be bored in protective film 10 , it is preferable to previously stamp protective film 10 . when more printed circuit boards are to be laminated , the above - described steps may be repeated . heat - pressure bonding is preferably carried out typically at a pressure of 0 . 2 - 3 mpa under heating to 40 - 150 ° c ., preferably to 50 - 120 ° c . when “ the heat - pressure bonding possible temperature ” is set to 40 ° c . or above , tackiness does not occur upon aligning of the protective film with the printed circuit board before heat - pressure bonding , thus improving working efficiency . when the heat - pressure bonding possible temperature is set 150 ° c . or below , curing of polyoxazolidone resin ( a ) does not proceed excessively allowing for adequate time for pressure bonding so that a wider process margin is ensured . heat - pressure bonding possible temperature means a temperature at which the viscosity of the film can be controlled to a level that the material of film can sufficiently fill the pattern without causing such problems air trapping and that the material never flows outside the pattern due to excessive flow . the present invention will now be described in more detail based on examples , which however shall not be construed as limiting the scope of the invention thereto , methods of measuring various physical properties and methods of evaluating various characteristics are given below . 0 . 2 g of resin was dissolved in 5 ml of dimethylformamide ( dmf ) to prepare a sampling liquid . using gel permeation chromatograph ( gpc ) ( instrument : shimadzu lc - 10a , column : shimadzu cto - 10a , detector : shimadzu rid - 10a , calculator : shimadzu c - r7aplus ), the sample liquid was analyzed at a flow rate of 1 . 0 ml / min and at 40 ° c ., and the weight - average molecular weight ( mw ) of the resin was measured using the calibration curve prepared from polypropylene glycol ( ppg ) standards . the resin composition ( varnish ) was applied on a 38 μm - thick carrier film ( polyethylene terephthalate flexible support ) using a comma coater , and the varnish was dried for 5 minutes at 120 ° c . in a roll supported - hot drying furnace to prepare a dry film having the dried resin layer ( protective film ) of 38 μm thickness . the resin layer ( protective film ) was visually observed as to whether or not the resin film maintained in film form when the carrier film was peeled off from the dry film . evaluation criteria are as follows : as a flexural fatigue pattern , a copper - clad flexible laminate ( copper foil / insulating layer / copper foil = 12 μm / 12 μm / 12 μm thickness , l / s = 75 μm / 75 μm ) was provided , and a dry film was attached to the laminate so that the resin layer ( protective film ) was against the copper foil of the laminate . after laminating the assembly in vacuo at 130 ° c . and 3 mpa , the carrier film was peeled off , and the resin layer was cured at 185 ° c . for 60 minutes in a circulating hot air oven . in this way a laminate was manufactured in which a 10m - thick circuit protective film was formed on the copper foil . in accordance with “ ipc - tm - 650 method 2 . 4 . 3 ,” the number of flexural fatigue cycles was measured for the laminate . dry films ( each 38 μm in thickness ) were respectively attached to both sides of a polyimide film prepared by etching away the copper foils of a copper - clad flexible laminate ( neoflex ® nfx - 2abpfe ( 25t ), mitsui chemicals , inc ., copper foil / polyimide layer / copper foil = 12 μm / 25 μm / 12 μm thickness ) so that the resin layers ( protective films ) were against the polyimide film . after laminating the assembly in vacuo at 130 ° c . and 3 mpa , the carrier film was peeled off , and the resin layer was cured at 185 ° c . for 60 minutes in a circulating hot air oven . in this way a test specimen was manufactured in which a 38 μm - thick insulating resin layer ( circuit protective layer ) was formed on both sides . using the test specimen , flame retardancy was evaluated in accordance with “ ul94 thin material vertical burning test .” a polyimide substrate having a comb - shaped copper circuit ( copper foil thickness : 12 μm , l / s = 35 μm / 35 μm ) was provided . a dry film was attached to the polyimide substrate so that the resin layer ( protective film ) was against the circuit surface of the polyimide substrate . after laminating the assembly in vacuo at 190 ° c . and 3 mpa , the carrier film was peeled off , and the resin layer was cured at 185 ° c . for 60 minutes in a circulating hot air oven . in this way an evaluation sample was manufactured in which a 10 μm - thick cover layer ( circuit protective layer ) was formed on the copper foil . the evaluation sample was attached to a reflow board ( magic resin board , daisho denshi co ., ltd .) so that the cover layer ( circuit protective layer ) was firmly attached to the reflow board . the reflow board to which the evaluation sample was attached was allowed to flow at a flow rate of 0 . 4 m / min in a reflow furnace ( sx - 1508 , senju metal industry co ., ltd .) in which peak temperatures were set to 220 ° c . and 260 ° c . after separating the evaluation sample from the reflow board , a surface of the reflow board was observed at 25 × under a microscope to confirm the presence or absence of any cover layer residue or contamination . when the presence of cover layer residue or contamination was confirmed on the reflow board surface , it was determined that an anomaly occurred . on the other hand , when the presence of cover layer residue or contamination was not confirmed on the reflow board surface , it was determined that an anomaly did not occur . 75 . 0 g of methyl ethyl ketone ( mek ), 37 . 0 g of isopropyl alcohol ( ipa ) and 37 . 0 g of toluene were charged into a 500 ml four - necked separable flask , and the reaction was heated to 70 ° c . a dropping funnel containing 40 . 0 g of toluene and 60 . 0 g of methylene diisocyanate ( mdi - ph ) ( mitsui chemicals , inc .) was placed onto the four - necked separable flask , and the content of the dropping funnel was added dropwise into the flask over about 30 minutes . after a 1 - hour reaction at 80 ° c ., the reaction was heated to 160 ° c . to remove ipa and toluene . after cooled , 40 . 0 g of dimethylacetamide ( dmac ) and as a catalyst 0 . 6 g of 1 - benzyl - 2 - phenylimidazole ( 1b2pz ) ( shikoku chemical corporation ) were added and stirred , and the reaction mass was transferred to a dropping funnel . the dropping funnel was placed onto a 1 l separable flask containing 160 . 0 g of dmac and 90 . 0 g of bisphenol epoxy resin ( epomik r - 139s , mitsui chemicals , inc ., epoxy equivalent weight : 185 g / eq ). the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) was 1 . 04 . the content in the dropping funnel was added in dropwise into the flask over about 40 minutes while heating the reaction to 160 ° c . under stirring and nitrogen stream . while distilling off ipa being produced , the reaction was continued for about 4 hours until removal ipa by distillation finishes . as a result , a 45 wt % polyoxazolidone ( pox1 ) solution in dmac was prepared . the obtained polyoxazolidone ( pox1 ) was analyzed by infrared spectroscopy , confirming in the spectrum that an absorption at 915 cm − 1 ascribed to the epoxy group disappeared and an absorption at 1752cm − 1 ascribed to the carbonyl group of the oxazolidone ring occurred . the weight - average molecular weight ( mw ) of the obtained polyoxazolidone ( pox1 ) was 103 , 000 . a 45 wt % polyoxazolidone ( pox2 ) solution in dmac was prepared in the same manner as in synthesis example 1 except that while distilling off ipa being produced , the reaction was continued for about 8 hours until removal ipa by distillation finishes . the weight - average molecular weight ( mw ) of the obtained polyoxazolidone was 146 , 000 . a 45 wt % polyoxazolidone ( pox3 ) solution in dmac was prepared in the same manner as in synthesis example 1 except that 98 . 0 g of the bisphenol epoxy resin ( epomik r - 139s , mitsui chemicals , inc ., epoxy equivalent weight : 185 g / eq ) was used and that the reaction was carried out with the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) being 0 . 95 . the weight - average molecular weight ( mw ) of the obtained polyoxazolidone was 112 , 000 . a 45 wt % polyoxazolidone ( pox4 ) solution in dmac was prepared in the same manner as in synthesis example 1 except that 71 . 0 g of the bisphenol epoxy resin ( epomik r - 139s , mitsui chemicals , inc ., epoxy equivalent weight : 185 g / eq ) was used and that the reaction was carried out with the mole ratio of the dicarbamate compound to the diepoxy compound ( dicarbamate compound / diepoxy compound ) being 1 . 30 . the weight - average molecular weight ( mw ) of the obtained polyoxazolidone was 27 , 000 . a mixture of 46 g ( 0 , 10 mol ) of tris - p - hydroxyphenylmethane , 340 g of epichlorohydrin , and 0 . 65 g of ethyltriphenylphosphonium bromide was stirred at 105 - 110 ° c . for 2 hours . the content of the flask was cooled , followed by addition of 35 ml of toluene . the inner pressure of the flask was reduced to below 50 mmhg , and the flask was heated to 70 - 80 ° c . thereafter , 31 g of 50 wt % sodium hydroxide aqueous solution was added drowpise into the flask , and distillation was continued for 60 minutes while circulating epichlorohydrin , the reaction mixture was cooled , and nacl was removed by suction filtration . the epichlorohydrin solution was washed with water and condensed to dryness in vacuo to afford a trifunctional epoxy resin ( phbaep ) having a melting point of 60 - 65 ° c . and an epoxy equivalent weight of 166 g / eq . to 200 g of the 45 wt % polyoxazolidone ( poxl ) solution in dmac was added as a flame retardant 15 g of phenoxycyclophosphazene ( fp - 300 , fushimi pharmaceutical co ., ltd ., p content : 1 . 40 %) and 25 g of the trifunctional epoxy resin ( phbaep , epoxy equivalent weight : 166 g / eq ), and stirred in an automatic kneader for 30 minutes to afford a brown viscous liquid ( varnish ). the viscosity of the obtained varnish was 3 . 0 pa &# 39 ; s , the varnish was applied onto a 38 μm - thick pet film and dried to produce a dry film in which a 25 μm - thick resin layer was formed on the pet film . using the dry film , base materials for flexural fatigue test , flame retardancy evaluation and reflow test were fabricated , and the evaluations were carried out . results are listed in table 1 . dry films were produced in the same manner as in example 1 except that varnishes ( resin compositions ) having the compositions listed in table 1 were prepared and used . using the dry films , base materials for flexural fatigue test , flame retardancy evaluation and reflow test were fabricated , and the evaluations were carried out . results are listed in table 1 . as seen from table 1 , the laminates and circuit boards manufactured using the resin compositions of examples exhibited superior flexural fatigue life and reflow heat resistance . moreover , as seen from table 1 , the dry films having the resin layers made of the resin compositions of examples remained in film form without being broken into pieces even when the resin layer was laminated to a substrate and thereafter the carrier film was peeled off . in particular , when thermosetting resin ( epoxy resin ) having at least three reactive functional groups in one molecule was added ( examples 1 - 6 ), the state of the dry film improved , and moreover , flexural fatigue life improved . the addition of the flame retardant resulted in improvement of flame retardancy ( examples 1 - 6 and 8 ). the resin composition of the present invention can provide a circuit board and a multilayer circuit board which are superior in heat resistance and flexural fatigue life . the resin composition of the present invention can also provide a dry film suitably used for the manufacture of such a circuit board and a multilayer circuit board .	2
the sinuous spring nesting and stacking machine 10 of this invention comprises a rectangular frame 12 upon which is mounted a sinuous spring infeed mechanism 16 for causing straight discrete lengths 14 of sinuous wire to be fed into and over a rotating mandrel 18 which imparts an arcuate curvilinear shape to those lengths 14 of sinuous wire springs . those discrete straight lengths 14 of sinuous wire are derived from a conventional continuously operating wire forming machine 2 ( see fig9 ) which continuously feeds sinuous wire into a standard loop accumulator 4 from which the wire is fed into a cut - off machine 6 . from the cut - off machine 6 , the lengths 14 of straight sinuous wire are supplied to the feeder mechanism 16 of the nesting and stacking machine , which is synchronized by a conventional common controller ( not shown ) with the forming machine 2 , accumulator 4 and cut - off machine 6 . the arcuately formed curvilinear sinuous springs 15 are then caused by the infeed mechanism 16 to be moved alternately over one of two circular forming drums 20 , 22 . those forming drums , as explained more fully hereinafter , are caused to reciprocate between two positions such that after a first spring 15 is deposited upon one forming drum 20 , the forming drums are shifted to align the second forming drum with the infeed mechanism preparatory to the next following spring 15 being deposited on the second forming drum 22 . located internally of these forming drums 20 , 22 are a pair of smaller diameter stacking drums 24 , 26 ( see fig4 and 6a ). as the forming drums 20 , 22 reciprocate after having a spring 15 deposited thereon , the next following reciprocable stroke of the forming drums causes the springs 15 to be moved off of the forming drum 20 , 22 and onto the underlying stacking drum 24 or 26 , respectively . consequently , the sequence is for a first arcuately formed spring 15 to be deposited upon a first forming drum 22 , for example . the drums are then reciprocated rightwardly so as to align the forming drum 20 with the infeed mechanism 18 and position the spring 15 on the drum 22 over the stacking drum 26 . the next leftward movement of the forming drums 20 , 22 , after a spring 15 is deposited on the forming drum 20 , causes the spring 15 on the forming drum 22 to be moved off of the first forming drum 22 and onto the underlying stacking drum 26 . the next following rightwardly movement of the forming drums 20 , 22 , the spring 15 causes the spring 15 on the leftward forming drum 20 to be stripped from that forming drum 20 and onto the underlying stacking drum 24 . this procedure is followed until a predetermined number of arcuate curvilinear springs 15 have been alternately and sequentially deposited upon each of the stacking drums 24 , 26 , after which the stacking drum 26 is moved rightwardly , so as to strip the nested stack of springs on that stacking drum 26 from the stacking drum 26 and allow that stack to fall onto an underlying discharge chute 28 or 30 . the stacking drum 24 is then moved leftwardly and the stack of springs or the stacking drums stripped from that stacking drum 24 . thereafter , the stacking drums 24 , 26 are moved back to their original positions beneath their respective forming drums 20 or 22 preparatory to receiving the next following spring 15 from that forming drum . this sequence of operations is all controlled by a common controller ( not shown ) which synchronizes the drive of the complete machine 10 , including its infeed mechanism 16 with the drive of the sinuous wire forming machine 2 , accumulator 4 and cut - off machine 6 . the nesting stacking machine frame 12 is generally rectangular and comprises a front plate 32 , a rear plate 34 , and side plates 36 , 38 . this frame is illustrated as being bolted together , but could as well be welded or connected via any other conventional connectors . the machine frame 12 is , in turn , mounted upon a base frame and enclosed within a housing 12 a ( shown in phantom in fig1 ) as is conventional with all machinery having moving parts . fixedly mounted upon this frame 12 and extending between the side plates 36 , 38 , there are a pair of supporting shafts 40 , 42 . these shafts 40 , 42 extend through apertures ( not shown ) in the side plates and are secured to the side plates by mounting blocks 44 . the mounting blocks 44 each comprise pairs of blocks 44 a , 44 b located on the outside of each end of the shafts 40 , 42 and secured together by conventional screws so as to clamp the ends of the shafts 40 , 42 therebetween . the lowermost one of each pair of blocks 44 a , 44 b is then secured to the outside surface of the side rails 36 , 38 by set screws 44 c . as explained more fully hereinafter , these supporting shafts 40 , 42 then serve as mounting shafts for the reciprocable forming drums 20 , 22 and the mechanism movable with those drums 20 , 22 . these shafts 40 , 42 also support the independently movably stacking drums 24 , 26 as well as stationary stacking drum stripper paddles 46 , 48 ( see fig7 a and 7b ) associated with the stacking drums 24 , 26 . the belt drive infeed mechanism 16 is driven from a timing input gear 50 operable through a shaft 52 to drive a drive gear or pulley 54 and , through an endless flexible belt 56 , pair of idler gears or pulleys 58 , 60 . the flexible endless belt 56 is movable over these gears or pulleys 54 , 58 , 60 and has an outside peripheral surface 78 engageable with the top surface of incoming straight lengths 14 of sinuous wire so as to move those lengths 14 of sinuous wire into surface contact with the rotating mandrel 18 . the mandrel 18 is rotatably mounted upon a shaft 62 which is , in turn , fixedly secured to the frame 12 . the complete infeed mechanism 16 is mounted upon a separate frame ( not shown ) which is , in turn , fixedly secured to the machine frame 12 . the infeed mechanism is so constructed that the intermediate gear or pulley 58 is adjustably mounted so as to enable it to be moved relative to the mandrel 18 and thereby vary the configuration of the arc imparted to the sinuous spring 15 by the mandrel 18 as the wire moves over the mandrel . the mechanism for affecting reciprocable movement of the forming drums 20 , 22 comprises a pair of air cylinders 64 , 66 bolted to the outside surface of the side plate 38 . the piston rods 64 a , 66 a of these cylinders extend through the side plate 38 and are fixedly connected through an appropriate linkage 70 , 72 to a slider plate 68 to which the forming drums 20 , 22 are fixedly attached . this slider plate 68 is sandwiched between the forming drums 20 , 22 and is connected via the linkages 70 , 72 to the piston rods 64 a , 66 a such that upon simultaneous actuation of the cylinders 64 , 66 , the slider plate is caused to slide and reciprocate over the supporting shafts 40 , 42 between the two positions illustrated in fig4 and 5 . as may be seen most clearly in fig4 and 5 , the slider plate 68 has a bore ( not shown ) axially aligned with bores 70 in mounting blocks 72 , 74 located on opposite sides of the mounting plate and secured thereto by bolts 76 . the support shafts 40 , 42 extend through the axially aligned bores of the slider plate and the mounting blocks 72 , 74 , thereby enabling the slider plate 68 with its attached forming drums 20 , 22 to slide over the support shafts 40 , 42 upon simultaneous actuation of the cylinders 64 , 68 secured to opposite ends of the slider plate 68 via the piston rods 64 a , 68 a and the linkages 70 , 72 . adjustably mounted upon opposite sides of the slider plate 68 , there are a pair of proximity trigger assemblies 106 , 108 . each trigger assembly 106 , 108 comprises a pair of parallel plates 106 a , 106 b and 108 a , 108 b separated by a spring assembly 106 c . these proximity trigger assemblies function as stops as springs wrap around the forming drums 20 , 22 to limit the rotary movement of the spring about the forming drum and stop it when the leading end of a spring 15 contacts the lowermost plate 106 a or 108 a . there is also a proximity switch ( not shown ) associated with each of these trigger assemblies such that upon contact of the end of a spring 15 with the lower plates 106 a , 108 a of the assembly , the switch is actuated to initiate reciprocable movement of the forming drums as explained more fully hereinafter . fixedly mounted on the outside of each stacking drum 24 , 26 , there is a side mounting plate 24 a , 26 a . these side mounting plates 24 a , 26 a serve as mounting plates for skip paddle assemblies 80 , 82 , 84 and 86 ( fig2 ). two of these skip paddle assemblies 80 , 82 are mounted upon the outside of side mounting plate 24 a , and two others , 84 , 86 , are mounted on the outside of the side mounting plate 26 a . each side mounting plate 24 a , 26 a has arcuate slots 90 formed therein these arcuate slots are of slightly smaller radius than the radii on the inside of the forming drums 20 , 22 and are generally aligned with the inside surface of those forming drums 20 , 22 . arcuate shaped skip paddles 96 of the paddle assemblies 80 , 82 , 84 and 86 are extendable through these slots 90 and engageable with the ends of the springs 15 as those springs are stripped from the forming drums , as explained more fully hereinafter . the skip paddle assemblies 80 , 82 , 84 86 are all identical in both configuration and function . accordingly , only one skip paddle assembly 84 will be described in detail , it being understood that the other skip paddle assemblies 80 , 82 and 86 mounted upon their respective side mounting plates are identical . with reference to fig7 a and 7b , it will be seen that each skip paddle assembly comprises a pneumatic cylinder 88 secured by a generally l - shaped cylinder mounting block 92 to a side mounting plate . in the case of the skip plate assembly 84 , the cylinder mounting plate 90 is adjustably mounted upon the side mounting plate 26 a and is secured thereto by a bolt 94 which extends through the arcuate slot 90 . a paddle 96 is mounted on the inner end of the piston rod 98 associated with each cylinder 88 of each skip paddle assembly . these paddles are arcuately shaped so as to be extendable through the arcuate slots 90 and engageable with the ends of the arcuately configured springs as those springs are moved off of the larger diameter forming drums 20 , 22 . those paddles engage the ends of the springs and temporarily hold them as the springs move off of the forming drums 20 , 22 , after which the paddles retract into the arcuate slots 90 so as to permit the ends of the springs to follow the center portions of the springs inwardly into contact with the outside peripheral surface of the stacking drum or the outside peripheral surface of the spring which preceded that formed spring onto the stacking drum . also with reference to fig7 a and 7b , it will be seen that also bolted to each of the side mounting plates 24 a , 26 a , there is a spring location finger 100 which extends radially outwardly from the outside peripheral surface of each stacking drum 24 , 26 . this finger 100 has an inwardly extending slot 102 formed therein so as to enable a forming drum 20 or 22 to slide into and out of this slot 102 , as explained more fully hereinafter . this finger functions to locate and align springs on the stacking drum as the springs are removed off of the forming drum and onto the stacking drum . in the course of movement from a forming drum and onto a stacking drum , a loop of the spring fits over this finger 100 . thereby , a stack of springs are all aligned one with the next above it when a stack of nested springs are removed from the stacking drum , as illustrated in fig8 a and 8b . located on the outside of the forming drums , and rotatably movable between a first position illustrated in fig3 , 6 a and 7 b , and a second position illustrated in fig6 b and 7a , there are two pair of spring clamp assemblies 130 , 130 a and 132 , 132 a . since each pair of these assemblies are identical and actuated simultaneously , only one ( 130 ) of one pair 130 , 130 a will be described in detail , it being understood that the other 130 a , 132 and 132 a are identical , but with one of each pair positioned on the opposite side of the forming drum with which it is associated . each clamp assembly includes an air cylinder 136 mounted upon a stacking drum mounting plate 24 a or 26 a and a pivotal paddle 134 movable between the two positions illustrated in fig6 a and 6b . to pivotally move the paddle between these two positions , the air cylinder 136 is activated to cause a rotatable piston rod 138 of the cylinder 136 to actuate the paddle 134 and move the paddle into contact with the peripheral surface of a forming drum and hold the spring against axial movement as the forming drum is moved axially from under the spring . thereafter , the air cylinder 136 returns the paddle 134 to the rest position illustrated in fig6 a . with reference now to fig1 , it will be seen that the stacking drum 24 , 26 stripper mechanism comprises a first air cylinder 110 mounted upon the frame side plate 38 on the left side of the machine for affecting reciprocable movement of the stacking drum 24 and a second air cylinder 112 mounted upon the outside of the right side plate 36 operable independently of the air cylinder 110 for affecting reciprocable movement of the stacking drum 26 . each air cylinder 110 , 112 has a stacking drum mounting plate 114 mounted on the outer end of the piston rods 110 a , 112 a of the respective cylinders 110 , 112 . the stacking drum 24 is fixedly attached to the mounting plate 114 at the end of the piston rod 110 a and the stacking drum 26 is fixedly attached to the mounting plate 114 at the end of the piston rod 112 a associated with the air cylinder 112 . in order to limit reciprocable movement of the stacking drum 24 toward the side plate 38 , there are a pair of shock absorbers 118 , 120 mounted on the side plate 38 and an identical pair of shock absorbers 122 , 124 ( see fig3 ) mounted on the side plate 36 . each of these shock absorbers has a movable piston rod 118 a , 120 a , 122 a and 124 a spring biased outwardly and positioned so as to be engageable with the rim 24 a of the drum 24 when the stacking drum 24 is moved toward the side plate 38 and with the rim 26 a of the drum 26 when the stacking drum 26 is moved outwardly toward the side plate 36 . referring first to fig9 , operation of the nesting and stacking machine 10 is synchronized and commences with start - up of a parent sinuous spring forming machine 2 . that machine is a conventional sinuous wire forming machine operative to form a continuous length of wire into a sinuous pattern of formed wire , such as the sinuous wire illustrated in the drawings of this application . that sinuous wire has multiple parallel bars 14 a , each bar of which is connected at its opposite ends to adjacent bars via semi - circular end turns 14 b extending in opposite directions from opposite ends of each bar 14 a . while the sinuous wire illustrated in the drawings of this application have generally circular end turn sections , that sinuous wire could have end turns of varying configurations , even straight bars . that sinuous wire passes from the forming machine 2 through a conventional loop accumulator 4 to a conventional indexable cut - off machine 6 from whence it is fed via an infeed trackway 8 into the nesting and stacking machine 10 . that trackway feeds the incoming straight lengths 14 of sinuous wire into the infeed mechanism 16 , the endless belt of which forces that straight wire to pass over the mandrel 18 and thereby have an arcuate configuration imparted to the straight length of sinuous wire . the arc imparted to the then arcuately curved wire is of a radius smaller than the radius of the forming drums 20 , 22 and even slightly smaller than the radius of the stacking drums 24 , 26 . that arcuately formed curvilinear wire then passes between the peripheral surface of a stacking drum 20 or 22 and a stop block 25 stationarily mounted on the rear end of the machine 10 and secured to the rear plate 34 of the machine frame . with reference to fig2 , there is illustrated a straight wire spring 14 being fed into and over the mandrel 18 . as there illustrated , that spring , after having an arcuate configuration imparted thereto by the mandrel 18 , as the spring passes over the mandrel and beneath the surface of the belt 58 , is caused to move onto the peripheral surface of the forming drum 22 and to wrap around that drum until the movement of the spring is blocked by contact with the lower plate 108 a of the proximity trigger assembly 108 . that contact triggers actuation of a proximity switch ( not shown ) associated with that assembly 108 to initiate cycling of the machine stripper mechanism so as to cause the now arcuately formed curvilinear spring 15 on the forming drum 22 to be moved rightwardly on the forming drum 22 while simultaneously positioning the forming drum 20 in a position beneath the mandrel 18 such that the next following spring will be fed onto the other forming drum 20 . this axial movement of the forming drums 20 , 22 is affected by the simultaneous actuation of the air cylinders 64 , 66 which cause the slider plate 68 , with its attached forming drums 20 , 22 , to move rightward , as viewed in fig4 . in this rightwardmost position , as viewed in fig4 , the stacking drum 26 is located beneath the forming drum 22 . as viewed in fig4 and 5 , the following straight wire spring 14 is then fed over the mandrel and onto the forming drum 20 and continues to wrap around that forming drum until the leading end of that now arcuately formed configurated spring contacts the lower plate 106 a of the proximity trigger assembly 106 associated with that forming drum 20 . this contact of the end of the spring 15 with the lower plate 106 a of the proximity trigger assembly 106 actuates the switch associated with that assembly , which , in turn , initiates leftward movement of the slider plate 68 and the forming drums 20 , 22 attached thereto . before that leftward movement of the slider plate 68 and attached forming drums 20 , 22 may be initiated , though , several things need to first happen . the cylinders 136 and the clamping plates 134 associated therewith must be pivoted from the position illustrated in fig6 a to the position in fig6 b , whereat the inner edge of that plate 134 contacts the peripheral surface of the forming drum 22 near the slider plate 68 so as to hold that spring against axial leftward movement as the slider plate 68 and attached stacking drums 20 , 22 move leftwardly . simultaneously , with the actuation of the clamping plate air cylinders 136 , the motors 88 associated with the skip plate assemblies 86 on the rightward side of the frame 12 are actuated so as to cause the skip plates 96 on that side to extend and move inwardly through the arcuate slots 90 in the slider plate 68 . when extended , as illustrated in fig7 a , these skip plates 96 are located beneath the ends of the spring 15 located on the forming drum 22 . as the forming drum 22 moves leftwardly , as indicated by the arrow 93 in fig7 a , the spring is held against axial movement with the forming drum by the clamp plates 134 and the ends of the spring are then temporarily held against movement into contact with the underlying stacking drum until after the forming drum 22 has moved completely out from under the spring 15 previously located on that drum . the skip plates 96 then are pulled inwardly to the position illustrated in fig7 b , and the ends of the springs allowed to drop onto the stacking drum 26 . this temporary holding of the ends of the spring 15 by the skip plates 96 prevents the ends of the springs from becoming entangled with underlying springs on the stacking drums during the stacking of the springs on the stacking drums . this sequence of operation and the reciprocable movement of the forming drums is then repeated when the slider plate 68 and attached stacking drums are next moved rightward after placement of a spring over the forming drum 20 and contact of a spring on the drum with the proximity trigger assembly 108 . the rightward movement of the drums then causes sequential actuation of the clamping plate air cylinder 136 mounted on the mounting plate 24 a and simultaneously , the actuation of the air cylinder 88 on the plate 24 a to move the clamping plates 134 and skip plates 96 into positions to prevent rightward movement of the spring 15 on the forming drum 22 and to temporarily hold the ends of the spring 15 as it moves off of the forming drum 22 against inward movement onto the stacking drum 24 . only after the center portion of the spring has moved inwardly over the stacking drums do the skip plate paddles 96 move inwardly and allow the ends of the spring to drop into contact with the stacking drum 24 or , if a spring has been previously been placed upon that drum , into contact with the spring previously placed on that stacking drum . this leftward and then rightward movement of the forming drums 20 , 22 is repeated until an appropriate number of springs have been nested and stacked on each of the stacking drums 24 , 26 . after an appropriate number of springs have been nested and stacked on each of the stacking drums 24 , 26 , as counted by a counter of the controller ( not shown ) the cylinder 112 associated with the stacking drum 26 is actuated such that its piston rod and attached mounting plate 114 are caused to move rightwardly and in the course of movement , pull the stack of springs 15 nested thereon off of the stacking drum 26 and allow the nested stack of generally circular configurated springs to fall into the discharge chute 28 . in the course of movement rightward , as viewed in fig7 b , the stripper paddles 46 , which are stationarily mounted on the supporting shafts 40 , 42 , prevent the springs from moving rightward with the stacking drum 26 and force the springs to move off of that stacking drum . the movements depicted in fig9 and sequential actuation of air cylinder motors of the machine are all cycled by a conventional controller , which has not been illustrated herein , but which may be readily supplied by a person skilled in this art . while i have described only one preferred embodiment of this invention , persons skilled in this art will appreciate changes and modifications which may be made without departing from the spirit of this invention .	1
an embodiment of the present invention is described in detail hereunder with reference to the accompanying drawings . an antenna 1 according to the present embodiment is suitable for use in a wireless starting system 2 mounted on a vehicle or the like . as shown in fig1 , the wireless starting system 2 comprises a circuit board 4 and an antenna board 6 . here , the wireless starting system 2 is a system that allows a driver to wirelessly lock or unlock the doors and tailgate , etc of a vehicle , and start the engine thereof by wirelessly matching an id code between a receiving device disposed on the main body of the vehicle and a key called keyless operation key . the keyless operation key has a radio communication function , and the driver is only required to carry the keyless operation key and enter a wireless operation range of the vehicle in order to effect the matching of the aforementioned id code ( so - called keyless entry system ). the antenna 1 is suitable for use not only in the wireless starting system 2 , but also in other wireless systems . circuits such as a radio communication circuit rf and a cpu 8 are formed on the upper surface and under surface of the circuit board 4 . a feed point 10 is provided on the circuit board 4 , and a power source 12 ( see fig5 ) is connected to the feed point 10 via a feeder of 50ω ( not shown ). further , a matching circuit 14 is provided on the under surface of the circuit board 4 for performing impedance matching between the antenna 1 and the feeder , said matching circuit 14 being connected to the power source 12 and the antenna 1 . the circuit board 4 and the antenna board 6 are connected perpendicularly to each other . antenna elements 16 a , 16 b are patterned on a front side of the antenna board 6 facing the circuit board 4 and a back side thereof opposite to the front side thereof , respectively , by a metal foil . such antenna elements 16 a , 16 b patterned on the front and back sides of the antenna board 6 share an identical shape , and are laid one on top of another across the antenna board 6 . however , the present invention is not limited to the configuration in which the circuit board 4 and the antenna board 6 are connected perpendicularly to each other . the circuit board 4 and the antenna board 6 may be formed into a flat single substrate . further , the present invention is not limited to the configuration in which the antenna elements 16 a , 16 b are patterned on both the front and back sides of the antenna board 6 . the antenna elements 16 a , 16 b may be patterned only on one side of the antenna board 6 . the antenna elements 16 a , 16 b comprise vertical sections 18 a , 18 b vertically upstanding in the vicinity of the feed point 10 , and horizontal sections 20 a , 20 b substantially parallel to a ground pattern ( not shown ) formed on the circuit board 4 and formed at a predetermined height from the ground pattern , said horizontal sections 20 a , 20 b having one end thereof connected to an end portion of the vertical sections 18 a , 18 b . the other end of the horizontal sections 20 a , 20 b formed away from the vertical sections 18 a , 18 b is an open end . further , the vertical sections 18 a , 18 b are connected to the feed point 10 via an l - shaped bracket 21 . furthermore , the antenna elements 16 a , 16 b comprise short stubs 22 a , 22 b vertically extending from the horizontal sections 20 a , 20 b toward the circuit board 4 . the short stubs 22 a , 22 b are connected and short - circuited to the ground pattern of the circuit board 4 via an l - shaped bracket 23 . the short stubs 22 a , 22 b are formed in the vicinity of the vertical sections 18 a , 18 b and a distance ( a ) away from the vertical sections 18 a , 18 b toward the open end side of the horizontal sections 20 a , 20 b ( see fig5 ). furthermore , the antenna elements 16 a , 16 b comprise open stubs 24 a , 24 b vertically extending from the horizontal sections 20 a , 20 b toward the circuit board 4 . an end portion of the open stubs 24 a , 24 b facing the circuit board 4 is an open end . the open stubs 24 a , 24 b are formed away from the short stubs 22 a , 22 b toward the open end side of the horizontal sections 20 a , 20 b . however , at the same time , such open stubs 24 a , 24 b are also formed away from the open end side of the horizontal sections 20 a , 20 b toward the short stubs 22 a , 22 b . in the present embodiment , the open stubs 24 a , 24 b are formed in a position that is a distance of ( c ) away from the vertical sections 18 a , 18 b toward the open end side of the horizontal sections 20 a , 20 b ( see fig5 ). according to the present embodiment , the two vertical sections 18 a , 18 b , the two horizontal sections 20 a , 20 b , the two short stubs 22 a , 22 b , and the two open stubs 24 a , 24 b , are connected to one another via a plurality of through holes 25 on both the front and back sides of the antenna board 6 . the antenna elements 16 a , 16 b thus formed resonate while acting as an excitation element . in this case , when target frequency is f , and a wavelength corresponding to such frequency f is λ , a path length that is the sum of the length of the vertical sections 18 a , 18 b and the length of the horizontal sections 20 a , 20 b is preferably 10 - 40 % of the wavelength λ . fig6 is an immittance chart concerning the input impedances of the antenna 1 . according to the present embodiment , as shown in fig5 , the width of each pattern of the vertical sections 18 a , 18 b , the horizontal sections 20 a , 20 b and the open stubs 24 a , 24 b is 3 mm , and the width of the pattern of the short stubs 22 a , 22 b is 4 mm . further , a length l of the horizontal sections 20 a , 20 b is 119 mm , and a height h of the vertical sections 18 a , 18 b , the short stubs 22 a , 22 b and the open stubs 24 a , 24 b is 21 mm , respectively . furthermore , the distance ( c ) between the vertical sections 18 a , 18 b and the open stubs 24 a , 24 b is 109 mm , and the distance ( a ) between the vertical sections 18 a , 18 b and the short stubs 22 a , 22 b is 20 mm . such distance ( a ) was further varied to 30 mm , 40 mm and 50 mm , and input impedances corresponding to each one of these values of the distance ( a ) were then obtained . the impedances thus obtained are shown in a table 1 , and the “ no .” in the table 1 corresponds to the numbers shown in the immittance chart . here , “ j ” denotes an imaginary unit . points 1 through 4 are shown in the immittance chart of fig6 , concerning the input impedances corresponding to the various values of the distance ( a ) between the vertical sections 18 a , 18 b and the short stubs 22 a , 22 b . by varying the distance ( a ) between the vertical sections 18 a , 18 b and the short stubs 22 a , 22 b , it was found that the shorter the distance ( a ) was , the larger a step - up ratio of the impedance ( an incremental ratio of impedance ) became , and the smaller the q value became , thus widening the bandwidth of the antenna 1 . by providing the short stubs 22 a , 22 b , the impedance is allowed to step up , thereby reducing the impedance difference to be matched by the matching circuit 14 , thus reducing the loss on the matching circuit 14 , and improving the antenna gain . further , the antenna gain improved by 1 - 2 db with the presence of the open stubs 24 a , 24 b , as compared to a configuration in which no open stub is provided . next , other positions of the open stubs 24 a , 24 b were considered by providing the open stubs 24 a , 24 b closer to the short stubs 22 a , 22 b , while fixing the distance ( a ) between the vertical sections 18 a , 18 b and the short stubs 22 a , 22 b to 20 mm . a varying distance ( b ) is the distance between the original position of the open stubs 24 a , 24 b and a new position thereof to be considered shown by broken lines in fig5 . the varying distance ( b ) was varied to 20 mm , 30 mm and 40 mm , and the input distances were then obtained with respect to each one of these values of the distance ( b ). the impedances thus obtained are shown in a table 2 . points 12 through 14 are shown in the immittance chart of fig6 , concerning the input impedances corresponding to each new position of the open stubs 24 a , 24 b to be considered . when the open stubs 24 a , 24 b were positioned closer to the short stubs 22 a , 22 b by namely increasing the distance b , the resistance value of the impedance decreased while the imaginary value ( reactance value ) of the impedance increased . the imaginary value ( reactance value ) of the impedance significantly increased when the distance ( b ) was increased , thereby increasing the impedance difference to be matched , thus making it difficult to perform impedance matching . further , at that time , the impedance difference to be matched by the matching circuit 14 increased , thereby increasing the loss on the matching circuit 14 , thus decreasing the gain of the antenna 1 . furthermore , at that time , the q value increased , thereby narrowing the bandwidth of the antenna 1 . in addition , the resistance value of the impedance can be further increased and the imaginary value ( reactance value ) of the impedance can be reduced to zero by providing a plurality of open stubs 26 , 28 , for example , two , as shown in fig7 , and by regulating the positions of the short stubs 22 a , 22 b and the open stubs 26 , 28 as well as the intervals between the short stubs 22 a , 22 b and the open stubs 26 , 28 . a varying distance ( d ) between the two open stubs 26 , 28 , as shown in fig7 , is varied to 40 mm and 35 mm , and the input impedances obtained with respect to each varying distance ( d ) are shown in a table 3 . the resistance value of the impedance can be increased , and the imaginary value ( reactance value ) of the impedance can be reduced to zero by regulating the distance ( d ) between the two open stubs 26 , 28 . in this way , the gain of the antenna can be further improved . the gain of the antenna can be improved by 3 db or more with the presence of the two open stubs 26 , 28 , as compared to a configuration in which no open stub is provided . the short stubs 22 a , 22 b and the open stubs 24 a , 24 b , 26 , 28 are provided away from the vertical sections 18 a , 18 b toward the open end side of the horizontal sections 20 a , 20 b , thereby making it easy to ensure a proper distance between the radio communication circuit rf and the cpu 8 or the like by disposing the radio communication circuit rf on an end side of the circuit board 4 , even when both the radio communication circuit rf and the cpu 8 or the like are provided on the same circuit board 4 . such a configuration makes it easy for the cpu 8 or the like to be less affected by the noise produced by the radio communication circuit rf . further , in an inverted - l antenna or an inverted - f antenna , when the height of a horizontal section is low , radio waves are barely emitted therefrom , but almost only emitted from a vertical section , thus causing vertically - polarized waves to become dominant . as described in the present embodiment , the gain of the antenna 1 can be improved by providing one or a plurality of the open stubs 24 a , 24 b , 26 and 28 . according to the present embodiment , horizontally - polarized waves can be emitted from the horizontal sections 20 a , 20 b by appropriately regulating the height thereof , and vertically - polarized waves are emitted from the vertical sections 18 a , 18 b , the short stubs 22 a , 22 b , and the open stubs 24 a , 24 b , 26 , 28 . in this sense , the radio field strength of the horizontally - polarized waves and the radio field strength of the vertically - polarized waves can even be rendered to be equal to one another by regulating the amount of the vertically - polarized waves or the height of the horizontal sections 20 a , 20 b . the present invention is not limited to the aforementioned embodiment . various embodiments are possible without departing from the spirit and scope of the present invention .	7
with reference now to the drawings , and in particular to fig1 through 4 thereof , a new manual vehicle jack assembly embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . the present invention , designated as numeral 10 , includes a mounting bracket 12 having a planar rectangular horizontal plate 14 . such horizontal plate is equipped with a periphery defined by a short inboard edge , a short outboard edge and a pair of elongated parallel side edges . the mounting bracket further has a pair of vertical plates 16 including a first vertical plate integrally coupled along the inboard edge of the horizontal plate and extending upwardly therefrom in perpendicular relationship therewith . also included is a second vertical plate integrally coupled along a center line of the horizontal plate and extending upwardly therefrom in perpendicular relationship therewith . the second vertical plate is preferably supported by triangular braces which are mounted to the horizontal plate . by this structure , a slot is defined for receiving a longitudinal frame bar of a vehicle . preferably , the mounting bracket is permanently attached to the frame bar via a plurality of unillustrated screws . alternate methods of permanent attachment may also be employed such as a weld or the like . next provided is a jack assembly 18 including a vertically oriented cylindrical tube 20 mounted to the horizontal plate of the mounting bracket between the outboard edge and the center line thereof . as such , the jack assembly is laterally offset from the vertical plates of the mounting bracket . the cylindrical tube extends both above and below the horizontal plate of the mounting bracket to define an upper extent and a lower extent . as shown in the figures , the lower extent has a height of at least twice that of the upper extent . the jack assembly further includes an elevation cylinder 22 slidably situated within the cylindrical tube . a height of the elevation cylinder is at least twice that of the elevation cylinder . as shown in the figures , a planar square base 24 is mounted to a lower end of the elevation cylinder . the elevation cylinder has a plurality of vertically spaced notches formed therein for reasons that will soon become apparent . the jack assembly further includes a control mechanism 26 having a housing 28 coupled to the lower extent of the cylindrical tube and extending radially therefrom . as shown in fig3 & amp ; 4 , the housing extends past the outboard edge of the horizontal plate of the mounting bracket . further , the housing has an open top and an upwardly extending outboard lip 30 . the control mechanism of the jack assembly further includes a sleeve 32 pivotally coupled at an inboard end thereof within the housing about a horizontal axis . lengths of the sleeve and the housing of the control mechanism are preferably similar . as shown in fig1 & amp ; 2 , the sleeve has a vertical tab 34 coupled to a bottom end thereof with a notch formed therein . such notches serves for removably receiving the upwardly extending outboard lip when in a lowered orientation . in use , the elevation cylinder is adapted to raise and lower upon the reciprocation of the sleeve thereby elevating the vehicle . it should be noted that this is accomplished by a ratchet type mechanism which is commonly known . to control whether the reciprocating pumping action effects raising or lowering of the elevation cylinder , a toggle switch 36 is provided . also included is a jack arm 38 having an l - shaped configuration . the jack is equipped with a first end with a tapered configuration and a second end with a socket mounted thereon . in operation , the first end of the jack arm is adapted to be removably situated within an outboard end of the sleeve for manually reciprocating the same . fig1 & amp ; 2 best show a storage locking assembly 40 for maintaining the elevation cylinder in an upwardly extended orientation for storage purposes . the storage locking assembly includes a first pair of vertical threaded bores formed in the horizontal plate of the mounting bracket adjacent ends of the outboard edge thereof . associated therewith is a second pair of bores formed in the base of the elevation cylinder of the jack assembly adjacent ends of an outboard edge thereof . coupled within the first and second pair of bores is a pair of bolts 42 . each bolt has a length about equal to a height of the bottom extent of the cylindrical tube of the jack assembly for maintaining the elevation cylinder in the upwardly extended orientation . finally , a deployed locking assembly 44 is provided including a first aperture formed in the elevation cylinder of the jack assembly at a top end thereof . a second aperture is formed in the upper extent of cylindrical tube of the jack assembly adjacent to a top end thereof . it is preferred that the apertures face the outboard edge of the horizontal plate of the mounting bracket . a quick release pin 46 is removably situated within the first and second apertures . as such , the pin maintains the elevation cylinder in a downwardly extended orientation during deployment . it should be noted that the present invention is permanently installed adjacent to each of the wheels of a vehicle . as to a further discussion of the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	1
the present invention is based upon the discovery and isolation of a highly inducible 30 kda protein that is released by , and accumulates in media conditioned by , cultured murine macrophage - like cells ( raw 264 . 7 ) following stimulation with lps , tnf , or il - 1 . a partial amino acid sequence of this isolated polypeptide was identical to the sequence of the hmg1 protein , also known as amphoterin , a protein not before linked to the pathogenesis of any disease . this information was used to clone a cdna encoding hmg1 , which sequence was expressed to provide recombinant protein , which protein was used to generate specific anti - hmg1 antibodies . therapeutic and diagnostic efficacy was determined in a series of predictive in vitro and in vivo experiments . the experiments are detailed in the examples section . for example , following administration of endotoxin ( ld 100 ) to mice , serum hmg1 levels increased later ( at 16 h ) than well - known “ early ” mediators of sepsis ( such as tnf and il - 1 ) and plateau levels of hmg1 were maintained for 16 to 32 hours . patients with lethal sepsis had high serum hmg1 levels , which were not detected in normal healthy volunteers . moreover , acute experimental administration of rhmg1 to test animals , whether alone or in combination with sub - lethal amounts of lps , caused marked pathological responses and even death . more distributed dosing schedules of lower amounts of rhmg1 led to significant weight loss in treated animals . these results give evidence that hmg1 is a mediator of endotoxemia and particularly a late mediator , as opposed to known “ early ” mediators such as tnf and il - 1 . these data further show the importance of serum hmg1 as a marker for the severity or potential lethality of sepsis and related conditions . in addition , treatment with anti - hmg1 antibodies provided full protection from ld 100 doses of lps in mice . hmg1 is inducible bad tnf and il - 10 , and dose - dependently stimulates tnf release from hupbmcs . tnf is a marker of macrophage activation , so it is likely ( without limitation as to implied mechanisms or being bound by theory ) that hmg1 promotes downstream re - activation of cytokine cascades which , in turn , mediates late pathogenesis and lethality in sepsis and related conditions involving activation of pro - inflammatory cytokine responses . thus , hmg1 likely occupies a central role in mediating the inflammatory response to infection and injury , and antagonists of hmg1 will be of therapeutic benefit in sepsis and related conditions of inflammatory cascade activation . the appearance of hmg1 in the inflammatory cytokine cascade is suitable to propagate later phases of the host response and contribute to toxicity and lethality . the predictive data provided herein support the therapeutic efficacy of hmg1 antagonists and provide evidence in support of the aforementioned theory regarding mechanism of action . the in vivo treatment data showed the efficacy of hmg1 antagonists in general , and anti - hmg1 antibodies in particular , for treating conditions mediated by the inflammatory cytokine cascade in general and particularly sepsis conditions , including , for example , septic shock , sepsis syndrome or other “ sepsis - like ” conditions mediated by inflammatory cytokines . further , the independent pathogenicity , and toxicity / lethality of hmg1 shows that hmg1 antagonists are particularly effective when co - administered with antagonists of “ early ” inflammatory mediators such as tnf , mip , il - 1 and il - 6 . in summary , hmg1 is a cytokine mediator of inflammatory reactions because : 1 ) hmg1 is released from macrophages and pituicytes following stimulation with bacterial toxins or with pro - inflammatory cytokines ( tnf or il - 1β ); 2 ) hmg1 accumulates in serum of animals exposed to lps and in patients with sepsis ; and 3 ) hmg1 - specific antibodies protect against mortality in a predictive lethal endotoxemia animal model of clinical sepsis and related conditions . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered to a patient either by itself ( complex or combination ) or in pharmaceutical compositions where it is mixed with suitable carriers and excipients . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered parentally , such as by intravenous injection or infusion , intraperitoneal injection , subcutaneous injection , or intramuscular injection . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered orally or rectally through appropriate formulation with carriers and excipients to form tablets , pills , capsules , liquids , gels , syrups , slurries , suspensions and the like . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered topically , such as by skill patch , to achieve consistent systemic levels of active agent . the inventive pharmaceutical composition or inventive pharmaceutical combination can be formulated into topical creams , skin or mucosal patches , liquids or gels suitable for topical application to skin or mucosal membrane surfaces . the inventive pharmaceutical composition or inventive pharmaceutical combination can be administered by inhaler to the respiratory tract for local or systemic treatment . the dosage of the inventive pharmaceutical composition or inventive pharmaceutical combination of the present invention can be determined by those skilled in the art from this disclosure . the pharmaceutical composition or inventive pharmaceutical combination will contain an effective dosage ( depending upon the route of administration and pharmacokinetics of the active agent ) of the inventive pharmaceutical composition or inventive pharmaceutical combination and suitable pharmaceutical carriers and excipients , which are suitable for the particular route of administration of the formulation ( i . e ., oral , parenteral , topical or by inhalation ). the active agent is mixed into the pharmaceutical formulation by means of mixing , dissolving , granulating , dragee - making , emulsifying , encapsulating , entrapping or lyophilizing processes . the pharmaceutical formulations for parenteral administration include aqueous solutions of the active agent or combination in water - soluble form . additionally , suspensions of the active agent may be prepared as oily injection suspensions . suitable lipophilic solvents or vehicles include fatty oils such as sesame oil , or synthetic fatty acid esters , such as ethyl oleate or triglycerides , or liposomes . aqueous injection suspensions may contain substances which increase the viscosity of the suspension , such as sodium carboxymethyl cellulose , sorbitol , or dextran . the suspension may optionally contain stabilizers or agents to increase the solubility of the active agent or combination to allow for more concentrated solutions . pharmaceutical formulations for oral administration can be obtained by combining the active agent with solid excipients , such as sugars ( e . g ., lactose , sucrose , mannitol or sorbitol ), cellulose preparations ( e . g . starch , methyl cellulose , hydroxypropylmethyl cellulose , and sodium carboxymethyl cellulose ), gelaten , gums , or polyvinylpyrrolidone . in addition , a disintegrating agent may be added , and a stabilizer may be added . the present invention provides antisense oligomers having a sequence effective to inhibit or block the expression of the hmg1 gene or mrna sequence . antisense technology which uses specific - oligonucleotides to inhibit expression of target gene products , is developing as a therapeutic modality for human disease . several selection criteria are available to contribute to the optimization of antisense oligonucleotide antagonists . for example , it is advisable to choose sequences with 50 % or more gc content . preferred sequences span the aug initiation codon of the target protein , but sites in the coding region and 5 ′ utr may perform equally well . such sequences are generally about 18 - 30 nucleotides long and chosen to overlap the atg initiation codon from the hmg1 cdna sequence to inhibit protein expression . longer oligomers are often found to inhibit the target to a greater extent , indicating that a preferred length is about 25 mer for the first oligonucleotides chosen as antisense reagents . typically , three oligonucleotide sequences are chosen with regard to these criteria , and compared for antagonist activity to control oligonucleotide sequences , such as “ reverse ” oligonucleotides or those in which about every fourth base of the antisense sequence is randomized . therefore , a preferred sequence for making antisense oligomer sequences to hmg1 is a 25 mer sequence chosen to overlap the atg initiation codon ( underlined ) from the hmg1 cdna sequence : gaggaaaaataactaaacatgggcaaaggagatcctaagaag [ seq id no . 5 ] and such preferred antisense sequences are used to construct antisense oligonucleotide agents ( and suitable controls ) for an in vitro comparison as antagonists of hmg1 . these in vitro data are predictive of human clinical utility using antisense agents of comparable design . the antibodies disclosed herein may be polyclonal or monoclonal ; may be from any of a number of human , non - human eukaryotic , cellular , fungal or bacterial sources ; may be encoded by genomic or vector - borne coding sequences ; and may be elicited against native or recombinant hmg1 or fragments thereof with or without the use of adjuvants , all according to a variety of methods and procedures well - known in the art for generating and producing antibodies . generally , neutralizing antibodies against hmg1 ( i . e ., those that inhibit biological activities of hmg1 particularly with regard to its pro - inflammatory cytokine - like role ) are preferred for therapeutic applications while non - neutralizing antibodies may be as suitable for diagnostic applications . examples of such useful antibodies include but are not limited to polyclonal , monoclonal , chimeric , single - chain , and various human or humanized types of antibodies , as well as various fragments thereof such as fragments and fragments produced from specialized expression systems . the diagnostic assay provided here uses anti - hmg1 antibodies that can be either polycolonal or monoclonal or both . the diagnostic procedure can utilize standard antibody - based techniques for measuring concentrations of the gene product of hmg1 genes in a biological fluid . preferred standard diagnostic procedures are elisa assays and western techniques . this example provides the results of an experiment to identify and isolate later released macrophage - derived factors that play , a role in sepsis and in related conditions typified by inflammatory cytokine activity . the experiment reported in this example examined murine macrophage raw 264 . 7 cell - conditioned media after stimulation of the cultures with tnf . murine macrophage raw 264 . 7 cells were obtained from american type culture collections ( atcc , rockville , md ., usa ), and proliferated in culture under dmem supplemented with 10 % fetal bovine serum and 1 % glutamine . when confluency reached 70 - 80 %, the medium was replaced by serum - free opti - mem i medium and cultures were stimulated with pro - inflammatory cytokines ( e . g . tnfα or il - 1 ) or bacterial endotoxin ( lps ). the proteins released from the above stimulated macrophage cultures were surveyed . specifically , at different time points , cells and cell - conditioned media were separately collected by centrifugation ( 3000 rpm , 10 minutes ). proteins in the conditioned medium were concentrated by ultrafiltration over amicon membranes with mr cutoff of 10 kda ( amicon inc ., beverly , mass ., usa ), subsequently fractionated by sds - page , and stained with coomassie blue ( 1 . 25 % coomassie blue r250 in 30 % methanol / 10 % acetic acid ). after destaining with 30 % methanol / 7 % acetic acid , protein ( s ) of interest ( i . e ., those that preferentially accumulated in conditioned media of stimulated cultures ) was isolated by excision from the sds - page gel , and subjected to n - terminal sequencing analysis ( commonwealth biotechnologies , inc ., richmond , va . usa ). comparison of sds - page gel analysis of profiles of proteins accumulated in control ( without tnfα stimulation ) versus tnf - stimulated raw 264 . 7 cells revealed a strongly inducible 30 kda protein whose concentration in the cell - conditioned medium was significantly increased after stimulation for 16 hours . amino acid sequence analysis of this isolated protein revealed its n - terminal sequence as gly - lys - gly - asp - pro - lys - lys - pro - arg - gly - lys - met - ser - ser [ seq id no . 1 ]. a review of relevant gene databases found a 100 % identity to the n - terminal amino acid sequence of hmg1 . these data identified hmg1 as a “ late - appearing ” product of lps - stimulated macrophage cultures and therefore as a candidate pro - inflammatory mediator . this activity was confirmed by administration of recombinantly produced hmg1 and / or of anti - hmg1 antibodies in cellular and animal model systems that are predictive of human clinical conditions . this example shows which cell sources are capable of releasing hmg1 in response to tnf , il - 1 and / or lps . cells studied include gh 3 pituicytes , murine macrophage raw 264 . 7 cells , human primary peripheral blood mononuclear cells ( hupbmcs ), human primary t cells , rat adrenal pc - 12 cells , and rat primary kidney cells ( table 1 ). the rat pituitary gh 3 cell line was obtained from american type culture collection ( atcc , rockville , md ., usa ), and cultured in deme supplemented with 10 % fetal bovine serum and 1 % glutamine . human pbmcs and t cells were freshly isolated from whole blood of healthy donors and cultured in rpmi 1640 supplemented with 10 % human serum as previously described ( zhang et al ., j . exp . med . 185 : 1759 1768 , 1997 ). when confluency reached 70 - 80 %, the medium was replaced by serum - free opti - mem i medium and cultures stimulated with proinflammatory cytokines ( e . g ., tnfα or il - 1 ) or bacterial endotoxin ( lps ). although human t cell , rat adrenal ( pc - 12 ) cells , and rat primary kidney cells contained cell - associated hmg1 as demonstrated by western blotting analysis of whole cell lysates using hmg1 - specific antibodies ( see example 4 below ), hmg1 did not significantly accumulate in the medium of these cultures after stimulation with either tnf , il - 1β , or lps ( table 1 ). tnf , il - 1β ( minimal effective concentration = 5 ng / ml for each ) and bacterial endotoxin ( lps , minimal effective concentration = 10 ng / ml ) induced the release of hmg1 from human pbmcs in a time - and dose - dependent manner ( table 1 ). ifnγ alone ( 0 - 200 u / ml ) did not induce hmg1 release from any of the above cells , but when added in combination either with tnf or il - 1β , ifnγ dose - dependently enhanced hmg1 release from macrophages , with a maximal 3 - fold enhancement by ifnγ at a concentration of 100 u / ml . the release of hmg1 was not due to cell death , because cell viability was unaffected by tnf , il - 1β , or lps , as judged by trypan blue exclusion ( 90 - 92 ± 5 % viable for control vs . 88 - 95 ± 4 % in the presence of 100 ng / ml tnf , il - 1β or lps ). the amount of hmg1 released by pituicytes and macrophages inversely correlated with the intracellular concentration of hmg1 , as determined by western blotting analysis , indicating that the released material is , in part , derived from pre - formed cell - associated hmg1 protein . potential sources of circulating hmg1 in vivo were assessed by hybridization of an hmg1 - specific probe to mrna prepared from various normal human tissues ( blot substrate available from commercial sources ), with the results summarized in fig5 . several macrophage - rich tissues ( lung , liver , kidney , pancreas and spleen ) exhibited the most abundant hmg1 mrna expression ; less was observed in pituitary , bone marrow , thymus , lymph node and adrenal gland . in addition to providing information as to the relative tissue distribution of hmg1 expression , this study shows the practicality and utility of assaying for hmg1 - specific nucleic acid sequences in tissue samples . this example details procedures to produce hmg1 by well - known recombinant dna technologies . the hmg1 open reading frame was amplified by pcr and subcloned into an expression vector ( pcal - n ). briefly , the 648 - bp open reading frame of hmg1 cdna was pcr amplified ( 94 ° c . 1 ′, 56 ° c . 2 ′, 72 ° c . 45 ″, 30 cycles ) from 5 ng rat brain quick - clone cdna ( catalog # 7150 - 1 , clontech , palo alto , calif ., usa ) using primers containing the following sequences , 5 ′- ccc gcg gat cca tcg agg gaa gga tgg gca aag gag atc cta - 3 ′ [ seq id no . 2 ], and 5 ′- ccc gca agc tta ttc atc atc atc atc ttc t - 3 ′ [ seq id no . 3 ]. the 680 bp pcr product ( 4 μg ) was digested with bam hi and hind iii , and cloned into the bam hi / hind iii cloning sites of the pcal - n vector ( stratagene , la jolla , calif ., usa ). the recombinant plasmid was transformed into e . coli bl21 ( de3 ) plyss ( novagen , madison , wis ., usa ), and positive clones were screened and confirmed by dna sequencing on both strands using a tag dyedeoxy terminator cycle sequencing kit on the abi 373a automated fluorescent sequencer ( applied biosystels , foster city , calif ., usa ). to express recombinant hmg1 , positive clones were cultured at 37 ° c . with vigorous shaking , ( 250 rpm ) until od 600 reached 0 . 6 , when iptg ( 1 mm ) was added . twelve hours after iptg induction , bacterial cells were harvested by centrifugation ( 6500 rpm , 15 minutes ), and lysed by freeze - thaw cycles . the water - soluble fraction was collected after centrifugation ( 30 minutes , 12 , 000 rpm ), and recombinant hmg1 was purified on a calmodulin - binding resin column as instructed by the manufacturer ( stratagene ). bacterial endotoxin was removed from the recombinant hmg1 by using detoxi - gel endotoxin - removing gel ( pierce , rockford , ill . usa , cat . # 20344 ), and residual lps content was determined by the limulus amebocyte lysate test ( lal test , cat . # 50 - 648u , qcl - 1000 chromogenic lal , bio - whittaker , inc ., walkersville , md ., usa ). purified recombinant hmg1 was added to cultures of human peripheral blood mononuclear cells ( hupbmcs ), and supernatants assayed for tnf by elisa four hours after stimulation . the lps - neutralizing agent polymyxin b ( 10 μg / ml ) was added concurrently with recombinant hmg1 to eliminate the effect of any contaminating lps on tnf release . additionally recombinantly derived hmg1 was administered to test animals , with or without the additional endotoxemic challenge of exogenous lps , to study the pathogenic potential of high levels of hmg1 in vivo ( see fig2 b and 2c ). in some experiments , serum samples were secured from hmg1 - treated animals to be assayed for tnf as detailed herein ( see fig1 b ). the above procedure provides recombinant hmg1 as a fusion peptide comprising a 3 . 0 kda calmodulin - binding domain and a thrombin cleavage site as an amino terminal extension in register with the hmg1 peptide sequence . in some experiments , the fusion tag was removed from an aliquot of the recombinant protein and the bioactivity of the full fusion protein was compared to the cleaved hmg1 peptide ; no significant difference in bioactivity was noted and additional experiments ( especially those requiring administration of recombinantly produced hmg1 to animals ) typically were conducted with the ( uncleaved ) fusion protein . as demonstrated in fig3 a and 3b , in vitro or in vivo administration of recombinantly derived hmg1 induced a brisk tnf response , confirming the identification of hmg1 as a late - appearing lps - induced macrophage - derived endogenous mediator with pro - inflammatory activity . this example provides the results of experiments to generate and use polyclonal antibodies against hmg1 . briefly , polyclonal antibodies against an oligopeptide corresponding to the n - terminal amino acid sequence of hmg1 , or against purified recombinant hmg1 , were generated in rabbits according to standard procedures well known in the art . briefly , eight copies of an oligopeptide with the sequence gkgdpkkprgkmssc [ seq d no . 4 ] were anchored to radially branching lysine dendrites ( small immunogenically inert core ). these large macromolecules were injected three times both subcutaneously and intradermally ( 0 . 5 - 1 . 0 mg per injection ) into rabbits at week 1 , 2 , and 4 after pre - bleed at day 0 . two weeks after the last immunization , rabbits were bled and boosted intramuscularly with 1 . 0 mg of antigen followed by a second bleeding two weeks later . alternatively , to produce polyclonal antibodies against recombinant hmg1 , rabbits were immunized with recombinant hmg1 fusion peptide ( 100 μg per injection ) following a similar protocol . monoclonal antibodies reactive against hmg1 ( i . e ., that bind , and in some cases , neutralize or antagonize the biological activity of hmg1 ) are conveniently prepared according to methods well known in the art using the hmg1 antigens described herein or other hmg1 peptide fragments as immunogens . such monoclonal - antibodies , and / or the hybridomas that produce them , are useful to produce various “ humanized ” antibodies reactive against hmg1 ( all according to methods known in the art ), which humanized antibodies are useful as taught herein . hmg1 - specific antibodies were used to measure by western blotting analysis the inducible release of hmg1 from raw 264 . 7 cells after treatment with tnf or lps ( fig1 ). briefly , proteins were fractionated by sds - page on a 4 - 20 % gradient gel , transferred to a pvdf membrane , and blotted with rabbit antiserum raised against either the n - terminal synthetic hmg1 antigen or against recombinant hmg1 . the signal was detected using a ecl kit as instructed by the manufacturer ( amersham life science inc ., arlington heights , ill ., usa ), and levels of hmg1 were determined by measuring optical intensity of bands on western blots digitized for analysis using nih 1 . 59 image software , with reference to a standard curve of purified recombinant hmg1 . no hmg1 protein was detected in raw 264 . 7 cells - conditioned medium in the absence of tnf or lps treatment , but hmg1 accumulated in conditioned medium to high levels after such stimulation , reaching a plateau at 8 - 28 hours after stimulation ( fig1 a ). in summary , the data presented in examples 1 , 3 and in fig1 a show that the release of hmg1 from macrophages is stimulus - specific and time - and dose - dependent , with maximal accumulation observed within 8 hours after stimulation with tnf at concentrations as low as 5 ng / ml . it is well appreciated that sepsis , septic shock and related conditions may occur in humans in response to stimuli that differ qualitatively or quantitatively from the single large , lethal lps bolus used in this predictive model . nevertheless , experimental endotoxemia has been a valuable and predictive model system by which to identify critical components of the inflammatory cytokine cascade and by which to identify specific antagonists with predicted clinical utility . in this regard , hmg1 antagonists are perhaps more therapeutically attractive than tnf antagonists in view of the later appearance of hmg1 versus tnf in the response to endotoxin . this example illustrates an in vivo experiment in rodents measuring serum hmg1 levels after administration of a sublethal dose of lps ( ld 50 ). mice or rats were treated with lps , and sera were collected at different time points , and assayed for levels of hmg1 by western blotting analysis . the serum concentrations of hmg1 were estimated by measuring the optical band intensity with reference to a standard curve of purified hmg1 . serum levels increased significantly by 16 hours after lps , and remained high for at least 32 hours ( fig1 b ), and were not detectable in vehicle - treated control animals . these data show that hmg1 represents a particularly attractive target for diagnosis of , and pharmaceutical intervention against sepsis and related disorders of cytokine toxicity because hmg1 is a late - appearing mediator in the inflammatory cytokine cascade . this example provides the results of a predictive is in vivo assay to measure therapeutic activity or antagonists of hmg1 in relation to treatment of sepsis and related conditions of cytokine - mediated toxicity . in this example , the hmg1 antagonist was an anti - hmg1 antibody preparation . controls treated with pre - immune serum developed lethargy , piloerection , diarrhea , and succumbed to death within 48 hours . these clinical signs of endotoxemia were significantly prevented by administration of anti - hmg1 antibodies . male balb / c mice ( 6 - 7 weeks , 20 - 23 grams ) were randomly grouped ( 10 animals per group ) and pre - treated either with control pre - immune ) or anti - hmg1 serum ( as made in example 4 ) 30 minutes before administration ( intraperitoneally ) of a lethal dose of lps ( 50 mg / kg in 1 × pbs ). other experimental groups received additional doses of anti - hmg1 serum at + 12 or , + 12 , and + 36 hours after lps administration . animals were observed for appearance and survival for at least two weeks . polyclonal antibodies against recombinant hmg1 were generated in rabbits , and anti serum was assayed for specificity and titer by elisa and western blotting procedures . the polyclonal antiserum immunospecifically recognized ( bound to ) recombinant hmg1 in western blot analysis , for instance , and discriminated rhmg1 from other proteins in both crude bacterial lysates and as a purified protein that had been diluted into mouse serum . using chemiluminescence - amplified detection methods in western blotting analysis , polyclonal anti - hmg1 antiserum at dilutions up to 1 : 1000 was useful to detect as little as 50 pg rhmg1 protein . administration of anti - hmg1 antiserum in the indicated ( fig2 a ) amounts at − 0 . 5 ( if one dose ), − 0 . 5 and 12 ( if two doses ), or − 0 . 5 , 12 and 36 ( if three doses ) hours relative to lps challenge ( at time 0 ) was protective against lps - induced lethality , and repeated dosing schedules provided better protection . fig2 b illustrates that rhmg1 causes dose - dependent lethality in endotoxic mice . male balb / c mice ( 20 - 23 grams ) were randomized in groups of ten to receive lps ( 3 . 15 mg / kg ; a non - lethal dose ) alone or in combination with purified recombinant hmg1 protein . administration of hmg1 at the indicated doses 2 , 16 , 28 and 40 hours after lps challenge significantly increased the lethality of the underlying endotoxemia . fig2 c illustrates the independent lethal toxicity of hmg1 as a function of dose . purified rhmg1 was administered to male balb / c mice ( five mice per treatment group ) as a single i . p . bolus at the indicated dosage . mice were observed for at least 48 hours , and 60 % of mice treated with rhmg1 at a dose of 500 μg / mouse died within 24 hours of rhmg1 challenge , indicating a single dose ld 50 of less than 500 μg / mouse . the protection conferred by anti - hmg1 antibodies was specific , because administration of pre - immune serum , which showed no immunospecific reactivity to hmg1 on western blots , did not spare subjects from lps - mediated mortality ( fig2 a ). moreover , hmg1 - specific antibodies did not cross - react with other macrophage - derived cytokines ( e . g . il - 1 and tnf ), eliminating the possibility that antibodies conferred protection by binding and thereby neutralizing these mediators . protection against sepsis , sepsis associated pathogenesis and sepsis - related diseases involving activation of pro - inflammatory cytokine cascades may be improved by combination therapy targeted against more than one component of the cytokine cascade . antagonists of hmg1 in this regard can be combined with specific antagonists of tnf , il - 1 , mif and other inflammatory mediators , or with more broadly active antagonists of inflammatory responses that inhibit multiple components of the inflammatory cascade ( e . g ., aspirin , nsaids , anti - inflammatory steroids , etc . ), to provide even more effective therapeutic modalities . protection against lps toxicity was antibody dose - related , and more frequent dosing with higher amounts of antibody reduced mortality by up to 70 % ( fig2 a ). mice were observed for at least 2 weeks in all experiments , and no late mortality occurred , indicating that anti - hmg1 antibody treatment confers lasting protection against lps lethality , and does not merely delay the time of death . this example provides data that establish an association between hmg1 and human sepsis , and thereby support an indication for using hmg1 antagonists generally and anti - hmg1 antibodies in particular in human sepsis and related conditions of cytokine toxicity . serum hmg1 levels in normal healthy individuals and critically ill patients were measured using the polyclonal antibodies generated as in example 4 in a western blot format with reference to a standard curve of rhmg1 . hmg1 was not detectable in normal controls , but accumulated to high levels in critically ill patients with sepsis ( table 2 ). these data show that elevated serum hmg1 levels are observed in patients with sepsis , and the highest levels of serum hmg1 are observed in lethal cases ( table 2 ). these data further indicate the therapeutic importance of hmg1 antagonists in sepsis and also provide evidence for the diagnostic utility of an assay for sepsis and severity ( i . e ., potential lethality ) of sepsis by measuring serum concentrations of hmg1 . this diagnostic assay is also useful for diagnosing the severity of allied conditions involving activation of the inflammatory cytokine cascade . additional subjects were screened for serum hmg1 levels in association with lethal versus non - lethal sepsis , with results ( cumulative with table 2 ) as described in fig6 . the data summarized in fig6 represent serum samples obtained from eight healthy subjects and twenty - five septic patients infected with gram positive [ bacillus fragilis ( 1 patient ), enterococcus facecalis ( 1 patient ), streptococcus pneumonia ( 4 patients ), listeria monocytogenes ( 1 patient ), or staphylococcus aureus ( 2 patients )], gram negative [ escherichia coli ( 7 patients ), klebsiella pneumonia ( 1 patient ), acinetobacter calcoaceticus ( 1 patient ), pseudomonas aeruginosa ( 1 patient ), fusobacterium nucleatum ( 1 patient ), citrobacter freundii ( 1 patient )], or unidentified pathogens ( 5 patients ). serum was fractionated by sds - page gel electrophoresis , and hmg1 levels were determined by western blotting analysis with reference to standard curves of purified rhmg1 diluted in normal human serum . the detection limit by western blotting analysis is 50 pg . note that hmg1 is not detectable in normal controls , but significantly increased in septic patients . the average level of hmg1 in serum of non - surviving septic patients ( n = 13 patients , mean hmg1 level = 83 . 7 ± 22 . 3 ng / ml ) is significantly higher than in survivors ( nt = 12 , mean hmg1 level = 25 . 2 ± 15 . 1 ng / ml , p & lt ; 0 . 05 ). these data provide direct evidence of the utility of screening tissue ( including , without limitation blood or serum ) samples for hmg1 sequences ( protein or nucleic acid ) as a diagnostic and prognostic indicator of the presence of sepsis and related disorders of cytokine activation and of the severity and likely clinical course of such diseases and conditions . the present results provide evidence that hmg1 is a late released mediator element of the inflammatory cytokine cascade . addition of recombinant hmg1 to primary human peripheral blood mononuclear cells led to the dose - dependent induction of tnf within four hours after stimulation ( fig3 a ). this stimulation by recombinant hmg1 of tnf release by hupbmcs was not due to lps contamination because : ( i ) purified recombinant hmg1 was not contaminated by lps as judged by an lal endotoxin assay ; ii ) addition of the lps - neutralizing agent polymyxin b did not affect hmg1 - induced tnf release ; and iii ) proteolytic cleavage of recombinant hmg1 preparations with trypsin completely abolished the tnf release activity for the pbmc cultures . hmg1 stimulation also induced macrophages to release nitric oxide ( no ) to confirm that hmg1 induced serum tnf release in vivo , purified recombinant hmg1 was administered intraperitoneally to balb / c mice , and blood samples were collected to be assayed for tnf by the l929 assay . as shown in fig3 b , tnf was not detectable in serum of control animals , but was significantly increased two hours after administration of recombinant hmg1 protein . repetitive administration of recombinant gene product of the hmg1 gene ( 100 μg / mouse / day ) caused significant body weight loss ( fig4 ) in mice . without limitation on as to mechanism and without being bound by theory , these data are consistent with the hypothesis that hmg1 acts as a feed - forward stimulator of the pro - inflammatory cascade under both in vitro and in vivo conditions . these in vivo data in a predictive model of weight loss also provide predictive evidence that a pharmaceutical formulation comprising hmg1 or a therapeutically active fragment thereof is an effective weight loss therapy . serum hmg1 levels in hypophysectomized versus control rats also were measured by quantitation of western blot intensities as described above . there were significantly higher hmg1 levels within 12 hours after endotoxic challenge ( lps at 1 . 0 mg / kg ) in hypophysectomized rats ( approx . 75 ng / ml ) as compared to controls ( approx . 25 ng / ml ). these results indicate that pituicytes are not the major source of serum hmg1 levels and that macrophages may play a quantitatively more important role .	0
in fig1 a trichromatic tube 1 is fitted with a saddle - saddle type of magnetic deflector 2 according to the prior art , comprising a first , horizontal deflection coil 3 , called a line coil , and a second vertical deflection coil 4 , called a frame coil , both saddle - shaped , and a magnetic circuit 5 made of a ferromagnetic material . the line coil 3 is placed near the wall 6 of the tube 1 while the frame coil 4 is placed near the magnetic circuit 5 . the magnetic circuit has the shape of a sleeve open at both ends so that the windings of the line and frame coils can be placed radially towards the outside of the tube and can form leading - out wires marked 7 and 8 for those set in the front of the tube and marked 9 and 10 for those set in the rear side of the tube . when the tube 1 and the magnetic deflector 2 are surrounded by a shield 11 ( fig2 ), it is proposed to modify the magnetic deflector as shown in fig2 . this deflector 12 has a line coil 13 set near the glass 6 of the tube 1 , a frame coil 14 surrounding the line coil 13 , both saddle - shaped , and a magnetic circuit 15 near the frame coil 14 surrounding the said frame coil 14 . the rear leading - out wires 19 , 20 of the line and frame coils extend longitudinally and no longer radially and are entirely surrounded by the magnetic circuit 15 . for this purpose , the magnetic circuit 15 , for example , is extended towards the rear by a ferrite ring 21 . the front leading - out wires 17 and 18 have reduced dimensions and extend beyond the ferrite . the magnetic circuit 15 is closed towards the rear by a ferrite ring 22 which notably bears a quadrupole coil 23 . this ring 22 is set around the neck of the tube near the rear leading - out wires 19 and 20 and the ferrite ring 21 . the windings of the quadrupole coil 23 are set within notches cut out along the inner rim of the ring 22 . this quadrupole coil is powered by a current which varies parabolically in synchronization with the linearly varying current that flows in the frame coil . more precisely , it is known that , to obtain a linear vertical deflection of the electron beams , the frame coil 14 must be powered by a current which varies linearly as a function of time along the central curve 24 of the fig3 a , the lateral curves 25 corresponding to the frame return currents . to obtain a current which varies parabolically along the central curve 26 of fig3 b , a part of the frame current is applied to a multiplier circuit 28 ( fig4 ) which integrates the signal applied to it . the output signal of this multiplier circuit 28 is applied to the quadrupole coil 23 by means of an operational amplifier 29 . a potentiometer 30 is used to vary the amplitude of the parabolic signal and thus to do the setting . the various elements of the magnetic deflector which have just been described schematically with reference to fig2 and 4 , can be made in different ways which are within the scope of the specialist . thus the line coil 13 and the frame coil 14 can each be borne by a flare - shaped sleeve made of plastic material with notches on the inner surface to accomodate the windings of each coil , thus giving a precise arrangement of the said windings and , hence , a precise and constant distribution of the magnetic fields . these two sleeves are fitted into each other and the external sleeve which bears the frame coil may also constitute both the magnetic circuit 15 and the ferrite ring 21 which extends the said magnetic circuit 15 . the ferrite ring 22 which closes the rear end of the coils 13 , 14 of the magnetic circuit 15 , ending in the ring 21 , can be separated from the other elements which have just been referred to , but can be combined with them according to the assembly which shall now be decribed with reference to fig5 . in this fig5 which is a longitudinal cross - section of the rear part of the magnetic deflector , the said deflector ends in a spherical - shaped sealing 32 . four screws , such as those marked 33 , are incorporated in the sealing 32 and work in cooperation with four holes , such as those marked 34 , which are drilled into a sealing 35 surrounding the ferrite ring 22 and the coils that it bears . the holes 34 have a diameter greater than that of the screws 33 so as to give clearance to the said screws . in the rear , the sealing 35 is joined to a collar 36 used to fix the sealing 35 to the glass 37 of the tube neck . that side of the sealing 35 which faces the spherical part of the rear sealing of the magnetic deflector has a ring - shaped shoulder 38 on which the spherical surface 39 lies , in such a way as to enable the deflector to be shifted with respect to the sealing 35 under the action of the screws 33 and their associated nuts . the element marked 40 designates the shield of the tube and the associated deflector . the shield is closed towards the rear by a plate 41 which should then have holes facing the screws 33 so that the associated nuts can be screwed in . of course , the lay - out of the spherical rear part of the deflector with the circular shoulder 38 of the sealing - filled 35 can be achieved with deflectors other than those showing the characteristics of the present invention . the magnetic deflector described above has line and frame coils located on the magnetic circuit forming a screen with respect to the shield 11 in such a way that the force lines of the magnetic fields are not short - circuited by the shield . the front leading - out wires 17 , 18 have been made with their diameter reduced to the minimum so as to reduce the effect of the shield on the magnetic fields generated . the rear leading - out wires 19 , 20 are wound flat then covered with a ferrite ring 21 so that the force lines of the magnetic fields created by them loop back in the ring and are not short - circuited by the shield . the ferrite ring 22 complements the closing of the circuit for the force lines of the magnetic fields . furthermore , the quadrupole coil 23 borne by this ring can be used to correct the convergence error along the 6h / 12h axis which is proper to saddle - saddle type of magnetic deflectors and which has been referred to in the introduction . the magnetic deflector according to the invention is set in the following way . in the first operation , the center of purity of the tube is made to coincide with the center of purity of the magnetic deflector by shifting the deflector along the axis of the tube . this operation is done according to the rules habitually employed in this respect , namely with the tube illuminated green . when this coincidence is obtained , the collar 36 is clamped so as to fix the deflector to the neck . in the second setting operation , the horizontal and vertical axes of the tube are made to coincide with the corresponding electromagnetic axes of the deflector by means of screws 33 , with the associated nuts being screwed in to a greater or smaller extent . this operation is called yaming . in the third operation a zero trilemma t is obtained . it will be noted that this trilemma is obtained in two stages : firstly , the 3h / 9h convergence error and the horizontal red - blue trapezoid error trh is cancelled , and then the 6h / 12h convergence error is cancelled . the cancellation of c 3 / 9 and trh is obtained by construction , by modifying the component of the first even harmonic h2 of the magnetic field of the deflector in the line coil for the convergence 3h / 9h and the frame coil for the trapezoid trh . the cancellation of the convergence error 6h / 12h is obtained , as indicated above , by setting the value of the parabola - shaped current which flows through the quadrupole coil 23 of the ferrite ring 22 . there is another correction to be made , which has not been referred to until now . in principle , the convergence correction introduces a cushion - shaped magnetic field for the line and a barrel - shaped magnetic field for the frame . hence , inside the deflector , the electron beams are not subjected to one and the same uniform magnetic field . the result of this is that the green beam undergoes a deflection different from that of the red and blue beams ; a fault of this type , known as the coma error , has the result of making a green picture appear on the screen , the amplitude of the said green picture being smaller than that of the magenta picture which results from the superimposition of the red and blue images . in trichromatic tubes of the prior art , this correction is usually obtained by magnetic parts set on either side of the red and blue beams in such a way as to short - circuit the force lines of the magnetic field in varying degrees , and this diminishes the effect of the magnetic field on each of the red and blue beams in varying degrees . this way of conducting the operation is not possible for a high scanning frequency used in a high - definition trichromatic tube , for the high - frequency magnetic field created by the line coil would heat the magnetic parts , thus modifying their characteristics and , hence , modifying the setting of the coma error cancellation . according to the present invention , the coma error is cancelled by modulating the amplitude of the magnetic field in the rear of the deflector at the ferrite ring 21 . this magnetic field modulation is obtained through a suitable distribution of the line and frame coil sections along the axis of the tube and angularly . more precisely , as can be seen in the diagram of fig6 which is a flat or evolute view , at the rear ends , of the interior of half a coil , the sections 45 and 46 are separated from the sections 47 , 48 and 49 by a distance h in the longitudinal direction and by a distance m which has the shape of a circular arc . in the longitudinal direction , the various sections are set in notches which delimit the separations such as those marked 50 and 51 between the sections 47 , 48 and 49 . this special arrangement of the sections can be used to modify the distribution of the magnetic field along the length of the ferrite ring .	7
fig3 is a schematic diagram illustrating an embodiment of the instant invention . specifically , in fig3 an asynchronous data terminal ( dte ) 30 is connected to a transmit portion 32 and a receive portion 34 of the processor unit of the instant invention . furthermore , a data input line 36 and a data output line 38 is provided from the data network . thus the processor of the instant invention is capable of operating in full duplex mode . first , the transmit portion will be described . data , in asynchronous form , from dte 30 is output through dte output port 40 into a scc ( serial communications controller ) which is in communication with transmit processor 50 . the scc may be a usart ( universal synchronous / asynchronous receiver transmitter ), or the like . scc 44 reads the incoming asynchronous data stream and strips start and stop bits . the remaining data stream is then input to selector 46 , which in response to instructions from processor 50 , selects a route for the data to go through buffer a ( reference numeral 52 ) or buffer b ( reference numeral 54 ). buffers a & amp ; b together form a storage means , where each stores a complete message packet alternately . in the first route ( through buffer a ) selector 46 is connected to buffer a 52 and counter 56 . the output of counter 56 is also input to the buffer , so that the character count from counter 56 is input to the top of buffer a . for the purposes of this application , the front of a buffer is considered to be a data location which is output first , when the contents of the buffer are output . further , a sync generator 58 is connected to processor 50 for receiving an instruction therefrom , and is further connected on its output side to buffer a . upon instructions from processor 50 , the sync generator 58 transfers a sync byte to buffer a , on the top thereof , before the character count . the output of buffer a is input to a second selector 48 . the second selector 58 is also connected to processor 50 and selects between the data from buffer a and the data from buffer b . the output of selector 48 is input to a second scc 62 which is also in communication with processor 50 . the output of scc 62 is then provided to the data network through output line 38 . the second data route from selector 46 is provided through buffer b 54 . this route is substantially the same as the route through buffer a . specifically , selector 46 is connected to buffer b and second counter 60 . second counter 60 has an output connected to buffer b , so that the number of characters counted by second counter 60 may be input to the top of the buffer . further , a second sync generator 64 is connected to processor 50 , and provides an output connected to buffer b , for transferring a sync character or sync byte to the top of the buffer ( before the character count ). the output of buffer b is connected to selector 48 . it should also be noted that processor 50 receives a clock pulse from clock 66 . fig4 illustrates a specific form of the data packet used in the instant invention . however , it should be understood that many different forms for the data packet may be employed and still be within the scope of the instant invention . specifically , as seen in fig4 the total frame generated in the transmit portion of the instant invention has 27 bytes . the data frame as provided in the instant invention has 24 bytes of data ( bytes 0 - 23 ) which are actually transmitted through the t1 carrier system . it also has three bytes of control information ( bytes a , b and c ) which are used internally before the 24 bytes of data are actually transmitted to the channel bank . specifically , the transmitted frame is 24 bytes of 8 characters each . the frame duration is 3 ms . thus , as can be seen from fig2 a 24 byte data frame is transmitted in two super frames of the ds - 1 signal , which has a duration of 3 ms . specifically , in byte a , a sync byte is sent . byte b is called the dac ( digital access control ) byte . it carried control and status information between the converter 32 at one end of the circuit and converter 34 at the opposite end . this control information can include the baud rate , type of data ( sync , async , voice , etc .) control codes for loopbacks , etc . in byte b , a dac byte is provided with information for controlling new data before it is transmitted to the channel bank . byte c is referred to as a &# 34 ; telco byte &# 34 ; which carries the telephone signal information between the subscriber and the channel bank . in general , the operation of the transmit portion 32 of the instant invention operates according to a process illustrated in fig5 . specifically , the asynchronous data stream is received from dte 3 into scc 44 , where the start and stop bits are stripped off of the data . the characters m are received from the dte 30 within a time period p . the total number of characters received in time period p are counted in counter 56 while the characters m are then stored in buffer a . the count k of the total number of characters in the time period p ( from counter 56 ) is then stored in the front of buffer a . a sync byte y is then stored in front of the count k . next , the selector 48 , under control of processor 50 , selects buffer a so that data from buffer a is fed into scc 62 . processor 50 then gives the command to scc 62 to output the data on line 38 to the data network . thus , the output data frame includes a sync byte y , followed by a character count k ( indicating the number of characters to be transmitted in that data frame ), and then followed by the actual characters m . all characters in the frame in excess of character count k are discarded in the received data line to the customer as idle after k characters have been transmitted . when buffer a outputs the data packet through selector 48 to scc 62 , selector 46 has now selected the route through buffer b for the next packet of data . in other words , while buffer b is being filled up with data , buffer a sends data into scc 62 . on the other hand , when buffer b has filled up with data and is then sending data into scc 62 , buffer a is being refilled with data . thus , buffers a and b work in an alternating fashion so that when one is being filled the other is sending and vice versa . a specific embodiment of the data frame generated by the transmit portion 32 is illustrated in fig4 . further , bytes 0 through 23 are the 24 bytes of data actually transmitted through the t1 carrier system . as illustrated , the most significant bit ( msb ) is at position 1 , while the least significant bit ( lsb ) is at position 8 . in this specific embodiment , the least significant bit , position 8 , is always reserved for a &# 34 ; signaling bit &# 34 ;, which is most often used to designate on hook or off hook . further , the second least significant bit ( position 7 ) is also blocked off for control bits . in the first byte , position 7 is referred to as a ff ( full frame ) bit which will be used as described later . in bytes 1 - 23 , a one is inserted in each of these bit slots . thus , the usable data space is provided in bit positions 1 - 6 of bytes 0 through 23 . of that usable data space , an 8 bit byte is set off as cc0 - cc7 at the first of the data block . the character count k is inserted into this position . since the maximum amount of data bytes to be transmitted is 18 , the &# 34 ; sync bit &# 34 ; is one when the total number of 18 data bytes are being transmitted and the byte cc0 - cc7 is used as an actual data byte for transfer . at the very end of the block of usable data bytes is a byte dac0 - dac7 . this &# 34 ; dac &# 34 ; byte is used for internal control . in the receive portion 34 , receiver processor 70 is driven by second clock 68 . in fact , clocks 66 and 68 can be a single clock or can be synchronized with one another . incoming data is received on line 36 from the data network . the format of the incoming data received on line 36 is similar to the format of the transmitted data output on line 38 . the data is first received by scc 72 ( which may be a usart or other similar device ) which is in communication with receive processor 70 . the operation of the receive portion 34 is essentially the opposite of the transmit portion 32 . specifically the sync character is first detected by the processor 70 through sync detect line 84 . selector 74 which is controlled by processor 70 receives the output of scc 72 and selects one of buffer a 76 or buffer b 78 in which to insert the data . a count detector 86 detects the character count from the stream bytes transmitted from selector 74 to buffer a . the output of the count detector is input to counter 90 . the outputs of buffer a and counter 90 are input to an and gate 94 which provides an output to selector 80 . when the counter 90 reaches the character count ( i . e . the total number of data bytes to be transmitted ) the counter turns off , thus disabling and gate 94 . additionally , corresponding with buffer b of the receive portion 34 , a count detector 88 receives the character count and applies the same to counter 92 . the output of counter 92 is input to an and gate 96 , which receives its other input from buffer b . the output of and gate 96 is then input to selector 80 . these features operate the same way as buffer a , so that only the actual number of data bytes which are sent ( corresponding to the character count ) are actually transferred to selector 80 for transmitting to dte 30 . thus , the number of characters according to the character count k are transferred from buffer a to selector 80 and further to scc 82 . scc 82 adds the necessary start and stop bits and outputs data ( in asynchronous format ) back to dte 30 along line 42 . as with the transmit portion 32 , in the receive portion 34 buffers a and b operate alternately so that when one is filling the other is sending and vice versa . fig6 a represents the process of converting an asynchronous data signal into the form of a synchronous data signal , as used in the general purpose communications processor illustrated in fig3 . specifically , it is the process used in the transmit portion 32 of the general purpose communications processor . it should be noted that this process for converting the asynchronous data signal to a synchronous data signal can be accomplished either through hardware as illustrated in fig3 or through software . fig6 a illustrates a basic process or program for converting asynchronous data signals to synchronous data . step 98 corresponds with a start of the process . step 100 represents receiving asynchronous characters from a data terminal ( such as dte 30 ). next , in step 102 , the start and stop bits are stripped from each of the asynchronous characters to form individual data bytes . step 104 counts the number k of characters received in a time period t . in step 106 , a message packet is formed ( in synchronous form ) having a fixed length and including a sync byte , a character count , and the data bytes received from the dte 30 . step 106 will be described in further detail below . step 108 relates to a step of outputting the message packet to a synchronous communication network . individual message packets are output adjacent one another , without any fill space ( also referred to as idle space ) in between adjacent message packets . step 110 merely checks to see if it is time to stop the communication . if the answer is no , then the process returns to step 100 . if the answer to step 110 is yes , then the process is over , and it proceeds to the end at step 112 . step 106 which includes forming the message packet of a fixed length may also include the steps illustrated in fig6 b . for example , in fig6 b , step 106 of forming the message packet may include one or all of the steps illustrated . step 114 inserts the received data bytes into the buffer . step 116 is a general step for modifying the packet or data bytes in the packet . this step may occur at any point in step 106 . packet modification step 116 will be described in more detail below . next , step 118 inserts the character count onto the top of the buffer ( in front of the data bytes ). step 120 then inserts a sync byte into the buffer before the character count . as stated above , the packet modification step 116 is illustrated in more detail in fig6 c . the subroutine for packet modification 116 can be understood in combination with the packet diagram in fig4 . the individual steps in packet modification step 116 may be employed singly , all together , or not at all . step 122 inserts a logic i at the same position of each data byte . step 124 inserts a logic 1 at a fixed position in each byte for signaling onhook / offhook . step - 26 makes the character count a single bit as illustrated bit ff ( full frame ) which indicates that the maximum number of characters is being transmitted . step 128 adds a control byte after data bytes in the packet . this is represented in fig4 by the byte dac 0 through dac 7 . fig7 represents the process of converting a synchronous data signal , in the form of a message packet including a sync byte , a character count , and a plurality of data bytes , into an asynchronous data signal , as used in the general purpose communications processor illustrated in fig3 . specifically , it is the process employed in the receive portion 34 of the general purpose communications processor . it should be noted that this process for converting the synchronous data signal to an asynchronous data signal can be accomplished either through hardware as illustrated in fig3 or through software . fig7 represents the basic process or program for converting synchronous data signals to asynchronous data signals . step 130 corresponds with a start of the process . step 132 represents a step of receiving synchronous data in the form of a message packet which includes a sync byte , a character count , and a plurality of data bytes . next , step 134 the text the sync byte by checking the first receive byte to see if it corresponds with a predetermined sync byte pattern . of course , it is possible that the sync byte may be positioned somewhere else within the message packet , in which case the step for detecting the sync byte would check in the predetermined position for the sync byte . of course , it is most practical to position the sync byte in the first receive byte of the message packet . also , step 134 includes synchronizing the internal clock with the detected sync byte . since a sync byte is located in a fixed position in each message packet , the detection of the sync byte provides timing security for the complete message packet . in step 136 , the character count is detected . preferably , the character count is found in the second received byte . however , as with the sync byte , the character count may be located at another position within the message packet . step 138 represents the output formatting step which includes a number of sub - steps or sub - processes for formatting the output in the necessary asynchronous form to be output to an asynchronous data terminal . the output formatting step 138 includes step 140 which stores the data bytes in alternate buffers . the data bytes may be stored in a single buffer , however , at least two buffers , each alternately loaded with a complete message packet , is preferable . step 142 adds start and stop bits to each data byte . step 144 receives the output of the detected character count and provided the count to step 145 which outputs only the number of data bytes corresponding to the detected character count . step 148 merely checks to see if it is time to stop the communication . if the answer is no , the process returns to step 132 . if the answer is yes , then the process is over and it proceeds to the end at step 150 . an advantage of the general purpose communications processor as illustrated in fig3 is that it provides for a low cost , stand alone , communications system which provides for extremely fast communications . the use of a transmit processor and a receive processor enables the system to operate in full duplex mode . the employment of a transmit processor and a receive processor enables the system to use two commonly available processors , rather than a single exotic , super fast processor . for example , the speed with which the receive processor 70 can communicate with the scc 82 ( for example a usart ) may be kept to a reasonable level , rather than at a super high speed . because of the use of two normal processors , a dramatic cost difference and thus a lower manufacturing cost can be obtained when compared with using a single very high speed processor . using a transmit and a receive processor enables independence of the transmit channel from the receive channel and thus enables protocols , speeds , etc . to be independent of one another . although the above system has been described in reference to the operation of a t1 system , in common use in the united states , as well as other countries , it should be noted that the instant invention may be employed with other systems in use . for example , the instant invention may be easily employed in a european standard primary digital multiplex system . such a signal ( the ccitt primary multiplex signal ) employs a frame with 32 channels of 8 bits each , rather than the 24 channels of the ds - 1 signal . the first channel or byte is used as a framing signal , the second through sixteenth channels are for encoded speech or data , the seventeenth channel is for signaling information for each channel , and the remaining fifteen channels are for encoded speech or data . thus , there are thirty data bytes , one framing word and one signaling word in each thirty - two byte frame . since the frames occur at the standard 8 , 000 per second rate , the data rate is 256 bits in 125 ms or 2 . 048 mbps . the instant invention is fully applicable to the above european system , as well as others in existence . although a specific form of embodiment of the instant invention has been described above and illustrated in the accompanying drawings in order to be more clearly understood , the above description is made by way of example and not as a limitation to the scope of the instant invention . it is contemplated that various modifications apparent to one of ordinary skill in the art could be made without departing from the scope of the invention which is to be determined by the following claims .	7
like characters of reference designate like parts in those figures of the drawings in which they occur . referring first to fig1 - 6 the reference numeral 10 indicates one embodiment of the device , as a whole , comprising an upright forward and rearwardly open channel outer frame means 12 which supports a vertically telescoping handle means 14 in turn vertically reciprocating a panel sweep means 16 for propelling animal feces 18 , or other articles into an open receptacle means 20 , which may be a conventional plastic sack , when the handle means is telescoped downward . the frame means 12 includes an outer inverted u - shaped support frame 21 having a bight portion 22 and depending legs 24 and 26 provided with inwardly turned flange edges 28 for vertically slidably receiving an inverted u - shaped inner frame means 30 having a square aperture 31 medially the ends of its bight portion and depending stub legs 32 and 34 cooperatively received between the inner surface of the outer frame legs 24 and 26 . the inner frame means stub legs are similarly provided with flange edges 36 and 38 which are nested between the respective outer frame flanges 28 during reciprocating movement of the inner frame means , as will now be described . the handle means 14 comprises an upright tubular base member 40 rigidly connected as by welding , at its depending end portion with the outer frame bight member 22 , medially its length , in axial alignment with an aperture 33 formed therein . the handle means further includes an elongated tubular handle 42 having its depending end portion slidably received within the upper end portion of the tube 40 and axially connected with a spring guide 44 having an annular stop 45 adjacent its uppermost end . the depending end portion of the spring guide 44 is bifurcated as at 47 , and provided with converging surfaces 49 for entering the bight portion aperture 31 of the inner frame 30 . a screw 51 inserted into the slot 47 rigidly secures the spring guide 44 to the inner frame 30 . a resilient member , such as helical spring 46 , surrounds the spring guide 44 and abuts the stop 45 at its uppermost end and the top surface of the outer frame means 21 bight portion 22 at its depending end for normally biasing the handle member 42 in a telescopic extended direction . the frame means 12 further includes a planar base plate 48 having upstanding vertically slotted relatively short legs 50 which are slidably received by the inner surface of the respective outer frame means legs 24 and 26 and are secured to the depending end portion of the outer frame legs by bolt and nut means 52 . the base plate 48 is transversely widened in a rearward direction opposite the base legs 50 for supporting the apparatus 10 on a planar surface such as the earth 56 ( fig3 ). a pair of stub axles 58 , only one being shown , project inward in confronting axial alignment from the central portion of each leg 32 and 34 of the inner frame means 30 . the stub axles 58 are longitudinally slidably received in downwardly open grooves 60 , only one being shown , formed in the outer surface of each leg 59 and 61 of the inverted u - shaped sweep means 16 having a planar bight portion 63 . a generally rectangular panel 64 forming the sweep portion of the sweep means 16 , is integrally connected by one marginal side to the bight portion 63 . the legs 32 and 34 of the inner frame means 30 are centrally provided with through cam slots 70 each having respective end portions substantially vertically aligned and disposed on opposite sides of the respective stub axle 58 with an intermediate portion 72 of the slots arcuately bowed in a rearward direction around the position of the respective stub axle 58 . the purpose of the slots 70 is to form a cam surface for guiding the respective end portions of an elongated axle 74 , extending at respective end portions through the respective cam slot 70 and apertures in the depending end portion of the sweep means legs 59 and 61 , and in transverse slots 76 in the respective leg 24 and 26 of the outer frame means 21 . the horizontal slot 76 permits the axle 74 to move forwardly and rearwardly relative to the outer frame legs 24 and 26 when the inner frame and cam slots 70 are moved downwardly relative to the axle 74 during downward telescoping movement of the handle 42 which vertically pivots the panel sweep means 16 substantially 180 ° about the horizontal axis of the stub shafts 58 . one embodiment of the container means 20 comprises a wire - like bracket member 78 having a u - shaped end portion comprising a bight portion 80 and upstanding legs 82 forming a three sided socket for receiving three sides of an endless container support 84 having a peripheral groove 86 for nesting the bight portion 80 and vertical legs 82 of the bracket member u - shape and impinging open end edge portions of a flexible bag 88 between the wire - like bracket member and the groove 86 . the open end portion of the bag 88 is extended through the endless container support 84 and doubled back upon itself before inserting the support 84 into the bracket 78 . the bracket member legs 82 are bent at right angles intermediate their ends , as at 90 , forming legs 91 extending horizontally parallel and forwardly toward opposing top end portions of the outer frame means 21 for respectively entering apertures 92 therein and are locked by a pair of set screws 93 . an endless resilient member 94 on the horizontal legs 91 is manually moved to impinge the bag doubled back end portion overlying the support 84 opposite the bight portion 80 as illustrated by fig1 . in the operation of the embodiment of fig1 - 6 the apparatus 10 is positioned , as illustrated by fig1 relative to feces or other articles 18 to be bagged . the handle member 42 is manually telescoped into the tube 40 which forces the spring guide 44 downward and moves the inner frame 30 downwardly within the outer frame 21 , vertically pivoting the sweep means 16 through the frame means end openings and propels the articles 18 into the receptacle 88 . release of manual pressure on the handle member 42 permits the spring 46 to telescopically extend the handle member 42 relative to the tube 40 and return the sweep means 16 to the position illustrated by fig1 - 3 . when all the articles 18 have been picked up , or the container 88 filled , the container is removed from the bracket 78 and placed in a trash receiving receptacle , not shown . a clean empty receptacle 88 is then attached to the bracket 78 as described hereinabove , thus completing one cycle of operation . referring also to the remaining fig7 and 9 wherein prime numerals indicate modified parts or assemblies . the reference numeral 10 &# 39 ; indicates another embodiment in which the assembled frames and telescoping handle members are substantially identical with respect to the embodiment 10 except as hereinafter noted . the frame means 12 &# 39 ; is modified by omitting the base plate member 48 . the container means 20 &# 39 ; comprises a generally rectangular container 102 having a top 103 ; a bottom 104 ; opposing sides ; one closed rearward end wall 107 ; and , a forward end 108 having an opening 109 . a ramp 110 is inclined downwardly from the end 108 toward the surface of the earth 56 for guiding articles into the container ( fig7 ). adjacent its forward end wall 108 the bottom wall 104 is provided with a transverse recess 111 which receives and pivotally supports the bight portion 80 of the wire frame member 78 permitting vertical pivoting movement of the container 102 about the horizontal axis of the bight portion 80 as presently explained . the container end wall 107 supports a transverse axle 112 which journals a pair of wheels 114 at its respective end portions adjacent opposite sides of the container . the purpose of the wheels 114 is to move the device 10 &# 39 ; across the surface of the earth in a two wheel dolly fashion , accomplished by tilting the handle member 14 to the right , as viewed in fig8 . the panel sweep rectangular portion panel 64 is replaced by a brush member 100 similarly secured to the sweep support bight portion 63 . the brush member 100 is characterized by paint brush - like bristles 101 which contact articles and / or the surface being cleaned and sweep articles or debris through the open frame means 12 &# 39 ; and deposit the same within the container 102 through its opening 109 . with the device 10 &# 39 ; in the position of fig8 the device can be moved from location to location in a two wheel dolly fashion as explained hereinabove . when it is desired to pick up articles with the device 10 &# 39 ;, the handle and frame means are manually lifted and moved to the right , as viewed in fig8 thus pivoting the container means 102 about the axis of the bracket member bight portion 80 to dispose the container means 102 in the position illustrated by fig7 wherein its opening 109 is in confronting relation with the opening of the frame means 12 &# 39 ; and the brush members 100 when the latter are disposed in the dotted line position of fig7 . thereafter , the operation of the device 10 &# 39 ; is substantially identical with the above described operation of the embodiment 10 during the article pickup or cleaning action . an exception is that the brush members 100 pick up smaller articles than is possible with the paddle or planar member 64 . after picking up articles , the container means 102 may be emptied by removing it from the bight portion 80 or manually pivoting the wheel equipped end portion of the container 102 upwardly so that its opening 109 is disposed downwardly over a suitable trash receiving receptacle , not shown . the device 10 &# 39 ; may be repositioned , as illustrated by fig8 and 9 , by manually lifting the handle and frame means in an upward direction , as viewed in fig7 - 9 , to pivot the container about the axis of the bracket bight portion 80 in its groove 111 to dispose the container wall 103 downwardly , as illustrated by fig8 . the depending ends of the frame means 12 &# 39 ; legs rest upon respective side edge portions of the container bottom wall 104 . obviously , the invention is susceptible to changes or alterations without defeating its practicability . therefore , i do not wish to be confined to the preferred embodiment ( s ) shown in the drawing ( s ) and described herein .	4
in the description of the figures that follows , like elements will be denoted with like numerals throughout the figures and description thereof . fig1 shows a state - of - the - art beverage system / dispenser (“ system ”). 100 that includes a carbonation system 110 , a heat transfer system 120 , a plumbing / manifold assembly 130 , a valve / nozzle assembly 140 and a recirculation pump 150 . carbonation system 110 is provided with a supply of carbon dioxide through line 112 from a carbon dioxide source ( not shown ). heat transfer system 120 is provided with a supply of product through a product supply line 121 and a supply of water through a water supply line 122 ( both from sources not shown ). heat transfer system 120 chills the product supply and water supply and transfers pre - chilled water through a product transfer line 114 to carbonation system 110 , where the pre - chilled water is carbonated . thereafter , carbonated , pre - chilled water is transferred to heat transfer system 120 through a product transfer line 116 . carbonation system 110 is , generally , provided with a separate power supply 118 . heat transfer system 120 transfers chilled plain water , chilled carbonated water and chilled product to plumbing / manifold assembly through product lines 124 , 126 and 128 , respectively . plumbing / manifold assembly 130 then transfers chilled plain water , chilled carbonated water and chilled product to valve / nozzle assembly 140 through product lines 132 , 134 and 136 , respectively . valve / nozzle assembly 140 is , generally , provided with a separate power supply 142 that powers valve / nozzle assembly 140 to dispense chilled product through a product dispense line 144 . in the state - of - the - art method and system , recirculation pump 150 continually recirculates chilled plain water through product lines 152 and 154 from plumbing / manifold assembly 130 to heat transfer system 120 and , likewise , continually recirculates chilled carbonated water through product lines 156 and 158 from plumbing / manifold assembly 130 to heat transfer system 120 . from heat transfer system 120 chilled plain water , chilled carbonated water and chilled product are again transferred to plumbing / manifold assembly 130 through product lines 124 , 126 and 128 , respectively . because recirculation pump 150 is continually recirculating chilled plain water and chilled carbonated water from plumbing / manifold assembly 130 to heat transfer system 120 , recirculation pump 150 is powered from a source not shown in fig1 . in fig1 , recirculation pump 150 is also shown associated with a backflow preventer 159 ( not shown again in fig2 - 6 , but could be used in those situation where recirculation pump is not a unidirectional pump ). the power source for recirculation pump 150 in the embodiment shown in fig1 could be part of power supply 118 for carbonation system 110 , part of power supply 142 for valve / nozzle assembly 140 , or a separate power supply . fig2 shows a system 200 , in which all of the components of system 200 are essentially the same as in system 100 in fig1 . in addition , fig2 shows that system 200 includes a timer / relay / controller 210 that is connected to its own power supply 220 . timer / relay / controller 210 is also connected to recirculation pump 150 via power line 240 . in the embodiment shown in fig2 , and different than the embodiment shown in fig1 , recirculation pump 150 is powered only by power supply 220 that is controlled by timer / relay / controller 210 . thus , power is supplied from power supply 220 via power line 240 to recirculation pump 150 according to the manner in which timer / relay / controller 210 is set . recirculation pump 150 is turned off by timer / relay / controller 210 after completing one cycle of recirculation ( i . e . activation time plus duration of time ). recirculation pump 150 repeats a cycle of recirculation based on turn on / turn off times and , thus , the recirculation cycle time , for each turn on / turn off determined by timer / relay / controller 210 . according to this embodiment of the present disclosure , the duration of one cycle of recirculation may be randomly set by the end - user ( i . e ., the establishment in which system 200 is installed ). in turn , one cycle of recirculation can be determined easily through trial and error by the end - user to attain , e . g ., the desired product temperature , whether mandated by a product supplier or by the end - user . it will be appreciated by those skilled in the art that the duration of one cycle of recirculation may be adjusted according to parameters known to the end - user , such as time of day , outside temperature , and similar such parameters . the end - user would appreciate from experience that , for example , during peak use periods ( such as lunch and / or dinner ) one cycle of recirculation may occur less frequently ( or not at all ) than during non - peak use periods ( such as mid - morning , mid - afternoon and / or late night ). fig3 shows a system 300 , in which all of the components of system 300 are essentially the same as in system 200 in fig2 . system 300 is an embodiment of the present disclosure in which the activation and duration of timer / relay / controller 210 is not based upon a set time as is the case in the embodiment of fig2 . rather , the activation and duration of timer / relay / controller 210 ( and thus the activation / duration of recirculation pump 150 ) is based on monitoring pressure changes in plumbing / manifold assembly 130 . as background , when a beverage is dispensed from valve / nozzle assembly 140 there is a pressure change ( drop ) in one or more of product lines 132 , 134 and / or 136 . according to the embodiment shown in fig3 , a change in pressure in one or more of product lines 132 , 134 and / or 136 is detected by a pressure transducer / pressure switch 310 placed in association with plumbing / manifold assembly 130 which , in turn , is associated with timer / relay / controller 210 through a connection 312 . if there is no pressure change detected ( meaning no product is being / has been dispensed by valve / nozzle assembly 140 ) by pressure transducer / pressure switch 310 after a set duration of time ( for example , approximately 8 - 12 min . at 90 ° f . ambient temperature and 65 % relative humidity ), pressure transducer / pressure switch 310 activates timer / relay / controller 210 through connection 312 , and a recirculation cycle ( s ) of recirculation pump 150 will be performed , after which recirculation pump 150 will be turned off . again , recirculation pump 150 continues to perform recirculation cycle ( s ) until such time as timer / relay / controller 210 is deactivated via connection 312 when pressure transducer / pressure switch 310 detects a pressure change in plumbing / manifold assembly 130 . by performing pressure sensing using pressure transducer / pressure switch 310 , timer / relay / controller 210 will be activated and deactivated by signals from connection 312 . therefore , in some respects , one skilled in the art can envision that system 300 automatically responds to peak use periods and non - peak use periods because pressure changes in plumbing / manifold assembly 130 are indicative of use , and lack of use , respectively . alternatively , timer / relay / controller 210 may be activated if there is no change in pressure in plumbing / manifold assembly 130 over different preset time intervals . for example , timer / relay / controller 210 may be activated if there is no change in pressure in plumbing / manifold assembly 130 for 1 , 5 or 10 min ., or for any other time desired , and kept activated for any time period chosen by the end - user until such time as a change in pressure is detected . fig4 shows a system 400 , in which all of the components of system 400 are essentially the same as in system 300 in fig3 . system 400 is an embodiment of the present disclosure in which the activation and duration of timer / relay / controller 210 is not based upon a set time or pressure measurement . rather , the activation and duration of timer / relay / controller 210 ( and thus the activation / duration of recirculation pump 150 ) is based on monitoring temperature changes in plumbing / manifold assembly 130 . as mentioned above , the quality of dispensed beverages from valve / nozzle assembly 140 depends on the temperature ( s ) in one or more of product lines 132 , 134 and / or 136 , usually of all three lines . according to the embodiment shown in fig4 , a change in temperature in one or more of product lines 132 , 134 and / or 136 is detected by a temperature sensor 410 placed in association with plumbing / manifold assembly 130 which , in turn , is associated with timer / relay / controller 210 through a connection 412 . if there is no temperature change detected ( meaning that beverage quality is likely not affected ) by temperature sensor 410 timer / relay / controller 210 is not activated through connection 412 , and recirculation cycle ( s ) of recirculation pump 150 will not be performed . if , however , temperature sensor 410 detects an increase in temperature above a set threshold temperature ( set , e . g ., by the end - user or mandated by a product supplier ), a signal will be sent to timer / relay / controller 210 via connection 412 , timer / relay / controller 210 will be activated to start recirculation pump 150 to perform recirculation cycle ( s ). again , recirculation pump 150 continues to perform recirculation cycle ( s ) until such time as timer / relay / controller 210 is deactivated via connection 412 when temperature sensor 410 detects that a desired reduction to a predetermined lower temperature is attained in one or more of product lines 132 , 134 and / or 136 of plumbing / manifold assembly 130 . by temperature monitoring and sensing using temperature sensor 410 , timer / relay / controller 210 will be activated and deactivated by signals from connection 412 . therefore , in some respects , one skilled in the art can envision that system 400 automatically responds to environmental ( i . e ., ambient temperature at a point of use location of system 400 ) because temperature changes in plumbing / manifold assembly 130 can be indicative of such ambient conditions . in the embodiment shown in fig4 , the temperature at which activation of timer / relay / controller 210 occurs and the temperature at which deactivation of timer / relay / controller 210 occurs can be selected according to particular needs . for example , the activation / deactivation temperature may be the same , e . g . 40 ° f ., so that activation of timer / relay / controller 210 occurs when the measured temperature of plumbing / manifold assembly 130 goes above 40 ° f . and deactivation of timer / relay / controller 210 occurs when the measured temperature of plumbing / manifold assembly 130 reaches 40 ° f . more commonly however , the activation / deactivation temperature will be set as a range of temperatures , e . g . a 40 ° f . activation temperature and a 36 ° f .° deactivation temperature . as will be apparent to those of skill in the art , use of temperature sensor 410 provides flexibility in the parameters used to attain satisfactory product quality . fig5 shows a system 500 , in which all of the components of system 500 are essentially the same as in systems 300 and 400 in fig3 and 4 . system 500 is an embodiment of the present disclosure in which the activation / deactivation of timer / relay / controller 210 is not based upon a set time , pressure or temperature measurement . rather , the activation / deactivation of timer / relay / controller 210 ( and thus the activation / deactivation of recirculation pump 150 ) is based on changes in current and / or voltage supplied to and / or used by valve / nozzle assembly 140 . in this situation , this embodiment of the present disclosure is similar in concept to that of fig3 that measures pressure changes at one or more of product lines 132 , 134 and / or 136 , usually of all three lines of plumbing / manifold assembly 130 . the pressure changes at one or more of product lines 132 , 134 and / or 136 of plumbing / manifold assembly 130 indicate that valve / nozzle assembly 140 of system 300 is in use , and not requiring the recirculation provided by recirculation pump 150 . likewise , current and / or voltage use indicates that valve / nozzle assembly 140 of system 500 is in use , and not requiring the recirculation provided by recirculation pump 150 . according to the embodiment shown in fig5 , a change in current and / or voltage use by valve / nozzle assembly 140 is detected by a current and / or voltage sensing device 510 placed in association with power supply 142 of valve / nozzle assembly 140 . current and / or voltage sensing device 510 is also associated with timer / relay / controller 210 through a connection 512 . if there is no current and / or voltage change detected ( meaning no product is being / has been dispensed by valve / nozzle assembly 140 ) by current and / or voltage sensing device 510 after a set duration of time ( for example , approximately 8 - 12 min . at 90 ° f . ambient temperature and 65 % relative humidity ), current and / or voltage sensing device 510 activates timer / relay / controller 210 through connection 512 , and a recirculation cycle ( s ) of recirculation pump 150 will be performed , after which recirculation pump 150 will be turned off . again , recirculation pump 150 continues to perform recirculation cycle ( s ) until such time as timer / relay / controller 210 is deactivated via connection 512 when current and / or voltage sensing device 510 detects a current and / or voltage change at valve / nozzle assembly 140 . by performing current and / or voltage change sensing using current and / or voltage sensing device 510 , timer / relay / controller 210 will be activated and deactivated by signals from connection 512 . therefore , in some respects , one skilled in the art can envision that system 500 also can automatically respond to peak use periods and non - peak use periods because current and / or voltage changes at valve / nozzle assembly 140 are indicative of use , and lack of use , respectively . alternatively , timer / relay / controller 210 may be activated if there is no change in pressure in plumbing / manifold assembly 130 over different preset time intervals . for example , timer / relay / controller 210 may be activated if there is no change in current and / or voltage pressure at valve / nozzle assembly 140 for 1 , 5 or 10 min ., or for any other time desired and kept activated for any time period chosen by the end - user until such time as a change in current and / or voltage is detected . fig6 shows a system 600 , in which all of the components of system 600 are essentially the same as in systems 300 , 400 and 500 in fig3 and 5 . system 600 is an embodiment of the present disclosure in which the activation / deactivation of a timer / relay / controller 610 is not based upon a set time , pressure , temperature or current and / or voltage measurement . rather , the activation / deactivation of timer / relay / controller 610 ( and thus the activation / duration of recirculation pump 150 ) is based on monitoring and recording dispense - patterns of either plumbing / manifold assembly 130 or valve / nozzle assembly 140 . in the embodiment shown in fig6 , dispense - patterns of plumbing / manifold assembly 130 are monitored , but one skilled in the art would appreciate that dispense - patterns at valve / nozzle assembly 140 would be useful as well for the same purpose . in this embodiment of the present disclosure , system 600 is equipped with a self - learning timer / relay / controller 610 that records use , and therefore beverage dispense - patterns , at one or more of product lines 132 , 134 and / or 136 , usually of all three lines , of plumbing / manifold assembly 130 . self - learning timer / relay / controller 610 records the dispense - patterns over a course of time ( e . g . a week ), and also the dispense - patterns during each day of the week , as indicated by a dispense - pattern metering device 620 via a connection 622 with self - learning timer / relay / controller 610 . self - learning timer / relay / controller 610 thereafter is able to predict low / non - use periods during a week from that history . self - learning timer / relay / controller 610 then activates recirculation pump 150 according to the dispense - patterns learned by self - learning timer / relay / controller 610 . again , self - learning timer / relay / controller 610 recognizes low / non - use periods and the duration of same . therefore , self - learning timer / relay / controller 610 will maintain recirculation pump 150 activated for a time sufficient , and in accordance with , the recognized low / non - used periods and their duration . therefore , one skilled in the art can envision that system 600 automatically responds to peak use periods and non - peak use periods as learned over a period of time . likewise , the periods of peak use and non - peak use may change over longer periods of time ( e . g ., seasonally ) and self - learning timer / relay / controller 610 will accommodate such seasonal changes . fig7 shows resulting temperatures using various pump on / pump times according to the present disclosure . the target temperature of the embodiments shown in fig7 was an assumed maximum target temperature of 42 ° f . in the table shown in fig7 , test run . # 1 reflects the increase in temperature above the maximum often set by a product supplier without any recirculation via the recirculation pump over a period of time of 30 min . test runs . # 2 - 10 show that using various pump on , and pump off times the target maximum temperature of 42 ° f . can be attained using the intermittent recirculation systems and methods according to the present disclosure . more particularly , assuming a maximum product temperature , that is often set , by a product supplier of 41 ° f ., test runs . # 3 - 10 attain this target temperature . further , assuming a maximum product temperature set by product supplier of 40 ° f ., test runs . # 9 - 10 attain this target temperature . it should also be recognized that the terms “ first ”, “ second ”, “ third ”, “ upper ”, “ lower ”, and the like may be used herein to modify various elements . these modifiers do not imply a spatial , sequential , or hierarchical order to the modified elements unless specifically stated . while the present disclosure has been described with reference to one or more exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the present disclosure . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the disclosure without departing from the scope thereof . therefore , it is intended that the present disclosure not be limited to the particular embodiment ( s ) disclosed as the best mode contemplated , but that the disclosure will include all embodiments falling within the scope of the appended claims .	1
preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings . it should be noted , however , the scope of the invention is not limited to the illustrated examples . fig1 shows a structure of a first embodiment according to the present invention , and fig2 is a timing chart of the circuit shown in fig1 . in this embodiment , a current value control section 1 has an effect of reducing the sensitivity of a driver element 5 to a threshold voltage variation among pixels . further , fig1 shows a pixel circuit located in the j - th row and the i - th column , and n - channel tfts are used for all the transistors in this circuit structure . one of a source electrode and a drain electrode of a signal selection element 7 having a gate electrode connected to a scan line sj is connected to a signal line di . the other of the source and drain electrodes of the signal selection element 7 is connected with a second electrode 9 of a tft characteristics storage capacitor 8 , a first electrode 10 of which is connected with a gate electrode of the driver element 5 . further , one of a drain electrode and a source electrode of a first switching element 6 is connected to a positive power source line 11 , and the other of the drain and source electrodes of the first switching element 6 is connected to the gate electrode of the driver element 5 . a reset line rj is connected to a gate electrode of the first switching element 6 . one of a drain electrode and a source electrode of a second switching element 16 having a gate electrode connected with the reset line rj is connected with a connection point between the signal selection element 7 and the second electrode 9 of the tft characteristics storage capacitor 8 , and the other of the drain and source electrodes of the second switching element 16 is connected with a connection point between the driver element 5 and a sub pixel 2 ( 2 a , 2 b ). further , a second electrode 15 of a brightness signal storage capacitor 13 is connected to a connection point between the signal selection element 7 and the tft characteristics storage capacitor 8 , and a first electrode 14 of the brightness signal storage capacitor 13 is connected with the positive power source line 11 ( the drain electrode of the driver element 5 ). prior to writing a brightness voltage signal to the current value control section 1 by means of the signal line di , at a time before time a in fig2 , a signal of the reset line rj is set to a potential ( in this case , h level ) which places the first switching element 6 and the second switching element 16 in a conducting state . thus , the first and second switching elements 6 and 16 are turned on , and a voltage of the positive power source line 11 is set at the first electrode 10 of the tft characteristics storage capacitor 8 and a voltage connected to the sub - pixel 2 is set to the second electrode 9 of the tft characteristics storage capacitor 8 . consequently , a potential difference which is larger than the threshold voltage between the gate and the source of the drive element 5 is stored between the electrodes 9 and 10 of the tft characteristics storage capacitor 8 . subsequently , the potential of the selection control lines e ( j , k ) is set to a potential which turns all the sub - pixel selection elements 3 ( 3 a , 3 b ) in the j - th row off . in this state , because the potentials of the drain and the gate of the driver element 5 are identical and the potential difference which is larger than the gate - source threshold voltage of the driver element is generated at the tft characteristics storage capacitor 8 , the driver element 5 is in a conducting state . however , because all the sub - pixel selection elements 3 are turned off , no electric current flows through the light emitting elements 4 . as a result , the source potential of the driver element 5 increases , and when the gate - source potential of the driver element 5 equals the threshold voltage of the driver element 5 , the driver element 5 is turned off . namely , the threshold voltage of the driver element 5 is recorded in the tft characteristics storage capacitor 8 . then , with the reset line rj being set to a potential ( l level ) which places the first switching element 6 and the second switching element 16 in a non - conducting state , and the scan line sj being set to a potential which places the signal selection element 7 in a conducting state , a brightness signal ( electrical signal ) voltage supplied from the signal line di is recorded in the brightness signal storage capacitor 13 via the signal selection element 7 . at this time , because the threshold voltage of the driver element is held at both ends of the tft characteristics storage capacitor due to the threshold voltage detection process described above , the gate voltage of the driver element 5 has a value obtained by adding the threshold voltage of the driver element 5 to the brightness signal voltage which is recorded . subsequently , with the scan line sj being set to a potential ( l level ) which puts the signal selection element 7 in a non - conducting sate and one or more ( typically one ) of the selection control lines e ( j , k ) being selected , one or more ( typically one ) of the light emitting elements 4 ( 4 a , 4 b ) is placed in a light emitting state . the value of the current id flowing in the driver element 5 at this time can be represented by the following expression : in the above expression , β is a value which is determined by the mobility , the shape , and the material of the driver element 5 , vgs is a potential between the gate and the source of the driver element 5 , and vth is the threshold voltage of the driver element 5 . as described above , the value of the gate potential of the drive element 5 is a value obtained by adding the threshold voltage of the driver element 5 to the brightness signal voltage . therefore , when the brightness signal voltage is represented by vdata , the following equation can be obtained . consequently , the current id can be represented by the following expression . thus , the current value id does not depend on the threshold voltage of the driver element 5 , so that the display quality can be increased . here , vo is a source potential of the driver element 5 when the light emitting element 4 emits light . with the above structure , by turning the sub - pixel selection element 3 off , the electric current of the driver element 5 can be turned off and the threshold voltage of the driver element 5 can be stored in the tft characteristics storage capacitor 8 . consequently , even when the signal selection element 7 , the first and second switching elements 6 and 16 , the driver element 5 , and the sub - pixel selection elements 3 are formed by n - channel tfts , it is not necessary to provide a switching element for turning the electric current of the driver element off . it is therefore possible to form a pixel circuit using amorphous silicon tfts with the same number of elements as the number of elements in the pixel circuit using p - channel tfts shown in fig8 . fig3 shows another embodiment to which the present invention is applied . this pixel circuit has an effect of reducing the sensitivity of the driver element 5 to a variation of β , in addition to a variation of the threshold voltages , among the pixels . as shown in fig3 , the end of the signal selection element 7 opposite to the end connected to the signal line di is connected with the end ( source electrode ) of the driver element 5 which is connected to the sub pixel 2 . this end of the signal selection element 7 opposite to the signal line di is also connected with the second electrode 9 of the tft characteristics storage capacitor 8 , the first electrode 10 of which is connected to the gate electrode of the driver element 5 . further , the positive power source line 11 and the gate of the driver element 5 are connected via the first switching element 6 , and the gate of the first switching element 6 , similar to the gate of the signal selection element 7 , is connected to the scan line sj or the reset lint rj ( to the reset line rj in the example shown in fig3 ). prior to the timing a in fig4 , the potential of the selection control lines e ( j , k ) is set to a potential which places all the sub - pixel selection elements 3 in the j - th row in a non - conducting state . then , with the scan line sj being set to a potential ( h level ) which puts the signal selection element 7 and the first switching element 6 in a conducting state , a brightness signal current is caused to flow via the signal line di . at this time , because the first switching element 6 is turned on , the gate potential and the drain potential of the driver element 5 are identical , to allow the brightness signal current to flow in the driver element 5 . consequently , when the brightness signal current is represented by i data , the voltage represented by the following expression is generated between the gate and the source of the driver element 5 : subsequently , the scan line sj is set to a potential ( l level ) which puts the signal selection element 7 and the first switching element 6 in a non - conducting state , and one or more ( typically one ) of the selection control lines e ( j , k ) is selected to place one or more of the light emitting elements 4 in a light emitting state . at this time , the value of current id flowing in the driver element 5 can be represented by the following expression : as such , with the use of the pixel circuit shown in fig3 , as in the above example , the current value id does not depend on the threshold value vth and β of the driver element 5 , so that the display quality can be increased . while the preferred embodiments of the present invention have been described using specific terms , such description is for illustrative purposes only , and it is to be understood that changes and variations may be made without departing from the spirit or scope of the appended claims .	6
the present invention broadly concerns a head cap for a wrench and a wrench incorporating such a head cap . the invention also concerns a method for providing a wrench with indicia such as logos , trademarks , designs , names , or emblems . the exemplary embodiments of the invention are describe with respect to a ratchet wrench , but it should be understood that the invention is not strictly limited to only ratchet - type wrenches . therefore , with reference to fig1 , 2 and 3 , a ratchet wrench 10 is illustrated that is provided with an exemplary embodiment of the head cap of the present invention . ratchet wrench 10 includes a handle 12 extending along a longitudinal axis l - l with a “ working ” or ratchet head 30 disposed at a distal end of the handle 12 . attached to the ratchet 30 is ratchet head cap or cover 20 . fig4 shows a detailed and exploded view of ratchet wrench 10 . ratchet head 30 is configured to receive drive mechanism components 16 that are operative to rotate a drive stud 14 in selected direction . drive stud 14 may thus be considered a lower tool piece in this embodiment . head portion 30 also receives control components , for example to control the direction of rotational ratcheting . the drive mechanism 16 and slide actuator 15 are described in my previous application pct / us2005 / 047525 filed dec . 20 , 2005 , which is incorporated in its entirety herein by reference . thus , ratchet head 30 includes a surrounding sidewall 13 having a lower edge 17 and an opposite upper edge 19 ( fig2 a ). as can be seen in fig4 , ratchet head cover 20 is engineered to engage ratchet head 30 via wing portions 21 . it should be noted that slide actuator 15 is retained in its operating position by ratchet head cover 20 includes a generally flat plate portion 23 with a surrounding peripheral edge portion 29 when ratchet head cover 20 is snapped into position . to this end , also , the interior , non - exposed surface 25 of ratchet head cover 20 may include a channel 55 configured to receive a portion of slide actuator 15 ratchet head cover 20 also includes an exposed indicia surface 24 ( fig6 ) for printing , embossing , or attaching logos , trademarks , designs , names , or emblems . the indicia may be silk - screened , hot - stamped , pad - printed , laser printed , decaled , embossed , or molded onto or into the indicia surface 24 . indicia surface 24 may also include an attachment point for accessories . the ratchet head cover provided herein is also engineered to be removable or changeable . as described in detail below , the cover may be configured so that it is easily removed with a small screwdriver or such that removal requires a special tool or destruction of the cover . with reference to fig4 a it can be seen that wing recess 31 located on ratchet head 30 is sized and configured to receive wing 21 of the ratchet head cover 20 . fig5 - 10 all illustrate the ratchet head cover 20 in greater detail . with reference to fig2 a , 4 a , and fig5 - 10 the installation of ratchet head cover 20 can be better appreciated . with reference again to fig4 a , a top wall 33 is partially surrounded by retaining rim 34 that is proximate to upper edge 19 . rim 34 and top wall 33 accordingly forms a shallow cover recess cavity 35 . bottom surface 25 of the ratchet head cover 20 confronts surface 33 of the ratchet head 30 when in the mounted state . the perimeter of the ratchet head cover 20 has a shoulder 26 ( fig5 ), which corresponds in size and configuration to the retaining rim 34 of ratchet head 30 . upon assembly , shoulder 26 engages retaining rim 34 to ensure that the ratchet head cover 20 is centered on the ratchet head 30 and that lateral support is provided to the cover in the event that the ratchet is dropped or otherwise impacted . the outer perimeter of the head cover is provided with a radius “ r ” to prevent the head cover catching on surfaces when employing the ratchet wrench in tight spaces . ratchet head cover wing portions 21 engage in recesses 31 located on the sides of ratchet head 30 . each wing portion 21 includes cooperative interlocking features such as a snap feature or protrusion 22 that is sized and configured to engage snap cavity 32 located on the sides of the ratchet head 30 within the wing recess cavities 31 . once engaged , protrusions 22 act to retain the ratchet head cover 20 in position ( see fig2 a ). with reference to fig1 it should be noted that wing portions 21 are formed at a small acute angle “ a ” relative to a longitudinal plane “ p ” that is perpendicular to the plane of flat plate portion 23 . this facilitates location of the ratchet head cover on the ratchet head , especially for automated assembly . angle “ a ” also acts to wedge the ratchet head cover 20 onto the ratchet head 30 . angle “ a ” may range from zero to approximately twenty degrees . the head portion 30 should include a mating angle that is less than or equal to the head cover angle “ a ”. in the case where ratchet head cover 20 is of a molded construction , angle “ a ” will also facilitate release from the mold . ratchet head cover 20 may be formed of any material that is sufficiently flexible , when formed into the thin cross - section of wings 21 , to allow the wings to deflect without yielding such that the cover may be installed . such materials include , for example , steel , aluminum , titanium , carbon fiber , fiberglass , and plastic . preferably , the cover is molded from polymeric material that when polymerized is strong and stiff . an example of such a material is polyamide 66 plastic resin such as dupont ® zytel ® 101 . fibers may also be added to the material to increase the strength . in reference to fig9 and 10 , it can be seen that snap features 22 are of a rounded configuration , thus allowing the subsequent removal of the ratchet head cover 20 . to further facilitate the removal and replacement of the ratchet head cover 20 each wing portion 21 is provided with a removal notch 27 . removal notch 27 is provided with an angled surface 28 which provides a surface against which the wing portion 21 may be pried away from the ratchet head 30 with a small tool , thereby releasing snap feature 22 from snap cavity 32 to release the ratchet head cover 20 from the ratchet head 30 . fig1 , 12 , and 13 illustrate an alternative embodiment of the ratchet head cover 120 . in this embodiment , end portions 121 include a ramp - like protrusion or snap feature 122 that is configured to provide a permanent installation of a ratchet head cover 120 . referencing fig1 , snap feature 122 includes a ramp portion for facilitating the installation of the ratchet head cover 120 . snap feature 122 also includes lock surface 142 that mates with the ratchet head in a permanent fashion . locking surface 142 may be flat or slightly angled to ensure that the snap feature is not easily removed from the snap cavity . in addition and with reference to fig1 , end portions 121 do not include a removal notch as in the previous embodiment . again , a channel 155 may be provided to receive a portion of the slide actuator . fig1 a , 15 b , and 15 c show alternative embodiments of the snap feature . fig1 a illustrates a ratchet head cover 220 with a snap feature 222 that is oblong in shape having rounded end portions 229 . fig1 b illustrates a ratchet head cover 320 with a snap feature 322 that is rectangular in shape . fig1 c illustrates a ratchet head cover 420 with a snap feature 422 that is cylindrical in shape . with reference to fig1 a , 15 b , and 15 c it should be understood that the head portion of the ratchet wrench would be provided with a snap recess that corresponds in size and shape to the snap features shown in the corresponding figures . it should also be understood that the head covers shown in fig1 a , 15 b , and 15 c could be configured to be difficult to remove from the head , as is shown in the figures , or may be configured with a removal notch as best shown in fig5 and 6 . illustrated in fig1 is yet another embodiment of a ratchet wrench 510 . ratchet head cover 520 includes two wing portions 521 and also a front wing portion 550 . front wing portion 550 provides further support for the ratchet head cover 520 . head portion 530 includes removal access holes 536 that allow access from the interior 538 ( also see 38 fig2 a ) of head portion 530 to the bottom of snap recess 532 . removal access holes 536 allow the tool manufacturer to remove ratchet head cover 520 by inserting a tool through the access holes 536 to push the snap features out of snap recesses 532 . head cover 520 also includes a recess 556 sized and configured to receive an emblem 555 . emblem 555 is a form of indicia that may be that of a tool brand , vehicle make , racing team , or the name of the tools owner . emblem 555 may be secured to the head cover 520 with glue or it may be fastened with studs 560 . head cover 520 also includes thru holes 561 sized to receive studs 560 . studs 560 may be threaded in which case a nut may be assembled after insertion through holes 561 . preferably , however , the studs 560 may be formed of a plastic that can be melted subsequent to insertion through holes 561 thereby retaining the emblem 555 in recess 556 . fig1 illustrates a further embodiment of the ratchet head cover 620 where the indicia face 624 is of a domed shape . it is also contemplated that the indicia surface 624 could be formed in a variety of three - dimensional shapes including shapes that represent portions of an automobiles exterior design . in yet another embodiment of the ratchet head cover shown in fig1 and 19 , the cover 620 includes a mounting element 670 for attaching accessories to the wrench . accessories that would be useful to attach to a ratchet wrench include , for example , a small flashlight , a laser , a mirror , a belt clip , or the like . fig1 depicts the attachment feature having a dovetail configuration . the dovetail feature has a length “ l ,” a width “ w ,” and a thickness “ t .” the sides 672 of the dovetail have an acute angle “ b ” relative to indicia surface 624 . fig2 a , b , and c show several possible configurations of the attachment feature the attachment feature 770 shown in fig2 a has a triangular groove where the sides of the groove 772 and 773 are formed at an angle “ c ” to each other . the attachment feature may be formed with a lengthwise rail 875 having a flat outer surface 876 as shown in fig2 b . similarly , with reference to fig2 c , the lengthwise rail may be formed with a radiused outer edge 976 as is shown on attachment feature 970 . fig2 illustrates the attachment of a small flashlight 680 to the attachment feature 670 of cover 620 . flashlight 680 includes a dovetail groove 682 that is sized and configured to mate with the dovetail configuration of attachment feature 670 . the flashlight 680 is attached to the cover 620 by sliding the flashlight onto the attachment feature as indicated in fig2 . in reference now to fig2 - 24 , an alternative embodiment of a head cap or cover 920 is illustrated for use , for example , with a box end wrench 910 . this embodiment is provided to illustrate that the head cover according to the present invention may be used with wrenches other than ratchet wrenches . here , head cover 920 includes a flat plate portion 922 from which a downwardly depending surrounding skirt 94 depends . exposed surface 925 may be provided with indicia , as described above . skirt 924 has an inwardly turned lip 926 so that it may be mounted over working head 930 of wrench 910 so as to encompass all of the lower surface thereof . to this end , a notch 932 is provided to accommodate handle 912 . fig2 illustrates another embodiment in the form of a head cover 950 adapted to mount on wrench 960 that includes a handle 970 . here , wrench 960 is in the form of a deep socket 964 that is permanently affixed to handle 962 . head cover 970 includes a pair of side wings , such as side wing 972 which downwardly depend from flat plate portion 974 . likewise , a front wing portion 976 depends downwardly from flat plate portion 974 . suitable wing recesses are provided in a manner described above , so that such description is not again repeated . again , intermating cooperative interlocking structures may be provided , all in the manner of that described with respect to the first embodiment . head cover is again provided to show that a head cover may be used with other types of wrenches . from the foregoing , it should also be appreciated that the present invention contemplates a method of providing a wrench with selected indicia . this method may include any steps inherent in the above - described structures . broadly , the method provides selected indicia wherein the wrench has a forwardly located working head with a surrounding sidewall extending between an upper edge and a lower edge that is opposite the upper edge . furthermore , the wrench includes a handle extending longitudinally and rearwardly of the working head along a longitudinal axis . according to the broad method , a head cap is provided that includes a generally flat plate portion having a peripheral edge portion and opposite first and second surfaces and that has selected indicia located on the first surface . the method then includes the step of securing the head cap to the working head to define a mounted state such that the second surface confronts the working head with the first surface forming an exposed surface on the working head . here , the flat plate portion is sized and configured so that it spans a majority of the region surrounded by the upper edge of the working head with the peripheral edge portion of the head cap being substantially co - extensive with the upper edge of the working head when in the mounted state . the method may also include the step of securing the head cap by providing a mounting structure that downwardly depends from the peripheral edge portion and mechanically engaging the surrounding sidewall of the working head with this mounting structure . it is noted , the method may include other steps contemplated by the forgoing structures . accordingly , the present invention has been described with some degree of particularity directed to the exemplary embodiments of the present invention . it should be appreciated , though , that modifications or changes may be made to the exemplary embodiments of the present invention without departing from the inventive concepts contained herein . accordingly , the present invention has been described with some degree of particularity directed to the exemplary embodiments . it should be appreciated , though , that modifications or changes may be made to the exemplary embodiments without departing from the inventive concepts contained herein .	1
referring now to the drawings , fig1 , 2 , 3 and 4 show a conventional , known seal member 2 for use as a flanged joint gasket between two duct sections 4 , 6 ( fig2 ). the duct sections 4 , 6 have end flanges 8 , 10 respectively and when assembled the seal member 2 is sandwiched between the flanges 8 , 10 . as shown in fig2 , in the illustrated case the seal member 2 is housed in a groove or recess 12 let into the joint face 14 of the flange 8 on duct section 4 . the joint face 16 of the opposite flange 10 is finished flat . when in place in the recess 12 the exposed face of the seal member 2 stands slightly proud of the flange face 14 so that when the flanges 8 , 10 are clamped one against the other the seal is compressed into groove 12 by the opposing flange face 16 of duct section 6 . bolt holes 18 are spaced apart around the flange joints 8 , 10 to receive a multiplicity of clamp bolts ; the view of the gasket 2 in fig1 shows a total of sixteen bolt holes 18 , by means of which the flanges 8 , 10 are fastened together . in the views of fig2 , 3 and 4 the position of a bolt hole 18 is indicated by a centre line 20 midway across the breadth of the gasket 2 . the holes 18 in the gasket align with corresponding apertures 18 in the duct flanges 8 , 10 . typically gasket 2 comprises a single , monolithic body of elastomeric material . the thickness of the gasket normally is chosen to suit the application and properties of the material . thus , if the flanges are finished as plain faces the gasket 2 will normally consist of a thin , single sheet - like member of rectangular cross section as illustrated in fig3 . however , poor surface textures , for example milling cusps or witness marks left by milling operations on the faces of the joint flanges 8 , 10 may give rise to leakage problems . also flange movement due to relative flexing of the casing or duct sections 4 , 6 can cause sufficient distortion to result in leakage across a face of the gasket 2 . the seal member or gasket of the invention illustrated in fig5 and 6 is intended to provide a solution to these problems . the views of fig5 and 6 correspond to those of fig3 and 4 and show cross - sections and side views respectively . in the example used to illustrate the invention the gasket shown in fig1 has a particular shape , two long , parallel sides joined by semi - circular ends . however , it will be understood that the invention is not restricted to gaskets or seal members of this , or any other particular shape , and the following description with appropriate changes where necessary will be find general application . the drawings are not to scale . in the example described above the gasket illustrated in fig1 may be substituted by a gasket having the same profile in plan view but constructed as illustrated in the cross - section and detailed views of fig5 and 6 in accordance with the invention . the gasket member 30 according to the invention comprises a seal or gasket member made of an elastomeric material , depending on circumstances suitable alternative materials include plastic material , fibre or metal . as a replacement for the prior art gasket of fig1 a gasket in accordance with the present invention also has a profile in plan view of a closed figure consisting of two parallel sides joined by semi - circles at either end . in cross - section , however , as shown in fig5 it has the shape of a non - rectangular parallelogram . the gasket has a thickness “ x ” between opposite faces 32 , 34 , the remaining edges of the parallelogram , that is faces 36 , 38 are formed parallel to each other and at an oblique angle “ α ” with respect to the parallel faces 32 , 34 . in accordance with the invention the seal or gasket 30 , or at least as much of it as is practicable , has a branchiate structure . that is much of the body of the seal or gasket member has a structure akin to branchiae , the breathing organs or gills of a fish . the branchiate portions of the seal member 30 comprise at least one , and preferable a plurality of , flexible membranes or strips formed by a plurality of narrow slots . the present example has three slots 40 , 42 , and 44 which run parallel to the long edges or end faces 36 , 38 of the seal member , thus producing four flexible membrane strips 46 , 48 , 50 and 52 . the seal member may contain a greater or lesser number of slots and membrane strips . these slots 40 , 42 , 44 extend through the thickness of the gasket member 30 at oblique angle “ α ” with respect to the surfaces 32 , 34 , parallel to the faces 36 , 38 and to each other . the slots 40 , 42 , 44 extend part way around the gasket 30 , thus part of the gasket lies between the ends of the slots forming a land therebetween . referring to fig6 the ends of the slots , denoted by suffixes “ a ” and “ b ”, are spaced apart by a short distance “ y ”. preferably , the ends of the slots are formed at an oblique angle “ β ” with respect to the longitudinal direction of the slot , see 40 a and 40 b in fig6 . thus , depending upon the angles α , β and the dimensions x , y the portions of gasket overhang or overlay one another to greater or lesser amounts . a large overhang has the effect of reducing the stiffness of the gasket member 30 in the direction across the member compared with the stiffness of a solid seal member 2 of the prior art kind shown in fig2 , 3 and 4 . the narrow slots separate the gasket member 30 into a plurality of overlaying segments each of which is able to rotate slightly under load independently of each other . thus , by choosing the dimensions , the stiffness of the seal member 30 can be selected to create a flexible member that is able to seal against a surface of poor surface texture , such as against flange faces 14 , 16 of fig2 produced by milling . in addition each segment is also able to translate slightly under load to seal against a pair of such flange faces . in operation the independent small rotations of the segments counter contrary local variations in mating flanges and the translations counter sympathetic local variations and the narrow slots each function approximately as a plenum chamber . the resulting effect is to reduce any flow across the seal faces by introducing intermediate pressure pockets in each slot . furthermore the risk of leakage is greatly reduced because to establish a leakage flow all independent segments would have to be defective simultaneously . the slots improve sealing effectiveness by increasing flexibility in the segment contact and the number of potential seal barriers . it will become evident upon considering the detail shown in fig6 that the slots 40 , 42 , 44 could not continue around the seal member 30 without dividing it into a number of separate parts . therefore , in order to maintain structural integrity of the seal member 30 , each of the narrow slots is discontinuous at regular intervals along its length , the slot lengths being separated by individual lands of width “ y ”. each land thus formed potentially increases stiffness that could increase the risk of a leak . this problem is solved : firstly by staggering the lands between neighbouring slots 40 & amp ; 40 ′, 42 & amp ; 42 ′, 44 & amp ; 44 ′, and secondly by forming the ends of the slots 40 a & amp ; 40 b , 42 a & amp ; 42 b , 44 a & amp ; 44 b at compound angles . the lands forming the slot discontinuities are shown “ in - line ”, ie they are staggered in the same direction and relatively close together but , alternatively , the lands may be staggered in a “ zigzag ” fashion and / or more widely spaced apart . discontinuities increase the probability of a leak occurring but in compensation the number of slots may be increased thus reducing the overall possibility of a leak across the whole width of the gasket . boltholes introduce potential design complexity . the lands separating two or more slots should not be given to the aperture of a bolthole as to do so would create free ends of gasket sections . to avoid free ends that may be assembled incorrectly it is preferred that a bolthole aperture is surrounded by continuous seal land . fig7 shows an example of how the seal member 30 may be designed to avoid free ends . the seal member 30 is pierced by a bolthole aperture 18 approximately at mid - breadth . the slots 40 , 42 , 44 are terminated a short distance from the circumference of aperture 18 , thus leaving an uninterrupted land 54 surrounding the aperture 18 . in order to retain as much as possible of the benefit of the improvement due to the invention the width of the land 54 is kept as short as practicable . furthermore , it is inadvisable to design a joint so that the load carried by a bolt passes directly through a seal or gasket member as this could cause low cycle fatigue in the bolt . the preferred solution is substantially to relieve the clamp load immediately adjacent to a bolthole by one of two methods . first , the groove 12 into which seal 2 is fitted is formed around a bolthole to leave a boss concentric with the bolthole itself . since such a groove is formed by removing material from the duct flange 8 then the top of the boss remains level with the flange face 14 . alternatively , the machined part of groove 12 includes the sites of the boltholes 18 , that is a boss is not formed , and a washer of thickness equal to the depth of the groove is placed in the groove around a clamp bolt . in both instances , because the thickness of seal member 2 is slightly greater than the depth of groove 12 , when the flanges 8 , 10 are clamped together the seal member 2 is only lightly compressed all over and the greater amount of the clamp force is transmitted through either the bosses or the washers and contacting flange faces in the vicinity of the boltholes 18 .	5
embodiments of the present invention will be described below with reference to the accompanying drawings . fig1 to 8 illustrate the structure of a semiconductor device according to the first embodiment , and the sections of elements in different steps of a method of fabricating the device . as shown in fig1 , a semiconductor substrate 101 is prepared . a silicon oxide film 102 about 5 nm thick is formed on the surface of the semiconductor substrate 101 . a silicon nitride film 103 about 100 nm thick is deposited on the silicon oxide film 102 . the silicon nitride film 103 is coated with a resist film ( not shown ), and lithography using a light source such as krf or arf and reactive ion etching ( to be referred to as rie hereinafter ) are performed , thereby forming a trench 104 for burying a dummy pattern . the trench 104 extends through the silicon nitride film 103 , and reaches a depth of about , e . g ., 100 nm from the surface of the semiconductor substrate 101 . a silicon oxide film is deposited on the entire surface so as to be buried in the trench 104 by teos • cvd or high - density plasma ( to be referred to as hdp hereinafter ) cvd , and then planarized by cmp , thereby forming a dummy pattern 104 . as shown in fig2 , an anti - reflective coating ( to be referred to as an arc hereinafter ) 111 is formed on the surfaces of the planarized silicon nitride film 103 and dummy pattern 104 . a resist film 112 is formed on the arc 111 to form a bottom arc type resist pattern 112 . the arc film 111 is formed in order to use photolithography capable of processing faster than that when an electron beam is used , and to realize fine patterns . as shown in fig3 , the resist pattern 112 is used as a mask to etch the silicon nitride film 103 . as a consequence , the upper portion of the dummy pattern 104 is exposed into a projecting shape . as shown in fig4 , the resist pattern 112 and arc film 111 are removed . if it is necessary to prevent the pattern of the silicon nitride film 103 from being widened by sidewall patterns to be formed later , it is desirable to narrow the silicon nitride film 103 by wet etching using hot phosphoric acid . as shown in fig5 , a silicon nitride film about 20 nm thick is deposited on the entire surface , and etched back by non - masking rie . in this manner , sidewall patterns 113 made of the silicon nitride film are formed on the side surfaces of the dummy pattern 104 and on the side surfaces of the silicon nitride film 103 . as shown in fig6 , the silicon nitride film 103 , sidewall patterns 113 , and dummy pattern 104 are used as masks to perform rie to a depth of about 100 nm of the semiconductor substrate 101 . in this way , island - like fins 101 a are formed in the lower portions of the two side surfaces of the dummy pattern 104 , and a voltage supply active region 101 b is formed in the lower portion of the silicon nitride film 103 . as shown in fig7 , the dummy pattern 104 is removed by etching using , e . g ., hf . after that , for the purpose of device isolation , a silicon oxide film 114 is deposited on the entire surface by hdp • cvd , and planarized by cvd . in addition , etch back is performed by rie to leave the silicon oxide film 114 behind on the bottom surface of the trench by a thickness of about 40 nm . as a consequence , fins 101 a about 60 nm thick are formed . after that , a gate oxide film 131 made of a silicon oxynitride film or the like ( for example , h f o 2 , zro 2 , hfsion ) is formed on the side surfaces of the fins 101 a by thermal oxidation and nitriding or the like . as shown in fig8 , a first polysilicon film 121 about 300 nm thick is deposited as a gate electrode material on the entire surface , and planarized by cmp . in addition , a second polysilicon film 122 about 50 nm thick is deposited , and a silicon nitride film 115 about 100 nm thick is deposited on the surface of the second polysilicon film 122 . the silicon nitride film 115 is coated with a resist film ( not shown ), and this resist film is patterned into the shape of a gate electrode . the patterned resist film is used as a mask to pattern the silicon nitride film 115 . furthermore , the silicon nitride film 115 thus patterned is used as a mask to pattern the first and second polysilicon films 121 and 122 by rie . consequently , a gate electrode made of the first and second polysilicon films 121 and 122 is formed . the subsequent steps are the same as the conventional lsi fabrication steps , so an explanation thereof will be omitted . a method of fabricating a semiconductor device according to a comparative example will be explained below with reference to fig9 to 18 . as shown in fig9 , a silicon oxide film 12 about 5 nm thick is formed on a semiconductor substrate 11 by thermal oxidation or the like , and a silicon nitride film 13 about 100 nm thick is deposited . on the silicon nitride film 13 , an amorphous silicon film , for example , for dummy pattern formation is deposited by a thickness of about 150 nm . this amorphous silicon film is coated with a resist , and lithography is used to form a resist pattern about 0 . 1 μm wide . the obtained resist pattern is used as a mask to etch the amorphous silicon by rie , thereby forming a dummy pattern 14 . a teos film about 40 nm thick is deposited on the surfaces of the dummy pattern 14 and silicon nitride film 13 . then , the teos film is processed by non - masking rie to leave teos sidewalls 15 behind on the side surfaces of the dummy pattern 14 . as shown in fig1 , the dummy pattern 14 is etched away by using a liquid chemical or the like , thereby leaving a pattern mask made of the teos sidewalls 15 behind on the silicon nitride film 13 . as shown in fig1 , the silicon nitride film 13 and teos sidewalls 15 are coated with a resist , and the conventional lithography technique is used to form a patterned resist film 21 . as shown in fig1 , both the pattern made of the teos sidewalls 15 and the pattern made of the resist film 21 are used as masks to process the silicon nitride film 13 by rie . after that , the teos sidewalls 15 and resist film 21 are removed . as shown in fig1 , the silicon nitride film 13 is used as a mask to remove the semiconductor substrate 11 to a depth of about 80 nm by rie . as shown in fig1 , a silicon oxide film 21 for device isolation is deposited on the entire surface by hdp • cvd or the like , and planarized by cmp . the silicon oxide film 21 is then etched back by non - masking rie , and left behind on the bottom surface of the trench by a thickness of about 40 nm . a gate oxide film ( not shown ) made of a silicon nitride film or the like is formed on the side surfaces of fins . as shown in fig1 , a first polysilicon film 23 about 300 nm thick is deposited as a gate electrode material on the entire surface , and planarized by cmp . after that , a second polysilicon film 24 about 50 nm thick is deposited on the entire surface . in addition , a silicon nitride film 22 about 100 nm thick is deposited on the entire surface . the silicon nitride film 22 is coated with a resist to form a resist film ( not shown ) having a gate electrode shape . this resist film is used as a mask to etch the silicon nitride film 22 , and a pattern made of the obtained silicon nitride film 22 is used as a mask to process the first and second polysilicon films 23 and 24 by rie . in this manner , a gate electrode made of the first and second polysilicon films 23 and 24 is formed . as shown in fig1 , if a bottom arc type resist film is used after the step shown in fig1 , an arc film 31 is also formed after development in a region where no resist film 21 is formed . when the arc film 31 is etched , as shown in fig1 , the arc remains on the side surfaces of the teos sidewalls 15 . consequently , as shown in fig1 , the width of the line pattern made of the micropatterned teos sidewalls 15 is increased by the remaining arc . also , in this fabrication method according to the comparative example , in the steps shown in fig1 to 15 , portions of the semiconductor substrate on the two sides of the narrow fins are simultaneously etched away in the same process . since the mechanical strength of the fins is insufficient , the fins may fall or may be disconnected depending on the dimensions . by contrast , in the first embodiment described above , when the arc film 111 is formed in the step shown in fig2 , the conventional problem that the arc remains on the side surfaces of the sidewall patterns can be solved because the undercoating of the arc film 111 is flat . it is also possible to realize both the micropatterned sidewall patterns 113 for fin formation , and the common bottom arc type resist pattern 112 for forming the voltage supply active region . that is , the film deposition and etch back steps for forming the sidewall patterns 113 are performed after the step of forming the common resist pattern 112 . accordingly , the lithography step for forming the common resist pattern 112 can be executed on the flat undercoating , so the two patterns can be realized . in this embodiment of the present invention , it is also possible to form the fins 101 a having a fine width which is smaller than the limit of lithography , and reduce the line edge roughness . that is , when fins are formed by lithography , they cannot be formed by a width smaller than the limit of lithography . in addition , the side surfaces of the fins are roughened by variations in width . this not only worsens the line edge roughness but also causes disconnection in some cases . by contrast , in the step shown in fig5 of the first embodiment , a silicon nitride film is deposited to cover the dummy pattern having the exposed upper portion , and sidewalls are formed on the side surfaces of the dummy pattern by etch back . the width of the sidewalls is determined by the thickness of the deposited silicon nitride film , so no such variations as caused by lithography are produced . therefore , fins can be formed by a width smaller than the limit of lithography while the line edge roughness is reduced . also , in the formation of narrow fins , if semiconductor layers inside and outside these fins are simultaneously etched away as in the comparative example , these fins may fall or may be disconnected . the first embodiment solves this problem by removing the two sides of the fins in different steps . that is , in the step shown in fig1 , the inside of the two fins are etched away by forming the dummy pattern 104 . in the step shown in fig3 , the silicon nitride film 103 present outside the dummy pattern 104 is removed to expose the upper portion of the dummy pattern 104 . then , in the step shown in fig5 , the sidewall patterns 113 are formed on the side surfaces of the dummy pattern 104 . in the step shown in fig6 , the outsides of the fins are etched away . as described above , the step of removing the inside of the two fins shown in fig1 is different from the step of removing the outsides of these fins shown in fig6 . accordingly , destruction or the like of the fins can be prevented . fig1 shows the planar arrangement of the semiconductor device according to the first embodiment . the two fins 101 a are formed to be perpendicular to the gate electrode made of the first and second polysilicon films 121 and 122 . drain regions 101 ad 1 and 101 ad 2 and source regions 101 as 1 and 101 as 2 are formed on the two sides of the gate electrode . the drain regions 101 ad 1 and 101 ad 2 are connected to a drain voltage supply active region 101 bd . the source regions 101 as 1 and 101 as 2 are connected to a source voltage supply active region 101 bs . in the first embodiment , a portion where the dummy pattern 104 is present is removed from a central portion of each of the drain voltage supply active region 101 bd and source potential supply active region 101 bs . therefore , a distance x 2 from this portion of the drain voltage supply active region 101 bd or source voltage supply active region 101 bs to the gate electrode is longer than a distance x 1 from two end portions , except for the central portion , of the drain voltage supply active region 101 bd or source voltage supply active region 101 bs to the gate electrode . this makes it possible to reduce the parasitic capacitance between the gate electrode and the drain voltage supply active region 101 bd or source voltage supply active region 101 bs , and increase the operating speed of the device . a method of fabricating a semiconductor device according to the second embodiment of the present invention will be described below with reference to fig2 to 26 . the second embodiment differs from the first embodiment in that an soi substrate is used . as shown in fig2 , a box silicon oxide film 100 is formed on a semiconductor substrate ( not shown ), and a semiconductor layer 101 about , e . g ., 100 nm is formed on the box silicon oxide film 100 , thereby preparing an soi substrate . a silicon oxide film 102 about 5 nm thick is formed on the semiconductor layer 101 , and a silicon nitride film 103 about 100 nm thick is deposited on the silicon oxide film 102 . a resist film ( not shown ) is formed on the silicon nitride film 103 , and used as a mask to etch the silicon nitride film 103 , silicon oxide film 102 , and semiconductor layer 101 by rie , thereby forming a trench about 205 nm deep for burying a dummy pattern . in this state , the depth of the silicon nitride film 103 is about 100 nm , the depth of the silicon oxide film 102 is about 5 nm , and the depth of the semiconductor layer 101 is about 100 nm . a teos film or a silicon oxide film obtained by hdp • cvd is deposited on the entire surface and planarized by cmp , thereby burying a dummy pattern material in the trench to form a dummy pattern 104 . as shown in fig2 , an arc film 111 is formed on the planarized silicon nitride film 103 and on the dummy pattern 104 , and coated with a resist . lithography and rie of the arc are then performed to form a bottom arc type resist film 112 having a pattern corresponding to voltage supply active regions . as shown in fig2 , the resist film 112 is used as a mask to etch the silicon nitride film 103 . as a consequence , the upper portion of the dummy pattern 104 is exposed into a projecting shape . as shown in fig2 , the resist film 112 and arc film 111 are removed . if it is necessary to avoid the pattern of the silicon nitride film 103 from being widened by the presence of sidewall patterns 113 , the silicon nitride film 103 patterned in accordance with voltage supply active regions is desirably narrowed in advance by wet etching using hot phosphoric acid . a silicon nitride film about 20 nm thick is deposited on the entire surface , and non - masking rie is performed . consequently , as shown in fig2 , sidewall patterns 113 made of the silicon nitride film are formed on the side surfaces of the dummy pattern 104 and on the side surfaces of the silicon nitride film 103 having the pattern of voltage supply active regions . as shown in fig2 , the silicon nitride film 103 , the sidewall patterns 113 made of the silicon nitride film , and the dummy pattern 104 are used as masks to etch the semiconductor layer 101 to its bottom surface by rie . in this manner , fins 101 a made of the semiconductor layer 101 are formed on the two side surfaces of the dummy pattern 104 , and a voltage supply active region 101 b is formed in the lower portion of the silicon nitride film 103 . after that , a gate oxide film ( not shown ) made of a silicon oxynitride film or the like is formed on the side surfaces of the fins 101 a . a first polysilicon film 121 about 300 nm thick is deposited as a gate electrode material on the entire surface , and planarized by cmp . then , a second polysilicon film 122 about 50 nm thick is deposited , and a silicon nitride film 115 about 100 nm thick is deposited on the entire surface . as shown in fig2 , a resist film ( not shown ) having a gate electrode pattern is formed on the silicon nitride film 115 , and used as a mask to process the silicon nitride film 115 . furthermore , the silicon nitride film 115 is used as a mask to process the first and second polysilicon films 121 and 122 by rie . in this manner , a gate electrode made of the first and second polysilicon films 121 and 122 is formed . the subsequent steps are the same as the conventional lsi fabrication steps , so an explanation thereof will be omitted . as in the first embodiment described above , the second embodiment can solve the problem that the arc remains on the side surfaces of the sidewall patterns . also , both the dummy pattern lithography step of forming the fins 101 a and the lithography step of forming the voltage supply active region 101 b can be performed on the flat undercoating . this makes fine pattern formation possible . since the fins are formed by using the sidewalls as masks , the fins 101 a narrower than the limit of lithography can be formed , and the line edge roughness can be reduced . in addition , as in the first embodiment , the dummy pattern 104 extends to a central portion of the voltage supply active region 101 b . since this increases the distance from the gate electrode to this portion of the voltage supply active region 101 b , the capacitance between the gate electrode and the voltage supply active region 101 b can be reduced . as a consequence , the speed of the device operation can be increased . furthermore , since an soi substrate is used in the second embodiment , no device isolation insulating film need to be deposited unlike in the first embodiment . in the step shown in fig2 , therefore , it is unnecessary to remove the dummy pattern 104 buried between the pair of fins 101 a . accordingly , the dummy pattern 104 supports the fins 101 a and increases the structural strength of the fins 101 a . this prevents a fall of the fins 101 a . consequently , thinner and higher fins can be formed because they are supported by the dummy pattern 104 . a method of fabricating a semiconductor device according to the third embodiment of the present invention will be described below with reference to fig2 to 32 . each of the first and second embodiments described above is applied to a case in which fins made of a semiconductor layer serving as source , drain , and channel regions are formed by processing a semiconductor substrate . the third embodiment is applied to a case in which a gate electrode is formed by processing a polysilicon film . as shown in fig2 , a gate oxide film 202 is formed on a semiconductor substrate 200 . a polysilicon film 201 about 100 nm thick is formed on the gate oxide film 202 . a silicon nitride film 103 about 100 nm thick is deposited on the polysilicon film 201 . a resist film ( not shown ) is formed on the silicon nitride film 103 , and used as a mask to etch the silicon nitride film 103 and polysilicon film 201 by rie , thereby forming a trench about 200 nm deep for burying a dummy pattern . a teos film or a silicon oxide film obtained by hdp • cvd is deposited on the entire surface and planarized by cmp , thereby burying a dummy pattern material in the trench to form a dummy pattern 104 . as shown in fig2 , an arc film 111 is formed on the planarized silicon nitride film 103 and on the dummy pattern 104 , and coated with a resist . lithography and arc - rie are then performed to form a bottom arc type resist film 112 having a pattern corresponding to a voltage supply active region . as shown in fig2 , the resist film 112 is used as a mask to etch the silicon nitride film 103 . consequently , the upper portion of the dummy pattern 104 is exposed into a projecting shape . as shown in fig3 , the resist film 112 and arc film 111 are removed . if it is necessary to avoid the pattern of the silicon nitride film 103 from being widened by the presence of sidewall patterns 113 , the silicon nitride film 103 patterned in accordance with a voltage supply active region is desirably narrowed in advance by wet etching using hot phosphoric acid . a silicon nitride film about 20 nm thick is deposited on the entire surface , and non - masking rie is performed . consequently , as shown in fig3 , sidewall patterns 113 made of the silicon nitride film are formed on the side surfaces of the dummy pattern 104 and on the side surfaces of the silicon nitride film 103 having the pattern of a voltage supply active region . as shown in fig3 , the silicon nitride film 103 , the sidewall patterns 113 made of the silicon nitride film , and the dummy pattern 104 are used as masks to etch the polysilicon film 201 to its bottom surface by rie . in this manner , gate electrodes 201 a made of the polysilicon film 201 are formed on the two side surfaces of the dummy pattern 104 , and a voltage supply active region 201 b for supplying a gate potential to these gate electrodes is formed in the lower portion of the silicon nitride film 103 . the dummy pattern 104 is removed by a liquid chemical or rie . the subsequent steps are the same as the conventional lsi fabrication steps , so an explanation thereof will be omitted . as in the first and second embodiments described above , the third embodiment can solve the problem that the arc remains on the side surfaces of the sidewall patterns . also , both the lithography step of the dummy pattern 104 for forming the gate electrode 201 a and the lithography step of forming the potential supply active region 201 b can be performed on the flat undercoating . this makes fine pattern formation possible . since the gates are formed by using the sidewalls as masks , the gate electrodes 201 a narrower than the limit of lithography can be formed , and the line edge roughness can be reduced . each of the above embodiments is merely an example and does not limit the present invention . therefore , these embodiments can be modified within the technical scope of the present invention . for example , the film materials , film formation methods , film thicknesses , trench depths , and the like described in the above embodiments can be freely changed .	7
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its applications to the details of the particular arrangements shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . in the summary above and in the detailed description of preferred embodiments and in the accompanying drawings , reference is made to particular features ( including method steps ) of the invention . it is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features . for example , where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention , that feature can also be used , to the extent possible , in combination with and / or in the context of other particular aspects and embodiments of the invention , and in the invention generally . in this section , some embodiments of the invention will be described more fully with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout , and prime notation is used to indicate similar elements in alternative embodiments . 1 vault with skimmer and float and shelf 2 inlet wall 3 inlet pipe 4 . first side wall 6 . second side wall 8 outlet wall 9 outflow pipe 10 bottom vault 12 settling chamber 14 top of vault 15 manhole cover ( s ) 20 shelves ( solid ) 22 outlet wall side attachment 24 first side wall attachment 26 second side wall attachment 28 outer front edge of shelf 29 support beam for front edge 30 skimmer panel 32 top of skimmer panel 34 first side of skimmer panel 36 second side of skimmer panel 38 bottom of skimmer panel 40 panel wheel assemblies 41 panel seal 42 a top centering wheel 42 b . axle for top centering wheel 44 a first load wheel 44 b axle for first load wheel 45 a second load wheel 45 b axle for second load wheel 46 a third load wheel 46 b axle for third load wheel 47 a fourth load wheel 47 b axle for fourth load wheel 48 a bottom centering wheel 48 b axle for bottom centering wheel 50 skimmer tracks ( channels ) 60 float ( s ) 70 no flow hydraulic gradeline 80 a medium flow inflow hydraulic gradeline 80 b medium flow outflow hydraulic gradeline 90 high flow hydraulic gradeline 100 multi - chamber 110 baffles 200 screen system g gap between float and skimmer panel g 1 gap opening between lower edge of skimmer panel and shelf outer edge during medium flow g 2 gap opening between lower edge of skimmer panel and shelf outer edge during high flow g 4 minimum gap between lower edge of skimmer panel an front edge of shelf g 5 gap between bottom edge of skimmer panel and front edge of shelf with bottom edge of skimmer panel and shelf at same height g 6 gap between bottom edge of skimmer panel and front edge of shelf with bottom edge of skimmer panel hanging lower the front edge of shelf the hydro - variant skimmer and shelf system 1 can be adapted to be an internal component of a vault system 1 or an open ditchline . the objective of the invention is to be a skimmer that constricts and restricts stormwater flow during low to medium flows . during high flows the hydraulics of the skimmer will automatically adjust to allow for greater conveyance of water flow . stormwater treatment systems are generally more effective when more detention time is achieved within the treatment system . whether the application is for use inside a vault system , open ditchline , pond conveyance , or media application , the greater treatment will be achieved with maximum detention time . a typical vault system may have a variety of internal components . however , the vault system is always an inflow conveyance and an outflow conveyance . when used in a vault system the invention can be located adjacent to the outflow of the vault . the objective of the invention will be to create greater detention time within the vault . greater detention time within a vault treatment system will achieve the following : 1 . a higher hydraulic grade line within the vault will be achieved with greater detention time . this higher hydraulic grade line will influence the hydraulic grade line within the inflow pipe . this higher hydraulic gradeline in the inflow pipe will increase the cross - sectional conveyance of water flow . when the cross - sectional conveyance is increased and the volume of water flow remains the same , the linear velocity of water flow will reduce . reduced linear velocity in the pipe will enable greater stratification of heavier that water solids within the pipe toward the bottom of the pipe . when heavier the water solids are conveyed along the bottom of a pipe , the distance that the solids must travel through the water column in the treatment vault to reach the settling zone of the treatment vault is reduced . this will enhance the potential capture of heavier than water solids within the treatment vault . 2 . comparing a low hydraulic grade line in a pipe to that of a high hydraulic grade line in a pipe , with both conditions having the same volume of flow . the linear velocity of water flow in the condition with the low hydraulic gradeline will have a significantly higher linear velocity than that of the condition having the high hydraulic gradeline . the general shape of a pipe ( round ) has significantly greater cross - sectional conveyance midway up the pipe as compared to the cross - sectional conveyance at the bottom of a pipe . for example ; for an approximately 24 ″ diameter pipe , the cross - sectional conveyance from the bottom to 3 ″ up is 0 . 23 ft 2 , the cross - sectional conveyance 3 ″ tall midway in the pipe is 0 . 5 ft 2 . the cross - sectional conveyance vertically midway in a pipe is greater than double that of the conveyance along the bottom of the pipe . being able to take advantage of the cross - sectional conveyance midway in a pipe will dramatically reduce the linear velocity of the water flowing through the pipe . it is typical for treatment systems that settle heavier than water solids into lower settling chambers to function better when the linear velocity of water is reduced . reduced linear inflow velocity will prevent inertia of water flow from streaming through a treatment system and bypassing the features of the treatment system . lower linear velocity of inflow water will also help to avoid the re - suspension of heavier than water solids . fig1 is an upper perspective partial cut - away view of a single chamber or rectangular vault 1 generally formed from concrete , and the like , with a track mounted skimmer panel 30 with float 60 on a shelf 20 with no flow . fig2 a is an enlarged front perspective view of the skimmer 30 with float 60 of fig1 . fig2 b is a rear perspective view of the skimmer 30 with float 60 of fig2 a fig2 c is an enlarged view of the lower left corner of the skimmer 30 of fig2 b . fig2 d is an enlarged view of the lower right corner of the skimmer 60 of fig2 b fig2 e is a left side view of the skimmer 30 with float 60 of fig2 b . fig3 is a top view of the chamber / vault 1 with skimmer panel 30 with float 60 and shelf 20 of fig1 . fig4 is a side view of the chamber / vault 1 with panel 30 with float 60 and shelf 20 of fig1 with side wall removed . fig5 is an end view from the outflow pipe 9 of the chamber / vault 1 with skimmer panel 30 with float 60 and shelf 20 of fig1 with end wall 8 removed . referring to fig1 - 5 a single chamber square or rectangular vault 1 is shown that can have an inlet wall 2 with inlet pipe 3 , first side wall 4 , second side wall 6 , outlet wall 8 , outflow pipe 9 , bottom wall 10 , settling chamber 12 , top of vault 14 with manhole cover ( s ) 15 . with the no flow 70 scenario the hydraulic gradeline is at a low level in the chamber 1 with the flow level slightly lower than the bottom of the inlet pipe 3 . a generally horizontal shelf 20 can have a rear edge that can be attached to the outlet wall attachment 22 to the outlet wall , first side wall attachment 24 attached to a first side wall 4 , second side wall attachment 26 attached to a second side wall 6 , and a horizontal support beam 29 which has ends attached to each of the side walls 4 , 6 which supports the outer front edge 28 of the shelf 20 . the front edge 28 of the shelf 20 can also be inclined approximately 20 % down from the rear outlet wall attachment 22 . referring to fig2 a - 2e , the floatable skimmer panel 30 can be a generally planar panel formed from solid metal , plastic , combinations thereof , and the like , such as those described in u . s . pat . nos . 7 , 846 , 327 ; 8 , 034 , 234 ; 8 , 034 , 236 ; 8 , 083 , 937 ; and 8 , 231 , 780 , each to happel , the inventor of the subject invention , which are all incorporated by reference in their entirety . the wheel assemblies 40 used with the floatable skimmer panel 30 can be similar wheel assemblies shown and described in u . s . pat . nos . 8 , 034 , 234 ; 8 , 034 , 236 ; 8 , 083 , 937 ; and u . s . pat . no . 8 , 231 , 780 to happel , the inventor of the subject invention , which are all incorporated by reference in their entirety . the skimmer panel 30 can have a top edge 32 , first side extending flange 34 , second side extending flange 36 , bottom edge 36 , and wheel assemblies 40 attached to both the first side flange 34 and second side flange 36 . each of the wheel assemblies can include a seal 41 which provides a water proof seal against side water passing about the skimmer panel 30 , when water is pushing against an opposite side of the panel 30 . each of the wheel assemblies 40 , can include a top centering wheel 42 a , axle 42 b for top wheel 42 a which rotates in a plane parallel to the plane of the panel 30 , a first load wheel 44 a with axle 44 b mounting the wheel 44 a in a rotational plane perpendicular to the plane of the panel 30 , a second load wheel 45 a with axle 45 b mounting the wheel 45 a in a rotational plane perpendicular to the plane of the panel 30 , a third load wheel 46 a with axle 46 b mounting the wheel 46 a in a rotational plane perpendicular to the plane of the panel 30 , a fourth load wheel 47 a with axle 47 b mounting the wheel 47 a in a rotational plane perpendicular to the plane of the panel 30 , and a bottom centering wheel 48 a , with axle 48 b for the bottom wheel 48 a which rotates in a plane parallel to the plane of the panel 30 each of the wheel assemblies 40 can be attached to the side edges 34 , 36 of the panel 30 allows for the panel 30 to slide up and down in each of the track channels 50 . each of the track channels can be formed from a vertical space between a pair of the vertical flanges that are attached to the side walls 4 , 6 of the chamber 1 along the top edge 32 of the panel 30 can be a horizontal mounted float ( s ) 60 that can be mounted on a face of the skimmer panel 30 , and have a gap , g spaced therebetween . because of this gap , g , water is able to surround the upper float 60 on all sides to create buoyancy . buoyancy would not be created if only the front and bottom sides of the float 60 were in contact with the adjacent water level . the gap , g , can have a width of approximately ¼ ″ to approximately 2 ″, and the term approximately can include +/− ten percent of the number value . as shown in fig1 - 5 , the hydraulic gradeline ( height ) at no flow remains as the height between in - flow pipe 3 and outflow pipe 9 . as such , all of most of the potential flow is significantly constricted during low flow , which maximizes treatment of the incoming storm water . this constricted flow allows for capturing contaminates such as foliage , litter , and sediments , and lighter than water liquids such as petroleum products in order to treat the storm water flow to prevent pollutants from being conveyed downstream to a receiving body of water . the intention is that debris or liquids that float due to buoyancy will not be able to move downward into the water column to pass through the open bottom of the skimmer . when the opening is relatively small under a skimmer it will have greater headloss , less water conveyance , but greater treatment . here , the heavier contaminants settle in the settling chamber 12 . fig6 is another upper perspective view of the chamber / vault 1 with skimmer panel 30 with float 60 over an outer edge 28 of the shelf 20 of fig1 during medium flow with gap , g 1 . fig7 is a top view of the chamber / vault 1 with skimmer panel 30 and float 60 over the shelf 20 of fig6 . fig8 is a side view of the chamber / vault 1 with skimmer panel 30 and float 60 of fig6 with side wall 10 removed . fig9 is an end view from the outflow pipe 9 of the chamber / vault 1 with skimmer panel 30 and float 60 over shelf 20 of fig6 with end wall 8 removed . referring to fig6 - 9 , a medium flow into in - flow pipe 3 into chamber / vault 1 can have an inflow hydraulic gradeline ( height ) 80 a which can cause float 60 which is attached to side of top 32 of skimmer panel 30 to raise skimmer panel 30 within tracks 50 ( s ). a gap g 1 can form under the skimmer panel bottom 30 and the outer edge 28 of the shelf 20 , which allows water to pass through the gap , g 1 and back into the settling chamber area 12 , and have a lower outflow hydraulic gradeline 80 b when passing through outflow pipe 9 . as such , the combination of the floatable skimmer panel 30 with the flat solid shelf 20 having a gap g 1 allows for capturing contaminates such as foliage , litter , and sediments , and lighter than water liquids such as petroleum products in order to treat the storm water flow to prevent pollutants from being conveyed downstream to a receiving body of water . the vertical sides of the panel 30 make use of a hydraulic pressure differential between the front side and back side of the skimmer panel 30 to direct the median water flow down and pass it through the open bottom gap 1 . once the flow passes through the open bottom flow will be conveyed downstream . the intention is that debris or liquids that float due to buoyancy will not be able to move downward into the water column to pass through the open bottom of the skimmer . when the opening is relatively small under a skimmer it will have greater headloss , less water conveyance , but greater treatment . during medium flow and high flow , the flow volume is primarily responsible for raising the float 60 and skimmer 30 and not the flow rate . the gap , g 1 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . fig1 is another upper perspective view of the chamber / vault 1 with skimmer panel 30 and float 60 on a shelf 20 of fig1 during high flow . fig1 is a top view of the chamber / vault 1 with skimmer panel 30 and float 60 over shelf 20 of fig1 . fig1 is a side view of the chamber / vault 1 with skimmer panel 30 and float 60 over shelf 20 of fig1 with side wall 6 removed . fig1 is an end view from the outflow pipe 9 of the chamber / vault 1 with skimmer panel 30 and float 60 over shelf 20 of fig6 with end wall 8 removed . referring to fig1 - 13 , the inflow hydraulic gradeline 90 passing into in - flow pipe 2 at high flow raises the float 60 and skimmer panel 30 within track ( s ) 50 forming a large gap , g 2 under the front edge 28 of the shelf and the raised skimmer panel bottom 38 . the larger gap g 2 allows water to flow to outflow pipe 9 , and back into the settling chamber area 12 . gap , g 2 is clearly larger than gap , g 1 . here , the inflow hydraulic gradeline 90 at in - flow pipe 30 remains at the same height as the outflow hydraulic gradeline 90 at outflow pipe 9 . the novel system allows for little or no constriction of water flow through the chamber / vault 1 which reduces and eliminates possible flooding before the incoming storm water reaches the in - flow pipe 3 . fig1 is a perspective upper view of a multi - chamber vault 100 with track mounted skimmer panel 30 with float 60 on a shelf , 20 and baffles 110 in with no flow . fig1 is a top view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 . fig1 is a side view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 with side wall 6 removed . fig1 is an end view from the outflow pipe 9 of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 with end wall 8 removed . referring to fig1 - 17 , with no flow 70 scenario the hydraulic gradeline 70 can remain at a low level in the chamber 1 with the flow level slightly lower than the bottom of the inlet pipe 3 and outlet pipe 9 , and can function similar to the no flow that occurs in the previous embodiment with respect to fig1 - 5 . fig1 is another upper perspective view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 during medium flow . fig1 is a top view of the multi - chamber vault 1 with skimmer panel 30 and float 60 and baffles 110 of fig1 . fig2 is a side view of the multi - chamber vault 1 with skimmer panel 30 and float 60 and baffles 110 of fig1 with side wall 6 removed . fig2 is an end view from the outflow pipe 9 of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 with end wall 8 removed . referring to fig1 - 21 , a medium flow into in - flow pipe 3 into chamber / vault 1 can have an inflow hydraulic gradeline ( height ) 80 a which can cause float 60 which is attached to side of top 32 of skimmer panel 30 to raise skimmer panel 30 within tracks 50 ( s ). a gap g 1 can form under the skimmer panel bottom 30 and the outer edge 28 of the shelf 20 , which allows water to pass through the gap , g 1 and back into the settling chamber area 12 , and have a lower outflow hydraulic gradeline 80 b when passing through outflow pipe 9 . the capture of contaminants and flow can work similar to the medium flow described in reference to the previous embodiment shown in fig6 - 9 . during medium flow and high flow , the flow volume is primarily responsible for raising the float 60 and skimmer 30 and not the flow rate . the gap , g 1 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . fig2 is another upper perspective view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig1 during high flow . fig2 is a top view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig2 . fig2 is a side view of the multi - chamber vault 1 with skimmer panel 30 and float 60 and baffles 110 of fig2 with side wall 6 removed . fig2 is an end view from the outflow pipe 9 of the multi - chamber vault 100 with skimmer panel 30 and float 60 and baffles 110 of fig2 with end wall 8 removed . referring to fig2 - 25 , the inflow hydraulic gradeline 90 passing into in - flow pipe 2 at high flow raises the float 60 and skimmer panel 30 within track ( s ) 50 forming a large gap , g 2 under the front edge 28 of the shelf and the raised skimmer panel bottom 38 . the gap g 2 allows water to flow to outflow pipe 9 , and back into the settling chamber area 12 . gap , g 2 can be larger than gap , g 1 . here , the inflow hydraulic gradeline 90 at in - flow pipe 30 remains at the same height as the outflow hydraulic gradeline 90 at outflow pipe 9 . the novel system allows for little or no constriction of water flow through the chamber / vault 1 which reduces and eliminates possible flooding before the incoming storm water reaches the in - flow pipe 3 . the operation and function of the skimmer panel 30 with float 60 and gap , g 2 is similar to the previous embodiment shown and described in reference to fig1 - 13 . fig2 is a perspective upper view of a multi - chamber vault 100 with track mounted skimmer panel 30 and float 60 on a shelf 20 , and screen system 200 with no flow . fig2 is a top view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig2 . fig2 is a side view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig2 with side wall 6 removed . fig2 is an end view from the outflow pipe 9 of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig2 with end wall 8 removed . the screen system 200 can be similar to and operate similar to the screen systems shown and described in u . s . pat . nos . 8 , 034 , 234 ; 8 , 491 , 797 ; and u . s . pat . no . 8 , 366 , 923 to happel , which are all incorporated by reference in their entirety . referring to fig2 - 29 , the hydraulic gradeline ( height ) at no flow remains as the height between in - flow pipe 3 and outflow pipe 9 . as such , all of most of the potential flow is significantly constricted during low flow , which maximizes treatment of the incoming storm water . the skimmer panel 30 and shelf 20 functions similar to the previous embodiment shown and described in reference to fig1 - 5 . fig3 is a top view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 over shelf 20 of fig2 during medium flow . fig3 is a side view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig3 with side wall 6 removed . fig3 is an end view from the outflow pipe 9 of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig3 with end wall 8 removed . referring to fig3 - 32 , medium flow into in - flow pipe 3 into chamber / vault 1 can have an inflow hydraulic gradeline ( height ) 80 a which can cause float 60 which is attached to side of top 32 of skimmer panel 30 to raise skimmer panel 30 within tracks 50 ( s ). a gap g 1 can form under the skimmer panel bottom 30 and the outer edge 28 of the shelf 20 , which allows water to pass through the gap , g 1 and back into the settling chamber area 12 , and have a lower outflow hydraulic gradeline 80 b when passing through outflow pipe 9 . the floatable skimmer panel 30 with float 60 and shelf 20 can operate similarly to the medium flow scenario shown and described in reference to fig6 - 9 . during medium flow and high flow , the flow volume is primarily responsible for raising the float 60 and skimmer 30 and not the flow rate . the gap , g 1 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . fig3 is a top view of the multi - chamber vault 100 with skimmer panel 30 and float 60 over shelf 20 and screen system 200 of fig2 during high flow . fig3 is a side view of the multi - chamber vault 100 with skimmer panel 30 and float 60 and screen system 200 of fig3 with side wall 6 removed . fig3 is an end view from the outflow pipe 9 of the multi - chamber vault 200 with skimmer panel 20 and float 60 and screen system 200 of fig3 with end wall 8 removed . referring to fig3 - 35 , the inflow hydraulic gradeline 90 passing into in - flow pipe 2 at high flow raises the float 60 and skimmer panel 30 within track ( s ) 50 forming a large gap , g 2 under the front edge 28 of the shelf and the raised skimmer panel bottom 38 . the gap g 2 allows water to flow to outflow pipe 9 , and back into the settling chamber area 12 . gap g 2 , is larger than gap , g 1 . here , the inflow hydraulic gradeline 90 at in - flow pipe 30 remains at the same height as the outflow hydraulic gradeline 90 at outflow pipe 9 . the novel system allows for little or no constriction of water flow through the chamber / vault 1 which reduces and eliminates possible flooding before the incoming storm water reaches the in - flow pipe 3 . the skimmer panel 30 and shelf 20 operate similarly to the high flow scenario shown and described in reference to fig1 - 13 above . fig3 is a side view of the vault chamber 1 of the preceding figures during no flow of the skimmer panel 30 and float 60 , with the skimmer panel 30 sitting on the shelf edge with no gap between the shelf and the skimmer . fig3 a is an enlarged view of the skimmer on shelf with no gap of fig3 . fig3 - 36a show the position of the skimmer panel 30 with shelf 20 that was previously shown and described in reference to fig1 - 5 , 14 - 17 and 26 - 29 . fig3 is a side view of the vault chamber 1 of the preceding figures with the skimmer panel 30 over the front shelf edge 28 with gap g 4 between the top front edge 28 of the shelf 20 and the bottom 38 of the skimmer panel 30 . fig3 a is an enlarged view of the skimmer panel 30 over the shelf 20 with top gap g 4 of fig3 . a minimum fixed gap , g 4 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . referring to fig3 - 37a , a minimum gap , g 4 , can be maintained so that there is always a minimum gap during no flow conditions , and the gap can increase during high flow conditions . having a minimum gap creates headloss and greater detention time for low to medium flows . greater detention time translates into greater removal efficiency of pollutants . in addition , as the rain event ends the hgl on the upstream side of the skimmer will quickly lower to that of a static water flow condition . this will enable the debris captured in the screen system to quickly be stored above the hgl and dry out . as the hgl rises with the association of larger flows the skimmer 30 will float up and the gap between the shelf 20 and bottom of the skimmer 30 will increase . skimmer forward to and over top edge of shelf with gap fig3 is a side view of the vault chamber 1 of the preceding figures during no flow of the skimmer panel 30 and float 60 , with the skimmer panel 30 front of the front edge 28 of the shelf 20 with gap , g 5 between the front edge 28 of the shelf 20 and the bottom 38 of the skimmer panel 30 . fig3 a is an enlarged view of the skimmer panel 30 over the shelf 20 with gap g 5 between the front edge 28 of the shelf 20 and the bottom 38 of the skimmer panel 30 of fig3 . the gap g 5 , will restrict the flow to create greater detention time , however , there is no portion of the shelf in front of the skimmer for solids to collect and possibly clog the gap . in addition , gravity will be able to aid in keeping the gap free of debris during no flow conditions . a minimum fixed gap , g 5 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . similar to gap , g 4 , the gap , g 5 will get larger with higher gradelines . gap between bottom edge of skimmer panel and front edge of shelf with bottom edge of skimmer panel hanging lower the front edge of shelf fig3 is a side view of the vault chamber 1 of the preceding figures during no flow of the skimmer panel 30 and float 60 , with the skimmer panel 30 hanging down in front edge 28 of the shelf 20 with gap g 6 between the hanging down skimmer panel 30 and front edge 28 of the shelf 20 . fig3 a is an enlarged view of the hanging down skimmer panel 30 in front of shelf 20 with gap g 6 of fig3 . a minimum fixed gap , g 6 can potentially have a width of approximately ¼ ″ to approximately 2 ″ or greater . the term approximately can include +/− ten percent of the number value . gap , g 6 will restrict the flow to create greater detention time , however , there is no portion of the shelf in front of the skimmer for solids to collect and possibly clog the gap . in addition , gravity will be able to aid in keeping the gap free of debris during no flow conditions . gap , g 6 will also get larger with a higher gradeline . fig4 is a side view of the vault chamber 1 of the preceding figures during no flow of the skimmer 30 and float 60 , with the skimmer bottom 38 located inside the outer edge 28 of the shelf 20 . fig4 a is an enlarged view of the skimmer bottom 38 located on the shelf 20 inside of the outer edge 28 of the shelf 20 . the hydro - variant skimmer and shelf system can be adapted to be an internal component of a vault system or an open ditchline . the objective of the invention is to be a skimmer that constricts and restricts stormwater flow during low to medium flows . during high flows the hydraulics of the skimmer will automatically adjust to allow for greater conveyance of water flow . stormwater treatment systems are generally more effective when more detention time is achieved within the treatment system . whether the application is for use inside a vault system , open ditchline , pond conveyance , or media application , the greater treatment will be achieved with maximum detention time . a typical vault system may have a variety of internal components . however , the vault system always an inflow conveyance and an outflow conveyance . when used in a vault system the invention will typically be located adjacent to the outflow of the vault . the objective of the invention will be to create greater detention time within the vault . greater detention time within a vault treatment system will achieve the following : 1 . a higher hydraulic grade line within the vault will be achieved with greater detention time . this higher hydraulic grade line will influence the hydraulic grade line within the inflow pipe . this higher hydraulic gradeline in the inflow pipe will increase the cross - sectional conveyance of water flow . when the cross - sectional conveyance is increased and the volume of water flow remains the same , the linear velocity of water flow will reduce . reduced linear velocity in the pipe will enable greater stratification of heavier that water solids within the pipe toward the bottom of the pipe . when heavier the water solids are conveyed along the bottom of a pipe , the distance that the solids must travel through the water column in the treatment vault to reach the settling zone of the treatment vault is reduced . this will enhance the potential capture of heavier than water solids within the treatment vault . 2 . comparing a low hydraulic grade line in a pipe to that of a high hydraulic grade line in a pipe , with both conditions having the same volume of flow . the linear velocity of water flow in the condition with the low hydraulic gradeline will have a significantly higher linear velocity than that of the condition having the high hydraulic gradeline . the general shape of a pipe ( round ) has significantly greater cross - sectional conveyance midway up the pipe as compared to the cross - sectional conveyance at the bottom of a pipe . for example ; for a 24 ″ diameter pipe , the cross - sectional conveyance from the bottom to 3 ″ up is 0 . 23 ft 2 , the cross - sectional conveyance 3 ″ tall midway in the pipe is 0 . 5 ft 2 . the cross - sectional conveyance vertically midway in a pipe is greater than double that of the conveyance along the bottom of the pipe . being able to take advantage of the cross - sectional conveyance midway in a pipe will dramatically reduce the linear velocity of the water flowing through the pipe . it is typical for treatment systems that settle heavier than water solids into lower settling chambers to function better when the linear velocity of water is reduced . reduced linear inflow velocity will prevent inertia of water flow from streaming through a treatment system and bypassing the features of the treatment system . lower linear velocity of inflow water will also help to avoid the re - suspension of heavier than water solids . 3 . treatment systems that have an internal screen system will have less hydraulic pressure difference between the inflow side of a screen and the outflow side of a screen . in addition , the higher hydraulic grade line will enable more screen area to be involved with the flow . the reduction in the difference for pressure between the inflow side of the screen and the outflow side of the screen will help to prevent foliage from compressing against the screen . with less foliage compression the water flow between the pieces of foliage will be greater . it is also likely that less foliage compression will prevent the screen from becoming completely blinded with no water flow . 4 . greater detention time will also increase the performance of treatment systems that make use of chemical treatment media for treatment . it is typical for all media to have an increase in chemical reactivity for pollutant removal with an increase in contact time . the unique hydraulics of the invention enables a high level of detention time during low flows , and allows for the conveyance of large volumes of water during high flows . the skimmer will automatically adjust to the changing hydraulic gradeline as needed . this is accomplished by designing the skimmer so that it will float and move upward with a rising hydraulic gradeline . as the skimmer raises the gap between the horizontal shelf increases which increase the cross - sectional conveyance under the skimmer . for potential hydraulic conveyance having an opening under the skimmer provides far greater conveyance with significantly less headloss than a comparable conventional spill way in which water pours over top of a control structure . in most applications the hydro - variant skimmer will raise high enough to have no impact on headloss while continuing to function as a skimmer to prevent the passage of floatables . another unique feature of the hydro - variant skimmer is that it &# 39 ; s buoyancy is determined by the hydraulic gradeline on the upstream side of the skimmer . floats attached to the front side of the skimmer are mounted in such a way as to enable water to surround the float on all sides . the skimmer is a front side buoyancy skimmer . if there was no hydraulic gradeline present on the back side of the skimmer , the skimmer would still be able to rise based on only the hydraulic gradeline on the front side of the skimmer . the invention can be adapted to vault systems that have 1 or multiple chambers . the shape of the vault system is not a limiting factor , and can be square , rectangular , round , or a cylinder . fig4 is a graph show of removal efficiency using the invention as compared to the prior art vaults based on tests completed in the spring of 2014 . the results of the test indicate an approximately 15 to approximately 20 percent increase in the removal efficiency , for 100 micron particles , of the hydro - variant shelf system vs the same skimmer with no shelf . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .	4
a seal ring assembly 10 according to the invention is shown in fig1 and 2 , and includes a split ring 11 . the cross - section of the ring is shown as rectangular ( similar to a conventional piston ring ), but other cross - sectional shapes can also be used depending upon the nature of the sealing application . three spring members 12 of a shallow - v - shape have center portions 13 which are spot welded to the inner surface of split ring 11 . the center portions of the spring members are annealed or softened by the spot welding process , and the material is left in this condition rather than being restored to the temper which characterizes the other portions of the spring member . each spring member 12 includes a pair of leaf springs 15 extending from opposite ends of center portion 13 circumferentially along the inner periphery of the split ring . the unstressed leaf springs ( as shown in fig1 ) do not conform to the curvature of the inner surface of the split ring , and a clearance space 16 exists between the central part of each leaf spring and the inner surface of the split ring . the leaf springs are shown with a slightly inwardly concave curvature , but they may also be shaped as straight chordal segments , or may even have an inwardly convex curvature , depending on the magnitude of loading force which is desired in the installed seal . a typical application of the seal ring is shown in fig3 and 4 , where an inner duct member 18 having a flanged end 19 with a ring groove 20 is telescoped within an outer duct member 21 . these ducts illustrate in schematic form the type of sealing problem presented by a bleed - air duct in a fan - jet engine as discussed above . the duct parts are made with loose dimensional tolerances , and intentionally have some relative radial freedom to accommodate temperature variations . it is essential that some longitudinal or axial freedom be provided between inner and outer duct members 18 and 21 to compensate for expansion and contraction of the engine portions to which the two duct members are secured . both duct members are also subjected to considerable vibration during engine operation , and it is desirable to provide some radial damping between the components to avoid rattling and constant impaction of the parts which leads to rapid seal wear and the need for frequent seal and duct replacement . seal ring assembly 10 is fitted into ring groove 20 and split ring 11 is compressed until the inner duct member and seal ring assembly can be fitted within outer duct member 21 . when the seal is thus installed , the ends of each leaf spring 15 bear on the inner surface of split ring 11 , and the center portion of each leaf bears on the base of the ring groove as shown in fig4 . the individual leaf springs thus behave as simple beams which are substantially freely supported at their ends ( see arrows 23 in fig4 ) and are loaded between their ends ( see arrows 24 in fig4 ). the performance characteristics of this type of spring are predictable from standard strength - of - materials of stress - analysis texts which discuss the behavior of simple beams . the two leaf springs that comprise integral spring member 12 act substantially independently of each other because of the isolation provided by annealed or softened center portion 13 . if annealing of center portion 13 is not practical , the desired isolation of adjacent springs can be achieved by reducing the cross - section of portion 13 to make this portion flexible and hinge - like in action . no bending moments are introduced at the ends of the individual leaf springs , and each leaf spring functions as if it was terminated at the annealed center portion . the result is a series of effectively isolated leaf springs which have a relatively low spring rate and are capable of relatively large displacement . the springs are thus effective in maintaining a desired loading on the split ring even though considerable wear occurs on the outer face of the split ring . that is , a considerable radial expansion of the ring due to surface wear can be tolerated without loss of the desired loading force from the leaf springs . the springs also damp radial motion and rattling of the fitted parts which would otherwise arise from the loose radial fit intentionally provided to accommodate thermal expansion . the simple - beam behavior of the individual leaf springs is in sharp contrast to the characteristics of other styles of split - ring loading springs such as continuous wave springs . a wave spring lacks isolation between the individual chordal segments which extend between points of contact on the inner surface of the split ring . bending moments are thus introduced at the ends of the segments , and the result is a high - rate spring which is capable of only limited displacement before the yield limit of the spring material is reached . the spring rate of a wave spring is about fourteen times that of the isolated leaf springs of the invention , and loading force accordingly drops off rapidly as wear occurs on the split ring . the inventive seal springs work at lower stress levels than a corresponding wave spring , resulting in a longer service life before fatigue . leaf springs 15 are in effect hinged to center portion 13 , and the introduction of bending moments at the spring ends is thus avoided . the resulting low spring rate means that little change in seal loading will occur as the springs gradually expand during sacrificial wear of the split - ring surfaces which bear on the outer duct member . substantial increases in both seal life and seal effectiveness are thereby achieved , and useful life of the sealed duct parts is also improved . leaf springs 15 have a self - centering action which centers split ring 11 around the inner duct member . the loading force of the spring is low enough to permit longitudinal sliding between the inner and outer duct members , but the force is also sufficient to damp vibratory lateral motion which would otherwise cause fretting wear and short seal life . the spring members and split ring can be made of a variety of materials , depending on the desired loading and wear characteristics of the assembly . a typical assembly is made from weld - compatible corrosion - resistant steels . another embodiment of the seal ring assembly is shown in fig5 . in this embodiment , a jacket or cap 25 of bronze - filled polytetrafluoroethylene plastic ( sold under the trademark teflon ) is cemented or otherwise secured to split ring 11 for installation convenience . alternatively , the cap may be fitted over but not secured to the ring . the cap has a c - shaped cross - section to cover the outer periphery of the split ring as well as the sides of the ring . the purpose of cap 25 is to provide a replaceable sacrificial wearing surface which is an effective seal , and which does not scuff or fret the duct members during relative motion of the members . extension of the cap along the sides of split ring reduces wear on the sides of the ring groove . other materials may be used for the cap , depending upon the temperature and mechanical loading requirements on the seal . plasma - coated materials such as a ceramic - molybdenum coating may also be used to eliminate galling and to provide lubrication for relative axial movement of the duct members . another embodiment of the invention is shown in fig6 where split ring 11 is combined with an unattached spring member 30 . the spring member is a split ring which corresponds roughly to the inside circumference of split ring 11 , but is divided into chordal segments forming individual leaf springs 31 . these leaf springs are connected by junctions 32 which are softened or annealed ( or alternatively reduced in cross - section ) to provide the hinging action described above in reference to spring member 12 . spring member 30 is thus generally similar in shape to a conventional wave spring , but entirely different in function and reaction force due to the presence of softened ( or narrowed ) junctions 32 which permit the individual leaf springs to deflect and react substantially independently of each other . the assembly illustrated in fig6 is particularly useful in small - diameter seals where it may be difficult to expand an attached - spring assembly sufficiently to slide over a duct member before fitting into a ring groove . spring member 30 can be installed separately , and the installation problem is therefore avoided . the ring groove should be dimensioned to ensure that the spring member is retained captive by the outer split ring after assembly . a mechanical hinge or pivot connection can also be provided between the individual leaf springs , but the annealed construction is preferred as it is simple and inexpensive . in the version of the seal ring assembly shown in fig1 and 2 , the annealing occurs automatically when the spring members are spot - welded to the split ring . localized cross - section reduction is also an effective way to provide the desired hinging action , and is particularly appropriate where the spring members are made of plastic materials or of metals which cannot be satisfactorily annealed . although the invention has been described in terms of a seal ring fitted in a groove on the inner member of two telescoped members , the invention is equally useful on a ring fitted in a groove defined by the outer member . in the latter case , the leaf springs are secured to the outer peripheral surface of the ring rather than the inner peripheral surface as shown in the drawings . there has been described a simple and economically produced seal ring assembly which provides a relatively constant sealing force in spite of gradual expansion of the outer seal ring due to wear . the desired longitudinal freedom of the several sealed parts is achieved , while maintaining a centering action and damping force which prevents radial rattling and impacting of the loosely fitted loose - tolerance parts . the assembly is useful in many applications , but finds primary utility in high - temperature joints which are subjected to vibration .	5
referring to fig1 the device 1 forming an emptying screw for the residual product stored in a silo with a substantially flat base comprises , in the example considered here , three beams 10 , 20 and 30 placed above the base of the silo and parallel to it , these beams overall having the same structure . each beam 10 , 20 and 30 consists of a rectilinear metallic core 11a and a rectilinear metallic profiled section 11b which extend substantially over the same length ( fig3 ). the profiled section 11b is fixed with one face against a longitudinal face of the core 11a and parallel to the latter , and it extends over a height of about 30 cm . the upper part of the profiled section 11b is bent forward , that is to say in a direction away from the core 11a . the longitudinal face of the profiled section 11b opposite its face fixed to the core 11a will be referred to as the front face . the first beam 10 ( fig1 ) is mounted pivotably via one of its ends 10a , called the inner or first end , which is articulated around a pivot structure 2 situated on the whole above the discharge opening 3 provided , for example , at the center of the base of the silo and delimited by a trough 4 . the pivot structure 2 is fixed to a support 5 placed at the center of the trough 4 and connected by connection bars 5a to the edges of the trough 4 . toward its other end 10b , called the outer or second end , the beam 10 is supported by a plate 12 . this plate 12 ( fig2 ) supports a motor assembly comprising two electric motors m1 and m &# 39 ; 1 , and a drive system , such as a wheel 15 , via which the beam 10 bears on the base of the silo . the axis of rotation of the wheel 15 is substantially parallel to the beam 10 , in such a way as to permit the pivoting movement of the latter , and it is connected to the output shaft of the motor m &# 39 ; 1 . the first beam 10 supports in rotation an endless screw 16 borne by bearings fixed to the front face of the profiled section 11b , said screw extending parallel to the beam . at its inner end , the endless screw 16 over - hangs the discharge opening 3 in such a way that the product which it conveys runs out through this opening . toward its other end , the axis of the endless screw 16 is coupled to the output shaft of the motor m1 by a pinion and chain system 17 , for example . the second and third beams 20 and 30 have a structure analogous to that of the first beam 10 . in other words , all the following elements are once again present : two metallic profiled sections 11a and 11b , two plates 22 and 32 which support the so - called outer ends 20b and 30b of the beams 20 and 30 , two motor assemblies , each comprising two electric motors m2 , m &# 39 ; 2 , and m3 , m &# 39 ; 3 , two drive systems 25 and 35 for the beams 20 and 30 controlled by the motors m &# 39 ; 2 and m &# 39 ; 3 , and two endless screws 26 and 36 driven in rotation by the motors m2 and m3 , respectively . toward its so - called inner end 20a , the beam 20 is mounted in articulated fashion via auxiliary pivot structure 6 supported in rotation by the plate 12 of the first beam 10 , while toward its so - called inner end 30a , the beam 30 is mounted in articulated fashion via auxiliary pivot structure 6 supported in rotation by the plate 22 of the second beam 20 . when the three beams 10 , 20 and 30 are parallel to one another , they are offset relative to one another . the second beam 20 is ahead of the first beam 10 in the direction of pivoting , and the third beam 30 is ahead of the second beam 20 . it should be noted that the inner end of the second endless screw 26 of the second beam 20 , at the inner end 20a of the latter , extends beyond the end of the endless screw 16 of the first beam 10 , at the outer end of the latter , so that the product conveyed by the second endless screw 26 is picked up by the first endless screw 16 . this same arrangement exists between the endless screws 26 and 36 of the second and third beams 20 and 30 . the end of the endless screw 36 of the third beam 30 , at the outer end 30b of the latter , advantageously extends beyond the plate 32 for reasons which will be explained hereinbelow . means 50 are provided for controlling the pivoting of the second beam 20 relative to the first beam 10 when the latter is in motion . in the example considered here ( fig2 and 3 ), these means 50 consist of an electrical device such as a switch 51 mounted in the control circuit of the motor m &# 39 ; 2 of the system 25 driving the second beam 20 . this switch 51 is supported by the plate 12 in the vicinity of the articulation pivot 6 for the two beams 10 and 20 . the element for triggering this switch consists of a finger 52 mounted at the upper end of the articulation pivot 6 . conversely , means 55 are provided for controlling the pivoting of the first beam 10 relative to the second beam 20 . these means 55 also consist of an electric switch 56 mounted in the control circuit of the motor m &# 39 ; 1 of the system 15 driving the first beam 10 . this switch 56 is supported by the plate 12 in the vicinity of the articulation pivot 6 of the two beams 10 and 20 . the element for triggering this switch 56 is the same as that for the switch 51 , namely the finger 52 borne by the articulation pivot 6 . in practice , the two electric switches 51 and 56 are situated on each side of the finger 52 . in a similar manner , these same control means 50 and 55 are provided between the beams 20 and 30 . finally , it should be noted that there is a wheel 15a mounted freely at the front of the plate 12 in order to perfect the stability of the beam 10 on the base wall of the silo . in an analogous manner , two free wheels 25a and 35a are also supported , respectively , by the plates 22 and 32 of the two other beams 20 and 30 . once gravitational emptying has been carried out , the device is started up in order to carry out residual emptying . in a general manner , the three respective motors m1 , m2 and m3 for driving in rotation the endless screws 16 , 26 and 36 are started up sequentia the three beams 10 , 20 and 30 being substantially in alignment with i . e . parallel to one another . the product conveyed by the endless screw 36 of the third beam 30 is picked up by the endless screw 26 of the second beam 20 , then taken up by the endless screw 16 of the first beam 10 and tipped into the discharge opening 3 of the silo . the drive motors m &# 39 ; 1 , m &# 39 ; 2 and m &# 39 ; 3 of the beams are also started up , but as long as the resistance offered by the product opposes the pivoting movement of the beams 10 , 20 and 30 , the latter remain stationary . in practice , the drive motor m &# 39 ; 1 of the wheel 15 of the first beam 10 comes into operation only when the beam is clear of the product , this instant being detected by a photoelectric cell , for example . once the motor m &# 39 ; 1 has been actuated , the motors m &# 39 ; 2 and m &# 39 ; 3 for driving the beams 20 and 30 are successively started up . of course , the beams 10 , 20 and 30 do not necessarily pivot simultaneously and at the same angle , because the quantity of product , its structure , etc . vary from one position to another . it is for these various reasons that the devices 50 and 55 for controlling the pivoting of the beams relative to one another have been provided . if the second beam 20 pivots more quickly than the first beam 10 , the radial finger 52 of the control means 50 pivots in a defined direction and comes to act on the electric switch 51 , the effect of this being to stop the motor m &# 39 ; 2 driving the beam 20 . of course , the motor m &# 39 ; 2 is once again started up as soon as the finger no longer acts on the switch 51 . conversely , if the first beam 10 pivots more quickly than the second beam 20 , the radial finger 52 of the control means 55 pivots in an opposite direction and comes to act on the electric switch 56 , the effect of this being to stop the motor m &# 39 ; 1 driving the beam 10 . the same control means 50 and 55 provided between the second and third beams 20 and 30 act in a similar manner . in the case of a cylindrical silo , the three beams 10 , 20 and 30 extend overall on a radius of the silo , and it is important to note that the end of the endless screw 36 extending beyond the plate 32 of the third beam 30 comes into the vicinity of the inner side wall of the silo , this making it possible to remove the product stored in this zone . the device according to the invention is used for the residual emptying of various products , in general cereals , these granular or pulverulent bulk products running off by gravity . in the case of hemispherical silos , the residual emptying can be entirely carried out with the device according to the invention , the set of endless screws overall extending over a length corresponding to the radius of the silo . in the case of silos with a noncylindrical crosssection , it is very easy to imagine the whole device being displaced parallel to itself instead of simply having a pivoting movement about a central point . taking as an example the case of a base with a rectangular cross - section , it suffices , for this purpose , to position the inner end of the first beam in the vicinity of one of the sides of the base of the silo , the set of beams extending over a length corresponding to that of the other side of the base of the silo and to then move the assembly along a discharge opening situated on one side of the base wall of the silo . as a variant , the assembly can be moved in a median line situated half way between two opposite sides of the base of the silo , this discharge opening in this case being situated on this median line . of course , the invention is not limited to the embodiments given solely by way of example , and it comprises all the technical equivalents described hereinabove . in particular , the principle of the invention is applicable to a number of beams at least equal to two , and the person skilled in the art can easily imagine , without departing from the scope of the invention , alternatives for the articulation systems between the beams , the systems for controlling the pivoting movement of two consecutive beams by using photoelectric cells for example , and the systems for driving the beams based on chains , for example . the motors for driving the endless screws and the beams can be of the pneumatic or hydraulic type . finally , certain features , such as the position of the drive motors and the extension of the endless screw of the final beam in the direction of the wall of the silo , are improvements which can be attached to single - beam devices .	1
in order to more clearly describe the inventive concept of the present invention , a brief description of a capacitance - type transducer over which the present invention is an improvement , will be presented . referring now to the drawings and specifically to fig1 a , an electroacoustical transducer 10 constructed in accordance with the teachings of the prior art is depicted . transducer 10 includes cylindrical housing 12 having open end 14 and partially closed perforated end 16 at the opposite end thereof . housing 12 also includes flanged portions 18 near opened end 14 of said housing 12 . slot vibratile diaphragm 20 extends across opening 14 and is positioned between diaphragm support ring 22 and said housing 12 . diaphragm 20 includes an insulative layer of polyamide film on which an extremely thin layer of gold ( approximately 300a ) has been vapor deposited . diaphragm support ring 22 is of circular cross section with an opening 23 through the center thereof and has a flanged end for cooperative engagement with flange portion 18 of housing 12 . backplate 24 , of circular cross section , includes a slightly crowned electrically conductive surface for cooperative engagement with the insulative layer of diaphragm 20 . leaf spring 26 provides the force that maintains backplate 24 in cooperative engagement with diaphragm 20 . when assembled , the transducer components described in fig1 a are in the position shown in fig1 b . fig1 b is a sectional view , in elevation , of the transducer components illustrated in fig1 fully assembled . the transducer of fig1 b is assembled by placing a uniform radial force on diaphragm 20 for the purpose of maintaining said diaphragm in a relatively flat plane and then positioning said diaphragm over opening 14 ( fig1 ) of housing 12 , such that the gold layer of diaphragm 20 is toward perforated end 16 of said housing 12 . with diaphragm 20 maintained in this planar orientation , the periphery of diaphragm 20 is sandwiched between the flanged end of insulative ring 22 and flange portion 18 of housing 12 , and then the open end of housing 12 is crimped onto said insulative ring 22 which places the periphery of diaphragm 20 in a fixed position with respect to said housing 12 . backplate 24 is placed in opening 23 of support ring 22 such that the slightly crowned surface of said backplate 24 engages the insulative layer of diaphragm 20 and forms said diaphragm 20 into the same general shape as the crowned surface of said backplate 24 . with backplate 24 so positioned , leaf spring 26 is inserted through openings 28 in support ring 22 such that the center flat portion of leaf spring 26 presses against backplate 24 and the ends of leaf spring 26 rests against the walls in opening 28 of support ring 22 . with leaf spring 26 so positioned , diaphragm 20 remains formed to the general shape of the crowned surface of backplate 24 . fig1 c is a top view of transducer housing 12 which is a plan view of perforated end 16 of said housing 12 as it is shown in fig1 b . perforated end 16 provides two very important interrelated functions for transducer 10 . one function is the protection of the extremely thin gold outer layer of diaphragm 20 from direct physical injury . damage to this layer may drastically affect transducer acoustical energy transmission and reception capabilities . another function provided by said perforated housing end 16 is that it enables an acoustical wavefront to be transmitted and / or sensed by diaphragm 20 . if a protective function is to be provided by housing end 16 , there must be one or more openings therein of sufficient magnitude for the passage of acoustical energy therethrough . turning now to the present invention , and specifically to fig2 a , an exploded perspective view of capacitance - type electroacoustical transducer 30 incorporating a preferred embodiment of the present invention is depicted . in fig2 a , transducer 30 includes cylindrical housing 32 having central opening 34 , of circular cross section , through its longitudinal center . cylindrical housing 32 includes flange portion 36 extending laterally therefrom near one end thereof . flat vibratile diaphragm 38 extends across that end of housing opening 34 near flange 36 of housing 32 between diaphragm support ring 39 and said housing 32 . diaphragm 38 consists of three distinctive layers 40 , 42 and 44 that are formed in situ into a single vibratory unit before being assembled into transducer 30 . these three layers have been artificially shown spaced from one another in fig2 a in order to facilitate describing the makeup of diaphragm 38 . layer 40 of diaphragm 38 is the above - mentioned 0 . 3 mil polyamide film which is also referred to herein as kapton . the next layer 42 is an aluminum foil layer which has been vapor deposited by conventional means to a thickness of from 800 to 1 , 000 a onto one surface of said kapton film . third or dielectric layer 44 of diaphragm 38 may be a coating of silicon , silicon dioxide or glass that has been vapor deposited in situ on the outer surface of said aluminum layer to the same order of magnitude thickness as said aluminum layer . diaphragm support ring 39 is of circular cross section with an opening through the center thereof and has a flanged end 46 for cooperative engagement with flange portion 36 of cylindrical housing 32 . backplate 48 , of circular cross section , includes a slightly crowned , irregular , and grooved electrically conductive surface for cooperative engagement with diaphragm 38 . leaf spring 50 provides the physical force that maintains backplate 48 in cooperative engagement with diaphragm 38 . when fully assembled , the transducer components described in fig2 a are in the positions shown in fig2 b . fig2 b is a sectional view , in elevation , of the transducer components illustrated in fig2 a , fully assembled . the transducer of fig2 b is assembled by placing a uniform radial force on diaphragm 38 for the purpose of maintaining said diaphragm in a relatively flat plane , and then positioning said diaphragm 38 within the flanged end opening 34 that extends through housing 32 . with diaphragm 38 maintained in this planar orientation and with layer 40 of said diaphragm 38 facing said housing 32 , the periphery of said diaphragm 38 is sandwiched between flanged end 46 of ring 39 and flanged portion 36 of housing 32 , and then the outer portion of flange 36 is crimped onto said ring 39 which places the periphery of diaphragm 38 in a fixed position with respect to said housing 32 . crowned backplate 48 is placed within support ring 39 such that the crowned surface of said backplate 48 engages the glass , silicon or silicon dioxide surface of diaphragm 38 and forms said diaphragm 38 into the same general shape as the crowned surface of said backplate 48 . with backplate 48 so positioned , leaf spring 50 is inserted through openings 52 in support ring 39 such that the center portion of leaf spring 50 presses against backplate 48 and the ends of leaf spring 50 rest against the walls in openings 52 of support ring 39 . as shown in fig2 c , which is an enlargement of detail 2c in fig2 b , with leaf spring 50 so positioned , backplate 48 presses against dielectric layer 44 of diaphragm 38 thereby tensioning said diaphragm 38 , together with its above - described constituent layers 40 , 42 and 44 , to the desired diaphragm tension force level for proper transducer 30 operation . in the above - described preferred embodiment of the present invention , the dielectric layer between metal foil layer 42 and backplate 48 is preferably provided by vapor depositing such dielectric materials as silicon , silicon dioxide , glass , etc ., in situ on the inward facing metal foil surface . a less desirable technique would be to add the dielectric layer during transducer assembly . an alternate , though less capacitance producing arrangement would be to anodize ( i . e ., infuse or disperse oxygen into ), the grooved , irregular surface of aluminum backplate 48 which is represented by dielectric coating or layer 54 in fig2 a , and this coating would be a substitute for the above - mentioned vapor deposited dielectric layer on metal foil layer 42 . if a metal other than aluminum were employed for backplate 48 , in certain instances an oxide of such other metal may also be employed as the transducer dielectric . anodizing aluminum foil layer 42 of transducer 30 would be impractical because the anodizing layer would have to be several orders of magnitude thicker than the metal foil layer which would produce a transducer diaphragm that would be much too heavy to effectively transmit sufficient quantities of object detecting acoustical energy at ultrasonic frequencies . the primary function of polyamide or kapton film layer 40 in diaphragm 38 of transducer 30 is to provide a physical support for aluminum foil layer 42 and , if employed in this manner , to support dielectric layer 44 also . as noted above , aluminum foil layer 42 is approximately 1 , 000 a thick and dielectric layer 44 has the same order of magnitude thickness . inasmuch as one angstrom ( a ) is equal to one ten - billionth of a meter , it is clear that neither aluminum layer 42 nor dielectric layer 44 have sufficient thickness and / or substance to be supported without aid of a film or support layer 40 . an important requirement of film layer 40 is that its mass be low relative to the mass of the conductive diaphragm layer such as aluminum foil layer 42 . in addition to its support function for foil layer 42 , film layer 40 of diaphragm 38 also protects the aluminum foil or other such base metal layers from physical as well as environmental damage . physical protection is provided in prior art transducer 10 ( fig1 a , 1b ) by perforated housing end 16 . however , in transducer 30 of the present invention , film layer 40 completely covers the outward - facing surface of foil layer 42 , thereby making additional protective structure unnecessary . the absence of additional protective structure avoids any acoustical signal attenuation that may be caused by such structure . protective film layer 40 introduces no such signal attenuation problems primarily because it forms a portion of diaphragm 38 and vibrates therewith . the close , intimate contact between film layer 40 and metal foil layer 42 and , if utilized , dielectric layer 44 , either reduces or prevents contact between metal foil layer 42 and its environment . by reducing or preventing such contact , oxidation , for example , of metal foil layer 42 is either reduced or prevented , thereby enabling less costly base metals such as aluminum to be utilized as the metal foil layer in place of more expensive noble metals such as gold and silver or the like . an additional advantage of having a protective outer film layer such as layer 40 over metal foil layer 42 in transducer 30 is that a less expensive base metal layer such as aluminum can be made to look like a more expensive noble metal such as gold if the proper coloring is chosen for said outer film layer . when selecting dielectric coating materials for inclusion between metal foil layer 42 and backplate 48 of transducer 30 of the present invention , it is essential that the thickness of any selected material be reduced at a substantially greater rate than its dielectric constant . if all other factors affecting transducer capacitance remain the same while the dielectric constant and thickness of a selected dielectric material change at the same rate from a previously selected material , there would be no net change in transducer capacitance . the polyamide film layer of diaphragm 20 in prior art transducer 10 depicted in fig1 a and 1b provides the dielectric material between the conductive layer of diaphragm 20 and transducer backplate 24 and therefore the film layer of diaphragm 20 must necessarily be an insulator . however , in transducer 30 which embodies the inventive concept of the present invention , film layer 40 of diaphragm 38 in transducer 30 may be constructed of either conductive or insulative materials so long as the material selected has the qualities necessary to produce the desired acoustical wavefront . in prior art transducer 10 ( fig1 b ), the electrically conductive layer of diaphragm 20 is in direct physical contact with electrically conductive housing 12 and therefore , electrical connection to said conductive diaphragm layer is made by connecting to said housing 12 . by contrast , in transducer 30 of the present invention , a small area of the metal foil layer would be masked off prior to the vapor deposition of dielectric material on said metal foil layer , and subsequent connection to the conductive metal foil layer would be made through said small masked off foil area . it will be apparent to those skilled in the art by the foregoing description of my invention that various improvements and modifications can be made in it without departing from its true scope . the embodiments described herein are merely illustrative and should not be viewed as the only embodiments that might encompass my invention .	6
the present invention is based on the novel discovery that a combination of β - 1 , 3 ( 4 )- endoglucanohydrolase , β - 1 , 3 ( 4 ) glucan , diatomaceous earth , mineral clay , and glucomannan effectively inhibit the growth of pathogenic fungal species and thereby reduce or eliminate the direct or indirect negative consequences which accrue to the host mammalian or avian organism . the β - 1 , 3 ( 4 )- endoglucanohydrolase is from a commercial source and is produced from submerged fermentation of a strain of trichoderma longibrachiatum . the diatomaceous earth is prepared by methods commonly known in the art . it is available as a commercially - available acid - washed , product with 95 % silica ( sio 2 ) and with its remaining components not assayed but consisting primarily of ash ( minerals ) as defined by the association of analytical chemists ( aoac , 2002 ). the yeast cell wall extract is prepared by a method commonly known in the art . it is a commercial source of β - 1 , 3 ( 4 ) glucan and glucomannan derived from primary inactivated yeast ( saccharomyces cerevisiae ) with the following chemical composition : moisture 2 - 3 % dry matter 97 - 98 % proteins 14 - 17 % fats 20 - 22 % phosphorous 1 - 2 % mannans 22 - 24 % β - 1 , 3 ( 4 ) glucan 24 - 26 % ash 3 - 5 % the mineral clays ( aluminosilicates ) used in this invention may be fulfilled by any of a variety of commercially - available clays including , but not limited to , montmorillonite clay , bentonite and zeolite . in a preferred embodiment of the invention , β - 1 , 3 ( 4 )- endoglucanohydrolase , diatomaceous earth , yeast cell wall extract and mineral clay are combined at 0 . 05 - 3 %, 1 - 40 %, 1 - 20 % and 40 - 92 %, respectively . in a preferred composition , β - 1 , 3 ( 4 )- endoglucanohydrolase , diatomaceous earth , yeast cell wall extract and mineral clay are combined at 0 . 1 - 3 %, 5 - 40 %, 2 - 10 % and 40 - 80 %, respectively . in an especially preferred embodiment of the invention , β - 1 , 3 ( 4 )- endoglucanohydrolase , diatomaceous earth , yeast cell wall extract and mineral clay are combined at 0 . 2 - 3 %, 30 - 40 %, 4 - 6 % and 50 - 65 %, respectively . the preferred physical form of the invention is a dry , free - flowing powder which is suitable for direct inclusion into a feed , food product or as a supplement to a total mixed ration or diet . the compositions provided by the present invention may be incorporated directly into commercially - available feeds or food products or fed as supplements to commercially - available feeds or food products . the composition contained in the present invention may be fed to any mammalian or avian species . the methods of the invention comprise reducing the growth and associated mycosis caused by enteric infections of pathogenic fungal organisms in the gut of mammalian and avian species . when incorporated directly into feeds , the present invention may be added to feeds in amounts ranging from 0 . 1 to 5 kg per ton of feed . in an especially preferred composition , the invention may be added to feeds in amounts ranging from 1 - 2 kg per ton of feed . the composition contained in the present invention may be added to animal feedstuffs or to foods in amounts ranging from 0 . 0125 % to 2 % by weight of feed . in a preferred embodiment , the composition is added to animal feedstuffs or to food in amounts from 0 . 0625 % to 1 % by weight of feed . in an especially preferred embodiment , the invention is added in amounts from 0 . 125 % to 0 . 5 % by weight of feed . alternatively , the composition contained in the present invention may be fed directly to mammalian or avian species as a supplement in amounts 0 . 016 grams / kg to 0 . 37 grams / kg of live body weight per day . in an especially preferred embodiment , the invention may be provided to mammalian and avian species in amounts of 0 . 10 grams / kg to 0 . 20 grams / kg of body weight per day . one of skill and art can appreciate that the amount of the invention fed can vary depending upon the animal species , size of the animal and type of the feedstuff to which the invention is added . the novel methods of this invention comprise the ability of a combination of β - 1 , 3 ( 4 )- endoglucanohydrolase , diatomaceous earth , yeast cell wall extract and clay to inhibit the enteric growth and mycosis caused by various pathogenic fungal genera which include , but are not limited to , aspergillus , aureobasidium , candida , eurolium , fusarium , mucor , penicillium and rachiborskiomyces sp . the benefits resulting from the application of the invention to mammalian species include , but are not limited to , reduced death losses , reduced incidence of mycotic abortion , reduced incidence of jejunal hemorrhage syndrome ( dead gut syndrome ), reduced incidence of scouring ( diarrhea ), improved growth rate , improved efficiency of growth , improved milk production , improved efficiency of milk production and reduced somatic cell counts in milk products ( dairy animals ). the benefits from the application of the invention to avian species include , but are not limited to , reduced death losses , improved growth and egg production , improved fertility , and reduced incidence of enteric diseases . the following are intended to be illustrative of the invention , and are not to be considered restrictive of the scope of the invention as otherwise described herein . the following novel experiment documents the presence of mold spores or conidia in the feed , jejunal contents and jejunal wall of a holstein dairy cow which died in 2002 from jejunal hemorrhage syndrome ( dead gut syndrome ). samples of feed , jejunal contents and jejunal tissue were homogenized in a polytron and serial dilutions ( 1 ml ) of these samples were applied to a petrifilm ® mold count plate . the feed sample was centrifuged following homogenization to generate a particulate fraction and a soluble fraction . the density of mold counts in each of these samples is shown in table 1 . the data indicate the presence of mold in feed and the gut . of interest , the mold sample preferentially localized into the jejunal wall , a characteristic of aspergillus fumigatus . these data indicated potential for the fungal infection to underlie the etiology which led to death of the animal . the following experiment documents a novel discovery in which we determined that fungi can colonize the gut , invade the blood and produce a mycotic condition which can result in jejunal hemorrhage , mycotic abortion and death of dairy animals . to complete this study , several novel steps were undertaken : the sequence of aspergillus fumigatus 18s small ribosomal subunit gene was determined from existing literature ( jaeger et al ., 2000 ) and used to design dna primers for polymerase chain reaction ( pcr ) analysis of the presence of aspergillus dna in the gut , tissues and blood of cows exhibiting mycotic abortion or which had died from jejunal hemorrhage . two sets of primers were prepared : a primary pan - fungal set which amplified all fungal dna and a “ nested set ” which specifically - amplified and detected aspergillus genera ( jaeger et al ., 2000 ). additional primers ( from the 18s gene ) were designed for sybr - green analysis ( real - time quantitative pcr ) to allow for the determination of the mold dna concentration ( mold “ burden ”) in blood of cows which had mycotic abortions or which had died from jejunal hemorrhage syndrome . using the dna primers designed in step 1 ( above ) we determined that cows afflicted with jejunal hemorrhage syndrome or which displayed mycotic abortions exhibited high levels of aspergillus mold counts in jejunal wall and blood . using our novel real - time sybr - green quantification protocol ( step 2 , above ) we determined that the mold burden in cows which had either died from jejunal hemorrhage syndrome or which had displayed incidence of mycotic abortion were extremely high . control ( asymptomatic ) cows did not harbor fungal dna . instead , via sequencing , we have detected other non - pathogenic fungal species ( e . g ., cladosporium ) at low concentrations . this has led us to conclude that lower levels of aspergillus infection ( mycosis ) result in abortion ( known as “ mycotic abortion ”) whereas exceedingly high levels result in death of the infected animal . whether or not death results from a direct effect of fungal infection or , instead , from secondary ( indirect ) bacterial infections ( e . g ., clostridium sp .) has not been determined . the following novel experiment illustrates the ability of a mixture of clay and β - 1 , 3 ( 4 ) glucan / glucomannan ( 95 . 6 % and 4 . 4 %, respectively ) to inhibit the growth of aspergillus fumigatus in culture . a . fumigatus culture was derived from a local corn grain sample and applied as a streak to a culture plate containing sabouraud dextrose agar medium supplemented with chloramphenicol and gentimycin ( to inhibit bacterial growth ). drops ( 50 μl ) of sodium - aluminum silicate clay combined with β - 1 , 3 ( 4 ) glucan and glucomannan ( 40 mg / ml : 95 . 6 % clay , 4 . 4 % β - 1 , 3 ( 4 ) glucan and glucomannan ) were applied to the a . fumigatus streaks and the growth of the mold culture was evaluated following 42 hours of culture at 27 ° c . the mold culture at 42 hours is shown as a zigzag pattern of white mold with spreading mycelia ( see appended fig1 ). drops of the clay / β - 1 , 3 ( 4 ) glucan and glucomannan product can be seen visually as brown - colored areas on the culture dish . one such spot in fig1 is indicated at the tip of a piece of white paper marked “ i ”. application of the clay / β - 1 , 3 ( 4 ) glucan and glucomannan product to the culture clearly and effectively diminished growth of a . fumigatus . this novel experiment shows that additions of the mineral clay , β - 1 , 3 ( 4 ) glucan and glucomannan mixture ( 95 . 6 % clay , 4 . 4 % β - 1 , 3 ( 4 ) glucan and glucomannan ) effectively inhibit the growth of aspergillus fumigatus . the inhibition of fungal growth with these combined ingredients , represents a portion of the mechanism of action which we submit as a mechanism of action for products in the treatment and prevention of mycotic diseases in mammalian and avian species . aspergillus was inoculated into 10 ml of sabouraud dextrose broth supplemented with chloramphenicol and gentimycin ( to inhibit bacterial growth ). in addition , various amounts of a combination of mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan were added directly to cultures to establish the effects of these compounds on the growth of the aspergillus culture . the density of cells was utilized as an index of a . fumigalus cell number and density was monitored using a spectrophotometer ( wavelength was 530 nm ). in control cultures ( i . e ., a . fumigatus with no additions of the three components of the invention ), we typically observed a long lag phase ( see appended fig2 ) where little fungal growth occurred . this was followed by a rapid , “ log - phase ” growth curve with maximum fungal cell density being reached after several hours . when a combination of mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan product was added to the culture , the growth of the yeast culture was delayed ( see appended fig2 and 3 ). specifically , addition of mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan mixture in combination , delayed entry of the a . fumigatus culture into the rapid log - phase growth . however , once a . fumigatus growth began , this product did not limit the total growth of the culture . the lowest effective dose of the clay : β - 1 , 3 ( 4 ) glucan and glucomannan combination was 100 μg / 10 ml culture where a delay of 1 - 2 hours in growth was observed ( see appended fig2 ). higher levels of the mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan mixture ( e . g ., 500 μg / 10 ml ) delayed entry of the a . fumigatus into log - phase growth ( see appended fig3 ). of interest , the transit time of digesta in an adult bovine animal is 48 - 72 hours . the poorer growth conditions which a . fumigatus would find in the bovine digestive tract ( i . e ., due to competition with other microbial species , less growth substrate and less oxygen ) would most likely alter its growth in such a manner that a delay in log - phase growth could result in loss of the infectious organism in the feces before it has opportunity to rapidly proliferate . hence , we propose that the delay in the log - phase fungal growth caused by the presence of a 95 . 6 % mineral clay with 4 . 4 % β - 1 , 3 ( 4 ) glucan and glucomannan mixture effectively reduces the degree of colonization of the gut which may be caused by aspergillus and other fungal genera and thereby reduces the harmful direct , and possibly indirect , effects of an aspergillus infection or infection by other pathogenic fungal species . this novel experiment documents the ability of diatomaceous earth to inhibit the growth of a . fumigatus in culture . similar to example 4 , diatomaceous earth was added to cultures of a . fumigatus which had been supplemented with chloramphenicol and gentimycin ( to inhibit bacterial growth ). a control sample was prepared to study fungal growth in the absence of diatomaceous earth . in addition , various levels of diatomaceous earth ( 5 , 50 , 250 , 500 , 1000 and 5000 μg / 10 ml culture ) were added to a . fumigatus cultures to determine its effects on fungal growth . culture conditions were identical to those outlined in example 4 . fig4 ( appended ) documents the novel and surprising ability of diatomaceous earth to markedly reduce growth of a fungal culture . the lowest effective dose at which diatomaceous earth inhibited fungal growth was 50 μg / 10 ml of culture medium ( fig4 , appended ). efficacy was also detected up to concentrations of 1000 μg / 10 ml of culture medium ( data not included ). this novel experiment documents the additive ability of a 3 - way combination of diatomaceous earth , mineral clay and β - 1 , 3 ( 4 ) glucan and glucomannan mixture to effectively inhibit fungal growth . in this experiment , aspergillus fumigatus was cultured as described in previous examples . the effects of adding a mixture of all three ingredients on growth of a . fumigatus were studied . the mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan mixture delayed entry into log phase growth ( as described in examples 2 - 5 ). diatomaceous clay ( 50 μg / 10 ml of culture ) in combination with mineral clay : β - 1 , 3 ( 4 ) glucan and glucomannan mixture ( 500 μg / 10 ml culture ) inhibited growth of the aspergillus culture ( i . e ., a longer delay in entry into log - phase growth ; see appended fig5 ). effects were greater than when products were added alone . this novel experiment documents the ability of β - 1 , 3 ( 4 )- endoglucanohydrolase , alone and in combination with the other components of the invention , to markedly inhibit growth of a . fumigatus in liquid culture . in this experiment , the abilities of β - 1 , 3 ( 4 )- endoglucanohydrolase alone ( 100 tμ / ml ) and a combination of β - 1 , 3 ( 4 )- endoglucanohydrolase ( 100 μg / ml ) and a mixture of diatomaceous earth , mineral clay and β - 1 , 3 ( 4 ) glucan / glucomannan ( 100 μg / ml ) were combined and their effects on fungal growth ( as described above ) were assessed . the β - 1 , 3 ( 4 )- endoglucanohydrolase alone was unable to reduce fungal growth ( fig6 ). surprisingly , however , addition of this enzyme to the combination of diatomaceous earth , mineral clay and β - 1 , 3 ( 4 ) glucan / glucomannan caused a marked reduction in fungal growth . specifically , initiation of fungal growth was delayed from 4 hours to over 7 hours ( fig6 ). these results show that the composition of the invention ( i . e ., mineral clay , yeast cell wall extract , diatomaceous earth and β - 1 , 3 ( 4 )- endoglucanohydrolase ) is capable of a previously - undescribed effect of inhibiting growth of pathogenic fungal species ; species which have documented adverse effects on morbidities and mortalities of mammalian and avian species . the combination of products reduces growth of pathogenic fungi in the gut of mammalian and domestic species and thereby prevents the invasion and colonization of the blood compartment ( mycosis ) and represents a mixture which is flowable in easily incorporated into feed products and food products . the invention specifically prevents fungal - based septicemia and the deleterious direct and indirect effects resulting thereof the present invention was effective in achieving its inhibitory effects under growth conditions which might be found in mammalian and avian digestive systems where nutrients , moisture , oxygen and elevated temperatures are provided by the host . the foregoing description of the preferred embodiment of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modifications or variations are possible in light of the above illustrations . the embodiment was chosen and described to provide the best illustration of the principles of the invention and its practical application to thereby enable one of ordinary skill in the art to utilize the invention in various embodiments and with modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth to which they are fairly , legally and equitably entitled .	0
as shown in the drawings for purposes of illustration , the present invention is concerned with a technique for nulling interference or jamming signals received with data signals at an antenna array . fig1 shows a portion of a global positioning system ( gps ) that receives a number of modulated rf signals from an antenna array 11 and detects one or more binary codes originally transmitted from a corresponding number of orbiting satellites . the detected codes are supplied to a gps navigation processor ( not shown ), which processes the codes to determine the precise location of the receiver . the modulated signals received from the antenna array 11 can sometimes contain interference in the form of a jamming signal . null processing and beam steering apparatus 13 , embodying the present invention , and a conventional tracking and detection circuit 15 , process the modulated signals and substantially eliminate the effects of the interference . as shown in fig1 the antenna array 11 includes n elements , designated 17a - 17n . the modulated antenna signals are supplied on lines 19a - 19n to the null processing and beam steering apparatus 13 , which produces quadrature i and q data signals on lines 21 and 23 , respectively , for input to the tracking and detection circuit 15 . the latter circuit generates reference signals i ref and q ref on lines 24 and 25 for use in demodulation in the apparatus 13 , and also generates a replica of the pseudorandom number ( pn code ) on line 26 for use in the apparatus 13 . as is well known , when phase lock closure is achieved by the tracking and detection circuit 15 , no satellite signal component is present in the q channel output of apparatus 13 . the circuit 15 , which is of conventional design , extracts certain information from the i and q data signals , and supplies this information to the gps navigation processor , as indicated by data path 27 . the apparatus 13 receives clock signals over line 28 from a reference oscillator 29 , which also supplies clock signals to the tracking and detection circuit 15 , on line 30 . the prior grobert patent ( u . s . pat . no . 4 , 734 , 701 ) discloses a simplified technique for null processing , without the need for complex weighting adjustment of the received antenna signals prior to summation . basically , this technique effects weighting after demodulation and conversion of the signals to digital form . although the technique results in nulling of any jamming signals , it may also result in the generation of one or spurious nulls in the antenna pattern , which adversely affect operation of the receiver if a spurious null is directionally aligned with an information signal source , such as a gps satellite . in accordance with the present invention , nulling of a jamming signal is effected in a manner similar to that of the prior grobert patent , but the effects of spurious nulls are practically eliminated by providing for steering of the antenna beam to move a spurious null away from a signal source of interest . basically , the object of the invention is achieved by combining two circuits : the nulling circuit of the prior grobert patent and an antenna beam steering circuit . although antenna beam steering using an array of antenna elements is a relatively simple matter in the absence of jamming signals , it is not immediately obvious how one might effect antenna beam steering in the presence of jamming , and concurrently with operation of the nulling circuit . to facilitate an explanation of the invention , the nulling and beam steering functions will be described separately , using separate block diagrams ; then the combined functions will be described using a single block diagram . throughout this description , it will be understood that numerous references to &# 34 ; circuits ,&# 34 ; &# 34 ; mixers ,&# 34 ; &# 34 ; integrators ,&# 34 ; &# 34 ; summers ,&# 34 ; &# 34 ; filters &# 34 ; and the like should not be taken to mean that there are separate hardware components for performing these functions . as in the earlier grobert patent , the preferred mode of implementation is software , using a programmed microprocessor or similar component for performing the various functions on digital forms of the input signals . as in the prior patent , the elemental functions being performed by the software are relatively simple , and it will be readily understood by anyone of ordinary skill in the programming and signal processing arts how to implement the various functions in software form . for purposes of explanation , however , it is expedient to describe each component as if it were a discrete piece of hardware . fig2 a and 2b together show how a jamming signal is nulled in accordance with the invention , and further depicts how ac ( alternating current ) coupling is used to avoid nulling the information signals as well as the jamming signal . for convenience of illustration , only two antennas and associated processing apparatus are shown : a primary antenna element , referred to with the suffix &# 34 ; 1 &# 34 ; and an auxiliary antenna element , referred to with the suffix &# 34 ; 2 &# 34 ;. thus the quadrature signals derived from the primary antenna element 17a are referred to as i 1 and q 1 , and the corresponding signals derived from auxiliary antenna element 17b are referred to as i 2 and q 2 . where identical or similar components are used in processing the primary and auxiliary signals , they are referred to by the same reference numeral , but using suffixes &# 34 ; a &# 34 ; and &# 34 ; b ,&# 34 ; respectively . the first step in processing the received rf signals is performed in demodulators 32a and 32b . it will be understood that the demodulation step encompasses everything performed in the &# 34 ; hardware &# 34 ; section of the circuit disclosed in the prior grobert patent , including downconverting , removing pn code from the modulate rf signals , and mixing the signals with reference i and q signals fed back from the tracking and detection circuit 15 ( fig1 ). for purposes of this specification , the &# 34 ; demodulation &# 34 ; step performed in blocks 32a and 32b also includes low - pass filtering the signals to include only an approximately 1 - khz bandwidth , and converting the analog signals to digital form . thus the i 1 and q 1 signals output from the demodulator 32a are filtered digital baseband signals , as are the i 2 and q 2 signals output from the demodulator 32b . the circuit of fig2 a produces a nulled i output signal on line 34 from the input signals i 1 , i 2 and q 2 . basically the nulled i output signal is obtained by summing , in summer 36 , the i 1 signal and a weighted contribution derived from the i 2 and q 2 input signals . the nulled i output signal on line 34 is fed back over line 37 and correlated with the i 2 and q 2 signals to produce the weighted auxiliary contribution . an i 2 weighting circuit comprises a mixer 38 , a negative integrator 40 and a multiplier 42 . the mixer 38 produces an output product signal for input to the negative integrator 40 , the output of which is in turn fed to the multiplier 42 . also input to the multiplier 42 is the i 2 signal . the output of the multiplier 42 is connected to one input of another summer 44 . the other input to summer 44 is derived from another weighting circuit , comprising a mixer 46 , a negative integrator 48 and a multiplier 50 . this circuit correlates the 35 nulled i output signal with the q 2 input signal and produces the required input to summer 44 . the output of summer 44 is connected as a second input to summer 36 , which generates the nulled i output . operation of the nulling circuit of fig2 a can be best understood by considering the relative phases of signals at various points in the circuit . although a jamming signal will in general be felt as a broadband noise - like signal , it is helpful for purposes of analysis to consider a single sinusoidal component of the jamming signal . for example , if the jamming signal reaches the antenna 17b first , and the antenna 17a is spaced one half - wavelength from antenna 17b , the signals i 1 and i 2 can be represented as oppositely directed vectors , as indicated at the demodulator outputs . for q 2 the signal is represented by a vector that leads the i 2 vector by 90 °. initially , the outputs of the multipliers 42 and 50 will be zero and the i 1 signal will appear on the nulled i output line 34 . when this signal is fed back and correlated with the i 2 input , in mixer 38 , the mixer will produce a negative output and the associated negative integrator 40 will begin to ramp to a positive value . thus multiplier 42 will begin to produce an output with the same phase as i 2 , which will tend to cancel the i 1 signal in summer 36 , as indicated by &# 34 ;/ 0 &# 34 ; . adjacent to line 34 . at the same time the i 1 - phased signal on line 34 will not correlate with the q 2 signal , since the two signals are orthogonal , and integrator 48 will stay at its zero level . after a time , negative integrator 40 will reach a level at which the contribution from i 2 will completely cancel the i 1 signal in summer 36 , and the jammer component on output line 34 will be zero , i . e . completely nulled out . at this point there will be no correlation , in mixer 38 , between the signal on line 34 and the i 2 input signal , so the negative integrator 40 will remain at its current cumulative level and the nulling operation will be complete . a similar analysis may be made assuming a different phasing of the received jamming signals . for example , if it is assumed that the jamming signal source is exactly overhead and reaches the two antenna elements in phase , then i 1 and i 2 will be in phase , if it is further assumed that the electrical paths followed by these signals do not inject any phase differences . initially , the correlation of the signal on line 34 and the i 2 input signal will be positive , and the negative integrator 40 will begin to ramp negatively . thus the multiplier 42 will invert the i 2 signal , and the resulting signal will tend to cancel the i 1 signal when the two are added in summer 36 . further , the analysis is not affected by the presence of additional auxiliary antennas and circuits . for each additional auxiliary circuit n , the output signal on line 34 is correlated with the i n and q n components , and the resulting contribution is input to the same summer 36 . nulling of the q output signal is performed in a similar fashion , as indicated in fig2 b . the q 1 input is summed in summer 60 with contributions derived from the auxiliary inputs . more specifically , the q nulling circuit includes an i 2 weightign cirucit comprising a mixer 62 , a negative integrator 64 and a multiplier 66 , and a q 2 weighting circuit comprising a mixer 68 , a negative integrator 70 and a multiplier 72 . a nulled q output signal on line 74 is fed back and correlated with the i 2 and q 2 input signals in the mixers 62 and 68 , the result being accumulated in the negative integrators 64 and 70 , and applied as a weighting factor in the multipliers 66 and 72 . the resulting weighted values if i 2 and q 2 are combined in a summer 76 , and then input to the summer 60 to be combined with the q 1 input signal . the circuit of fig2 b generates the nulled q signal on line 74 in much the same way that the nulled i signal is generated . following the same example as fig2 a , initially the q 1 input signal will be impressed on the output line 74 , and fed back for correlation with the i 2 and q 2 input signals . initially , the i 2 and q 1 signals will not correlate , being orthogonal . the negative integrator 64 will remain at zero and there will be no weighted contribution from the i 2 component . in mixer 68 , the q 2 signal correlates with the q 1 signal , since one is the inverse of the other , and the negative integrator 70 begins to ramp positively . thus a q 2 component is input to the summer 76 and then to the summer 60 , tending to cancel the q 1 input and producing the desired nulled q signal , as indicated by &# 34 ;/ 0 &# 34 ; adjacent to line 74 . when the nulled q output is zero , negative integrator 70 continues to hold a positive value and continues to provide the necessary weighting factor to produce a nulling effect . as described thus far , the circuit of fig2 a and 2b will function to null any signals received by the antenna elements 17 , including signals from the gps satellites . the presently preferred embodiment of the invention uses ac coupling to permit the satellite signals to pass through the circuit without being subject to nulling . the circuit of fig2 a includes three coupling capacitors for this purpose . one capacitor 80 is connected in line 37 , which feeds back the nulled i output for correlation with the i 2 and q 2 inputs . second and third capacitors 82 and 84 are connected in the i 2 and q 2 input lines to the mixers 38 and 46 , respectively . the jamming signal is composed of relatively high frequencies and couples easily through these capacitors . because the data signals received from the satellite are basically dc ( direct current ) or of very low frequency , the capacitors present a very high impedance to these signals . therefore , the i and q data signals pass directly through the the summers 36 and 60 and onto the output lines 34 and 74 , respectively , without unwanted compensation by the nulling circuitry . the dynamic weighting principles used in the nulling circuitry of fig2 a and 2b can also be used to steer the antenna beam , as will now be explained with reference to fig3 a and 3b . fig3 a includes many of the same components as fig2 a . for ease in comparing the two figures , primed and identical versions of the same reference numerals have been used where appropriate . thus the fig3 a circuit includes summer 36 to which i 1 is input , and summer 44 for combining the outputs of two weighting circuits that determine the weights of the i 2 and q 2 input signals . the principal difference , as contrasted with fig2 a , is that fig3 a does not include any capacitors for ac coupling . as described thus far , the circuit will perform nulling of an input data signal , and will therefore produce a zero output from the summer 36 . another important addition to the circuit is an additional summer 90 and an inverter 92 . the inverter 92 inverts the i 1 input signal and connects it to the summer 90 . the other input of the summer 90 is taken from the auxiliary input to summer 36 . in effect , then , summer 90 has the same inputs as summer 36 , but subtracts one input from the other instead of adding them . therefore , instead of nulling the i 1 signal the summer 90 produces an enhanced signal on output line 94 , referred to as a beamed i output signal . formation of a beamed q signal makes use of an observable property of the nulling circuitry . when the circuitry is operating on a jamming signal and forms a null in the i output , there is an almost exact relationship between the weighting values in the circuits for processing the i and q signals . specifically , the i 2 weighting factor in the circuit for producing the nulled i output is the same as the q 2 weighting factor in the circuit for producing the nulled q output . further , the q 2 weighting factor in the circuit for producing the nulled i output is the inverse of the i 2 weighting factor in the circuit for producing the nulled q output . in symbolic form , if the factors for i 2 weighting and q 2 weighting in the nulled i circuit are i 2i and q 2i , respectively , and the factors for i 2 weighting and q 2 weighting in the nulled q circuit are i 2q and q 2q , respectively , then : for brevity , the foregoing relationship will be referred to in this specification as cross - strapping with a change of sign . fig3 b shows how a beamed q output signal is generated using the cross - strapping relationship . the circuit consists of summer 76 , multipliers 66 &# 39 ; and 72 &# 39 ;, an additional summer 94 , and inverters 96 and 98 . using the cross - strapping principle , multiplier 66 &# 39 ; receives as an input the inverted form of the signal produced by negative integrator 48 &# 39 ; ( fig3 a ), supplied through connector b and inverter 98 . similarly , multiplier 72 &# 39 ; receives an input from negative inverter 48 &# 39 ;, through connector b and without inversion . the multipliers 66 &# 39 ; and 72 &# 39 ; also have as inputs the demodulated i 2 and q 2 signals , respectively , and produce outputs connected to summer 76 , which combines the correctly weighted i 2 and q 2 contributions . the output of summer 76 is coupled as an input to the additional summer 94 , which also receives as an input the inverted form of the q 1 input signal , through inverter 96 . summer 94 and inverter 96 generate the difference between the q 1 input signal and the auxiliary components that are sufficient to null q 1 . therefore , the output of summer 94 is a beamed q signal . forming a beamed q signal int his manner is required because there is no satellite signal q component present when the receiver phase lock loop is closed . for the same reasons that the nulling circuit of fig2 a and 2b produces an antenna pattern null that will automatically track the directional position of a jamming signal , the beam steering circuit of fig3 a and 3b will automatically track the directional position of a moving satellite signal source . however , the circuit of fig3 a and 3b will not operate properly in the presence of a jamming signal , since , if the jamming signal dominates , the antenna array will be effectively beamed toward the jamming signal instead of toward the desired signal source . a further modification is needed to permit beam steering in the presence of a jamming signal . because of the nature of spread spectrum modulation techniques used in the gps and other communication systems , a jamming signal may be spread over a wide range of frequencies and has the appearance of broadband noise . some of the jamming signal noise is removed by the low - pass filters included in the demodulation process already described . however , when an effective jamming signal is present the signal output from the low - pass filters ( which have a bandwidth of approximately 1 khz ) will typically have a negative signal to noise ratio ( snr ), which means that the noise has a greater power than the signal . the further improvement depicted in fig4 requires the addition of additional low - pass filters 100 , 102 and 104 having a bandwidth of only approximately 1 hz . filter 100 is connected in the i 1 input line to summer 36 &# 39 ;, and filters 102 and 104 are connected in the i 2 and q 2 input lines to mixers 38 &# 39 ; and 46 &# 39 ;, respectively . these filters remove practically all of the noise generated by the jamming signal , but permit the satellite information signals to pass . because of the action of tracking loops in the tracking and detection circuitry 15 ( fig1 ), the satellite signals are basically dc signals that will be passed by the very narrow bandwidth low - pass filters 100 , 102 and 104 . one additional step is needed to ensure that the satellite signals will pass through the filters . gps signals are encoded with data at a low data rate of approximately 50 bits per second . as low as this data rate is , it still will not pass through the 1 hz filters , so must be removed from the satellite signals to permit beam steering to operate . the step of removing the data is performed in mixers 106 , 108 , 110 and 112 , the first three of which are connected in series with and immediately prior to the filters 100 , 102 and 104 , respectively . the fourth mixer 112 is connected between the output of summer 44 and the lower input of summer 36 &# 39 ;. each of these mixers has as its other input a signal referred as dsign , which is indicative of the sign of the data signal . the data being removed in the mixers is encoded on the baseband signals as a succession of sign reversals at the 50 hz data rate . as will shortly be described , the sign of the i data signal can be conveniently derived and fed back as the dsign signal . thus the effect of the mixers 106 , 108 , 110 and 112 is to remove the sign reversals in the input data signal , so that the signal will pass through the low - pass filters and beam steering will be operative . another difference between fig4 and fig3 a is that the final summer 36 &# 39 ; in fig4 has its i 1 input inverted , as indicated by a minus sign . initially , the input to summer 36 &# 39 ; derived from the weighting circuits will be zero , and the i 1 signal will appear in inverted form at the output of summer 36 &# 39 ;. in mixer 38 &# 39 ; this inverted i 1 signal will be correlated negatively with the input i 2 signal having the opposite phase , and the negative integrator 40 &# 39 ; will begin to ramp up positively . thus multiplier 42 &# 39 ; will leave the sign of the input i 2 signal unchanged , as indicated by the right - directed vector at the lower input of summer 36 &# 39 ;. therefore , the output of the summer 36 &# 39 ; will converge on a zero value . it will be appreciated that the inverter 92 and summer 90 of fig3 a have been omitted from fig4 for simplicity , and that a corresponding circuit for forming a beamed q signal in the presence of jamming has not been shown . however , a complete beam steering and nulling circuit will be discussed with reference to fig5 a and 5b . up to this point , the nulling and beam steering functions have been described separately , although fig4 depicts beam steering in the presence of a jamming signal . on first consideration , it may appear to be impossible to implement both nulling and beam steering functions simultaneously since there is no q signal component present due to the action of the receiver phase lock loop . the nulling operation is performed by automatically adjusting weighting circuits to form an antenna pattern in which a null is aligned with a jamming signal source . the beam steering operation has as its goal the adjustment of the antenna pattern to be aligned with a desired signal source , and thereby to enhance the signal to noise ratio ( snr ) performance of the receiver . it would seem to be impossible to perform both functions at the same time . although the circuits shown in fig2 - 4 have included only two antenna elements ( one primary element and one auxiliary element ), it was noted earlier that a practical embodiment of the invention would include more antenna elements than two , and a corresponding number of processing circuits . in general , for an n - element antenna array , a system could be designed to null as many as n - 1 jamming signals . a unique combination of the weight settings in the nulling circuit must be determined to null all n - 1 jammers , and the system is then said to be fully constrained . if the number of jamming signals is n - 2 or less , the system is said to be less than fully constrained and there is an infinite number of weight setting combinations that may selected to implement nulling of all the jamming signals . so long as the nulling system is less than fully constrained , beam steering is possible in addition to jammer nulling . a combined beam steering and jammer nulling circuit is shown in fig5 a and 5b . fig5 a is basically a combination of the features shown in fig2 a and 4 . the ac - coupled nulling circuit includes the summer 36 , which combines the i 1 input signal with the output of summer 44 , which in turn combines weighted i 2 and q 2 inputs . nulling is accomplished by feeding back the i output signal on line 34 to the mixers 38 and 46 , which also receives input signals i 2 and q 2 . the outputs from these two mixers are connected to separate negative integrators 40 &# 39 ; and 48 &# 39 ;, the outputs of which are connected to respective multipliers 42 &# 39 ; and 50 &# 39 ;. these multipliers apply appropriate weighting to the i 2 and q 2 input signals , which are then combined in summer 44 . the nulling function is performed exactly as described with reference to fig2 a . nulling of the satellite information signals is precluded by the presence of capacitors 80 , 82 and 84 . summer 44 has additional inputs from similar weighting circuits used to weight the signal contributions derived from third , fourth and additional antenna elements . the weighting circuits for determining these additional contributions has been omitted for clarity . the beam steering circuitry of fig5 a includes the mixer 106 for removing data from the i 1 input signal , the low - pass filter 100 , and the summer 36 &# 39 ;. the two inputs to the summer 36 &# 39 ; are an inverted i 1 input , derived from the mixer 106 and the filter 100 , and the auxiliary input derived from the summer 44 , through the additional mixer 112 used to remove data modulation . the output of mixer 36 &# 39 ; is fed back to mixers 38 &# 39 ; and 46 &# 39 ; for correlation with the i 2 and q 2 input signals . negative integrator 40 &# 39 ; receives input from two sources : mixer 38 , which correlates a nulling error signal from summer 36 with the i 2 input signal , and mixer 38 &# 39 ;, which correlates a beam steering error signal from summer 36 &# 39 ; with the i 2 input signal . likewise , negative integrator 48 &# 39 ; receives inputs from mixer 46 and mixer 46 &# 39 ;. the negative integrators develop weighting factors that are influenced by both the nulling function and the beam steering function of the circuit . the relative weight given to each function is controlled by a beam steering loop gain amplifier 120 , having a gain factor g s . in the presently preferred embodiment of the invention the value of g s is less than unity . a value of approximately 1 / 128 has proved satisfactory for most situations , but other gain factors may used to achieve desired performance characteristics . in any event , it appears that a relatively weak beam steering loop is all that is needed to &# 34 ; nudge &# 34 ; the weighting factors enough to move any spurious nulls away from the direction of a data signal . the circuit for generating a q output signal combining jammer nulling and beam steering principles when there is no q signal component present int he q channel output is shown in fig5 b . it includes the features of the nulling circuit of fig2 b , specifically the summer 60 for combining the q 1 input signal and a combined weighting signal generated by summer 76 . the nulled q output signal is fed back , through ac coupling , to mixers 62 and 68 , which correlate the nulled signal with i 2 and q 2 inputs . negative integrators 64 and 70 accumulated the outputs of the respective mixers 62 and 68 , and generated weighting factors for applications to multipliers 66 and 72 , respectively . i 2 and q 2 input signals weighted by the multiplier outputs are combined in the summer 76 , which also receives weighted input components from other similar weighting circuits that process signals from additional antenna elements . adjustment of the q weighting factors is effected in part by cross - strapping with sign reversal from the i weighting factors of fig5 a , and in part by a control loop associated with each q weighting circuit . in particular , the weighting circuit associated with the i 2 input further includes a multiplier 122 and loop gain amplifier 124 . the multiplier 122 derives one input from the negative integrator 64 and the other , through connector b , from negative integrator 48 &# 39 ; ( fig5 a ). the output of the multiplier is amplified by the gain amplifier 124 and then fed back into negative integrator 64 as a second input . a similar loop circuit is provided for nudging the q 2 weighting factor , including a multiplier 126 and a loop gain amplifier 128 . following the cross strapping principle , this multiplier obtains one input , negated , from negative integrator 40 &# 39 ;, through connector a , and obtains its other input from negative integrator 70 . the multiplier output is amplified by loop gain amplifier 128 and fed back into the negative integrator 70 as a second input . the loop gain factor g q provided by the amplifiers 122 and 128 is again preferably less than unity . a value of approximately 1 / 4 is presently favored , to provide a relatively weak beam steering influence on the q weighting factors . as described earlier , the beam steering function of the invention depends principally on the use of a very low - pass filter ( 100 , 102 and 104 in fig5 a ). if , as in the case of gps , there is a low - frequency data modulation on the received signal , this must be removed for beam steering purposes , to permit the information signal to pass through the filters . in the case of gps , the data signal takes the form of a sign modulation at 50 bits per second . the signal dsign is used to remove this modulation in mixers 106 , 108 , 110 and 112 . the dsign signal is easy to derive from the i output signal on line 34 , and requires only a summing circuit 130 and a limiter 132 . the summing circuit integrates the incoming signal over 20 - millisecond intervals , under control of a conventionally derived data - rate clocking signal ( not shown ), and the limiter produces a positive or negative output signal indicative of the sign of the information signal . this is the dsign signal used to strip data from the information signal for purposes of beam steering . performance of the apparatus of the invention is obviously very much dependent on the degree to which the system is constrained by the presence of jamming signals . so long as the system is not completely constrained , i . e . with fewer than n - 1 jammers present , the beam steering loop will operate to &# 34 ; nudge &# 34 ; the weighting factors sufficiently to move any spurious nulls away from the direction of incoming signals . this avoids the cycle - slipping problem alluded to earlier , and at the same time provides a substantial improvement in snr performance . once the system becomes constrained by the presence of n - 1 jammers , its operation reverts to that of a pure jammer nulling circuit , and spurious nulls may affect the receiver performance . it will be appreciated from the foregoing that the present invention represents a significant advance in the field of signal processing receivers subject to interference from jamming signals . in particular , the invention provides a technique for nulling out a limited number of jamming signals while at the same time steering the antenna array to avoid the alignment of a spurious null in the antenna pattern with the direction of a signal of interest . it will also be appreciated that , although an embodiment of the invention has been described in detail for purposes of illustration , various modifications may be made without departing from the spirit and scope of the invention . accordingly , the invention is not to be limited except as by the appended claims .	6
fig1 displays a high level diagram of a basic prior art fsk receiver for binary fsk signals . in this system , the received waveform is processed for each of the possible transmitted sinusoids and metrics associated with each possibility are compared to make a data decision . the received waveform is processed in detectors 10 and 120 . in the binary system displayed only two sinusoids are possible , these corresponding to a “ 1 ” or a “ 0 ”. thus in the detector 110 , the signal is processed as a function of f 1 and guard time g , and in the detector 120 the signal is processed as a function of f 2 and g . in fig1 , f 1 is representative of the sinusoid communicating a “ 1 ” whereas f 2 represents the sinusoid communicating a “ 0 ”. the outputs of detectors 110 and 120 are supplied to a decision block 130 . the decision block 130 can implement a variety of known decision processes and logic such as viterbi decoding . while this description utilizes the well known non - coherent receive structure for fsk , embodiments of the invention are equally applicable to the more complicated coherent demodulator which includes a phase tracking function . fig2 displays the processing in each prior art non - coherent fsk processing block or detector 110 as shown in fig1 . the processing of detector 120 is accomplished in a similar manner . the non - coherent fsk receiver 100 will have one of these blocks ( detectors ) for each fsk tone or symbol utilized . in fig2 , the received waveform is multiplied by both the sin and cos of the hypothesized transmitted signal ( the waveform f 1 and f 2 representing “ 0 ” or “ 1 ”, or f m for m - ary signals where m = 1 − m ) by multipliers 112 and 111 respectfully . the output of each multiplier is integrated over the duration of the received symbol , from the end of the guard time g until the end of the symbol time t in integrators 113 and 114 . the output of the two integrators are squared in blocks 115 and 116 and summed in summer 117 to create a numerical metric or processed signal p 1 ( or p 2 for detector 120 ) that is used in the decision process . the integration in fig2 is nominally over the duration of the received symbol , from 0 to t . if the system is designed for operation in a multi - path distortion environment the lower limit of the integration is usually set to the expected level of multi - path distortion , identified as the guard time g , and typically between 2 – 4 ms . in fixed systems with repeatable multi - path distortion , experimentation can achieve a single optimal guard time , however in mobile systems or those in which multi - path distortions are not steady , a single optimal guard time is not available . an embodiment of the present invention is demonstrated in fig3 . the embodiment of fig3 implements several hypotheses of different degrees of multi - path distortion ( g or g n , where n is the number of different predetermined guard times and n = 1 to n ) for each possible transmitted frequency ( f m , where m is the number of possible symbols and m = 1 to m ). for example the lower limit of integration may be selected as 0 , 1 , 2 or 3 . 3 ms for a typical hf communication system . the number of different hypotheses m × n is not limited by this invention and may be other then those specifically described herein . the receiver 300 unitizes a plurality of detectors or processing units 310 , each processing the received signal as a function of f m and g n . fig3 is a representation of a binary fsk signal receiver with four hypotheses of multi - path distortion and two possible transmitted frequencies or symbols . group 311 are detectors 310 corresponding to the same possible waveform f 1 and differing guard time hypotheses g n and group 312 corresponds to detectors 310 with the sample possible waveform f2 and differing guard time hypotheses gn ( g 1 = 0 , g 2 = 1 , g 3 = 2 and g 4 = 3 . 3 ). detectors 311 d and 312 d form an integrator pair , all possible transmitted symbols f 1 and f 2 and a single guard time g 4 = 3 ms . embodiments of the invention will have similarly matched trios , foursomes , etc . according to the number of possible transmitted symbols or frequencies in a given communication system ) i . e ., a 4 - ary symbol signal will have an integrator group of 4 detectors representing all four possible symbols at the same guard time g k ). the output p mn from all of the different hypotheses is applied to a multi - path distortion estimation block 320 . here the values of p mn for each hypothesis are compared , possible distortions due to multi - path distortion are noted , and an estimate of the degree of multi - path distortion , g e , is generated . the estimate of g e may be updated at a rate at or lower than the symbol rate . this estimate is then utilized in a metric selector 325 to select the correct integrator pair p mk ( group or set ) for the degree of multi - path distortion on the communication channel ( where k is the corresponding n satisfying the relationship g n ≈ g e ). the estimate g e from the multi - path distortion estimation block 320 may be advantageously low pass filtered in the low pass filter 340 to track slow variations in multi - path profile , avoiding spurious signals while adapting the guard time during the reception of the signal &# 39 ; s symbols . the system and method described enable the signal to be processed with the most appropriate guard time for a changing or steady degree of multi - path distortion on the communication channel . fig4 displays the simulated performance of an embodiment of the invention for an additive white gaussian noise channel ( awgn ). an embodiment of the invention , identified as verb , achieves the same performance as a 0 ms guard time implementation at − 3 db snr and above . the 0 ms guard time is the optimal selection for the awgn channel which has no multi - path distortion . fig5 is a graph of the performance of the invention under a significant amount of multi - path distortion that is characterized by a multi - path spread of 2 ms . as shown in the graph , an embodiment of the present invention identified as verc achieves very close to the optimal 2 . 08 ms guard time performance . the implementation of embodiments of the present invention allow near optimal or optimal performance for a given multi - path environment over a range of multi - path environments . although embodiments described herein specifically address the hf radio propagation band , embodiments of the invention are equally applicable to all communication systems that utilize all variation and transmit orders of fsk , such as phase shift keying ( psk ), quaternary phase shift keying ( qpsk ), orthogonal frequency division multiplexing ( ofdm ) or other modulation schemes in which the symbol duration is significantly greater than the expected multipath delay , and all radio frequency bands which can experience multi - path distortion or fading , including vhf , uhf mobile radio channels , cell phones etc . while preferred embodiments of the present invention have been described , it is to be understood that the embodiments described are illustrative only and that the scope of the invention is to be defined solely by the appended claims when accorded a full range of equivalence , many variations and modifications naturally occurring to those of skill in the art from a perusal hereof .	7
a first embodiment of an anti - rotation magnet carrier / anti - rotation plate assembly or device or combination 25 in accordance with the present invention is shown in fig1 - 3 which comprises an anti - rotation disc or plate 27 and a magnet carrier 29 . anti - rotation disc or plate 27 has a circular solid base 28 , an outer circumferentially extending peripheral edge 31 , a central through - hole or aperture 33 , and a plurality of tabs or fingers 35 and 37 projecting outwardly and upwardly away from the peripheral edge 31 and extending around the base 28 in a spaced - apart , equidistant , and alternating relationship . anti - rotation disc or plate 27 can be stamped from sheet metal . the tabs or fingers 35 are wider and shorter than the tabs or fingers 37 . magnet carrier 29 has a generally circular base 41 with a circumferentially extending outer peripheral edge 43 ; a vertical , hollow magnet tube or housing 45 extending generally normally upwardly from a central portion of the base 41 ; and a plurality of receptacles in the form of recesses , grooves , notches , or slots 47 which are formed in the peripheral edge 43 and extend around the base 41 in a spaced - apart , equidistant relationship . magnet carrier 29 may be made from any suitable thermoplastic material . as shown in fig1 , anti - rotation disc or plate 27 is seated flat against the base plate 80 of a cup 82 located in the interior of linear position sensor 10 in a relationship wherein the central aperture 33 in anti - rotation plate 27 is in alignment with a central aperture 85 defined in the base plate 80 of cup 82 of linear position sensor 10 . linear position sensor 10 additionally comprises an elongate , generally cylindrically - shaped shaft 84 which extends through the aligned apertures 33 and 85 in the plate 27 and base 80 respectively . the shaft 84 includes a head 86 having a width greater than the diameter of the shaft 84 and a circumferential recess or groove defined in the outer surface on the shaft 84 below the head 86 which defines a shoulder 90 spaced from the head 86 . the anti - rotation plate 27 and base 80 together with a portion of a membrane 87 located below the base 80 and another plate 89 located below the membrane 87 are sandwiched between the head 86 and the shoulder 90 of shaft 84 to clamp the plate 27 to the base 80 of the cup 82 and keep the plate 27 from moving or rotating relative to the cup 82 . as shown in fig1 and 2 , magnet carrier 29 is seated over the anti - rotation plate 27 in a relationship wherein the lower face of the base 41 of magnet carrier 29 is seated in abutting relationship against the upper face of the base 28 of anti - rotation plate 27 ; the peripheral edge 43 of the base 41 of magnet carrier 29 is abutted against the interior face of each of the tabs 35 on the base 28 of anti - rotation plate 27 ; and fingers 37 are aligned with the notches 47 . the fingers 37 are bent inwardly from their fig3 positions to their crimped fig1 and 2 positions in which the fingers 37 are located in the respective notches 47 and abutted against surface 41 of magnet carrier 29 to prevent the magnet carrier 29 from rotating relative to the plate 27 which , in turn , prevents the magnet 100 ( fig1 ) in magnet carrier 29 from rotating relative to the sensor 102 ( fig1 ) outside of allowable variations of rotational movement to eliminate the risk of unacceptable deviations in the signal generated by the sensor 102 . this , of course , is important inasmuch as any deviations in the rotational movement of magnet 100 from the magnet &# 39 ; s original programmed state can induce undesired magnetic field variations and cause incorrect signal outputs . another embodiment of anti - rotation assembly 125 in accordance with the present invention is shown in fig4 - 6 . anti - rotation assembly 125 comprises an anti - rotation disc or plate 127 and a magnet carrier 129 . anti - rotation disc or plate 127 has a circular solid base or plate 128 , an outer circumferentially extending edge 131 , a central aperture 133 , and a plurality of tabs 137 projecting outwardly and upwardly from the edge 131 of plate 127 and extending around the base 128 in equidistant , spaced - apart relationship . the base 128 additionally defines a plurality of interior spaced - apart , equidistant , generally u - shaped slots 130 defining a plurality of circumferentially extending interior raised pre - stressed prongs , tabs , or fingers 132 . anti - rotation disc or plate 129 can be stamped from sheet metal . magnet carrier 129 , which may be made from any suitable thermoplastic material , includes a generally circular base 141 having an outer circumferentially extending peripheral edge 143 and a central generally cylindrical , hollow magnet tube or housing 145 extending upwardly from the center of the base 141 . as shown in fig5 , anti - rotation disc or plate 127 is seated on the base 80 of the cup 82 in the interior of linear position sensor 10 and the shaft 84 secures the plate 127 against rotational movement relative to the base 80 in the same manner as the plate 27 of anti - rotation assembly 25 , and thus the earlier description with reference to the attachment of the plate 27 of assembly 25 to the base 80 is incorporated herein by reference . as shown in fig4 and 5 , the bottom face or surface of the base 141 of magnet carrier 129 is seated against the upper face or surface of the base 128 of plate 127 in a relationship wherein the prongs 132 in the base 128 of plate 127 abut against the bottom surface of the base 141 of magnet carrier 129 . tabs 137 on the base 141 of magnet carrier 129 are bent and crimped inwardly into abutting relationship with the top face or surface of the base 141 to secure the base 141 and thus the magnet carrier 129 to the plate 127 , thus preventing the rotation of the magnet carrier 129 relative to the plate 127 and the rotation of magnet 100 ( fig1 ) relative to the sensor 102 ( fig1 ) outside of allowable variations in rotational movement to eliminate the risk of undesired magnetic field measurements and incorrect sensor signal outputs . according to this embodiment , the crimp force exerted by the tabs 137 on the base 141 exerts a downward force against the base 141 which , in turn , causes the raised pre - stressed prongs or tabs 137 on plate 127 to flatten out . the pre - stress prongs 137 , however , are also adapted to flex with the thermoplastic material of the base 141 as a result of thermal exposure to reduce the effects of creep and eliminate the rotation of the magnet carrier 129 . another embodiment of an anti - rotation assembly 225 in accordance with the present invention is shown in fig7 - 9 . anti - rotation assembly 225 comprises an anti - rotation disc or plate 227 and a magnet carrier 229 . anti - rotation disc or plate 227 has a circular base 228 , an outer circumferential peripheral edge 231 , a central aperture 233 , and a plurality of prongs 237 extending outwardly and generally normally upwardly from the peripheral edge 231 . in the embodiment shown , prongs 237 extend around the base 228 in an equidistant , spaced - apart relationship . each of the prongs 237 has a pair of sharp points 238 that extend generally normally inwardly from opposed sides of each of the prongs 237 . anti - rotation disc or plate 227 may be stamped from sheet metal . magnet carrier 229 , which may be made from any suitable thermoplastic material , has a generally circular base 241 with an outer circumferentially extending peripheral edge 243 ; a vertical , cylindrical , hollow magnet or housing tube 245 extending generally upwardly from a central portion of the top surface or face of the base 241 ; and an annular circumferentially extending interior receptacle in the form of a slot 244 formed and extending into the bottom surface or face of base 241 . as shown in fig7 , the plate 227 of anti - rotation assembly 225 is seated on the base 80 of the cup 82 in linear position sensor 10 and is rigidly connected to the shaft 84 of linear position sensor 10 in the same manner as the plate 27 of anti - rotation assembly 25 and thus the earlier description with reference to assembly 25 is incorporated herein by reference . as shown in fig7 and 9 , the bottom face or surface of the base 241 of magnet carrier 229 is seated against the upper face or surface of the base 228 of the plate 227 in a relationship wherein the prongs 237 on plate 227 are aligned with and extend into respective portions of the slot 244 in the bottom face or surface of the base 241 of magnet carrier 229 . the sharp points 238 on each of the prongs 237 have a length which is greater than the width of the slot 244 so that the points 238 wedge into the material of the base 241 upon insertion of the prongs 237 in base 241 to secure the magnet carrier 229 to the plate 227 and prevent the rotation of the magnet carrier 229 relative to the plate 227 which , in turn , prevents the rotation of the magnet 100 ( fig1 ) relative to the sensor 102 ( fig1 ) outside of allowable variations in rotational movement to eliminate the risk of undesired magnetic field measurements and incorrect sensor signal outputs . fig1 - 12 depict a further embodiment of an anti - rotation assembly 325 in accordance with the present invention which comprises an anti - rotation disc or plate 327 and a magnet carrier 329 . anti - rotation disc or plate 327 has a circular base 328 , an outer peripheral circumferential edge 331 , a central aperture 333 , and a plurality of fingers 337 projecting outwardly and generally normally upwardly from the peripheral edge 331 and extending around the base 328 in an equidistant , spaced - apart relationship . anti - rotation disc or plate 327 may be stamped from sheet metal . magnet carrier 329 , which may be made from any suitable thermoplastic material has a generally circular base 341 with an outer peripheral circumferential edge 343 ; a vertical , hollow , cylindrical magnet tube or housing 345 extending normally upwardly from the center of the top surface of the base 341 ; at least one receptacle in the form of a recess , groove , notch , or slot 344 formed in the peripheral edge 343 of base 341 ; and a plurality of interior receptacles in the form of through - holes or openings 346 defined in the base 341 and extending between the top and bottom surfaces thereof . through - holes 346 extend around the base 341 in an equidistant , spaced - apart relationship . as shown in fig1 , anti - rotation disc or plate 327 is seated on the base 80 of the cup 82 in linear position sensor 10 and the shaft 84 of linear position sensor 10 couples and secures the plate 327 to the cup 82 in the same manner as described earlier with respect to the plate 27 of anti - rotation assembly 25 , and thus the earlier description with reference to plate 27 is incorporated herein by reference . as shown in fig1 and 11 , magnet carrier 329 is located and seated in the interior of the cup 82 of linear position sensor 10 in a relationship wherein the bottom face or surface of the base 341 of magnet carrier 329 is seated against the upper face or surface of the base 328 of the plate 327 in a relationship wherein the fingers 337 on plate 327 are aligned with and extend through respective ones of the through - holes 346 defined in the base 329 of magnet carrier 341 to prevent the rotation of the magnet carrier 329 relative to the plate 327 and thus prevent the rotation of magnet 100 ( fig1 ) relative to the sensor 102 ( fig1 ) outside of allowable variations in rotational measurement to eliminate the risk of undesired magnetic field measurements and incorrect sensor signal outputs . as also shown in fig1 - 12 , linear position sensor 10 additionally comprises an annular outer ring 390 including a tab 392 which extends generally normally outwardly and downwardly from an interior peripheral circumferential edge 394 of ring 390 . ring 390 is seated in the cup 82 of linear position sensor 10 in a relationship surrounding and abutting against the top surface of the peripheral circumferential edge 343 of the base 341 of magnet carrier 329 with the tab 392 seated in the groove 344 defined in the edge 342 of the base 341 of magnet carrier 329 to prevent the rotation of the ring 390 relative to the magnet carrier 329 and the cup 82 . fig1 - 15 depict yet a further embodiment of an anti - rotation assembly 425 in accordance with the present invention which comprises an anti - rotation disc or plate 427 and a magnet carrier 429 . anti - rotation disc or plate 427 has a circular base 428 , an outer peripheral circumferential edge 431 , a central aperture 433 , a plurality of crimp tabs 437 projecting outwardly and upwardly from the peripheral edge 431 , and a plurality of elongate legs 439 also extending outwardly from the peripheral edge 431 . the fingers 437 and legs 439 extend around the base 428 in a spaced - apart and alternating equidistant relationship . the tabs 437 are shown in fig1 in their uncrimped position and orientation generally normal to the base 428 of plate 427 . the legs 439 extend outwardly from the peripheral edge 431 of plate 427 in a relationship generally co - planar with the base 429 . each of the legs 439 includes a distal upturned ear 440 extending generally normally upwardly from the distal end of each of the legs 439 . magnet carrier 429 has a generally circular base 441 with an outer peripheral circumferential edge 443 , and a vertical , hollow , cylindrical magnet tube or housing 445 extending generally normally upwardly from the center of the base 441 . as shown in fig1 , the plate 427 is seated and secured to the base 80 of the cup 82 in the interior of linear position sensor 10 and the shaft 84 couples and secures the plate 427 to the cup 82 in the same manner as described earlier with respect to the plate 27 of anti - rotation assembly 25 and thus the earlier description with reference to the plate 27 and assembly 25 is incorporated herein by reference . as additionally shown in fig1 , the exterior face of each of the ears 440 of the legs 439 of the plate 427 is positioned in abutting relationship with and against the interior face of one of the coils 497 of helical spring 495 which is also located in the interior of the linear position sensor 10 and seated on the base 80 of the cup 82 in linear position sensor 10 to provide for the concentric positioning and compression of the spring 495 in linear position sensor 10 and eliminate the risk of collision and controlling axial force compression in the interior of linear position sensor 10 . as shown in fig1 , magnet carrier 429 is located and seated in the interior of linear position sensor 10 in a relationship wherein the lower face or surface of the base 441 of magnet carrier 429 is seated against the upper face or surface of the base 428 of plate 427 ; the tube 445 is co - linearly aligned with the shaft 84 ; and the peripheral edge 443 of the base 441 of magnet carrier 429 is abutted against the inside face of respective crimp tabs 437 on plate 427 . the tabs 437 are bent inwardly and crimped into abutting relationship with the top surface or face of the base 429 of magnet carrier 429 to secure the magnet carrier 429 to the plate 427 , thus preventing the rotation of the magnet carrier 429 and the rotation of the magnet 100 ( fig1 ) relative to the sensor 102 ( fig1 ) outside of allowable variations in rotational movement to eliminate the risk of undesired magnetic field and signal variations as described above . although not shown in any of the figures , it is understood that a compression o - ring may be sandwiched between the lower surface of the base 441 of the magnet carrier 429 and the upper surface of the base 428 of the plate 427 to enhance the crimp action and connection between the plate 427 and magnet carrier 429 . fig1 and 17 depict an anti - rotation assembly 525 in accordance with the present invention which comprises a magnet carrier 529 and an anti - rotation magnet 590 . magnet carrier 529 has a generally circular base 541 with an outer peripheral circumferential edge 543 and a vertical , hollow , cylindrical magnet tube or housing 545 extending generally normally upwardly from the center of the base 541 . in the embodiment of fig1 and 17 , the peripheral edge 543 of magnet carrier 529 additionally includes a pair of diametrically opposed straight segments 593 and 595 defining a pair of keying features for automated feeding of the magnet carrier 529 during assembly . tube 545 includes an interior cylindrical surface 544 having a key defined by an elongate projection or bump 546 protruding outwardly therefrom and extending the length of the tube 545 in an orientation generally normal to the base 541 . the interior cylindrical surface 544 of the tube 545 additionally includes a plurality of elongate , spaced - apart , parallel crush ribs 548 projecting outwardly therefrom and extending around the circumference of the interior surface 544 in a relationship spaced from and parallel to the elongate key 546 . the magnet 590 is in the form of an elongate solid cylinder which includes respective top and bottom surfaces 592 and 594 and a side exterior longitudinal surface 596 having an elongate groove or recess 598 defined therein and extending generally between the top and bottom surfaces 592 and 594 . as shown in fig1 , magnet 590 is slid into and secured in the interior of the tube 545 in a relationship wherein the key 546 in tube 545 is aligned with and extends and protrudes into the groove 598 . the diameter of the tube 545 and the diameter of magnet 590 are such that the ribs 548 in the tube 545 are crushed when magnet 590 is slid into the tube 545 , thus providing for a friction fit between magnet 590 and tube 545 . the combination of the key 546 in tube 545 and groove 598 in magnet 590 eliminates the risk of any rotation of the magnet 590 relative to the tube 545 outside of allowable variations of rotational movement to eliminate the risk of undesired magnetic field measurements and thus incorrect signal variations as described above . fig1 and 19 depict another anti - rotation assembly 625 in accordance with the present invention which comprises a magnet carrier 629 and an anti - rotation magnet 690 . magnet carrier 629 has a generally circular base 641 with an outer peripheral circumferential edge 643 and a vertical , hollow , cylindrical magnet tube or housing 645 extending generally normally upwardly from the center of the base 641 . tube 645 includes an interior cylindrical surface 644 and an interior lower or bottom horizontal base or surface 648 with a key defined by a projection or bump 646 protruding outwardly therefrom . magnet 690 is in the form of an elongate solid cylinder which includes respective top and bottom surfaces 692 and 694 and a side exterior longitudinal surface 696 . each of the top and bottom surfaces 692 and 694 includes an elongate groove 697 and 698 formed therein . as shown in fig1 , magnet 690 is slid into and secured in the interior of tube 645 in a relationship wherein the bottom surface 694 of magnet 690 is abutted against the bottom interior surface or base 648 of the tube 645 and the key 646 extends and protrudes into the groove 698 defined in the bottom surface 694 of magnet 690 . as shown in fig1 , the magnet carrier 629 and , more specifically , the tube 645 thereof includes a plurality of prongs 672 extending outwardly and inwardly from a top peripheral edge 674 thereof . two of the prongs 672 are opposed to each other and are positioned and extend into the groove 697 formed in the top surface 692 of the magnet 690 . thus , according to the invention , the use of a key 646 / groove 698 combination and prong 672 / groove 697 combination eliminates the risk of rotation of the magnet 690 relative to the tube 645 outside of allowable rotational variations to again eliminate the risk of undesired magnetic field and signal variations as described above . while the invention has been taught with specific reference to the embodiments shown , it is understood that a person of ordinary skill in the art will recognize that changes can be made in form and detail without departing from the spirit and the scope of the invention . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope .	6
now referring to fig2 , a building block of the present invention may be seen . the circuit shown shall be referred to herein as an xp 1 loop comprising four bipolar transistors of the same conductivity type , namely in this embodiment , npn transistors qn 1 , qn 2 , qn 3 and qn 4 . in a preferred embodiment , transistors qn 1 and qn 2 are matched transistors , each having an emitter area a , with transistors qn 3 and qn 4 also being matched transistors each having an emitter area na , i . e ., each having an emitter area that is n times the emitter area of each of transistors qn 1 and qn 2 . in the circuit shown , a current ib is applied to the collector and base of transistor qn 3 , which passes through transistor qn 1 and through r 2 . the voltage across resistor r 2 is labeled vin for reasons which will subsequently become apparent . also a voltage vb is applied to the collector of transistor qn 2 , which provides current through transistors qn 2 and qn 4 and resistor r 3 . fig2 shows the common connection of the emitter of transistor qn 3 and the collector of qn 1 is connected to the base of transistor qn 4 , and the common connection of the emitter of transistor qn 2 and the collector of transistor qn 4 is connected to the base of transistor qn 1 . with the connections shown in fig2 , starting at voltage vin , the voltage of node 1 is equal to the voltage vin plus the base emitter voltage of transistor qn 1 plus the base emitter voltage of transistor qn 2 , with the voltage vout being equal to the voltage at node 1 minus the base emitter voltage of transistor qn 3 minus the base emitter voltage of transistor qn 4 . thus in equation form , the output voltage vout can be written as follows : vout = vin + ( vbe qn1 − vbe qn3 )+( vbe qn2 − vbe qn4 ) vout = vin + 2 δvbe assuming for the moment that the base currents in the four transistors qn 1 - qn 4 are relatively negligible , the voltage term vbe qn1 - vbe qn3 represents the difference in base emitter voltages ( δvbe ) between two transistors operating with the same collector current ( ib ), but with different current densities because of their different emitter areas . similarly , the voltage term vbe qn2 - vbe qn4 also represents the difference in base emitter voltages ( δvbe ) between two transistors operating with the same collector current , but with different current densities because of their different emitter areas . assuming the emitter area ratio n is the same for transistors qn 2 and qn 4 and for transistors qn 1 and qn 3 , vout can be expressed as : t = absolute temperature k = boltzmann constant q = the electrical charge on an electron thus each of these avbe voltages is a ptat voltage suitable for use as a piat voltage in a bandgap reference . in particular , assume for the moment that r 2 is zero so that vin is at ground potential . the voltage vout will be a ptat voltage 2δvbe increments above ground potential . the circuit of fig2 may be cascaded with additional xp 1 ptat voltage circuits , also in accordance with fig2 , as shown in fig3 . as shown therein , the output vout ( fig2 ) for the first xp 1 loop forms what will be the input voltage vin for the second xp 1 loop , with the 2δvbe voltage generated by the second xp 1 loop being added to the 2δvbe ptat voltage generated by the first xp 1 circuit . thus in the circuit of fig3 , the output voltage of the first xp 1 loop will be equal to the ptat voltage 2δvbe . the current through r 2 , namely the desired current through transistors qn 2 and qn 4 of the first xp 1 loop plus the bias current ib through the transistors qn 3 and qn 1 of the second xp 1 loop , will be equal to the ptat voltage 2δvbe divided by the resistance of resistor r 2 . thus resistor r 2 acts as a current source equal to 2δvbe / r 2 , and resistors r 3 and r 4 , and corresponding resistors in other embodiments described herein , act as current sources , and may be replaced by active current sources if desired . similarly , current is pulled from the voltage source vb , in that the current supplied by each connection to vb is the current required to provide the ptat voltage drop across the respective resistor ( or current for the current source used in place of the respective resistor ) connected to the respective emitter of transistor qn 4 . in that regard , in the preferred embodiment , all xp 1 loops have the same bias current , with the currents through transistors qn 2 and qn 4 equal to the currents through transistors qn 3 and qn 1 , in a preferred embodiment both currents being on the order of 4 microamps . note that any noise on the voltage vb or in the bias current ib does not substantially change the ptat voltages generated or their temperature sensitivity , as the ptat voltages are only sensitive to the difference in current densities in the two series connected pairs of transistors , and is essentially independent of the magnitude of the current ( ib ) itself . these small current variations have little effect on the cumulative ptat voltage vout that is obtained by cascading xp 1 loops as shown in fig3 . thus the ptat voltage vout of fig3 is substantially immune to noise in the bias currents ib of the cascaded xp 1 loops due to the cross coupled nature of each xp 1 loop . consequently , substantially the only noise on the output voltages vout is the noise generated within the four transistor xp 1 circuits themselves . since this noise is not correlated between xp 1 loops , the output noise vout of the final xp 1 loop in a cascaded series of xp 1 circuits is equal to the square root of the sum of the squares of the noise in each xp 1 loop , not the noise of one xp 1 loop times the number of xp 1 loops cascaded . thus not only is each xp 1 loop substantially immune to the bias current noise , but the noise in one xp 1 loop does not linearly add like the ptat avbe voltage itself does when multiple loops are cascaded . now referring to fig3 again , three cascaded xp 1 loops are shown . in the first loop , the emitter of transistor qn 1 is connected to ground so that the emitter of transistor qn 4 will be at a voltage of 2δvbe above ground . since this voltage is essentially clamped by the first xp 1 loop , the value of resistor r 2 will determine the current through transistors qn 2 and qn 4 . in particular , assuming the same currents are desired through transistors qn 2 and qn 4 as through transistors qn 3 and qn 1 so that each xp 1 loop is to have the same current bias , resistor r 2 would be selected to conduct twice that current bias , i . e . the current through transistors qn 2 and qn 4 of the first xp 1 loop plus the current though transistors qn 3 and qn 1 of the second xp 1 loop ( 2 ib ), with a voltage across resistor r 2 of 2δvbe . the same considerations apply to determining the value of resistor r 3 , although that resistor will nominally be twice the value of resistor r 2 , as the voltage on the emitter of transistor qn 4 will be 4δvbe , i . e ., twice the voltage on the emitter of transistor qn 4 in the first xp 1 loop . similarly , vout will be 6δvbe , with resistor r 4 being selected to conduct a bias current approximately equal to ib , plus whatever current is required by the circuit connected to vout . thus there is a progression in resistor values tending to equalize the currents through transistors qn 2 and qn 4 of all xp 1 loops . in these xp 1 loops , the r 1 , c 1 circuits are optional . again , since the 2δvbe ( at r 2 ), 4δvbe ( at r 4 ) and 6δvbe ( at r 5 ) voltages are ptat voltages and thus vary with temperature . now referring to fig4 - 1 and 4 - 2 , an overall diagram showing a bandgap reference using cascaded xp 1 loops in accordance with fig3 may be seen . in these figures and in other figures to be described , the signal en is a conventional enable signal . in the embodiment of fig4 - 1 and 4 - 2 , a low noise bias current generator 20 provides a bias current to low noise buffered current mirrors 22 , which in turn provide the bias currents ib to each of the xp 1 loops , specifically loop 1 , loop 2 and loop 3 . similarly , a bias voltage generator 24 generates the bias voltage vb that is applied to each of the xp 1 loops . in that regard , the bias voltage vb is applied through resistors r 6 and r 7 to xp 1 loops 1 and 2 , respectively . in particular , note that the emitter of transistor q 1 in loop 1 is at a circuit ground potential , the emitter of transistor qn 1 of xp 1 loop 2 is at a potential of 2δvbe ( approximately 200 mv in the exemplary embodiment ) and the voltage of the emitter of transistor qn 1 in the third xp 1 loop is at 4δvbe ( approximately 400 mv ). thus resistors r 6 and r 7 are provided in a progression of values to provide a voltage drop of 4δvbe and 2δvbe , respectively , so that the collector - base voltage of transistors qn 2 in all three loops are equal to zero . these resistors are optional , and not shown in the embodiment of fig6 - 1 , 6 - 2 and 6 - 3 . also connected to the bias voltage generator 24 and one of the current outputs of the buffered current mirrors 22 is a summing amplifier 26 . this amplifier is referred to herein as a summing amplifier , as the output thereof is the sum of the 6δvbe output of xp 1 loop 3 plus the vbe of a bipolar transistor in the summing amplifier itself . the summing amplifier is shown in detail in fig5 . this amplifier uses four transistors q 5 through q 8 , of the same conductivity type and connected the same as the transistors in one of the xp 1 loops . however , in the summing amplifier of fig5 , all transistors preferably have the same emitter area . the output out of the amplifier is coupled through resistor r 5 to ground , as shown in fig4 - 1 , with the input in being coupled to resistor r 4 and the output out of xp 1 loop 3 , also as shown in fig4 - 1 . as may be seen in fig5 , the output bg is 1vbe above the input in , specifically , the base emitter voltage ( vbe ) of transistor qn 5 . the input in , of course , is the accumulated ptat voltage 6δvbe . in a preferred embodiment each δvbe is approximately 100 millivolts , so that at least nominally the sum of the 6δvbe ( approximately 600 mv ) on the input in plus the base emitter voltage of transistor q 5 ( approximately 600 mv ) provides the nominal bandgap output voltage of 1 . 2 volts at bg . as may be seen in fig4 - 1 and 4 - 2 , the nominal bandgap voltage bg output of the summing amplifier 26 is coupled to a trim network 28 , which may be of conventional design . in the preferred embodiment , the actual trim network is a trim network capable of providing both positive and negative trim increments to the bandgap voltage for calibration purposes . those trim increments , controlled by the 8 bit input bgt [ 7 : 0 ], are ptat trim voltage increments to make up for ratio deviations in the components of the xp 1 loops based on the accumulated ptat voltage input , as shown . in that regard , assuming that the only significant temperature variations in the bandgap voltage are caused by the negative temperature coefficient of an emitter base ( e - b ) junction and the positive temperature coefficient δvbe of pairs transistors operating with different current densities . whatever the base emitter voltage is of transistor qn 5 of fig5 , a substantially temperature insensitive bandgap voltage will be achieved if a ptat voltage is added thereto to provide a sum equal to the actual bandgap voltage ( for silicon − 1 . 23 volts ). while the trim network used in the preferred embodiment uses digital ptat trim voltages increments in both positive and negative directions , the xp 1 loops could be nominally set to provide a ptat voltage component somewhat below ( or above ) the desired value , with the trim network adjusting that ptat voltage component up ( or down ) for calibration purposes , or as a further alternative , an analog trim network could be used , again with either positive and negative trimming capabilities , or alternatively , with the ability to either increase or decrease the incremental calibration in a unidirectional manner . the output of the trim network 28 ( fig4 - 2 ), which is the bandgap voltage , goes through a resistor network of resistors r 8 though r 11 to provide an input to a transconductance operational amplifier 30 ( alternatively a regular operational amplifier may be used ). the desired bandgap reference voltage ( 1 . 23 volts ) appears at the top of resistor r 15 . therefore the output voltage ref appears at the output of the transconductance operational amplifier . feedback for the transconductance amplifier is provided by resistor network comprising resistors r 12 through r 16 . resistors r 12 through r 14 are of the same value as resistors r 8 through r 10 , respectively , with the nominal combination of resistors r 15 and r 16 being the same value as resistor r 11 . in the exemplary embodiment being explained , the two resistor networks shown in fig4 - 2 provide a selection of outputs set during fabrication by appropriate masking . in particular , with a bandgap voltage of 1 . 23 volts out of the trim network 28 , the first resistor network will provide that voltage to the positive input to the transconductance operational amplifier 30 . the negative input through resistor r 17 is taken from the node between resistors r 14 and r 15 . the transconductance operational amplifier provides an output ref which provides the current through resistors r 12 , r 13 and r 14 . more importantly , through resistors r 12 and r 16 to provide the negative feedback voltage equal to the bandgap voltage provided to the positive transconductance amplifier input . in the exemplary embodiment , resistors r 12 through r 16 are selected such that with the configuration shown in fig4 - 2 , the feedback of 1 . 23 volts provides an output voltage ref of 2 . 048 volts . if , on the other hand , resistors r 8 and r 12 are effectively shorted out during fabrication ( by masking or otherwise ), the transconductance amplifier 30 will readjust the output ref to again provide a feedback of 1 . 23 volts , in the exemplary embodiment readjusting the output ref to 1 . 8 volts . shorting out resistors r 8 , r 9 , r 12 and r 13 in the exemplary embodiment provides an output of 1 . 25 volts . and finally , shorting out resistors r 8 through r 10 and r 12 through r 14 will provide the basic bandgap voltage output of 1 . 23 volts . resistor r 16 is a variable resistor that acts as the gain trim . in that regard , the resistor network r 8 through r 11 is provided to adjust the resistance coupled to the positive input of the transconductance amplifier 30 to match the resistance to the negative input of the transconductance amplifier from resistor network r 12 through r 16 . as an alternative , rather than use a variable resistor ( r 16 ) in the output resistor network , after the ptat voltage component in the output of summing amplifier 26 ( fig4 - 1 ) has been trimmed , one can use a separate additional trim circuit ( as part of the trim block 28 — fig4 - 2 ) to add ( or subtract ) a temperature insensitive voltage component to what would have been the output of the trim block 28 . in one embodiment , these trims are done by providing a voltage component to the output of the summing amplifier 26 by pushing a current into one end of a series resistor and drawing an equal current out of the other end of the series resistor . as before these trims may be preferably bidirectional digital trims , but could be unidirectional or analog trims . referring again to fig4 - 2 , the output ref may be increased above 2 . 048 volts to even higher voltages by simply increasing the total resistances of resistors r 12 through r 14 and r 8 through r 10 relative to the sum of resistors r 15 and r 16 . however , doing so , at least by very much , has the disadvantage of simply multiplying ( gaining up ) the noise on the 1 . 23 volt bandgap voltage generated . instead , it is more desirable to create a bandgap reference that generates two times the bandgap , specifically 2 . 46 volts , using the present invention . such a circuit is shown in fig6 - 1 , 6 - 2 and 6 - 3 . in the circuit of fig6 ( fig6 - 1 , 6 - 2 and 6 - 3 ), a low noise bias current generator 20 and low noise voltage bias generator 24 , which may be identical to those used in fig4 - 1 , together with the buffered current mirrors 22 provide the required current and voltage biases to the six xp 1 loops used . this provides a total of 12δvbe output to the summing amplifier 26 , which again may be the same as that used in the embodiment of fig4 - 1 and 4 - 2 . in that regard , note that summing amplifier 26 adds 1vbe to the total ptat voltage component , to which another vbe must be added to obtain a voltage equal to twice the bandgap voltage . to achieve this , another transistor might be added to the summing amplifier 26 so that 2vbe is added to the 12δvbe of the six xp 1 loops . this is undesirable as it adds to the minimum power supply voltage required to provide the headroom required to operate the entire circuit . accordingly , as a preferred alternative , transistor qn 9 ( fig6 - 3 ) is added . the second vbe will be the base emitter voltage of transistor qn 9 . since the transconductance amplifier is effectively an operational amplifier , its output will seek a level such that its negative input is equal to its positive input of approximately a ptat voltage of 1 . 2 volts plus approximately 0 . 6 volt of the negative temperature coefficient term ( vbe term added by the summing amplifier 26 ). consequently the voltage at node 2 will be will be one vbe higher than the feedback voltage at inm and thus one vbe higher than the positive input to the transconductance amplifier , or approximately 1 . 2 volts ( 2vbe ) plus approximately 1 . 2 volts of ptat voltage for a total voltage of 2 . 4v ( 2 bandgap voltages will now be at node 2 ). in one embodiment , the resistor networks , similar to those of fig4 - 2 , are selected to provide outputs of 5 . 00 volts , 4 . 5 volts , 4 . 096 volts , 3 . 30 volts , 3 . 00 volts , 2 . 5 volts and the twice bandgap voltage ( 2bg ) of 2 . 46 volts . as before , trimming may be by way of the variable resistor on the output resistor network as shown , or as part of the trim block as previously explained with respect to fig4 - 1 and 4 - 2 . it should be noted that the embodiments disclosed herein use low noise current sources and a low noise voltage source to bias the xp 1 loops . this is , in effect , an embellishment as opposed to a necessity in that because the xp 1 loops are substantially immune to noise in their biasing currents , a relatively low noise bandgap reference ( compared to the prior art ) would still be provided without the use of such low noise current and voltage sources . similarly , the resistors r 1 and capacitors c 1 in each xp 1 loop are also optional , but are desirable to provide frequency compensation and prevent peaking in the xp 1 loop . in a preferred embodiment the low noise bias current source 20 , the current mirrors 22 and the bias voltage generator 24 , as well as the six xp 1 loops of the embodiment of fig6 - 1 through 6 - 3 for the 2bg reference are also used for the 1bg reference of fig4 - 1 and 4 - 2 . in that regard , it may be seen in fig4 - 1 that three of the current mirror outputs are merely coupled to ground for the 1bg reference , whereas in fig6 - 1 those same three current mirrors are used to bias the three additional xp 1 loops for the 2bg reference . thus the same chip may be used for both references as determined by specific masking during the fabrication process . the key , of course , to the low noise characteristics of the present invention is based primarily on the xp 1 loops themselves , each of which is relatively low noise and substantially immune to noise in its biasing current ib . thus the noise of the cascaded loops is not additive , but rather only accumulates as the square root of the sum of the squares of the noise of each transistor in each of the xp 1 loops . while the ptat output voltage of the first xp 1 loop has relatively low noise , the ptat output voltage of the second cascaded xp 1 loop will have twice the ptat output voltage of the first xp 1 loop , but will have a noise of only √{ square root over ( 2 )} times the noise voltage signal to noise ratio . therefore the signal to noise ratio ( s / n ) is improved by √{ square root over ( 5 )}. in fig4 - 1 , resistors r 2 through r 5 actually serve as passive current sources ( the words “ current sources ” are used generically herein to include current sinks ). similarly , the corresponding resistors in fig6 - 1 and 6 - 2 serve as passive current sources . as an alternative , active current sources may be used for some or all of these resistors . this is illustrated in fig7 - 1 , and fig8 - 1 and 8 - 2 . fig7 - 2 and 8 - 3 are merely repeats of fig4 - 2 and 6 - 3 , but are provided for completeness of these illustrations . use of active current sources is not preferred however , as simulations indicate that active current sources increase noise in the references , and that the head room for the bipolar current source for the first xp 1 loop in a cascaded series of xp 1 loops may be marginal . in a most general sense , each of the cascaded xp 1 loops is comprised of four e - b junctions physically connected in first and second pairs so that bias currents flow through each pair , but electrically cross coupled so that the voltage from an end or output of the first pair of the e - b junctions to an end or output of the second pair of e - b junctions is equal to the voltage drop across a first e - b junction in the first pair of e - b junctions plus the voltage drop across a second e - b junction in the second pair of e - b junctions , minus the sum of the voltage drop across a third e - b junction in the first pair of e - b junctions and the voltage drop across a fourth e - b junction in the second pair of e - b junctions . in the embodiments of cascaded xpl loops disclosed so far , four transistors have been cross coupled , with one ( qn 3 ) being diode connected and another ( qn 4 ) being preferably operated with a zero collector base voltage . however , qn 2 and qn 3 could be diode connected transistors , as shown in fig9 . here , rather than biasing qn 2 with a voltage , the bias current to the now two diode connected transistors is increased to provide the bias current ib to each side of the xp 1 loops , as shown in fig9 . with this change , fig4 - 1 and 4 - 2 become fig1 - 1 and 10 - 2 , and fig6 - 1 through 6 - 3 become fig1 - 1 through 11 - 3 . in that regard , any mismatch in current sources between the top and bottom of the xp 1 circuits will merely accumulate and pass to the ends of the cascaded loops , or at least pass to the side of the first cascaded xp 1 loop that is connected to the circuit ground . note that the biasing of the summing amplifier is preferably not changed so as to be able to better drive the trim circuit coupled thereto . also in the embodiments described , the summing amplifier is a circuit like an xp 1 loop as shown in fig1 - 1 , but simply generates a ctat voltage ( vbe ) component by adding the base emitter voltage of transistor qn 5 to the total ptat voltage component of the cascaded xp 1 loops . as an alternative , by way of example , the common connection between the emitter of the transistor qn 2 , the base of transistor qn 1 and the collector of transistor qn 4 of the last ptat voltage component generating xp 1 loop may be also be used as the sum of the ptat voltage components and the vbe of transistor qn 1 of the last cascaded xp 1 loop . thus in this alternative , the so called summing amplifier may have the e - b junction area ratios as the other xp 1 loops . however , the ptat voltage component generated by such a loop will not be added to the total ptat voltage output of the cascaded loops , as the common connection merely adds the vbe of transistor qn 1 to the total ptat voltage component of the prior loops , and in the claims to follow , would not be considered to be one of the cascaded ptat voltage circuits . finally , while the present invention has been disclosed and described with respect to basic bandgap references , one may readily include what is referred to as a curvature correction circuit to further flatten the temperature sensitivity of the bandgap voltages generated , if desired . curvature correction circuitry is well known in the prior art and does not form a part of the present invention . some embodiments wherein maximum performance is desired will include curvature correction , while other embodiments where minimum die size is the controlling factor , will not include curvature correction . in one embodiment where curvature correction is used , the correction is obtained by varying with temperature , the bias current ib through transistors qn 7 and qn 5 of the summing amplifier ( fig5 ) for the one bg embodiment of fig4 - 1 and 4 - 2 , or varying with temperature , the bias current ib through transistors qn 7 and qn 5 of the summing amplifier ( fig5 ) and through transistor qn 9 ( fig6 - 3 ) for the two bg embodiment of fig6 - 1 through 6 - 3 . thus while certain preferred embodiments of the present invention have been disclosed and described herein for purposes of illustration and not for purposes of limitation , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .	6
now , the invention will be described in detail with reference to the drawings showing exemplary embodiments of the invention . referring to fig1 the light emitted from a light source 10 is converted into a monochromatic light by means of a monochromator 12 . the monochromatic light from the monochromator 12 . is then scanned in respect of the wavelength by a wavelength drive apparatus 14 and applied alternatively to a sample cell 18 and a reference cell 20 through a sector mirror 16 . numerals 22 and 24 designate mirrors . the light beams transmitted through the sample cell 18 and the reference cell 20 are alternatively directed to a detector 28 by way of another sector mirror 26 which is rotated in synchronism with the sector mirror 16 . a divider circuit 30 serves to produce a ratio between two different output signals from the detector 28 which represent the light intensities i s and i r of the light beams transmitted through the sample cell 18 and the reference cell 20 , respectively . the signal representative of the ratio is subsequently converted into a digital signal by an analog - to - digital or a - d converter 32 . the individual output signal bits from the a - d converter 32 are separated into two bit groups which are fed to a first gate block 34 and a second gate block 36 and coupled to associated individual and gates 34a , 34b , . . . , 36a , 36b . . . . the gate output signals from the first gate block 34 are supplied to a volatile random access memory 38 , while the gate output signals from the second gate block 36 are fed to a correcting circuit 40 . a switch 42 is interlocked with a main switch ( not shown ) so as to be turned on simultaneously with the latter . a delayed pulse generator 44 is provided to supply a pulse signal to a write command circuit 46 when a predetermined time required for the operation of the system to be stabilized has elapsed after the switch 42 was turned on . upon reception of the pulse signal , the write command circuit 46 will initiate the operation of the wavelength drive apparatus 14 thereby to cause the monochromator 12 to perform the wavelength scanning operation and at the same time enable the individual and gates 34a , 34b and so forth belonging to the second gate block 34 . on the other hand , the individual gates 36a , 36b and so forth of the second gate block 36 will remain non - conductive , since the signal polarity is inverted by an inverter 48 . in this state , signals corresponding to ratios between the specimen light intensities and the reference light intensities at various wavelengths are supplied to the input area of the memory 38 one after another , as the wavelength scanning is conducted by the wavelength drive apparatus 14 , and these input signals are stored in the memory 38 at the respective addresses allotted for respective wavelengths to be sampled . when a cycle of the wavelength scanning has been completed , the wavelength drive apparatus 14 will supply a pulse signal to the write command circuit 46 thereby to invert the output signal thereof . as a result , the wavelength drive apparatus 14 will stop the wavelength scanning operation and the gates of the first gate block 34 will become non - conductive , while the gates of the second gate block 36 are made conductive . the write - in operation of the intensity ratios between the specimen transmitting light beam and the reference light beam into the memory 38 is conducted in the condition in which no specimen is placed into the sample cell . in other words , the signals representive of the sampled wavelengths corresponding to the ratio i so / i ro between the light intensity i so derived from the sample cell containing no specimen and the reference light intensity i ro are written in the memory . a switch 50 allows the signals corresponding to the ratio i so / i ro to be written in the memory 38 when occasion requires , as the wavelengths are scanned . in other words , the switch 50 can be temporarily turned on thereby to initiate the wavelength scanning and write - in operations . after the write - in operation in the memory 38 described above has been completed , a specimen to be analyzed is placed in the sample cell 18 and a manually operatable switch ( not shown ) is actuated so as to cause the wavelength drive apparatus 14 to conduct again the wavelength scanning operation . then , the measure signals corresponding to the ratios i s / i r between the specimen transmitting light intensity i s and the reference light intensity i r are input to the correcting circuit 40 through the second gate block 36 one after another , as the wavelengths of these light beams are scanned by the wavelength drive apparatus 14 . at the same time , the addressing signals allotted for the respective wavelengths from the wavelength drive apparatus 14 are supplied to the memory 38 , and the ratio i so / i ro signals ( correcting signals ) corresponding to the wavelengths of light beams already transmitted through the idle sample cell 18 and the reference cell 20 and stored in the memory 38 as hereinbefore described are read out at the output area of the memory 38 . the correcting circuit 40 serves to correct the measure signals fed from the second gate block 36 with the correcting signals i so / i ro from the memory 38 . the corrected measure signals are then supplied to a digital - to - analog or d - a converter 52 . the correcting circuit 40 is so arranged as to perform the correcting function thereof by dividing the measure signal i s / i r by the correcting signal i so / i ro . the d - a converter converts the corrected signal from the correcting circuit 40 into the corresponding analog signal which can be visibly displayed at a display meter 54 . it may occur that , even if specimen is placed in the sample cell 18 , if the main switch of the system is turned on , after a predetermined time duration has elapsed , the wavelength drive apparatus 14 brings about the wavelength scanning operation as well as the write - in operation for every wavelength in the memory 38 under the command of the write command circuit 46 . in this connection , it is to be noted that the operation of the write command circuit 46 in the state in which the specimen has been initially present in the sample cell 18 is an erroneous operation , since it is intended in accordance with the invention to write in the memory 38 the signals for the wavelengths derived from the sample cell 18 in which no specimen is present . with a view to preventing such erroneous operation , a specimen sensor 56 is provided according to the invention to determine the presence or absence of the specimen in the cell 18 and the write command circuit 46 is adapted to be not operated when the presence of specimen in the cell 18 is detected by the sensor 56 . in the above described embodiment , the ratio between the signals representative of the specimen transmitting light intensity and the reference light intensity is obtained by the divider circuit 30 . however , it is also possible to obtain logarithms of the above ratios . in such case , the correcting circuit 40 will function as a subtractor circuit to subtract the read - out signal of the memory 38 from the output signals of the second gate block 36 . further , it is assumed in the above description that the detector 28 is adapted to detect both the specimen transmitting light intensity and the reference light intensity and the signals representative of the ratios of these intensities are stored in the memory 38 after having been converted into corresponding digital signals by the a - d converter 38 . however , the invention is never restricted to such arrangement . for example , as is shown in fig2 it is also possible to separate the output of the detector 28 into the specimen light signal and the reference light signal by means of a phase discriminator 60 interlocked with the sector mirrors 16 and 26 , wherein the specimen light signal is supplied to a switching device 64 after having been converted into the corresponding digital signal through an a - d converter 62 , which switching device 64 will then supply the specimen light signal either to the volatile memory 66 or to divider circuit 68 under the command of the write command circuit 46 . in a similar manner , the channel for processing the reference light intensity includes an a - d converter 70 , a switching device 72 and a volatile memory 74 . when the switching devices 64 and 72 are changed over to the divider circuit 68 , the ratio of the two signals is produced and fed to the correcting circuit 40 . signals as read out from the memories 66 and 74 are applied to the divider circuit 76 , whereby the ratio of these signals is produced and supplied to the correcting circuit 40 . it will be appreciated that , according to the invention , the operator gets rid of the trouble of having to write the correcting values in the volatile memory every time the power source is turned on . further , since the correcting values can be written in the volatile memory in the stabilized state of the whole system , it is possible to obtain the output signals which have been appropriately corrected without fail .	6
referring to fig1 and 3 in detail , the numeral 10 indicates generally a push - button key pad having ten push - button keys 12 arranged in a 3 by 4 matrix which is common to touch - tone dial telephones . each key , when depressed , closes a single pole switch . the key pad is preferably constructed in a manner described in more detail in u . s . pat . no . 4 , 291 , 201 . the key pad assembly is mounted in the telephone in conventional manner by mounting screws 14 . the key pad assembly is connected to a printed circuit board 16 by a flat cable connector 18 , preferably having seven conductors , corresponding to the total number of columns and rows in the switch matrix . the circuit board 16 is removably mounted on the key pad assembly 10 by inserting the corners of the circuit board 16 in notches at the corners of the key pad assembly , as indicated at 20 and 22 . the other corners of the circuit board 16 are held by a pair of latches 24 and 26 . the latches can be pushed to one side so as to release the corners of the circuit board 16 , allowing the circuit board to be shifted laterally out of the notches 20 and 22 . referring to the key pad circuit diagram of fig5 the push - buttons 12 are arranged to complete a connection at any of the crossover points of a 3 by 4 matrix of conductors . the seven row and column conductors of the matrix are connected by the seven conductors of the ribbon cable 18 to seven pins on the touch - tone generator integrated circuit chip , indicated at 30 in fig4 . this is a standard chip for generating a plurality of touch - tone frequencies at a tone output terminal , using the output of a quartz crystal oscillator 32 . a resistor network , indicated generally at 34 , acts as pull ups and pull downs on the key board input when the tone generator chip is disabled . the network has no effect on the dial in normal operation . referring to fig4 the touch - tone control circuit for a telephone set is shown . the incoming telephone line pair is connected to the tip and ring terminals 40 and 42 . a bridge rectifier circuit 44 is connected in the incoming line circuit to operate the control circuit with either polarity across the incoming line . a hook switch 46 , shown in the &# 34 ; on - hook &# 34 ; condition for the telephone , connects the tip terminal through the normally open contacts 48 to a hand set transmitter 50 through a normally conducting transistor 52 and a standard hybrid network 54 when the hand set is taken off the hook . the ring terminal 42 in turn is connected to the transmitter 50 through a transistor 56 and the hybrid network 54 . a receiver 58 is also normally connected to the tip and ring terminals 40 and 42 through the hybrid network 54 when the hand set is taken off the hook . when one of the buttons 12 on the key pad is operated during a touch - tone dialing sequence , the touch - tone generator chip 30 provides a muting signal on the mute output terminal which is coupled through a transistor 60 to the transistor 56 , turning off the transistor 56 and opening the circuit to the transmitter 50 . thus the transmission path is turned off whenever a touch - tone signal is being generated . the touch - tone signal from the generator 30 is at the same time coupled to the telephone line through the tip and ring terminals 40 and 42 through a transistor 62 and hook switch terminals 48 . at the same time , the receiver 58 is muted by a transistor 63 which provides a shunting path across the receiver 58 when the transistor 56 is turned off . a capacitor 64 holds the transistor 63 on until after the transmitter path is turned on again by the transistor 56 on release of the push - button dial button . the hand set operation , as thus far described , allows line current to be fed through the bridge rectifier 44 to power the tone generator chip 30 , the transmitter 50 and the receiver 58 when the hand set is off the hook . incoming voice signals flow through the diode bridge rectifier 44 and through the transistor 52 to the receiver 58 through the hybrid network 54 . outgoing voice signals from the transmitter flow through the transistor 56 through the hybrid network 54 to the diode bridge 44 . when a button on the key pad is depressed , the transistor 56 turns off the transmitter path and mutes the receiver while the touch - tone is being generated . when the button on the key pad is released , the transmitter is turned on by the transistor 56 and the receiver is unmuted . for speaker phone operation , the tip terminal 40 is connected through the diode bridge rectifier 44 to one terminal of the speaker phone network 70 , assuming the speaker phone power supply 72 is turned on to activate the speaker phone and the hand set remains &# 34 ; on - hook &# 34 ;. also with the hand set positioned &# 34 ; on - hook &# 34 ;, the transistor 52 is turned off , which removes the shunting effect of the hybrid network across the speaker phone network . the speaker phone network 70 is connected to the ring terminal 42 through a series resistance 74 which is normally shunted by a conducting transistor 76 . transistor 76 is driven by a transistor 78 connected in a darlington configuration . a transistor 80 , controlled by the mute output of the tone generator 30 , operates to turn off the transistor 76 when a dial button on a key pad is depressed , thereby effectively inserting the transistor 74 in series with the speaker phone network to mute the receiver of the speaker phone . a polarity guard circuit is provided by switch element 82 connecting the tip 40 to a transistor 84 . the switch element includes a screw 86 which forms a conductive path between two conductors when it is screwed into a plastic sleeve 88 . with the switch 82 closed , the transistor 84 disables the touch - tone generator chip 30 if the polarity of the tip 40 is negative with respect to ring 42 . with the switch 82 open , operation is normal regardless of the tip - ring polarity . the polarity guard is useful in disabling the output call capability of the phone set .	7
fig1 shows a cable connector which embodies the present invention . the cable connector comprises a female member 12 and a male member 14 . as can best be seen in fig1 , and 2a , the female member 12 is generally hook - shaped in cross - section and comprises a c - shaped head 16 with a mounting tail 18 attached to one leg of the c . the free leg 20 of the c extends rearwardly back along the general direction of the tail 18 . a cable receiving opening or bore 22 is formed in the bight of the c . the bore 22 is at the front of the connector when the male element 14 and female element 12 are assembled . the bore 22 has a chamfer 24 at its front end to facilitate insertion of the cable . the tail portion 18 of the female member 12 has a generally planar bottom surface which is adapted for mounting on a supporting structure 26 by means of a suitable fastener , such as bolt or screw 28 , as shown in fig6 and 9 . as can be seen , the axis of the female bore 22 is slightly angled with respect to the plane of the bottom surface of the tail 18 . the tail 18 also includes a mounting aperture 30 near its rearward end . the upper surface 32 of the tail portion 18 is inclined downwardly toward the rear , to mate with the tail portion of the male member 14 as will become apparent hereinafter . the interior surface 34 of the c - shaped head 16 of the female member 12 is generally cylindrical , with a pair of longitudinal slots or grooves 36 and 38 . the rearward wall 40 of the groove 38 which is in the free end 20 of the c - shaped head 16 is inclined with respect to the cylindrical surface 34 and forms a cam follower surface . the cam follower 40 terminates in a detent or stop surface 42 . a toothlike projection 44 extends upwardly from the upper surface of the female tail 18 at the rearward edge of the groove 36 ; the projection 44 provides one clamping surface for the cable , and the upper , interior cylindrical surface 46 at the rear of the bore 22 provides a second clamping surface . the male member 14 is best shown in fig1 , and 3a . the male member 14 includes a tail portion 48 and a generally cylindrical head portion 50 . as shown in fig3 the male member 14 is preferably symmetrical in cross - section , except for a pair of ridges or projections 52 and 54 which provide cam surfaces on the cylindrical surface of the male head 50 , and except for the orientation of a cable - receiving opening or bore 56 in the male head 50 . the cams 52 and 54 are appropriately spaced for travel in either of the grooves 36 and 38 of the female member 12 , as will be explained in detail hereinafter . the bore 56 in the male head 50 preferably has its axis inclined with respect to the axis of symmetry of the male member 14 by some small angle a ; as will be explained in detail hereinafter , this feature is the preferable means for providing size adjustability in the cable connector of the present invention . the male bore 56 is preferably somewhat larger in diameter than the female bore 22 , and has a generally x - shped cross - section as disclosed in u . s . pat . no . 3 , 406 , 372 . the male bore 56 is extended somewhat into the tail portion 48 of the male member 14 to provide a slot or opening 58 to accommodate the end of the cable and to permit the clamping surface of the projection 44 to engage the cable . thus , the male member 14 provides a first clamping surface for the cable at the upper interior cylindrical surface 60 at the rear of the bore 56 , and a second cable clamping surface at the lower interior cylindrical surface 62 at the front of the bore 56 . the tail portion 48 of the male member 14 also includes a mounting or clamping aperture 64 which is in general alignment with the aperture 30 in the female tail 18 when the male and female components are assembled . the upper and lower surfaces 66 and 68 , respectively , of the male tail 48 are inclined to mate with the inclined surface 32 of the female tail 18 when the connector is in its closed position . the male tail 48 also includes a pair of indicia 70 which may be embossed or stamped on the tail surfaces and which are indicative of the size of the cable which the connector is adapted to clamp when the male member 14 is in a given configuration with respect to the female member 12 . turning now to fig4 , and 6 , the operation of the connector will be described . as shown therein , the connector is configured for the clamping of a particular size of cable , as for example a 250mcm cable . in this configuration , the male member 14 has the same orientation as in fig3 ; accordingly , the uppermost indicium 70 indicates size 250 . as shown in fig4 the connector is in its open or &# 34 ; insertion &# 34 ; position , with the male and female bores 56 and 22 in nearly axial alignment for ease of insertion of the 250 cable . in this position , the cam 54 is in the groove 38 but not in contact with the cam follower 40 , and the other cam 52 is free to move in the groove 36 . as the tail portions 18 and 48 are forced together ( as the tail portion 48 of the male member 14 moves in the direction of the arrow in fig5 ), the connector is operated to a partially closed , intermediate clamping position , as shown in fig5 . note that the clamping surface or toothlike projection 44 has begun to contact the cable and to deform it . note also that the cam 54 is now in engagement with the cam follower surface 40 . this cam action causes the free leg 20 of the c - shape head 16 of the female member 12 to be deflected slightly upwardly ; this causes a positive spring pressure to be exerted through the cam surfaces 40 and 54 , resulting in a resilient locking pressure of the clamping surface 60 against the cable . the resilient deflection of the free leg 20 may also somewhat relieve the clamping pressure at the clamping surface 46 in the female bore 22 . as a result of this cam - locking system , the cable is held securely enough within the connector to prevent pull - out when the connector is in its intermediate or partially closed position , thus enabling the operator to more easily complete the installation and clamping operation , as shown in fig6 . as shown in fig6 the connector is in its fully clamped and locked position ( in the drawing some slight separation between the male tail surface 68 and the female tail surface 32 has been left for clarity in showing the interengagement of the parts ). the bolt 28 has been inserted through the aperatures 30 and 64 and serves the dual function of holding the tails 18 and 48 together in clamped position , and of mounting the connector to the supporting structure 28 . as can be seen , the axis of the male bore 56 has beenrotated with respect to the axis of the female bore 22 through some angle b from their co - axial orientation ( shown approximately in fig4 ). the cam 54 has now moved past the terminus of the cam follower surface 40 and has slipped over the detent 42 , thus permitting the free end 20 of the c - shaped female head 16 to snap back from its deflected configuration ( as shown in fig5 ). thus , the cam 54 abuts against the rearward surface of the detent 42 , providing a firm mechanical lock which assists in holding the connector in its fully closed or clamped position . the size 250 cable is now securely clamped between the clamping surfaces 44 and 60 at the rear of the connector and the clamping surfaces 62 and 46 at the front of the connector ; the clamping forces are as shown in the diection of the arrows . these clamping forces cause deformation and deflection of the 250 cable as shown . in particular , the orientation and positioning of the clamping surface 44 causes significant upward deflection of the ree end of the cable through the slot 58 rearwardly of the clamping surface 60 , thus increasing resistance to cable pull - out . the x - shaped cross - section of the male bore 56 reduces undesirable shearing action at the front end of the connector , and the larger aperture of the male bore 56 permits some &# 34 ; bird caging &# 34 ; of the cable , which also increases pull - out resistance , as disclosed in u . s . pat . no . 3 , 883 , 211 . the size adjustability feature of the connector of the present invention can be best understood with reference to fig7 , and 9 . as shown therein , the male member 14 is now oriented so that the connector is adapted to receive and clamp a cable of a different size than that of the configuration illustrated in fig4 - 6 ; as for example , a 4 / 0 cable , which has a slightly smaller diameter than a 250mcm cable . in order to adapt for a 4 / 0 size cable , the male member has been re - oriented , by rotating 180 degrees about its axis of symmetry . in this orientation , the uppermost indicia 70 has indicates that the connector is adapted to receive a 4 / 0 cable . as shown in fig7 the male and female bores 56 and 22 are again nearly in axial registry , so that the connector is in the open or insertion position for a 4 / 0 cable . as a consequence , the male tail 48 is now spaced further from the female tail 18 than was the case in fig4 . again , the cam 52 is not in contact with the cam follower 40 , and the other cam 54 is free to move in the groove 36 . as the tails 18 and 48 are moved together in the direction of the arrow in fig8 the cam 52 contacts the cam follower surface 40 again providing the cam locking action as previously described . when the connector is in its fully closed or clamped position as illustrated in fig9 the cam 52 again has moved past the detent 42 , permitting the free end 20 of the c - shaped head 16 to snap down into a positive locked position . the location and spacing of the cams 52 and 54 on the cylindrical surface of the male head 50 depends , of course , on the geometry of the grooves 36 and 38 , the cam follower 40 and the detent 42 , as well as the angle a . as shown in fig9 with the male member 14 in this orientation , the axis of the male bore 56 has , in the fully closed or clamped position of the connector , rotated through a greater angle relative to the axis of the female bore 22 than was the case in the orientation illustrated in fig6 . this angle is approximately b + 2a . thus , it can be seen that the connector of the present invention is able adequately to clamp a cable of a given size when the male member 14 is in one insertion orientation , and adequately to clamp a cable of a smaller diameter when the male member is rotated 180 degrees about its axis of symmetry so as to assume its second insertion orientation . another useful aspect of this adjustability feature is that the connector of the present invention is able to provide varying clamping forces on cables of identical or nearly identical diameter but made of different materials . for example , if one wished to clamp a size 250 aluminum cable , one could use the configuration illustrated in fig7 - 9 . similarly , if one wished to clamp a size 250 copper cable , one could use the configuration illustrated in fig4 - 6 . with the aluminum cable , the relative degree of rotataion between the male and female members would be the angle b + 2a ; the more deformable aluminum could tolerate this degree of clamping action . on the other hand , with the copper cable , the relative degree of rotation would be only the angle b , thus accommodating the connector to the relatively lesser deformability of copper . this provides a solution to a difficult probelm in the art ; namely , the problem of providing a single rotating - jaw connector which will adequately and safely clamp both aluminum and copper cables of a given diameter . ( it should be understood , of course , that it may not be possible to design a connector which will , in all size cases , serve to accommodate both cables of one material but different diameters and also cables of the same diameter , but different materials ). it should also be understood that there are other ways of achieving the differing degrees of relative rotation so as to enable the connector of the present invention to accommodate different sized cables of the same material , or identically - sized cables of different materials . for example , the inclined surfaces of the male tail 48 could be made asymmetrical , thus limiting the degree of closure of the connector in one orientation of the male member 14 versus its other , rotated - 180 degrees , orientation . this could be accomplished with or without changing the orientation of the axis of the female bore 22 as shown in the preferred embodiment . as indicated previously with respect to fig6 and as is also true of fig9 a slight separation between the male and female tails has been left for clarity in showing the interengagement of the parts . in actuality , when the device is in its fully clamped configuration , the upper surface ( 66 in fig4 - 6 and 68 in fig7 - 9 ) would be essentially parallel with the lower surface of the female tail 18 , and thus with the plane of the mounting structure 26 . likewise , the under side of the head of the bolt 28 would be parallel with and firmly contacting the surface 66 or 68 . also , the lower surface of the male tail ( 68 in fig6 and 66 in fig9 would be essentially parallel to and in contact with the upper surface 32 of the female tail 18 . it should be understood that various changes and modifications to the preferred embodiment disclosed herein will be apparent to those skilled in the art . such changes and modifications can be made without departing from the spirit and scope of the present invention and without diminishing its attendant advantages . it is , therefore , intended that such changes and modifications be covered by the appended claims .	5
the present invention will be described in detail with reference to the accompanying drawings . fig4 is a block diagram of a fram according to the present invention . four cell array blocks 300 are arranged as a 2 × 2 matrix format in a chip . a control circuit unit 100 including an address input pad , a buffer , a decoder and a sense amplifier array is arranged between a first row and a second row of the matrix . a data bus unit 200 is arranged between a first column and a second column of the matrix . a bitline ( not shown ) of a cell array block 300 is connected to a data bus line in the data bus unit 200 through a column selection controller 310 . fig5 is a detailed structural diagram illustrating the control circuit unit of fig4 . the control circuit unit 100 comprises a sense amplifier array 100 , a column address pad 122 , a column address buffer 121 , a column address decoder 120 , a row address pad 112 , a row address buffer 131 , a row address decoder 130 , an i / o pad 141 , a data i / o buffer 140 , and a chip controller 150 . the sense amplifier array 110 includes a plurality of sense amplifiers . a column address is inputted into the column address pad 122 , stored in the column address buffer 121 , and decoded by the column address decoder 120 . a row address is inputted into the row address pad 112 , stored in the row address buffer 131 , and decoded by the row address decoder 130 . data is inputted or outputted at the i / o pad 141 , and stored in the data i / o buffer 140 . the chip controller 150 controls the operation of a chip . an output signal from the row address decoder 130 controls a wordline / plateline driver 320 to output a driving voltage to a wordline and a plateline in read / write operations . fig6 is a block diagram illustrating the sense amplifier array 110 in the control circuit unit 100 of fig4 and a sense amplifier data bus unit 160 for connecting a data bus unit 200 to the sense amplifier array 110 . each sense amplifier in the sense amplifier array 110 shares the data bus unit 200 . there are various methods for connecting the data bus unit 200 to the sense amplifier array 110 , which are explained below . fig7 is a diagram illustrating a first example of connection between the sense amplifier array unit 110 and the data bus unit 200 of fig6 . each sense amplifier 111 in the sense amplifier array 110 is connected to a sense amplifier data bus line 161 in the sense amplifier data bus 160 . the sense amplifier data bus line 161 is directly connected to a data bus line 210 in the data bus unit 200 . fig8 a is a diagram illustrating a second example of connection between the sense amplifier array unit 110 and the data bus unit 200 of fig6 . switches sw 1 and sw 2 are arranged apart in the middle portion of the data bus unit 200 . the sense amplifier data bus line 161 corresponding to each sense amplifier 111 is directly connected to the corresponding data bus line 210 between the switches sw 1 and sw 2 . the sense amplifier 11 is connected to the right or left side of the data bus unit by the complementary switching operations of sw 1 and sw 2 . fig8 b shows the enlarged connection portion of fig8 a . fig9 a is a diagram illustrating a third example of connection system between the sense amplifier array unit 110 and the data bus unit 200 of fig6 . unlike the second example , the data bus unit 200 is divided into a first data bus unit on the left side and a second data bus unit on the right side in the third example . the sense amplifier data bus is also divided into a first sense amplifier data bus connected to the first data bus unit and a second sense amplifier data bus connected to the second data but unit . a data bus line 162 in the first sense amplifier data bus is directly connected to a first data bus line 210 - l in the first data bus unit . a data bus line 163 in the second sense amplifier data bus is directly connected to a second data bus line 210 - r in the second data bus unit . fig9 b shows the enlarged connection portion of fig9 a . a first switch sw 1 is connected to each data bus line 162 in the first sense amplifier data bus . a second switch sw 2 is connected to each data bus line 163 in the second sense amplifier data bus . the switches sw 1 and sw 2 are connected to the same port of the sense amplifier 111 . the structure of the sense amplifier 11 will be explained in detail later . the sense amplifier 11 is connected to the first sense amplifier data bus line 162 or the second sense amplifier data bus line 163 by the complementary switching operations of sw 1 and sw 2 . fig1 is a block diagram illustrating a global controller and a local controller for controlling the sense amplifier according to the present invention . a control signal inputted to the sense amplifier 11 is generated from a global controller 170 and a local controller 180 . the global controller 170 outputs a common control signal into all sense amplifiers 111 in the sense amplifier array . the local controller 180 , which is located in each sub sense amplifier array of a sense amplifier array , outputs a common control signal into a plurality of the sense amplifiers 111 in the sub sense amplifier array . the local controller 180 is controlled by a column address bit yi & lt ; n & gt ; while the global controller 170 generates a control signal regardless of a column address bit . the sense amplifiers 111 selected by the column address bit start read or write modes . since a read mode is necessarily accompanied with a restore mode , the sense amplifier 111 selected by the column address bit performs a restore or write operation . however , the rest sense amplifiers 111 , which are not selected by the column address bit , start only a read mode with a restore mode . as a result , the global controller 170 outputs a signal which is commonly used in read and write modes . the local controller 180 generates a control signal for performing read and write modes into the selected sense amplifier 111 , and a control signal for performing only a read mode into the unselected sense amplifier 111 . the specific operation of the sense amplifier 111 and its control signals will be explained below . fig1 a is a circuit diagram illustrating the sense amplifier 111 of fig1 . the sense amplifier 111 comprises a data line pull - up controller 400 , an amplification unit 500 , and an i / o controller 600 . the data line pull - up controller 400 pulls up a voltage of a data line to a vcc in response to a control signal dbpu_c . the data line is connected to a sense amplifier data bus line . the amplification unit 500 comprises a first comparator 510 , a second comparator 530 , an equalizer 520 , and a storage unit 540 . the first comparator 510 compares a signal of a data line with that of a reference line , and outputs a high level signal when the signal of the data line is higher than that of the reference line . the second comparator 530 outputs an opposite level signal to the first comparator 510 . the equalizer 520 equalizes a voltage from an output unit of the first comparator 510 with that of the second comparator 530 . the storage unit 540 includes two input terminals connected through the first comparator 510 and the second comparator 530 , and each switch 550 and 560 . the i / o controller 600 includes a first path 610 , a second path 620 , a third path 630 and a fourth path 640 . the first path 610 transmits data inputted from a data i / o buffer ( not shown ) into the storage unit 540 . the second path 620 outputs data stored in the storage unit 540 . the third path 630 transmits an output signal from the second path 620 into the data i / o buffer . the fourth path 640 transmits the output signal from the second path 620 into the data line . the storage unit 540 stores output signals from the first comparator 510 and the second comparator 530 in a read mode , thereby performing a restore operation after the read operation . in a write mode , the storage unit 540 stores data transmitted from the first path 610 , and transmit the data into data lines of the second path 620 and the fourth path 640 , thereby allowing data to be written in the memory cell . here , the restore operation is similarly performed to the write operation . fig1 b is a circuit diagram illustrating another example of the sense amplifier 111 of fig1 . the major function of the example shown in fig1 b is the same as that of the sense amplifier shown in fig1 a . however , a pmos transistor 521 is used herein instead of the equalizer 520 of fig1 a . the pmos transistor 521 has a gate to receive a control signal identical with the control signal of the data line pull - up controller 400 , a source connected to the vcc , and a drain connected to an output terminal of the first comparator 510 . fig1 and 13 are timing diagrams of the sense amplifier of fig1 a and 11 b . fig1 is a timing diagram illustrating a write mode when the column address bit yi & lt ; n & gt ; is activated . fig1 is a timing diagram illustrating a write mode when the column address bit yi & lt ; n & gt ; is inactivated . referring to fig1 , if a write enable signal web is activated , a wsn becomes “ high ” and the first path 610 of fig1 a is activated . a whsn becomes “ low ” and the second path 620 of fig1 a is inactivated ( t 0 ). thereafter , sen 1 , stgn and sen 2 are activated , and a signal of the data line is stored in the storage unit 540 of fig1 a ( t 2 ). if the column address bit yi & lt ; n & gt ; is activated , the sen 2 and the switches 550 and 560 of fig1 a are inactivated . next , data inputted in the i / o buffer is stored in the storage unit 540 of fig1 a ( t 3 ). if the whsn becomes “ high ” and the second path is activated ( t 5 ), data stored in the storage unit 540 of fig1 a is outputted to the data line through the activated ( t 4 ) fourth path 640 of fig1 a . referring to fig1 , although the write enable signal web is activated , the wsn is maintained at a low level , and the first path 610 is inactivated . the whsn is maintained at a high level , and the second path is activated . if the sen 1 , the sen 2 and the stgn are activated , the value of the data line is read , and stored in the storage unit 540 ( t 2 ). next , a lsn is activated , and the fourth path is activated ( t 4 ). then , the value stored in the storage unit is outputted into the data line . that is , when the column address bit yi & lt ; n & gt ; is not activated , the restore operation is only performed . as described above , the global controller 170 generates a signal that is identically operated when the column address bit is selected and unselected . the local controller 180 generates that is not identically operated . referring to fig1 and 13 , the control signals sen 1 , sen 2 , lsn , lsp , stgn , stgp , seqn and seqp are generated from the global controller 170 , and the control signals rsn , rsp , wsn , wsp , whsn and whsp are generated from the local controller 180 . fig1 is a structural diagram illustrating one of a plurality of unit blocks in a cell array block of fig4 . each unit block comprises a main bitline pull - up controller 330 , a cell array , and a column selection controller 310 . the cell array includes a main bitline load controller 340 , and a plurality of sub cell blocks 350 connected in series between the main bitline pull - up controller 330 and the column selection controller 310 . fig1 is a circuit diagram illustrating the main bitline pull - up controller 330 of fig1 . the main bitline pull - up controller 330 comprises a pmos transistor having a gate connected to a control signal mbpuc , a source connected to a vpp or a vcc , and a drain connected to the main bitline 360 . the main bitline pull - up controller 330 pulls up the main bitline to a “ high ” level in a “ precharge ” operation . fig1 is a circuit diagram illustrating the column selection controller 310 of fig1 . the column selection controller 310 comprises a transmission gate for connecting a main bitline to a data bus line in response to control signals csn and csp . fig1 is a circuit diagram illustrating the main bitline load controller 340 and the sub cell block 350 of fig1 . here , one sub cell block 350 is shown for convenience sake . the main bitline load controller 340 comprises a pmos transistor having a gate connected to a control signal mblc , a source connected to a vpp or a vcc , and a drain connected to the main bitline 360 . when the control signal mblc is activated , the main bitline load controller 340 serves as load of the main bitline 360 . a detection voltage of the main bitline 360 is determined by a load resistance and a current level of the main bitline 360 . the current level is determined by a transistor n 1 . the main bitline load controller 340 may be attached to each main bitline . however , when a driving load is large , the main bitline load controller 340 is arranged in each sub cell block 350 , thereby reducing driving load of each main bitline load controller 340 . the sub cell block 350 comprises a sub bitline 351 , and nmos transistors n 1 , n 2 , n 3 , n 4 and n 5 . the sub bitline 351 is connected in common to a plurality of unit memory cells . each unit memory cell is connected between a wordline wl & lt ; m & gt ; and a plateline pl & lt ; m & gt ;. the nmos transistor n 1 for regulating current has a gate connected to a first terminal of the sub bitline 351 , and a drain connected to the main bitline 360 . the nmos transistor n 2 has a gate connected to a control signal mbsw , a drain connected to a source of the nmos transistor n 1 , and a source connected to ground . the nmos transistor n 3 has a gate connected to a control signal sbpd , a drain connected to a second terminal of the sub bitline 351 , and a source connected to ground . the nmos transistor n 4 has a gate connected to a control signal sbsw 2 , a source connected to the second terminal of the sub bitline 351 , and a drain connected to a control signal sbpu . the nmos transistor n 5 has a gate connected to a control signal sbsw 1 , a drain connected to the main bitline 360 , and a source connected to the second terminal of the sub bitline 351 . the load of the main bitline may be reduced to that of the sub bitline 351 by activating one of a plurality of sub bitlines 351 in the main bitline 360 . the sub bitline 351 is selected by the control signal sbsw 1 . the sub bitline 351 regulates a potential of the sub bitline 351 to a ground level if the sbpd signal , which is a regulating signal of the pull - down nmos transistor n 3 , is activated . the sbpu signal regulates a power voltage to be supplied to the sub bitline 351 . when a “ high ” voltage is required in a low voltage , a voltage higher than the vcc voltage is supplied to the sub bitline 351 . the control signal sbsw 2 regulates a signal flow between the sub bitline sbl and the main bitline mbl . the sub bitline 351 is connected to a plurality of unit cells . the sub bitline 351 is configured to be connected to the gate of the nmos transistor n 1 and to regulating a sensing voltage of the main bitline 360 . fig1 a is a timing diagram illustrating a write operation of the sub cell block of fig1 . in intervals t 2 and t 3 , a level of a signal written in a cell is detected . in an interval t 4 , a self - boosting operation is prepared . in an interval t 5 , a “ high ” level signal is written . in an interval t 6 , a “ low ” level signal is written . in the intervals t 2 and t 3 , if data of the cell is “ high ”, a voltage of the sub bitline 351 becomes “ high ”. as a result , as current flowing in the nmos transistor n 1 becomes larger , a voltage of the main bitline 360 becomes lower than the reference level . on the other hand , when the data of the cell is “ low ”, the voltage of the sub bitline 351 becomes “ low ”. as a result , as the current flowing in the nmos transistor n 1 becomes less , the voltage of the main bitline 360 becomes higher than the reference level . in this way , the data stored in the cell may be detected . in the interval t 4 , if the sbsw 2 becomes “ high ” at a state where the sbpu is maintained at a “ low ” level , charges are stored in parasitic capacitors between the gate and the source or the gate and the drain of the transistor n 4 . in the interval t 5 , if the sbpu becomes “ high ”, potentials of the sbsw 2 , the sub bitline 351 and the wordline wl & lt ; i & gt ; are boosted as much as additional potential difference by the stored charges . as a result , data “ 1 ” is automatically stored in the cell . if the data inputted to the main bitline 360 through the i / o buffer is “ 0 ”, the sbsw 1 is activated , and the sbsw 2 is inactivated . then , the potential of the plateline pl & lt ; i & gt ; becomes “ high ”, and that of the sub bitline 351 also becomes “ 0 ”. as a result , as the charges stored in the cell move into the sub bitline , the data “ 0 ” is written in the cell ( t 6 ). fig1 b is a timing diagram illustrating a read operation of the sub cell block of fig1 . in intervals t 2 and t 3 , a level of a signal written in a cell is detected . in an interval t 5 , a “ high ” level signal is written . in an interval t 6 , a “ 0 ” level signal is restored . the operation in the intervals t 2 - t 4 is identical with that of fig1 a . in general , a restore operation is required after a read operation . referring to fig1 b , however , a restore operation is performed in the intervals t 5 and t 6 . in the interval t 5 , data “ 1 ” is restored regardless of the originally stored value . in the interval t 6 , data “ 0 ” is restored . the explanation of the restore operation is omitted because it is the same as that of the write operation . fig1 is a cross - sectional diagram illustrating the connection portion between a data bus unit and a column selection controller according to the present invention . the connection portion comprises a first layer l 1 , a second layer l 2 , and a third layer l 3 . the first layer l 1 comprises two nmos transistors having a common source and a common drain . the common source is connected to the main bitline 360 , and the common drain is connected to a first shared layer 370 . the second layer l 2 includes a second shared layer for connecting the first shared layer 370 to the data bus line 210 . the third layer l 3 includes the data bus line 210 . the second shared layer 380 allows the area of the first shared layer 370 to be minimized . as a result , the increase in the area of the whole chip layout due to increase in that of the first shared layer 370 can be prevented . additionally , the design of the above - described layout improves process margin and efficiency of signal transmission . fig2 is a block diagram illustrating a vpp supply circuit 700 for supplying a vpp to the cell array block of fig4 . referring to fig2 , a plurality of vpp driving circuits 800 are arranged in each cell array block 300 , and first vpp pump circuits 200 are arranged on top and bottom of the control circuit unit 100 . the vpp driving circuit 800 comprises a second vpp pump circuit 820 , a level shifter 810 , and a driver 830 . the second vpp pump circuit 820 generates a gate vpp signal . the level shifter 810 level - shifts an output signal from the first vpp pump circuit . the driver 830 , which is controlled by the gate vpp signal and an output signal from the level shifter 819 , outputs a driving voltage . the first vpp pump circuit 700 requires relatively larger layout size and operates at lower speed . therefore , the first vpp pump circuit 700 is disposed in the middle of the vpp driving circuits 800 to effectively control a vpp level . however , the vpp driving circuit 800 operates at higher speed . as a result , the vpp driving circuit 800 is individually arranged in each unit block . fig2 is a structural diagram illustrating the vpp driving circuit 800 of fig2 . the driver 830 comprises nmos transistors 821 and 832 . the nmos transistor 832 has a source connected to ground , a drain to output a driving voltage , and a gate controlled by a result obtained from logical operation of a pull - down control signal and an output signal from the address decoder . the nmos transistor 821 has a gate to receive the vpp ( gate vpp signal ) supplied from the second vpp pump circuit 820 , a source to receive the output signal from the address decoder , and a gate connected to a drain of a nmos transistor 831 in a node n 1 . a level shifter circuit comprises the nmos transistor 831 . the nmos transistor 831 has a drain to receive the vpp ( driving vpp signal ) outputted from the first vpp pump circuit , a source connected to a drain of the nmos transistor 832 , and the gate connected to the drain of the nmos transistor 821 . fig2 is a timing diagram illustrating the operation of the vpp driving circuit 800 of fig2 . in the cell operation , the voltage vpp is outputted into the wordline , the plateline , the sbpu and sbsw 2 ( see fig1 ). referring to fig2 , in an interval t 1 , a signal wlcon as an output signal from the second vpp pump circuit 820 is to make the node n 1 ( see fig2 ) at a vcc level . if a gate voltage of the nmos transistor 821 rises to the vpp , a voltage smaller than the vpp is generated at the node n 1 . this value is represented by a vcc . then , if the gate voltage of the nmos transistor 821 becomes vcc , the nmos transistor 821 is turned off and the node n 1 becomes floating . when an interval t 2 starts , a driving vpp signal outputted from the first vpp pump circuit 700 becomes vpp . here , the node n 1 is boosted to vcc + vpp by charges stored in the parasitic capacitor between the node n 1 and the drain of the nmos transistor 831 . additionally , a wordline voltage becomes vpp because the nmos transistor 831 is turned on . the vpp of the wlcon signal in the final stage of the interval t 2 turns on the nmos transistor 821 . as a result , the node n 1 falls to the vcc level . here , since the wlcon signal falls to the vcc again , the nmos transistor 821 is turned off and the node n 1 becomes floating . the voltage of the node n 1 also becomes the vcc , and the nmos transistor 831 is turned off . as a result , the wordline wl becomes floating . here , a potential difference is maintained by charges stored in the parasitic capacitor between the floating wordline wl and the sub bitline 351 . in this state , if the sbpu signal becomes “ high ”, the sub bitline 351 becomes “ high ” ( see fig1 and 18 ). next , a boosting voltage is generated as much as the potential difference maintained between the wordline wl and the sub bitline 351 ( t 3 ).	6
features of the illustrated embodiment of the present inventions include improved vaporization of a precursor material ( e . g ., cupraselect ® for copper cvd ) for delivery to a deposition system . although the illustrated embodiments of the inventions are described in terms of copper thin films grown by cvd , those skilled in the art will recognize that the inventions may be applied to any thin film deposition process where it is desirable to maintain controlled and repeatable delivery of process material to improve the resultant film and reduce contamination levels in the system . other liquid precursors or reactants include but are not limited to teos , trimethyl borate , tetraethyl borate , tetraethyl phosphate , tetraethyl phosphite , tetrakis ( dimethylamino ) titanium diethyl analog , and water . copper compound precursors other than cupraselect ® may also be used . turning now to the drawings , more particularly to fig1 there is shown a liquid delivery system 10 which uses a vaporizer 12 for vaporizing the reactant liqid in a manner which reduces clogging of the vaporizer . liquid flow rate is controlled by a closed loop system between a liquid flow controller 14 and a system controller 17 which includes a programmed workstation . in the system 10 , a liquid reactant 11 , such as cupraselect ® is delivered from a liquid bulk delivery tank 16 to a cvd process chamber 18 of a thermal or plasma - enhanced type . the chamber 18 may be conventional except that the vaporizer 12 is preferably mounted directly to the lid 19 of the chamber 18 as described in greater detail below . examples of suitable chambers include ( apart from the aforementioned lid modification ) the chambers described in the following commonly owned issued u . s . pat . no . 5 , 000 , 113 , issued mar . 19 , 1991 to adamik et al . ; u . s . pat . no . 4 , 668 , 365 , issued may 26 , 1987 to foster et al . ; u . s . pat . no . 4 , 579 , 080 , issued apr . 1 , 1986 to benzing et al . ; u . s . pat . no . 4 , 496 , 609 , issued jan . 29 , 1985 to benzing et al . and u . s . pat . no . 4 , 232 , 063 , issued nov . 4 , 1980 to east et al ., the disclosures of which are incorporated by reference herein . the liquid bulk delivery tank 16 has a dip tube 20 extending into the tank 16 and a source 24 providing a pressurized gas such as helium to “ head ” space 26 at the top of tank 16 , above the liquid reactant 11 , for driving the liquid from the tank . the liquid flow controller 14 is connected between the liquid bulk delivery tank 16 and liquid inlet 30 of the vaporizer 12 . a controlled amount of liquid is received by the vaporizer 12 , which converts the liquid to vapor and transports the vapor through the lid 19 of the process chamber 18 by means of a carrier gas , such as helium , nitrogen or argon . a gas tank 34 containing the carrier gas is connected to gas inlet 36 of the vaporizer 12 through a mass flow controller 38 which regulates the gas flow rate . in many applications , liquid 11 may be toxic and / or caustic . to facilitate servicing of the system 10 and its component valves and other elements , a purge line 39 is connected between the gas tank 34 and the liquid flow monitor to allow the operator to purge system 10 of the reactant liquid 11 and its vapor before servicing . to further reduce the amount of reactant in the system , a vacuum line 41 is used in conjunction with purge line 39 to evacuate liquid and vapor from the system . ( vacuum line 41 is coupled to the vacuum system of the cvd process chamber .) remotely controllable ( e . g ., pneumatic ) valves 13 are inserted on each line . these valves are opened and closed to enable normal operation and purge and evacuation operations . to enhance safety and fault - tolerance , each line having a remotely controlled valve 13 may also have a manual valve 15 which can be closed manually if the remotely controlled valve fails . one embodiment of the vaporizer 12 is shown in greater detail in fig2 - 4 . referring first to fig2 the vaporizer 12 includes an “ atomizer ” stage 200 which mixes the liquid precursor 11 with the carrier gas which is then permitted to expand rapidly . as a consequence , the liquid precursor is broken up and dispersed in the carrier gas in tiny particles or droplets which are delivered to a vaporizer chamber 202 to be vaporized . by the term “ atomizer ,” it is not intended to convey that the atomizer stage 200 necessarily disperses the liquid precursor at the atomic level . however , it is believed that the atomizer stage 200 does disperse the liquid precursor into an aerosol - like dispersion in the flow of carrier gas to the vaporizer chamber 202 . aerosol particles can range for example , from 10 − 7 to 10 − 4 cm ( 4 × 10 − 8 to 4 × 10 − 5 in ) in diameter ; turbulent gases can disperse particles 100 times larger . in one application , it is believed that an atomizer stage in accordance with the illustrated embodiment disperses a cupraselect ® liquid precursor so that most particles of liquid precursor dispersed in the flow of carrier gas to the vaporizer stage 202 have a size substantially smaller than 10 mils ( 0 . 010 inches ) and more similar to aerosol sized particles . the size of the particles can of course vary , depending upon the application . the atomizer stage 200 includes a valve body 204 which receives a flow of the liquid precursor through liquid inlet 30 , and a flow of carrier gas through gas inlet 36 . the liquid inlet 30 includes a coupler 206 which receives one end of a liquid precursor supply line 208 from the liquid flow controller 14 ( fig1 ). the gas inlet 36 includes a coupler 210 which receives one end of a gas supply line 212 from the mass flow controller 38 via a control valve 13 . the couplers 206 and 210 may be any of known coupler designs suitable for the particular application . the lines 208 and 212 may be flex lines as described in the aforementioned copending application to facilitate opening and closing the chamber lid 19 . referring now to fig3 and 4 , the valve body 204 of the atomizer stage 200 includes a fluidic passageway 220 which is coupled by second fluidic passage way 222 to the liquid inlet coupler 206 , and a third fluidic passageway 224 to the gas inlet coupler 210 . as best seen in fig4 the valve body passageway 220 receives a flow 230 of carrier gas from passageway 224 ( fig3 ) and a flow 232 of liquid precursor from the passageway 222 ( fig3 ) which , in the illustrated embodiment , is arranged orthogonal to the first passageway 220 . it is believed that such an arrangement provides a shearing tee intersection 236 which causes the flow 232 of liquid precursor to be “ sheared ” by the carrier gas flow 230 at the tee intersection 236 and to facilitate mixing with the flow of carrier gas as represented by the combined portions 232 a and 230 a of the flows 232 and 230 , respectively . in the illustrated embodiment , the mixing passageway 220 has a relatively narrow width as indicated at w in fig4 . the narrow width of the passageway 220 is believed to facilitate the formation of relatively small particles or droplets as the flow 232 of liquid precursor is sheared by the flow 230 of carrier gas at the tee intersection 236 . in the illustrated embodiment , the mixing passageway has a diameter in the range of 20 - 30 mils but may be larger or smaller , depending upon the particular application . the mixing passageway 220 has a pair of inlets 220 a and 220 b positioned at the tee intersection 236 . one inlet 220 a is coupled to the passageway 222 to admit liquid precursor from the passageway 222 . the other inlet 220 b is coupled to the passageway 224 to admit carrier gas from the passageway 224 . in the illustrated embodiment , the mixing passageway 220 has a relatively short overall length from the liquid precursor inlet 220 a to a cavity inlet 262 as represented by l in fig4 . the short length of the mixing passageway 220 relative to the width w of the mixing passageway is believed to inhibit recombination of the particles of the liquid precursor into larger droplets as the mixed flow of carrier gas and liquid precursor flows from the tee intersection 236 to the cavity inlet 262 . in the illustrated embodiment , the ratio of the mixing passageway 220 length l to its width w ranges from 2 : 1 to 20 : 1 . the ratio may vary , depending upon the application . the inlet 220 b of the mixing passageway 220 is coupled to a reduced diameter portion 224 a of the carrier gas passageway 224 . in the illustrated embodiment , the reduced diameter portion 224 a has the same width as the mixing passageway 220 . the rate of flow of carrier gas from the larger diameter portion 224 b of the gas passageway 224 to the mixing passageway 220 is accelerated by a constricting nozzle portion 240 ( fig3 ) positioned prior to constricted gas passageway 224 a . in the illustrated embodiment , the constricting nozzle portion 240 is hemispherically shaped to smoothly constrict the flow of gas into the reduced diameter passageway 224 a and mixing passageway 220 . it is believed that the constriction of the gas flow accelerates the gas flow velocity by the “ venturi effect .” in the illustrated embodiment , the nozzle portion 240 reduces the diameter of the gas passageway 224 by a factor of approximately ten to one . the nozzle portion 240 prior to the mixing passageway is optional and may have a variety of other shapes including cylindrical and frusto - conical . in a similar manner , the rate of flow of liquid precursor from the liquid passageway 222 to the mixing passageway 220 is accelerated by a constricting nozzle positioned in the liquid passageway 222 prior to the mixing passageway 220 . in the illustrated embodiment , the constricting nozzle is implemented by a “ zero dead volume ” valve represented schematically at 244 in fig3 . other types of valves may be used also . the valve 244 includes a valve member represented schematically at 246 which when seated again the valve member seat , closes the liquid passageway 222 to prevent the flow of liquid precursor to the mixing passageway 220 . in the open position in which the valve member 246 is displaced from the valve seat , the flow of liquid through the valve is constricted in a manner similar to that of the gas flow to accelerate the flow of liquid precursor into the mixing passageway . the constriction of the flow of liquid from the liquid passageway 222 , through the open valve 244 , to the mixing passageway 220 , is represented schematically as reduced diameter valve passageway 244 a ( fig4 ) of the passageway 222 . in the illustrated embodiment , the passageway 244 a has a diameter of approximately 10 mils and the valve 244 in effect reduces the diameter of the liquid passageway 222 by approximately ten to one . the construction details of zero dead volume valves are well known to those skilled in the art and may take a variety of forms . however , it should be appreciated that , in the closed valve position , the volume of any closed passageway of the valve 244 ( as represented by “ dead leg ” passageway 244 a ) between the mixing passageway 220 and the valve member 246 seated in the valve seat of valve 244 , is preferably as small as practical , hence the designation “ zero dead volume .” reducing the dead volume of the dead leg of the valve passageways facilitates cleaning and purging the vaporizer 12 . in the illustrated embodiment , the volume of the dead leg 244 a which is purged when the valve 244 is closed is less than 0 . 1 cc and is more preferably less than 0 . 001 cc ( cubic centimeters ). the dimensions of the valve may vary depending upon the application . in addition , the valve is optional in some applications . as best seen in fig3 the mixture of carrier gas and liquid precursor is delivered by the mixing passageway 220 to a cavity 260 formed in the valve body 204 . in the illustrated embodiment , the mixing passageway 220 has a relatively constant diameter from the shearing tee 236 to the cavity 260 such that the mixture is delivered to the cavity 260 without substantial additional constriction . to reduce back pressure , it may be desirable in some applications to minimize the length of the reduced diameter passageways . however , it is preferred that the mixing passageway be sufficiently long to centrally direct the mixed flow of carrier gas and liquid precursor to the expansion cavity . the cavity 260 includes a hemispherically shaped inlet portion 260 a followed by a generally cylindrically shaped outlet portion 260 b . the hemispherically shaped inlet portion 260 a defines the cavity inlet 262 recessed into the cavity wall and fluidically connected to the end of the mixing passageway 220 . in the illustrated embodiment , the cavity 260 lacks an injection tip or other inlet member extending into the cavity . at the opposite end of the cavity 260 , the cylindrical outlet portion 260 b defines a cavity outlet 264 having an inner diameter substantially larger than that of the cavity inlet 262 . as shown in fig3 the diameter of the cavity 260 increases monotonically in the hemispherically shaped portion 260 a . as a consequence , the mixture of carrier gas and liquid precursor exiting the mixing passageway 220 at the cavity inlet 262 , rapidly expands as it passes through the hemispherically shaped inlet portion 260 a and is not constricted by the hemispherically shaped inlet portion 260 a . it is believed that it is this rapid expansion of the mixture flow which facilitates dispersing the liquid precursor into an aerosol - like flow of very tiny particles borne by the flow of rapidly expanding carrier gas . in the illustrated embodiment , the inner diameter of the cavity 260 remains substantially constant in the cylindrical outlet portion 260 b . the outlet portion 260 b is approximately ¼ to ½ in diameter in the illustrated embodimen . the cavity 260 of the atomizer stage may have sizes and shapes other than the hemispherical and cylindrical shapes shown and described . for example , frusto - conical cavities may also be used , depending upon the application . however , constrictions in the cavity may cause an increase in the deposition of materials onto the walls of the cavity . as best seen in fig2 the vaporizer chamber 202 of the vaporizer 12 includes a housing 270 which defines a generally cylindrical vaporizer chamber interior 272 . the aerosol - like dispersion of liquid precursor and carrier gas is delivered by the atomizer outlet 264 to a central inlet 274 defined by the housing 270 of the vaporizer chamber 202 . the valve body 204 of the atomizer stage 200 is secured to the housing 270 of the vaporizer chamber 200 with the outlet of the atomizer 200 aligned with the inlet 274 of the vaporizer chamber 202 . the coupling between the atomizer 200 and the vaporizer chamber 202 is sealed with suitable seals 276 ( fig3 ). in the illustrated embodiment , the vaporizer chamber inlet 274 includes a generally cylindrical portion 274 a ( fig3 ) having the same inner diameter as the cylindrical portion 260 b of atomizer cavity outlet 264 , followed by a frusto - conically shaped expanding nozzle portion 274 b . disposed within the chamber interior 272 and facing the vaporizer chamber inlet 274 is a hot plate 280 which is heated to a temperature sufficient to vaporize the particles of liquid precursor borne by the carrier gas to the hot plate 280 . in the illustrated embodiment , the inner diameter of the vaporizer chamber inlet 274 remains substantially constant in the cylindrical portion 274 a and expands in a linear monotonic fashion in the frusto - conical portion 274 b . the inlet 274 of the vaporizer chamber 202 may have shapes other than the cylindrical and frusto - conical shapes shown and described . for example , hemispherically shaped inlets may also be used , depending upon the application . however , constrictions in the inlet may cause an increase in the deposition of materials onto the walls of the inlet . as best seen in fig5 the hot plate 280 is disposed within the vaporizer chamber interior 272 and has an annular - shaped outer zone 280 a which defines a plurality of passageways 282 disposed around the outer zone 280 a . each hot plate passageway 282 passes through the hot plate 280 to permit vaporized material to pass through the hot plate 280 and through an opening 284 ( fig2 ) in the lid 19 of the processing chamber 18 to the interior 286 of the processing chamber 18 . the size and number of the passageways 282 may vary , depending upon the application . in the illustrated embodiment , it is preferred for the passageways to be of a sufficiently large size and number so as to reduce or eliminate any substantial pressure drop as the vapor passes through the hot plate . a line of sight as indicated by the line 290 ( fig2 ) along the sides of the frusto - conical portion 274 b intersects a central disk - shaped zone 280 b on the upper surface of the hot plate 280 . as a consequence , the sides of the frusto - conical portion 274 b of the vaporizer chamber inlet 274 direct a majority of the dispersed liquid precursor material onto the central zone 280 b of the hot plate 280 to be vaporized . other angles may be selected , depending upon the application . as shown in fig2 and 5 , the central zone 280 b of the hot plate 280 has a plurality of concentric grooves 288 which receive droplets of liquid precursor from the atomizer stage 200 and vaporize the droplets into a vapor . the grooves increase the effective surface of the hot plate for transferring heat energy to the droplets to vaporize the droplets . in addition , the grooves collect droplets which do not immediately vaporize until the droplets receive sufficient energy to vaporize . the vaporized material passes through the passages 282 of the hot plate and through the lid opening 284 to the interior of the deposition chamber 18 as indicated by the flow arrow 289 . in the illustrated embodiment , the grooves 288 of the hot plate 280 have a width in the range of { fraction ( 1 / 16 )} to ⅛ inch and a depth in the range of ¼ to ½ inch . the dimensions may vary , depending upon the application . it is preferred that the grooves be sized to maintain good heat conduction to inhibit excessive cooling of the hot plate top surface . in addition , the size of the grooves can affect fabrication cost and cleaning efficiency . the vaporizer 12 including the valve body 204 , chamber housing 270 , and the hot plate 280 , is heated by a heating jacket 292 which encloses the exterior of the vaporizer chamber housing 270 and the exterior of the hot plate outer zone 280 a . the components of the vaporizer 12 in the illustrated embodiment including the valve body 204 , vaporizer chamber housing 270 , and hot plate 280 are fabricated from . aluminum . it should be appreciated that other materials may be used including other high heat conductive materials . the temperature of the components of the atomizer stage 200 and the vaporizer chamber including the hot plate 280 which may come into contact with the liquid precursor or vapor are controlled in the illustrated embodiment . the temperatures are preferably sufficiently high to facilitate vaporization of the liquid precursor and sufficiently low to avoid degradation of the chemicals . in the illustrated embodiment in which the liquid precursor is cupraselect ®, a temperature range for these components of 70 - 75 ° c . is preferred . the temperature range may of course vary , depending upon the application . alternative to the heating jacket , the heating may accomplished by any known and accepted means for chamber component heating such as , but not limited to , fluid exchange with fluid remotely heated , resistive heating elements contained in or upon the hot plate 280 , chamber housing 270 or valve body 204 , and heat lamps ( not shown ) within the chamber or the like . if the hot plate is heated by heat applied to or in the outer zone 280 a of the hot plate , it is preferred that the hot plate passageways 282 leave sufficient material of the outer zone 280 a between adjacent passageways to permit heat to be adequately conducted to the interior hot plate zone 280 b . the vaporizer chamber housing 270 is mounted on the hot plate outer zone 280 b which in turn is mounted on the deposition chamber lid 19 aligned with the opening 284 in the lid 19 . the coupling between the vaporizer hot plate 280 and the deposition chamber lid 19 is sealed with suitable seals 300 ( fig2 ) as is the coupling between the vaporizer housing 270 and the hot plate 280 . the deposition chamber 18 is defined by sidewalls 302 , floor 304 and lid 19 . the lid 19 incorporates a showerhead 308 having a plurality of orifices 310 therein to distribute the vapor for deposition . the deposition chamber 18 further contains a heated susceptor 312 for retaining a substrate 316 such as a semiconductor wafer onto which it is desirable to deposit copper . the susceptor 312 is fabricated from a durable metallic material such as aluminum or a ceramic such as aluminum nitride or boron nitride . the susceptor 312 also functions as a heater or heat sink and contains additional components to heat or draw heat from the wafer 316 . for example , the susceptor 312 can be provided with one or more resistive heater coils 313 which are connected to a power source . the power source provides a current flow through the coil 313 which generates heat within the substrate support 312 which is then conducted to the wafer 316 . an annular plate 314 circumscribes the chamber walls 302 and provides support for a cover ring 318 . copper is deposited onto the substrate 316 by cvd when a vaporized precursor from the vaporizer 12 contacts the heated wafer . cover ring 318 provides protection to peripheral portions of the substrate 316 and lower chamber regions upon which deposition is undesirable . a pressure control unit 342 , ( e . g ., a vacuum pump ), is coupled to the process chamber 18 via a valve 338 ( e . g ., a throttle valve ) to control the chamber pressure . the showerhead of the deposition chamber is optional and may be any of known conventional showerheads . in addition the showerhead may be constructed as described in the aforementioned copending application . as described therein , the showerhead 308 is fabricated to serve not only as a distribution plate for the vaporized precursor and carrier materials , but also as a secondary “ hot plate ” to catch and revaporize excess process material . the showerhead 308 performs this function by way of a plurality of optional concave segments 326 formed on an upper surface of the showerhead 308 and an optional shadow plate 324 disposed above the showerhead 308 . a flow of completely vaporized process material 289 passes from the vaporizer 12 and into the chamber 18 . a flow 343 continues through a plurality of orifices 344 provided in the shadow plate 324 and through the plurality of orifices 310 in the showerhead 308 . the shadow plate orifices 344 are offset from the showerhead orifices 310 to reduce liquid precursor contamination . specifically , a flow 345 of an incompletely vaporized ( liquid ) material from the vaporizer 12 is caught by one of the concave portions 326 on the top of the showerhead 308 . the showerhead 308 and shadow plate 324 are heated to approximately 65 ° c . which is a temperature suitable for vaporization of the liquid precursor material ( i . e ., cupraselect ®). the heating is accomplished by any known and accepted means for chamber component heating such as , but not limited to , fluid exchange with fluid remotely heated , resistive heating elements contained in or upon the showerhead 308 and / or shadow plate 324 , heat lamps within the chamber 18 or the like . as such , the liquid material vaporizes and follows a path 347 through one of the plurality of orifices 310 in the showerhead 308 . the flow of incompletely vaporized material can also occur along path 350 , become vaporized on the shadow plate 324 and continue as a vaporized flow along path 352 . it is believed that the showerhead 308 and shadow plate 324 prevent the flow of liquid material to the wafer surface by capturing and secondarily vaporizing such liquid . various components described above such as the hot plate 280 , the housing 270 or the valve body 200 may each be fabricated as monolithic or one - piece structures . alternatively , these components may be assembled from subcomponents , depending upon the particular application . the above - described apparatus and process can be performed in a system that is controlled by a processor based control system 17 ( fig1 ). fig8 shows a block diagram of a deposition system 10 , such as that depicted in fig1 having such a control system 17 that can be employed in such a capacity . the control system 17 includes a processor unit 802 , a memory 804 , a mass storage device 806 , an input control unit 808 , and a display unit 810 which are all coupled to a control system bus 812 . the processor unit 802 forms a general purpose computer that becomes a specific purpose computer when executing programs such as a program for implementing the cvd of copper of the illustrated embodiment . although this embodiment is described herein as being implemented in software and executed upon a general purpose computer , those skilled in the art will realize that the present invention could be operated using hardware such as an application specific integrated circuit asic or other hardware circuitry . as such , the control aspects of the embodiments of the present inventions should be understood as being able to be implemented , in whole or in part , in software , hardware or both . the processor unit 802 is either a microprocessor or other engine that is capable of executing instructions stored in a memory . the memory 804 can be comprised of a hard disk drive , random access memory (“ ram ”), read only memory (“ rom ”), a combination of ram and rom , or another processor readable storage medium . the memory 804 contains instructions that the processor unit 802 executes to facilitate the performance of the deposition system 10 . the instructions in the memory 804 are in the form of program code . the program code may conform to any one of a number of different programming languages . for example , the program code can be written in c +, c ++, basic , pascal , or a number of other languages . the mass storage device 806 stores data and instructions and retrieves data and program code instructions from a processor readable storage medium , such as a magnetic disk or magnetic tape . for example , the mass storage device 806 can be a hard disk drive , floppy disk drive , tape drive , or optical disk drive . the mass storage device 806 stores and retrieves the instructions in response to directions that it receives from the processor unit 802 . data and program code instructions that are stored and retrieved by the mass storage device 806 are employed by the processor unit 802 for operating the deposition system 90 . the data and program code instructions are first retrieved by the mass storage device 806 from a medium and then transferred to the memory 804 for use by the processor unit 802 . the display unit 810 provides information to a chamber operator in the form of graphical displays and alphanumeric characters under control of the processor unit 802 . the input control unit 808 couples a data input device , such as a keyboard , mouse , or light pen , to the processor unit 802 to provide for the receipt of a chamber operator &# 39 ; s inputs . the control system bus 812 provides for the transfer of data and control signals between all of the devices that are coupled to the control system bus 812 . although the control system bus is displayed as a single bus that directly connects the devices in the processor unit 802 , the control system bus 812 can also be a collection of busses . for example , the display unit 810 , input control unit 808 and mass storage device 806 can be coupled to an input - output peripheral bus , while the processor unit 802 and memory 804 are coupled to a local processor bus . the local processor bus and input - output peripheral bus are coupled together to form the control system bus 812 . the control system 17 is coupled to the elements of the deposition system 10 , employed in copper cvd in accordance with the illustrated embodiment . each of these elements is coupled to the control system bus 812 to facilitate communication between the control system 17 and the elements . these elements include the following : a plurality of valves 814 ( such as valves 13 and 15 of fig1 ), the heating elements ( such as the heating element 113 and heating jacket 292 of fig2 ), the pressure control unit 342 , the flow controllers ( such as the flow controllers 14 and 38 of fig1 ), vaporizer 12 ( including the valve 244 of fig3 ), and a pressure source controller ( such as pressure source 24 of fig1 ). the control system 17 provides signals to the chamber elements that cause these elements to perform operations for forming a layer of copper in the subject apparatus . in operation , the processor unit 802 directs the operation of the chamber elements in response to the program code instructions that it retrieves from the memory 804 . for example , once a wafer is placed in the processing chamber 100 , the processor unit 802 executes instructions retrieved from the memory 804 such as activating the heating element 313 , controlling valves 814 to produce the desired flow rate of precursor and carrier materials , move susceptor 312 into position for cvd and the like . the execution of these instructions results in the elements of the deposition system 10 being operated to deposit a layer of material on a substrate . the novel deposition system described above may provide for an improved cvd operation by more completely and uniformly dispersing and vaporizing a precursor material in a chamber . additionally , various features of the deposition system may include a reduction in the likelihood of clogging or excessive and undesirable plating that potentially creates particles in the chamber and / or premature failure or excessive maintenance of system components . it should be understood that the preceding is merely a description of some embodiments of the present inventions and that numerous changes to the disclosed embodiments can be made in accordance with the disclosure herein without departing from the spirit or scope of the inventions . the preceding description , therefore is not meant to limit the scope of the inventions . rather , the scope of the inventions are to be determined only by the appended claims and their equivalents .	2
reference is now made to fig1 which illustrates the stent fabrication method of the present invention . in the stent fabrication method of the present invention , a drawing representing a stent is designed on a computer that generates a printout with the desired stent pattern presented in a flat format 40 . the pattern of step 40 can be printed on any size printout , but generally must be reduced to fit the requirements of photographic film 42 and the dimensions of the desired stent design . after the drawing of the stent pattern is reduced , it is transferred onto a high contrast transparent film 44 . the final step requires that the photo - transparent film be calibrated to match the circumference and dimensions of the tubular member employed in the fabrication process 46 . the tubular member can be any type of biocompatible materials , such as titanium , tantalum , stainless steel , platinum , gold alloy or gold / platinum alloy , a polymeric material or a material which is plated with a biocompatible material . the preferred candidate for stainless steel material for the tubular member is either the 316 or 321 stainless steel classes . the process of forming the tubular member is well known extrusion technology . it is preferable to have the tubular member relatively consistent in diameter , concentricity , thickness and seamless . to process the particular tubular member , is it preferable to clean and remove contaminates 20 . the tubular member can be further treated by exposing the cleaned tubular member to a temperature in the range of 100 to 200 degrees celsius . dependent on the tubular member &# 39 ; s material and the photo - sensitive resist material employed , a coupling agent may be necessary to enhance the adhesion of the photo - sensitive resist to the outer surface of the tubular member . therefore , after cleaning , the outside surface of the tubular member is optionally coated with a coupling agent 22 . the processed tubular member is then coated with a photo - sensitive solution 24 . next , a novel apparatus is employed which exposes the resist coated tubular member to a specific pattern of uv light 26 . the exposed tubular member is then immersed into a negative resist developer 28 , whereby unexposed resist is removed from the processed tubular member . fig2 is a schematic view of the finished stent of the present invention in its intended operational environment . a stent resulting from the present invention can be used to treat atherosclerotic disease , prevent vessel recoil , overlie an aortic dissecting aneurysm , tack dissections to the vessel wall , and eliminate the risk of occlusion caused by flaps in both coronary native vessels and by - pass grafts . stents can also be used to reinforce collapsing structures in the respiratory , biliary , urological , and other tracts . for steps 20 , 22 and 24 , fig3 demonstrates a simple means for exposing tubular member 64 to a cleaning solution 60 , coupling agent 61 , or the photo - sensitive resist 63 within a container 62 . for example , industroclean solvent detergent made by amway corporation is an example of suitable commercially available cleaning solution . a number of organo - silane coupling agents may be employed with the current invention process . some examples of commercially available organo - silane coupling agents are vinyltriethoxysilane or methyltriethoxysilane made by union carbide and z - 6040 ( containing glycidoxypropyltrimethoxysilane ) or z - 6020 ( containing aminoethylaminopropyltrimethoxysilane ) made by dow corning . probimide made by olin industries is an example of suitable commercially available photo - sensitive resist . when exposing the tubular member 64 with some commercially available photo - sensitive resists 63 , the thickness of the resist polymer layer is dependent upon the amount of exposure time and possibly , the method of exposure or other variables . one method that can be employed to control the thickness of the photo - sensitive resists is to uniformly draw the tubular member ( s ) 64 through a solution of photo - resist for a specified period of time to obtain the desired coating layer . furthermore , it may be desirable to protect the internal lumen of the tubular member from the photo - sensitive resist polymer during the exposure process . it should be obvious to the one skilled in the art that standard methods of subjecting one or more tubular members to a cleaning solution are commercially available and can be employed with the present invention . in addition , it would be obvious to those skilled in the art to expose the cleaned tubular member to a heat source , preferably in the temperature range of 100 to 200 degrees celsius , to facilitate drying of the tubular member . furthermore , it should be obvious to one skilled in the art that standard methods of coating one or more tubular members with a coupling agent or photo - sensitive resist are commercially available and can be employed with the present invention . having said this , subjecting tubular members of different metallic compositions may require different commercially available photo - sensitive resists or , if necessary , coupling agents . fig4 - a demonstrates a cross - section of the outer surface of tubular member 64 coated with a photo - sensitive resist 66 . in this example , the adhesion properties between tubular member 64 and the resist 66 is robust enough to not require an intermediate coupling agent layer . for example , using class 316 or 321 stainless steel for the tubular member with probimide made by olin industries is an example of a suitable photo - sensitive resist / tubular member combination that does not need a coupling agent . it should be recognized by the artisan that there are several classes of polymers that can be employed with the present invention to function as a protective coating . fig4 - b shows a cross - section of the outer surface of tubular member 64 coated with a photo - sensitive resist 66 . sandwiched between the tubular member 64 and resist 66 is a coupling agent 68 . in this example , the adhesion properties requires the use of a coupling agent to facilitate and strengthen the bond between the tubular member 64 and the resist 66 . for example , using gold alloy or platinum metal for the tubular member with probimide photo - sensitive resist is an example of a combination that may need an organo - silane coupling agent to strengthen the bond between the tubular member and the resist . fig5 a and 5b show a preferred stent configuration imprinted on a transparent photographic film . the drawing of the pattern is generated on a computer program , reduced and printed onto a transparent film . for example , a stress analysis program called algor was used to develop the computer generated printouts . the printout is then sent to a film processing facility who reduces the printout and generates a precisely dimensioned negative . as discussed in more detail below , the dimensions of the negative must be calibrated to render a specific stent design . because of regulations concerning patent drawings which prohibit large blackened areas , an explanation of the drawings used to represent the photographic film is necessary . in fig5 a and 5b , the open ( transparent ) spaces which allow the uv light to pass through the film are represented as solid black lines and alternating loops . the white areas of the drawings 5a and 5b represent the exposed ( black ) areas of the film which will block the uv light from passing through the film and exposing the underlying areas to uv . an example of a suitable film that can be employed in the present invention is kodak ali - 4 accumax film made by kodak industries . the length 77 of stent imprint is directly equal ( 1 to 1 ) to the circumference of tubular member 64 . the width 75 is equivalent to the working length of the processed stent . fig5 b shows the transparent photographic film 76 with multiple frames 70 of the preferred stent configuration . fig6 shows sections of the apparatus including the ultraviolet lamp 82 laid - out in a typical configuration with sealed bulb 81 and filament 80 in an assembly . a regulating platform 84 comprises a base 84 with a top plate 88 . a specially configured slit 87 centers the ultraviolet light into a narrow beam which reaches and penetrates the specific pattern of transparent film 76 . selected portions of the coated tubular member are illuminated with ultra - violet light which causes the exposed photo - resist to react and change its properties ( cure and harden ) and result in those portions remaining after electro - chemical etching as the stent struts 118 . the platform also comprises a rotating member 86 engaged with tubular member 64 . rotating member 86 moves in conjunction with the film passing over the rotating tubular member . for step 28 , fig7 demonstrates a simple means for exposing tubular member 92 to a negative resist developer 90 , within a container 94 . it should be recognized by the artisan that there are numerous commercially available solvents for selectively removing the unexposed photo - sensitive resist of polymeric protective coating . it should also be obvious to the artisan that standard methods of exposing one or more tubular members with a negative resist developer can be employed . fig8 is a representation of step 30 where a means 100 is used to remove unexposed photo - sensitive resist or protective polymeric coating and rinse excess negative resist developer or other selective solvents from the partially exposed tubular member 92 using an appropriate solvent 102 . in the preferred embodiment , qz3501 made by olin industries is an example of suitable commercially available solvent to rinse the excess negative resist developer . at this time , the entire tubular member is incubated for a specified period of time , allowing the remaining photo - sensitive resist polymer to fully cure ( harden ) and attach to the surface of the processed tubular member . the tubular member can be incubated at room temperature or can be exposed to a heat source in the range of 100 to 400 degrees celsius . fig9 is a representation of step 32 where an electro - chemical means is employed to remove the unexposed metallic material from the exposed tubular member 92 . shown in fig9 is electro - chemical solution 110 contained within a member 116 . in the preferred embodiment , a combination of phosphoric acid and sulfuric acids are employed to the etch unexposed metallic material . hydrite 4000 made by hydrite industries is an example of suitable commercially available electro - chemical etching solution that contains the phosphoric and sulfuric acids . when employing a tubular member composed of stainless steel class 304 , the preferred electro - chemical etching solution comprises a solution of ferric chloride . if the tubular member is composed of a gold alloy or platinum , other electro - chemical etching solutions , such as potassium cyanide , aqua regia ( hydrochloride and nitric acids ), or sodium hypochlorite may be required . to energize the etchant solutions , a negative charge is supplied through cathode 112 ( which is immersed in the etchant solution ) to the positively charged electrode 114 with is engaged to final tubular member 119 ( of which both are immersed in the etchant solutions ). materials commonly employed as cathodes are platinum or gold . it should be obvious to one skilled in the art that standard methods of treating one or more tubular members with a electro - chemical means can be employed . fig1 is a representation of the preferred stent design 72 that results from the present invention method . the portions of the photoresist that were exposed to uv illumination and changed physical properties ( cured and hardened ) are retained during the electro - chemical process and remain intact as the struts or loops 118 of stent 72 . the portions of the photoresist that were not exposed to uv illumination are removed during the electro - chemical process and result in open spaces 120 . the structure resulting from a pattern of struts 118 and open spaces 120 comprises the desired stent configuration . the present invention results in the preferred stent design 72 having specifically configured struts 118 . fig1 , 12 , and 13 illustrate , in cross - section , three exemplary stent strut designs . as demonstrated in fig1 , the preferred stent design has the outer portion of the struts protruding in a trapezoidal configuration 134 which is directed radially from the longitudinal axis of the stent . the pattern of the preferred stent employs cross - section fig1 and has a series of loops ( u - shaped ) 118 and a single backbone running along the length of the stent , thereby forming the basic scaffold of the stent design . the pattern of fig1 and 11 can be formed of any size ; a preferable size is between 0 . 035 thousandths to 0 . 100 thousandths in diameter when formed ( crimped ). the expanded or deployed diameter ranges from 2 . 0 mm to 8 . 0 mm with a preferred range for coronary applications of 2 . 5 mm to 6 . 0 mm . the length of the stent is virtually constant from its initial formation length to its length when expanded and ranges from 2 mm to 50 mm , with a preferred length for coronary applications of 5 mm to 20 mm . in an alternate embodiment , the pattern of stent 72 is similar to that of fig1 and 11 but differs in the outer portion of the strut comprising a triangular configuration 132 ( fig1 ) where the point of the triangle is directed radially from the longitudinal axis of the stent . in another alternate embodiment , the pattern of stent 72 is similar to that of fig1 and 11 but differs in the outer portion of the strut comprising an extended base with a radius 130 ( fig1 ) which is directly radially from the longitudinal axis of the stent . finally , the stent 72 can be polished to remove any excess material not properly removed by the process . the polishing can be performed mechanically , by rubbing a polishing stick having diamond dust on its outside inside the stent 72 . alternatively , an additional electro - polishing step can be utilized . fig1 is a simplified perspective view of the apparatus used in the present invention stent fabrication process . mounted on a stage is a supporting means 141 for locating the enclosure 142 containing uv light source 82 over the y shaped regulating platform 84 . the uv light source has a wavelength within the range of 360 to 440 nanometers with a preferred wavelength of 390 nanometers . a series of repeating stent patterns or individual frames 70 are imprinted on a spool of film 147 which is engaged to rotating shaft 146 . a motor 143 is engaged to and rotates the shaft 146 which speed is regulated by controller 140 . mounted also on the stage is regulating platform 84 which supports the coated tubular member 64 engaged to a rotatable shaft 86 . the top of the regulating platform comprises a plate which is mounted within two horizontal inward facing slots cut into regulating platform 84 . the top contains a specifically configured centering slit 87 positioned over the film 76 and coated tubular member 64 . the function of the configured slit is to act as a slit lens and center the uv light obtained from the light source onto the narrow region of the film . in this simplified example of the apparatus , the film engages the tubular member 64 which is free to rotate on shaft 86 . the movement of the photographic film over the tubular member 64 generates a rotational force which is in unison with the advancement of the film . an alternate method not shown would be to use a synchronized motor mechanism that would control both the advancement of the film and the corresponding rotation of the tubular member . also not shown is a means to automatically remove the exposed tubular member 92 from the regulating platform and replacing with a coated tubular member 64 . the automatic mechanism needs to correspond with the movement of the film to replace the tubular member between individual stent patterns ( frames ) 70 . mounted on the side of the stage is another supporting means 154 containing a rotatable shaft 150 . a weight is suspended from the end of the photographic film 148 and functions to provide tension on the photographic film to ensure adequate engagement with coated tubular member 64 . a take - up reel or any number of tensioning mechanisms can suffice for the weight 148 . fig1 is a cross - sectional view of the apparatus as seen along line 2 -- 2 in fig1 showing the perspective view of the apparatus . this cross - sectional view shows the relative position of uv light source 82 over regulating platform 84 , slit 87 and tubular member 64 . it can be seen from this figure that weight 148 provides tension to maintain the engagement of the photographic film to the tubular member . fig1 is a cross - sectional view of the light source and the regulating platform . this view demonstrates the orientation of the light source 82 facing in the general direction of the regulating platform 84 . diffuse uv light ( shown by the arrows emanating from the light source ) enter into specially configured slit 87 . the figure also demonstrates one embodiment of the apparatus where the forward advancement of the photographic film 76 ( shown by arrow ) generates a rotational force ( shown as clockwise ) on the coated tubular member 64 which moves in unison with the film . fig1 is a cross - sectional enlargement of the regulating platform of the apparatus , specifically demonstrating the configuration of the focusing slit 87 . light enters beveled angles 90 which funnels the electromagnetic energy into a narrow channel 92 finally engaging photographic film 76 . the pattern imprinted on the film blocks some of the light rays ; while spaces in the pattern allow light to reach and react with the photo - sensitive resist on the coated tubular member 64 . this process transfers the stent pattern from the relatively flat photographic film to the circular tubular member . fig1 is a side perspective view of the regulating platform . this figure shows a section of regulating platform 84 , depicting one of the beveled angles 90 and one side of the narrow channel 92 of slit 87 . also demonstrated is that the width of beveled angle 90 and channel 92 is approximately equivalent to the width of the photographic film 76 . also shown is the photographic film 76 engaged with coated tubular member 64 . length 77 of frame 70 is designed and calibrated to equal the circumference of tubular member 64 . it is to be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather the scope of the present invention is defined only by the claims which follow :	0
in practicing this invention , the powdered alloy comprising a relatively noble matrix metal and a solute metal is produced by conventional techniques such as melting the metal under inert or reducing conditions and thereafter comminuting the alloy by atomization to form a particulate alloy having an average particle size of less than about 300 microns . water atomization of molten metal alloys is shown in u . s . pat . no . 2 , 956 , 304 wherein metal particles are produced at particularly small particle sizes less than about 100 mesh . water atomization similarly causes considerable surface oxidation of alloy particles due to the high temperatures of molten metal as well as the oxidizing characteristics of the water itself . the noble matrix metal in the alloy can be defined broadly as those metals having a melting point of at least about 200 ° c . and whose oxides have a negative free energy of formation at 25 ° c . of from 0 to 70 kilocalories per gram atom of oxygen . suitable alloy matrix metals include , for example , iron , cobalt , nickel , copper , cadmium , thallium , germanium , tin , lead , antimony , bismuth , molybdenum , tungsten , rhenium , indium , palladium , osmium , platinum , and rhodium as more particularly set forth in u . s . pat . no . 3 , 779 , 714 . in any particular combination of matrix metal and solute metal in the alloy to be dispersion strengthened by internal oxidation , the matrix metal must be relatively noble with respect to the solute metal so that the solute metal will be preferentially oxidized . this is achieved by selecting the solute metal such that its negative free energy of oxide formation at 25 ° c . is at least 60 kilocalories per gram atom of oxygen greater than the negative free energy of formation of the oxide of the matrix metal at 25 ° c . such solute metals have a negative free energy of oxide formation per gram atom of oxygen of over 80 kilocalories and generally over 120 kilocalories . suitable alloy solute metals include : silicon , titanium , zirconium , aluminum , beryllium , thorium , chromium , magnesium , manganese , niobium , tantalum , and vanadium ( vo ), as more particularly set forth in u . s . pat . no . 3 , 779 , 714 . in accordance with the process of this invention , atomized alloy particles substantially free of oxide surface film are internally oxidized to form dispersion - strengthened metal . in accordance with one aspect of this invention , atomized alloy particles are processed to remove the oxide build - up on the particle surface formed during atomization . the surface oxide film can be mechanically removed such as by milling , grinding or roll flaking the atomized alloy particles . ballmilling , for example , can be used at a 4 : 1 to 8 : 1 ratio of ball / metal for 2 to 8 hours . roll flaking can be used to reduce thickness of the atomized particles as well as remove oxide films which are believed to break up and / or redistribute the surface oxide over a larger surface area generated by the flaking of spherical powder . flakes have larger surface : volume ratio than spheres of same volume . these and similar processes which deform or flatten the powder particle would be suitable . in accordance with a further aspect of this invention , the surface oxide film can be removed by chemical action such as leaching . for example , atomized copper alloy powder can be leached in dilute nitric acid , ammonium hydroxide and also in mixtures of ammonium and sodium hydroxides . still , a further method of preventing surface oxide build - up on the atomized alloy particles pertains to collecting the alloy powder in a dry medium and avoid wet collection mediums such as water . dry collection within helium , for instance , prevents contact with an oxidizing substance as well as avoids steam formation within the atomization chamber . helium is substantially better than nitrogen in that the thermal conductivity thereof is 6 . 5 times that of nitrogen whereby much faster quenching , without appreciable oxidation , can be achieved . helium quenching enables faster quenching of the atomized particles , thus minimizing oxidation of the solute metal such as aluminum at the particle surface and further minimizes migration of solute metal from the center of the alloy particle to the particle surface which can detrimentally deplete the alloy particle of solute metal . the alloy particles being substantially free of surface oxide build - up can be internally oxidized by a variety of methods such as disclosed in u . s . pat . nos . 3 , 488 , 185 ; 3 , 552 , 954 ; and 3 , 179 , 515 . a particularly preferred method is shown in commonly assigned u . s . pat . no . 3 , 779 , 714 wherein 100 weight parts of alloy particles are mixed with about 0 . 1 to 10 weight parts of oxidant . the exact proportion of oxidant mixture depends on the solute metal to be oxidized and the concentration of solute metal in the alloy . the preferred oxidant comprises an intimate mixture of heat - reducible metal oxide having a negative free energy of formation at 25 ° c . of up to about 70 kilocalories per gram atom of oxygen , and finely divided hard , refractory metal oxide having a negative free energy of formation exceeding the negative free energy of formation of the heat - reducible metal oxide by at least about 60 kilocalories per gram atom of oxygen at 25 ° c . the heat - reducible metal oxide is present in the oxidant in an amount sufficient for complete oxidation of the solute metal in the alloy . the hard , refractory oxide in the oxidant is present in substantially the same equivalent elemental proportion as the solute metal in the alloy , and both are of a particle size suitable for dispersion strengthening of the oxidant residue resulting from the internal oxidation , as set forth in u . s . pat . no . 3 , 779 , 714 . after internal oxidation , the oxidant residue comprises particles of in situ residue of heat - reducible metal oxide and particles of hard , refractory metal oxide uniformly distributed therein and the residue of heat - reducible metal oxide is intimately dispersed within the alloy powder . the dispersion - strengthened metal mixture is eventually coalesced and consolidated by hot - working to form a solid metal workpiece whereby the residue of heat - reducible metal is dispersion strengthened by the hard , refractory metal oxide and forms an integral part of the dispersion strengthened resulting workpiece . dispersion strengthened metal powders are ordinarily consolidated under heat and pressure such as by extrusion at temperatures usually above about 1400 ° f . wherein the extrudate emerges from the extrusion press typically in cylindrical bar stock which then can be cold drawn and machined to the desired configuration of the workpiece . the advantages of this invention wherein surface oxide build - up is either prevented or removed from alloy particles prior to the step of internally oxidizing are further illustrated in the following examples . a copper alloy containing 0 . 2 % by weight alloyed aluminum was atomized by helium and collected dry . the powder was then heat treated in accordance with the process of u . s . pat . no . 3 , 779 , 714 and finally hot extruded into 1 / 4 &# 34 ; dia rods . table 1 shows the room temperature mechanical properties of this material compared with the conventional alloy made by nitrogen atomization and water collection . table 1______________________________________room temperature properties of internallyoxidized cu - 0 . 20 % al alloy . ( n . sub . 2 / wet vs . he / dry ) tensile electricalatomization hardness strength elongation conductivity______________________________________ ( gas / collection ) ( r . sub . b ) ( psi ) (%) (% iacs ) n . sub . 2 / water 58 58 , 000 24 91he / dry 68 68 , 000 22 92______________________________________ there is a significant improvement in room temperature tensile strength and hardness on helium atomized and dry collected material . the improvement is even more dramatic at high temperatures . this is demonstrated by the data in table 2 . table 2______________________________________1550 ° f . stress rupture properties of internallyoxidized cu - 0 . 20 % al alloy . ( n . sub . 2 / wet vs . he / dry ) 100 hour rupture strengthatomization at 1550 ° f . ______________________________________ ( gas / collection ) ( psi ) n . sub . 2 / water 3 , 800he / dry 8 , 000______________________________________ the 100 hour rupture strength at 1550 ° f . was more than doubled when the alloy powder was atomized by helium and collected dry . this also comprises a significant improvement over the best values reported in literature for similar composition in as extruded condition . preston and grant 1 report a 100 rupture stength value of 6 , 000 psi for internally oxidized cu - 0 . 23 % al alloy . the room temperature properties reported by them are similar to those of he / dry material .	2
with reference to fig1 to 7 , the following description will describe an operator seat portion ( seat portion , operator seat ) 22 that is disposed in a cab 20 of a wheel loader ( construction machine ) 10 according to one embodiment of the present invention . as used herein to describe the present invention , the following terms “ front ”, “ rear ”, “ right ”, and “ left ” refer to the directions as follows . the term “ front ” should be defined as a direction that an operator faces in a state where the operator sits on the operator seat ( the advance side of the wheel loader 10 ). the term “ rear ” should be defined as the reverse side of the wheel loader 10 . the term “ right ” should be defined as the right side of the operator in a state where the operator faces toward the advance side , and the term “ left ” should be defined as a direction opposite to the right side of the operator . as shown in fig1 , a cab structure according to this embodiment is applied to a cab 20 that is mounted on the wheel loader 10 . the wheel loader 10 includes a body unit 11 , a lift arm 12 , a bucket 13 , four tires 14 , and the cab 20 . the lift arm 12 is mounted to the front part of the body unit . the bucket 13 is mounted to the fore end of the lift arm 12 . the tires 14 support the body unit 11 , and rotate so that the body unit runs . the cab 20 is mounted on an upper part of the body unit 11 . the body unit 11 includes an engine room and an actuator portion . the engine room accommodates an engine ( not shown ). the actuator portion actuates the lift arm 12 and the bucket 13 . the lift arm 12 is an arm member that lifts the bucket 13 mounted to the fore end of the lift arm 12 , and is actuated by a lift cylinder that is installed together . the bucket 13 is mounted to the fore end of the lift arm 12 . a bucket cylinder controls dumping and tilting of the bucket 13 . the cab 20 has rollover protective structure ( hereinafter , referred to as rops ), and includes a door 25 that is disposed on the right side surface of the cab 20 . the cab 20 forms an operator compartment for the operator that is composed of combination of a plurality of steel pipes and plates . the cab 20 is disposed slightly frontward of the middle part of the body unit 11 . the structure of the cab 20 and its mount structure will be described bellow . as shown in fig2 , the operator seat portion 22 and a steering device ( operation portion ) 24 are disposed in the interior compartment of the cab 20 according to this embodiment . the interior compartment is formed by the door 25 , a front windshield fg , and so on that are mounted to a frame portion . the frame portion is formed by a plurality of pole members 21 a - 21 f , and so on . in the pole members 21 a - 21 f , the front - right , front - left , rear - right and rear - left corner pole members 21 a , 21 b , 21 c and 21 d are arranged in the proximity of four corners of the cab 20 , and the right - middle and left - middle pole members 21 e and 21 f are arranged on the left and right side surfaces of the cab 20 , respectively . as shown in fig3 , the operator seat portion 22 includes a seat section 22 a and a backrest ( backrest section ) 22 b . the operator ( driver ) who operates the wheel loader 10 sits on the seat section 22 a . the backrest 22 b supports operator &# 39 ; s back . the operator seat portion 22 is located in the proximity of a middle part of the cab 20 . the operator seat portion 22 moves frontward and rearward along slide rails ( not shown ) that are included in a slide mechanism 41 . the slide mechanism 41 is disposed on a bottom - side support section 23 d of a hanging - from - above mechanism ( hanging portion , rotation mechanism , operator seat ) 23 . in addition , the angle of the backrest 22 b of the operator seat portion 22 can be also adjusted by an angle adjustment mechanism 42 . specifically , the angle adjustment mechanism 42 adjusts the angle of the backrest 22 b by frontward and rearward movement of the bottom end of the angle adjustment mechanism 42 in accordance with frontward and rearward slide movement of the seat section 22 a . in this configuration , the operator slides the seat section 22 a frontward and rearward , or adjusts the backrest section 22 b to a desired angle to meet operator &# 39 ; s need when stepping into / off the cab or operating the wheel loader , therefore , it is possible to improve the comfort for the operator in the cab 20 . the hanging - from - above mechanism 23 that supports the operator seat portion 22 from above will be described bellow . as shown in fig2 , for example , the steering device 24 is disposed between the operator seat portion 22 and the front windshield fg . the operator operates operation levers ( operation part ) 31 , a switch panel ( operation part ) 32 and so on ( see fig4 , described later ) to changes the traveling direction of the wheel loader 10 or to control the bucket 13 , and so on . the structure of the steering device 24 will be also described later . the door 25 is attached to the right side of the cab 20 , and pivots about hinges as a pivot axis that are secured to the right - middle pole member 21 e so that the door 25 is opened / closed outside the cab 20 . as shown in fig3 , for example , the operator seat portion 22 according to this embodiment is supported by the hanging - from - above mechanism 23 . the hinging - from - above mechanism 23 supports the operator seat portion 22 from above so that the operator seat portion 22 is hung . the hanging - from - above mechanism 23 is connected to a ceiling surface 20 a of the cab 20 . the hanging - from - above mechanism 23 connects the operator seat portion 22 to the ceiling surface 20 a of the cab 20 , and serves as a rotation mechanism that changes the orientation of the operator seat portion 22 . the hanging - from - above mechanism 23 includes a rotation shaft 23 a , a ceiling - side support section 23 b , a backside support section 23 c , and a bottom - side support section 23 d . as shown in fig3 , the rotation shaft 23 a is disposed substantially perpendicular to the ceiling surface 20 a , and serves as a rotation axis for changing the orientation of the operator seat portion 22 when the operator steps into / off the cab . the rotation shaft 23 a is inserted into an opening that is formed in the ceiling - side support section 23 b . the ceiling - side support section 23 b rotates together with the operator seat portion 22 in a substantially horizontal direction about a part corresponding to the opening that is provided with the rotation shaft 23 a inserted thereto . as shown in fig6 , for example , the rotation range of the ceiling - side support section 23 b is restricted by a recessed portion 20 b that is formed on the ceiling surface 20 a of the cab 20 and has a stepped shape . that is , the side surfaces of the ceiling - side support section 23 b come in contact with the stepped - shape parts of the recessed portion 20 b as a recessed part of the ceiling surface 20 a . this contact restricts the ceiling - side support section 23 b into a predetermined rotation angle in the rightward and leftward rotation directions . accordingly , the operator seat portion 22 is rotated in a desired rotational direction , when the operator steps into / off the cab 20 . therefore , it is possible to improve ease of stepping into / off the cab . in addition , in operation of the wheel loader , when the operator turns operator &# 39 ; s face to the rear to look behind in a state where the operator sits on the operator seat portion 22 , rotation of the operator seat portion 22 allows the operator to easily look behind . the restriction of the rotation range within the predetermined range can prevent the operator seat portion from rotating too much than required . the ceiling - side support section 23 b is connected to the backside support section 23 c at an l - shaped part . a protection structure that protects an area in the proximity of operator &# 39 ; s head is formed by integrally forming the ceiling - side support section 23 b and the backside support section 23 c , or by employing a structure that firmly connects both sections . as a result , even in case that a large load is applied onto an upper part of the cab 20 and the upper part of the cab 20 is deformed , the area in the proximity of operator &# 39 ; s head can be protected by the protection structure composed of the ceiling - side support section 23 b and the backside support section 23 c . the backside of the backrest 22 b of the operator seat portion 22 is attached to the backside support section 23 c . the top and the bottom of the backside support section 23 c are connected to the ceiling - side support section 23 b and the bottom - side support section 23 d , respectively . the bottom - side support section 23 d is a substantially l - shaped support member that is connected to the bottom of the backside support section 23 c , and supports the bottom surface of the seat section 22 a of the operator seat portion 22 . in this embodiment , since thus - constructed hanging - from - above mechanism 23 supports the operator seat portion 22 , it is not necessary to provide a member that is disposed on the floor of the cab 20 to support the operator seat portion 22 . for this reason , as shown in fig3 , space s is provided under the bottom - side support section 23 d . accordingly , even in case that the cab 20 is deformed due to a large load that is applied on to the ceiling surface of the cab 20 , the operator seat portion 22 can be moved into the space s that is provided between the operator seat portion 22 and the floor of the cab 20 . as a result , even in case that an upper part of the cab 20 is deformed , for example , it is possible to efficiently prevent that shock is applied to an area in the proximity of operator &# 39 ; s head as compared with conventional operator seats . in addition , in a normal condition , since the space s is normally provided under the operator seat portion 22 , it is possible to improve ease of cleaning up the interior of the cab 20 . in this embodiment , the steering device 24 includes left and right arm sections ( arm sections ) 24 a and 24 b , and a support section 24 c . as shown in fig4 , the operation levers 31 and the switch panel 32 are disposed on the top surfaces of the left and right arm sections 24 a and 24 b in a horizontal position , respectively . the left and right arm sections 24 a and 24 b are connected to the support section 24 c that stands on the floor of the cab 20 through a pivot shaft 24 d . the left and right arm sections 24 a and 24 b integrally pivot upward and downward relative to the support section 24 c about the pivot shaft 24 d . as shown in fig3 and 4 , the left and right arm sections 24 a and 24 b extends in a substantially horizontal direction . in this horizontal position , the fore ends of the left and right arm sections 24 a and 24 b extend in the front - to - rear direction to reach a part in the proximity of the backrest 22 b of the operator seat portion 22 so that the operator who sits on the operator seat portion 22 is surrounded by the left and right arm sections 24 a and 24 b , for example . on the other hand , in a standing position , as shown in fig5 , the left and right arm sections 24 a and 24 b pivot to a position along the front windshield fg so that the operator can freely approach space between the operator seat portion 22 and the steering device 24 , and space in the side of the operator seat portion 22 . the support section 24 c stands on the floor of the cab 20 to support the left and right arm sections 24 a and 24 b . specifically , as shown in fig5 , the support section 24 c is disposed between the operator seat portion 22 and the front windshield fg in the front - to - rear direction , and between an accelerator pedal 26 and a brake pedal 27 in the left - to - right direction . as shown in fig4 , the tilt angle of the support section 24 c can be adjusted in the front - to - rear direction about a connection part between the support section 24 c and the floor of the cab 20 as a pivot axis . in addition , as shown in fig7 , a folding monitor 28 is mounted to an upper part of the support section 24 c . the monitor 28 is unfolded at the upper part of the support section 24 c as shown in fig7 when required , for example , when the operator operates the wheel loader , and pivots about a pivot shaft ( not shown ) that is disposed on the backside of the support section 24 c and thus is folded onto the backside of the support section 24 c when not in use . accordingly , it is possible to minimize reduction of operator &# 39 ; s range of front vision due to the monitor 28 installation , and to ensure the maximum operator &# 39 ; s range of vision . in this embodiment , the steering device 24 that is tiltable upward and downward is used in combination with the operator seat portion 22 that is supported from above by the aforementioned hanging - from - above mechanism 23 . thus , the left and right arm sections 24 a and 24 b pivot and swing upward from the normal horizontal position shown in fig3 and 4 to the standing position along the front windshield fg shown in fig5 . accordingly , this structure ensures wide space between the operator seat portion 22 and the steering device 24 . therefore , it is possible to further improve ease of stepping into / off the cab for the operator . in a case where the tilt angle of the support section 24 c can be changed upward and downward together with the left and right arm sections 24 a and 24 b , the position of the steering device 24 can be changed in two tilt - up positions . as a result , the operator can choose whether only the left and right arm sections 24 a and 24 b pivot to the standing position , or the support section 24 c additionally pivots to the standing position depending on the situation when operator steps into / off the cab . the operator seat portion 22 of the wheel loader 10 according to this embodiment is disposed in the cab 20 of the wheel loader 10 , as shown in fig1 . the operator seat portion 22 includes the seat section 22 a that the operator sits on , and the backrest 22 b , as shown in fig3 . a part of operator seat portion 22 is connected to the ceiling surface 20 a of the cab 20 , and is supported by the hanging - from - above mechanism 23 in a hanging - from - above manner . accordingly , the space s can be provided between the operator seat portion 22 that the operator sits on , and the floor of the cab 20 , as shown in fig3 . the space s that is formed under the operator seat portion 22 not only provides ease of cleaning up the interior of the cab 20 but also provides protection space above operator &# 39 ; s head in case that an upper part of the cab 20 is deformed or damaged , for example . specifically , even in case that the hanging - from - above mechanism 23 that supports the operator seat portion 22 is disconnected from the ceiling surface 20 a due to deformation or the like of the upper part of the cab 20 , since the space s exists under the seat , the operator seat portion 22 falls onto the floor of the cab 20 . therefore , it is possible to more surely provide the protection space above operator &# 39 ; s head as compared with conventional cabs in case of deformation or the like of the upper part of the cab . the operator seat portion 22 of the wheel loader 10 according to this embodiment is hung from the ceiling surface 20 a of the cab 20 by the hanging - from - above mechanism 23 , as shown in fig3 . in addition , the operator seat portion 22 rotates in a substantially horizontal direction about the rotation shaft 23 a that is included in the hanging - from - above mechanism 23 . accordingly , in a case where the hanging - from - above mechanism 23 is used , since the operator seat portion 22 can be turned toward the stepping into / off door 25 , it is possible to sufficiently provide ease of stepping into / off the cab for the operator . in addition , in a state where the operator sits on the operator seat portion 22 , when the operator turns operator &# 39 ; s face to the rear to look behind , rotation of the operator seat portion 22 allows the operator to easily look behind . as a result , since the operator seat portion 22 and the hanging - from - above mechanism 23 are provided , it is possible to provide the cab 20 that provides ease of stepping into / off the cab , and additionally provides excellent workability . as shown in fig4 and 5 , the operator seat portion 22 of the wheel loader 10 according to this embodiment is opposed to the steering device 24 that can pivot upward and downward and can be changed between the normal horizontal position ( see fig4 ) and the standing position ( see fig5 ). accordingly , since the cab 20 is configured to have the left and right arm sections 24 a and 24 b of the steering device 24 that are orientated in the standing position when the operator steps into / off the cab , and are orientated in the horizontal position when the operator drives the wheel loader , for example , it is possible to provide the cab 20 that provides ease of stepping into / off the cab and excellent operability . in particular , as compared with typical steering - wheel type steering devices , it is possible to provide large space in the front of the operator seat portion 22 when the operator stepping into / off the cab . therefore , it is possible to sufficiently provide ease of stepping into / off the cab 20 . in the operator seat portion 22 of the wheel loader 10 according to this embodiment , as shown in fig4 and 5 , the steering device 24 is disposed in front of the operation seat portion 22 and is opposed to the operator seat portion 22 . the support section 24 c and the left and right arm sections 24 a and 24 b included in the steering device 24 can be pivoted . accordingly , for example , when the operator steps into / off the cab 20 , the operator can change the position of the steering device 24 in two tilt - up positions by pivoting the left and right arm sections 24 a and 24 b , and the support section 24 c . as a result , required amount of space can be provided in front of the operator seat portion 22 . therefore , it is possible to improve ease of stepping into / off the cab . the operator seat portion 22 of the wheel loader 10 according to this embodiment further includes the slide mechanism 41 that slides the seat section 22 a frontward and rearward , as shown in fig3 . accordingly , in a case where the hanging - from - above system is employed for the operator seat portion 22 , the operator can operate the wheel loader 10 at a comfortable seat position for the operator by sliding the seat section 22 a frontward and rearward . in addition , it is preferable that the seat section 22 a is slid to the rearmost position when the operator steps into / off the cab . as a result , space in front of the operator seat portion 22 can be provided as much as possible when the operator steps into / off the cab . therefore , it is possible to sufficiently provide ease of stepping into / off the cab . the operator seat portion 22 of the wheel loader 10 according to this embodiment , further includes the angle adjustment mechanism 42 that adjusts the angle of the backrest 22 b , as shown in fig3 . accordingly , in a case where the hanging - from - above system is employed for the operator seat portion 22 , the operator can operate the wheel loader 10 also at comfortable condition for the operator by adjusting the angle of the backrest 22 b . in addition , it is preferable that the backrest 22 b is tilted toward the rearmost position when the operator steps into / off the cab . as a result , space in the front of the operator seat portion 22 can be provided as much as possible . therefore , it is possible to sufficiently provide ease of stepping into / off the cab . in the operator seat portion 22 of the wheel loader 10 according to this embodiment , as shown in fig3 , the ceiling - side support section 23 b and the backside support section 23 c that are included in the hanging - from - above mechanism 23 are connected in an l - shaped state , and extends from the backside of to the topside of the hanging - from - above mechanism 23 to cover operator &# 39 ; s head . accordingly , even in case that the ceiling surface 20 a or the like of the cab 20 is damaged due to shock applied onto the ceiling surface 20 a , for example , the ceiling - side support section 23 b and the backside support section 23 c can protect operator &# 39 ; s head . in addition , in a case where the hanging - from - above mechanism 23 also serves as a protection structure for operator &# 39 ; s head , it is preferable that the hanging - from - above mechanism 23 is designed in consideration of the material of the ceiling - side support section 23 b and the backside support section 23 c and strength of the connection part and so on . in the cab 20 of the wheel loader 10 according to this embodiment includes the aforementioned operator seat portion 22 and the hanging - from - above mechanism 23 , as shown in fig2 . therefore , the cab 20 can have effects similar to the aforementioned effects that improve ease of cleaning up the interior of the cab , and more surely provide the protection space above operator &# 39 ; s head in case of deformation or the like of the upper part of the cab as compared with conventional cabs . the wheel loader 10 according to this embodiment includes the aforementioned cab 20 , as shown in fig1 . therefore , the wheel loader 10 can have effects similar to the aforementioned effects that improve ease of cleaning up the interior of the cab , and more surely provide the protection space above operator &# 39 ; s head in case of deformation or the like of the upper part of the cab as compared with conventional wheel loaders . the foregoing description has described one embodiment according to the present invention . however , the present invention is not limited to the foregoing embodiment . various changes and modifications can be made without departing from the spirit of the present invention . in the foregoing embodiment , the operator seat portion 22 freely pivots within the predetermined range about the rotation shaft 23 a of the hanging - from - above mechanism 23 . however , the present invention is not limited to this configuration . for example , as shown in fig8 , a locking mechanism ( rotation locking mechanism ) 40 that restricts rotation of the operator seat portion 22 may be disposed on the side of the backrest 22 b of the operator seat portion 22 , or the like . in this case , when the operator steps into / off the cab , the operator seat portion 22 can be in a rotatable state . on the other hand , after the operator sits on the operator seat portion 22 , the operator can pivot an insertion portion 40 b of the locking mechanism 40 about a pivot shaft 40 a so that the insertion portion 40 b is inserted into an engagement portion 40 c that is formed on a rear wall of the cab 20 . thus , rotation of the operator seat portion 22 is restricted . accordingly , operator &# 39 ; s posture becomes stable in operation of a wheel loader , for example , therefore , it is possible to improve operability of a construction machine such as a wheel loader . in the foregoing embodiment , as shown in fig4 and 5 , the steering device 24 that is opposed to the operator seat portion 22 includes the left and right arm sections 24 a and 24 b that can be changed their position upward and downward . however , the present invention is not limited to this configuration . for example , as shown in fig9 and 10 , a cab 120 that includes a steering device ( operation portion ) 124 with a typical steering wheel 124 a may be used . in the cab 120 , the steering device 124 is used in combination with the operator seat portion 22 of the hanging - from - above mechanism system . in the steering device 124 , the height and the position in the front - to - rear direction of the steering wheel 124 a can be minutely adjusted depending on operators , as shown in fig1 . in this case , a typical steering device 124 can be used in combination with the operator seat portion 22 , additionally , rotation of the operator seat portion 22 ensures ease of stepping into / off the cab for the operator . in terms of ease of stepping into / off the cab for the operator , it is preferable that the steering device 24 of the swing - up system according to the foregoing embodiment is used in combination with the operator seat portion 22 of the hanging - from - above mechanism system . the reason is that space in front of the operator seat portion 22 can be sufficiently provided as compared with the configuration in which the steering device 124 that includes the typical steering wheel 124 a shown in fig9 and 10 is used in combination with the operator seat portion 22 . in the foregoing embodiment , the hanging - from - above mechanism 23 that connects a part of the operator seat portion 22 to the ceiling surface 20 a of the cab 20 extends from the bottom surface of the seat section 22 a to the back surface of the backrest 22 b of the operator seat portion 22 to support the operator seat portion 22 . however , the present invention is not limited to this configuration . for example , the hanging - from - above mechanism 23 may support only a seat section or only a backrest . in the foregoing embodiment , the operator seat portion 22 rotates about the rotation shaft 23 a that is secured to an upper part of the hanging - from - above mechanism 23 that is located on the ceiling surface 20 a of the cab 20 . however , the present invention is not limited to this configuration . it is not always necessary to locate the rotation shaft on the ceiling surface . for example , a rotation shaft may be located in a connection part between the hanging portion and the seat portion . in this case , rotation of the seat portion when the operator steps into / off the cab allows the operator to easily step into / off the cab . in the foregoing embodiment , the left and right arm sections 24 a and 24 b that are included in the steering device 24 integrally pivot . however , the present invention is not limited to this configuration . for example , the steering device may include the left and right arm sections that independently pivot . in this case , for example , the operator is required to pivot only one arm section that is located in the side where the operator steps into / off the cab , thus , required pivoting torque is reduced . therefore , the position of the arm section can be more smoothly changed . in the foregoing embodiment , the operator seat according to the present invention is applied to the cab of the wheel loader . however , the present invention is not limited to this configuration . for example , the cab that includes the operator seat according to the present invention may be mounted to other construction machines such as a bulldozer , a hydraulic excavator , and a motor grader other than a wheel loader . an operator seat for a construction machine according to the present invention has an effect that provides more sufficient space above operator &# 39 ; s head as compared with conventional operator seats . accordingly , the present invention can be widely applied to operator seats that are disposed in cabs of various types of construction machines .	4
referring to fig1 a bale of wood fibers enters the line of equipment upon a conveyor 11 . the wood fibers , for example , may form a bale which is approximately 12 inches × 12 inches × 36 inches , weighing about 60 lbs . and having a moisture content of up to about 20 % by weight . the wood is preferably of what is called a soft - hardwood , for example , wood of the aspen family , including yellow poplar , and similar such woods which are commercially available in fiber form . the bale 10 proceeds into a bale breaker and shredder 12 which is schematically shown . this breaks up and shreds the bale into loose fibers 13 which are deposited upon a removal conveyor 14 . the fiber 13 are deposited into a feed hopper 15 of a dryer 16 . although different commercially available dryers may be used , a preferred dryer is a commercially available , tubular , forced air dryer having a hot air blower 17 which blows air through a long tube . the tube may be over 100 feet in length . the flowing air picks up the fibers entering through the feed hopper and carries them to the discharge orifice 18 of the dryer . this type of dryer is rapid acting and may carry the fibers through , drying them sufficiently to provide optimum molding conditions , such as to 5 %, and preferably , to about 3 % moisture by weight , in less than a minute . the fibers exiting from the discharge orifice 18 of the dryer are carried away upon a conveyor 19 . this conveyor also receives synthetic plastic fiber which begins as a bale 20 entering into the equipment upon a conveyor 21 . a conventional bale breaker and shredder 22 , which is schematically shown , shreds the bale into fibers 23 which are deposited as a thin coating over the blanket of wood fibers 13 upon the conveyor 24 . by way of example , the coating of synthetic fibers may be on the order of an eighth or a quarter of an inch upon a 2 inch thickness of wood fibers . however , the thicknesses of the fiber deposits may vary considerably , depending upon the nature of the fibers and the fiber ratio of the final specified blend . preferably , the wood fibers predominate . optionally , the synthetic fibers 23 may be deposited from conveyor 23 upon conveyor 14 and travel through the dryer 16 with the wood fibers . the wood fiber and synthetic fiber mixture is carried to a feed conveyor 28 ( see fig1 b and 2 ) where it is raised and dropped into the upper end of a large blending or distributor chamber 29 . the fiber is gravity dropped downwardly through the chamber , being spread apart and evenly disbursed by a v - shaped spreader 30 located within the chamber . the dropping fibers accumulate upon blending rolls 31 , pass through the nip of the rolls and then , drop through the lower end 32 of the blending chamber . the blended mixture of fibers 33 land upon a substantially horizontal collection conveyor 34 with conveys the blended fibers to a sloping conveyor 35 . such sloping conveyor , with has a roughened surface that may have cleats or treads or the like for roughening , carries the fibers upwardly to a pair of spiked or rough surface transfer rolls 38 and 39 . these rolls transfer the fibers , while further blending them , to a control valve 40 ( shown schematically ) which may be in the form of a simple movable louvre or plate . the fibers then drop down , in a controlled volume , into a volumetric control chamber 41 . in fig1 b , the chamber 41 is shown as having one solid wall 42 and an opposing wall 43 formed of a conveyor belt which simultaneously moves the fibers downwardly through the control chamber while containing them within the chamber . the fibers pass from the bottom of the control chamber into a group of spiked or rough surface transfer rolls 44 which carries them to a picker roll 45 . the transfer rolls and picker rolls are conventional in equipment used to form non - woven mats . a conventional trasfer roll may have spikes in the form of nail - like projections extending radially outwardly from its surface . likewise , the picker roll is formed with a rough surface , such as a sawtooth - like surface or spikes or the like . the fibers are transferred to the surface of the picker roll by the transfer roll spikes , the rough surface of the picker roll and also by means of high velocity air which blows the relatively loose fibers upwardly against the lower surface of the picker roll . the high velocity air is applied by a means of a suitable blower air duct 46 which extends the length of the picker roll . high velocity air for the duct is supplied by a suitable compressor or blower 47 which is schematically shown . when the fiber is blown and conveyed upon the picker roll , it is further blended and forms an initial web or blanket 48 , which is relatively weak . this web or blanket passes between an upper condenser roller 49 and a lower condenser roller 50 which compress the web and directs it to a conveyor 51 . as the web moves with the conveyor 51 , it passes beneath a resin hopper 54 which is loaded with a dry powdery , resinous molding material 55 , such as a phenolic resin powder . an example of such a material is a phenolformaldehyde novolac type resin containing hexamethylenetetramine for cure purposes supplied in powder form by polymer applications , inc . and identified as pa - 60 - 706 resin . the resin powder drops downwardly upon the web passing beneath it for dispersion through the web . the resin powder filled web next passes through a group of spiked transfer rollers 56 and is carried around to a second , rough surface picker roll 57 , aided by compressed air from an air duct 58 . the compressed air is supplied by an air blower 59 which is schematically shown . a secondary , further blended , web 60 is formed by the second picker roller operation and passes through a duct 61 , aided by the flow of compressed air from the air duct 58 . this secondary web is passed between an upper condenser roller 62 and a lower condenser roller 63 . preferably , the upper condenser roller has solid or air impervious surface while the lower condenser roller has a perforated surface to permit the escape of the compressed air from the duct 61 . next , the web is conveyed upon a transfer conveyor 64 to a point where scrim 65 is applied . the scrim may be arranged in a suitable roll and unwound to cover the moving web . the scrim is made of a thin sheet of non - woven synthetic fiber material , such as nylon , rayon , polypropylene and the like in the form of , for example , a thin , randomly oriented , fibrous scrim sheet . an example of a commercially available scrim material is spum bonded nylon supplied by monsanto . the particular kind of scrim material selected depends upon availability , cost , product specifications , etc . the scrim may be applied either upon the upper surface or the lower surface of the web or even upon both surfaces , if required for the particular finished product . the scrim shown in the drawing is applied to the lower surface of the web and the composite web - scrim material passes into a conventional needling machine 66 . this machine has a head 67 and a base 68 . numerous needles 69 ( see fig4 ) are secured to the vertically reciprocating head 67 and enter into sockets 70 formed in the base 68 . the needling operation disrupts and intertwines the fibers that are contacted by and displaced by the needles . thus , the fibers mechanically interlock with each other and also interlock with the scrim . consequently , as schematically illustrated in fig5 there appear to be lines of interlocked fibers and an interlocking between the fiber blanket and the scrim sheet which mechanically fastens the material together . the web moving out of the needling machine 66 is grasped by takeout rolls 71 and passes into a conventional , side trim roller cutter 72 for trimming and straightening the side edges of the web . then the web proceeds through a blade type cutter 73 , or some such suitable conventional cutter , for chopping the web into required lengths . these are removed upon a removal conveyor 75 . as illustrated in fig5 the finished composite fiber / scrim , mechanically interlocked web 78 has areas of interlocked fibers 79 which provide the composite web with structural integrity and sufficient strength for handling . the finished web comprises a thoroughly blended or intermixed fiber composition with the powdered resin throughly and evenly dispersed through the web . all of the molding powder is uncured and available for molding when the material is placed within a conventional compression mold for heat and pressure molding into a desired shape . although the fibers and the handling of the fibers may vary in accordance with the procedure described above , examples of useful web compositions are as follows : ______________________________________ preferred approximate range approximate % by weight % by weight______________________________________example i - compositionwood fiber 50 - 80 69synthetic fiber 0 . 02 - 10 9resin ( thermoset ) 10 - 18 16wax 0 - 3 2water less than 5 4 100example ii - compositionwood fiber 60 - 70 66synthetic fiber 0 . 02 - 10 8resin ( thermoset / 15 - 25 20thermoplastic ) wax 0 - 3 2water less than 5 4 100______________________________________ examples of typical materials used in the composition are : wood fiber : aspen , poplar , pine , etc . e . g ., roughly 35 - 45 % retained on 8 mesh screen , with 17 % moisture content synthetic fiber : nylon , polyester , etc . e . g ., nylon 6 or 66 , 1 / 2 &# 34 ; - 11 / 2 &# 34 ; length , 9 - 15 denier ( thickness of fiber ) thermoset resin : phenolic , epoxy , urethane , etc . thermoplastic resin : polyvinyl chloride , polypropylene , etc . wax : hydrocarbon , etc ., e . g ., fuller ww0089 scrim : monsanto , spun bonded nylon , 0 . 03 oz . per square yard for certain requirements , the natural wood fibers may be replaced in whole or in part by other natural fibers . examples of such compositions , using shoddy , i . e ., cotton , wool , etc ., as follows : ______________________________________ preferred approximate range approximate % by weight % by weight______________________________________example iii - compositionshoddy ( cotton , wool , etc .) 50 - 80 69synthetic 0 . 02 - 10 9resin ( thermoset ) 10 - 20 16wax 0 - 3 2water less than 5 4 100example iv - compositionshoddy 65 - 75 69synthetic fiber 0 . 02 - 10 9resin ( thermoset / thermo - 14 - 18 16plasticwax 0 - 3 2water less than 5 4 100______________________________________ ratio ( thermoset / thermoplastic ): 1 / 2 - 2 / 1 in compression molding , a mold release wax is frequently desirable . as set forth in the examples , the wax is in a powder form and in a range of up to about 3 % and preferably in the range of roughly 2 %. to dry the wood fibers , which typically come with roughly 16 to 20 % moisture content , referrring to an aspen type wood such as aspen , yellow poplar and the like , the fibers can be blown through the dryer tube which in a commercially form may be about 180 feet long at a temperature of between about 175 °- 300 ° fahrenheit in less than a minute . this drops the moisture content to between about 2 - 5 % and roughly to a preferred 3 % moisture by weight . as can be seen , the wood fibers are deposited , from the broken bales of wood fiber , into a blanket or mat to a depth of roughly 2 - 3 inches . the synthetic fibers are deposited upon the wood fiber mass to a depth of roughly 1 / 4 inch . as mentioned before , the depths vary depending upon the percentages of different fibers in the finished blend . these fibers are mixed repeatedly in order to get the high quality blend desired . that is , the fibers are in the first instance thoroughly blended in the blending chamber 29 . then they are re - blended in passing through the transfer rolls and into the volume control chamber 41 . next , they are again thoroughly re - blended and reconstituted into a fiber web in going through the first transfer roll group 44 and picker roll 45 . they are again re - blended , but now containing the powder resin , in the second picker roll 57 and transfer roll group 56 . this results in a blend uniformity wich in the later compression molding operation provides a uniform density , and molded thickness substrate , and eliminates weak areas in both the cloth - like web and the molded substrate . the finished web is pliable or readily extensible and thus easily drapable within a relatively deep compression mold having sharp corners , undercut areas and the like . the molded part forms relatively stiff , board - like , structural substrates for use in panels , such as the interior of an automotive vehicle door panel which is covered with an outside plastic shell or skin . as illustrated schematically in fig6 the web is draped within the cavity of die half 81 . when the opposite die half 82 is registered to close the cavity , the web is molded under heat and pressure to form the relative thin , stiff substrate 80 . by way of a typical example , the molding may be in the temperature range of 350 - 450 degrees f ., with pressure at about 350 - 600 psi and for 30 - 60 seconds to produce a 0 . 10 inch thick substrate from a roughly 1 / 2 inch thick web .	3
the invention provides a controllable embossing process to forming a plurality of nano - protrusions on a thermoplastic polymer substrate instead of melting polymer in an organic solvent , avoiding environmental protection problems and deformed nano - protrusions caused while removing the solvent and demolding . fig1 to fig3 are cross - sectional diagrams of a embossing process of the invention . as shown in fig1 , an anodic alumina oxidation template ( aao ) 101 with a plurality of nano - holes 105 is fabricated by anodizing an aluminum substrate , and further anodizing again to increase the uniformity of the nano - holes for reducing the difference of diameter between each nano - protrusion formed by the anodic alumina oxidation template 101 in sequent process . the diameter of the nano - holes 105 is less than about 200 nm , preferably between about 20 nm and 150 nm . as shown in fig2 , a polymer substrate 103 is softened by heating . the heating temperature depends on the material of the polymer substrate 103 . the polymer substrate 103 comprises thermoplastic polymer , thermoset polymer or uv curing polymer , preferably thermoplastic polymer such as pmma ( polymethyl methacrylate ), pc ( polycarbonate ), coc ( cyclo - olefin copolymers ), pp ( polypropylene ), pe ( polyethylene ), pvc ( polyvinyl chloride ), pet ( polyethylene terephthalate ) or pi ( polymide ), or thermoset polymer such as pi ( polyimide ) or epoxy . as shown in fig2 , the polymer substrate 103 is extruded by the aao template 101 . during the extrusion process , the aao template 101 sinks into the polymer substrate 103 while the polymer substrate 103 is extruded into the nano - holes 105 . after the extrusion process , the polymer substrate 103 is cooled to consolidate , and a surfactant is introduced to separate the polymer substrate 103 and anodic alumina oxidation template 101 . as shown in fig3 , a plurality of nano - protrusions 107 is formed on the polymer substrate 103 . the diameter of the nano - protrusions 107 is between about 20 nm and 150 nm . the height of the nano - protrusions 107 is smaller than about 400 nm . the distance between adjacent nano - protrusions is less than about 50 nm . the aspect ratio of the nano - protrusions 107 is smaller than about 3 , preferably smaller than about 2 . still refereeing to fig3 , during demolding process , there is no organic solvent remaining on the polymer substrate 103 , thus avoiding environmental protection problem and deformed nano - protrusion caused by organic solvent . the embossing process by using aao template of the invention costs less than the conventional lithography process per unit process area . the nano - protrusions 107 formed on the shallow portion of the polymer substrate 103 are revealed by demolding through the difference of affinity between the polymer substrate 103 and aao template 101 instead of removing the template by etching . the top portion of the nano - protrusions 107 can be formed in different shapes by adhesive force on the inner wall of the nano - holes 105 , cohesion of polymer as heating and shrink by consolidation . fig5 and fig6 show nano - arrays formed by embossing process of the invention at different conditions . cyclo - olefin polymer ( tg = 130 ° c .) substrate is embossed by an aao template having a plurality of nano - holes with a diameter of less than about 100 nm , at conditions of 150 ° c ., vacuum less than 1 atm and pressure less than 5 bar , forming a plurality of nano - protrusions 107 a with a convex top surface 108 a as shown in fig5 . in addition , cyclo - olefin polymer ( tg = 130 ° c .) substrate is embossed by an aao template having a plurality of nano - holes with a diameter of between about 100 nm and 200 nm , at conditions of 152 ° c ., vacuum more than 1 atm and pressure less than 5 bar , forming a plurality of nano - protrusion 107 b having a concave top surface 108 b . the height of the nano - protrusions 107 a and 107 b are less than 400 nm . the function of the nano - protrusion depends on the shape of the top surface thereof . the nano - protrusions 107 of the invention have high contact angle , hydrophobicity and van de waals force due to smaller contact area of the top surface thereof . in addition , the polymer substrate 103 with a plurality of nano - protrusions may be transparent and covered by a coating to reduce the reflectivity in wavelength range of visible light , thus improving the utility rate of light . a layer of organic or inorganic coating 109 may be further formed conformally on the nano - protrusions 107 to enhance the strength thereof , as shown in fig4 a and fig4 b . the thickness of the organic or inorganic coating 107 is less than about 100 nm preferably . the inorganic coating may be metalsuch as zr , ti , cu , ag , au , al , ni , w , fe or pt , oxide such as sio2 , tio2 or ito , gaas , ingaas , polysilicon or amorphous silicon . the organic coating may be polysiloxane , silicon , conductive polymer , oled ( organic light emitting diode ), pled ( polymer light emitting diode ) or pedot ( polyethylenethioxythiophene ) to enhance the toughness of the nano - protrusions 107 . the organic or inorganic coating can reveal the strength thereof directly on the nano - protrusions 107 , just like a strengthening sugar coating . the organic or inorganic coating has the same shape with the nano - protrusions 107 by conformal formation of coatings on the nano - protrusions . fig7 a is a cross - sectional diagram of nano - arrays observed by an electron microscope according to an embodiment of the invention . a transparent thermoplastic polymer substrate is embossed by an aao template having a plurality of nano - holes with a diameter of less than about 100 nm and an adjacent distance of about 20 nm . during embossing process , the transparent thermoplastic polymer substrate is extruded to fills part of the nano - holes . after embossing process , a plurality of nano - protrusions with aspect ratio of about 2 are revealed on the transparent thermoplastic polymer substrate by demolding , as shown in fig7 a . the nano - protrusion has a concave top surface as shown in fig6 . fig7 b is a top view of the nano - protrusions observed by an electron microscope . as shown in fig7 b , the nano - protrusions distribute uniformly . fig8 a is a cross - sectional diagram of nano - arrays observed by an electron microscope according to another embodiment of the invention . a transparent thermoplastic polymer is embossed by an aao template having a plurality of nano - holes with a diameter of about 100 nm and an adjacent distance of about 50 nm . after embossing process , a plurality of nano - protrusions with aspect ratio about 3 are revealed on the transparent thermoplastic polymer substrate by demolding , as shown in fig8 a . the nano - protrusion has a convex top surface as shown in fig5 . fig8 b is a top view of the nano - protrusions . as shown in fig8 b , the nano - protrusions distribute uniformly . fig9 a shows the contact angle between a drop of water and a general thermoplastic polymer substrate . the contact angle therebetween in fig9 a is about 90 degrees . fig9 b shows the contact angle between a drop of water and a thermoplastic polymer substrate having a plurality of nano - protrusions thereon formed by embossing process of the invention . the contact angle therebetween in fig9 b is over 140 degrees . accordingly , the nano - arrays formed by a template with a plurality of nano - holes exhibit superhydrophobicity as lotus effect . fig1 a shows the gecko &# 39 ; s effect of nano - arrays of the invention . as shown in fig1 a , a drop of water having a volume of less than about 10 μl are locked on a substrate having a plurality of nano - protrusions thereon . fig1 b shows drops of water adhering to a substrate having a plurality of nano - protrusions thereon . fig1 shows a transparent substrate comprising region a with nano - protrusions of the invention thereon and region b having no nano - protrusions of the invention . as shown in fig1 , the reflective brightness of light in region a is lower than in region b . the transparent substrate in fig1 may be pc ( polycarbonate ) or coc ( cyclo olefin copolymers ). for pc , region a has a reflectivity of about 2 - 3 between visible light wavelength of about 400 - 700 nm . for coc , region a has a reflectivity of about 1 - 2 between visible light wavelength of about 400 - 700 nm . the reflectivity of region a for different substrate materials is similar . it is known that the nano - array of the invention can reduce glare and reflection without inducing color - shift . experimental study indicates that the nano - protrusions substantially increase the adhesion between a polymer substrate and an overlying coating . fig1 a and 12 b respectively show the adhesion test results of 100 nm and 200 nm - thick au coatings on pc polymer substrates . the adhesion test was carried out using crosshatch adhesion test , where a grid of 100 squares was cut into the coated substrate , and a 3m tape was applied over the grid , and then rapidly peeled away . the number of squares remaining on the substrate gives a relative percentage value of adhesion . as shown in fig1 a and 12 b , regions c with nano - protrusions passed the adhesion test , while regions d without nano - protrusions failed . note that the nano - protrusions can be used to improve adhesion of any organic or inorganic coatings , such as si , au ; cu , or the like . further , polymer substrates other than the pc substrate ( coc substrates , for example ) may be used to practice the invention . table 1 shows transmission of a thermoplastic polymer substrate having a plurality of nano - protrusions thereon formed by embossing process of the invention . the reflectivity of general transparent thermoplastic polymer substrate , such as plastic , measured by hazemeter is under 3 . 5 %. as shown in table 1 , nano - protrusions formed by embossing process of the invention can increase the reflectivity of the general transparent polymer substrate to 94 %. finally , while the invention has been described by way of example and in terms of preferred embodiment , it is to be understood that the invention is not limited thereto . on the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .	1
referring now to the drawings , and particularly to fig1 to 4 , an orthodontic bracket 10 is shown in mounted position on a tooth 11 in fig1 and 4 to illustrate the invention . it will be appreciated that the bracket 10 includes a bracket body 14 and a base 16 . while the bracket body 14 illustrates a bracket of a type that is sold by tp orthodontics , inc . of laporte , ind ., it will be appreciated with respect to the invention the bracket body may be of any suitable type and of any suitable material . moreover , the invention , being directed primarily to the base , can be used on any appliance that would be mounted on a tooth , including a bracket , a molar tube , or a lingual button , an implantable stem for a tooth implant , or other appliance desired to be bonded to a tooth or the jaw for purposes of dentally or orthodontically treating a patient . thus , the appliance body 14 may be of any type that would be useful in treating the dentition of a patient , orthodontically or otherwise , where it would be desired to adhesively bond an appliance in a desired place . moreover , as will be discussed further below , the base of the invention can be used for orthopedic appliances to mount a part of a prosthesis on a bone of a person . the body of the appliance , and in this case the bracket 14 , may be made of any suitable material for an orthodontic appliance , such as metal like stainless steel , ceramic , or plastic . similarly , if the appliance body is a buccal tube , it can be made of any of these materials . as seen particularly in fig2 and 4 , the bracket body 14 includes an archwire receiving side 18 and a base receiving side 20 . the base 16 is mounted onto the base receiving side 20 . the bracket is made by suitably preparing the surface of the bracket body and then molding or otherwise applying a first layer 22 of a polymer resin to the bracket and then curing that layer . preferably , the layer includes edges that overlap the edges of the bracket body as illustrated in order to provide the best possible bonding or connection between the layer 22 and the bracket body and also enhance the transmission of light during the curing of the second layer . this step of the manufacture is illustrated in fig2 where only the cured layer 22 is shown on the mounting side of the bracket . next , a second layer 24 of a polymer resin is suitably applied over the first layer 22 . this layer is maintained in an uncured state , and therefore the appliance is provided to the orthodontic customer so that the orthodontist , after preparing the tooth on which the bracket is to be mounted , can merely apply the bracket with the bilayer base onto the tooth and then cure the second layer 24 accomplishing the mounting or attachment of the bracket to the tooth . once the second layer is cured , it will merge and be essentially integral with the first layer as the base of the bracket , as shown in fig4 and thereby provide the complete bonding connection between the bracket and the surface of the tooth 11 . the polymer resin of the first layer 20 may be acrylic , epoxy or acrylic - based epoxy resin , or any other suitable resin . further , the resin may be of a type that is light - curable , chemically curable , or heat - curable . preferably , the resin is of a type that is light - curable . moreover , the second layer 24 is of a polymer resin in the same polymer resin family as the polymer resin of the first layer 22 . preferably , the polymer resins are substantially identical to one another , and an acrylic - based epoxy that is light - curable . as long as the resins of each layer are from the same family , which enhances the bonding between the layers , the curing / polymerization process of each need not be the same . for example , the cured layer may be heat cured , while the uncured layer may be light - curable . it will be appreciated that the bracket with the bilayer base having a cured layer of polymer resin and an uncured layer of polymer resin will be shipped and transported to a customer in such a way as to protect the integrity of the uncured layer and also prevent it from curing during the time it is in transport . one method of transporting the appliance with the bilayer base is to flush it with nitrogen to preserve the uncured state of the adhesive resin and then hermetically seal it in a package to prevent light from activating the curing cycle of the uncured adhesive . where the base is of a light - curable resin , the transparent or translucent cured layer further functions as a light conduit for the curing light energy to allow the energy to fully activate the uncured layer of resin and fully cure the layer to fully bond the appliance to the mounting surface . thus , the light energy wicks or moves easily along the cured layer . one of the layers may be transparent , while the other layer is translucent . preferably , the cured layer is transparent to optimize the transmission of the curing light energy . thus , the bracket of the invention , having a bilayer base , is ready for the orthodontist to mount on a tooth and thereafter to direct a curing light at the uncured layer of the polymer resin to cure the layer and firmly attach the bracket to a tooth . the bilayer base of the invention is illustrated as being applicable to an orthopedic prosthesis in fig5 to 7 , wherein fig6 shows an elongated stem 30 over which the bilayer base 32 has been formed to define a prosthetic part ready to be used by the orthopedic customer for attachment to a bone following light - curing of the uncured layer of the base . the base 32 includes a cured layer 34 of a polymer resin over which an uncured layer 36 of substantially the same , if not the same , polymer resin is provided to complete the base . fig5 shows the orthopedic stem 30 with only the cured layer 34 applied to the stem in the manufacture of the bilayer base . thereafter , the uncured layer 36 is added before shipping the stem to an orthopedic customer , as shown in fig6 . it will be appreciated that the orthopedic prosthesis stem 30 could be made of any suitable material , such as metal , ceramic , or plastic , and be formed for use in any articulated part of the human anatomy . the particular appliance stem 30 shown is intended to be used for a hip replacement procedure to replace a part of a diseased femur 38 . a canal 40 is suitably formed , such as by drilling , in the end of the femur and into which the end of the prosthetic device is inserted . it will be appreciated that with respect to artificial knee replacements , as well as hip replacements , cemented and uncemented prostheses may be used . the present invention relates only to the use of a cemented prosthesis , and as above mentioned , the stem 30 may be made of any suitable material although it is usually made of metal . again , the appliance with the bilayer base as shown in fig6 wherein the outer layer 36 is provided in an uncured state before being provided to a customer like the above described orthodontic appliance . also , like an orthodontic appliance with the base of the invention , the prosthesis would be flushed with nitrogen and then hermetically sealed in a container that would not allow any light transmission to prevent curing of the light - curable polymer resin layer of the bilayer base when shipping the prosthesis to an orthopedic customer . it will be appreciated that the polymer materials of the bilayer base may be of the same type as above identified with respect to the orthodontic appliance . and where the polymer material of the uncured layer is light - curable , and the cured layer is transparent or translucent , the cured layer further functions to wick or transmit the light energy of a curing light to the entire uncured layer . fig7 illustrates the orthopedic part 30 having its bilayer base in place in a canal of a femur and the uncured layer , wherein the cured and uncured layers of the base integrally join together during the time the uncured layer attaches to the bone of the femur and connects the part to the femur . it will be appreciated that the illustrations of an orthodontic bracket and a part of a prosthetic artificial joint are merely illustrative of the scope and use of the bilayer base according to the invention as it could be used in connection with any artificial part that is to be secured to a bone or tooth of the body . it will be understood that modifications and variations may be effected without departing from the scope of the novel concepts of the present invention , but it is understood that this application is to be limited only by the scope of the appended claims .	0
fig1 and 3 depict the perforation apparatus in accordance with the present invention . the roller 10 is shaped in the form of a cylinder and of suitable length for the machine ( s ) on which it will be installed . the cylinder has a center shaft and is mounted for free - wheeling rotation . bearings 30 are attached to each end of the shaft of roller 10 . the bearings , once seated , facilitate the rotation of the roller . the bearings shown are of the conventional type used for large cylindrical roller type applications . grooves 50 are formed longitudinally in outer surface of the roller 10 . these grooves can be of any shape which allow perforation pin holders 20 to be inserted into the groove , to slide or be otherwise adjusted within the groove to any location between the ends of the roller , and to be supported by and secured within the groove . the grooves can , for example , be given a double step structure as shown in fig3 and 6 and extend the length of the roller . this facilitates the easy installation and deinstallation of the pin holders as well as the support of the holders once installed . the grooves must be formed in such a manner so that the outer surface of the inserted holder is exposed . the grooves are spaced radially around the roller , preferably each groove being an equal distance from each adjacent groove around the entire circumference of the roller . as shown , the grooves are formed with a double step structure which provides support for the holder in all directions except in a longitudinal direction along the roller 10 . although fig3 illustrates six grooves around roller 10 , any number of grooves may be employed . three is the minimum number of grooves that is sufficient for the preferred embodiment illustrated in fig1 wherein the roller 10 is free - wheeling and at least one of the pins 40 is in engagement with the film to rotate roller 10 at any given time . the perforation pin holders 20 can be of any desired length but will normally be less than the length of the roller 10 . in the preferred embodiment , the holders are approximately 2 inches in length . in a typical application for perforating packaging film , such as thermoplastic film , one or more holders would be inserted in each groove . the holders are then slid to the desired location along the groove and secured in place . if and when desired , the holder can be unsecured and moved to another location or removed from the groove entirely . the longitudinal spacing between holders within a particular groove is also variable . the holders may , for example , be adjusted after a trial run . the holders 20 have an outer surface which is flush with the outer surface of the roller 10 . one or more perforation pins 40 are mounted in the holders 20 . the pins are preferably removable from the holder so that pins can be easily exchanged without the need to remove the holder from the groove . for example , the pins may be press fit into the holder or manufactured with a threaded bottom portion which can be screwed into a tapped opening in the holder . various other connection configurations could also be used to accomplish the removable mounting of the pins . in the embodiment shown , the pins do not require pre - heating before perforating the packaging film . the perforation pins 40 protrude outwardly from the outer surface of the holders . the holder is secured in place at the desired location along the length of the groove by a threaded , recessed head screw 60 which , when tightened , bears against the bottom surface of groove 50 forcing holder 20 in an outward direction from the center of the roller and against an upper surface of the groove . the holder is thereby locked or secured in place by the bearing friction forces . the holders 20 , as depicted in fig4 and 5 , are shaped so as to conform to the shape of the groove so that they can be easily installed and moved in the groove . the inner step of the groove reduces the friction forces between the groove and holder sliding surfaces during installation of the holder and adjustment of its location . this inner step also provides a bearing surface for the locking screw 60 which is separate from the groove sliding surfaces . fig6 details the groove 50 and holder 20 assembly . the groove 50 is formed with a double step function . the outer step forms a groove portion which is capable of accepting and supporting inner holder portion 70 . this groove portion provides support for the holder in all directions except with respect to longitudinal movement of holder 20 within the groove . the second or inner step forms groove portion 80 , the inner surface of which serves as a bearing surface for locking screw 60 when the screw is tightened to longitudinally secure the holder within the groove . except as otherwise described above , the various components of the apparatus according to the present invention can be of conventional materials , dimensions and construction . however , other materials , dimensions and construction which have characteristics suitable for use in perforating shrink wrap packaging or other sheet materials in accordance with the present invention could also be used . the perforated packaging film can be collected onto a roller for further use or fed directly to a packaging machine and used for shrink wrapping . thus , as described , the present invention provides a perforating apparatus which does not require special sleeves for each separate application . the apparatus also does not require heated perforating pins . the apparatus has a constant outside diameter and therefore can be used on different machines for the same application without the need for spacers or other adjustment devices . the apparatus is easily adaptable to a variety of applications which require different perforation sizes , shapes and / or locations , and without the need to install and remove a roller and / or sleeve . the described perforating apparatus simplifies and facilitates the changing of the perforation sizes , shapes and / or locations when required and allows the perforation pin sizes , shapes or locations to be adjusted in a flexible manner and without requiring roller and / or sleeve removal .	8
fig1 is a configuration diagram of an example of a system according to the present invention . an electronic shelf label system 100 according to the example includes a management device 111 , a relay device 112 , and an electronic shelf label 113 . the electronic shelf label system 100 has the relay device 112 for relaying communication between the electronic shelf label 113 and the management device 111 managing the electronic shelf label 113 and manages the electronic shelf label 113 attached to a product shelf . fig2 is a block diagram of the relay device 112 . the relay device 112 includes a communication unit 141 , a process unit 142 , a storage unit 143 , a radio communication unit 144 , a power supply circuit 145 , and a battery 146 . the communication unit 141 is connected to the management device 111 via a network such as lan , wan , a dedicated line , or the like . the communication unit 141 performs communication with the management device 111 . the process unit 142 includes a microcomputer and the like and performs a process for relaying communication , for example , between the management device 111 and the electronic shelf label 113 based on a program installed on the storage unit 143 . the storage unit 143 includes a rewritable non - volatile memory such as eeprom , for example , rom , ram , and the like . in the storage unit 143 , information 131 on electronic shelf labels within a communication range is stored in addition to a communication control program . the radio communication unit 144 performs radio communication with the electronic shelf label 113 . the power supply circuit 145 is connected to an alternating - current power supply such as an external commercial power supply . the power supply circuit 145 converts the connected alternating - current power into a direct - current voltage and supplies the direct - current voltage as a driving voltage to the communication unit 141 , the process unit 142 , the storage unit 143 , and the radio communication unit 144 . the battery 146 includes a ni — cd battery , a lithium ion battery , an electric double layer capacitor , or the like as a chargeable battery unit . the battery 146 is charged from the direct - current voltage generated in the power supply circuit 145 and supplies electric power for driving the communication unit 141 , the process unit 142 , the storage unit 143 , and the radio communication unit 144 for a certain period of time so as to execute an end program when alternating - current power is cut . fig3 is a block diagram of the electronic shelf label 113 . the electronic shelf label 113 includes a radio communication unit 151 , a process unit 152 , a storage unit 153 , a display device 154 , and a battery 155 . the radio communication unit 151 performs radio communication with the relay device 112 . the process unit 152 includes cpu , for example . the process unit 152 controls communication with the relay device 112 and also controls display of the display device 154 based on a program stored in the storage unit 153 . the storage unit 153 includes a rewritable non - volatile storage device such as eeprom , for example . in the storage unit 153 , a program executed in the process unit 152 is installed and shelf label ids and product codes are stored . some of the shelf label ids and product codes are registered in advance and can be changed by the relay device 112 . the display device 154 includes lcd , an el panel , electronic paper , or the like . the display device 154 displays product names , product codes , prices and the like . the battery 155 includes a small battery and supplies electric power for driving the radio communication unit 151 , the process unit 152 , the storage unit 153 , and the display device 154 . first , status transition of the electronic shelf label 113 from an unregistered status to a normal operation status is described . the electronic shelf label 113 has three statuses , namely , an id assignment waiting status where an id is not assigned from the relay device 112 , an id registration waiting status where the id assigned from the relay device 112 is not registered in the management device 111 , and a normal status where the id is registered in the management device 111 . in the following , a transition process from the id assignment waiting status to the id registration waiting status is described . a transition process from the id registration waiting status to the normal status is omitted since this is the same process as the transition process from the id assignment waiting status to the id registration waiting status . first , a call process of the relay device 112 is described . fig4 is a process flow chart of a call process of the relay device 112 . when a call request is generated in step s 1 - 1 so as to assign an id to the unregistered electronic shelf label 113 , for example , the process unit 142 of the relay device 112 sets response probability to the call in step s 1 - 2 . next , the process unit 142 generates a beacon for calling including the response probability in step s 1 - 3 and transmits the beacon via the radio communication unit 144 in step s 1 - 4 . when a response from the electronic shelf label 113 is an error in step s 1 - 5 , the process of the process unit 142 returns to step s 1 - 2 . in the response probability setting process in step s 1 - 2 , when the response probability is reset due to errors and the like , a process for reducing the response probability from 50 % to 30 %, for example , is performed . next , a response process in the electronic shelf label 113 is described . fig5 is a process flow chart of a response process of the electronic shelf label 113 . the process unit 152 of the electronic shelf label 113 shifts from a sleep status to a communication status in step s 2 - 1 . when the calling of the beacon from the relay device 112 is received in step s 2 - 2 , the process unit 152 extracts the response probability included in the received beacon in step s 2 - 3 . the process unit 152 generates a random number from 1 to 100 in step s 2 - 4 and compares the generated random number with a response probability parameter of the extracted response probability in step s 2 - 5 . the response probability parameter is set such that when the extracted response probability is 100 %, a response must be made and when the extracted response probability is 50 %, a response is made with a probability of 50 %. the process unit 152 compares the response probability parameter with the generated random number in step s 2 - 5 . when the response probability parameter is less than the generated random number in step s 2 - 5 , the process unit 152 decides to respond to the relay device 112 and creates response information in accordance with the call in step s 2 - 6 . further , the process unit 152 determines a response time in step s 2 - 7 . the response time is determined by generating a random number and the like and determining the number of a communication slot inserted into a contended access period in accordance with the generated random number . fig6 is a diagram illustrating a response time determination operation . in fig6 , a horizontal axis indicates time . in this case , after a beacon b for calling is transmitted , a contended access period t 0 is set . in the contended access period t 0 , n communication slots sl 1 to sln are set . the process unit 152 selects one communication slot sli in a random manner from the communication slots sl 1 to sln in accordance with the random number for example . at a response time in step s 2 - 8 , namely , time of the selected communication slot sli , the process unit 152 transmits the created response in step s 2 - 9 . when the transmission of the response is finished , the process unit 152 shifts to a sleep status in step s 2 - 10 . in the sleep status , only minimum necessary circuits are in operation and operations of unnecessary circuits are stopped . when the response probability parameter is more than the generated random number in step s 2 - 5 , the process unit 152 decides not to respond and immediately shifts to the sleep status in step s 2 - 10 . in accordance with this , it is possible to reduce unnecessary power consumption . when the response information from the electronic shelf label 113 is received in step s 2 - 9 , the relay device 112 obtains the id of the unregistered electronic shelf label 113 included in the response information , transmits a call to the electronic shelf label 113 having the obtained id , and transmits id assignment information to the unregistered electronic shelf label 113 . as mentioned above , according to the present example , the relay device 112 sets the response probability and transmits the beacon for calling including the response probability and the electronic shelf label 113 receives the beacon for calling , extracts the response probability included in the beacon for calling , and makes a response in accordance with the response probability , so that it is possible to prevent collision of responses from plural electronic shelf labels 113 to the relay device 112 . in this case , in the present example , when response is decided , a communication slot for transmitting the response is determined in a random manner , so that it is possible to further reduce the probability of collision of responses , thereby enabling efficient communication . moreover , plural electronic shelf labels 113 are capable of certainly returning a response to the call from the relay device 112 without error , so that it is possible to reduce unnecessary calls and responses , thereby reducing power consumption . the present invention is not limited to the specifically disclosed embodiment , and variations and modifications may be made without departing from the scope of the present invention . the present application is based on japanese priority application no . 2006 - 038664 filed feb . 15 , 2006 , the entire contents of which are hereby incorporated herein by reference .	6
reference will now be made in detail to a preferred embodiment of the present invention , an example of which is illustrated in the accompanying drawings . fig1 is a view schematically showing a wiper system used in vehicles according to an embodiment of the present invention , and fig2 a , 2b and 2c are side sectional views illustrating the structure of the wiper system for this embodiment . reference numeral 2 in the drawings refers to a windshield . as shown in fig1 and fig2 a , 2b and 2c , wiper arms 4 are positioned at the bottom of the windshield 2 and are connected to a cam ( not shown ) on a drive shaft of a wiper motor m1 by means of linkages 6 to allow the wiper arms to be driven by the wiper motor m1 . as the drive structure and operation of the wiper arms 4 are similar to that of the prior art , an explanation thereof will be omitted in this specification . the wiper motor m1 is fixedly attached in an engine compartment 8 inside of which is also provided means for supplying washer fluid . the means for supplying washer fluid operates together with the wiper arms 4 . the means for supplying washer fluid includes a reserve tank 10 containing washer fluid , a pump 12 which is connected to the reserve tank 10 and pumps washer fluid when a driver activates an on / off switch ( not shown ), a hose 14 which is connected to an outlet of the reserve tank 10 and directs the pumped washer fluid , and a washer fluid control part 16 which is connected to the hose 14 and injects washer fluid on the windshield 2 in accordance with the position of the wiper arms 4 . the washer fluid control part 16 consists of a nozzle body 20 mounted under the hood 18 of the vehicle , and a nozzle 24 fixed to the nozzle body 20 communicating with a passage 22 formed in the nozzle body 20 . the passage 22 formed in the nozzle body 20 communicates with the hose 14 so that the washer fluid can be fed to the nozzle 24 . there are also provided lower and upper washer fluid interrupters 26 and 28 on the horizontal passage 22 which supply or delay the supply of washer fluid according to the position of the wiper arms 4 . the lower washer fluid interrupter 26 is provided in the nozzle body 20 to selectively open and close vertical passages 30 and 30 &# 39 ;, which communicate with the horizontal passage 22 , by undergoing a rectilinear movement . in the preferred embodiment , although there are shown a plurality of nozzles 24 , it is possible for there to only be one nozzle . the number of the washer fluid interrupters 26 and 28 , however , preferably corresponds to the number of nozzles . the lower washer fluid interrupter 26 , on which holes 32 and 34 are formed thereon , opens both the vertical passages 30 and 30 &# 39 ; to the horizontal passage 22 , and the other washer fluid interrupter 28 , on which a hole 36 is formed thereon , opens only one of the vertical passages 30 &# 39 ;. the lower and upper washer fluid interrupters 26 and 28 are elastically supported by elastic members 38 and 40 on one end thereof , and on the other side , the interrupters 26 and 28 are in constant contact with an outer circumferential surface of lower and upper cams 42 and 44 . the lower and upper cams 42 and 44 make the lower and upper washer fluid interrupters 26 and 28 move back and forth so that the lower and upper washer fluid interrupters 26 and 28 selectively open and close the passages 30 and 30 &# 39 ; formed in the nozzle body 20 . the lower and upper cams 42 and 44 are connected to a cam shaft 41 . preferably , rotary power from a drive shaft 45 of a washer fluid control motor m2 is coupled to the cam shaft via a drive belt 43 . the use of the drive belt helps to reduce the generation of noise . when the lower and upper cams 42 and 44 are rotated by the washer fluid control motor m2 , the lower and upper washer fluid interrupters 26 and 28 repeat a back and forth movement according to a circumference of the lower and upper cams 42 and 44 . as shown in fig3 a groove 46 is formed on a quarter portion of both the lower and upper cams 42 and 44 and , accordingly , the lower and upper washer fluid interrupters 26 and 28 move as much as the depth of the groove 46 . the shape of the lower and upper cams 42 and 44 are identical with each other , but , a positioning of the grooves 46 differs from each other . each position of the grooves 46 on the cams 42 and 44 with respect to the position of the drive shaft of the washer fluid control motor m2 are shown in fig3 a and 3b . the washer fluid control motor m2 is connected to the wiper motor m1 through a battery b , and is activated when the wiper motor m1 is activated . through the above , the lower and upper washer fluid interrupters 26 and 28 move back and forth during the wiping action of the wiper arms 4 . according to an embodiment of the present invention , the wiper motor m1 and washer fluid control motor m2 simultaneously operate when the switch is turned on . correspondingly , the wiper motor m1 operates the wiper arms 4 which clean the windshield 2 , while the washer fluid control motor m2 rotates the lower and upper cams 42 and 44 . the lower and upper washer fluid interrupters 26 and 28 , which are in contact with the outer circumference of the lower and upper cams 42 and 44 , move back and forth according to the movement line of the cams 42 and 44 when they begin to rotate , wherein the washer fluid in the reserve tank 10 is pumped by the washer fluid activating pump 12 and through to the washer fluid injection control part 16 . the washer fluid in the hose 14 is injected through one of the nozzles 24a and 24b or all of the nozzles by the operation of the washer fluid injection control part 16 . the selective injection of the nozzles is carried out according to the position of the cams 42 and 44 as shown in fig5 . the change of position of the lower and upper cams 42 and 44 as shown in fig5 is realized through the operation of the washer fluid control motor m2 . the lower and upper cams 42 and 44 are in constant contact with the washer fluid interrupters 26 and 28 regardless of their rotational positioning . s1 , s2 and s3 appearing in fig4 and 5 indicate different positions of the wiper arms 4 on the windshield 2 . namely , s1 indicates a point in which the wiper arms 4 begin to operate from a non - operating position , s2 indicates the middle point of the operation of the wiper arms 4 , and s3 indicates a turning position from which the wiper arms 4 turn back . for the purpose of simplifying the explanation , s1 will be referred to as an initial position , s2 as a middle position , and s3 as a turning position . at the moment the wiper arms 4 start their operation from the initial position s1 , the lower and upper cams 42 and 44 are positioned as shown in fig5 . when the lower and upper cams 42 and 44 rotate counterclockwise , such that the groove 46 of the lower cam 42 is on the fourth quadrant and the groove 46 of the upper cam 44 is on the third quadrant , the washer fluid interrupters 26 and 28 are kept in constant contact with the outside circumferential surface of the lower and upper cams 42 and 44 by the elastic force of the elastic members 38 and 40 . when the wiper arms 42 and 44 start their movement from the initial position s1 to the middle position s2 , as the holes 32 , 34 and 36 formed on the washer fluid interrupters 26 and 28 communicate with the vertical passages 30 , the washer fluid is simultaneously injected through the nozzles 24 as shown in fig2 a . accordingly , the washer fluid is injected at the positions p1 and p2 , as shown in fig4 on the windshield 2 . after the above injection , the lower and upper cams 42 and 44 further rotate to the position shown in the second column of fig5 where the wiper arms 4 are passing the middle position s2 of fig4 . accordingly , when the wiper arms 4 move from the middle position s2 to the turning position s3 , the lower washer fluid interrupter 26 connected to the lower cam 42 moves according to the position shown in fig2 b . once again , the elasticity of the elastic member 38 keeps the washer fluid interrupter 26 in close contact with the cam 42 . therefore , since the hole 32 formed on the lower washer fluid interrupter 26 is not lined up with the vertical passage 30 , the washer fluid can only be injected through the nozzle 24b , corresponding to the position p2 on the windshield 2 in fig4 . after the above , the wiper arms 4 finish moving to the turning position s3 and start moving back to the middle position s2 . the lower and upper cams 42 and 44 further rotate to the position shown in fig5 . since the washer fluid interrupters 26 and 28 are kept in constant contact with the circumference of the cams 42 and 44 , the washer fluid can be injected through both nozzles 24 as when the wiper arms 4 move from the initial position s1 to the middle position s2 . when the wiper arms 4 start moving from the middle position s2 to the initial position s1 , the lower and upper cams 42 and 44 further rotate to the position shown in the fourth column of fig5 . accordingly , as the upper washer fluid interrupter 28 makes contact with the groove 46 of the upper cam 44 , the upper washer fluid interrupter 28 blocks the vertical passage 30 &# 39 ; connected to the nozzle 24b , thereby obstructing the injection of washer fluid . here , the washer fluid can only be injected to the position p1 on the windshield through the nozzle 24a through the positioning of the lower and upper washer fluid interrupters 26 and 28 shown in fig2 c . as described above , a windshield wiper system for vehicles according to an embodiment of the present invention can improve the cleaning of the windshield by using a method in which the washer fluid is injected in front of the wiper arms . also , the windshield wiper system of the present invention can reduce the amount of the washer fluid scattering into the air while driving by increasing injection pressure of the washer fluid when the washer fluid interrupters close the passages leading to the nozzles of the washer fluid system . finally , an embodiment of the present invention can essentially reduce the amount of washer fluid lost since the washer fluid is injected on the surface of the windshield only in front of the wiper arms . while this invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , it is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .	1
fig1 is an external perspective view of a card connector which is an embodiment of the invention , fig2 is an external perspective view of a body 1 , fig3 and 4 are enlarged perspective views showing different portions of the body 1 , and fig5 is an enlarged section view of main portions , partially omitted . as shown in fig2 , the body 1 is made of an integral molded product of a synthetic resin , and a pair of arms 3 a , 3 b are extended from left and right ends of a laterally elongated head portion 2 , respectively . a lower plate portion 4 is continuously integrated with the head portion 2 and the pair of arms 3 a , 3 b . a contact row 21 configured by a predetermined number contacts which are laterally arranged is incorporated into the head portion 2 . the lower plate portion 4 has a recessed portion 41 which is between the pair of arms 3 a , 3 b , and which is recessed toward the head portion 2 . in the recessed portion 41 , right and left recessed edges 42 a , 42 b are formed into an arcuate shape . in the case where the recessed portion 41 is formed in the lower plate portion 4 in this way , even when the lower plate portion 4 is molded so as to have a reduced thickness , stress concentration hardly occurs in the recessed edges 42 a , 42 b because of the arcuate shapes of the recessed edges 42 a , 42 b , so that the lower plate portion 4 is hardly broken in the recessed edges 42 a , 42 b . the formation of the recessed portion 41 in the lower plate portion 4 is useful for suppressing the amount of a resin material for molding the body 1 , and produces advantages such as that , when the body 1 is mounted on a circuit board or a chassis which is not shown , the mounting state can be easily stabilized . to one of the left and right arms 3 a , 3 b , or to the left arm 3 a , attached are a lock spring 12 for locking a card ( not shown ) to an adequate set position , a spring member 13 for ejecting a card , and a cam mechanism 14 which performs a certain kind of operation . by contrast , components such as a card detection switch 15 for detecting insertion of a card are attached to the right arm 3 b . as shown in fig1 or 5 , a sheet metal frame 5 is attached to the body 1 . the frame 5 has a face plate portion 51 which is extended from the head portion 2 of the body 1 to the foremost end portions 3 a ′ , 3 b ′ of the arms 3 a , 3 b . plate - like pieces 52 a , 52 b which are longitudinally extended , and which are formed by bending the left and right ends of the face plate portion 51 overlap outward faces 31 a , 31 b of the left and right arms 3 a , 3 b , respectively . the left and right plate - like pieces 52 a , 52 b exert functions of blocking outward deformations of the left and right arms 3 a , 3 b , and reinforcing the arms 3 a , 3 b . the body 1 and the frame 5 are coupled to each other so as not to rattle longitudinally and vertically , by engaging engagement holes 53 and engagement hooks 54 which are formed in plural front and rear positions of the plate - like pieces 52 a , 52 b of the frame 5 , with engagement projections 32 and stepped faces ( not shown in the figures ) which are formed in corresponding positions of the arms 3 a , 3 b . in a tip end portion of the frame 5 , hook - like receiving pieces 55 a , 55 b are bendingly formed by vertically downwardly die - cutting and raising two or left and right places of the face plate portion 51 , respectively . by contrast , as shown in fig3 or 4 , an inward engagement face 33 a is formed in the foremost end portion 3 a ′ of the left arm 3 a , and an inward engagement face 33 b is similarly formed in the foremost end portion 3 b ′ of the right arm 3 b . as shown in fig5 , the receiving pieces 55 a , 55 b of the frame 5 overlap the engagement faces 33 a , 33 b in a butting condition , respectively , to block inward displacements of the foremost end portions 3 a ′, 3 b ′ the left and right arms 3 a , 3 b . since the foremost end portions 3 a ′, 3 b ′ of the left and right arms 3 a , 3 b are prevented by the left and right receiving pieces 55 a , 55 b of the frame 5 from being inwardly displaced in this way , the whole lengths of the arms 3 a , 3 b are not inwardly deflects . in the embodiment , an outward engagement piece 56 is extended from the left receiving piece 55 a , and the engagement piece 56 is inserted into a channel 36 formed in the arm 3 a . the configuration has an advantage that the tip end of the frame 5 is coupled with the foremost end portion of the arm 3 a of the body 1 and hence the coupling force between the body 1 and the frame 5 is enhanced . in the embodiment , as shown in fig1 or 2 , each of the left and right plate - like pieces 52 a , 52 b of the frame 5 is extended to reach the engagement face forming position a , b ( see fig3 or 4 ) of the foremost end portion of the corresponding one of the left and right arms 3 a , 3 b , and the engagement face forming position a , b is clamped between the plate - like piece 52 a , 52 b and the receiving piece 55 a , 55 b . in the case where the body 1 is produced by integral molding of a synthetic resin , even when the arms 3 a , 3 b of the molded body 1 are inwardly deflected for a technical reason in molding , therefore , the deflections of the arms 3 a , 3 b are adequately corrected by the clamping function exerted by the plate - like pieces 52 a , 52 b and the receiving pieces 55 a , 55 b . in the embodiment , the pair of receiving pieces 55 a , 55 b are extended in the thickness direction t of a card c ( see fig1 ) which is to be inserted into a card insertion space formed by a space between the lower plate portion 4 of the body 1 and the face plate portion 51 of the frame 5 , and , as shown in fig5 , the lateral width w of a insertion slot of the card insertion space is defined by the distance between opposing inward faces of the receiving pieces 55 a , 55 b . in the left and right arms 3 a , 3 b , guide faces 35 a , 35 b are formed in extended planes of the inward faces of the left and right receiving pieces 55 a , 55 b ( see fig1 , 3 , or 4 ), respectively . in the thus configured card connector , when the card c is inserted as indicated by the arrow a in fig1 , the lateral position of the card c is restricted by the left and right receiving pieces 55 a , 55 b and the guide faces 35 a , 35 b , and the lateral width w of the insertion slot is maintained to the adequate dimension by the left and right receiving pieces 55 a , 55 b . therefore , the card c can be inserted smoothly and in a proper posture . even when a prying force is applied to the card c during a process of manually inserting the card c , the prying force is received not only by the left and right arms 3 a , 3 b , but also by the receiving pieces 55 a , 55 b and the plate - like pieces 52 a , 52 b . even when the arms 3 a , 3 b are so thin and narrow that the arms 3 a , 3 b fail to have a considerably large strength , therefore , there arises no possibility that the arms 3 a , 3 b are deformed or broken . as a result , even when the card connector is narrowed and thinned by reducing the thickness and width of each of the arms 3 a , 3 b , the arms can be provided with sufficient strength .	6
fig1 shows an intermediate circuit capacitance or c z , at the output of a power supply unit , usually formed by multiple capacitors and usually followed by a discharging resistor r e . the discharging resistor r e is designed such that it can effect a discharge of the intermediate circuit capacitance c z within a few minutes in order to avoid danger to service personnel , as would exist if the intermediate circuit capacitance c z would remain charged for days with excessively high voltage , for example . inventively , this discharging resistor r e is connected in series with the actual measuring circuit 2 . the measuring circuit 2 is shown in detail in fig2 . this measuring circuit 2 contains an astable flip - flop 1 for operating a driver that is fashioned as a transistor t 3 , for an optical coupler containing a light - emitting diode ld in the exemplary embodiment . the light pulses emitted by the light - emitting diode ld are detected by a photodiode p and are displayed as voltage value at a voltage indicator m . the indicator m “ translates ” the current pulses , produced by the photodetector p from the detected light pulses , into a voltage vale dependent on a characteristic , which has been previously empirically detected , representing the relation between the frequency of the light pulses and the intermediate circuit voltage u z . when the intermediate circuit voltage is close to zero , practically no voltage drop occurs at a capacitor c 1 connected in series with r e , and thus a zener diode d 1 connected in parallel with c 1 remains inhibited . transistors t 1 , t 2 and t 3 then are non - conducting and the light - emitting diode ld remains dark . when the intermediate circuit voltage then exceeds the zener voltage of the zener diode d 1 , the transistor t 1 initially becomes conductive and drives the transistor t 2 , which , together , form a thyristor tetrode , this thyristor tetrode forming a flip - flop circuit in combination with the driving voltage divider of across the capacitor c 1 . this driving voltage divider is formed by resistors ( in the exemplary embodiment , 10k and 47k resistors ) connected in series and in parallel with the zener diode d 1 , and resistors ( in the exemplary embodiment , two 47k resistors ) connected at the base of transistor t 2 . the transistor t 3 that serves as driver for the light - emitting diode ld thereby conducts , and the light - emitting diode ld emits light . the capacitor c 1 discharges via the low - resistance path of the light - emitting diode circuit , causing the thyristor that is formed by the transistors t 1 , t 2 , quench and the transistor t 3 ceases to conduct , and the light - emitting diode ld ceases to emit light , so that a light pulse has been produced . the capacitor c 1 is slowly recharged by the discharging resistor r e and the previously described procedure starts again . a saw - tooth - shaped voltage thereby arises at the capacitor c 1 and the optical coupler with the light - emitting diode ld blinks with a frequency that is almost linearly proportional to the intermediate circuit voltage . if the intermediate circuit voltage finally exceeds a maximum value , the thyristor no longer quenches and the light - emitting diode changes to steady emission light . an upper transgression of the measuring range can be immediately recognized in this way . fig3 shows the voltage - response characteristic with c 1 = 100 nf and r e = 33 kohm . the almost linear relation between the voltage u z and the frequency f at which the light - emitting diode ld flashes . given commercially obtainable components , a precision of approximately 10 % is obtained , which is sufficient for most applications . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art .	6
these and other features and advantages of this invention are described in , or are apparent from , the following detailed description of various example aspects . fig2 a - 2b are diagrams illustrating a vacuum - assisted biopsy device , according to various aspects of the current invention . in fig2 a , the vacuum - assisted biopsy device 100 includes a stylet tip 110 that , during operation , penetrates the skin / tissue of a patient and is inserted through the skin to remove one or more tissue samples from the patient , the tissue samples being deposited in the notch 150 of the stylet tip 110 . according to various aspects , the stylet tip 110 may be connected to a vacuum pump 130 via a vacuum line 120 and a housing 160 , the vacuum pump 130 including a valve 140 . the housing 160 may include , in the case of a spring - loaded biopsy device , a valve mechanism and / or the firing mechanism to fire a cannula over the stylet tip 110 to sever tissue samples . according to various aspects , the housing 160 may also be used as a handle by an operator to operate the biopsy device . the valve 140 may , for example , only allow flow in a single direction such that air can only flow out of the vacuum pump 130 via the valve 140 , thus creating a vacuum . in addition , the valve 140 may help prevent foreign materials from coming in contact with the target tissue . in operation , the vacuum pump 130 may create a vacuum and transmit the vacuum via the vacuum line 120 to the stylet tip 110 . accordingly , when the stylet tip 110 penetrates the skin / tissue of the patient , the vacuum provided through the vacuum line 120 may draw an amount of tissue in the notch 150 that is larger than if no vacuum was provided , and the tissue sample may then be severed via , for example , firing a cutting cannula . alternatively , the tissue sample that is first severed via the stylet tip 110 may be deposited in the notch 150 , and the vacuum may be used to maintain the severed tissue sample within the notch 150 while the biopsy device is extracted from the body of the patient . as a result , when the stylet tip 110 is removed from the body of the patient , larger tissue samples can be collected by the biopsy device 100 because of the action of the vacuum that maintains a large amount of tissue inside the notch 150 . in fig2 b , the vacuum - assisted biopsy device 200 includes a stylet tip 210 that is to be inserted within the body of a patient during a biopsy so that tissue sample ( s ) from the patient may be deposited in the notch 250 of the stylet tip 210 . according to various aspects , the stylet tip 210 may be connected to a vacuum pump 230 via a vacuum line 220 , the vacuum pump 230 including a valve 240 . the housing 260 may include , in the case of a spring - loaded biopsy device , a valve mechanism such valve assembly 270 and / or the firing mechanism to fire a cannula over the stylet tip 210 to sever tissue samples . according to various aspects , the housing 260 may also be used as a handle by an operator to operate the biopsy device . the valve 240 may , for example , only allow flow in a single direction such that air can only flow out of the vacuum pump 230 via the valve 240 . as such , the valve 240 may help prevent foreign materials from coming in contact with the target tissue . in operation , the vacuum pump 230 may create a vacuum and transmit the vacuum via the vacuum line 220 to the stylet tip 210 . furthermore , an additional valve assembly 270 may be introduced between the stylet tip 210 and the vacuum pump 230 in order to regulate the vacuum flow between the stylet tip 210 and the pump 230 . according to various aspects , the valve assembly 270 may be in a closed state , where no vacuum is communicated to the stylet tip 210 , or in an open state , where a vacuum is communicated to the stylet tip 210 . in operation , the vacuum pump 230 may create a vacuum and may transmit the vacuum via the vacuum line 220 to the stylet tip 210 via the additional valve 270 . accordingly , when the stylet tip 210 penetrates the skin of the patient , the vacuum provided through the vacuum line 220 may draw an amount of tissue in the notch 250 that is larger than if no vacuum was provided , and the tissue may then be severed via , for example , firing a cutting cannula . accordingly , a larger amount of tissue sample may be collected in the notch 250 of the biopsy device 200 as compared to a biopsy performed without vacuum . fig3 a - 3d are diagrams illustrating a cannula and stylet having a notch in a vacuum - assisted biopsy device , according to various aspects of the current invention . in fig3 a , the biopsy device 300 includes the stylet tip 310 having the notch 350 connected to the vacuum line 320 . according to various aspects , the vacuum line 320 may include one or more outlets or passageways 315 that may allow for vacuum to flow between the vacuum line 320 and the environment during vacuum actuation by the vacuum pump . as such , when vacuum is applied and transmitted from the vacuum line , the tissue that has been severed , or that is about to be severed , by the cannula 340 may be attracted to the notch 350 via a vacuum travelling along the three arrows depicted in fig3 a and representative of the travel path of the suction action of the vacuum . as a result , a large amount of tissue may be attracted to the notch 350 which can be severed and extracted by the biopsy device 300 . according to various aspects , the circumference of the body of the stylet , which may correspond to a back portion of the stylet tip 310 and which is typically covered by the cannula 340 , may be altered such as to provide enough space for the vacuum to travel inside the cannula and around the outer surface of the stylet . for example , portions of the circumference of the stylet may be machined away so as to leave an uneven cylindrical shape with enough space to allow circulation of vacuum or air around the circumference of the stylet . according to various aspects , the outside surface 325 of the vacuum line 320 may include asperities and other surface features to provide , for example , space for a lubricant to provide adequate lubrication during insertion and operation of the biopsy device . in addition , the lubricant may prevent a vacuum leak during operation of the biopsy device . according to various aspects , the outside surface 325 of the vacuum line 320 may also be covered with a lubricant 335 such as , e . g ., silicone grease , to facilitate movement of the stylet tip 310 and the vacuum line 320 inside the wall of the outer tube or cannula 340 of the biopsy device 300 , and thus to facilitate movement of the stylet tip 310 in and out of the outer tube or cannula 340 to penetrate the skin / tissue of the patient , to remove tissue sample ( s ), or to rotate inside the outer tube or cannula 340 to remove tissue sample ( s ). in addition , the lubricant 335 may also act as a vacuum membrane to prevent vacuum from escaping through other portions of the biopsy device 300 and to constrain the path of the vacuum to the paths shown in fig3 a by the three arrows . in fig3 b , the biopsy device 300 includes the stylet tip 310 having the notch 350 connected to the vacuum line 320 . according to various aspects , the outside surface of the vacuum line 320 may have surface features 325 of various sizes to provide , for example , space for adequate lubrication of the stylet tip 310 during insertion and operation of the biopsy device , and the surface features 325 may be configured to fit against the inner wall of the outer tube or cannula 340 of the biopsy device . in addition , grooves 335 may also be provided on the surface of the stylet tip 310 between the surface features 325 to receive , for example , lubricant to facilitate movement and / or rotation of the stylet tip 310 inside the outer tube or cannula 340 and to provide a vacuum membrane . fig3 c illustrates another aspect of the current invention , where a conduit 345 provides an air / vacuum communication between the notch 350 and the vacuum line 320 . accordingly , the vacuum provided via the vacuum line 320 can be transmitted to the notch 350 and can attract an amount of tissue sample into the notch 350 either before the tissue is severed , or after the tissue has been severed . in fig3 d , according to various aspects of the current invention , a friction space or clearance 330 may be provided between the vacuum line 320 and the outer tube or cannula 340 to allow the stylet tip 310 and the vacuum line 320 to move and rotate freely inside the outer tube or cannula 340 , resulting in the outside diameter of the vacuum line 320 being smaller than the inside diameter of the outer tube or cannula 340 by an amount sufficient to reduce the friction between the outer tube or cannula 340 and the vacuum line 320 . for example , the clearance between the outside diameter of the vacuum line 320 and the inside diameter of the outer tube or cannula 340 may be in the range of 0 . 015 ″. according to various aspects , an asperity 355 may also be provided on the outside surface of the vacuum line 320 to maintain , for example , the clearance 330 between the vacuum line 320 and the outer tube or cannula 340 at a constant value , and may provide space for inserting a lubricant to reduce friction between the vacuum line 320 and the cannula 240 and to also provide sealing of the space between the vacuum line 320 and the cannula 240 and avoid or reduce unwanted vacuum leaks . additionally , the space between the vacuum line 320 and the cannula 240 can be reduced by crimping the exterior of the cannula 240 . in operation , when the stylet tip 310 is inserted into the target tissue , the cannula 340 may be moved forward at a relatively high speed to cover the stylet tip 310 , and as a result sever a tissue sample from the body of the patient . for example , the cannula 340 may be fired forward via a spring which , when activated , may fire the cannula 340 forward to cover the stylet tip 310 and sever a tissue sample . according to various aspects , there are three different types of cannula firing mechanisms : i ) manual , where the operator manually pushes the stylet tip 310 forward in the target tissue , and then manually pushes the cannula 340 forward to sever a tissue sample , ii ) semi - automatic , where the operator manually pushes the stylet tip 310 forward in the target tissue , and then fires the cannula 340 forward via the spring or firing mechanism , and iii ) automatic , where the operator fires both the stylet tip 310 and the cannula 340 forward into the target tissue via the spring or firing mechanism . fig4 a - 4d are diagrams illustrating a communication between the vacuum line and the notch in a vacuum - assisted biopsy device , according to various aspects of the current invention . in fig4 a , the biopsy device 400 includes stylet tip 410 and a notch 450 connected to the vacuum line 420 located within the outer wall 440 . according to various aspects , the notch 450 may be connected to the vacuum line 420 via a plurality of air / vacuum lines or microbores 465 that may be thinner than the vacuum line 420 . in the example illustrated in fig4 a , two microbores 465 are illustrated , but those of ordinary skill in the art will recognize that more than two microbores 465 may be present to ensure air and / or vacuum communication between the notch 450 and the vacuum line 420 . fig4 b illustrates a similar configuration as fig4 a , but with a single microbore 465 between the notch 450 and the vacuum line 420 to ensure air and / or vacuum communication . in fig4 c , the biopsy device 400 includes the stylet tip 410 with the notch 450 . according to various aspects of the current invention , the back portion of the stylet tip 410 may include a boss 475 that , in operation , may be fitted into a fitting 470 , the fitting being insertable within the vacuum line 420 . as a result , a vacuum or air communication may be established between the notch 450 and the vacuum line 420 so that the target tissue of a patient being subjected to the biopsy may be drawn in the notch 450 via the vacuum provided from the vacuum line 420 , before and / or after being severed , according to various aspects . in addition , a plurality of pores 480 may be provided in the vacuum line to provide an alternative or additional path for the vacuum to the stylet tip 410 . in fig4 d , the back portion of the stylet tip 410 includes the boss 475 , which , according to various aspects , may be directly inserted into the vacuum line 420 . accordingly , a vacuum or air communication may be established between the notch 450 and the vacuum line 420 so that the tissue sample of a patient being subjected to the biopsy may be drawn into the notch 450 via the vacuum provided via the vacuum line 420 . according to various aspects , openings 485 may be provided in the vacuum line 420 to provide an alternative or additional vacuum path to the stylet tip 410 during insertion and operation of the biopsy device . fig5 a - 5d are diagrams illustrating vacuum valves in a vacuum - assisted biopsy device , according to various aspects of the current invention . in fig5 a , a valve 570 includes a pinch valve , where a portion of the vacuum line 520 may be pinched in order to block or release passage of vacuum or air . fig5 b illustrates another type of valve 540 that is based on a duck bill 545 , according to various aspects of the current invention . it should be noted that although the above valves have been illustrated , other types of valves may also be used to regulate the air or vacuum communication between the vacuum line 420 and the notch 450 in order to ensure a large draw of tissue sample into the notch 450 and provide larger tissue samples than the samples collected using conventional biopsy devices for biopsy analysis . while aspects of this invention have been described in conjunction with the example features outlined above , various alternatives , modifications , variations , improvements , and / or substantial equivalents , whether known or that are or may be presently unforeseen , may become apparent to those having at least ordinary skill in the art . accordingly , the example aspects of the invention , as set forth above , are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and thereof . therefore , aspects of the invention are intended to embrace all known or later - developed alternatives , modifications , variations , improvements , and / or substantial equivalents .	0
certain terminology will be used in the following description for convenience in reference only and will not be limiting . the words “ up ”, “ down ”, “ right ” and left ” will designate directions in the drawings to which reference is made . the words “ in ” and “ out ” will refer to directions toward and away from , respectively , the geometric center of the device and designated parts thereof . the words “ proximal ” and “ distal ” will refer to the orientation of an element with respect to the patient support apparatus . such terminology will include derivatives and words of similar import . referring to fig1 , a patient support apparatus with a removable foot section 100 is illustrated . the patient support apparatus 100 includes a main bed 110 and a removable foot section 150 . the main bed 110 includes a support base 115 to which is mounted a main bed patient support deck 116 . the support deck 116 supports a main bed pad or mattress 112 having an upper surface 113 . the main bed 110 further includes an anterior or perineal edge face 114 adapted for receiving the removable foot section 150 . a pair of mounting brackets 118 ( fig1 - 3 ) is positioned distally from the anterior face 114 and is configured for mounting a pair of latch mounts 120 for securing the removable foot section 150 proximate the anterior face 114 of main bed 110 . the mounting brackets 118 can be configured as disclosed in commonly owned u . s . pat . no . 7 , 127 , 756 , which is hereby incorporated herein by reference . the removable foot section 150 can be supported by a pair of abductors as illustrated therein , for alignment of the removable foot section 150 with the latch mounts 120 . in the alternative , the removable foot section 150 and the abductors can be arranged to deliberately preclude support of the removable foot section 150 by the abductors , in order to force an operator to deliberately align the removable foot section 150 with the latch mounts 120 , and to avoid inadvertent placement of the removable foot section 150 adjacent the main bed 110 in a non - engaged condition . each latch mount 120 has a generally upwardly opening “ c ” shape and includes a distal or nose portion 128 incorporating an upwardly and inwardly directed catch 122 , a flattened central portion 126 and a raised proximal portion including an inwardly directed recess 124 . referring further to fig2 , each latch mount 120 includes a mounting base 132 for mounting the latch mount 120 to the mounting bracket 118 . each latch mount 120 further incorporates a pair of parallel opposing side channels 130 forming a narrowed center section or neck 129 for facilitating insertion of the latch mount 120 into the removable foot section 150 as will be further described below . referring to fig1 and 2 , the removable foot section 150 includes a proximal end 162 and a concave distal end 164 . the removable foot section 150 further includes a pair of tubular side rails 156 , a proximal cross rail 160 and an arcuate distal cross rail 158 . the tubular side rails 156 include a proximal end 157 . a foot section patient support deck 154 is mounted to the rails 156 , 158 , 160 . the patient support deck 154 is further configured for supporting a foot section pad 152 having an upper surface 153 . when the removable foot section 150 is attached to the main bed 110 , the upper surface 153 of the foot section 150 will be contiguous with the upper surface 113 of the main bed pad 112 . the removable foot section 150 further includes a brace 166 attached to and depending from the proximal cross rail 160 and the foot section patient support deck 154 . the brace 166 is configured to support the removable foot section 150 in a vertical orientation on a floor surface when the foot section 150 is removed from the main bed 110 . the removable foot section 150 is configured to stand , in the vertical orientation , on the brace 166 and the proximal end 157 of the side rails 156 . at the proximal end 157 of the side rails 156 , each side rail 156 includes a mount - receiving slot 168 with a chamfered mouth 170 . a sleeve 224 is secured within the side rail 156 over the mount - receiving slot 168 by a fastener 225 . the mount - receiving slots 168 are adapted for receiving the latch mounts 120 in such a manner that the neck 129 of each latch mount 120 , formed by the side channels 130 , aligns with the respective mount - receiving slot 168 of the side rails 156 . the sleeve 224 is positioned within the side rail 156 for alignment with the recess 124 of the latch mount 120 as the latch mount 120 enters the side rail 156 . the chamfered mouth 170 of each mount - receiving slot 168 aids the operator in guiding the latch mounts 120 into the mount - receiving slots 168 . the removable foot section 150 further includes a locking mechanism 180 for releasably locking the removable foot section 150 to the main bed 110 . as seen in fig1 - 2 , the locking mechanism 180 presents an operator with a main u - shaped handle 182 and a u - shaped release lever 184 pivotally associated with the main u - shaped handle 182 . the handle 182 and release lever 184 are inverted “ u ” s straddling the removable foot section 150 in the form of an arch . each depending leg of the handle 182 and release lever 184 terminate within a handle pivot assembly 186 . the handle pivot assembly 186 is pivotally mounted to a locking mechanism cam housing 188 depending from each side rail 156 . each cam housing 188 is u - shaped , with each upstanding leg or wall of the cam housing 188 connecting to the tubular side rail 156 so that the cam housing 188 hangs directly beneath the side rail 156 . referring briefly to fig6 a - 6b , the cover of the handle pivot assembly 186 has been removed to reveal that the release lever 184 is pivotally attached to the main handle 182 by a pivot pin 244 , and includes a distal portion 246 extending beyond the fulcrum formed by the pivot pin 244 . the main handle 182 is fixedly mounted to a double - d - shaped cam pin 232 which rotatably mounts the main handle 182 to the cam housing 188 . a spring - urged plate 239 having a central elongate slot 237 is slidably mounted on the cam pin 232 . the plate 239 includes a locking lug 240 extending inwardly toward the cam housing 188 , and adapted , under the urging of a spring 241 , for engaging one of a number of notches 242 , 243 formed in the wall of cam housing 188 . in fig6 a - 6b , the release lever 184 has been rotated about the pivot pin 244 so that the distal portion 246 of the release lever 184 has countered the urging of the spring 241 on the plate 239 , forcing the locking lug 240 out of the notch 242 . in fig3 - 4 , the locking lug 240 is urged by the spring 241 into the notch 242 . referring now to fig3 , a partial cut - away view of the removable foot section 150 , the internal components of the locking mechanism 180 within one side rail 156 are illustrated . the handle pivot assembly 186 , the outer wall of the cam housing 188 and the side rail 156 have been removed to reveal the internal components . the configuration of the locking mechanism 180 of each side rail 156 is the same . in the following description , the components and function of only one side rail 156 will be described , but it is to be understood that the components and function apply to both side rails 156 . it is to be recognized that some portions of the handle pivot assembly 186 will need to be a mirror image of the other for attachment to the outside of the respective side rail 156 . the locking mechanism 180 within the tubular side rail 156 includes a locking cam 230 , a carriage assembly 210 connected to the locking cam 230 by an elongate locking mechanism linkage 200 , and an elongate sensing link 190 . the locking cam 230 is eccentrically mounted on the double - d - shaped cam pin 232 and is rotatably connected to the cam housing 188 . the locking cam 230 includes a lever arm 231 and a distally extending flat portion 234 . the locking mechanism linkage 200 is pivotally connected at its distal end to the lever arm 231 of the locking cam 230 by a pivot pin 202 , and is pivotally connected at its proximal end to the carriage assembly 210 by a pivot pin 204 . the carriage 210 is slidably received within the tubular side rail 156 . the carriage 210 carries a u - shaped pivotal locking arm 212 , the bight portion of the “ u ” forming a locking hook 214 . the legs 212 a ( see fig3 ) of the “ u ” straddle the carriage 210 and are pivotally supported on the carriage 210 by a pivot pin 211 . the locking hook 214 is forced upward as a locking pin 220 , fixed to the respective side rail 156 , pivots the locking arm 212 about the pivot pin 211 by pressing against a distal portion of the locking arm 212 . the elongate sensing link 190 is slidably carried within the tubular side rail 156 and includes a proximal end 192 and a distal end 194 . the sensing link 190 is spring - biased in a proximal direction by a spring 195 connecting the sensing link 190 to the carriage assembly 210 , forcing the proximal end 192 of the sensing link 190 toward the proximal end 157 of the side rail 156 . as shown in fig3 - 4 , the distal end 194 of sensing link 190 is urged by the bias of the spring 195 against the locking cam 230 and under the flat portion 234 . as shown in fig1 - 5 , the main handle 182 is shown locked in an upright “ carry ” position . the arcuate distal end of the removable foot section 150 can be balanced against the operator &# 39 ; s midsection while the operator carries the removable foot section 150 by the upright , locked main handle 182 . it will be intuitive to the operator that the carry handle must be moved from the upright “ carry ” position to a stowed position so as to not interfere with the use of the patient support apparatus . referring to fig1 - 4 , the main handle 182 is prevented from rotating from its upright “ carry ” position by two mechanisms , the locking cam 230 and the spring - urged plate 239 ( see fig6 a and 6b ). the handle 182 , the locking cam 230 , and the plate 239 are all rotatably fixed on the double - d - shaped cam pin 232 . the locking cam 230 is prevented from rotating due to the positioning of the distal end 194 of the sensing link 190 under the flat portion 234 of the locking cam 230 . the plate 239 is urged by the spring 241 so that locking lug 240 is received in the notch 242 . in order to rotate the handle 182 , both of these locking mechanisms must be released . to releasably attach the removable foot section 150 to the main bed 110 , the removable foot section 150 must begin at a position removed from the anterior face 114 , with the upper surface 153 of the foot section pad 152 substantially co - planar with the upper surface 113 of the main bed pad 112 . this will align the bottom face of the side rails 156 and therefore the mount receiving slots 168 with the side channels 130 of the latch mounts 120 . the side rails 156 must also be aligned laterally with the latch mounts 120 . as the removable foot section 150 is moved toward the main bed 110 , the nose end 128 of each latch mount 120 will enter a respective side rail 156 such that the side channels 130 will be received in the mount receiving slots 168 . since the nose section 128 of the latch mount 120 is lower than the raised proximal portion of each latch mount 120 , the nose section 128 will clear the sleeve 224 mounted within each side rail 156 ( see fig4 ). as each latch mount 120 enters each side rail 156 , the nose section 128 will contact the proximal end 192 of each sensing link 190 . further movement of the foot section 150 toward the main bed 110 will cause the nose section 128 to force the sensing link 190 against the bias of the spring 195 . as the sensing link 190 is displaced against the bias of spring 195 , the distal portion 194 of the sensing link 190 is forced clear of the flat portion 234 of the cam 230 . with the distal portion 194 of the sensing link 190 displaced , as shown in fig5 - 9 , the flat 234 can now clear the distal portion 194 of sensing link 190 so that the cam 230 can rotate in a counter clockwise direction . before the handle 182 can be rotated , however , the secondary locking mechanism comprising the lug 240 within the notch 242 must be disengaged . in a natural and intuitive operation , aided by color - coding or instructional wording on the release lever 184 , the operator will squeeze together the release lever 184 and the main handle 182 . the release lever 184 is thereby rotated about the pivot pins 244 , causing the distal portion 246 of the release lever 184 to shift the plate 239 against the urging of spring 241 and extract the locking lug 240 from the notch 242 ( see fig6 a - 6b ). with the locking lug 240 out of the notch 242 , the double - d - shaped cam pin 232 , the locking cam 230 , the plate 239 , and the main handle 182 are free to rotate together relative to the cam housing 188 . with the removable foot section 150 still supported in the engaged position against the main bed by the operator &# 39 ; s midsection , the operator can then draw the main handle 182 distally about the cam pin 232 , thereby engaging the locking mechanism 180 for securing the removable foot section 150 to the main bed 110 . with particular reference to fig8 , as the cam pin 232 rotates with the main handle 182 , the lever arm 231 of the cam 230 draws the locking mechanism linkage 200 toward the distal end of removable foot section 150 , drawing the carriage assembly 210 with it . as the carriage assembly 210 traverses distally with respect to the locking pin 220 , the locking hook 214 is urged by sliding contact with the locking pin 220 into the central portion 126 of the latch mount 120 and then is drawn distally against the catch 122 . further rotation of the cam 230 will result in the foot section 150 being drawn in toward the anterior face 114 of the main bed until the sleeve 224 is received in the recess 124 of the latch mount 120 . the cam housing 188 includes a stop 236 positioned such that the flat portion 234 of the cam 230 reaches the stop 236 as the sleeve 224 is fully received in the recess 124 of the latch mount 120 . this coincides with the main handle 182 having rotated approximately 90 degrees so that it is substantially co - planar with the side rails 156 , and no longer interferes with the use of the bed . upon release of the main handle 182 and the release lever 184 by the operator , the spring 241 acting on the plate 239 will urge the locking lug 240 inwardly to engage the notch 243 in the cam housing 188 . the notch 243 is positioned on the cam housing 188 to correspond to the main handle 182 being in the horizontal position . the removable foot section 150 is thereby positively mounted to the main bed 110 until an operator proactively grasps the main handle 182 and the release lever 184 and moves the release lever 184 toward the main handle 182 , thence causing the locking lug 240 to be extracted from the notch 243 . the operator then rotates the main handle 182 in a clockwise rotation , reversing the above - described sequence to disengage the locking mechanism 180 . when main handle 182 reaches the upright position and the release lever 184 is released by the operator , the locking lugs 240 will enter the notches 242 under the urging of the springs 241 to lock the handle 182 in the upright position . the removable foot section 150 can thereafter be lifted away from the main bed 110 . the concave distal end 164 of the removable foot section 150 is configured for resting against the operator &# 39 ; s midsection while the operator lifts the removable foot section 150 by the main handle 182 . with the concave distal end 164 resting against the operator &# 39 ; s midsection , the center of mass of the removable foot section 150 is advantageously drawn closer to the operator , rendering the removable foot section 150 easier to lift and transport . referring now to fig1 - 16 , a further embodiment of a locking mechanism 300 for a removable foot section for a patient support apparatus is illustrated . the mechanism 300 includes a plate - like latch mount 310 configured for mounting to a main bed comparable to the main bed 110 described above . the latch mount 310 includes a sensing link receiver 312 , a latch receiver / recess 314 and a catch 316 . the removable foot section includes a rail 320 that is substantially rectangular in cross - section . a cross pin 322 is fixedly mounted near the proximal end of the rail 320 . a locking arm 330 is pivotally mounted to the rail 320 by a spring / locking arm pivot 332 . the locking arm 330 is pivotally linked to a spring arm 334 also pivoting about the spring / locking arm pivot 332 and biased in a counter clockwise direction ( as shown in fig1 ) by a spring 328 . the locking arm 330 includes a locking arm face 335 and is prevented from rotating through the contact of the locking arm face 335 with a sensing link nose 344 . the sensing link nose 344 is part of a sensing link 340 slidably mounted within the rail 320 . the sensing link 340 includes a longitudinal slot 352 for facilitating a relative movement to the spring / locking arm pivot 332 of the locking arm 330 . the sensing link 340 further incorporates a proximal slot / recess 342 for clearing the cross pin 322 of the cross rail 320 . referring sequentially to fig1 - 15 , as the foot section is moved or pushed by the attendant proximally toward the main bed , the latch mount 310 enters the proximal end of rail 320 through appropriately provided slots as in the embodiment described above . the first positive engagement occurs between the sensing link receiver 312 of the latch mount 310 and the sensing link nose 344 of the sensing link 340 . as the sensing link nose 344 contacts and is displaced distally by the latch mount 310 as shown in fig1 - 13 , the sensing link 340 is displaced distally with respect to the rail 320 as the rail 320 continues its movement toward engagement with the latch mount 310 . as the cross pin 322 becomes fully engaged with the latch receiver / recess 314 of the latch mount 310 , the sensing link nose 344 is pushed by the latch mount 310 past the locking arm face 335 of the locking arm 330 . when the sensing link nose 344 has cleared the locking arm face 335 , the locking arm 330 is biased counter clockwise by the spring 328 , forcing the locking hook 336 mounted to the locking arm 330 into the catch 316 of the latch mount 310 . the foot section is thereby locked with the main bed in a positive manner . referring to fig1 , a release mechanism is disclosed whereby a release handle 350 is slidably mounted to the side rail 320 . the release handle 350 includes two angled slots 358 , 360 configured to ride on laterally extending pins 362 , 364 secured to the frame 320 , so that as the release handle 350 is depressed ( or lifted ), the angled slots 358 , 360 will cause the release handle 350 to be drawn upward and to the right . a link arm 354 is pivotally mounted to the sensing link 340 by a pivot pin 348 . the link arm 354 includes a second pin 356 configured to engage the release handle 350 , and is supported by the laterally extending pin 362 . when the sensing link 340 is in the non - engaged position , i . e . fully extended to the left , the link arm 354 is also drawn to the left . with the link arm 354 drawn to the left , the second pin 356 is drawn into a longitudinal slot 353 formed in the release handle 350 . therefore , if the release handle is depressed when the sensing link 340 is not engaged by the latch mount 310 , the second pin 356 can slide freely in the slot 353 and the sensing link 340 is not affected . with the sensing link 340 displaced to the right by engagement with the latch mount 310 , the link arm 354 is also displaced to the right , as shown in fig1 . this shifts the second pin 356 out of the slot 353 and into a position to be engaged by a recess wall 355 formed on the release handle 350 . as the release handle 350 is depressed , the second pin is engaged by the recess wall 355 , causing sensing link 340 to be further displaced to the right . as sensing link 340 is displaced distally , a locking arm retracting pin 349 mounted on the sensing link 340 will bear against a locking arm retractor 338 , acting against the bias of the spring 328 and causing the locking arm 330 to rotate clockwise as shown in fig1 . with locking hook 336 withdrawn from the catch 316 , the foot section can be withdrawn distally from the main bed . as the foot section is withdrawn , the handle 350 can be released so that the sensing link nose 344 can engage the locking arm face 335 under the urging of the spring 328 . fig1 - 20 disclose a further embodiment of the patient support apparatus with a removable foot section 450 according to the invention . a pair of latch mounts 420 are provided , mounted to a main bed as described above in the first embodiment . the latch mounts 420 comprise an upwardly directed “ c ” shape , having an inwardly directed proximal recess 424 and an inwardly directed distal catch 422 . the latch mounts 420 further include an arcuate nose portion 428 . the removable foot section 450 includes a foot section patient support deck 454 supported by a pair of longitudinal side rails 456 and cross rails 458 , 460 , and a pad 452 supported by the support deck 454 . the side rails 456 each include a proximal slot 468 having a mouth 470 for receiving each of the latch mounts 420 , as in the first embodiment the removable foot section 450 further includes an attachment and locking mechanism 480 . the locking mechanism 480 includes a handle 482 in the form of an inverted “ u ”. each of the legs of the handle 482 are connected to a cam bracket 530 . each cam bracket 530 is pivotally mounted to one of the side rails 456 by a pivot pin 532 . the cam bracket 530 includes an internal cam plate 534 pivotally connecting the cam bracket 530 to a connecting link 500 by a pivot pin 502 , an external mounting plate 536 for mounting the handle 482 and a back plate 538 serving as a rotation stop of the cam bracket 530 with respect to the side rail 456 . each connecting link 500 is further pivotally connected to a carriage 510 and sensing link 490 . the connecting link 500 is connected to the carriage 510 by a pin 504 passing through a slot ( not shown ) in the side rail 456 . the slot enables proximal - distal movement of the pin 504 and the carriage 510 within the side rail 456 . the sensing link 490 pivots about the pin 504 . fig1 and 19 are enlarged cut - away views showing the carriage 510 , the sensing link 490 , and a locking arm 512 , which can be of a u - shape straddling the carriage 510 with the bight portion forming a locking hook 514 . the carriage 510 is slidably received in the side rail 456 , and pivotally mounts the locking arm 512 about a pivot pin 506 . the locking arm 512 is held in a raised position by a locking pin 520 after the same fashion as the first embodiment . referring specifically to fig1 , the sensing link 490 includes a catch 496 for receiving the locking pin 520 . in the position shown in fig1 , the catch 496 has received the locking pin 520 therein , which prevents the carriage 510 from moving distally within the side rail 456 . the handle 482 is also thereby prevented from rotating distally about pivot pin 532 . referring to fig1 , the removable foot section 450 has been moved proximally toward the latch mount 420 so that the arcuate nose portion 428 of the latch mount 420 has engaged the leading edge 492 of the sensing link 490 . this causes the sensing link 490 to pivot about the pin 504 , disengaging the catch 496 from the pin 520 . this frees the carriage 510 to slide distally , and therefore frees the cam bracket 530 to be rotated about pivot pin 532 and handle 482 to be rotated distally . upon rotation of the cam bracket 530 about the pivot pin 532 , the connecting link 500 is drawn distally , and the carriage 510 moves distally . as the latch mount 420 is positioned to displace the sensing link 490 , it further aligns the recess 424 with the sleeve 224 , and aligns the locking hook 514 of the locking arm 512 with the catch 422 of the latch mount 420 . in much the same fashion as the first embodiment described above , when the handle 482 is rotated counter - clockwise , the link 500 will be pulled distally . as shown in fig2 , the carriage 510 will draw the locking arm 512 to the left and cause the pin 520 to drive the proximal end of the locking arm 512 downward . the locking hook 514 engages the catch 422 while drawing the foot section 450 against the patient support , fully engaging the sleeve 224 in the recess 424 . as the handle 482 is rotated distally , the back plate 536 of the cam bracket 530 contacts the bottom of the side rail 456 as the handle 482 reaches a horizontal position . the arrangement is configured such that when the handle 482 is in the horizontal position , the locking mechanism 480 is fully engaged with the sleeve 224 fully seated in the recess 424 and the removable foot section 450 closely drawn against the patient support . referring now to fig2 - 24 , alternative locking mechanism embodiments 1180 , 2180 , 3180 , 4180 are illustrated . in fig2 , a removable foot section 1150 is provided with a locking mechanism 1180 . the locking mechanism 1180 is provided on each side rail 156 and includes a main handle 1182 and a release lever 1184 projecting a short distance upwardly from each handle pivot assembly 186 . in fig2 , a removable foot section 2150 is provided with a locking mechanism 2180 on each side rail 156 . the locking mechanism 2180 comprises a main handle 2182 and a release lever 2184 . the main handle 2182 includes an inwardly turned portion 2183 , and the release lever includes an inwardly turned portion 2185 , each inwardly turned portion 2183 , 2185 extending over the upper surface 153 of the foot section pad 152 . the inwardly turned portions 2183 , 2185 lack a continuous bight portion therebetween . in fig2 , a removable foot section 3150 is provided with a locking mechanism 3180 on each side rail 156 having main handles 3182 and release levers 3184 pivotally connected in a handle pivot assembly 3186 . the release lever 3184 is positioned proximally of the main handle 3182 for grasping by an operator . the main handles 3182 and the release levers 3184 curve proximally . in fig2 , a removable foot section 4150 is provided with a locking mechanism 4180 comprising a main handle 4182 . the main handle 4182 is pivotally or slidably mounted to the removable foot section between the side rails 156 , and configured to release the locking mechanism 4180 . although a particular preferred embodiment of the invention has been disclosed in detail for illustrative purposes , it will be recognized the variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention .	0
embodiments of the present invention will now be described with reference to the drawings . the embodiment illustrated in fig1 - 5 is directed to a baby carriage in which the mechanisms for folding the carriage are disposed at the lower end portions of the handle bar . according to another embodiment illustrated in fig6 the upright position of the handle bar can be adjusted forwardly and backwardly with respect to the seat portion of the carriage . referring to fig1 a baby carriage b has front leg bars ( a ) having wheels ( c ) at lower ends thereof , rear leg bars ( b ) having wheels ( c ) at lower ends thereof and a handle bar 1 whose lower end portions are attached to the upper portions of the front leg bars ( a ) extending along the axial direction thereof such that they appear to form a continuation of the front leg bars ( a ). the upper ends of the front leg bars ( a ) are pivoted at portions ( d ) near the upper end portions of the rear leg bars ( b ) such that the front leg bars are collapsible . thus , the baby carriage is substantially x - shaped as viewed from its side . brackets 2 support the lower portion of the handle bar 1 . specifically , the upper end portion of each bracket 2 is pivotally secured to the lower portion of the handle bar and the lower end portion of each bracket is pivotally secured to an intermediate portion of the rear leg bar ( b ). the brackets 2 serve to support the lower end portions of the handle bar 1 and are utilized for retaining the baby carriage b in the erected position . into each of fitting grooves 21 cut out at the upper end portion of the bracket 2 is fitted and engaged each of retainer shafts 31 , a short length of which is projected to the inner side face of a stopper 3 . an engaging hook 32 disposed at one end portion of each of the stoppers 3 is detachably engaged with a hook retaining means ( h ) formed at an upper portion of each front leg bar ( a ), so that the erected position of the baby carriage b can be maintained . alternatively , in the case of the embodiment illustrated in fig6 engaging hooks 32 , 32 project in a wing - like manner from opposite sides of each stopper 3 and are retained on retainer shafts h1 , h2 respectively projecting from the front and back sides of each of armrest members ( e ), so that the handle bar 1 can be alternatively positioned forwardly ( as shown by the dot - dash line ) or backwardly of the baby carriage . the stoppers 3 are disposed at the lower end portions of the handle bar 1 and are slidably disposed thereon such that they can each be raised or lowered along the axial direction of the handle bar 1 by operating wires 4 . the operating wires 4 slide in response to rotation a slide operation mechanism a disposed at the handgrip portion of the handle bar 1 . the lower end portions of the operating wires 4 are each secured to the stoppers 3 by retainer shafts 33 and the upper end portions of the operating wires 4 are secured to slide members 11 slidably mounted in the slide operation mechanism a , as illustrated in fig4 . a spring 34 interconnects each of the retainer shafts 33 to the lower end portions of the handle bar 1 to urge each of the stoppers 3 downwardly . a longitudinally extending slide groove 35 is provided in the lower end portion of the handle bar 1 for accommodating each of the retainer shafts 33 . referring to fig5 ( a ), the slide operation mechanism a constitutes an important part of the present invention and comprises the slide members 11 , 11 slidably accommodated in the handle bar 1 , operating grips 12 , 12 for operating the slide members 11 , 11 and slide guide pins 13 , 13 for actuating the slide members 11 , 11 by interlocking them with the operating grips . each of the slide members 11 are sized to be slidably received in a hollow portion 11a formed in the handle bar 1 . an engaging groove 14 for accommodating each of the operating wires 4 is formed by cutting out a part of each of the slide members 11 , 11 . additionally , a vertically disposed insertion hole 15 is provided in each of the slide members for receiving slide guide pin 13 such that the pin extends from opposite ends of each slide member . insertion holes 11b , 11b are provided in the handle bar 1 for allowing the slide member to be positioned in the hollow portion 11a . in this embodiment , although each slide member 11 and the slide guide pins 13 are individually formed and arranged as described above , the invention is not to be restricted to this arrangement . for example , as illustrated by fig5 ( b ), slide projections 13 , 31 , each having a length corresponding to the projected height of the slide guide pin 13 , project from the upper and lower faces of the slide members 11 such that they engage the slide guide grooves 18 formed in the operating grips 12 . in this case , it may be necessary to form guide grooves 11c on the handle bar for inserting the slide guide pins 13 therethrough . a resilient spring 16 extends between the confronting faces of the two slide members 11 , 111 with opposite ends of the spring contacting the two slide members so as to urge the slide member away from one another . horizontally extending slide grooves are provided in upper and lower portions of the handle bar 10 for accommodating the sliding movement of the slide members 11 , 11 . the semicircular shaped operating grips 12 , 12 are respectively provided with corresponding semicircular cavity portions 12a , 12a on the inner side faces thereof . these cavity portions 12a , 12a are formed as contact portions to contact the handle bar 1 . the two cavity portions 12a , 12a are arranged so as to oppose each other with the handle bar 1 sandwiched therebetween . the operating grips 12 , 12 are tightly fastened to each other by means of screws 12b , 12b or secured to each other by other engaging means . in this embodiment , although the operating grip is formed by connecting two components with each other , the invention is not to be limited to this structure . the two operating grips may be replaced by one cylindrical member and structural portions such as the slide guide grooves may be formed in this cylindrical member . u - shaped slide guide grooves 18 , 18 are formed in the cavity portion 12a of each of the operating grips 12 . these guide grooves 18 , 18 are dimensioned to receive the end portions of the slide guide pins 13 , and are shaped such that the upper portions of each of the u - shaped grooves project toward each other . since the assembled operating grip 12 serves to prevent the slip of a handgrip portion when rotating the operating grip 12 and to enhance the gripping effect , the operating grip 12 may have an oval shape or any other shape as an alternative to the circular cross - sectional shape . a stopper 19 is slidably mounted in a slide groove 20 formed on the handle bar for restricting the rotation of each of the operating grips 12 . an end portion of the stopper is disengageably fitted into a fitting groove 22 formed at the end portion of each of the operating grips 12 . an engaging projection 19a projecting from the rear face portion of the stopper 19 , is selectively fitted into recessed portions 19b or 19c formed in the handle bar 1 . in this connection , in the case where each of the stoppers 19 is placed in a released position , each of the recessed portions 19b serves to maintain the e released state thereof with the stoppers disengaged from the fitting grooves 22 , so that each of the operating grips 12 can freely rotate . each of the other recessed portions 19c serves to maintain the rotation restricted state of the end portion of the stopper 19 fitted into the fitting groove 22 . the construction of the engaging projection 19a and the recessed portions 19b , 19c may be modified . that is , the recessed portions may be formed in the stoppers 19 and the engaging projection may be formed in the handle bar 1 . in this embodiment , although all the mechanisms of the slide operation mechanism a are formed within the handle bar 1 of the baby carriage b ( i . e ., the two slide members 11 , 11 are so disposed as to be slidable in the hollow portion at the central portion of the handle bar 1 and the operating grips 12 , 12 are rotatably mounted on the surface of the handle bar 1 ), the invention is not to be restricted to this construction . for example , a slide operation mechanism a ( not shown ) having rotatably disposed operating grips 12 , 12 may be previously formed as an individual member . this slide operation mechanism a may then be attached at the intermediate portion of the handle bar 1 . additionally , it will be readily appreciated that the construction of the stoppers 19 for restricting the rotation of the operating grips 12 , 12 and their disposed positions may be freely modified by any other construction or positions than those illustrated in this embodiment . referring to fig3 reference numeral 23 designates each retainer shaft disposed at a portion near the lower end portion of each of the rear leg bar ( b ). the retainer shafts 23 are adapted to maintain the folded state of the baby carriage b by engaging the engaging hooks 32 of the stoppers 3 therewith when the body of the baby carriage b is folded . a seat portion 5 is detachably disposed on the body of the baby carriage b . specifically , retainer shafts 51 provided at opposite sides of the seat portion are detachably engaged with engaging portions 6 formed on the body of the baby carriage b . the folding operating of the present invention having the above - mentioned construction will be now described below by referring to an embodiment illustrated in fig1 to 5 . ( 1 ) the following step are conducted in folding the baby carriage : 1 . initially each of the stoppers 191 with its end portion fitted into the fitting groove 22 of each of the operating grips 12 , is retracted from its engaged position to allow the operating 12 to be rotated . that is , the engagement of the engaging projection 19a 19 with the recessed portion 19c is released , and the engaging projection 19a is fitted into the recessed portion 19b for fitting . 2 . then , the operating grips 12 , 12 are rotated either in a forward or backward direction of the handle bar 1 . 3 . when the operating grips 12 are rotated the slide guide pins 13 , 13 , the end portions of which are fitted into the side guide grooves 18 , 18 , move from the top portions of the slide guide grooves 18 , 18 to any one of the other positions continuously extending to opposite sides therefrom . 4 . since each of the slide guide pins 13 is passed through the insertion hole 15 formed in each of the slide members 111 the slide guide pin 13 slides in response to the rotation of the operating grip 12 , which causes the slide members 11 integrated therewith to also slide in the same direction as the sliding direction of the slide guide pin 13 . as a result , each of the operating wires 4 , with their upper end portions retained in the slide members 11 , is pulled upwardly . in this case , the above - mentioned slide guide pins 13 , 13 are passed through the slide grooves 17 , 17 formed horizontally on the upper and lower faces of handle bar 1 , so that the slide guide pins 13 slide in accordance with the u - shaped guide grooves 18 , 18 so as to move horizontally without being influenced by the u - shaped flexures . 5 . when the operating wires 4 slide upwardly , the stoppers 3 , disposed at the positions near the lower end portions of the handle bar 1 in an elevatable manner , also slide upwardly so that the engagement between the engaging hooks 32 formed at the end portions of the stoppers 3 and the hook retaining means ( h ) is released . 6 . when the engagement of the stoppers 3 is released , the grip operation of the operating grips 12 is released at that position so that the two slide members are instantaneously moved toward separate and opposite positions due to the resilient force of the spring 16 interposed therebetween . consequently , the slide members 11 , 11 are returned to their original positions . 7 . when the slide members 11 , 11 return to their original positions , the stoppers 3 , engaged with the lower ends of the operating wires 4 , likewise descend along the handle bar 1 due to the contraction force of the springs 34 and are brought into such a state as to achieve an engagement state again . 8 . since the handle bar 11 whose engagement through the stoppers 3 is released , has no means for retaining its engaged state , the handle bar 1 is collapsed in the direction shown by arrow x in fig2 about the pivoted portions of the bracket 2 . thus , the baby carriage can be folded in accordance with the above - mentioned movement of the handle bar 1 , as illustrated in fig3 . 9 . when the body of the baby carriage b is folded and the stoppers 3 descend toward the lower end portions of the rear leg bars ( b ), the engaging hooks 32 disposed on the stoppers 3 automatically engage with the retainer pins 23 disposed near the lower end portions of the rear leg bars ( b ). thus , the folding operation of the baby carriage is automatically completed . 10 . when the folding operation is completed , the end portions of the stoppers 19 are fitted into the fitting grooves 22 formed in the operating grips 12 , 12 , and the respective engaging projections 19a formed on the lower face portions of the respective stoppers 19 are fitted into the recessed portions 19c such that the operating grips 12 , 12 and the stoppers 19 do not rotate . ( 2 ) in the case where the baby carriage is assembled , the operation may be effected in a totally reversed manner to the above - mentioned folding operation , as follows : 1 . initially , the engagement of the stoppers 19 retained in the operating grips 12 , 12 of the handle bar in the folded state ( i . e ., the engagement of the engaging projections 19a into the recessed portions 19c ) is released and the stoppers are released . then , the engaging hooks 32 disposed on the stoppers 3 are disengaged from the retainer pins 23 disposed on the rear leg bars ( b ) by rotating the operating grips 12 , 12 . 2 . when the engagement of the stoppers 3 with the rear leg bars ( b ) is released , the handgrip portion of the handle bar 1 in the folded state , as illustrated in fig3 is raised in the direction shown by arrow y so that the brackets 2 and the handle bar 1 rotate in the direction shown by arrow z . when the brackets 2 and the lower end portions of the handle bar 1 are raised upwardly , the body of the baby carriage b is assembled in a state as illustrated in fig1 and 2 in accordance with this movement . 3 . with the above operation , the lower end portions of the handle bar 1 are located at the upper ends of the pivoted portions of the front leg bars ( a ) and the rear leg bars ( b ). as a result , the engaging hooks 32 disposed on the stoppers 3 automatically engage with the hook retaining means ( h ) formed above the upper end portions of the front leg bars ( a ). thus , the assembling operation of the baby carriage b is completed . since the present invention has , as mentioned above , the construction in which the operating grips 12 , 12 are disposed at the central portion of the handgrip portion of the handle bar the rotating operation of the operation grips 12 , 12 can be effected , while the handle bar 1 is gripped , thereby achieving simple operation . the releasing operation of the engaging mechanisms can therefore , be effected with ease . particularly , according to the present invention , since the operating grips 12 , 12 for sliding the operating wires 4 are so mounted on the handle bar 1 as to extend therealong , the rotating operation thereof can be effected by simply gripping the handle bar 1 with a hand . since the present invention is not provided with a projecting mechanism or lever as in the case of the conventional mechanism , the operation mechanism can be handled safely .	8
the display data synthesizer circuit according to the present invention is used with a display panel of the type which includes a multiplicity of display elements for displaying a desired pattern by selectively driving the display elements . one example of type of display panel is a display panel of the liquid crystal matrix type . for convenience of explanation , the description below will refer to a case in which the display data synthesizer according to the present invention is used with a display panel of the liquid crystal matrix type . in a display panel of liquid crystal matrix type having a rectangular effective area for display , a layer of liquid crystal is provided to extend over the effective display area and a desired pattern is displayed by exciting individual portions of the layer disposed in a matrix of rows and lines selectively according to the desired pattern thereby changing the light permeability of the excited portions from that of the non - excited portions . thus , the layer of liquid crystal acts as if it includes a plurality of individual display elements which are disposed in a matrix of rows and lines and are capable of being excited selectively and independently of each other . we , therefore , refer to each of the portions of the layer of liquid crystal as a &# 34 ; display element &# 34 ; hereinafter . in fig1 which shows schematically a display panel of the liquid crystal matrix type , such display elements are represented by small rectangular frames 2 disposed in matrix array on the effective display area 1 of the display panel . this display apparatus is well known as disclosed in u . s . pat . no . 3 , 922 , 667 issued nov . 25 , 1975 on u . s . patent application ser . no . 453 , 066 entitled &# 34 ; image or segment pattern forming x - y matrix addressing method &# 34 ;; &# 34 ; large - scale liquid crystal matrix display &# 34 ; k . ono , et al , page 34 , sid &# 39 ; 76 digest ; &# 34 ; large scale integration for display screens &# 34 ; t . p . brody , ieee transaction on consumer electronics vol . ce - 21 , no . 3 , august 1975 . a block diagram of the drive circuit used for character display is illustrated in fig2 . a character data source 10 includes a keyboard , an encoder , and a computer output unit . a character to be displayed , which is entered by the keyboard , is converted into a code of 6 to 8 binary bits in the well - known asc ii code , by means of an encoder , for example . a character data representing one section of the display panel 20 is produced and stored in the frame memory 12 . the character data in the frame memory 12 is read out with a predetermined timing and transmitted to the character generator 14 . the character data is decoded and converted into a character pattern data by the character generator 14 . a character pattern data includes signals for designating excitation of the selected display elements for display on the display panel . for example , assume that , as shown in fig1 the display panel provides for display of 32 characters , and includes display elements arranged in 5 rows and 7 lines l 1 , l 2 , . . . . . l 7 for each character , each line including a total of 160 display elements , and that the seven lines of display elements are sequentially driven in the so - called line sequence scanning mode . the character generator 14 applies line display data of 160 bits corresponding to 160 display elements for each line , each bit being &# 34 ; 1 &# 34 ; when the corresponding display element is to be excited , and &# 34 ; 0 &# 34 ; when it is not to be excited , to a line display data synthesizer circuit 16 , sequentially , character by character , each character including 5 bits applied in parallel . the synthesizer circuit 16 , upon receipt of the line display data of 160 bits , holds them for a predetermined period of time , during which time it transmits signals , each corresponding to one bit , to a row driver 18 . the row driver 18 , in turn , drives the 160 rows to excite them at predetermined voltage levels corresponding to the respective signals . the seven lines of the display panel , on the other hand , are driven by a line driver 24 for a predetermined period of time for each line in accordance with a predetermined sequence controlled by the scan control circuit 22 . the drive system for this liquid crystal matrix type display panel may employ the voltage equalization system as disclosed in the u . s . pat . no . 3 , 976 , 362 issued on aug . 24 , 1976 to hideaki kawakami , one of the inventors of the present application . in such a system , each display element is driven to an excited state ( hereinafter referred to as the &# 34 ; on &# 34 ; state ) or a non - excited state ( hereinafter referred to as the &# 34 ; off &# 34 ; state ) depending on the level of a resultant voltage of the drive voltages applied to the line and row involved . according to the voltage equalization system , each element to be in the non - excited state is also impressed with a voltage of a level insufficient to render the display element in the on - state . the display data synthesizer circuit 16 receives 5 - bit character pattern data inputs from the character generator 14 , synthesizes these inputs into a line character pattern data for one display line , and holds it for one - line scanning time . a conventional synthesizer of this type is configured as shown in fig3 . fig4 is a diagram for explaining the operation of this circuit . a parallel / series converter circuit 32 receives from the character generator a 5 - bit character pattern data input 30 including parallel five bits for one line of one character , and produces the five bit signals in series . the five bit signals , as shown in fig4 ( a ), are written in series in the parallel output shift register 34 . five bits for the same line of the next character are similarly written in series . in this way , 160 bits for the same line of 32 characters are sequantially written into the register 34 during a time interval t 0 - t 1 , and synthesized as a line display data including 160 bits for one display line . the 160 - bit line display data synthesized by the shift register are then parallelly and instantaneously transferred to and held for the next time interval of t 1 - t 2 by the latch circuit 36 as shown in fig4 ( b ). during the time interval of t 1 - t 2 , the latch circuit 36 produces parallelly to the row driver 18 the line display data of one display line on the one hand and on the other hand , a character pattern data of the next display line is written in the shift register 34 as shown in fig3 . as seen from the foregoing description , during each time interval period for scanning one display line , i . e . t 1 - t 2 , or t 2 - t 3 in fig4 the latch circuit 36 holds the line display data for that line , while the shift register 34 prepares a line display data for the next display line . thus liquid crystal character display is provided in the line sequence scanning mode . the fact that a latch circuit is used in the line display data synthesizer circuit as mentioned above poses , as apparent from fig3 the problem of an increased expense and labor for wiring because of a great number of input and output wirings for parallel bits involved . even when using integrated circuits presently available which incorporate only 4 bits for each package , a latch circuit of 160 bits as described above will require 40 integrated circuits . this is not desirable from the standpoint of reduction in circuit size or cost . an example of the display data synthesizer circuit according to the present invention is shown in fig5 . a 5 - bit character pattern data input 40 representing one line of one character is applied through the parallel / series converter circuit 42 to the series output shift register 46 where it is written bit serially . after the bits representing one line of one character are written in the shift register 46 , the content of the converter circuit 42 is cleared by a clear signal cl . and then , five bits representing the same line of the next character are inputted and applied to the shift register 46 by means of a preset signal ps . thus , 160 bits representing one display line of the display panel are written in the shift register 46 . the parallel output shift register 48 is adapted for series / parallel conversion of the output of the shift register 46 . each of the shift registers 46 and 48 has a capacity for storing a character pattern data of one display line of the display panel . an or gate 44 is provided for receiving clock pulses cp1 and cp2 for determining the timings in writing and reading operations of these registers . as compared with the clock pulses cp1 which determine the timing of data writing in the series output shift register 46 , the clock pulses cp2 which determine the timing in data transfer between the shift registers 46 and 48 have a sufficiently high frequency . in other words , the frequency of the clock pulses cp2 , which are used to regulate the data transfer speed , is determined in such a manner as to complete the data transfer of the bits for one display line within a time considerably shorter than a time interval t 1 - t 2 allotted for scanning one display line . as a typical example , the clock pulses cp1 and cp2 have frequencies of 250 khz and 1 . 2 mhz , respectively . the operation of the circuit of fig5 will be described with reference to fig6 . the bits , for example 160 bits , for the display data representing one display line of the display panel are written in series in the series output shift register during a time interval of t 0 &# 39 ;- t 1 shown in fig6 ( a ). next , during a time interval of t 1 - t 1 &# 39 ; as shown in fig6 ( b ), the written display data is written bit serially in the parallel output shift register 48 at timing of the clock pulses cp2 . the time interval t 0 &# 39 ;- t 1 during which the display data for one display line is written into the register 46 is almost equal to one line scanning period ( t 0 14t 1 ) allotted for scanning one display line . however , the time interval t 1 - t 1 &# 39 ; during which the same display data is written in the register 48 is much shorter than the one line scanning period since the frequency of the clock pulses cp2 is much higher than that of cp1 . the register 48 holds for a time interval corresponding to the one line scanning period the written display data , while at the same time applying the display data to the row driver in bit parallel . during the time interval of t 1 &# 39 ;- t 2 , display data for the next display line are similarly written in the shift register 46 . referring to fig6 ( b ) and 6 ( c ), the hatched part corresponds to the data transfer period , during which time an abnormal output may be produced at the driver output side . by making the frequency of clock pulses cp2 higher as mentioned above , however , the operation margin caused by the abnormal output is reduced to a negligibly small level , thus preventing any visual reduction in display quality . in this way , while the line display data for one display line is held bit parallel by the parallel output shift register 48 for the purpose of display on the one hand , a line display data for the next display line is synthesized by means of the series output shift register on the other hand . thus , in spite of a simple circuit configuration , line display data can be smoothly synthesized and held . another embodiment of the present invention is shown in fig7 . although this circuit operates in a manner similar to the foregoing embodiment , it has a feature in the configuration and operation of data transfer . a parallel / series converter to which a 5 - bit character pattern data input 50 is applied bit parallel converts the input into a bit - serial data and applies it to the series output shift register 56 in the next stage . the shift register 56 is divided into n sections 56 - 1 to 56 - n , for example 10 sections . each of the register sections is adapted to store a 16 - bit data and produce it bit - serially . a parallel output shift register 58 is for storing bit - serially the output of the shift - register 56 and producing it bit - parallelly . this shift register 58 includes n series - connected sections 58 - 1 to 58 - n , for example 10 sections , corresponding to the sections of the shift register 56 . each of the register sections 58 - 1 to 58 - n of the shift register 58 receives bit - serially 16 bits of character pattern data ( 1 / 10 of the line display data ) from a corresponding one of the register sections 56 - 1 to 56 - n , and produces them bit - parallelly . from the output of the parallel output shift register 58 , the 160 - bit character pattern data required for display of one display line for 32 characters each by 5 × 7 dot system is produced bit - parallelly . through the or gate 54 either the writing clock pulses cp1 or the transfer clock pulses cp2 are applied to the register sections 56 - 1 to 56 - n of the series output shift register 56 . the clock pulses cp1 are also applied , together with the clear input cl and the preset input ps , to the parallel / series converter circuit 52 . the clock pulses cp2 are applied also to the register sections 58 - 1 to 58 - n of the parallel output shift register 58 . the diagram of fig8 shows the relation of timing between the display clock signal for selectively scanning the display lines of the display panel and the clock pulses cp1 and cp2 . the period t of the display clock signal shown in fig8 ( a ) corresponds to the period during which the scanning driver selects one display line . as shown in fig8 ( b ), the write clock pulses cp1 , in order to permit one line display data for 32 characters to be written in the register 56 during the period t , include 32 pulse trains each containing 5 pulses . these pulses have a relation in timing with the preset input ps and the clear input cl as shown in fig9 . the transfer clock pulses cp2 , as shown in fig8 ( c ), include 16 pulses during the first t seconds in the display clock period t . during this time t , data transfer is carried out . in the operation of the circuit of fig7 it will be seen from fig8 and 9 that 16 bits of the line display data are parallelly transferred from the register sections 56 - 1 through 56 - n of the series output shift register 56 to the corresponding register sections 58 - 1 through 58 - n of the parallel output register 56 in timing of the transfer clock pulses cp2 during the first t seconds in the clock period t . in this case , data for each of the register sections transferred in series to the corresponding register section , while data transfer from the respective register sections is parallelly made as a whole . in this way , the transfer of 160 - bit line display data from the series output shift register 56 to the parallel output shift register 58 requires only a time equal to that required for series transfer of 16 bits , thus making possible highspeed transfer of 160 bits . during one clock period t less the transfer time t , i . e ., t - t , the series output shift register 56 synthesizes the line display data by reading a character pattern data for one display line bit serially from the parallel / series converter circuit 52 on one hand and from the parallel output shift register 58 , on the other hand , the line display data previously synthesized and transferred thereto is applied to the row driver in bit parallel form . in this way , a line display data for a given display line is synthesized and held . this operation is repeated for all the lines of the display panel in synchronism with the line sequence scanning operation , thus making depiction of desired characters on the display screen . the data transfer speed is of course determined at a sufficiently high level in this embodiment . a main advantage of the circuit of fig7 lies in that , since line display data are divided into several groups and parallelly transferred between shift registers , high speed data transfer is possible without using an extremely high frequency of the transfer clock pulses . the circuit of fig7 therefore , is suitably applied especially to a character display apparatus having a great number of characters involved in one display line and a great amount of data to be transferred during one line scanning period . fig1 and 11 show a comparison of drive voltage waveforms of the liquid crystal display panel between a system using a conventional line display data snythesizer circuit shown in fig3 and a system using the circuit according to the present invention shown in fig7 . the diagrams of fig1 ( a ) and fig1 ( a ) each shows a waveform of synthesized voltage vs of the line drive voltage and the row drive voltage applied to one display element to be excited , called the selected element . characters l 1 , l 2 , l 3 , so on , show the periods during which lines l 1 , l 2 and l 3 of the display panel are selected for scanning , respectively . in fig1 ( a ) and 11 ( a ), the selected display element is present in the line l 1 , and therefore , only during the scanning period for the line l 1 , the level of the synthesized voltage is higher than the threshold voltage required for excitation of the liquid crystal , thereby turning on the display element . the diagrams of fig1 ( b ) and fig1 ( b ), on the other hand each shows a waveform of a synthesized voltage vus applied to one display element in the line l 1 and to be non - excited , called the non - selected element . the voltage level for the non - selected element is higher during the scanning period for the line l 1 , because the drive voltage of the line driver is applied to the line when it is scanned . however , this voltage level is lower than the threshold voltage of the liquid crystal , so that , the display element is in the off state . the ratio α between the effective values of the voltage level vs for the selected element and the voltage level vus for the non - selected element , vs √ vus is called an operation margin . the higher the value α , the better the contrast of the display screen . by comparison between fig1 and 11 , it is seen that , in the case of fig1 relating to the present invention , an abnormal voltage vab is superimposed on the driver output voltages vs and vus . although this abnormal voltage vab may undesirably cause flickers for deterioration of display quality , it has been proved that such deterioration of the display quality is satisfactorily prevented if the period of generation of such a voltage is rendered sufficiently short as compared with the response time of the liquid crystal . therefore , this abnormal voltage poses no problem in practical application . further , the abnormal output vab reduces the operation margin α . it has also been confirmed , however , that by reducing the data transfer time t mentioned above to a level about 5 % of the clock period t , the reduction of the operation margin α is suppressed to an extent that the deterioration of contrast is not visibly recognized . from the detailed explanation above , it will be apparent that unlike the conventional display data synthesizer circuit which combines a parallel output shift register with a latch circuit , the present invention comprises a combination of a series output shift register and a parallel output shift register , with the result that the latch circuit requiring a great number of terminals is replaced by the series output shift register with a fewer number of terminals , thus simplifying the circuit configuration . this invention , therefore , is effective in reducing the size and cost of the character display apparatus using a liquid crystal . especially in the case where integrated circuits are used in the circuit of the invention , highly integrated mosics may be used as the series output shift register , thereby considerably reducing the number of integrated circuits used . this fact also greatly reduces the size and cost . these advantages become more conspicuous when the size of display is enlarged . furthermore , it is obvious that in embodying the present invention , the number of bits of the shift registers or the groups for transfer may be changed in accordance with the size of display or the circuit elements used .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.