Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the present invention allows for the development of composite materials reinforced with single - and multi - walled nanotubes in order to produce materials that are lightweight , possess high strength and stiffness , and show improved composite toughness . a complementing aspect of the invention allows for tailoring the thermal and electrical properties of these nanotube derived materials , and processing and manufacturing parts using them . the problems with infiltration of a metal with the nanotubes can be solved by fluid mixing that occurs in the electromagnetic levitation process . the invention addresses embedded nanotube dispersion , wettability , adhesion , and alignment issues in a matrix of metals . functionalizing of the metallic and semiconducting nanotubes along the tube wall can be used to ensure wetting . a series of metals and alloy matrices including aluminum , copper , and tin have been processed with nanotubes to investigate the thermophysical properties of the melt mixture and the mechanical , thermal , and electrical properties of the resultant composites for manufacturing sample parts such as sheets and tubes . the production of the nanotubes embedded composite materials can be scaled up using a newly developed longitudinal electromagnetic levitator in addition to using the conical one . multifunctional materials which couple two or more functions of structural , electrical , thermal , and other properties are highly desirable . these multifunctional materials are needed over a wide temperature range and must therefore be processed in metal systems for low to intermediate temperature applications . nanotubes are tubular molecules possessing mechanical , thermal , electrical , and other properties of significant interest that are utilized to achieve new multifunctional materials that were not previously available . while there is interest in developing nanotubes independent of other materials systems , there exists a great need to process nanotubes in various materials for advanced materials applications . nanotube processing in polymers is at hand by high shear mixing and methods exist for processing ceramic materials with dispersed nanotubes although alignment has not readily been achieved . swnts and vgcfs have been dispersed and processed in zirconia ( zro 2 ) at temperatures as high as 1100 ° c . with stable nanotubular features being observed . the present invention uses cp by electromagnetic or acoustic levitation to provide high degrees of shear flow of the metal matrix . the high degrees of shear mixing provide for nanotube agglomerates to break up and for metal infiltration to occur . the end result is a new composition of matter which is a metal part with highly dispersed nanotubes whether they are ropes , single nanotubes , or fullerenes . this process is also useful for vapor grown carbon fibers and multiwall nanotubes so all of the various nanofibers , including derivatized and functionalized nanotubes , can be processed into metals this way , provided the user considers nanofiber reactivity and starting conditions to control degrees of mixing and dispersion . in some cases , it is of interest that the nanotubes be reacted away to produce novel reinforcements that could not be produced by other means where nanotubes are used as a precursor system . the effect is to in situ create a “ nanometal ” new material by reacting the nanotubes with the metal and then to disperse the “ nanometal ” fiber evenly throughout the rest of the metal matrix . the resulting product will have different and unique properties compared to the precursor . there are several different fillers such as fullerenes , nanotubes , and nanofibers that are available and suitable for use in the present invention . those that are preferred are : vgcf ( vapor grown carbon fiber ), mwnt ( multi - walled nanotubes ), and swnt ( single walled nanotubes which in some cases are in “ ropes ”). the swnt &# 39 ; s are the most useful in the present invention . they can be easily functionalized and derivatized for specialized use in the matrix . there are several reasons for functionalizing or derivatizing the nanotube . initially , compatibility is an issue . functionalizing the nanotubes allows better incorporation into the matrix . in addition , the functionalized nanotubes can have enhanced properties that are desired in the final composition . a derivative is sometimes necessary to enhance the overall stability of the nanotube . for example , the ends may be “ closed ” ( like a buckyball — c 60 ) and thus are not completely carbon bonded as are those in the interior of the tube . one way of dealing with these closed ends is to create a derivative of the pure carbonaceous tube via a complex of the ends . the derivative nanotubes may enhance the system &# 39 ; s ability to align the nanotubes in the matrix as well as adding to the overall structural stability of the system . another way of dealing with the ends is simply to functionalize the ends . there are occasionally defective sites along the length of the tubes . ( usually more common in the mwnt than the swnt .) derivatives can be used to overcome these defective sites as well . according to one aspect of the present invention , a boat , fig1 , or can , fig2 , comprising the metal that is to form the matrix portion of the nrm is filled with a powder or other form of the nano - material that is to be dispersed in the matrix . the boat is placed within an electromagnetic levitator , conical or longitudinal as disclosed in u . s . pat . no . 5 , 887 , 018 , entitled “ longitudinal electromagnetic levitator ”. when power is supplied to the levitator , it induces strong magnetic fields that levitate the metal object within the levitator . in addition , because of the rapidly reversing field direction , powerful eddy currents are induced in the sample . these eddy currents may be strong enough to cause effective dis - entanglement and dispersion of nanotubes in the metal matrix . while the metal of the boat or can melts and forms the matrix , the thermal energy in the system is not enough to disintegrate the nanotubes . the temperature to which the levitated sample is heated during levitation and the period for which it is levitated can be controlled , making it possible to control the degree of nanotube dispersion . it is important to control temperature because if the temperature is maintained too high for too long , it is possible that reactions will occur between the nanotubes and the metal . in addition , generally with metals if the composite goes back into melt reactions are also possible that will change the characteristics of the composite . generally polymers can go back into melt without this risk , ( thermoplastics for example ) if the components do not separate . in addition , other additives can be included in the can or boat and thereby mixed or alloyed into the final product . the present technique can be used in a continuous or batch process . likewise the can or boat comprising the matrix metal can take any other suitable form . the levitation can be done in a vacuum or in atmosphere , or in the presence of specific gasses chosen for the specific components being mixed . ( although of course the acoustic process would not work in a vacuum .) for the matrix material it is possible to use pure metals , alloys and polymers and epoxies . for the pure metal case , in atmosphere , when levitated and in the presence of nanotubes , as the metal melts , the nanotubes stick to the surface , and are homogeneously mixed by the eddy currents as melting is complete . conditions of time , temperature , atmosphere , and pressure can be controlled to control the mix . the conditions and components may be varied and can be selected to achieve the desired end product . for instance the time and temperature will be chosen depending on the temperature needed to melt the matrix material , and the time to achieve the highly dispersed fill material , with the time and temperature both limited by the properties of the specific matrix and filler . it is also possible to achieve dispersion without alignment , for instance by mixing in a turbulent zone . the matrix materials can be essentially any material that can be levitated , provided it is electrically conducting . the expected best materials are metals , and more specifically iron , aluminum , titanium , cobalt , and their alloys . the levitator coil can be shaped or the temperature conditions can be otherwise controlled to heat only certain zones , or the work piece can be cycled through a levitator or different levitators with different controls and in the presence of different matrix and filler materials progressively overcoating the product to create “ onion layered ” composites with layers of differing properties . similarly the product can be fashioned under differing thermal conditions in different directions . hybrid mixers combining electromagnetic and acoustic principles can be used as well . with the acoustic levitator the electrically conducting aspect may not be a limitation . use of an acoustic levitator in microgravity or space applications permits additional conditions to vary . using cp to form metals with dispersed nanotubes involves melting metals and alloys of interest in one of several options with nanotubes . electromagnetic levitation is achieved when a metal or a conductor is put in a high frequency alternating electromagnetic field with a suitable coil geometry . eddy currents induced in the metal produce supporting and stabilizing forces while simultaneously heating the metal , in some cases , to the point of melting . therefore , the sample is held and melted in the absence of a solid container . advantages of the process include : absence of physical contact with the sample , clean heating and melting , and the high potential for a homogeneous melt due to the efficient magnetic stirring . fig3 shows ( a ) a conventional coil design and ( b ) a coil design developed in u . s . pat . no . 5 , 887 , 018 which were used in this invention . cp provides a high degree of mixing , higher than that achieved in induction melting and stir casting . this high degree of mixing is used and may be required to disperse the nanotubes in the metal matrix . cp also has the advantage that the coil and manufacturing process can be designed to provide for alignment of the nanotubes where the induction melting and stir casting can not easily do this . nanotubes interact with the metal flow to loosen from the tangled forms and become dispersed in the metal matrix . as a specific example , aluminum from either a high purity source or alloy form is taken as a thin sheet . pure aluminum is very ductile so it easily bends and can be folded to trap nanotubes inside . this sample is pressed to push out air and to reduce the void space , leaving an aluminum with nanotubes trapped inside the sample . the sample gets hung in the levitator coil of the containerless processor by a thin string . the connection between the string and sample is made using wax which melts and burns off without effecting the purity of the metal system . coil design and degree of heating are controlled to provide for mixing with sufficient flow ( turbulence ) so that the nanotubes are dispersed . the levitator is turned off or the power is ramped down to let the molten sample began to solidify and drop into a quench tank or chill die ( a die where a specific shape can be formed with controlled cooling ). with this method of combining aluminum with nanotubes , the concentration can be controlled and the cost to process can be limited since powder metallurgical steps are not needed . in some cases , the initial steps before levitation may require other steps to assure good mixing and dispersion where the time of melt has to be limited . fig4 shows micrographs of ( a ) a sample containerless processed without nanotubes and ( b ) one with nanotubes processed by cp . the levitator coil shown in fig1 ( b ) consists of a set of parallel conductors formed by bending copper tubing . fig5 shows the coil in operation with a sample rod continuously processed by passing through the electromagnetic field and with additional heat supplied to the melt zone . the coil is capable of levitating large samples with high aspect ratios , provides maneuverability , and very good control of the position , temperature , and stirring of the sample . it allows for continuous feed of the specimen , levitating multiple specimens for alloying and moving them under control . the neighboring conductors pass current in opposite directions to levitate the metal or molten mass . fig6 shows the end of the levitator coil . fig7 ( a ) shows an aluminum composite microstructure with nanotubes which was produced by electromagnetic levitation mixing for advanced composite materials applications . fig7 ( b ) and fig7 ( c ) show composites prepared by a deposition process for comparison . fig7 ( b ) shows the uniform particle sized microstructure of cobalt - tungsten carbide with the absence of abnormal grain growth for cutting tool and hard surface applications . fig7 ( c ) shows the finely dispersed fullerenes in the grain boundaries of polycrystalline nanostructured iron for magnetic applications ( other ferromagnetic metals and alloys have also been used ). the possibilities for enhancing materials properties by the levitation process of the present invention are apparent given the microstructural similarities of the uniform particle size and even distribution . the shape of the levitator coil itself can also be modified , allowing parts to be cast out to shape or near to shape . the castings can also be machined down to size . fig8 shows an illustration of an aluminum alloy matrix with traditional fiber reinforcement and a matrix enhanced by up to 5 % swnt . one aspect of the invention is to approach the design of advanced materials by enhancing the matrix in such fashion , with the improved metal now available for use in composites . fig9 a and 9 b illustrate this concept further , fig9 a is a graph illustrating on the x axis the volume % of filler , whether it is swnt , mwnt , fullerenes or vgcf . the y axis on the left shows the strength of the matrix , and above that the strength of the improved matrix . fig9 b similarly shows design possibilities for matrix fiber composite systems with high concentrations of swnt . preferred concentrations for composite systems are from 10 % to 60 %, and within that range more commonly 20 % to 25 %. fig9 b shows design possibilities for composites possible by increasing the capabilities of the fibers on the right and for increasing the capabilities of the matrix on the left . low concentrations of the fullerene and nanotube fillers are expected to be less than 5 volume percent . concentrations above this and generally around 10 - 25 volume % are considered reinforcing . expectations are that volume fractions less that 60 % will typically be considered of a composite level . processing of materials with nanotubes up to 100 % can occur provided the electrical conducting nature of the nanotubes is taken advantage of and that some small level of additional material is incorporated to hold them together . fullerenes are semiconducting with a band gap of ˜ 1 . 6 ev . swnts can be semiconducting or metallic . since they can be electrical conducting the metal matrix does not have to be of the highest concentration . the effective dispersion of the nanotubes is the key to the enhanced properties . the present invention provides a method that produces a homogeneous dispersion of the nanotubes in a matrix , overcoming the problems that are normally associated with dispersing nanotubes . more importantly , the matrix can be metals that are among the most difficult matrix components in which to achieve mixing . the present invention provides clear advantages as a practical and effective method for producing a homogeneous mixing or dispersion of nanotubes in a metal matrix . further , and of equal significance , the process allows for the alignment of the nanotubes in the matrix if desired . this creates the possibility of enhanced properties through arranged packing of the matrix . the utility of nanotube filled metals and improved composites is far - reaching . these commercial avenues impact the entire composite manufacturing industry . the applications for the nrm &# 39 ; s are vast , reaching into the mechanical , electrical , and thermal fields of materials science . an example application could be electrical transmission wires , where enhanced properties of reducing thermal expansion and increasing strength could allow longer reaches between towers . possible uses for the materials developed in this new application of cp include filled metals for electronic and thermal applications , structural composites , producing new alloys which are dispersion strengthened , and metal systems which are low radar observable materials . specific applications include avionics racks , skin materials for aircraft , automobile side panels , sporting goods such as for golf or baseball , bicycle components and frames , truss members for high strength , thermal management components both microscale and macroscale , and multifunctional components for several dual use applications : structural / impact , structural / thermal , and structural electrical . the filled matrices with improved properties of stiffness and strength can be formed into sheets , rods , tubes , truss members and other lightweight structures . advanced materials made in accordance with the present invention include an aluminum matrix with a nanotube filler ( less than 5 wt %) for use with other processes to produce near net composite parts for particular use in manufacturing of large structural automotive components made of fiber reinforced metals or plastics . metal matrix composite systems based on reinforcing nanotubes for electrical and mechanical applications can be made in accordance with the present invention . it solves the problem of being able to mix and disperse nanotubes on the nano - scale so that a high degree of dispersion occurs without nanotube damage or with / without nanotube alteration , which ever is preferred . since nanotubes are on the nano - scale and are available in tangled agglomerates , the ability to disperse them from the tangles and disperse them from each other has been of key interest . this use of cp provides for the high energy mixing necessary to achieve these goals . this new use of electromagnetic levitation generates a melted mass that has significant motion in the melt that is dictated by the specific coil design . this is to say , sections of significant turbulence can be generated and altered by coil design and temperature control . near term applications will be in the area of small parts since the availability of nanotubes is low at this current time . applications that could be realized in the future involve tremendous scale up of the levitation melting process and in turn the processing of large parts made of various metals with dispersed nanotubes . as to the manner of operation and use of the present invention , the same is made apparent from the foregoing discussion . with respect to the above description , it is to be realized that although an enabling embodiment is disclosed , the enabling embodiment is illustrative , and the optimum relationships for the steps of the invention and calculations are to include variations in size , material , shape , form , function and manner of operation , assembly and use , which are deemed readily apparent to one skilled in the art in view of this disclosure , and all equivalent relationships to those illustrated in the drawings and encompassed in the specifications are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative of the principles of the invention and since numerous modifications will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown or described , and all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	2
in a first preferred embodiment , the invention comprises an inner sheath 10 defining a inner region . in another preferred embodiment , the inner sheath is made from a thermoplastic material . a first preferred embodiment of the invention further comprises at least one conductor 12 extending within the inner region . in a preferred embodiment , the conductor is made from a material that has a conductivity of at least 3 . 5 × 10 7 siemens / meter . in another preferred embodiment , the conductor comprises copper . in another preferred embodiment , the conductor comprises aluminum . in another preferred embodiment , the conductor comprises direct current . in a single conductor embodiment , the invention is intended for use in seawater having sufficient conductivity to serve as a current return path . a first preferred embodiment of the invention further comprises an electromagnetic shielding layer 14 directly contacting , and wrapped around , each conductor . in another preferred embodiment , the electromagnetic shielding layer comprises a ferrous material . in another preferred embodiment , the electromagnetic shielding layer comprises stainless steel . in another preferred embodiment , the electromagnetic shielding layer has a magnetic permeability of at least 30 × 10 − 6 henries per meter . a first preferred embodiment of the invention further comprises an insulation layer 16 wrapped around each electromagnetic shielding layer . in another preferred embodiment , the insulation layer is made from a thermoplastic material . a first preferred embodiment of the invention further comprises a metallic shielding layer 18 wrapped around each insulation layer . in another preferred embodiment , the metallic shielding comprises copper . a second preferred embodiment of the invention comprises all the elements of the first preferred embodiment plus an outer sheath 20 sized and positioned to define an annular region with respect to the inner sheath . in another preferred embodiment , the outer sheath is made from a thermoplastic material . a third preferred embodiment of the invention comprises all the elements of the first preferred embodiment plus at least one optical cable 22 located in the inner region . a fourth preferred embodiment of the invention comprises all the elements of the first preferred embodiment plus at least two steel tubes 24 located in the inner region . a fifth preferred embodiment of the invention comprises all the elements of the first preferred embodiment plus a second conductor extending within the inner region , such that in this embodiment there are at least two conductors extending within the inner region and an electromagnetic shielding layer is wrapped around each copper conductor . in a preferred embodiment , the conductors are made from a material that has a conductivity of at least 3 . 5 × 10 7 siemens / meter . in another preferred embodiment , the conductors comprise copper . in another preferred embodiment , the conductor comprises aluminum . in another preferred embodiment , the conductors of the fifth preferred embodiment comprise single phase alternating current . a sixth preferred embodiment of the invention comprises all the elements of the fifth preferred embodiment plus a third conductor extending within the inner region , such that in this embodiment there are at least three conductors extending within the inner region and an electromagnetic shielding layer is wrapped around each conductor . the third conductor may exist in the same preferred embodiments as the first and second conductors , described above . in another preferred embodiment , the insulated conductors comprise three phase alternating current . in another preferred embodiment , the insulated conductors have a sufficient size to transmit at least 1000 volts . a seventh preferred embodiment of the invention comprises all the elements of the fifth preferred embodiment except that in place of at least two conductors 12 extending within the inner region , this seventh preferred embodiment comprises at least three pairs of conductors 30 a , 30 b , 31 a , 31 b , 32 a , and 32 b , extending within the inner region , each pair comprising a first conductor positioned radially opposite a second conductor in the inner region . in a preferred embodiment , the conductors comprise copper . in another preferred embodiment , each pair of conductors carries one of three phases of alternating current . a eighth preferred embodiment of the invention comprises all the elements of the sixth preferred embodiment plus at least two steel tubes 24 located in the inner region radially interior to each of the conductors . for each embodiment of the invention described above , the combination of a copper conductor wrapped in an electromagnetic shielding layer , further wrapped in a insulation layer , further wrapped in a metallic shielding layer , as described above is referred to as a “ shielded and insulated conductor .” in a ninth preferred embodiment , the invention further comprises an armored sheath 34 encasing all shielded and insulated conductors . in a preferred embodiment , the armored sheath comprises wire . the foregoing disclosure and description of the inventions are illustrative and explanatory . various changes in the size , shape , and materials , as well as in the details of the illustrative construction and / or an illustrative method may be made without departing from the spirit of the invention .	7
the present monolithic intrinsic ir focal plane ccd imager , which has the capability of being tuned for operation over the spectral region from 0 . 8 micron to 14 microns and beyond , of possibly up to 300 microns , will be better understood with reference to the figures . fig1 shows the architecture of the monolithic focal plane device 8 with the various layers and their functions indicated . the device 8 is four phase operated with the various phase connections labeled as 1 , 2 , 3 , and 4 on metal schottky barrier gates . device 8 is further explained herein below with reference to fig2 a , 2b , 2c , 3 , 4 , and 5 , with reference voltage waves of the ccd processor included in fig6 and 7 . the present monolithic ir focal plane ccd imager 8 is a non - scanning type device , i . e . it does not depend on the incoming signal radiation and background noise being scanned across the external ir detectors to properly process the scene image . rather , the incoming signal radiation and background noise is collected in an internal absorber layer 16 whereupon the photon wave energy is converted to electron charge . the imager 8 does not have distinct detectors , but has a plurality of areas defined by the low bandgap absorber layer 16 that exists under the activated schottky barrier gates . if there is overflow of electrons in the absorber layer 16 , the electrons will overflow into the spillover layer 14 . in the operational condition , the electrons momentarily reside in and recombine in the absorber layer 16 and possibly in the spillover layer 14 if layer 16 overfills . therefore , the &# 34 ; well &# 34 ; that is formed between the substrate 12 and the transfer layer 18 will not overfill and spill into the ccd channel 20 because the thickness and bandgap of the spillover layer 14 provides a large enough charge handling capability to handle any extra charge from the absorber layer . hence , the generated electron charges are retained in the well that is formed by both the absorber and spillover layers until the electron charges are &# 34 ; punched down &# 34 ; into the ccd channel layer 20 . lattice matching at the p - p heterojunction between the absorber layer 16 and the transfer layer 18 is important for efficient injection across the p - p heterojunction . fig3 , 5 , 6 and 7 may now be referred to for a better understanding of imager 8 . the thickness of the various layers are preferably the thicknesses as indicated in fig4 . the preferred mode of switching the four phases , indicated as φ1 , φ2 , φ3 and φ4 , of the schottky barrier gates 1 , 2 , 3 , and 4 is to switch &# 34 ; on &# 34 ; all of the φ1 and φ3 at exactly the same time and alternately switch &# 34 ; on &# 34 ; all of the φ2 and φ4 at exactly the same time for the next frame . looking at fig3 , and 5 , it can be seen that any of the odd numbered schottky barrier gates , i . e . gates 1 or 3 , are surrounded on all four sides by only even numbered schottky barrier gates , i . e . gates 2 or 4 . likewise , any of the even numbered schottky barrier gates are surrounded on all four sides by only odd numbered schottky barrier gates . channel stops 44 electrically isolate each row of the schottky barrier gates to prevent cross - talk or blooming into adjacent rows . channel stops 44 are held at a negative potential for electrical isolation . an assumption is made with respect to discussion of device 8 that the last of the schottky gates on alternate rows are 1 and 4 as indicated by fig5 and 7 . therefore , the transfer gate 38 receives alternate electron charges from wells developed under schottky gates 1 and 4 and parallel outputs the same alternate electron charges to a serial ccd shift register 40 for producing a serial video output . the serial video output may be used for either direct or remote viewing . in this manner of processing the video signal there is no need for a storage shift register , or in other words a memory is not needed . the focal plane device 8 may be constructed as follows . a p - type , low resistivity combination of group ii - vi elements , such as cadmium telluride ( cdte ) or cadmium selenium ( cdse ) single crystal wafer is used as the window substrate layer 12 . the preferred combination is cdte , but se may be substituted for te throughout this specification . from here on te will however be the referenced element . the p - type cdte single crystal wafer is used to seed the epitaxial growth of a p - doped cd x hg 1 - x te , 1 × 10 16 cm - 3 , 20 micron spillover layer 14 . the p - doped cd y hg 1 - y te , 1 × 10 15 cm - 3 , 2 micron absorber layer 16 is then epitaxially grown on the spillover layer 14 . next , the p - doped cd z hg 1 - z te , 1 × 10 16 cm - 3 , 4 micron transfer layer 18 is epitaxially grown on the absorber layer 16 . next , an n - doped cd z hg 1 - z te , 1 × 10 16 cm - 3 , 2 micron channel layer 20 is epitaxially grown on the transfer layer 18 . it should be noted that layers 18 and 20 do not necessarily have to be of the same composition as represented by subscript z . all four of these layers are preferably grown by liquid phase epitaxy at about 300 ° c . to 500 ° c . at a growth rate of about 1 / 2 micron per minute however other techniques of growth may be used . the ccd gate structure is next formed on the channel layer 20 surface . schottky barrier gate technology is preferred for the ccd gate structure because it is radiation hard and is not subject to the stringent interfacial properties required of a metal - insulator - semiconductor ( mis ) gate technology . however , should a mis technology become viable for cd z hg 1 - z te , the mis technology may also be considered for the ccd gate structure . the ccd gate structure is explained more fully herein below . in the above x , y , and z substripts z is never greater than 1 and is preferably about 0 . 9 . subscript x is about 0 . 4 . subscript y is about 0 . 2 . deposited on the opposite side of substrate 12 from the four epitaxially grown layers 14 , 16 , 18 , and 20 is an optical window , or optical filter 10 , preferably made of p - doped cdhgte that covers the input surface of the substrate 12 . a metal ohmic contact 22 of some configuration is deposited on a portion of optical filter 10 for electrical contact to the image system . the metal ohmic contact 22 may be only around the extreme outer edges of the optical filter 10 and is preferably made of some alloy of the group v material . the optical filter 10 defines the short wavelength cutoff of the image device 8 . as an example , if the absorber layer 16 has a composition to detect the 8 - 14 micron image , the optical filter will absorb light of all wavelengths less than 8 microns . the schottky barrier ccd gate structure that is formed on the channel layer 20 surface is preferably comprised of the following layers that are shown distinctly in fig1 and 4 . fig4 is a sectional view taken from line 4 -- 4 of fig3 . the schottky gates 1 , 2 , 3 , and 4 and the channel stops 44 that separate each row of schottky barrier gates are first deposited on channel layer 20 . a first insulator layer 36 is deposited between the channel stops 44 and the gates 1 , 2 , 3 , and 4 . a first metallization step is used to deposit first and second metal layers 26 and 42 over first insulator layer 36 and schottky gates 4 as shown in fig4 . second metal layer 42 is in electrical contact with schottky gate 4 and has the fourth phase voltage source , indicated by φ4 , of the four phase ccd switching system attached thereto . first metal 26 is likewise in electrical contact with schottky gate 3 ( even though not able to show in fig4 ) and has the third phase voltage source , indicated by φ3 , attached thereto . a second insulator layer 34 is now deposited over the remaining bare first insulator layer 36 , and first and second metal layers 26 and 42 . a second metallization step is used to deposit third and fourth metal layers 30 and 32 that are respectively in electrical contact with schottky gate 1 and schottky gate 2 ( not shown in fig4 ) and have the first and second phased voltage source , represented by φ1 and φ2 , attached thereto . the first and second insulator layers 36 and 34 are preferably made of siox doped with nitrogen . the schottky gates and metal layers may be made of any metal with a high work function , such as aluminum or gold . the various interlaced channel stops 44 are connected to a channel stop voltage source at terminal 45 . the substrate layer 12 is connected to a substrate voltage source 13 at the metal ohmic contact 22 . a suitable growth technique for the cdhgte layers is liquid phase epitaxy although any technique or combination of techniques that may prove capable of growing cdhgte multilayers of appropriate compositions may be used . the channel stops and the schottky gates may be grown by vacuum evaporation , and the insulator materials may be grown by chemical vapor deposition and / or molecular beam epitaxy . cdhgte is also the preferred material used in the processor system since it is closely latticed and thermal expansion coefficient matched over the entire range of compositions . the monolithic ir focal plane ccd imager however is not restricted to the cdhgte material system . any lattice and thermal expansion matched system with the appropriate set of properties can be used . it is clear that the focal plane device 8 is spectrally versatile since only one set of technologies is required to fabricate all the layers and the ccd and its accessories with the sole exception that the composition of the absorber layer 16 may be changed to make the device operable over a specific range of wavelengths . the device of this invention can be made to operate in the 1 - 2 micron , the 3 - 5 micron , and 8 - 14 micron atmosphere windows by simply changing the composition of the absorber cd y hg 1 - y te layer . the rest of the device layers and structures can remain the same . hence , device simplicity , versatility , and reliability are key advantages in the present focal plane device . also , the whole fabrication technique is quite compatible with large scale integration which can potentially impact its cost . operation of the focal plane imager device 8 is explained herein below with reference to the figures as appropriate . first , the imager has a video output from the ccd shift register 40 as shown by fig5 that is a video signal in the general raster sense and may be used in a direct view system , such as application to led array , or may be used in a remote view system , such as application to a transmitter for generating television type signals . the incoming signal to the focal plane is in the ir spectrum . the incoming ir signal along with background radiation enter through optical filter 10 , which defines the short wavelength cutoff for the imager device 8 , passes through the p - type window substrate 12 and the spillover layer 14 with the ir signal and background radiation being absorbed and converted to electron charges in the absorber layer 16 . the equilibrium energy band diagram including the conduction band potential profile 26 and the valence band potential profile are shown schematically in fig2 a , 2b and 2c . the biased condition when there is no charge in the ccd channel layer 20 is shown in fig2 b . the bias condition at this time may be shown in the schottky barrier gates φ1 , φ2 , φ3 , and φ4 of fig6 . actually , fig2 b may also represent an instant in time wherein charges may be present in the ccd channel 20 but have not been completely swept out by the transfer gate 38 . the ccd channel 20 may be thought of in fig2 b and 2c as accepting charges from absorber layer 16 only when the schottky barrier gates are activated for a length of time corresponding to the intergration time . the gate voltages for processing and transferring charge along the ccd channels to the transfer gate 38 are , say , + 15 volts with the inactive + 5 volts as indicated by the waveforms of φ1 , φ2 , φ3 , and φ4 of fig6 . the voltages may however be in the range of 10 volts difference between the activated and inactivitely , such as + 1 volt to + 11 volts or + 10 volts to +° volts respectively between the inactivated and activated gates . the channel stop voltage is shown representative as approximately - 5 volts . during the processing of the charge signal in the ccd channel 20 , the ccd channel well is prevented from being filled by the potential barrier formed between the p - type absorber layer 16 , which is the low bandgap sensor , and the p - type transfer layer 18 . if the p - p heterobarrier between the absorber and transfer layers of this invention were not present , the thermally and optically generated signal carriers could become excessive and would flow into the ccd channel 20 and fill the ccd well . for example , under low contrast conditions of high background radiation and small signal as is the case of the 8 - 14 micron region , the ccd channel would quickly fill and the imager would be inoperable . with the present p - p heterobarrier however the photon generated charge is allowed to enter the channel layer 20 only when the heterobarrier is &# 34 ; punched through &# 34 ; as shown by the solid line , indicated by lead lines as gates 1 and 3 , on the energy band diagram of fig2 c . the &# 34 ; punched through &# 34 ; condition may be achieved by momentarily lowering the substrate voltage to about - 15 volts from substrate voltage source 13 that is electrically connected to the metal ohmic contact 22 . the channel stop voltage source 45 applies a negative voltage as required to maintain isolation at the instant that the substrate voltage is - 15 volts . when the signal charges that are injected in to the ccd channel 20 are transferred to the end of the array by the four phase clock voltage , as shown in fig6 the charge signals are swept out of gates 1 and 4 , as shown by fig5 into the ccd shift register 40 by activating transfer gate 38 . during the time that the charges are being processed in the ccd channel , the voltage biasing is set such that the absorber layer is isolated from the channel layer by the p - p heterobarrier . the isolated condition is shown by dashed lines in fig2 c . the &# 34 ; punched through &# 34 ; injection condition shown by the solid line in the condition band potential profile 26 is as indicated by fig2 c . the preferred sequence of operations of the substrate and channel stop voltages , the phased voltages φ1 , φ2 , φ3 , and φ4 , the transfer gate 38 punch down voltages , and the ccd shift register 40 read out voltages are as follows . first , a photon charge have h . sub . ν is constantly received into the absorber layer 16 and the electron charges produced therein must be systematically controlled and selectively switched out of the focal plane imager as a video output signal . the photon charge wave , comprised of the usable signal and background radiation , enters through an optical filter 10 , passes through the p - type window substrate 12 and through the spillover layer 14 into the absorber layer 16 . the photon charge wave h . sub . ν is absorbed in the absorber layer 16 and is converted to electrons , or electron charges . since the absorber layer has the lowest bandgap , the electron charges remain therein except for possibly some spillover in the spillover layer 14 . the spillover layer 14 readily handles the extra electrons since the spillover layer has a large charge handling capability due to its higher bandgap and much wider thickness . recombination of some of these electrons occur during the off time , or non - read period , even more so than during the read period . the p - p heterobarrier , between the absorber layer 16 and the transfer layer 18 does not allow the electron charges to enter the channel layer 20 . this p - p heterojunction therefore prevents the premature &# 34 ; ccd well &# 34 ; filling of channel layer 20 and allows for signal time sampling . the electron charges produced within the absorber layer 16 during the read time are injected into the channel layer 20 by the &# 34 ; punch through &# 34 ; condition maintained by the voltage on the substrate layer 12 being lowered from about 0 volts to - 15 volts . refer to what happens between the condition of fig2 b and 2c . fig2 b is the condition of electron charges 16a filling the absorber layer 16 while the absorber layer is isolated from the ccd well channel layer 20 , with the channel layer 20 at that instant having the previous electron charges that were just punched through the p - p heterojunction being transferred along the ccd channel and subsequently parallel read out by transfer gate 38 . fig2 c shows the condition where the previous punched through electron charges have been read out and the present electron charges , shown as 16a in fig2 b , are now instantly punched through into the ccd well channel layer 20 . by considering alternating switching of odd gates 1 and 3 simultaneously and even gates 2 and 4 simultaneously , it can further be seen by fig1 that the activated gate is surrounded on all four sides by inactivated gates which in the present device provides better optical resolution . looking now at the lower part of fig6 it can be seen how the schottky barrier gates sweep the charges out on a line by line basis . the amount of time that the substrate voltage is lowered to - 15 volts , or the time the p - p heterojunction is punched down corresponds to the injection time , i . e . the integration time , of the focal plane imager . this time is selected such that the ccd well is never completely filled . normal tv frametime which may be used is 33 milliseconds . calculations show that the integration time for use of the absorber layer 16 composition for the 8 - 14 micron range is about 20 microseconds , and for absorber layer 16 composition for the 3 - 5 micron range is about 2 milliseconds . when the absorber layer 16 composition is for the 1 - 2 micron range , the integration time is set at approximately the frame time . a restriction on time sampling and processing is shown in fig7 i . e . after the transfer gate 38 stays punched down for the transfer gate pulses from schottky barrier gates phases φ1 and φ4 there is a time interval during which the ccd shift register 40 must read - out the last charge before the transfer gate accepts the next gate phases φ1 and φ4 . referring to fig7 again , it should be stated here that after simultaneous punch down of schottky barrier gates 1 and 3 by applying - 15 volts to the substrate and subsequent return to 0 volts the signal charge thus injected into the channel is read out through gates 1 with dimensions 1l and 1t and gates 4 with dimensions 4l and 4t into the ccd shift register 40 via the transfer gate 38 . the next frame is read out in like manner after simultaneous punch down of gates 2 and 4 for signal charge injection , again through gates 1 and 4 , fig5 . in other words , the &# 34 ; punch through &# 34 ; of electron charges from the absorber layer 16 to the ccd wells through the p - p heterojunction is by control of the substrate voltage 13 , and subsequent read - out , following transfer of the charges into channel 20 , depends upon the odd / even gate combinations that interface with the transfer gate , i . e . gates 1 and 4 as shown in fig5 . the signal charges are hence repeatedly time sampled and the ccd charge handling capability is not exceeded . the operation can be likened to a sensor - switch - processor configuration wherein the sensor signal is switched into the processor for specific time intervals so that the processor is never overloaded with charge . this method of injection and device concept is a novel feature of this invention . spatial resolution of the generated charges is maintained by arranging the four gate phases properly as mentioned where an activated gate is surrounded on all four sides by inactivated gates . because of the novel injection method , the device does not suffer from incompatibility between detector operating point and mos threshold voltage as it does in more conventional schemes . it should be noted that group iii - v materials may be used as the present monolithic device since they operate in the 3 - 5 micron region , but they do not operate in the 8 - 14 micron region . thus , the use of the group iii - v materials becomes restrictive . however , any lattice matched material having the proper bandgaps , thicknesses , the doping types and levels may be used in replacement of , or in combination with , the cdhgte / cdte materials in the present monolithic ir focal plane ccd imager . it should also be understood that an alternate means of applying voltage to the substrate to establish the punch through condition for charge injection from the absorber layer to the ccd channel would be the electrical equivalent of charging the gate voltages appropriately . in addition , edge passivation can be implemented by insulating layers and / or schottky barrier , or mis field plates . it should be noted that the video output shown in fig5 is raw video data which may need further processing ( i . e . background suppression , etc .) for display . while preferred embodiments and method of producing have been disclosed , it will be apparent to those skilled in the art that variations in specific details which have been described and illustrated may be made without departing from the spirit and scope of the invention as described in the appended claims .	6
while the present invention is susceptible of embodiment in various forms , there is shown in the drawings and will hereinafter be described a presently preferred embodiment with the understanding that the present disclosure is to be considered an exemplification of the invention and is not intended to limit the invention to the specific embodiment illustrated . it should be further understood that the title of this section of this specification , namely , “ detailed description of the invention ”, relates to a requirement of the united states patent office , and does not imply , nor should be inferred to limit the subject matter disclosed herein . in the present disclosure , the words “ a ” or “ an ” are to be taken to include both the singular and the plural . conversely , any reference to plural items shall , where appropriate , include the singular . referring now to the figures and in particular to fig1 there is shown a deep - set drop - in anchor 10 embodying the principles of the present invention . the anchor 10 includes a shell or sleeve 12 , a plug 14 , a threaded shank 16 having a bore formed longitudinally there in , indicated at 18 , and a setting pin 20 . the anchor 10 is removably set in a structure , such as in an opening o in a concrete floor or wall f . that is , any part or portion of the anchor 10 that would otherwise extend above the surface s of the structure f can be removed after use . this is particularly desirable where the anchor 10 is used in a temporary supporting arrangement as is required in tilt - wall construction . it has been found that the present deep - set anchor 10 provides high holding values or pull - out loads with very little displacement until fracture occurs . in fact , tension loads as high as 20 , 000 pounds have been observed when the anchor 10 is used at a five inch embedment depth , as indicated at d in fig1 . the sleeve or shell 12 is an annular element having a threaded region 22 and a split region 24 . an outer wall 26 of the sleeve 12 has a constant diameter d 26 along the length l of the sleeve 12 from an upper lip 28 of the sleeve 12 to a lower lip 30 of the sleeve 12 , through both the threaded region 22 and the split region 24 . for purposes of the present disclosure , upper and lower are used in reference to the orientation in which the parts will reside when the anchor is installed in a floor structure . an inner wall 32 of the sleeve 12 has a constant diameter d 22 at the threaded region 22 ( taking into consideration the threads 34 ) and tapers inwardly through the split region 24 , as indicated at 36 . thus , as seen in fig2 the diameter d 24 across the inner wall 32 decreases from a point ( indicated at 38 ) between the threaded region 22 and the split region 24 to the end of the split region 24 , as at about the lower lip 30 . in a current embodiment , the split region 24 includes four elongated channels 40 a - d extending longitudinally , dividing the split region 24 into four longitudinally extending sections 24 a - d . the channels 40 a - d are formed about equidistantly about the circumference of the sleeve 12 , or at 90 degrees from adjacent channels . those skilled in the art will recognize that other split patterns can be used in connection with the present anchor 10 without departing from the scope and spirit of the present invention . the plug 14 has a tapered profile the defines tapered sides as indicated at 42 and is configured for insertion into the sleeve 12 . the plug 14 “ fits ” within the split region 24 and can be formed having a taper 42 that complements the taper 36 of the sleeve 12 , however , such matching tapers 36 , 42 ( i . e ., taper angles ) are not necessary . a greatest diameter d 14 of the plug 14 is , however , greater than the smallest diameter d 24 of the split region 24 ( near the lower lip 30 ) so that the plug 14 interferingly fits within the sleeve 12 . the shank 16 includes a threaded end region 44 , an intermediate region 46 and a head 48 . in a current embodiment , the shank 16 is formed as a shoulder bolt , in which the threaded region 44 has a reduced diameter d 44 from the intermediate region d 46 . as such , a shoulder 50 is formed at the juncture of the threaded region 44 and the intermediate region 46 . the threaded region 44 is formed with threads 52 that complement ( i . e ., threadedly engage ) the sleeve threads 34 . as such , as seen in fig1 , the shoulder bolt 16 threads into the upper end ( e . g ., threaded region 22 ) of the sleeve 12 . the head 48 can be formed having a hexagonal shape , such as that of a convention bolt , to permit the use of conventional tools , wrenches , ratchets and the like , to ( threadedly ) engage and disengage the bolt 16 and sleeve 12 . the bolt 16 includes the through - bore 18 extending longitudinally therethrough . the bore 18 is configured for slidingly receiving the setting pin or like setting tool . the exemplary setting pin 20 includes a setting end 56 and head 58 opposing the setting end 56 . the setting end 56 is configured for engaging the plug 14 , and the head 58 is configured for being struck ( as with a hammer ) and for coming into contact with the bolt head 48 . in use , the plug 14 is inserted into the sleeve 12 and the bolt 16 is threaded into the sleeve 12 until the shoulder 50 engages the upper lip 28 of the sleeve 12 . the anchor 10 is then inserted into the bore o in the structure f to a desired depth d . with the anchor 10 at the desired depth d , the pin 20 is inserted into the bolt bore 18 , until the setting end 56 engages the plug 14 . it will be recognized by those skilled in the art that the pin 20 can be inserted into the bolt 16 before installation of the anchor 10 in the structure bore o . it will also be recognized by those skilled in the art that prior to setting the anchor 10 , the pin setting end 56 will rest on the plug top surface 60 and that the pin head 58 will not be fully seated on the bolt head 48 . that is , the pin head 58 will be spaced from or above the bolt head 48 . with the entire assembly ( i . e ., sleeve 12 , plug 14 , bolt 16 and pin ) 20 in place at the desired depth d in the bore o , the pin 20 is struck to drive the plug 14 into the sleeve 12 . the tapered wall 42 of the plug and the taper 36 of the sleeve 12 engage one another which wedges the plug 14 in the sleeve 12 . because of the interfering fit between the plug 14 and the sleeve section 24 a - d , the sleeve sections 24 a - d are urged outwardly , into engagement with the walls w of the structure bore o . this sets or secures the sleeve 12 in place in the structure f . once the anchor 10 is set in the structure f , the pin 20 can be removed from the bolt 16 and the bolt 16 can be removed from the sleeve 12 . the bolt 16 can be used , as part of the temporary support , or a more conventional ( non - through - bore ) bolt can be threaded into the sleeve 12 for the temporary support . the shoulder bolt 16 and setting pin 200 can then be reused for the installation of another sleeve 12 . after use , the bolt 16 ( which ever is used ) can be removed from the sleeve 12 so that no part of the anchor 10 extends above the surface s of the structure f . those skilled in the art will recognize that in proper use , the anchor 10 ( prior to setting ) will be inserted in to the structure bore o so that the bolt head 48 is in contact with the surface s of the structure f . this will assure proper positioning ( e . g ., depth ) of the anchor 10 in the structure f . those skilled in the art will also appreciate that unlike with the use of coil anchors , over - drilling ( the depth of ) the structure bore o will have no adverse effect on the use or integrity of the anchor 10 . as such , less consideration need be given to the maximum depth of the structure bore o . a method for securing an anchor 10 in an opening o formed in a structure f includes inserting the tapered plug 14 into the sleeve 12 and threading a shoulder bolt 16 into the sleeve 12 until the shoulder 50 contacts the upper lip 28 of the sleeve 12 . the sleeve 12 and bolt 16 are positioned the opening o in the structure f . the setting pin 20 is inserted in the bolt through - bore 18 , and is then forced downward ( as by striking with a hammer ), toward and into contact with the top surface 60 of the plug 14 . this drives the plug 14 into the split region 24 , which in turn drives the split region sections 24 a - d axially outwardly to secure the sleeve 12 in the opening o . as will be appreciated by those skilled in the art , positioning the setting pin 20 in the bolt through - bore 18 can be carried out before or after the sleeve 12 and bolt 16 are positioned in the opening o in the structure f . preferably , the anchor 10 is positioned in the opening o such that the bolt head 48 is positioned against a surface s of the structure f surrounding the opening o . still another advantage of the present anchor 10 is that it is readily inspectable . that is , because the plug 14 is properly set when the pin 20 is fully forced downward , by noting that the pin head 58 is flush with the bolt head , 48 , it can be readily , visually determined that the anchor 10 is properly set . all patents referred to herein , are hereby incorporated herein by reference , whether or not specifically do so within the text of this disclosure . from the foregoing it will be observed that numerous modifications and variations can be effectuated without departing from the true spirit and scope of the novel concepts of the present invention . it is to be understood that no limitation with respect to the specific embodiments illustrated is intended or should be inferred . the disclosure is intended to cover by the appended claims all such modifications as fall within the scope of the claims .	5
referring to the drawings , the screening apparatus has a casing 10 provided with a removable cover 12 and a base 14 seated on a support indicated by dash line 16 in fig1 . a cylindrical closed drum or rotor 18 is co - axially mounted on the upper part of a vertical shaft 20 ( see fig3 ). shaft 20 extends through a thrust bearing assembly 22 seated in base 14 and is provided with a sealing sleeve 24 with flinger associated with a bearing assembly . a drive sheave 26 has its hub fastened to the end portion of shaft 20 below base 14 by a wedging bushing 28 . a cylindrical shaft enclosure 30 has its lower end fixed to base 14 . a second bearing assembly 32 fixed to interior ledge 34 on enclosure 30 receives the shaft rotatably therethrough . shaft 20 is provided with a sealing sleeve 36 with flinger fixed thereto immediately above thrust bearing assembly 32 , and with another sealing sleeve 38 fixed thereto immediately above sleeve 36 . the shaft and sleeve 38 extend rotatably through an inverted cup - shaped central portion of a cover 40 of enclosure 30 , and a sealing gland 42 therein . the hub 44 of drum 18 , which is fixed to the drum end wall 46 and a further supporting wall 48 immediately below it , is fixed to the top of the shaft by a key , and the parts assembled to the shaft above bearing assembly 32 are held in place under some compression by a lock nut 50 on the threaded upper end of the shaft 20 . rotor 18 , which has clearance from base 14 and other fixed parts , is rotated by shaft 20 , which in turn is rotated by motor 52 ( fig1 ) mounted on support 16 through belts 54 connecting sheave 56 on the motor drive shaft with sheave 26 on shaft 20 . a stationary cylindrical screen 58 surrounds drum 18 co - axially and defines with the drum 18 an intervening screening passage 60 ( see fig2 and 3 ). screen 58 is provided with openings 62 for the outward passage of accepted stock from the screening passage , which may desirably be , as is conventional for headbox screening , 1 / 16th inch ( 1 . 59 m . m .) diameter holes spaced to provide 12 percent open area . drum 18 is provided with pulse creating means in passage 60 in the form of generally hemispherical buttons 64 secured to the ends of pins 66 attached to the drum and which may be , as shown , the shanks of bolts threaded through holes in the drum with locknuts on the inner surface of the drum . unconventionally , according to this invention , as best seen in fig4 screen 58 is provided with two pairs of closely spaced slots extending substantially from top to bottom of screening passage 60 , the slot pairs being spaced apart somewhat less than 180 ° about the screen axis , and is combined with surrounding structure , as a sub - assembly shown in fig4 to form one slot of each pair into a pulp slurry inlet to passage 60 and the other slot of the pair into a rejects outlet therefrom , with an intervening chamber for receiving accepted stock passing the screen . thus the apparatus is made to process in two halves , each treated in diametrically opposite halves of the apparatus , a single inflow of slurry to inlet pipe 68 ( fig1 ) and to provide a single outflow of accepted stock through accepts outlet pipe 70 but two outflows of rejects through diametrically opposite reject outlets 72 and 74 ( fig2 ). describing now in more detail the sub - assembly shown in fig4 and also in other figures , the sub - assembly has an annular base 76 which , as shown in fig3 is l - shaped in cross - section , has the bottom end of screen 58 welded to its inside edge and is in turn secured to the upper one of two relatively inverted , nested annular members of l - shaped cross - section 78 , 80 secured together and to apparatus base 14 when the screen is assembled . two opposite reject outlet slots 82 , 84 in screen 58 , extending approximately from top to bottom of screening passage 60 , constitute inlets to opposite rejects chambers formed by v - shaped channel members 86 , 88 each having its side edges secured to the outer face of screen 58 , and having its respective ends secured to base 76 and a flange 90 projecting laterally from the outer face of screen 58 above the screening passage . members 86 , 88 thus form a closed chamber about respective slots 82 , 84 except for the openings into respective reject outlets 72 and 74 . one side of channel members 86 , 88 is secured to screen 58 at one side edge of opposite slurry inlet slots 94 , 96 , respectively , through screen 58 to screening passage 60 , these being of approximately the same length and width as slots 82 , 84 and adjacent thereto ( see fig2 , 5 ). two accepts chamber wall members 98 , 100 , secured at their bottom edge to base 76 , each have a reversely bent end portion 99 , 101 , respectively , secured at the opposite side edge of inlet slots 94 , 96 , respectively , from members 86 , 88 , and form , with the sidewall of member 86 or 88 , tangentially directed inlet channels to slots 94 , 96 , respectively . the other end of members 98 , 100 is secured to the outer end of respective members 86 , 88 to form two opposite accepts chambers 104 , 106 on the outside of screening passage 60 , each being approximately 180 ° in angular extent minus the angular extent occupied by one set of inlet and outlet slots . the reversely bent end portions 99 , 101 of members 98 , 100 are secured at their tops to the underside of flange 90 , and above this members 98 , 100 are integral with hollow cylinder 108 secured at its inner surface to the outer edge of flange 90 and extending above it to form the outer edge of an overflow channel 110 ( fig3 ) from both accepts chambers 104 , 106 . an annular flange 112 ( fig3 ) on the outside of cylinder 108 seats on annular ledge 114 projecting inwardly from casing 10 to form the bottom of an accepts gutter 116 surrounding cylinder 108 above them , from which the accepts exit through outlet pipe 70 . elongated openings 118 are provided in flange 90 where it overlies chambers 104 , 106 to allow flow of accepts upward therethrough into overflow channel 110 . a ring 120 ( fig3 ), clamped between rim 122 of cover 12 and a top flange 123 on casing 10 , has a cylindrical sleeve 124 secured to its inner edge with a diameter such as to fit closely over the outer periphery of an unapertured extension 58a of screen 58 , thereby forming the inner wall of channel 110 and gutter 116 , with ring 120 closing the top of the gutter . sleeve 124 has a transverse wall 126 with an inverted cup 128 in its central portion receiving the upper end of shaft 20 , sleeve 124 and wall 126 serving as a closure for the upper end of screening passage 60 which , however , is not functional above the perforated portion of screen 58 . by removing cover 12 and pulling off ring 120 and sleeve 124 , end access to the screening passage 60 may be had . also , rotor 18 may be removed by unscrewing nut 50 and sliding rotor hub 44 off its keyed connection to shaft 20 . in operation , the feed slurry supplied to inlet 68 splits in two halves which flow respectively clockwise to the inlet channel to slot 94 and counterclockwise to the inlet channel to slot 96 in a flow passage provided between wall 98 of accepts chamber 104 and casing 10 . most of this flow passes inwardly through the inlet channels and slots tangentially into screening passages 60 , where the rotor is rotating counterclockwise in the drawings , as indicated by arrows in fig2 . slurry which does not enter the first inlet it encounters continues in the flow passage between the casing 10 and wall 100 of the other accepts chamber 106 until it either reaches the other inlet slot or is backed up by feed slurry flowing in the opposite direction . in screening compartment 60 the slurry flows from slot 94 counterclockwise past screening accepts compartment 104 , and from slot 96 counterclockwise past screening accepts compartment 106 while being subjected to the pulsing action of buttons 64 , with rejects exiting through outlet slots 84 and 82 , respectively , to piping ( not shown ) connected to rejects outlets 72 and 74 . any slurry passing a rejects outlet recirculates in the passage 60 past the following slurry inlet and accepts chamber . the accepts passing the screen flow upwardly in accepts compartments 104 , 106 through openings 118 in flange 90 , through and out channel 110 into gutter 116 and out outlet 70 to connected piping ( not shown ). in maintaining proper flow , it is desirable that the cross - sectional area of the slurry inlet 68 be considerably greater than the longitudinal cross - sectional area of screening passage 60 , such as two times the cross - sectional area of screening passage 60 multiplied by the number of inlets to the screening compartment ( two slots 94 , 96 in the illustrated embodiment ). the preferred embodiment shown has approximately the following dimensions for parts mentioned : rotor drum 18 outer diameter , 32 inches ( 813 m . m . ); screen 58 inner diameter , 36 . 6 inches ( 930 m . m . ); slots 82 , 84 , 94 , 96 , 38 . 25 inches ( 972 m . m .) long by 3 . 75 inches ( 95 m . m .) wide except at rounded ends ); accepts chambers 104 , 106 , 2 . 2 inches ( 56 m . m . wide ) by 147 ° angular extent ; casing 10 inner diameter 54 inches ( 1372 m . m . ), height to center of cover 90 inches ( 2286 m . m .). thus a screening path length past each accepts chamber is provided about 2 inches ( 50 . 4 m . m .) below the upper limit of 4 feet ( 1220 m . m .) of the most desirable range of such length set forth earlier herein . similar results can be achieved with two screens having but one of the two pairs of inlet and outlet slots and a smaller diameter , such that half the slurry fed to the single inlet slot of each screen flows nearly 360 ° about the screen axis to the outlet slot in a path of similar length . this would multiply the cost of the hardware needed to process the large flows which normally must be handled by headbox screens . however , for smaller flows , the single inlet and outlet slot modification may be better suited . the apparatus with the given dimensions is designed for a capacity of up to 10 , 000 g . p . m . ( 631 liters / sec .) applied to slurry of normal headbox consistency . if a single screen apparatus of even greater capacity is desired while maintaining screen path length within the most desirable range , a screen of larger diameter could be provided with three or more inlet slots and corresponding rejects slots and outlets . in the illustrated embodiment , the screening passage has a width of about 2 . 3 inches ( 58 m . m . ), as the above - given dimensions indicate . the pulsing hemispherical buttons 64 have a radius of 7 / 8 in . ( 22 m . m .) with a close clearance from the screen and there may be 80 - 100 of the buttons and pins 66 distributed with about equal spacing over the drum surface . the rotor drum 18 may be normally driven at about 330 r . p . m ., this being about half the normal angular velocity of the rotor drum in apparatus constructed according to u . s . pat . no . 3 , 363 , 759 aforesaid . however , it is desirable in the apparatus according to the present invention that the angular velocity of the rotor somewhat exceed ( e . g ., by 25 %- 50 %) the velocity of the incoming slurry at inlet 68 . provision may be made for varying rotor speed either by a variable speed motor or by varying sheave 56 diameter . while the rotor is normally most desirably rotated in the direction of flow in screening passage 60 , it can be rotated in the opposite direction . this may increase the screening throughput somewhat but also greatly increases horsepower requirements at lower efficiency . also , it is recognized that it would be possible to redesign the apparatus so that the screen would be rotated and the drum would be stationary , as this is know to produce similar screening action to that of a stationary screen with rotating pulse makers . for example , the screen could be rotated and interchanged in position with a fixed drum having the pulse creating devices on its inner face toward the screen and containing the slurry inlet and rejects outlet slots . in such an arrangement , separate accept chambers would not be needed and would be replaced by a single discharge system from the inside of the screen . while such a revised arrangement might operate similarly , it is believed it would not be as effective and the arrangement shown is preferred . positioning a rotating rotor drum inside a stationary outward flow screen rather than outside a stationary inward flow screen is preferred for several reasons including less horsepower needed to rotate the smaller drum . the illustrated embodiment is designed for mounting on a vertical axis , as is preferred but not essential . it should be pointed out , that the arrangement shown in which the accepts discharge axially from the accepts chambers 104 , 106 , has been found to be a desirable feature , contributing to the efficiency of screening and pulse reduction at these compartments .	1
as used herein , an endoprosthesis is a device that can be implanted in a human or veterinary patient . examples of such devices include without limitation self - expandable stents , balloon - expandable stents , stent - grafts , grafts ( e . g ., aortic grafts ), heart valve prosthesis ( e . g ., artificial heart valves ), vascular graft , and shunts . referring now in more detail to the exemplary drawings for purposes of illustrating embodiments of the invention , wherein like reference numerals designate corresponding or like elements among the several views , there is shown in fig1 endoprosthesis 10 in the form of a tube without fenestrations . the tube can be made by extruding or molding polymeric material , or the tube can be made by rolling a sheet of polymeric material . the tube has polymeric substrate 12 . the term “ substrate ” refers to the structural support material . after endoprosthesis 10 is implanted in a patient , the strength of substrate 12 allows the endoprosthesis to provide support to surrounding tissue or perform any other intended function . optionally , substrate 12 may be covered by a relatively thin coating from which a drug or other therapeutic agent may be released into a patient . as will be discussed in more detail below , when an optical coherence tomography ( oct ) technique is used , optical radiation is emitted toward polymeric substrate 12 . external surfaces of the endoprosthesis scatter the light due to a change in the index of refraction between the external surface and a fluid ( i . e ., air or liquid ) adjacent to the external surface . external surfaces include luminal surface 14 and abluminal surface 16 . the term “ luminal surface ” refers to the radially inward facing surface or the surface that faces toward central passageway or lumen 18 of endoprosthesis 10 . the term “ abluminal surface ” refers to the radially outward facing surface or the surface that faces away from central lumen 18 . the light scattered from external surfaces can provide an oct image that shows an outline of the external surfaces . as used herein , the term “ oct image ” is an image that is produced using an oct technique . laser modifying device 20 is used to modify substrate 12 to increase its ability to reflect and scatter light from within substrate 12 . the modification creates changes in the index of refraction within substrate 12 . after the modification , optical radiation from an oct technique will penetrate through the external surfaces and then be reflected and scattered from within the substrate , such that an oct image can show an image signal from inside the substrate that would normally not be present . as shown in fig2 , endoprosthesis 10 can be a stent in the form of tubular scaffold . the tubular scaffold is a tube with fenestrations 22 . the term “ fenestrations ” refers to holes or gaps through the wall of the tube . endoprosthesis 10 includes a plurality of radially deformable rings 24 . each ring 24 comprising a series of ring struts 26 . each ring strut 26 is connected by hinge 28 to adjacent ring strut 26 . ring struts 26 and hinges 28 are constructed of polymeric substrate 12 . the strength and elasticity of substrate 12 allows endoprosthesis 10 to be crimped to a reduced configuration , deployed to an enlarged configuration , and then provide support to surrounding tissue . each ring 24 is connected by hinges 28 ( further identified with the letter “ a ”) to adjacent ring 24 . all hinges 28 are configured to bend during crimping and deployment of endoprosthesis 10 . during crimping and deployment , hinges 28 mechanically deform to allow a change in overall outer diameter 30 of each ring 24 . end rings 24 ( further identified with the letter “ e ”) are located at opposite ends of endoprosthesis 10 . fenestrations 22 , ring struts 26 , and hinges 28 can be formed during an injection molding process using a mold having a cavity with a shape that corresponds to the shape of the fenestrations , ring struts , and hinges . molten polymeric material can be injected into the mold to form the scaffold of fig2 . after the polymeric material has been cooled and hardened , the tube can be removed from the mold and then laser modifying device 20 can be used to modify substrate 12 . alternatively , fenestrations 22 , ring struts 26 , and hinges 28 can be formed by cutting away material from a tube of polymeric material . optionally , the tube of polymeric material can be made by extruding a polymer through a die to form a precursor tube . the precursor tube can be radially expanded by a blow molding process to induce polymer molecule chains to have a preferential orientation that provides desirable structural characteristics . blow molding can be performed as described in u . s . publication no . 2011 / 0066222 a1 . after blow molding , material is cut away from the radially expanded tube to form the scaffold of fig2 . cutting can be performed as described in u . s . publication no . 2007 / 0283552 a1 . cutting can be performed using a mechanical knife , a cutting laser device , or other device . after material is cut away from the radially expanded tube to form ring struts 26 and hinges 28 , laser modifying device 20 can be used to modify substrate 12 to increase the ability of the substrate to reflect and scatter light from within the substrate . in further embodiments , the modification process using laser modifying device 20 can be performed at a time between completion of blow molding and the start of cutting . in another alternative , fenestrations 22 , ring struts 26 , and hinges 28 can be formed by cutting away material from a flat sheet of polymeric substrate material , which is then rolled to form the scaffold of fig2 . cutting can be performed using a mechanical knife , a cutting laser device , or other device . after material is cut away from the flat sheet , laser modifying device 20 can be used to modify substrate 12 to increase the ability of the substrate to reflect and scatter light from within the substrate . alternatively , the modification process using laser modifying device 20 can be performed before material is cut away . as mentioned above , a cutting laser device can be used to cut away material to form fenestrations 22 , ring struts 26 , and hinges 28 . the cutting laser device is adjusted to cut entirely through the wall thickness of the tube . the cutting laser device can be a femtosecond laser modifying device which is controlled in terms of power , pulse duration , pulse repetition rate , wavelength , focus , and other laser device variables in order to remove material and cut completely through the substrate material . as discussed in u . s . publication no . 2011 / 0307050 a1 , the laser device variables can be set such that there is minimal disruption to the substrate material below the surface being cut . laser modifying device 20 can be a femtosecond laser modifying device , which can be the same laser device which was used to cut away material or a different laser device . in order to modify the interior of substrate 12 to increase light reflection and scattering from within the substrate , laser modifying device 20 is controlled in terms of power , pulse duration , pulse repetition rate , wavelength , focus , and other variables so as not to cut entirely through the substrate material . settings for the laser device variables used to modify the interior of substrate 12 are different than settings used to cut entirely through the substrate material to produce fenestrations 22 , ring struts 26 and hinges 28 . to modify the interior of substrate 12 , the laser device variables are controlled to produce tiny gas - filled voids below the surface of substrate 12 . the laser modifying device can focus one or more laser beams onto a region below an external surface of substrate 12 to induce a nonthermal and photochemical process that breaks chemical bonds in the region below the external surface , which results in the gas - filled voids . due to translucency of the substrate material , the external surface above the gas - filled voids can remain in place and undamaged . in some instances , the external surface above the gas - filled voids can remain in place with some alteration but still cover over the gas - filled voids . during the modification process , cool air may be blown onto the external surface to prevent or minimize disruption of the external surface . the gas - filled voids can have a diameter or interior dimension that is greater than 1 μm , greater than 2 μm , or greater than 3 μm . although the term “ diameter ” is used to describe the size of the gas - filled voids , it should be understood that the gas - filled voids can be irregularly shaped , ellipsoid in shape , or spherical in shape . the gas - filled voids can have any enclosed shape . the term “ enclosed shape ” means that the void does not open to an external surface of substrate 12 . voids having the aforementioned diameters can be located at a depth below the external surface nearest the void , the depth being more than 2 μm , more than 10 μm , or more than 30 μm . each void within substrate 12 provides an interface between gas and polymer , which is also referred to as a gas - polymer interface . the gas - polymer interface corresponds to a change in the index of refraction between gas and polymer , which causes light radiation passing through the external surface to scatter upon reaching the voids . in an oct technique , the scattered light is processed to produce an oct image having an increase in image signal intensity from within substrate 12 as compared to a region of the substrate that does not have gas - filled voids . fig2 shows endoprosthesis 10 before it has been crimped to a reduced configuration . after laser modifying device 20 is used to modify substrate 12 , endoprosthesis 10 can be crimped onto a catheter so that endoprosthesis 10 has a reduced configuration , and then deployed to an enlarged configuration within a blood vessel or other bodily lumen . alternatively , laser modifying device 20 can be used to modify substrate 12 after it has been crimped onto a catheter . the laser beam can be carefully controlled , such as by use of a feedback camera , to avoid the catheter beneath the substrate . after the substrate 12 is modified to have gas - filled voids , endoprosthesis 10 can be deployed within a blood vessel or other bodily lumen . fig3 shows endoprosthesis 10 after substrate 12 has been modified using laser modifying device 20 and after endoprosthesis 10 has been deployed with lumen 40 . for example , after the interior of substrate 12 has been modified to have gas - filled voids , a catheter can be used to maneuver endoprosthesis 10 to a desired location while endoprosthesis 10 is in a reduced configuration . when at the desired location , endoprosthesis 10 is allowed to expand or is forcibly expanded to an enlarged configuration . abluminal surfaces 16 of endoprosthesis 10 provide support to lumen walls 42 which are shown in cross - section . lumen walls 42 can be , for example , the walls of a blood vessel or other bodily lumen . fig4 shows a length - wise slice of endoprosthesis 10 of fig3 . polymeric substrate 12 of endoprosthesis 10 was modified to have gas - filled voids before endoprosthesis 10 was deployed in lumen 40 . the slice shows the entire longitudinal length 11 of endoprosthesis 10 . the small rectangles 44 are schematic representations of ring struts 26 and hinges 28 intersected by the slice . catheter 50 is inserted through central lumen 18 of endoprosthesis 10 . catheter 50 has a fiber optic wire that is configured to emit light radially outward , such as in the direction of arrow 46 , toward endoprosthesis portions 44 . the light passes through the external surfaces of endoprosthesis portions 44 and lumen wall 42 and is reflected and scattered from within endoprosthesis portions 44 and lumen wall 42 . the fiber optic wire of catheter 50 is configured to sense the light scattered by endoprosthesis portions 44 and lumen wall 42 . while emitting light and sensing scattered light , catheter 50 can be rotated about its axis , such as in the direction of arrow 52 , and simultaneously pulled axially , such as in the direction of arrow 54 . rotation and pulling allow light to be scattered and then sensed from the entire longitudinal length 11 of endoprosthesis 10 and from the entire circumference of each ring 24 . catheter 50 is coupled to a processor , which is schematically represented by box 56 . processor 56 is configured to apply interferometric processing to the scattered light sensed by catheter 50 to generate image data representative of endoprosthesis 10 and lumen wall 42 that surrounds endoprosthesis 10 . the image data can be used to generate a plurality of images , each image being a circumferential slice taken at a different position along longitudinal length 11 of endoprosthesis 10 . for example , one of the images can be that of a circumferential slice at plane 59 to show a stent ring at middle segment 15 of endoprosthesis 10 . other images can be that of circumferential slices at planes 58 and 60 to show end rings 24 e at opposite end segments of endoprosthesis 10 . the opposite end segments are distal end segment 13 and proximal end segment 17 of endoprosthesis 10 . the image data can also be used to generate a three - dimensional image of endoprosthesis 10 . catheter 50 and processor 56 can be configured for oct imaging . in which case , catheter 50 can be configured to emit infrared light that passes through the external surfaces of endoprosthesis portions 44 and lumen wall 42 . as used herein , the term “ infrared light ” encompasses any wavelength from a nominal red edge of the visible spectrum at 700 nanometers ( nm ) to 1 mm . the infrared light can be short wavelength infrared ( 1 . 4 to 3 μm wavelength ), near - infrared light ( 0 . 75 to 1 . 4 μm wavelength ), mid - infrared light ( 6 to 8 μm wavelength ), or other infrared wavelengths . selection of wavelength can depend on the specific polymeric substrate material of endoprosthesis 10 and the desired depth through tissue at which an image is to be taken . catheter 50 can be configured to sense the near - infrared light ( or other light wavelength mentioned above ) that was scattered from within endoprosthesis portions 44 and lumen wall 42 . processor 56 can be configured to apply oct processing techniques to the scattered light sensed by catheter 50 to generate image data representative of endoprosthesis 10 and lumen wall 42 . image data for the entire longitudinal length of the endoprosthesis can be obtained by rotating and pulling catheter 50 as previously described . fig5 shows a simulated oct image showing a circumferential slice of one or more stent rings 24 of endoprosthesis 10 of fig3 and 4 deployed in lumen 40 . image signals , which appear light in color in fig5 , represent regions from which light was scattered after the light was emitted from a central region of lumen 40 represented generally by a “+” mark . the substrate material of the stent ring has not been modified to increase the ability of the substrate to reflect and scatter light from within the substrate . thus , portions of substrate 12 intersected by the slice have image signals ( appearing as a light color rectangle ) that identify the external surfaces of substrate 12 . the absence of an image signal from within substrate 12 causes the area within the substrate to appear dark in the oct image . the color of the interior region within substrate 12 is that same as that of the empty space at the center of lumen 40 . structures within lumen wall 42 surrounding the endoprosthesis scatter light and thus provide a ring - shaped image in which the strength of the image signal fades or becomes weaker with increasing distance from the oct light source near the “+” mark . fig6 shows a simulated oct image showing a circumferential slice of one or more stent rings 24 of endoprosthesis 10 of fig3 and 4 . the oct image is similar to that of fig5 except substrate 12 has been modified to increase the ability of the substrate to reflect and scatter light from within the substrate . thus , portions of substrate 12 in the slice have image signals ( appearing as a light color rectangle ) that identify the external surfaces of substrate 12 , and they also have image signals within substrate 12 that causes the area within the substrate to appear bright . the image signal intensity from the interior of substrate 12 in fig6 is greater than that in fig5 . also , the region within substrate 12 is much brighter than the empty space at the center of lumen 40 . in fig6 , the increase in brightness from within substrate 12 can help distinguish endoprosthesis structures from the empty space and from surrounding lumen walls 42 . in some embodiments , middle segment 15 of endoprosthesis 10 has not been modified by laser modifying device 20 in the manner described above . substrate 12 in the middle segment does not have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . end segments 13 and 17 of endoprosthesis 10 have been modified by laser modifying device 20 to have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . in these embodiments , the simulated oct image of fig5 may represent a circumferential slice taken through plane 59 in fig4 , and the simulated oct image of fig6 may represent circumferential slices taken through planes 58 and 60 in fig4 . in other embodiments , end segments 13 and 17 of endoprosthesis 10 have not been modified by laser modifying device 20 in the manner described above . substrate 12 in end segments 13 and 17 do not have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . middle segment 15 of endoprosthesis 10 has been modified by laser modifying device 20 to have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . in these embodiments , the simulated oct image of fig5 may represent circumferential slices taken through planes 58 and 60 in fig4 , and the simulated oct image of fig6 may represent a circumferential slice taken through plane 59 in fig4 . it is possible to modify substrate 12 in end rings 24 e exclusively to help determine where the endoprosthesis structure begins and ends when implanted in lumen 40 . in yet other embodiments , substrate 12 throughout longitudinal length 11 of endoprosthesis 10 has been modified by laser modifying device 20 to have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . in these embodiments , the simulated oct image of fig6 may represent circumferential slices taken through planes 58 , 59 , and 60 in fig4 and anywhere else along longitudinal length 11 of endoprosthesis 10 . as discussed above , substrate 12 can be modified to have gas - filled voids in order to distinguish some longitudinal segments ( e . g ., end segments ) from other longitudinal segments ( e . g ., a middle segment ). also , substrate 12 of one or more rings 24 can be modified to have gas - filled voids in ring struts 26 but not modified to have gas - filled voids in hinges 28 so as not to affect the elasticity and strength of the hinges . further , substrate 12 throughout longitudinal length 11 of endoprosthesis 10 , except hinges 28 , can be modified by laser modifying device 20 to have gas - filled voids that increase the ability of the substrate to reflect and scatter light from within the substrate . as discussed below , substrate 12 can also be modified to distinguish a surface of the endoprosthesis ( e . g ., abluminal surface ) from another surface of the endoprosthesis ( e . g . luminal surface ). fig7 shows a cross - section of a portion of substrate 12 which has been modified by laser modifying device 20 to have gas - filled voids 70 that increase the ability of the substrate to reflect and scatter light from within the substrate . gas - filled voids 70 have a non - uniform spatial density as viewed in the illustrated cross - section of substrate 12 . as used herein , “ spatial density ” refers to the total number of voids per unit area . for example , spatial density can be measured in terms of the total number of voids per 1000 μm 2 . the spatial density decreases with increasing distance from abluminal surface 16 . the spatial density is greater in area 72 adjacent to abluminal surface 16 of the endoprosthesis as compared to area 74 adjacent to luminal surface 14 . areas 72 and 74 are interior substrate portions . the greater spatial density in area 72 corresponds to a greater number of gas - polymer interfaces in area 72 , which results in a greater scattering of light and thus a greater oct image signal that could enhance visualization of abluminal surface 16 . fig8 shows a cross - section of a portion of substrate 12 which has been modified by laser modifying device 20 to have gas - filled voids 70 that increase the ability of the substrate to reflect and scatter light from within the substrate . the spatial density increases with increasing distance from abluminal surface 16 . the spatial density of gas - filled voids 70 is greater in area 74 as compared to area 72 . the greater spatial density in area 74 could enhance visualization of luminal surface 14 . a greater spatial density can be created in a preferred area ( either area 72 or 74 ) by controlling laser modifying device 20 to create more gas - filled voids in the preferred area . for example , laser modifying device 20 can be configured to focus energy in the preferred area instead of another area of substrate 12 . also , laser modifying device 20 can be arranged to emit a laser beam that enters substrate 12 from one of the external surfaces ( abluminal surface 16 or luminal surface 14 ) that is closest to the preferred area . fig9 shows a cross - section of a portion of substrate 12 which has been modified by laser modifying device 20 to have gas - filled voids 70 that increase the ability of the substrate to reflect and scatter light from within the substrate . the spatial density of gas - filled voids 70 in area 72 is about the same as that in area 74 so that there is a substantially uniform spatial density . the terms “ about the same ” and “ substantially uniform ” mean that the number of gas - filled voids in area 72 can be within plus or minus 20 % of the number of gas - filled voids in area 74 . the substantially uniform spatial density can be created by controlling laser modifying device 20 to create about the same number of gas - filled voids in areas 72 and 74 . for example , laser modifying device 20 can be configured to focus about the same amount of energy in areas 72 and 74 . also , laser modifying device 20 can be arranged to emit a laser beam that enters substrate 12 from one of the external surfaces ( abluminal surface 16 or luminal surface 14 ) and then , at a later time , emit a laser beam that enters substrate 12 from the opposite external surface . in fig7 - 9 , the illustrated cross - sections of substrate 12 can be that of ring strut 26 , hinge 28 or any other part of endoprosthesis 10 , such as link strut 27 of fig1 and 12b . the illustrated cross - section can be a longitudinal cross section , similar in orientation to the substrate cross - sections shown in fig4 . the illustrated cross - section can be circumferential cross sections , similar in orientation to the substrate cross - sections shown in fig6 . the cross - sections of fig7 - 9 show luminal surface 14 and abluminal surface 16 which face in opposite directions . side surfaces 76 and 78 connect luminal surface 14 to abluminal surface 16 . gas filled voids 70 are encapsulated within substrate 12 . gas filled voids 70 are sealed within luminal surface 14 , abluminal surface 16 , and side surfaces 76 and 78 . gas filled voids 70 are not necessarily illustrated to scale . gas - filled voids 70 can have a diameter or interior dimension that is greater than 1 μm , greater than 2 μm , or greater than 3 μm . gas - filled voids 70 can be located at a depth beyond the external surface nearest the void , the depth being greater than 2 μm , greater than 10 μm , greater than 30 μm , greater than 50 μm , or not greater than 50 μm . for example , gas - filled voids 70 can be located at depths greater than 2 μm , greater than 10 μm , greater than 30 μm , or greater than 50 μm from any one or more of luminal surface 14 , abluminal surface 16 , side surface 76 , and side surface 78 . as further example , there can be gas - filled voids at depths up to 50 μm but not greater than 50 μm as measured from any one of luminal surface 14 , abluminal surface 16 , side surface 76 , and side surface 78 . side surfaces 76 and 78 can be formed by a laser cutting device which cuts entirely through a sheet or tube of polymeric substrate material to form fenestrations 22 , ring struts 26 , hinges 28 , and other parts of endoprosthesis 10 . in some embodiments , area 72 is an area of substrate 12 adjacent to abluminal surface 16 and which extends from one side surface 76 to the opposite side surface 78 . area 74 is an area of substrate 12 adjacent to luminal surface 14 and which extends from one side surface 76 to the opposite side surface 78 . the distance from side surface 76 to opposite side surface 78 is referred to as the width of the cross - section . optionally , coating 80 can be applied on an external surface of substrate 12 , such as by spraying , dipping , or other method . gas - filled voids 70 are sealed within coating 80 . coating 80 may include a polymeric coating material . coating 80 may also include a drug or other type of therapeutic agent carried by the polymeric coating material . substrate 12 may be modified to have gas - filled voids before or after coating 80 is applied on substrate 12 . to avoid damage to substances in coating 80 , substrate 12 is preferably modified by laser modifying device 20 to have gas - filled voids before coating 80 is applied on substrate 12 . referring to fig1 , the illustrated cross - sections of fig7 - 9 can be a slice through plane 81 at inner curvature 82 of hinge 28 . the illustrated cross - sections of fig7 - 9 can be a slice through plane 84 at outer curvature 86 of hinge 28 . geometric central axis 88 separates inner curvature 82 from outer curvature 86 . geometric central axis 88 is centered between side surfaces 90 and 92 . it is to be understood that that the structural pattern for endoprosthesis 10 is not necessarily limited to what is depicted in fig2 and 3 . the structural pattern refers to the arrangement , and orientation of rings and of the various struts , hinges , and other structural elements . the structural pattern can be any of the stent patterns described in u . s . pat . nos . 7 , 476 , 245 and 8 , 002 , 817 . the stent can have virtually any stent pattern suitable for a polymer substrate . referring to fig1 , endoprosthesis 10 can have a strut pattern having radially deformable rings 24 connected to each other by link struts 27 . opposite ends of link struts 27 meet hinges 28 of adjacent rings 24 . substrate 12 of link struts 27 can be modified to have gas - filled voids 70 in the manner described above in fig7 - 9 and in the same manner described above for any part of the endoprosthesis of fig3 and 4 . fig1 a and 12b show photographs of endoprosthesis 10 having radially deformable rings 24 which are interconnected by link struts 27 similar to the scaffold shown in fig1 . substrate 12 of endoprosthesis 10 is made of poly ( l - lactic acid ) which was extruded to form a precursor tube , then radially expanded by blow molding , and then cut using a laser cutting device to form the scaffold . in fig1 a , the scaffold has been crimped to a reduced configuration on a balloon catheter . in fig1 b , the scaffold has been forcibly expanded to an enlarged configuration in which the inner diameter of each ring 24 is 3 . 5 mm . expansion is accomplished by inflation of balloon 96 of the catheter . compared to ring struts 26 and link struts 27 , it is the hinges 28 that perform most of the bending and flexing needed to allow the diameter of endoprosthesis 10 to be reduced during crimping and enlarged during subsequent expansion . as can be seen in fig1 a and 12b , ring struts 26 and link struts 27 remain substantially straight during crimping and expansion . substrate 12 can be modified to have gas - filled voids before or after being crimped on a catheter . during the modification process , the optical translucency of substrate 12 allows energy from laser modifying device 20 to pass across the external surface of the substrate and induce a process that breaks chemical bonds in the region below the external surface , which results in the gas - filled voids within the substrate . substrate 12 of endoprosthesis 10 can be modified to have gas - filled voids in ring struts 26 , link struts 27 , and hinges 28 . alternatively , substrate 12 of endoprosthesis 10 can be modified to have gas - filled voids in ring struts 26 and link struts 27 but not modified to have gas - filled voids in hinges 28 so as not to affect the elasticity and strength of the hinges . during an oct imaging process , the optical translucency of the substrate allows light directed toward the substrate to pass across the external surface of the substrate and be scattered by gas - filled voids . scattering of light from within the substrate increases the image signal of the endoprosthesis structure . in any of the above embodiments , substrate 12 is made of a material that is not metal . in any of the above embodiments , substrate 12 is made of a polymeric substrate material that can be penetrated by near - infrared light ( or other light wavelength mentioned above ) used in an oct technique . the polymeric substrate material can be bioresorbable . as used herein , the terms “ biodegradable ,” “ bioabsorbable ,” “ bioresorbable ,” and “ bioerodable ” are used interchangeably and refer to materials that are capable of being completely degraded , eroded , and / or dissolved when exposed to bodily fluids such as blood and can be gradually resorbed , absorbed , and / or eliminated by the body . the processes of breaking down and absorption of the polymer can be caused by , for example , hydrolysis and metabolic processes . the polymeric substrate material can be poly ( lactic acid ) or a polymer based on poly ( lactic acid ). polymers based on poly ( lactic acid ) include graft copolymers , block copolymers , such as ab block - copolymers (“ diblock - copolymers ”) or aba block - copolymers (“ triblock - copolymers ”), and mixtures thereof . examples of polymeric substrate materials include without limitation poly ( lactide - co - glycolide ), poly ( glycolic acid ), poly ( glycolide ), poly ( l - lactic acid ), poly ( l - lactide ) ( plla ), poly ( d , l - lactic acid ), and poly ( caprolactone ) ( pcl ) copolymers . as a further example , substrate 12 can be made from a plla / pcl copolymer . the coating that is optionally applied on substrate 12 can include a polymer , examples of which include without limitation ethylene vinyl alcohol copolymer ( commonly known by the generic name evoh or by the trade name eval ), poly ( butyl methacrylate ), poly ( vinylidene fluoride - co - hexafluororpropene ) ( e . g ., solef 21508 , available from solvay solexis pvdf , thorofare , n . j . ), polyvinylidene fluoride ( otherwise known as kynar , available from atofina chemicals , philadelphia , pa . ), ethylene - vinyl acetate copolymers , and polyethylene glycol . the coating that is optionally applied on substrate 12 can include a drug or other therapeutic agent , examples of which include without limitation sirolimus ( rapamycin ), everolimus , zotarolimus , biolimus a9 , ap23572 , tacrolimus , pimecrolimus and derivates or analogs or combinations thereof . the therapeutic agent can be an antiproliferative , antineoplastic , anti - inflammatory , antiplatelet , anticoagulant , antifibrin , antithrombin , antimitotic , antibiotic , antiallergic , or antioxidant substance . the methods described above for modifying substrate 12 to have gas - filled voids to facilitate oct imaging can be applied to a polymeric substrate in various implantable medical devices , such as pacemaker electrodes , and catheters . while several particular forms of the invention have been illustrated and described , it will also be apparent that various modifications can be made without departing from the scope of the invention . it is also contemplated that various combinations or subcombinations of the specific features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the invention . accordingly , it is not intended that the invention be limited , except as by the appended claims .	6
the present invention will now be described with reference to the accompanying drawings . the computer system shown in fig6 is constituted by , for example , a host computer 1 , a plurality of external storage units 2 and at least one magnetic disc system 3 . it is assumed that the present invention saves ( writes ) undated data records to a disk storage medium of the magnetic disc system 3 used for a database or the like . here , as to the saved data , data in the database are restored by recovering data stored on the disc medium on which data updating records are saved when any failure has occurred in the computer system . the undated data records are sequentially written using two data storage areas ( data blocks ) which are not contiguous , for failure recovery purposes , in a computer system using an . fba type magnetic disc system as a magnetic disc system for saving the updated records . the detailed description will now be given as to a method of writing the saved data . referring to fig1 ( a ), in this embodiment , it is assumed that numbered data are stored in the main memory 11 of the host computer 1 and these data are added ( updated ) on the disc storage medium in the fba type magnetic disc system 3 in numerical order . in addition , the disc storage medium is configured by blocks a , b , c , d , . . . ( 12 ). ( 1 ) in a first step , data 1 are stored in the block a , which is defined as the base block . ( 2 ) in a second step , the data 1 and data 2 are stored in , for example , a block c which does not follow the block a and is defined as the mate block . at this stage , since the data 1 still remain in the block a , the data exist which have been written before the failure even if the failure was generated during the second writing operation . ( 3 ) in the third step , the data 1 , the data 2 , and the data 3 are then stored in the block a to repeat the update process . ( 4 ) if the block a is filled during the third writing operation , the base block is changed to the block b and data 4 to be subsequently added are written in the block b , and the above - mentioned processes are thereafter repeated from the first step using the block b and , for example , a block d which does not follow the block b . when the writing operation is shifted from the block a to the block b , the data 4 may be stored in the block c by , e . g ., the fourth writing operation depending on a pattern of the length of data to be written ( the data 1 , the data 2 , . . . ) as shown in fig1 ( b ), and the data 4 are yet to be stored in the block a although the data 5 must be written in the block b by the fifth writing operation . even though the data 4 is stored in the block c , the data 4 will be erased when the block c becomes the base block later on . therefore , the data 4 must be written on block a which is the base block . in such a case , the following processes are carried out : ( 5 ) in the fifth step , the data from 1 to 5 are written in the two contiguous blocks a and b by one access , and the above - mentioned processing is thereafter repeated from the first step using the block b and , e . g ., the block d which does not follow the block b . after that the above - mentioned processing is thereafter repeated from the first step using the block c and , e . g ., the block e which does not follow the block c . this enables the data to be sequentially added and written in the blocks a , b , c , d , e , f . . . fig2 is a main flow chart showing the method of storing data according to the present invention . the main flow chart is constituted of two parts , i . e ., store data to be saved in the main memory and write the data stored in the main memory to the disc medium . fig3 is a flow chart showing a process of storing data in the above - mentioned main memory . two buffer areas in the main memory are defined as the current buffer , which is the currently - used buffer and the mate buffer , which is used for continuous write operations . in fig3 it is determined in stage 1 whether the current buffer is full . if the current buffer is not full , another data is additionally stored in the current buffer ( stage 2 ) and + 1 is added to the write number ( stage 3 ). if current buffer is full , it is determined whether the write number is even ( stage 4 ). if the write number is an odd number , the base block address is changed , and a write instruction flag is set to base ( stage 5 ). then , the mate and current buffers are switched ( stage 6 ). thereafter , the current buffer is cleared and data is stored therein ( stage 7 ), and the write number is set to 1 ( stage 8 ). if the write number is an even number , a continuous write instruction is set in order that data stored in the current buffer and the mate buffer are written continuously onto two contiguous block on the recording medium ( stage 9 ). thereafter , the mate buffer is cleared and data are stored therein ( stage 10 ), and the write number is set to 1 ( stage 8 ). fig4 is a flow chart showing a process of writing data stored in the main memory to the recording medium . if a continuous write instruction is not carried out ( stage 11 ), it is determined whether the continuous write instruction flag is set to base ( stage 12 ). the write instruction flag shows onto which block , the base block or the mate block , the data are to be written next time . if the write instruction flag is not set to base , the current buffer data are written to the mate block of the medium ( stage 13 ). then the write instruction flag is switched to base ( stage 14 ). if the write instruction flag is set to base ( stage 12 ), the current buffer data are written to the base block of the medium ( stage 15 ). then write instruction flag is switched to mate ( stage 16 ). if a continuous write instruction is made ( stage 11 ), the data stored in the current buffer and the mate buffer are written continuously to two consecutive block ( block a and block b ) on the recording medium ( stage 17 ). thereafter , the continuous write instruction is reset ( stage 18 ) and the write instruction flag is set to mate ( stage 16 ). as described above , the present invention advantageously enables sequential records to be added and written by alternately updating two discontiguous data storage areas on the disc medium , without lowering the data transfer efficiency due to the rotational loss of the disc storage medium . while this invention has been described with reference to an illustrative embodiment , this description is not intended to be construed in a limiting sense . various other embodiments of the illustrative embodiment , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to this description . it is , therefore , contemplated that the appended claims will cover any such modifications or embodiments as fall within the true scope of the invention .	6
the basic components of the present invention are shown in fig1 . the invention proposes a generic mechanism in order to administer error messages of electronic canopen apparatuses 100 at a central level without intervening in or , respectively , changing the system software . a monitoring software that serves to administer error messages of multiple , decentrally arranged electronic apparatuses is typically integrated into the system software . a modification to the system software is connected with relatively high cost since normally a system administrator is necessary for this purpose , and since this cannot be executed at the electronic apparatus 100 from a decentralized location ( on site , so to speak ). the monitoring software within the system software is designated with a square box in fig1 , which square box is arranged over an interface ( shown in the middle ). in the preferred embodiment the interface is a canopen bus bus . however , other interfaces can be provided in other embodiments in order to connect the electronic apparatuses 100 to a central administration instance , for example via usb interfaces . the system according to the invention thus has a storage medium 110 on which is stored the apparatus configuration file dcf . the storage medium 110 can advantageously also be arranged in the electronic apparatus . however , the storage medium 110 can also be placed at an external instance that is engaged in data exchange with the electronic apparatus 100 . in principle , it is insignificant whether the configuration file dcf is fashioned as a separate file or is distributed across multiple files . moreover , the system has a text streamer 120 that imports a message object mo from the expanded apparatus configuration file dcf and an event handler 130 that intercepts and parameterizes the error message . the text streamer 120 and / or the event handler 130 can be fashioned in the same instance but also in different instances . they can be fashioned in the electronic apparatus 100 ; alternatively , they can be fashioned in the central monitoring system , or in an instance that is likewise connected with the system via the canopen bus bus . for apparatuses that are configured according to the canopen standard , it is provided that an electronic data sheet eds is provided . the electronic data sheet is typically provided by the manufacturer and for its part generates an additional file , what is known as a device configuration file dcf . the device configuration file dcf and electronic data sheet eds are configuration files . according to a preferred embodiment of the present invention , the device configuration file dcf is extended with a message object mo . information that is relevant with regard to the presentation and with regard to the evaluation or to the additional processing of the error message is provided in the message object mo . an example of an extended message object mo is shown in fig3 . according to a preferred embodiment of the invention comprises the message object mo comprises the following information : a symbolic name of the message . this name should identify the message within the entire system and must be unique . apparatus data from which the message is derived . this is identified with the designation “ msgsourcename ” in fig3 . here a parameter or multiple parameters can be identified from which the message should be derived . this parameter is completely described by default within the configuration file dcf with regard to addressing and access option . trigger information that triggers a message . this is thereby information or , respectively , conditions that establish when a message has to occur . this is identified in fig3 with the designation “ msgtriggervalue ”. in order to be able to trigger individual bits or , respectively , groups of bits , a mask is defined that is linked with the parameters to be examined via an and link . the message is triggered when the masked parameter corresponds to the trigger value . alternatively , here other logical operators can be used in addition to the and link mentioned in the preceding . moreover , different trigger types can be differentiated . for example , “ 0 ” can identify a riding edge , “ 1 ” can identify a falling edge and “ 2 ” can identify a level . furthermore , the frequency of the occurrence of error messages can be identified . moreover , it is possible to limit the transmission of error messages or , respectively , to vary the frequency . for example , whether the message is in principle transmitted at every occurrence of the error or only at the first occurrence of the error , or for example in the event that additional system - specific conditions are satisfied , can thereby be configured . moreover , a combination of the preceding conditions can also be configured . for example , it could be defined that a message is in principle transmitted only at the first occurrence in the event that additional , system - specific conditions are satisfied . an interval time can also be defined that defines a time interval between the transmission of two successive error messages . a minimum time delay can be configured here so that it is ensured that error messages do not directly follow one another but rather are spaced apart from one another by a minimum time delay . however , this is optional . the manner of the presentation of the error message in the system . how the error message should be presented in the system is defined in this parameter . the entry is interpreted bit - by - bit ; it is thereby possible to allow multiple presentation forms in parallel or , respectively , simultaneously , so to speak . in a preferred embodiment of the present invention , the following configuration possibilities are preconfigured for the presentation : a status window ; a pop - up window ; a pop - up window to be confirmed ; and what is known as a log file . other embodiments provided additional presentation types here . at this point it is noted that the user can in principle configure additional presentation possibilities in order to be able to adapt the system to his specific requirement conditions . given the presentation in the form of a status window , the error message is presented to a user in a window on the screen that is accessible to said user . the same applies for the pop - up window , which likewise appears on the screen . given a pop - up window that is to be confirmed , the user must confirm the respective message in the pop - up window in order to be able to continue to work . the message is stored in a system - specific log file in the log file . rating ( weighting ) of the messages . the effect the message has on the respective entire system is established here . the type of rating can be configured . according to a default setting or , respectively , pre - configuration , three ratings are differentiated . the first level is merely information , while warnings are dealt with at a higher and second level . error messages are dealt with at a third and even higher level . additional meta - information that can be edited via text fields . message texts can likewise be defined here in the dcf file dcf . different text fields are differentiated : there is a text field that provides a rough context for the user . additional text fields can be provided for service use . for example , detailed explanations with regard to the message are conceivable here . additional steps to be executed can likewise be explained . moreover , additional meta - information with regard to the message can be provided . at this point it is noted that the message texts can be provided in different languages . a corresponding reference to the language can be configured . a basic workflow of the method according to the invention according to a preferred embodiment should be explained in the following in connection with fig2 . message object parameters of the message object mo are imported from the expanded apparatus configuration file dcf in a first step that is designated as s 1 in fig2 . the error message is recorded or intercepted in a next step . that is designated as step s 5 in fig2 . in an additional step , the recorded or , respectively , intercepted error message is parameterized with the imported message object parameters . this is designated as step s 10 in fig2 . following this is the administration of the error message in the parameterized form as a last step s 15 . in other words , the administration of the error message ensues using the preceding parameterization of the same . due to the extension of the configuration file dcf according to the invention with message objects mo , device messages can be handled at a higher level , for example at a system level but without affecting the system software . in particular , the appearance , the trigger and the processing of error messages can be uniformly configured and handled in the entire system . this produces an advantage that has proven to be very significant in practice , namely that the user of the respective apparatus 100 can implement a generic monitoring program that loads the necessary information from the respective apparatus description in a configuration step . this advantageously ensues wholly automatically , thus without additional user interaction . moreover , the changing of existing error messages and the insertion of new messages is very simple and is most of all possible without adaptation of the system software . the modification , deletion and / or integration of new error messages advantageously ensues automatically . in connection with fig2 it is noted that the method according to the invention can in principle be divided into two phases . a definition phase is provided in which step s 1 is classified . the other steps s 5 , s 10 and s 15 occur in a second phase , what is known as a runtime phase . the two phases can be temporally decoupled from one another . in other words , what handling should be provided for the respective error message can be established in advance in the definition phase . the message object mo is correspondingly configured . a structured description of the messages can therefore already be made at a very early point in time , and optimally with the respective component vendor . this improves the assignment enormously and can already avoid the occurrence of severe error states in advance . the respective error messages are then detected at runtime ( or , respectively , in the runtime phase and parameterized and correspondingly administered using the message object parameters of the message object mo that are defined in the definition phase . in one advantageous development of the invention it is provided that the definition phase is expanded so that definitions or , respectively , configurations with regard to the message object mo can be executed even at run time . the flexibility of the system is therefore extended . with the proposal according to the invention it is possible that the apparatuses 100 of the apparatus system can therefore be used in a distinctly simpler manner since the user only needs to become familiar with one ( uniform ) handling of messages . the administration of the error message comprises : a presentation or , respectively , display of the error message on a monitor ; the type of presentation ( size , location of the presentation in the form of a list or in the form of a window , etc . ); presentation location within the system ( should the error message be shown only on the respective specific apparatus 100 , or should the error message also be forwarded to the administrator at a system level etc . ); the duration of the presentation of the respective error message ; configurable events that must be fulfilled so that the error message is shown at all in the first place ; system conditions that must be fulfilled so that the error message is shown in a specific form ; and / or conditions in relation to other electronic apparatuses 100 that must be satisfied so that the error message is displayed . however , the preceding enumeration is not exclusive and can be freely configured and expanded at any time , in particular according to the respective user . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .	6
it is well known that biological tissue includes cell layers in a protein framework which provides tensile strength . the proteins are amino acids , and it is known that the application of heat or optical energy can denature such proteins . when the source of heat or energy is removed , the proteins if not totally broken down cool and begin to reconfigure and form an approximate replication of the prior tissue structure . the prior art teaches that the application of either optical energy from a laser or rf energy from a suitable generator could be used to bring the temperature of the biological tissue above room temperature but below the boiling point of water ( preferably between 45 °- 75 ° c . and more prefer 60 °- 70 ° c .). the denaturing of collagen , a major source of protein in the human body , can also be achieved by the application of energy , and is believed to go into solution and form a type of &# 34 ; biological glue &# 34 ; which seals the incision or discontinuity in the biological tissue . thus , it is possible to seal lesions , anastomose a severed or incised vessel or to reconstruct diseased or damaged tissue . i have found that a major disadvantage of such laser welding procedures for rejoining incised tissue is that insufficient tissue material is present for completing a successful joint . when optical energy from the laser actually denatures or melts the tissue in the areas to be joined , a portion of the tissue thickness is reduced so that the denatured materials can flow towards each other and stick together to form the joint . on relatively thin sections of tissue to be joined , such as in repairing an incised blood vessel wall , there is insufficient denatured material in the joint area for providing a sound , high tensile strength connection . collagen is known for use in the medical field as a material for repairing tissue damage caused by thermal , chemical or mechanical trauma ( see , e . g ., &# 34 ; collagen : its place in the medical industry &# 34 ; by j . m . pachence , et al ., medical device and diagnostic industry , january , 1987 ). i have found that this material can be used as a filler which can be placed in the path of the laser beam , melted or denatured , and directed into the incision or the tissue which is to be reconstructed . bipolar or unipolar rf energy will also yield the same or substantially similar results . based on qualitative observations , the additional collagen molecules provided by the filler material allows the tensile strength of the welded incision to be significantly increased . the application of optical energy and the use of additional collagen material provides several advantages in addition to increased tensile strength . the healing time of the wound is accelerated because blood supply to the affected tissue can be reestablished immediately after the surgical procedure . in addition , little or no scarring is produced because sutures are eliminated or substantially minimized . furthermore , the various techniques disclosed herein enhance the accuracy of the welding procedure thus avoiding optical or rf energy damage to adjacent or unintended areas of such tissue . a wide variety of materials may be used as a filler in this welding procedure . the most common source is collagen which may be obtained from bovine hides . another material , which is ideal from the standpoint of melting , flowing , and compatibility with biological tissue , is a collagen - like substance which has been modified by dissolving collagen in water and modifying the thusly dissolved collagen to render its surface charge effectively more positive than prior to modification . this material is well known and is disclosed , e . g ., in u . s . pat . no . 4 , 238 , 480 . the modified collagen is freeze - dried to form a solid mass of gelatin . in accordance with the teachings of the present invention , this mass of gelatin , alone or in combination with other collagen material , may be formed in the shape of a rod , strip , film or flake and utilized as a filler in a laser welding procedure . other forms of collagen which are suitable for use in the present invention include semed f , a collagen preparation manufactured in native fiber form without any chemical or enzymatic modifications , and semed s , a lyophilized collagen powder extracted from fresh bovine hides . each of these products is available from semex medical , frazer , pa . the semed f material is a type i collagen ( greater than 95 %), while the semed s is a mixture of type i and type iii collagen macromolecules in which the shape and dimension of tropocollagen in its natural helical orientation is retained . either of the semed s and semed f collagen material may be formed into welding filler material by suspending a suitable amount ( usually between about 0 . 5 and 10 weight percent ) of the material in deionized water to form a viscous solution followed by drying the solution under the action of heat or by freeze - drying of the solution , followed by vacuum treating and heating steps . as above with the gelatin material , the final shape of the material can be in the form of a rod , strip , powder , etc . a paste formulation may also be formed by dissolving relatively large amounts of the material in relatively small amounts of saline or deionized water . the shapes of these formed materials are solid and soft but firm . these materials may be readily sliced or cut to the desired sizes for use in the laser welding procedure . also , the desired size and shape can be achieved by freeze - drying the material in a suitably sized mold which is configured to the desired size and shape of the product . the thicknesses of the rods or sheets can be between 1 / 4 and 2 mm , depending upon the size of the incision to be joined or area of tissue to be reconstructed . when the paste form is utilized , it may be painted or dropped onto the areas of tissue to be joined or reconstructed . thus , the surgeon can choose from a wide variety of shapes , sizes , densities , thicknesses and configurations of such filler material depending upon the type of tissue to be welded . the concentration of the collagen in the liquid which is to be freeze - dried can range from 0 . 5 - 10 % and preferably 1 - 5 %, with the lower concentrations forming less dense or discontinuous solids . at lower concentrations of 0 . 5 to 1 %, the semed f forms a structure which approximates dense cobwebs . native collagen film , wherein the film strength is preserved and the triple - helix structure of the collagen polymer is maintained intact , can also be used , either alone or with a plasticizer incorporated therewith . a typical collagen sheet is cast from solution to a thickness of about 1 . 8 to 2 mm and contains the following composition by weight : collagen 70 . 3 %, plasticizer ( typically glycerol or glycerine ) 16 . 9 %, water 9 %, other 3 . 8 %. such a material is available from norwood medical products division of norwood industries , inc ., malverne , pa . when gelatin or other water soluble forms of collagen are utilized , certain advantages are provided in that the material will readily polymerize at body temperatures to form a stable subcutaneous gel . in addition , when implanted into the body as filler material in the weld joint , the polymerized material will become rapidly populated by host fibroblasts . thus , the material becomes vascularized and can remain histologically , stable for up to 18 months . one problem with gelatin material per se , however , is that it is highly soluble in blood such that the flow of blood across the material will cause it to dissolve . thus , gelatin or other soluble collagen material when used alone as laser weld filler should be limited to areas where direct contact with blood is avoided or minimized . it is more advantageous to use mixtures of the various types of collagen to obtain the most desirable features of each grade . for example , a 50 / 50 mixture of semed f and semed s allows the joint to obtain the higher tensile strength values of the f grade while retaining the superior flow properties of the s grade . proportions ranging from 3 : 1 to 1 : 3 also form useful mixtures . in addition , the gelatin material described above can be used in combination with the semed f to achieve similar results . in addition , low melting polymers or polymeric materials such as copolymers of polyhydroxy buteric acid and valeric acid are useful in certain applications . plasticizers such as polysaccharides may be included to further lower the melting point of these copolymers to below 200 ° f . these polymers may also be mixed with the collagen or gelatin to increase the strength of the final weld joint . the melting table i__________________________________________________________________________type wavelength ( μ ) f energy range / photons penetration comments__________________________________________________________________________co2 10 . 6 2 . 8 × 10 . sup . 13 3 . 7 × 10 . sup . 19 microns low penetrationhelium - neon . 634 almost nil nil target laserneodymium - multipleharmonicsyag 1 . 06 2 . 8 × 10 . sup . 14 5 . 3 × 10 . sup . 18 high yttrium - aluminum garnet 0 . 532 5 . 6 × 10 . sup . 14 2 . 7 × 10 . sup . 18 welds tissue increasing at low energy penetration increasing 0 . 353 8 . 4 × 10 . sup . 14 1 . 8 × 10 . sup . 18 0 . 266 1 . 1 × 10 . sup . 15 1 . 3 × 10 . sup . 18argon 4 . 8 1 . 1 × 10 . sup . 14 3 . 8 × 10 . sup . 19 2 - 400μ water absorption 5 . 12excimer ( excitable dimer ) xe cl . 308 9 . 7 × 10 . sup . 14 1 . 6 × 10 . sup . 18 & lt ; 20μ very shortxe f . 351 8 . 6 × 10 . sup . 14 1 . 8 × 10 . sup . 16 gasifies operationalkr f . 248 1 . 3 × 10 . sup . 15 1 . 3 × 10 . sup . 18 calcified distancear f . 193 1 . 6 × 10 . sup . 15 9 . 7 × 10 . sup . 17 plaques increases__________________________________________________________________________ safety table ii__________________________________________________________________________proposed laser - fiberoptic systemswavelength pulse principal plaque ablation operatinglasernm duration fiber efficiency calcified range__________________________________________________________________________excimer248 h y ? 308 2 - 200 nsec silica h y l351 m - h y (?) largon488 , 512 40 msec - cw silica l - m n m - hdye laser450 - 800 1 - 2 μsec silica m ? mnd : yag1 , 064 10 . sup .- 9 - 10 . sup .- 12 sec none h n (?) o cw silica l n m - hha : ylf2 , 060 100 μsec silica m ? m - h (? ) er : yag2 , 940 100 μsec znf . sub . 4 h y hco . sub . 210 , 600 1 μsec halide (?) h y (?) ? 10 msec halide m - h n l cw halide l n l__________________________________________________________________________ h , indicates high ; y , yes ; l , low ; m , medium ; cw , continuous wave ; n , no ; nd , neodymium ; ha , hafnium , er , erbium . 1 , indicates extensive thermal damage ; 2 , strong water absorption ; 3 , possible mutagenicity ; 4 , nonthermal active mechanisms ; 5 , developmental fibers . temperature of these polymers should be below about 212 ° f . and on the same order as the melting temperature of the collagen ( i . e ., between about 100 °- 200 ° f .). a wide variety of energy sources may be used to provide the desired energy for effecting the weld repair . typical laser devices are listed in tables i and ii . low wattage laser energy devices , such as those utilizing argon or co 2 , would be the most useful for such welding because of their lower energy output . higher energy output devices , such as electrostatic and rf frequency coagulators ( available from everest , valleylab , or medtronics ) using bipolar tips can also be used to denature or melt the collagen filler materials . since these devices have greater power input , they can burn the collagen to a greater extent than the argon or co 2 lasers . one skilled in the art , however , is able to control and successfully utilize these higher power devices in accordance with the teachings of the present invention . an argon beam coagulator , such as those made by beacon laboratories or birtcher , are also suitable since they provide an easily controllable flame or heat source which can be utilized to melt the filler material and surrounding tissue to form the weld joint . the protocol for the process is further appreciated by reference to fig1 . an incision 10 in a blood vessel 20 is closed by first applying three approximating sutures 30a , 30b and 30 followed by heating the tissue on either side of the incision with the laser 40 . filler material ( e . g ., collagen ) is applied to the incision by placing the tip of welding rod 50 into the laser beam near the heated portion of the incision . the filler material 50 is literally melted ( i . e ., denatured ) to provide additional collagen which flows onto or over the incision , mixes with the melted or denatured tissue , and thereafter cools and fuses to the underlying tissue substrate . fig2 shows a detail of the joint as it is being made by this procedure . as noted above , the use of such additional collagen material allows the tensile strength of the joint to be significantly increased over weld joints which do not include additional collagen filler material . this difference in tensile strength is due to the fact that the collagen filler material provides an additional collagen molecular substrate specifically in the area to be joined . the present technique therefore is analogous to the tungsten inert gas (&# 34 ; tig &# 34 ;) welding of metals such as steel or aluminum . in the tig process , additional filler metal is almost always used on thin sections . since the biological tissue to be joined is often relatively thin , similar improvements are obtained when using a filler material than by attempting to make the joint without such filter material . it has been found that a co 2 or argon laser with a half to one watt power is eminently suitable for making this type of joint . as noted above electrostatic generators can also be used . in addition , an argon beam electrocoagulator operated at 15 - 50 volts and 5 - 20 watts can also be used to denature and melt the collagen welding rod materials and surrounding tissue . in an attempt to maintain the temperature of the tissue joint at a relatively low value , saline can be used . this is accomplished by dipping the collagen welding rod into saline prior to placing the saline dipped collagen welding rod adjacent to joint area or by dripping saline into the weld . in actual testing , saline cooling makes a different of approximately 23 ° c . in the joint area ( e . g ., about 47 ° c . compared to about 70 ° c . without saline cooling ). the present invention resolves many of the problems of the prior art . when welding biological tissues , it is difficult to achieve uniformly good results . this problem is due in part to the inability of the surgeon to uniformly melt the biological tissue on each side of the joint to obtain a satisfactory weld . with the use of collagen welding rod as proposed by the present invention , additional collagen material is supplied to the joint from the rod to compensate for any overmelting of tissue on either side of the joint . this also provides an abundance of additional material to seal voids or other defects caused by overheating of tissue . thus , the reproducibility of the procedure and the attainment of uniform weld joints are significantly improved by the present invention . all different types of biological tissue may be treated according to the present procedures . for example , all types of blood vessels , including veins , arteries , etc . in the vascular system can be connected or repaired , as can muscle , fascia , tendon , skin or even nerve material . another procedure in accordance with the present invention is illustrated in fig3 . in that fig ., the incision is covered with a flat strip of collagen material 60 along its entire length . the adjacent blood vessel walls 70 on each side of the incision are overlapped by this strip 60 of collagen material . the laser 80 heats the strip of material and the adjacent blood vessel walls 70 to denature those materials into a mass which then solidifies to form the laser welded joint . again , the use of the strip of collagen material 60 facilitates the welding operation and improves the resultant tensile strength of the weld joint . fig4 shows a detail of the use of the strip material to fill a tissue defect or other lesion . in an alternate embodiment of the invention , in order to insure that the placement of the welding rod remains in the appropriate position for allowing denatured collagen to flow into the joint area , it is possible to secure or attach the filler metal to the area to be joined . an easy way to accomplish this is to dip the filler material into fibrin glue prior to applying the filler material to the area to be welded . in addition to retaining the filler in the appropriate area desired , the fibrin glue or other biological tissue adhesive also appears to act as a flux which assists in directing the denatured or melted collagen material into the incision . the welding procedure is made easier by utilizing an energy absorbing aid in conjunction with the filler material . these aids assist in the absorption of energy by the filler material so that the denaturing or melting process is more efficient , i . e ., more of the energy is directly utilized to denature or melt the filler material rather than is scattered to other areas of the body near the tissue to be repaired . preferred energy absorbing aids include any of the numerous dyes , such as vital green or basic red . the color of the absorbing acid or dye should match the wavelength of the transmitted energy for optimum results . however , any substance , preferably which is in liquid form and which is capable of absorbing energy and transmitting the absorbed energy to the filler material , may be used . often , the blood or hemoglobin of the patient may be used . water or other physiologic solutions are also useful . advantageously , the energy absorbing aid is applied to the filler material to form a coating thereon . the filler material may simply be dipped into a reservoir of the energy absorbing aid . more complex arrangements , such as a spraying device or pump , can be used to apply the energy absorbing aid to the filler material , if desired . in addition , the energy absorbing aid can be applied to the tissue to be repaired . this is easily accomplished , since the tissue is often cut and is bleeding to provide a suitable source of energy absorbing aid , i . e ., blood . also , the use of a dye is advantageous since it allows the joint to be easily viewed by the surgeon to determine exactly where the welding procedure must be conducted . in yet another embodiment , the welding procedure can be performed endoscopically : i . e ., access to the area desired to be repaired or reconstructed can be made through multiple naturally or surgically created apertures : one aperture is used for insertion of the laser , another for the insertion of the filler material , and a third for monitoring the procedure with an optical fiber connected to an eye - piece or a video camera while the procedure can be visually observed through the eyepiece or camera , the presentation of the procedure on a monitor is preferred because the incision can be viewed in an enlarged mode so that the surgeon can accurately determine the proper placement of the filler material and completion of the joint . the following examples illustrate applications of the welding procedures of the present invention . a dog was anesthetized and its neck and groin area prepared for access . the carotid artery and jugular vein were exposed and clamped , and a one inch incision was made in each one . an argon laser operated at about one - half watt was used to reweld the clamped joints with one of semed s , semed f , and modified collagen material ( i . e ., gelatin ) as described above . sutures were included at each end of the incision to prevent propagation of the incision during welding . the gelatin samples welded beautifully in that they readily melted , and simply and easily filled incision and rapidly formed a solid weld joint . however , upon exposure to blood , this material was solubilized by the blood which broke through the weld due to dissolution . the semed f samples did not flow as readily into the joint , but once the joint was made , a very high tensile strength repair was obtained . the performance of the semed s was intermediate between the modified polymer and semed f both with respect to joint strength and fluidity . mixtures of either semed s or modified collagen ( gelatin ) with the semed f material , in a 50 / 50 ratio provides the benefits of each material are achieved in a single filler rod material . to aid in the absorption of energy by the filler material and the tissue to be repaired , vital green dye was applied to the tissue and filler material . the filler material was merely dipped into the dye . the dye coated filler and tissue greatly facilitated the welding operation as it was easier to apply the optical energy to the desired locations . fig5 - 11 illustrate the usefulness of the welding procedures of the present invention by showing its effects on various welded tissue joints . these were generated by operating on dogs to incise normal tissue , followed by welding to repair the incision . fig5 shows the results of a dog aorta which was welded with the mixed collagen filler material two days after welding . the nuclei and cell structure of the aorta appear normal and no karyolysis is evident . fig6 shows this filler material and the welded vena cava adjacent the aorta of fig5 two weeks after welding . the welded vena cava and collagen filler material are juxtaposed to form an intact weld joint across the incision . no evidence of thrombosis is seen at this joint or surrounding tissue . fig7 and 8 further illustrate the weld joint of fig6 . these figs . show the filler material bridging the incision . in fig7 the collagen filler material appears as a large mass at the upper left hand corner of the photograph . the incision in the vena cava is just visible at the point where the material was transsected prior to placing in fixative . the fibrillar structure of the welding material is evident . in fig8 a low concentration of welding material as a thin band bridges the incision which appears at the lower left corner of the photomicrograph . the incision is closed by this material , and the vena cava architecture is intact . fig9 illustrates welded skin tissue . the gelatin welding material bridges the incision but has relatively poor tensile strength when tested about ten minutes after making the weld joint . the weld joint was properly made and , as noted above , the strength of the welded joint can be improved by including collagen in the filler material . fig1 illustrates a welded coating of gelatin material placed under the skin . the coating is able to hold the skin together for up to about ten minutes before losing strength due to saturation and dissolution in blood . again , proper selection of a welding material which includes insoluble collagen will provide a higher strength coating . fig1 illustrates the welding of muscle tissue with a mixed collagen filler material . the incision is clearly filled and joined by the welding material to produce a strong joint . in the preceding figs ., an eximer co 2 laser was utilized as the energy source , with basic red dye or blood used as the energy absorbing aid . no difference in performance was seen using either fluid . a wide variety of devices can be used to place the welding material in the vicinity of the tissue to be repaired . for example , in addition to the above - described arrangements , a tube of collagen welding material can be placed concentrically around the laser . thus , the surgeon can urge the tube forward toward the distal end of the laser , where it can be melted by the energy . the tube can be dyed with an energy absorbing aid to assist in the melting procedure . as the end of the tube melts , the surgeon can urge further material into the path of the laser beam . to retain the area to be repaired in the proper position , a pair of grasping forceps can also be used . in addition , for the repair of a blood vessel , a catheter or stent which includes a tubular covering of filler material can be introduced into the vessel beneath the area to be repaired . thereafter , the laser welding procedure is conducted on the outside of the vessel , to melt both the vessel and the collagen material which is immediately below . again , if desired , the collagen material can be dyed to increase its absorption of energy and melting efficiency . both bi - polar and uni - polar rf electrodes were also utilized to denature or melt various samples of modified gelatin , semed f and semed s , both alone and in combination , into arteriotomies and venotomies . a vascular anastomosis was also crated using semed f in accordance with the above - described welding technique . the weld joint was observed to be of high tensile strength . also , attempts at approximating muscle , tendon and skin have been successfully completed . it is believed that numerous variations and modifications may be devised by those skilled in the art to the specifically disclosed invention , and it is intended that the appended claims cover all such modifications and embodiments as would fall within the true spirit and scope of the present invention .	0
referring to fig1 - 4 proofing tool 100 generally includes anilox support 102 , transfer support 104 , anilox roll 106 , transfer roll 108 and positive roll drive 110 . anilox support 102 and transfer support 104 are similar but not identical structures . proofing tool 100 includes a doctor blade that is not shown in fig1 - 3 for clarity . an exemplary doctor blade and pressure bar are depicted in fig4 - 7 and 9 - 10 . anilox support 102 generally includes yoke 112 and extended portion 114 . yoke 112 supports anilox roll 106 between two arms 116 . likewise , transfer support 104 includes yoke 122 and extended portion 124 . anilox roll 106 and transfer roll 108 are supported between the arms of yoke 112 and yoke 122 respectively . anilox support 102 and transfer support 104 are connected only at distal end 125 of extended portions 120 and 124 . otherwise , anilox support 102 and transfer support 104 are oriented substantially parallel with a small gap between them . transfer support 104 is capable of some flexing movement from a disengaged position to an engaged position such that transfer roll 108 is held slightly more separated from anilox roll 106 when no force is applied to transfer roll 108 than when transfer roll is in contact with a printing substrate . positive roll drive 110 generally includes anilox gear 126 and transfer gear 128 . as best seen in fig3 and 4 , anilox gear 126 and transfer gear 128 mesh together to synchronize the motion of anilox roll 106 and transfer roll 108 . in one embodiment of the invention , there is a single set of anilox gear 126 and transfer gear 128 . another embodiment of the invention includes one anilox gear 126 and two transfer gears 128 . if one anilox gears 126 and two transfer gears 128 are present , one anilox gear 126 is located on one end of anilox roll 106 and two transfer gears 128 are located on each end of transfer roll 108 respectively . proofing tool 100 also includes one or more micrometer thimbles 130 . two micrometer thimbles 130 may be used to allow independent adjustment to ensure equal nip spacing across the width of anilox roll 106 and transfer roll 108 . micrometer thimbles 130 are positioned so that the measuring surfaces of spindles ( not shown ) contact transfer support 104 to determine a minimum nip spacing between anilox roll 106 and transfer roll 108 . gear teeth 131 of transfer gear 128 extend beyond transfer roll 108 , in part , so that if the proofing tool 100 is set down on a flat surface there will be a standoff created and transfer roll 108 will not touch the surface . anilox gear 126 and transfer gear 128 may be formed with fine pitch gear teeth to prevent gear chatter . in one aspect of the invention , the gear teeth mesh such that the gears are separated by slightly more than a true pitch diameter to allow for adjustment of nip without the need to change gears . optionally , proofing tool 100 may include a separation device ( not shown ) which can be utilized to force anilox support 102 apart from transfer support 104 a slight distance to ensure separation between anilox roll 106 and transfer roll 108 when not in use . proofing tool 100 may be formed substantially from aluminum alloy or from other materials known to the art . referring to fig5 - 8 proofing tool 100 includes pressure bar 134 , doctor blade holder 136 and doctor blade 138 . pressure bar 134 is located at the end of yoke 122 . doctor blade holder 136 is pivotably secured to the arms of yoke 122 . doctor blade holder 136 secures doctor blade 138 by clamping or another technique known to the art . doctor blade holder 136 has a relief cut into it , to allow positioning of the doctor blade 138 precisely parallel to anilox roll 136 . adjusting screw 140 passes through pressure bar 134 to bear on doctor blade holder 136 . adjusting screw 140 adjust the pressure of doctor blade 138 on anilox roll 106 . doctor blade holder 136 is pivotably attached to arms 116 of yoke 118 . in one embodiment of the invention , doctor blade 138 meets anilox roller 106 at approximately a 30 degree pressure angle . if the diameter of the anilox roll 106 is changed it may be necessary to change doctor blade holder 136 or to relocate the pivotable mounting of doctor blade holder 136 . alternately , the position of anilox roll 106 may be changed , for example by the use of a bushing having an eccentrically located hole therein . still referring particularly to fig5 , ball ends 142 may be used to removably secure proofing tool 100 to an automated proofing machine ( not shown .) if ball ends 142 are utilized , proofing tool 100 includes ball sockets 144 to receive ball ends 142 therein . proofing tool 100 may also include one or more slide lockpins 146 located in an aperture in proofing tool 100 to secure proofing tool 100 to one or more ball ends 142 at ball sockets 144 . the orientation of the doctor blade 138 in the present invention is reversed from that in known conventional prior art proofing tools . orientation reversal allows the optional introduction of a felt dam 147 adjacent to the doctor blade 138 . the application of a felt dam 147 allows for the maintenance of a larger volume of ink in the well adjacent the doctor blade 138 which is useful , particularly , in long draw downs . referring to fig5 and 8 , note that extended portion 115 and extended portion 120 of anilox support 102 and transfer support 104 may be milled to thin them . the level of milling can be altered to adjust the flexibility of anilox support 102 relative to transfer support 104 allowing for adjustment of the relative flexion of anilox support 102 relative to transfer support 104 . anilox roll 106 and transfer roll 108 may be supported in anilox support 102 by precision ball bearings , sleeve bearings or bushings . anilox roll 106 or transfer roll 108 may be supported at a one end by fixed bearing 148 and at a second end by moveable bearing 150 . one or both of anilox roll 106 or transfer roll 108 may be supported at both ends by fixed bearing 148 or by moveable bearing 150 . fixed bearing 148 and moveable bearing 150 may be , for example , delrin bearings . moveable bearing 150 may be adjustable so as to be loosened to remove transfer roll 108 and tightened to secure transfer roll 108 in place for use . in another embodiment of the invention , the drive roll of a proofing machine ( not shown ) may include a drive roll gear 152 such that transfer gear 128 engages the drive roll gear 152 so that the drive roll gear drives transfer gear 128 which in turn drives anilox gear 126 providing a positive drive engagement between a drive roll ( not shown ), transfer roll 108 and anilox roll 106 . in another embodiment of the invention , proofing tool 100 may incorporate an auxiliary ink reservoir ( not shown ). auxiliary ink reservoir may include a drip line and a valve to allow the institution of a steady drip supply to replenish a well of ink at doctor blade 138 . referring to fig9 and 10 , doctor blade 138 may include trailing edge doctor blade as depicted in fig1 or leading edge doctor blade as depicted in fig9 . trailing edge doctor blade 154 tends to force ink into anilox roll 106 while leading edge doctor blade 156 tends to meter the amount of ink by shearing off excess ink from the anilox roll 106 . another embodiment of proofing tool 100 may include both a trailing edge doctor blade 154 and a leading edge doctor blade 156 acting on a single anilox roll 106 . this embodiment may be especially advantageous when proofing tool 100 is used with highly viscous inks . highly viscous inks may tend to overwhelm the force of a trailing edge doctor blade 154 toward the anilox roll 106 and “ hydroplane ” the trailing edge doctor blade . in an embodiment of the invention like that depicted in fig1 a , 1b and 2 , transfer roll 108 is replaced with cylinder 158 that is typically of larger diameter than transfer roll 108 . an engraved offset printing plate 160 is attached to the cylinder , for example , by double - sided tape also known to those skilled in the art as sticky back or sticky back tape . printing plate 160 may be formed , for example , of rubber , vinyl or metal . printing plate 160 may include , for example , a plate made from a photopolymer via a photopolymer printing process . photopolymers are used in a plate making process in which a sheet of photopolymer plastic is exposed , generally with a positive image transparency via an enlargement or contact printing process . the photopolymer is then “ developed ” with chemicals that etch the surface of the photopolymer to make it take ink in varying degrees . the resulting printing plate 160 is then fixed with other chemicals and dried to prepare if for use in the printing process . the photopolymer plate is then used in the printing process to provide images that allow for tonal gradations when printed . photopolymer plates can also be prepared using a laser process . another aspect of the present invention is that positive roll drive 110 may be used to maintain rotational integrity during proofing as in other embodiments described herein . the meshing anilox gear 126 and transfer gear 128 match the pitch velocity of anilox roll 106 with cylinder 158 bearing printing plate 160 which is also may be matched with the pitch velocity of a drum ( not shown ) that transports the substrate . cylinder 158 bearing the engraved printing plate 160 will typically be of larger diameter than transfer roll 108 described in some embodiments . for example , cylinder 158 may have a diameter of approximately 2 inches . in order to accommodate the larger diameter of cylinder 158 bearing engraved printing plate 160 , spacer 162 may be used as depicted in fig1 a , 1b and 2 , to space anilox support 102 and transfer support 104 apart from one another . other size cylinders may of course be used . the larger diameter of the cylinder 158 bearing the engraved printing plate 160 provides more surface area for producing larger useable images . printing plate 160 may have similar engraved characteristics as an engraved offset plate that will be run on a printing press . alternately , a standard printing plate 160 may be used that includes , for example , dot patterns ranging from five to one hundred percent density as well as solid patterns . an example printing plate 160 pattern is depicted in fig1 . in another aspect of the invention , depicted in fig1 , positive stop 164 mounted on a proofing machine ( schematically depicted in part ) may be added . positive stop 164 provides a mechanism to adjust nip or printing pressure between cylinder 158 bearing the printing plate 160 and a substrate to which printing plate 160 will be applied . when proofing tool 100 is lowered during proofing , substrate micrometer 166 engages to positive stop 164 to mechanically position proofing tool 100 . micrometers 166 may be incorporated into the structure of proofing tool 100 or the proofing machine to allow precise repeatable measurement of nip between cylinder 158 supporting printing plate 160 and drive roll 168 of the proofing machine ( not shown ). substrate micrometers 166 may be adjusted . adjustment of micrometers 166 upward will lower printing pressure by widening the nip . adjusting micrometers 166 lower , will increase the nip pressure by narrowing the nip distance . positive stop 164 is beneficial to control nip as the surface area of printing plate 160 changes . without controlling the nip , the control of pressure only may cause the cylinder 158 bearing the printing plate 160 to “ hump ” with variations in the thickness of printing plate 160 . printing plate 160 tends to drop into low spots in the engraving where there is a reduced image offset area and create an abrupt thump when a higher portion of the offset image is encountered . an example embodiment of a drive roll 168 according to one example embodiment is shown in fig2 . the drive roll includes a polished metallic center segment surface 169 disposed between and resilient band surface segments 171 adjacent each end of the metallic center portion 169 . the resilient bands may be formed of rubber , urethane or other similar material . materials having a forty to sixty durometer measurement may be used according to one example embodiment . a semi - positive drive is formed by the contact of the resilient band segments 171 of the drive roll 168 with the teeth of the impression roll 108 or the cylinder 158 having the plate 160 secured thereto , such as is shown in fig1 . thus , there will be little or no slippage between the impression roller and the drive roller 168 . this configuration allows for the use of lighter nip pressure on the plate compared to configurations where the plate must provide the traction against the drive roll in order to operate the proofing apparatus . the present invention also includes a method of predicting the performance of a printing press for a printing job . the method includes preparing a first printing plate 160 then securing the printing plate 160 to a proofing tool 100 . the proofing tool 100 is then adjusted to optimize ink transfer from anilox roll 106 to printing plate 160 and further adjusted to optimize ink transfer from printing plate 160 to a substrate . optimization of ink transfer generally is achieved by adjusting the nip until minimum ink transfer without skipping of the image occurs across the width of the printed image . once ink transfer is optimized an operator prepares a printing proof on a substrate and then evaluates the printing proof to predict the performance of a second printing plate 160 which is adapted for use on the printing press . this evaluation allows prediction of the performance of the second printing plate 160 on the printing press . when the operator is evaluating printing performance the operator may measure dot gain and / or color density as well as other factors related to the printing proof . instruments for making these measurements are known . in some embodiments of the invention , the first printing plate 160 and second printing plate 160 are prepared as a single printing plate having a first portion and a second portion that are then separated to create the first printing plate 160 and the second printing plate 160 . optionally the printing plates may be prepared separately but simultaneously or prepared to similar or identical standards to allow prediction of the performance of the printing plate 160 on the printing press . the proofs prepared with the first printing plate 160 on proofing tool 100 may also be evaluated for the performance of sticky back adhesive which is applied between the printing plate 160 and cylinder 158 of proofing tool 100 . a skilled operator can observe the results on the proof and determine whether the sticky back adhesive is too thick , too thin , too hard or too soft , too stiff or too flexible . referring to fig1 , the method may also include designing the first printing plate 160 to include a first portion that has dot images including a range that may extend from 0 to 100 % dot density . the method may include designing the printing plate 160 as depicted in an example pattern in fig1 to include some smaller portion of the range form 0 to 100 % dot density . the invention further includes designing printing plate 160 to include a portion for testing print density . determining print density is a way of measuring the thickness of an ink layer laid down on substrate by printing plate 160 . based on the evaluation of the sample proof prepared with printing plate 160 it may be desired to adjust the characteristics of printing plate 160 . an additional adjusted printing plate 160 may be prepared in which the adjusted printing plate 160 is adjusted relative to the first printing plate to alter dot density or print density or other characteristics . for example , the adjusted printing plate 160 may be adjusted to compensate for an undesirable dot gain by increasing or decreasing the dot density on the plate . the present invention also includes a method of supplying a kit for predicting the performance of a printing press for a printing job . the method includes supplying or providing a proofing device including a proofing tool 100 to which a first printing plate 160 is securable and providing instructions to perform the method as outlined above . referring to fig1 and 12 , an embodiment of the invention also includes a method of preparing a printing press for a press run including creating a printing plate 160 having a printing press portion 170 that is dimensioned to be secured to a printing press and a proofing portion 172 that is dimensioned to be secured to a proofing tool . the method may also include separating the printing press portion 170 from the proofing portion 172 and applying the proofing portion 172 to the proofing tool . an operator then prepares a proof with the proofing tool and the proofing portion 172 and then uses the proof to calibrate the printing press or the ink to be used with the printing press to predict the performance of the printing press with the portion of the plate that is intended for the printing press . some embodiments the present invention also include modifying the thickness and / or hardness of printing plate 160 as well as the thickness and / or hardness and / or flexibility of the sticky back mounting adhesive used to mount the printing plate 160 . in another embodiment of the invention the method is used to test the ink and compatibility of the ink with a particular photo polymer printing plate 160 and substrate . in another embodiment of the invention the invention may be utilized to validate the ink photopolymer and sticky back combination for use on the printing plate to run a printing job which has previously been run . the present invention may also include a printing plate 160 for printing that includes a printing press portion 170 that is dimensioned to be secure to a printing press as well as a proofing portion 172 that is dimensioned to be secure to a proofing tool 100 . the printing press portion 170 and the proofing portion 172 are separable so that the printing press portion 170 can be secured to the printing press and the proofing portion 172 can be secured to the proofing tool 100 . in another embodiment the invention includes a proofing tool 100 including an anilox roll 106 and cylinder 158 as well as a proofing printing plate 160 that is secured to cylinder 158 and which includes a portion of a printing plate 160 that includes a printing press portion 170 and a proofing portion 172 wherein the printing press portion 170 will be used to print materials that have been proofed with the proofing printing plate . fig1 - 17 depict another example embodiment in accordance with the invention . referring to fig1 - 16 proofing tool 200 generally includes anilox support 202 , transfer support 204 , anilox roll 206 , transfer roll 208 , positive roll drive ( not shown ), photopolymer plate 210 , metering roll 201 , and doctor blade 205 . anilox support 202 and transfer support 204 are similar but not identical structures . anilox support 202 generally includes yoke 212 and extended portion 214 . yoke 212 supports anilox roll 206 between two arms 216 . likewise , transfer support 204 includes yoke 222 and extended portion 224 . anilox roll 206 and transfer roll 208 are supported between the arms of yoke 212 and yoke 222 respectively . in this example embodiment , anilox support 202 and transfer support 204 are connected only at distal end 225 of extended portions 220 and 224 . otherwise , anilox support 202 and transfer support 204 are oriented substantially parallel with spacer 162 and a small gap between them . in other embodiments , anilox support 202 and transfer support 204 are connected at a location closer to anilox roll 206 and transfer roll 208 . transfer support 204 is capable of some flexing movement from a disengaged position to an engaged position such that transfer roll 208 is held , for example slightly more separated from anilox roll 206 when no force is applied to transfer roll 208 than when transfer roll is in contact with a printing substrate . transfer support 204 can also hold transfer roll 208 in contact with anilox roll 206 . positive roll drive 210 generally includes anilox gear 226 and transfer gear 228 . anilox gear 226 and transfer gear 228 mesh together to synchronize the motion of anilox roll 206 and transfer roll 208 . in an example embodiment of the invention , there is a single set of anilox gear 226 and transfer gear 228 . another example embodiment of the invention includes one anilox gear 226 and two transfer gears 228 . if one anilox gear 226 and two transfer gears 228 are present , one anilox gear 226 is located on one end of anilox roll 206 and two transfer gears 228 are located on each end of transfer roll 208 respectively . in another example embodiment , proofing tool 200 may utilize a semi positive drive in which anilox gear 226 engages a resilient surface of transfer roll 208 in a substantially non slip relationship . metering roll 201 is positioned adjacent anilox roll 206 and can be forced against anilox roll 206 under spring tension for example by threaded arrangement 203 . threaded arrangement 203 may be tightened or loosened as desired to control the force with which metering roll 201 contacts anilox roll 206 to adjust metering pressure . metering roll 201 can rotate against and in contact with anilox roll 206 , which forces ink into anilox roll 206 cells . a generally wedge shaped space between the metering roll 201 and anilox roll 206 forms a reservoir with adequate volume to contain sufficient ink for proofing an ink sample . metering roll 201 , in an example embodiment , has a resilient surface such as rubber or another polymer . metering roll 201 is located above anilox roll 206 in contrast to the prior art . proofing tool 200 also includes doctor blade 205 . in an example embodiment , doctor blade 205 is designed to have a leading edge that shears the excess ink from the anilox roll 206 . that is , doctor blade 205 is a leading edge doctor blade . fig1 illustrates the interaction between the anilox roll 206 and the leading edge doctor blade 205 , whereby the anilox roll 206 turns counterclockwise and the doctor blade 205 is positioned with its distal end against the surface of the anilox roll 206 to enable ink shearing . in some example embodiments , doctor blade 205 may also utilize a trailing edge configuration . proofing tool 200 also includes one or more micrometer thimbles 230 . two micrometer thimbles 230 may be used to allow independent adjustment to achieve equal nip spacing across the width of anilox roll 206 and transfer roll 208 . in an example embodiment , micrometer thimbles 230 are positioned so that the measuring surfaces of spindles ( not shown ) contact transfer support 204 to determine a minimum nip spacing between anilox roll 206 and transfer roll 208 . in an example embodiment , gear teeth 131 of transfer gear 228 , as previously described , extend beyond transfer roll 208 , in part , so that if the proofing tool 200 is set down on a flat surface there will be a standoff created and transfer roll 208 will not touch the surface . anilox gear 226 and transfer gear 228 may be formed with fine pitch gear teeth to prevent gear chatter . in one aspect of the invention , gear teeth 131 mesh such that anilox gear 226 and transfer gear 228 are separated by slightly more than a true pitch diameter to allow for adjustment of nip without the need to change gears . optionally , proofing tool 200 may include a separation device ( not shown ) which can be utilized to force anilox support 202 apart from transfer support 204 a slight distance to ensure separation between anilox roll 206 and transfer roll 208 when not in use . proofing tool 200 may be formed substantially from aluminum alloy or from other materials known to the art . in operation , referring to fig1 through 10 , proofing tool 100 is used to prepare ink proofs for flexographic printing processes . an operator sets a nip distance between anilox roll 106 and transfer roll 108 by adjusting micrometer thimbles 130 . after micrometer thimbles 130 are adjusted to a desired nip distance ink is applied between doctor blade 138 and anilox roll 106 . if present , felt dam 147 is saturated with ink . if a proof is to be hand pulled , an operator grasps proofing tool 100 by extended portion 114 and extended portion 120 and orients proofing tool 100 so that anilox roll 106 is substantially vertically above transfer roll 108 . transfer roll 108 is then brought into contact with a substrate and proofing tool 100 is drawn along the substrate . ink is then transferred from anilox roll 106 to transfer roll 108 with the amount of ink being transferred being controlled by doctor blade 138 and the qualities of anilox roll 106 . ink from transfer roll 108 is transferred to the substrate creating an ink proof . if proofing tool 100 is used with an ink proofing machine ( not shown ) proofing tool 100 is prepared for proofing in a process similar to that described above . proofing tool 100 is then attached to proofing machine ( not shown ) by connecting ball sockets 144 to ball ends 142 . a substrate is inserted between transfer roll 108 or proofing tool 100 and a drive roll ( not shown ) of ink proofing machine ( not shown ). if positive roll drive 110 is present , in one embodiment , transfer gear 128 may be engaged to a drive roll gear 152 so that as drive roll 168 rotates the drive roll gear 152 it meshes with transfer gear 128 and rotates transfer roll 106 . transfer gear 128 engages with anilox gear 126 and rotates anilox roll 106 , thus preventing slippage between the drive roll ( not shown ), transfer roll 108 , and anilox roll 106 . when proofing tool 100 is released from contact with the substrate , anilox roll 106 and transfer roll 108 may be separated by the resiliency of extended portion 120 and extended portion 124 . in operation , referring to fig1 - 17 , proofing tool 200 is used to prepare ink proofs for flexographic printing processes . an operator sets a nip distance between anilox roll 206 and transfer roll 208 covered by photopolymer plate 210 by adjusting micrometer thimbles 230 . an operator also sets metering tension by adjusting threaded arrangement 203 , which increases or reduces force , as desired , against metering roll 201 . after micrometer thimbles 230 and threaded arrangement 203 are adjusted , ink is applied at the juncture between metering roll 201 and anilox roll 206 . if a proof is to be hand pulled , an operator grasps proofing tool 200 by extended portion 214 and extended portion 220 and orients proofing tool 200 so that anilox roll 206 is substantially vertically above transfer roll 208 and metering roll 201 is above anilox roll 206 . transfer roll 208 is then brought into contact with a substrate and proofing tool 200 is drawn along the substrate . ink is pressed into cells of anilox roll 206 by metering roll 201 . ink is then transferred from anilox roll 206 to transfer roll 208 with the amount of ink being transferred being controlled by doctor blade 205 which shears off excess ink from anilox roll 206 and the qualities of anilox roll 206 . ink from transfer roll 208 is transferred from photopolymer plate 210 to the substrate creating an ink proof . this operation is substantially different than that of a press . in proofing tool 200 , metering roll 201 is gravitationally above anilox roll 206 and ink is held in the nip between metering roll 201 and anilox roll 206 by the inherent viscosity and surface tension of the ink . in a press , the metering roll is gravitationally below the anilox roll , where the metering roll rotates in an ink bath and lifts ink upward to the anilox roll . it follows then , that doctor blade 205 in proofing tool 200 is functionally different as well . in proofing tool 200 , leading edge doctor blade 205 shears excess ink away from anilox roll 206 at a location above the center of rotation of anilox roll 206 . trailing edge doctor blades 154 act to both force ink into the anilox roll cells , and to remove excess ink . because of its trailing edge positioning and dual role , over time , ink particulates can build up on the back of trailing edge doctor blade 154 . this results in a less efficient metering of ink and less accurate prediction of ink and plate performance on the press . it has been observed that when a sufficient quantity of ink particulate accumulate behind trailing edge doctor blade 154 the force with which trailing edge doctor blade 154 is against anilox roll 206 is overcome and an undesired excess quantity of ink is released . the excess quantity of ink is transferred to transfer roll 108 or photopolymer plate 210 and an area of increased color density is created on the substrate . fig1 illustrates the results of an experiment that tested several kinds of proofers , including those with both trailing and leading edge doctor blades , and measured the density of ink left on a substrate measured at twenty locations . the line depicted with a diamonds , labeled “ vignette without ir ,” is a proofer with a leading edge doctor blade and no metering or ink roll . the line depicted with a squares , labeled “ vignette with ir ,” is the proofer identified herein as proofer 200 ; a proofer with a leading edge doctor blade and an ink roll as described herein . the line depicted with a triangle , labeled “ dr - 100 ,” is a conventional proofing tool implementing a trailing edge doctor blade . even a casual glance at the chart evidences the fact that the leading edge doctor blade with ink roll , the embodiment described in proofer 200 , has fewer and less extreme peaks and valleys than either of the other proofers , thus demonstrating its improved consistency . fig1 is a table of the density measurements and standard deviation calculations for the three proofers described above , as well as the printing press “ dot pattern mark andy press ,” an industry standard flexographic printing press . specifically , the table shows the inputs into the standard deviation calculation ; the twenty inking measurements tested and graphed in fig1 . in this case , standard deviation of ink density can be thought of as a reflection of inking consistency or ink density over the length of a proof drawdown on a substrate . the chart shows that an embodiment of proofer 200 , with a standard deviation of 0 . 013168943 , is not only more consistent than conventional proofers ( 0 . 016026294 and 0 . 023502519 standard deviations , respectively ), but also more consistent than an industry standard printing press ( 0 . 015652476 standard deviation ). the present invention may be embodied in other specific forms without departing from the spirit of any of the essential attributes thereof ; therefore , the illustrated embodiments should be considered in all respects as illustrative and not restrictive , reference being made to the appended claims rather than to the foregoing description to indicate the scope of the invention .	1
the description of the invention herein should be construed in congruity with the laws and principals of chemical bonding . for example , when a moiety is optionally substituted and said substitution requires the removal of a hydrogen atom from the moiety to be substituted , the description of the moiety should be read to include the moiety with or without said hydrogen atom . as another example , if a variable is defined as a particular moiety or atom and is further defined to have value of 0 or some integer , the bond ( s ) attaching said moiety should be suitably removed in the event the variable equals 0 . an embodiment or aspect which depends from another embodiment or aspect , will describe only the variables having values and provisos that differ from the embodiment or aspect from which it depends . it is to be understood that the present invention may include any and all possible stereoisomers , geometric isomers , diastereoisomers , enantiomers , anomers and optical isomers , unless a particular description specifies otherwise . as used herein , “ halo ” or “ halogen ” includes fluoro , chloro , bromo and iodo . as used herein , “ alkyl ” or “ alkylene ” includes straight or branched chain configurations . the compounds of this invention can exist in the form of pharmaceutically acceptable salts . such salts include addition salts with inorganic acids such as , for example , hydrochloric acid and sulfuric acid , and with organic acids such as , for example , acetic acid , citric acid , methanesulfonic acid , toluenesulfonic acid , tartaric acid and maleic acid . further , in case the compounds of this invention contain an acidic group , the acidic group can exist in the form of alkali metal salts such as , for example , a potassium salt and a sodium salt ; alkaline earth metal salts such as , for example , a magnesium salt and a calcium salt ; and salts with organic bases such as a triethylammonium salt and an arginine salt . the compounds of the present invention may be hydrated or non - hydrated . the compounds of this invention can be administered in such oral dosage forms as tablets , capsules ( each of which includes sustained release or timed release formulations ), pills , powders , granules , elixirs , tinctures , suspensions , syrups and emulsions . the compounds of this invention may also be administered intravenously , intraperitoneally , subcutaneously , or intramuscularly , all using dosage forms well known to those skilled in the pharmaceutical arts . the compounds can be administered alone , but generally will be administered with a pharmaceutical carrier selected upon the basis of the chosen route of administration and standard pharmaceutical practice . compounds of this invention can also be administered in intranasal form by topical use of suitable intranasal vehicles , or by transdermal routes , using transdermal skin patches . when compounds of this invention are administered transdermally the dosage will be continuous throughout the dosage regimen . the dosage and dosage regimen and scheduling of a compounds of the present invention must in each case be carefully adjusted , utilizing sound professional judgment and considering the age , weight and condition of the recipient , the route of administration and the nature and extent of the disease condition . in accordance with good clinical practice , it is preferred to administer the instant compounds at a concentration level which will produce effective beneficial effects without causing any harmful or untoward side effects . compounds of the present invention may be synthesized according to the description provided below . variables provided in the schema below are defined in accordance with the description of compounds of formula ( i ) unless otherwise specified . the following intermediates 1 - 13 may be used to synthesize examples 1 - 51 . 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole : ( scheme 1 , ( a )) to a solution of benzil ( 3 . 0 g , 14 mmol ) in glacial acetic acid ( 100 ml ) was added ammonium acetate ( 22 . 2 g , 284 mmol ) followed with acetaldehyde ( 1 . 26 g , 28 mmol ). the resultant suspension was stirred at 100 ° c . for 2 . 5 hours . after removal of most of solvent , the residue was dissolved in etoac . the precipitate ammonium acetate was filtered off . the filtrate was washed with 2n naoh , h 2 o , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : etoac / hexanes ). this compound was obtained as a white solid ( 0 . 96 g , 4 . 1 mmol , 29 % yield ): mp 232 - 235 ° c . ; ms m / e 235 . 0 ( mh + ); 1 h nmr ( dmso - d 6 ) δ7 . 27 ( br m , 10h ), 2 . 33 ( s , 3h ); 13 c nmr ( dmso - d 6 ) δ144 . 3 , 128 . 7 , 128 . 3 , 127 . 8 , 127 . 3 , 126 . 3 , and 14 . 0 . anal . calcd for c 16 h 14 n 2 . 0 . 12 h 2 o : c , 81 . 26 ; h , 6 . 07 ; n , 11 . 85 . found : c , 81 . 20 ; h , 6 . 03 ; n , 11 . 89 . 2 - ethyl - 4 , 5 - diphenyl - 1h - imidazole : ( scheme 1 , ( a )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 30 ( t , 3h ), 2 . 72 ( q , 2h ), 7 . 44 ( b , 10h ), 12 . 02 ( b , 1h ); mass spec : 249 . 26 ( mh + ). 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - 1h - imidazole : ( scheme 1 , ( a )) prepared as described for the example above . 1 h nmr ( dmso ): δ2 . 32 ( s , 3h ), 7 . 13 ( t , 2h ), 7 . 27 ( t , 2h ), 7 . 47 ( m , 4h ), 12 . 15 ( b , 1h ). 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester : ( scheme 1 , ( b )) to a solution of 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole ( 0 . 20 g , 0 . 85 mmol ) in dmf ( 6 ml ) was added nah ( 60 % in mineral oil , 0 . 038 g , 0 . 94 mmol ). the resulting mixture was stirred at rt for 10 min . the stirring continued for 2 hours after addition of ethyl 7 - bromoheptanoate ( 0 . 21 g , 0 . 90 mmol ). the reaction mixture was diluted with diethyl ether ( 30 ml ), washed by water , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : etoac / hexanes ). this compound was obtained as a colorless oil ( 0 . 24 g , 0 . 61 mmol , 72 % yield ): 1 h nmr ( dmso - d 6 ) δ1 . 08 ( m , 4h ), 1 . 15 ( t , j = 7 . 2 hz , 3h ), 1 . 33 ( m , 4h ), 2 . 16 ( t , j = 6 . 6 hz , 2h ), 2 . 40 ( s , 3h ), 3 . 68 ( t , j = 7 . 8 hz , 2h ), 4 . 03 ( q , j = 4 . 5 hz , 2h ), 7 . 05 ) m , 1h ), 7 . 13 ( m , 2h ), 7 . 34 ( m , 4h ), 7 . 48 ( m , 3h ); 13 c nmr ( dmso - d 6 ) δ13 . 4 , 14 . 4 , 24 . 3 , 25 . 7 , 27 . 8 , 29 . 6 , 33 . 5 , 43 . 3 , 59 . 9 , 125 . 8 , 126 . 0 , 128 . 1 , 128 . 3 , 128 . 8 , 129 . 3 , 131 . 1 , 131 . 8 , 135 . 2 , 135 . 3 , and 144 . 0 . anal . calcd for c 25 h 30 n 2 o 2 : c , 76 . 89 ; h , 7 . 74 ; n , 7 . 17 . found : c , 76 . 33 ; h , 7 . 67 , n , 6 . 85 . 8 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- octanoic acid ethyl ester : ( scheme 1 , ( b )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 06 ( b , 6h ), 1 . 20 ( t , 3h ), 1 . 42 ( m , 4h ), 2 . 22 ( t , 2h ), 2 . 49 ( s , 3h ), 3 . 70 ( t , 2h ), 4 . 06 ( q , 2h ), 7 . 16 ( m , 3h ), 7 . 35 ( m , 4h ), 7 . 51 ( m , 3h ). mass spec : 405 . 32 ( mh + ). 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexanoic acid ethyl ester : ( scheme 1 , ( b )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 13 ( m , 2h ), 1 . 17 ( t , 3h ), 1 . 43 ( m , 4h ), 2 . 15 ( t , 2h ), 2 . 40 ( s , 3h ), 3 . 70 ( t , 2h ), 4 . 04 ( q , 2h ), 7 . 13 ( m , 3h ), 7 . 47 ( m , 4h ), 7 . 54 ( m , 3h ). mass spec : 377 . 26 ( mh + ). 8 -( 2 - ethyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester : ( scheme 1 , ( b )) prepared as described for the example above . 1 h nmr ( dmso - d 6 ) δ1 . 08 ( m , 4h ), 1 . 15 ( t , j = 7 . 2 hz , 3h ), 1 . 33 ( m , 7h ), 2 . 16 ( t , j = 6 . 6 hz , 2h ), 2 . 71 ( q , j = 7 . 5 hz ), 3 . 68 ( t , j = 7 . 8 hz , 2h ), 4 . 03 ( q , j = 4 . 5 hz , 2h ), 7 . 05 ( m , 1h ), 7 . 13 ( m , 2h ), 7 . 34 ( m , 4h ), 7 . 48 ( m , 3h ). anal . calcd for c 26 h 32 n 2 o 2 : c , 77 . 19 ; h , 7 . 97 ; n , 6 . 92 . found : c , 77 . 06 ; h , 8 . 13 ; n , 6 . 89 . mass spec : 405 . 2 ( mh + ). 7 -[ 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - imidazol - 1 - yl ]- heptanoic acid ethyl ester : ( scheme 1 , ( b )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 09 ( m , 4h ), 1 . 17 ( t , 3h ), 1 . 38 ( m , 4h ), 2 . 19 ( t , 2h ), 2 . 39 ( s , 3h ), 3 . 6 ( t , 2h ), 4 . 05 ( q , 2h ), 7 . 03 ( t , 2h ), 7 . 36 ( m , 4h ), 7 . 41 ( m , 2h ). mass spec : 427 . 49 ( mh + ). 7 -[ 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - imidazol - 1 - yl ]- heptanoic acid : ( scheme 1 , ( c )) to a solution of 7 -[ 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - imidazol - 1 - yl ]- heptanoic acid ethyl ester ( 1 . 9 g , 4 . 4 mmol ) in etoh ( 10 ml ) was added naoh ( 10 n , 2 ml , 20 mmol ). the resulting mixture was stirred at rt for 1 hour , diluted with etoac ( 100 ml ), washed by hcl ( 0 . 5 n ), and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : meoh / ch 2 cl 2 ). this compound was obtained as a white solid in hcl salt form ( 1 . 9 g , 4 . 3 mmol , 98 % yield ): 1 h nmr ( dmso ): δ1 . 15 ( m , 4h ), 1 . 37 ( t , 2h ), 1 . 47 ( t , 2h ), 2 . 13 ( t , 2h ), 2 . 73 ( s , 3h ), 4 . 03 ( t , 2h ), 7 . 35 ( t , 2h ), 7 . 45 ( m , 4h ), 7 . 57 ( m , 2h ), 12 . 1 ( b , 1h ). 8 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid : ( scheme 1 , ( c )) prepared as described for the example above . 1 h nmr ( dmso - d 6 ) δ11 . 95 ( br s , 1h ), 7 . 56 ( m , 3h ), 7 . 46 ( m , 2h ), 7 . 38 ( m , 2h ), 7 . 28 ( m , 3h ), 3 . 83 ( t , 2h , j = 7 . 5 hz ), 2 . 67 ( s , 3h ), 2 . 09 ( t , 2h , j = 7 . 5 hz ), 1 . 38 ( m , 2h ), 1 . 25 ( m , 2h ), and 1 . 09 ( m , 4h ), 13 c nmr ( dmso - d 6 ) δ174 . 5 , 144 . 4 , 131 . 3 , 130 . 1 , 129 . 6 , 128 . 9 , 128 . 8 , 128 . 4 , 128 . 1 , 126 . 8 , 44 . 3 , 33 . 8 , 29 . 4 , 28 . 9 , 25 . 6 , 22 . 3 and 11 . 7 . anal . calcd for c 23 h 26 n 2 o 2 . 0 . 95 hcl . 0 . 32 c 6 h 14 : c , 70 . 48 ; h , 7 . 46 ; n , 6 . 60 . found : c , 70 . 82 ; 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexanoic acid : ( scheme 1 , ( c )) prepared as described for the example above . 1 h nmr dmso ): δ1 . 17 ( m , 2h ), 1 . 33 ( m , 2h ), 1 . 51 ( m , 2h ), 2 . 09 ( t , 2h ), 2 . 76 ( s , 3h ), 4 . 03 ( t , 2h ), 7 . 38 ( m , 5h ), 7 . 49 ( m , 2h ), 7 . 65 ( m , 3h ). 8 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- octanoic acid : ( scheme 1 , ( c )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 07 ( b , 6h ), 1 . 39 ( m , 2h ), 1 . 48 ( m , 2h ), 2 . 15 ( t , 2h ), 2 . 72 ( s , 3h ), 3 . 92 ( t , 2h ), 7 . 35 ( s , 5h ), 7 . 52 ( m , 2h ), 7 . 606 ( m , 3h ), 12 . 1 ( b , 1h ). anal . calcd . for c 24 h 28 n 2 o 2 . 0 . 982hcl . 0 . 59h2o : c , 68 . 16 ; h , 7 . 19 ; n , 6 . 62 . found : c , 68 . 00 ; h , 7 . 09 ; n , 6 . 81 . 8 -( 2 - ethyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid : ( scheme 1 , ( c )) prepared as described for the example above . 1 h nmr ( dmso - d 6 ) δ11 . 95 ( br s , 1h ), 7 . 56 ( m , 3h ), 7 . 46 ( m , 2h ), 7 . 38 ( m , 2h ), 7 . 28 ( m , 3h ), 3 . 83 ( t , 2h , j = 7 . 5 hz ), 3 . 13 ( q , j = 7 . 8 hz , 2h ), 2 . 09 ( t , 2h , j = 7 . 5 hz ), 1 . 38 ( m , 5h ), 1 . 25 ( m , 2h ), and 1 . 09 ( m , 4h ). anal . calcd for c 24 h 28 n 2 o 2 . 1 . 00hcl . 0 . 44 c 6 h 14 : c , 68 . 44 ; h , 7 . 15 ; n , 6 . 65 . found : c , 68 . 43 ; h , 6 . 98 ; n , 6 . 53 . [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 1 ( d )) to a suspension of 8 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ( 11 . 3 g , 28 . 3 mmol ) in a mixture of et 3 n ( 10 g , 99 mmol ) and toluene ( 200 ml ) was added azide ( 11 . 0 g , 39 . 7 mmol ). the resultant mixture was stirred at r . t . for 10 min . and then at 108 ° c . under n 2 for 90 min . after the mixture was cooled to r . t ., 2 - fluorophenol ( 3 . 8 g , 37 mmol ) was added . the reaction mixture was stirred at r . t . for 10 min and then at 80 ° c . for 1 h . the mixture was diluted with etoac , washed with h 2 o , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : etoac / hexanes ). this compound was obtained as a white solid ( 7 . 3 g , 15 . 5 mmol , 55 % yield ): mp 129 - 131 ° c . ; 1 h nmr ( dmso - d 6 ) δ7 . 85 ( br s , 1h ), 7 . 50 ( m , 3h ), 7 . 33 ( m , 5h ), 7 . 30 - 7 . 05 ( m , 6h ), 3 . 69 ( t , 2h , j = 4 . 8 hz ), 2 . 95 ( dd , 2h , j = 4 . 8 , 3 . 6 hz ), 2 . 4 ( s , 3h ), 1 . 4 ( m , 2h ), 1 . 3 ( m , 2h ), 1 . 09 ( m , 4h ). anal . calcd for c 29 h 30 fn 3 o 2 : c , 73 . 86 ; h , 6 . 41 ; n , 8 . 91 . found : c , 73 . 63 ; h , 6 . 45 ; n , 8 . 81 . mass spec : 472 . 2 ( mh + ). [ 6 -( 2 - ethyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid tert - butyl ester ( scheme 1 , ( d )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 04 ( m , 4h ), 1 . 28 ( m , 7h ), 1 . 35 ( s , 9h ), 2 . 79 ( m , 4h ), 3 . 68 ( t , 2h ), 7 . 08 ( t , 1h ), 7 . 16 ( t , 2h ), 7 . 36 ( m , 4h ), 7 . 51 ( m , 3h ). anal . calcd . for c28h37n3o2 . 0 . 196 ch2cl2 . 0 . 4 c6h14 : c , 73 . 68 ; h , 8 . 69 ; n , 8 . 43 . found : c , 73 . 81 ; h , 8 . 38 ; n , 8 . 19 . mass spec : 448 . 2 ( mh + ). 6 -( 2 - ethyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid sec - butyl ester : ( scheme 1 , ( d )) prepared as described for the example above . 1 h nmr ( dmso ): δ0 . 84 ( t , 3h ), 1 . 03 ( bs , 4h ), 1 . 11 ( d , j = 6 . 27 hz , 3h ), 1 . 36 ( t , 2h ), 1 . 48 ( m , 7h ), 2 . 76 ( q , 2h ), 2 . 84 ( q , 2h ), 3 . 71 ( t , 2h ), 4 . 55 ( m , 1h ), 6 . 8 ( t , 1h ), 7 . 05 ( m , 1h ), 7 . 16 ( t , 2h ), 7 . 36 ( m , 4h ), 7 . 50 ( m , 3h ). anal . calcd . for c 2 8h 37 n 3 o 2 . 0 . 17 ch 2 cl 2 . 0 . 245 c 6 h 14 : c , 73 . 66 ; h , 8 . 50 ; n , 8 . 70 . found : c , 73 . 73 ; h , 8 . 19 ; n , 8 . 69 . mass spec : 448 . 2 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 4 - chloro - butyl ester : ( scheme 1 , ( d )) prepared as described for the example above . analytical hplc 1 . 46 min ( 89 %). mass spec : 454 . 3 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid benzyl ester : ( scheme 1 ( d )) prepared as described for the example above . this compound was purified by preparative hplc ( ymc 30 × 100 mm ( 5 um packing ), 10 % meoh / 90 % water / 01 % tfa as mobile phase a , 90 % meoh / 10 % water / 0 . 1 % tfa as mobile phase b ). 1 h nmr ( dmso ): δ1 . 067 ( bs , 4h ), 1 . 26 ( t , 2h ), 1 . 47 ( t , 2h ), 2 . 73 ( s , 3h ), 2 . 91 ( q , 2h ), 3 . 94 ( t , 2h ), 5 . 01 ( s , 2h ), 7 . 20 ( m , 3h ), 7 . 35 ( m , 8h ), 7 . 49 ( m , 2h ), 7 . 59 ( d , j = 6 . 69 mhz , 3h ). mass spec : 468 . 17 ( mh + ). 2 - propanone , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 11 ( m , 4h ), 1 . 30 ( m , 2h ), 1 . 50 ( m , 2h ), 1 . 92 ( d , j = 9 . 25 mhz , 6h ), 2 . 74 ( s , 3h ), 2 . 96 ( m , 2h ), 3 . 94 ( t , 2h ), 7 . 29 ( t , 1h ), 7 . 39 ( m , 2h ), 7 . 41 ( m , 3h ), 7 . 49 ( m , 2h ), 7 . 61 ( m , 2h ). mass spec : 433 . 31 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid cyclohexyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 64 min ( 85 %). mass spec : 460 . 21 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid methyl ester : prepared as described for the example above . analytical hplc 1 . 33 min ( 80 %). mass spec : 392 . 12 ( mh + ). 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 50 min ( 83 %). mass spec : 454 . 15 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 4 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 52 min ( 97 %). mass spec : 472 . 09 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 , 4 - difluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 54 min ( 96 %). mass spec . 490 . 06 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 4 - chloro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 61 min ( 95 %). mass spec : 488 . 02 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 4 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 51 min ( 96 %). mass spec : 484 . 11 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid o - tolyl ester : ( scheme 1 ( d )) prepared as described for the example above . h analytical hplc 1 . 54 min ( 92 %). mass spec : 468 . 11 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 4 - cyano - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 46 min ( 94 %). mass spec : 479 . 08 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 , 6 - dimethoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 43 min ( 94 %). mass spec : 514 . 10 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 48 min ( 99 %). mass spec : 484 . 12 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid methyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 41 min ( 98 %). mass spec : 406 . 32 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid ethyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 49 min ( 95 %). mass spec : 420 . 35 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 58 min ( 99 %). mass spec : 468 . 32 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 4 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 60 min ( 98 %). mass spec : 486 . 30 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 58 min ( 96 %). mass spec : 486 . 31 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 2 , 4 - difluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 61 min ( 90 %). mass spec : 504 . 31 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 4 - chloro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 68 min ( 90 %). mass spec : 502 . 29 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 4 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 59 min ( 90 %). mass spec : 498 . 33 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid o - tolyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 63 min ( 90 %). mass spec : 482 . 33 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 4 - cyano - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 53 min ( 90 %). mass spec : 493 . 31 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 2 , 6 - dimethoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 53 min ( 96 %). mass spec : 528 . 37 ( mh + ). [ 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptyl ]- carbamic acid 2 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 57 min ( 90 %). mass spec : 498 . 33 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid ethyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 36 min ( 98 %). mass spec : 392 . 35 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 48 min ( 97 %). mass spec : 440 . 36 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 4 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 51 min ( 97 %). mass spec : 458 . 33 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 2 , 4 - difluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 52 min ( 95 %). mass spec : 476 . 32 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 48 min ( 98 %). mass spec : 458 . 33 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 4 - chloro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 62 min ( 98 %). mass spec : 474 . 29 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 4 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 49 min ( 99 %). mass spec : 470 . 35 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid o - tolyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 56 min ( 95 %). mass spec : 454 . 36 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 4 - cyano - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 44 min ( 99 %). mass spec : 465 . 32 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 2 , 6 - dimethoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 44 min ( 99 %). mass spec : 500 . 38 ( mh + ). [ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- carbamic acid 2 - methoxy - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 46 min ( 97 %). mass spec : 470 . 34 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 3 , 4 - difluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 55 min ( 84 %). mass spec : 490 . 32 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid isopropyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 47 min ( 83 %). mass spec : 420 . 17 ( mh + ). { 6 -[ 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - imidazol - 1 - yl ]- hexyl }- carbamic acid 2 - fluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 50 min ( 95 %). mass spec : 508 . 29 ( mh + ). { 6 -[ 4 , 5 - bis -( 4 - fluoro - phenyl )- 2 - methyl - imidazol - 1 - yl ]- hexyl }- carbamic acid 2 , 6 - difluoro - phenyl ester : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 50 min ( 85 %). mass spec : 526 . 31 ( mh + ). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid ethyl ester ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 40 min ( 82 %). mass spec : 406 . 15 ( mh + ). benzaldehyde , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 48 min ( 89 %). mass spec : 481 . 26 ( mh + ). 4 - fluorobenzaldehyde , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 58 min ( 87 %). mass spec : 499 . 32 ( mh + ). 2 - nitrobenzaldehye , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 56 min ( 95 %). mass spec : 526 . 3 ( mh + ). 3 - nitrobenzaldehyde , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 57 min ( 83 %). mass spec : 526 . 32 ( mh + ). 4 - nitrobenzaldehyde , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 58 min ( 94 %). mass spec : 526 . 29 ( mh + ). 3 - pyridinecarboxaldehyde , o -[ 6 -( 2 - methyl - 4 , 5 - diphenyl - 1h - imidazol - 1 - yl ) hexyl ] amino ] carbonyl ] oxime : ( scheme 1 ( d )) prepared as described for the example above . analytical hplc 1 . 24 min ( 94 %). mass spec : 482 . 26 ( mh + ). the following intermediates 14 - 20 may be used to synthesize examples 52 - 74 . 1 -( 5 - bromo - pentyl )- 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole : ( scheme 2 ( e )) to a solution of 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole ( 2 . 0 g , 8 . 5 mmol ) and 1 , 5 - dibromopentane ( 3 . 01 g , 12 . 7 mmol ) in dmf ( 100 ml ) was added nah ( 60 % in mineral oil , 0 . 50 g , 12 . 7 mmol ). the resulting mixture was stirred at rt for 1 hour , quenched by addition of water , extracted by ch 2 cl 2 , washed by water , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : etoac / hexanes ). this compound was obtained as a pale yellow oil ( 2 . 2 g , 5 . 7 mmol , 67 % yield ): 1 h nmr ( dmso ): δ1 . 20 ( m , 2h ), 1 . 47 ( m , 2h ), 1 . 64 ( m , 2h ), 2 . 41 ( s , 3h ), 3 . 45 ( t , 2h ), 3 . 72 ( t , 2h ), 7 . 16 ( m , 3h ), 7 . 31 ( m , 4h ), 7 . 55 ( t , 3h ). mass spec : 384 . 57 ( mh + ). 1 -( 6 - bromo - hexyl )- 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole : ( scheme 2 ( e )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 2 ( m , 4h ), 1 . 5 ( m , 2h ), 1 . 75 ( m , 2h ), 2 . 5 ( s , 3h ), 3 . 4 ( t , 2h ), 3 . 69 ( t , 2h ), 7 . 14 ( m , 3h ), 7 . 36 ( m , 4h ), 7 . 516 ( m , 3h ). mass spec : 399 . 14 ( mh + ). 1 -( 3 - bromo - propyl )- 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole : ( scheme 2 ( e )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 99 ( m , 2h ), 2 . 43 ( s , 3h ), 3 . 39 ( t , 2h ), 3 . 88 ( t , 2h ), 7 . 17 ( m , 3h ). 7 . 35 ( m , 4h ), 7 . 53 ( m , 3h ), mass spec : 356 . 59 ( mh + ). 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- benzoic acid ethyl ester : ( scheme 2 ( h )) to a solution of 1 -( 3 - bromo - propyl )- 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole ( 0 . 80 g , 2 . 2 mmol ) and ethyl 4 - hydroxybenzoate ( 1 . 20 g , 7 . 2 mmol ) in dmf ( 30 ml ) was added k 2 co 3 ( 0 . 40 g , 2 . 9 mmol ). the resulting mixture was stirred at 55 ° c . for 1 hour , quenched by addition of water , extracted by etoac , washed by water , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : etoac / hexanes ). this compound was obtained as a pale yellow gum ( 0 . 92 g , 2 . 0 mmol , 94 % yield ): 1 h nmr ( dmso ): δ1 . 32 ( t , 3h ), 1 . 85 ( m , 2h ), 2 . 402 ( s , 3h ), 3 . 87 ( m , 4h ), 4 . 28 ( q , 2h ), 6 . 89 ( d , j = 8 . 82 hz , 2h ), 7 . 143 ( m , 3h ), 7 . 36 ( m , 4h ), 7 . 46 ( m , 3h ), 7 . 82 ( d , j = 8 . 85 mhz , 2h ). mass spec : 441 . 28 ( mh + ). 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- benzoic acid ethyl ester : ( scheme 2 ( h )) prepared as described for the example above . 1 h nmr ( dmso ): δ1 . 31 ( t , 3h ), 2 . 5 ( s , 3h ), 4 . 07 ( m , 2h ), 4 . 15 ( m , 2h ), 4 . 26 ( q , 2h ), 6 . 91 ( d , j = 8 . 88 mhz , 2h ), 7 . 16 ( m , 3h ), 7 . 33 ( d , j = 7 . 56 mhz , 2h ), 7 . 41 ( m , 2h ), 7 . 53 ( m , 3h ), 7 . 85 ( d , j = 8 . 85 mhz , 2h ). 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- benzoic acid : ( scheme 2 ( i )) to a solution of 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- benzoic acid ethyl ester ( 0 . 80 g , 1 . 8 mmol ) in etoh ( 20 ml ) was added naoh ( 10 n , 4 . 0 ml , 40 . 0 mmol ). the resulting mixture was stirred at rt for 3 hours , diluted with water , acidified to ph ˜ 1 using 1n hcl , extracted by ch 2 cl 2 , and then was dried over mgso 4 . after filtration and concentration in vacuo , the residue was purified by flash chromatography ( sio 2 : meoh / ch 2 cl 2 ). this compound was obtained as a white dry foam in hcl salt form ( 0 . 80 g , 1 . 8 mmol , 99 % yield ): 1 h nmr ( dmso ): δ1 . 93 ( m , 2h ), 2 . 67 ( s , 3h ), 3 . 97 ( t , 2h ), 4 . 13 ( t , 2h ), 6 . 85 ( d , j = 8 . 82 mhz , 2h ), 7 . 33 ( s , 5h ), 7 . 43 ( m , 2h ), 7 . 55 ( m , 3h ), 7 . 86 ( d , j = 8 . 82 mhz , 2h ), 12 . 64 ( b , 1h ). 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxyl - benzoic acid : ( scheme 2 ( i )) prepared as described for the example above . 1 h nmr ( dmso ): δ2 . 82 ( s , 3h ), 4 . 19 ( m , 2h ), 4 . 39 ( m , 2h ), 6 . 93 ( d , j = 8 . 85 mhz , 2h ), 7 . 359 ( m , 5h ), 7 . 54 ( m , 2h ), 7 . 61 ( m , 3h ), 7 . 86 ( d , j = 8 . 76 mhz , 2h ), 12 . 685 ( b , 1h ). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 3 , 4 - difluoro - phenyl ester : ( scheme 2 ( j )) to a suspension of 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- benzoic acid ( 0 . 10 g , 0 . 23 mmol ) in a mixture of et 3 n ( 0 . 09 g , 0 . 88 mmol ) and toluene ( 2 ml ) was added azide ( 0 . 1 g , 0 . 35 mmol ). the resultant mixture was stirred at r . t . for 10 min . and then at 108 ° c . under n 2 for 45 min . after the mixture was cooled to r . t ., 3 , 4 - difluorophenol ( 0 . 10 g , 1 . 0 mmol ) was added . the reaction mixture was stirred at r . t . for 10min and then at 80 ° c . for 1 h . the mixture was diluted with etoac , washed with h 2 o . after filtration and concentration in vacuo , the residue was purified by preparative hplc ( ymc 30 × 100 mm ( 5 um packing ), 10 % meoh / 90 % water / 01 % tfa as mobile phase a , 90 % meoh / 10 % water / 0 . 1 % tfa as mobile phase b ). this compound was obtained as a white solid ( 0 . 082 g , 0 . 13 mmol , 55 % yield ): 1 h nmr ( dmso ): δ2 . 83 ( s , 3h ), 4 . 06 ( t , 2h ), 4 . 39 ( t , 2h ), 6 . 82 ( d , j = 7 . 05 mhz , 2h ), 7 . 29 ( m , 2h ), 7 . 32 ( m , 2h ), 7 . 45 ( m , 4h ), 7 . 52 ( m , 4h ), 7 . 61 ( m , 3h ). mass spec : 526 . 22 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 4 - chloro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . 1 h nmr ( dmso ): δ2 . 83 ( s , 3h ), 4 . 07 ( t , 2h ), 4 . 39 ( t , 2h ), 6 . 83 ( d , j = 10 . 3 mhz , 2h ), 7 . 24 ( d , j = 10 . 3 mhz , 2h ), 7 . 30 ( m , 2h ), 7 . 36 ( m , 5h ), 7 . 46 ( d , j = 12 . 6 mhz , 2h ), 7 . 59 ( m , 2h ), 7 . 61 ( m , 3h ). mass spec : 524 . 18 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid methyl ester : ( scheme 2 ( j )) prepared as described for the example above . 1 h nmr ( dmso ): δ2 . 82 ( s , 3h ), 3 . 62 ( s , 3h ), 4 . 05 ( t , 2h ), 4 . 38 ( t , 2h ), 6 . 77 ( d , j = 7 mhz , 2h ), 7 . 28 ( m , 1h ), 7 . 31 ( m , 3h ), 7 . 36 ( m , 3h ), 7 . 53 ( m , 2h ), 7 . 61 ( m , 3h ), 9 . 45 ( b , 1h ). mass spec : 428 . 24 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 3 , 4 - difluoro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 66 min ( 95 %). mass spec : 540 . 25 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 4 - methoxy - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 52 min ( 98 %). mass spec : 534 . 35 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 4 - chloro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 62 min ( 81 %). mass spec : 538 . 22 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 2 - methoxy - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 49 min ( 95 %). mass spec : 534 . 43 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 3 - chloro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 71 min ( 90 %). mass spec : 538 . 23 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 58 min ( 84 %). mass spec : 490 . 25 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 2 - fluoro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 49 min ( 92 %). mass spec : 508 . 23 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 4 - fluoro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 53 min ( 92 %). mass spec : 508 . 23 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol1 - yl )- propoxy ]- phenyl }- carbamic acid phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 53 min ( 95 %). mass spec : 504 . 39 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 4 - methoxy - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 50 min ( 94 %). mass spec : 520 . 24 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid o - tolyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 54 min ( 92 %). mass spec : 504 . 25 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 2 - fluoro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 52 min ( 95 %). mass spec : 522 . 32 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 2 - methoxy - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 46 min ( 97 %). mass spec : 520 . 25 ( mh +). { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid 3 - chloro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 61 min ( 97 %). mass spec : 524 . 18 ( mh +). { 4 -[ 3 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- propoxy ]- phenyl }- carbamic acid 2 , 6 - difluoro - phenyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 58 min ( 90 %). mass spec : 540 . 25 ( mh +). notebook number : { 4 -[ 2 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- ethoxy ]- phenyl }- carbamic acid ethyl ester : ( scheme 2 ( j )) prepared as described for the example above . analytical hplc 1 . 45 min ( 72 %). mass spec : 442 . 25 ( mh +). the following intermediates 21 - 24 may be used to synthesize examples 75 - 77 . 2 - methyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester : ( scheme 3 ( o )) sodium bis ( trimethylsilyl ) amide ( 1m in thf ) ( 3 . 0 ml , 3 . 0 mmole ) was added dropwise to a solution of starting material 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 1 g , 2 . 5 mmole ) in anhydrous thf ( 10 ml ) at − 78 ° c . under nitrogen . after addition , the reaction was let stirred 2 minutes , then iodomethane ( 0 . 06 ml , 0 . 96 mmole ) was added slowly at − 78 ° under nitrogen . the reaction mixture was let stirred at − 78 ° c . for 1 hr , then warming up to room temperature and let stirred for 18 hrs . the next day , analysis by tlc indicated consumption of starting material . the reaction was quenched with aqueous ammonium chloride ( 10 ml ). the aqueous layer was extracted with ethyl acetate ( 3 × 25 ml ). the organic layers obtained were combined , dried over sodium sulfate and filtered . the resultant filtrate was concentrated in vacuo . purification by flash column chromatography using hexane / ethyl acetate ( 4 : 1 ) gave rise to product ( 150 mg , 45 %). 1 h nmr ( cdcl 3 ): δ1 . 09 ( d , j = 6 . 95 mhz , 6h ), 1 . 15 ( t , 3h ), 1 . 51 ( m , 2h ), 2 . 32 ( m , 1h ), 2 . 50 ( s , 3h ), 3 . 70 ( t , 2h ), 4 . 11 ( q , 2h ), 7 . 25 ( m , 3h ), 7 . 32 ( m , 2h ), 7 . 45 ( m , 5h ), 13 c nmr ( cdcl 3 ): δ13 . 7 , 14 . 3 , 17 . 1 , 26 . 4 , 26 . 6 , 30 . 3 , 33 . 4 , 39 . 4 , 43 . 8 , 60 . 2 , 125 . 9 , 126 . 5 , 128 . 0 , 128 . 4 , 128 . 5 , 129 . 0 , 131 . 1 , 131 . 8 , 134 . 8 , 136 . 3 , 144 . 0 , 176 . 6 . anal . calcd . for c 26 h 32 n 2 o 2 . 0 . 25 h 2 o : c , 76 . 34 ; h , 8 . 01 ; n , 6 . 85 . found : c , 76 . 38 ; h , 8 . 13 ; n , 6 . 83 . mass spec : 405 . 29 ( mh +). 2 - ethyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester : ( scheme 3 ( o )) this compound was obtained using the procedures as described above . the following scales and reagents were used : 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 390 mg , 1 mmole ), sodium bis ( trimethylsilyl ) amide ( 1m in thf ) ( 1 . 2 ml , 1 . 2 mmole ), iodoethane ( 0 . 4 ml , 779 . 8 mg , 5 mmole ), anhydrous thf ( 10 ml ). product was obtained ( 100 mg , 24 %). 1 h nmr ( cdcl 3 ): δ0 . 88 ( t , 3h ), 1 . 23 ( m , 4h ), 1 . 33 ( t , 3h ), 1 . 54 ( m , 4h ), 1 . 68 ( b , 1h ), 2 . 04 ( s , 1h ), 2 . 17 ( m , 1h ), 2 . 49 ( s , 3h ), 3 . 709 ( t , 2h ), 4 . 15 ( m , 2h ), 7 . 19 ( m , 3h ), 7 . 42 ( m , 3h ), 7 . 46 ( m , 4h ). 13 c nmr ( cdcl 3 ): δ12 . 0 , 13 . 9 , 14 . 6 , 25 . 7 , 26 . 6 , 27 . 0 , 30 . 5 , 31 . 9 , 44 . 0 , 47 . 3 , 60 . 2 , 126 . 1 , 126 . 7 , 128 . 2 , 128 . 7 , 129 . 2 , 131 . 3 . anal . calcd . for c 27 h 34 n 2 o 2 : c , 77 . 48 ; h , 8 . 19 ; n , 6 . 69 . found : c , 77 . 34 ; n , 8 . 01 ; n , 6 . 56 . mass spec : 419 . 32 ( mh +). 2 - isopropy - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester : ( scheme 3 ( o )) sodium bis ( trimethylsilyl ) amide ( 1m in thf ) ( 1 . 2 ml , 1 . 2 mmole ) was added dropwise to a solution 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 390 mg , 1 mmole ) in anhydrous thf ( 10 ml ) at − 78 ° c . under nitrogen . the reaction solution was let stirred warming up to room temperature during a period of 3 hrs . the reaction solution was cooled to − 78 ° c ., and 2 - iodopropane ( 499 . 97 ul , 849 . 95 mg , 5 mmole ) was added in dropwise . the reaction was let stirred at room temperature for 1 hr , then at 50 ° c . for 1 hr . analysis by tlc indicated consumption of starting material . the reaction was worked - up using the procedures as described above . crude material was purified by flash column chromatography using hexane / ethyl acetate ( 4 : 1 ) to give product ( 80 mg , 18 . 5 %). 1 h nmr cdcl 3 ): δ0 . 89 ( t , 6h ), 1 . 14 ( m , 4h ), 1 . 249 ( t , 3h ), 1 . 49 ( m , 3h ), 1 . 81 ( m , 2h ), 1 . 989 ( m , 1h ), 2 . 49 ( s , 3h ), 3 . 70 ( t , 2h ), 4 . 1 ( m , 2h ), 7 . 15 ( m , 1h ), 7 . 31 ( t , 2h ), 7 . 40 ( m , 2h ), 7 . 445 ( m , 5h ). 13 c nmr ( cdcl 3 ): δ13 . 7 , 14 . 4 , 20 . 2 , 20 . 4 , 26 . 5 , 27 . 2 , 29 . 3 , 30 . 3 , 30 . 7 , 43 . 8 , 52 . 6 , 59 . 9 , 125 . 9 , 126 . 5 , 128 . 0 , 128 . 3 , 128 . 5 , 129 . 0 , 131 . 0 , 131 . 8 , 134 . 8 , 136 . 3 , 144 . 0 , 175 . 6 . anal . calcd . for c 28 h 36 n 2 o 2 . 0 . 21 h 2 o : c , 77 . 07 , h , 8 . 41 ; n , 6 . 42 . found : c , 77 . 08 ; h , 8 . 84 ; n , 6 . 22 . mass spec : 433 . 2 ( mh +). 2 - methyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid : ( scheme 3 ( p )) a solution of starting material 2 - methyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 130 mg , 0 . 32 mmole ) in methanol ( 5 ml ) and sodium hydroxide ( 64 mg , 1 . 61 mmole ) was let stirred under reflux for 18 hrs . the next day , the reaction was let cooled to room temperature and concentrated in vacuo . the residue was diluted with water , and acidified with hydrochloric acid ( 3n ). the aqueous layer was extracted with dichloromethane ( 3 × 10 ml ). the organic layers were combined , dried over sodium sulfate and filtered . the resultant filtrate was concentrated in vacuo to afford product as a white solid ( 120 mg , 99 %). mass spec : 377 ( mh +). 2 - ethyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid : ( scheme 3 ( p )) this compound was obtained using the procedures as described above . the following scales and reagents were used : 2 - ethyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 100 mg , 0 . 24 mmole ), sodium hydroxide ( 2n , 0 . 5 ml , 1 . 0 mmole ), methanol ( 5 ml ). product was obtained as white solid ( 90 mg , 96 %). mass spec : 391 . 25 ( mh +). 2 - ethyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid : ( scheme 3 ( p )) this compound was obtained using the procedures as described above . the following scales and reagents were used : 2 - isopropyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ethyl ester ( 80 mg , 0 . 18 mmole ), sodium hydroxide ( 2n , 0 . 5 ml , 1 . 0 mmole ), methanol ( 5 ml ). product was obtained as white solid ( 46 mg , 64 %). mass spec : 405 . 37 ( mh +). [ 1 - methyl - 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 3 ( q )) diphenylphosphoryl azide ( 0 . 083 ml , 0 . 38 mmole ) was added to a suspension of starting material 2 - methyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ( 120 mg , 0 . 32 mmole ) and triethylamine ( 0 . 14 ml , 1 . 005 mmole ) in toluene ( 5 ml ) at room temperature . the reaction mixture was let stirred at room temperature for 10 minutes under nitrogen , then at 108 ° c . for 90 minutes . the reaction was let cooled to room temperature , to which 2 - fluorophenol ( 0 . 03 ml , 0 . 038 g , 0 . 338 mmole ) was added . the reaction mixture was let stirred at room temperature for 30 minutes , then at 100 ° c . for 18 hrs . the next day , analysis by tlc ( dichloromethane / ethyl acetate 3 : 1 ) indicated consumption of starting material . the reaction was let cooled to room temperature , where the solvent was removed by rotorvap . the crude material was purified by flash column chromatography using dichloromethane / ethyl acetate ( 6 : 1 to 3 : 1 ). product was obtained ( 110 mg , 71 %). 1 h nmr ( cdcl 3 ): δ1 . 21 ( d , j = 8 . 75 mhz , 6h ), 1 . 35 ( m , 2h ), 1 . 51 ( m , 2h ), 2 . 50 ( s , 3h ), 3 . 71 ( m , 3h ), 4 . 93 ( b , 1h ), 7 . 18 ( m , 6h ), 7 . 32 ( m , 2h ), 7 . 46 ( m , 6h ). 13 c nmr ( cdcl 3 ): 813 . 7 , 21 . 1 , 25 . 2 , 30 . 3 , 36 . 7 , 43 . 7 , 47 . 5 , 116 . 5 , 116 . 650 , 124 . 132 , 124 . 325 , 125 . 943 , 126 . 520 , 128 . 027 , 128 . 347 , 128 . 509 , 129 . 018 , 131 . 101 , 131 . 796 , 134 . 8 , 136 . 4 , 138 . 6 , 144 . 1 , 153 . 0 , 153 . 7 , 155 . 6 . anal . calcd . for c 30 h 32 fn 3 o 2 . 0 . 42 h 2 o : c , 73 . 06 ; h , 6 . 71 ; n , 8 . 52 . found : c , 73 . 24 ; h , 6 . 82 ; n , 8 . 29 . mass spec : 486 . 27 ( mh +). [ 1 - ethyl - 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 3 ( q )) this compound was prepared using the procedures as described above . the following scales and reagents were used : starting material 2 - ethyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ( 90 mg , 0 . 23 mmole ), diphenylphosphoryl azide ( 0 . 060 ml , 0 . 276 mmole ), triethylamine ( 0 . 14 ml , 1 . 005 mmole ), and 2 - fluorophenol ( 30 ul , 0 . 338 mmole ). after purification by flash column chromatography , product was obtained ( 90 mg , 18 %). 1 h nmr ( cdcl 3 ): δ0 . 96 ( t , 3h ), 1 . 24 ( m , 5h ), 1 . 51 ( m , 2h ), 1 . 54 ( m , 3h ), 2 . 50 ( s , 3h ), 3 . 72 ( t , 2h ), 4 . 77 ( d , j = 9 . 28 mhz , 1h ), 7 . 16 ( m , 7h ), 7 . 342 ( m , 2h ), 7 . 45 ( m , 5h ). 13 c nmr ( cdcl 3 ): δ10 . 2 , 13 . 7 , 25 . 1 , 26 . 3 , 28 . 2 , 30 . 3 , 34 . 7 , 43 . 7 , 53 . 076 , 116 . 466 , 116 . 650 , 124 . 108 , 124 . 276 , 125 . 937 , 126 . 527 , 128 . 015 , 128 . 348 , 128 . 483 , 129 . 001 , 131 . 1 , 131 . 8 , 134 . 8 , 136 . 3 , 144 . 1 , 153 . 5 . anal . calcd . for c 31 h 34 fn 3 o 2 : c , 74 . 52 ; h , 6 . 86 ; n , 8 . 41 . found : c , 74 . 43 ; h , 6 . 98 ; n , 8 . 32 . mass spec : 500 . 34 ( mh +). [ 1 - isopropyl - 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- hexyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 3 ( q )) this compound was obtained using the procedures as described above . the following scales and reagents were used : starting material 2 - isopropyl - 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- heptanoic acid ( 45 . 8 mg , 0 . 113 mmole ), diphenylphosphoryl azide ( 0 . 029 ml , 0 . 135 mmole ), triethylamine ( 0 . 049 ml , 0 . 351 mmole ), and 2 - fluorophenol ( 0 . 012 ml , 0 . 135 mmole ). after purification by flash column chromatography , product was obtained ( 27 . 5 mg , 47 %). 1 h nmr ( cdcl 3 ): δ0 . 95 ( m , 6h ), 1 . 27 ( m , 5h ), 1 . 53 ( m , 2h ), 1 . 73 ( m , 2h ), 2 . 50 ( s , 3h ), 3 . 56 ( m , 1h ), 3 . 73 ( t , 2h ), 4 . 75 ( d , j = 10 mhz , 1h ), 7 . 19 ( m , 7h ), 7 . 33 ( m , 2h ), 7 . 45 ( m , 5h ). 13 c nmr ( cdcl 3 ): δ13 . 7 , 17 . 5 , 19 . 3 , 25 . 5 , 26 . 3 , 30 . 3 , 32 . 2 , 32 . 3 , 43 . 7 , 56 . 7 , 116 . 5 , 116 . 6 , 124 . 1 , 124 . 3 , 124 . 3 , 125 . 9 , 126 . 4 , 126 . 5 , 128 . 0 , 128 . 3 , 128 . 5 , 128 . 8 , 131 . 1 , 131 . 8 , 134 . 8 , 136 . 4 , 144 . 1 , 153 . 7 . anal . calcd . for c 32 h 36 fn 3 o 2 . 0 . 59 h 2 o : c , 73 . 31 ; h , 7 . 15 ; n , 8 . 01 . found : c , 73 . 45 ; 7 . 20 ; n , 7 . 61 . mass spec : 514 . 2 ( mh +). the following intermediates 27 - 29 may be used to synthesize example 78 . 2 -[ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- 2 - phenyl ]- malonic acid diethyl ester : ( scheme 4 ( r )) a solution of star ~ ting material 1 -( 5 - bromo - pentyl )- 2 - methyl - 4 , 5 - diphenyl - 1h - imidazole ( 0 . 5 g , 1 . 3 mmole ) in dmf ( 5 ml ) was added to a suspension of sodium hydride ( 63 mg , 1 . 56 mmole ) in dmf ( 5 ml ) at room temperature under nitrogen . the reaction suspension was let stirred for 30 minutes at room temperature . diethyl phenyl malonate ( 0 . 29 ml , 313 . 5 mg , 1 . 3 mmole ) was added to the reaction suspension dropwise at room temperature under nitrogen . the reaction mixture was let stirred at 45 - 50 ° c . for 48 hrs . analysis by tlc indicated only a trace of starting material remained . the reaction was let cooled to room temperature , then poured into saturated sodium chloride solution . the aqueous layer was extracted with ethyl acetate ( 3 × 25 ml ). the organic layers were combined and washed with water ( 1 × 30 ml ). the organic layer was separated , dried over sodium sulfate and filtered . the filtrate was concentrated in vacuo . the crude material was purified by flash column chromatography using ethyl acetate / toluene ( 2 . 5 : 7 . 5 ). product was obtained as a colorless oil ( 650 mg , 93 %). 1 h nmr ( cdcl 3 ): δ1 . 12 ( m , 4h ), 1 . 20 ( t , 6h ), 1 . 47 ( m , 2h ), 2 . 16 ( t , 2h ), 2 . 46 ( s , 3h ), 3 . 66 ( t , 2h ), 4 . 22 ( m , 4h ), 7 . 15 ( m , 1h ), 7 . 26 ( m , 4h ), 7 . 32 ( m , 5h ), 7 . 43 ( m , 5h ). 13 c nmr ( cdcl 3 ): δ13 . 7 , 14 . 0 , 24 . 2 , 26 . 8 , 30 . 2 , 35 . 7 , 43 . 8 , 61 . 5 , 62 . 5 , 125 . 9 , 126 . 5 , 127 . 5 , 127 . 9 , 128 . 1 , 128 . 2 , 128 . 3 , 128 . 5 , 129 . 0 , 131 . 0 , 144 . 1 , 170 . 6 . anal . calcd . for c34h 38 n 2 o 4 . 0 . 34 toluene : c , 76 . 77 ; h , 7 . 20 ; n , 4 . 91 . found : c , 76 . 64 ; h , 7 . 27 ; n , 4 . 78 . mass spec : 539 . 29 ( mh +). 2 -[ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- 2 - phenyl - malonic acid : ( scheme 4 ( s )) a solution of starting material 2 -[ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- 2 - phenyl - malonic acid diethyl ester ( 630 mg , 1 . 17 mmole ) in thf ( 18 ml ) and sodium hydroxide ( 2n ) ( 8 ml ) was let stirred at 80 ° c . for 18 hrs . the next day , analysis by tlc indicated no significant change in the reaction . the thf solvent was removed by rotorvap . the residue was diluted in methanol ( 20 ml ). the reaction solution was let stirred under reflux for 2 hrs . analysis by tlc indicated consumption of starting material . the organic solvent was removed by rotorvap . the residue was diluted with water ( 20 ml ). the aqueous layer was extracted diethyl ether ( 2 × 20 ml ). the organic layers were combined and extracted with sodium hydroxide ( 10 %) ( 2 × 10 ml ). the basic aqueous layers were combined and acidified with hydrochloric acid ( 3n ) to ph = 1 , then extracted with dichloromethane ( 2 × 20 ml ). the organic layers were combined , dried over sodium sulfate and filtered . the resultant filtrate was concentrated in vacuo to provide product as a white solid ( 580 mg , quantitative yield ). mass spec : 483 . 54 ( mh +). 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- 2 - phenyl - heptanoic acid : ( scheme 4 ( t )) a solution of starting material 2 -[ 5 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- pentyl ]- 2 - phenyl - malonic acid ( 580 mg , 1 . 32 mmole )) in glacial acetic acid ( 20 ml ) was let stirred under reflux for 18 hrs . the next day , the reaction was let cooled to room temperature and concentrated in vacuo . product was obtained ( 398 . 6 mg , 77 . 7 %). 1 h nmr ( cdcl 3 ): δ1 . 11 ( b , 4h ), 1 . 42 ( bd , 2h ), 1 . 59 ( m , 1h ), 1 . 96 ( m , 1h ), 2 . 55 ( s , 3h ), 3 . 43 ( t , 1h ), 3 . 96 ( t , 2h ), 7 . 199 ( m , 3h ), 7 . 27 ( m , 7h ), 7 . 39 ( m , 2h ), 7 . 45 ( m , 3h ), 11 . 857 ( b , 1h ), 13 c nmr ( cdcl 3 ): δ6 12 . 0 , 21 . 4 , 26 . 1 , 26 . 8 , 29 . 5 , 29 . 7 , 33 . 1 , 44 . 2 , 52 . 2 , 127 . 0 , 127 . 2 , 127 . 4 , 128 . 0 , 128 . 4 , 128 . 4 , 128 . 5 , 129 . 1 , 129 . 3 , 129 . 5 , 130 . 6 , 131 . 0 , 133 . 0 , 139 . 8 , 144 . 1 , 175 . 8 , 177 . 7 . mass spec : 439 . 24 ( mh +). [ 6 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- 1 - phenyl - hexyl ]- carbamic acid 2 - fluoro - phenyl ester : ( scheme 4 ( u )) diphenylphosphoryl azide ( 0 . 083 ml , 0 . 38 mmole ) was added to a suspension of starting material 7 -( 2 - methyl - 4 , 5 - diphenyl - imidazol - 1 - yl )- 2 - phenyl - heptanoic acid ( 140 mg , 0 . 32 mmole ) and triethylamine ( 0 . 14 ml , 1 . 005 mmole ) in toluene ( 5 ml ) at room temperature . the reaction mixture was let stirred at room temperature for 10 minutes under nitrogen , then at 108 ° c . for 90 minutes . the reaction was let cooled to room temperature , to which 2 - fluorophenol ( 0 . 03 ml , 0 . 038 g , 0 . 338 mmole ) was added . the reaction mixture was let stirred at room temperature for 10 minutes , then at 100 ° c . for 18 hrs . the next day , analysis by tlc ( dichloromethane / ethyl acetate 3 : 1 ) indicated consumption of starting material . the reaction was let cooled to room temperature , where the solvent was removed by rotorvap . the crude material was purified by flash column chromatography using dichloromethane / ethyl acetate ( 6 : 1 to 3 : 1 ). product was obtained ( 58 mg , 33 . 1 %). 1 h nmr ( cdcl 3 ): δ1 . 18 ( t , 3h ), 1 . 27 ( t , 2h ), 1 . 497 ( t , 2h ), 2 . 47 ( s , 3h ), 3 . 70 ( t , 2h ), 4 . 63 ( q , 1h ), 5 . 38 ( d , j = 8 . 16 mhz , 1h ), 7 . 18 ( m , 7h ), 7 . 37 ( m , 7h ), 7 . 44 ( m , 5h ). 13 c nmr ( cdcl3 ): δ13 . 6 , 25 . 4 , 26 . 1 , 30 . 2 , 36 . 0 , 43 . 6 , 55 . 7 , 116 . 5 , 116 . 7 , 124 . 1 , 124 . 3 , 124 . 3 , 126 . 0 , 126 . 4 , 126 . 5 , 127 . 7 , 128 . 0 , 128 . 3 , 128 . 5 , 128 . 8 , 129 . 0 , 131 . 0 , 131 . 7 , 134 . 7 , 136 . 3 , 141 . 6 , 144 . 1 , 153 . 0 . anal . calcd . for c 35 h 34 fn 3 o 2 . 0 . 42 h 2 o : c , 75 . 71 ; h , 6 . 32 ; n , 7 . 57 . found : c , 75 . 75 ; h , 6 . 49 ; n , 7 . 50 . mass spec : 548 . 27 ( mh +). homogenates of crude membranes were prepared from h4 cells that express transfected human faah ( h4 - faah cells ). briefly , cells were grown in dmem supplemented with 10 % fbs and geneticin at a final concentration of 500 μg / ml ( gibco brl , rockville , md .). confluent cultures of h4 - faah cells were rinsed twice with phosphate - buffered saline [ 138 mm nacl , 4 . 1 mm kcl , 5 . 1 mm na 2 po 4 , 1 . 5 mm kh 2 po 4 ( ph 7 . 5 ), 37 ° c .] and incubated for 5 - 10 min . at 4 ° c . in lysis buffer [ 1 mm sodium bicarbonate ]. cells were transferred from plates to polypropylene tubes ( 16 × 100 mm ), homogenized and centrifuged at 32 , 000 × g for 30 min . pellets were resuspended by homogenization in lysis buffer and centrifuged at 32 , 000 × g for 30 min . pellets were resuspended in lysis buffer ( 15 - 20 μg protein / ml ) then stored at − 80 ° c . until needed . on the day of an experiment , membranes were diluted to 2 . 67 μg protein / ml in 125 mm tris - cl , ph 9 . 0 activity of faah was measured using a modification of the method described by omeir et al ., 1995 ( life sci 56 : 1999 , 1995 ). membrane homogenates ( 240 ng protein ) were incubated at room temperature for one hour with 1 . 67 nm anandamide [ ethanolamine 1 - 3 h ] ( american radiolabeled chemical inc ., st louis , mo .) and 10 μm anandamide ( sigma / rbi , st . louis , mo .) in the absence and presence of inhibitors . the reaction was stopped by the addition of 1 volume of a solution of methanol and dichloroethane ( 1 : 1 ). the mixture was shaken and then centrifuged at 1000 × g for 15 min . to separate the aqueous and organic phases . an aliquot of the aqueous phase , containing [ 3 h ]- ethanolamine was withdrawn and counted by scintillation spectroscopy . data were expressed as the percentage of [ 3 h ]- ethanolamine formed versus vehicle , after subtraction of the background radioactivity determined in the presence of 10 μm arachidonyl trifluoromethyl ketone ( atfmk ), an inhibitor of faah . ic 50 values were determined using a four - parameter logistic equation for dose - response curves . compounds for which ic 50 values are not provided herein showed no faah inhibition or marginal faah inhibition in preliminary tests . * a & lt ; 10 nm ; b 10 nm & lt ; 100 nm ; c 100 nm & lt ; 1 , 000 nm ; d 1 , 000 nm & lt ; 10 , 000 nm in fig1 ., example 1 , was active in phase i ( acute phase ) and phase ii ( chronic phase ) of the rat formalin test . in animals that received 25 mg / kg , i . v , of example 1 , the number of paw flinches was reduced by nearly 40 % in the first 10 minutes after administration of formalin . paw flinches were reduced by approximately 30 % over the following 50 minutes . the effect of example 1 was similar to that seen with a 3 mg / kg , i . p . dose of morphine . in fig2 ., animals that received example 1 , the latency to paw withdrawal was increased significantly . the present results confirm , the activity of example 1 against acute pain . in fig3 ., example 1 was examined in the chung model of neuropathic pain where animals exhibit a pain response ( paw withdrawal ) to a normally innocuous stimulus ( light touch ), in animals with a neuropathic injury , the threshold for withdrawal of the injured paw was increased ( toward normal ) in a dose - dependent fashion by example 1 . the anti - neuropathic effect observed with 20 mg / kg example 1 exhibited earlier onset of action compared to 100 mg / kg gabapentin ( reference compound ) with similar peak efficacy .	2
a thorium nitrate solution containing 500 grams of thorium per liter was neutralized with ammonia gas to a ph of 3 under cooling to 5 ° to 10 ° c ., whereby there was formed a clear solution containing 444 grams of thorium per liter . using stirring at room temperature there were dissolved in 1860 ml this solution which contained 826 grams of thorium , 2l3 grams of resorcinol and 87 grams of glycine and there were added an additional 780 ml of water as well as 170 ml of uranyl nitrate solution which contined 490 grams of uranium per liter . this clear solution having a volume of 3 liters which contained per liter 303 grams of th + u in the weight ratio th : u = 10 . 1 as well as 71 grams of resorcinol and 29 grams of glycine and had a viscosity of 11 cp was split according to known methods into equally sized drops while the solution was forced through a nozzle under the action of an electromagnetic oscillating system , whereby the liquid stream flowing out at a frequency of 400 hertz in air formed 24 , 000 drops per minute which hardened to solid spherical particles during the falling through a 20 cm long ammonia gas atmosphere , which particles were collected in an ammoniacal precipitation bath as spheres of thorium oxide hydrate and ammonium diuranate . the precipitation bath contained 5 percent by weight ammonia . the molar ratio of the substituted hydrocarbon compound to thorium plus uranium amounted to 0 . 5 : 1 for resorcinol and 0 . 3 : 1 for glycine . the spherical particles were washed free of ammonium nitrate with water and isopropanol , dried , calcined in air at 300 ° c . and sintered under hydrogen at 1700 ° c . to ( th , u ) o 2 - mixed oxide spheres of high density ( greater than 98 % of the theoretical density ). the analysis of a representative amount of particles of over 2000 particles gave an average diameter of 391μ with a standard deviation of 8 . 8μ for 99 % of all particles with 99 % probability , which corresponds to a variation coefficient of 2 . 3 %. the investigation of the spherical shape showed that the ratio of the largest to the smallest diameter per sphere at more than 80 % of all spheres was between 1 . 00 and 105 : 1 and that less than 1 % had a diameter ratio of 1 . 10 : 1 . the throughput per nozzle amounted to 0 . 4 kg thorium plus uranium per hour in the form of 400μ spheres , which means over 1 . 4 × 10 6 particles . 523 ml of thorium nitrate solution having a ph of 3 . 8 which contained 444 grams of thorium per liter were mixed under stirring with 48 . 5 grams of pyruvic acid and after 15 minutes there were mixed in an additional 110 ml and 48 . 5 ml of uranyl nitrate solution ( 490 grams u / l ). the clear solution having a volume of 730 ml had a viscosity of 13 cp at 20 ° c . and contained per liter 350 grams of thorium plus uranium in the weight ratio th : u = 10 : 1 as well as 66 grams of pyruvic acid . even after a long standing time of 24 hours there was not observed a crystallization or a turbidity of the solution . this solution was changed into 48 , 000 drops per minute as described in example 1 , which drops hardened to solid , spherical shapes in ammonia gas and ammonia solution , washed free of ammonium nitrate and dried in air . the molar ratio of pyruvic acid to thorium plus uranium amounted to 0 . 5 : 1 . there were dissolved in 306 ml of uranyl nitrate solution having a ph of 2 which solution contained 490 grams per liter of uranium , 71 grams of resorcinol and 12 grams of glycine and there were added 110 ml of water , whereby there was formed a clear solution having a viscosity of 2 cp at 20 ° c . which contained per liter 300 grams of uranium , 142 grams of resorcinol and 24 grams of glycine , corresponding to a mole ratio resorcinol - to - uranium of 1 : 1 and a glycine to uranium mole ratio of 0 . 25 : 1 . this solution remained clear for more than 48 hours and was as described in example 1 forced through a nozzle , whereby the liquid stream flowing out formed 120 , 000 uniform drops , which were hardened in ammonia gas and were collected in ammonia solution in the form of solid spheres from ammonium diuranate and had a diameter of 0 . 8 mm . the further treatment by washing for the purpose of removal of ammonium nitrate , drying , calcining and sintering under hydrogen at 1700 ° c . resulted in spherical nuclear fuel spheres of dense uo 2 having a diameter of 200μ . measurements showed that the ratio of largest to smallest diameter per sphere at 86 % of all the particles was below 1 . 05 and in the remainder of the particles did not exceed 1 . 10 . there were dispersed 30 grams of carbon black in a solution of the composition set forth in example 3 . this suspension having a viscosity of 10 cp at 20 ° c . under continuous stirring was converted into black spherical particles in the manner described in example 1 . at a frequency of 1500 hertz the throughput per nozzle per minute was 90 , 000 drops , corresponding to 0 . 2 kg of uranium per hour per nozzle . after the washing and drying the particles were reacted and sintered at 1850 ° c . under argon to uc 2 nuclear fuel particles having a diameter of 220μ . there were dissolved 118 . 5 grams of resorcinol in 260 ml of thorium nitrate solution having a ph of 3 . 8 and containing 481 grams of thorium per liter . by dilution with 150 ml of water there was formed a solution which contained 250 grams of thorium and 237 grams of resorcinol per liter , corresponding to a resorcinol - thorium molar ratio of 2 : 1 . the solution had a viscosity at 20 ° c . of 9 cp . the solution was forced through a nozzle at a vibrator frequency of 427 hertz in the manner described in example 1 and converted into 25 , 700 drops per minute , which drops were solidified in a 30 cm long ammonia gas atmosphere into spheres of thorium oxide hydrate and collected in 5 percent by weight aqueous ammonia solution . the spherical particles were freed of ammonia nitrate by washing , dried and calcined and sintered at 1500 ° c . in air to dense tho 2 - fertile material particles having a diameter of 503μ . the measurement of a representative sample of 200 spheres showed that 98 % thereof had a diameter ratio from the largest to the smallest diameter of each particle below 1 . 1 . although each particle on the average weighed only 0 . 65 mg the throughput amounted to 1 kg tho 2 per nozzle per hour . 76 . 3 grams of acetamide and 12 . 1 grams of glycine were dissolved in 303 ml of thorium nitrate solution having a ph of 3 . 8 and containing 444 grams th / l and there were added with stirring an additional 90 ml of water and 28 . 5 ml of uranyl nitrate solution having a concentration of 490 grams u / l . the clear solution contained per liter 300 grams of th + u in the weight ratio th : u = 10 : 1 , 152 . 6 grams of acetamide and 24 . 2 grams of glycine and had a viscosity of 11 cp at 20 ° c . as described in example 1 there were produced per nozzle per minute 36 , 000 spherical particles which were changed by heat treatment including sintering under hydrogen at 1700 ° c . into mixed oxide spheres of ( th , u ) o 2 of good sphericity having a diameter of 400μ . in this example , the molar ratio of acetamide - th + u = 2 : 1 and glycine - th + u = 0 . 25 : 1 . 50 grams of pyrogallol were dissolved in 500 ml of thorium nitrate solution having a ph of 3 . 8 and containing 206 g th , corresponding to a mole ratio of pyrogallol - thorium of 0 . 4 : 1 . this solution having a viscosity of 12 cp at 20 ° c . was converted into particles of good spherical form in the manner set forth in example 1 . these particles upon drying in air were colored black . 564 ml of thorium nitrate solution having a ph of 3 . 8 and a content of 232 grams th ( 1 mole ) were mixed with 29 grams of propionaldehyde ( 0 . 5 mole ). the clear solution had a viscosity of 5 cp at 20 ° c . and similar to example 1 was converted into spheres of precipitated thorium oxide hydrate . the washed and dried particles were marked by good roundness . 564 ml of thorium nitrate solution having a ph of 3 . 8 and a content of 232 grams of th ( 1 mole ) were mixed with 29 grams of acetone ( 0 . 5 mole ) and similar to example 1 converted into 24 , 000 discrete particles per nozzle per minute . the viscosity of the solution was 5 cp at 20 ° c . 564 ml of thorium nitrate solution having a ph of 3 . 8 containing 232 grams of th ( 1 mole ) were mixed with 44 grams of dioxane ( 0 . 5 mole ). the clear solution had a viscosity of 5 cp at 20 ° c . and was worked into microspheres in a manner similar to example 1 . the solidified particles were washed and dried and were marked by good spherical shape . the use of 36 grams of tetrahydrofurane ( 0 . 5 mole ) in place of dioxane gave similarly good results . the viscosity of the solution likewise amounted to 5 cp at 20 ° c . there were dissolved in 540 ml of thorium nitrate solution having a ph of 3 . 8 and containing 232 grams of th ( 1 mole ) with strong stirring slowly 10 grams of 1 - leucine ( 0 . 077 mole ) to form a clear solution having a viscosity of 4 cp at 20 ° c . this solution containing 394 grams th / l similar to example 1 was converted into spherically shaped particles of good roundness , subsequently washed free of ammonium nitrate and dried in air . 8 . 1 grams of glycine ( 0 . 1 mole ) were dissolved in 540 ml of thorium nitrate solution having a ph of 3 . 8 and containing 232 grams of th ( 1 mole ). the concentration per liter of solution was 428 grams of th and 15 grams of glycine , the viscosity was 8 cp at 20 ° c . this solution was converted into spheres of thorium oxide hydrate in the same manner as example 1 , washed free of nitrate with ammonia water and dried at 90 ° c . in air . there could not be detected any glycine by analysis of the wash water . the dried particles contained 1 . 3 weight % carbon . 29 . 5 grams of acetamide ( 0 . 5 mole ) were dissolved at room temperature in 564 ml of thorium nitrate solution having a ph of 3 . 8 and containing 232 grams of th ( 1 mole ). the clear solution having a viscosity of 5 cp at 20 ° c . was converted into spherical particles in a manner similar to example 1 . these spheres were washed and then dried in air . the use of 22 . 5 grams of formamide ( 0 . 5 mole ) in place of acetamide likewise gave thorium oxide hydrate spheres . the viscosity of this solution likewise amount to 5 cp at 20 ° c . 49 . 5 grams of succinimide were dissolved with stirring in 564 ml of thorium nitrate solution having a ph of 3 . 8 and containing 232 grams th ( 1 mole ). the clear solution which had a viscosity of 5 cp at 20 ° c . was worked up as described in example 1 to dried microspheres of good spherical shape having a diameter of 1 mm . example 15 p 30 grams of ethylenediamine ( 0 . 5 mole ) with cooling were mixed with 100 ml of water and neutralized with 70 ml of 65 % nitric acid in 50 ml of water to a ph of 6 . this neutralized solution with stirring was mixed with 564 ml of thorium nitrate solution having a ph of 3 . 8 and containing 232 grams th ( 1 mole ) whereupon there was formed a clear solution of 800 ml containing 290 grams th / l . the viscosity was 4 cp at 20 ° c . in a manner similar to that described in example 1 this solution was changed into 24 , 000 drops per nozzle per minute which drops were hardened in ammonia gas and collected in ammonia solution as spherically shaped particles of good form .	6
fig1 schematically illustrates a gas turbine engine 20 . the gas turbine engine 20 is disclosed herein as a two - spool turbo fan that generally incorporates a fan section 22 , a compressor section 24 , a combustor section 26 and a turbine section 28 . alternative engine architectures 200 might include an augmentor section 12 , an exhaust duct section 14 and a nozzle section 16 ( fig2 ) among other systems or features . the fan section 22 drives air along both a bypass flowpath and into the compressor section 24 . the compressor section 24 drives air along a core flowpath for compression and communication into the combustor section 26 then expansion through the turbine section 28 . although depicted as a turbofan in the disclosed non - limiting embodiment , it should be understood that the concepts described herein are not limited to use with turbofans as the teachings may be applied to other types of turbine engine architectures such as turbojets , turboshafts , and three - spool ( plus fan ) turbofans . the engine 20 generally includes a low spool 30 and a high spool 32 mounted for rotation about an engine central longitudinal axis x relative to an engine static structure 36 via several bearing structures 38 . the low spool 30 generally includes an inner shaft 40 that interconnects a fan 42 , a low pressure compressor (“ lpc ”) 44 and a low pressure turbine (“ lpt ”) 46 . the inner shaft 40 drives the fan 42 directly or through a geared architecture 48 to drive the fan 42 at a lower speed than the low spool 30 . an exemplary reduction transmission is an epicyclic transmission , namely a planetary or star gear system . the high spool 32 includes an outer shaft 50 that interconnects a high pressure compressor (“ hpc ”) 52 and high pressure turbine (“ hpt ”) 54 . a combustor 56 is arranged between the high pressure compressor 52 and the high pressure turbine 54 . the inner shaft 40 and the outer shaft 50 are concentric and rotate about the engine central longitudinal axis “ a ” which is collinear with their longitudinal axes . core airflow is compressed by the lpc 44 then the hpc 52 , mixed with the fuel and burned in the combustor 56 , then expanded over the hpt 54 and the lpt 46 . the turbines 54 , 46 rotationally drive the respective low spool 30 and high spool 32 in response to the expansion . the main engine shafts 40 , 50 are supported at a plurality of points by bearing structures 38 within the static structure 36 . bearing structures 38 at various locations may alternatively or additionally be provided . with reference to fig3 , an enlarged schematic view of a portion of the turbine section 28 is shown by way of example ; however , other engine sections will also benefit here from . a full ring shroud assembly 60 within the engine case structure 36 supports a blade outer air seal ( boas ) assembly 62 with a multiple of boas segments 64 proximate to a rotor assembly 66 ( one schematically shown ). the full ring shroud assembly 60 and the blade outer air seal ( boas ) assembly 62 are axially disposed between a forward stationary vane ring 68 and an aft stationary vane ring 70 . each vane ring 68 , 70 includes an array of vanes 72 , 74 that extend between a respective inner vane support 76 , 78 and an outer vane support 80 , 82 . the outer vane supports 80 , 82 are attached to the engine case structure 36 . the rotor assembly 66 includes an array of blades 84 circumferentially disposed around a disk 86 . each blade 84 includes a root 88 , a platform 90 and an airfoil 92 ( also shown in fig4 ). a portion of each blade root 88 is received within a rim 94 of the disk 86 . each airfoil 92 extends radially outward , and has a tip 96 disposed in close proximity to a blade outer air seal ( boas ) assembly 62 . each boas segment 64 may include an abradable material to accommodate potential interaction with the rotating blade tips 96 . to resist the high temperature stress environment in the hot gas path of a turbine engine , each blade 84 may be formed to have a single crystal or columnar grain microstructure . it should be appreciated that although a blade 84 with internal passageways 98 ( fig5 ) will be described and illustrated in detail , other components including , but not limited to , vanes , fuel nozzles , airflow swirlers , combustor liners , turbine shrouds , vane endwalls , airfoil edges and other gas turbine engine components “ w ” may also be manufactured in accordance with the teachings herein . the present disclosure involves the use of additive manufacturing techniques to form a component “ w ”, as will be disclosed in the embodiments described below . in general terms , additive manufacturing techniques allow for the creation of a component “ w ” by building the component with successively added layers ; e . g ., layers of powdered material . the additive manufacturing process facilitates manufacture of relatively complex components , minimize assembly details and minimize multi - component construction . in the additive manufacturing process , one or more materials are deposited on a surface in a layer . in some instances , the layers are subsequently compacted . the material ( s ) of the layer may be subsequently unified using any one of a number of known processes ( e . g ., laser , electron beam , etc .). typically , the deposition of the material ( i . e . the geometry of the deposition later for each of the materials ) is computer controlled using a three - dimensional computer aided design ( cad ) model . the three - dimensional ( 3d ) model is converted into a plurality of slices , with each slice defining a cross section of the component for a predetermined height ( i . e . layer ) of the 3d model . the additively manufactured component is then “ grown ” layer by layer ; e . g ., a layer of powdered material ( s ) is deposited and then unified , and then the process is repeated for the next layer . examples of additive manufacturing processes that can be used with the present disclosure include , but are not limited to , stereolithography ( sls ), direct selective laser sintering ( dsls ), electron beam sintering ( ebs ), electron beam melting ( ebm ), laser engineered net shaping ( lens ), laser net shape manufacturing ( lnsm ), direct metal deposition ( dmd ), direct metal laser sintering ( dmls ) and others . the present disclosure is not limited to using any particular type of additive manufacturing process . in the embodiments described below , an additive manufacturing process is utilized to form a crucible 100 ( fig6 ) and a component “ w ” 84 ( e . g ., a blade , a vane , etc .). with reference to fig6 , the additive manufactured crucible 100 generally includes a core 102 and a shell 104 . the shell 104 and the core 102 define the geometry of the component “ w ” ( e . g ., including complex exterior and interior geometries of the component “ w ”), and provide a support structure for the component “ w ”. the shell 104 forms a structure having surfaces that will define the outer surfaces of the component “ w ”. the core 102 forms bodies that occupy volumes that will be voids ( e . g ., internal passages ) within the final component “ w ”. the crucible 100 may comprise a variety of different material types ; e . g ., refractory metals , ceramics , combinations thereof , etc . as will be explained below , the crucible 100 may be utilized as a melting unit and / or a die during processing of the component “ w ”. with reference to fig8 , according to one disclosed non - limiting embodiment for forming single crystal or columnar grain superalloy component with internal passageways , a method includes forming a crucible 100 . the crucible 100 is additively manufactured ( step 202 ). it should be appreciated that the core 102 and / or shell 104 of the crucible 100 may be additively manufactured from materials that include , but are not limited to , ceramic material such as silica , alumina , zircon , cobalt , mullite , kaolin , refractory metals , combinations thereof , etc . following additive manufacture , the crucible 100 may be dried and fired ( i . e . bisqued ) at an intermediate temperature before high firing to fully sinter and densification . the additively manufactured crucible 100 thereby forms a cavity for forming the component w . that is , the crucible 100 is integrally formed by the additive manufacturing process such that the conventional separate manufacture of the core and shell are essentially combined into a single step . it should be appreciated that single or multiple molds and cavities may be additively manufactured and assembled . the crucible 100 may then be filled with a component material such as a desired metal ( step 204 ). non - limiting examples of metal component materials include superalloys ; e . g ., nickel based superalloys , cobalt based superalloys , iron based superalloys , combinations thereof , etc . in some instances , the component material added to the crucible 100 may be in powder form that can be subsequently melted . in other instances , the component material added to the crucible 100 may be in molten form that is subsequently solidified . the present disclosure is not limited , however , to adding component material in any particular form . in some instances , the crucible is combined or utilized with structure ( e . g ., a starter seed and a chill plate ) operable to cause the component w to be formed having a directionally solidified microstructure ( i . e ., a “ ds ” microstructure ), such as a single crystal microstructure or a columnar grain microstructure . a single crystal solid ( sometimes referred to as a “ monocrystalline solid ”) component is one in which the crystal lattice of the substantially all of the component material is continuous and unbroken to the edges of the component , with virtually no grain boundaries . processes for growing a single crystal alloy structure are believed to be known to those of ordinary skill in the art , and therefore descriptions of such processes are not necessary here for enablement purposes . however , an example is provided hereinafter to facilitate understanding of the present disclosure . a portion of a metallic starter seed may extend into a vertically lower portion of the component material receiving portion of the crucible 100 . during subsequent processing of the component “ w ”, molten component material contacts the starter seed and causes the partial melt back thereof . the component material is subsequently solidified by a thermal gradient moving vertically through the crucible 100 ; e . g ., the component is solidified epitaxially from the unmelted portion of the starter seed to form the single crystal component . the thermal gradient used to solidify the component may be produced by a combination of mold heating and mold cooling ; e . g ., using a mold heater , a mold cooling cone , a chill plate and withdrawal of the component being formed . as indicated above , the aforesaid description is an example of how a single crystal microstructure component may be formed , and the present disclosure is not limited thereto . now referring again to the embodiment described in fig8 , a single crystal starter seed or grain selector may be utilized to enable the component “ w ” to possess a single crystal microstructure ( or other ds microstructure ) during solidification ( step 206 ). the solidification may utilize a chill block in a directional solidification furnace . the directional solidification furnace has a hot zone that may be induction heated and a cold zone separated by an isolation valve . the chill block and additively manufactured crucible 100 may be elevated into the hot zone and filled with molten super alloy . after the pour , or being molten , the chill plate may descend into the cold zone causing a solid / liquid interface to advance from the partially molten starter seed , creating the desired single crystal microstructure ( or other ds microstructure type ) as the solid / liquid interface advances away from the starter seed . the formation process may be performed within an inert atmosphere or vacuum to preserve the purity of the component material being formed . following solidification , the additively manufactured crucible 100 may be removed from the solidified component “ w ” by various techniques ( e . g ., caustic leaching ), thereby leaving behind the finished single crystal component ( step 208 ). after removal , the component w may be further finished such as by machining , threading , surface treating , coating or any other desirable finishing operation ( step 210 ). now referring to fig9 and 10 , in another non - limiting embodiment a method 300 includes additively manufacturing a component “ w ” ( e . g . a turbine blade , vane , etc .) having internal cooling passages ( step 302 ) and a crucible 100 . in this embodiment , the component “ w ” and the crucible 100 are additively manufactured using a multi - feedstock process such as a two - powder bed system . a structure 130 of the component w is manufactured of the desired superalloy , while the core 102 and shell 104 of the crucible 100 are manufactured of a different material such as a ceramic , a refractory metal , or other material which is later removed ( fig1 ). with respect to the internal cooling passages of the component “ w ”, during the additive manufacturing process , a ceramic material , a refractory metal material , or other core 102 material is formed at the locations within the layers of the additively formed structure to coincide with the locations of the voids that will form the passages within the component . the core 102 within the component structure 130 and the shell 104 that surrounds the component structure 130 are later removed ; e . g ., in a manner as described above . the structure 130 of the component w , being additively manufactured , may be a polycrystalline superalloy . as indicated above , it may be desirable for the component structure 130 to have a single crystal microstructure ( or other ds microstructure ) that is better suited to withstand the high temperature , high stress operating environment of the gas turbine engine . to thereby facilitate formation of a component having a single crystal microstructure ( or other ds microstructure ), the additively manufactured superalloy structure 130 is re - melted within the crucible 100 ( step 304 ). for example , the additively manufactured superalloy structure 130 may be re - melted and directionally solidified ( e . g ., as described above ) to form a metal single crystal structure ( or other ds microstructure ) within the crucible 100 . as indicated above , the present disclosure is not limited to any particular technique for creating the single crystal microstructure . following solidification , the additively manufactured crucible 100 may be removed from the solidified component w such as by caustic leaching , to leave the finished single crystal component ( step 306 ). after removal , the component w may be further finished such as by machining , threading , surface treating , coating or any other desirable finishing operation ( step 308 ). now referring to fig1 and 12 , a method 400 according to another non - limiting embodiment includes additively manufacturing component “ w ” with a multi - feedstock additive manufacturing process such as three - powder bed system ( step 402 ). the component “ w ” 140 is manufactured of the desired superalloy while the core 102 and shell 104 of the crucible 100 are manufactured of a different material ( fig1 ). locations for the internal cooling passages 142 of the component “ w ” are additively manufactured of ceramic material and locations for microcircuits 144 of the component “ w ” are additively manufactured of a refractory metal material . the microcircuit 144 is relatively smaller than , and may be located outboard of , the internal cooling passages 142 to facilitate tailorable , high efficiency convective cooling . the bodies formed to create the microcircuits may be formed of refractory metals ( e . g ., molybdenum ( mo ), tungsten ( w ), etc .) that possess relatively high ductility for formation into complex shapes and have melting points that are in excess of typical casting temperatures of nickel based superalloys . refractory metals of this type can be removed by various know techniques ( e . g ., chemical removal , thermal leeching , oxidation methods , etc .) to leave behind a cavity forming the microcircuit 144 . as described above , to facilitate formation of a component having a single crystal microstructure ( or other ds microstructure ), the additively manufactured component 140 is re - melted within the crucible 100 ( step 404 ) formed in step 402 , and subjected to processes for creating the single crystal microstructure ( or other ds microstructure type ) within the component 140 . as indicated above , the present disclosure is not limited to any particular technique for creating the single crystal microstructure . following solidification , the additively manufactured crucible 100 may be removed from the solidified component w such as by caustic leaching , to leave the finished single crystal component “ w ” 140 ( step 406 ). after removal , the component “ w ” may be further finished such as by machining , threading , surface treating , coating or any other desirable finishing operation ( step 408 ). now referring to fig1 and 14 , a method 500 according to another disclosed non - limiting embodiment includes additively manufacturing component “ w ” with a multi - feedstock additive manufacturing process such as two - powder bed system ( step 502 ). the component “ w ” 150 is manufactured of the desired superalloy while microcircuits 152 of the component “ w ” are additively manufactured of a refractory metal material . that is , the refractory metal material is additively manufactured within the structure 150 where the microcircuits 152 will be located . in this embodiment , the internal cooling passages 154 of the component w may be filled with a ceramic slurry to form the core 102 ( step 504 ). the slurry may include , but is not limited to , ceramic materials commonly used as core materials including , but not limited to , silica , alumina , zircon , cobalt , mullite , and kaolin . in the next step , the ceramic core may be cured in situ by a suitable thermal process if necessary ( step 506 ). next , a ceramic shell may then be formed over the component 150 and internal ceramic core ( step 508 ). the ceramic shell may be formed over the component 150 and ceramic core by dipping it into ceramic powder and binder slurry to form a layer of ceramic material covering the component 150 . the slurry layer is dried and the process repeated for as many times as necessary to form a green ( i . e . unfired ) ceramic shell mold . the thickness of the green ceramic shell mold at this step may be from about 0 . 2 - 1 . 3 inches ( 5 - 32 mm ) the green shell mold may then be bisque fired at an intermediate temperature to partially sinter the ceramic and burn off the binder material . the mold may then be high fired at a temperature between about 1200 ° f . ( 649 ° c .) to about 1800 ° f . ( 982 ° c .) from about 10 to about 120 minutes to sinter the ceramic to full density to form the shell mold . as described above , to facilitate formation of a component having a single crystal microstructure ( or other ds microstructure ), the additively manufactured component is re - melted within the crucible 100 ( step 510 ), and subjected to processes for creating the single crystal microstructure ( or other ds microstructure type ) within the component 150 . as indicated above , the present disclosure is not limited to any particular technique for creating the single crystal microstructure . following solidification , the additively manufactured crucible 100 may be removed from the solidified component w such as by caustic leaching , to leave the finished single crystal component “ w ” 150 ( step 512 ). after removal , the component “ w ” may be further finished such as by machining , threading , surface treating , coating or any other desirable finishing operation ( step 514 ). now referring to fig1 and 16 , a method 600 according to another disclosed non - limiting embodiment facilitates a high quality surface finish . as described above , the component “ w ” is additively manufactured of a desired superalloy that itself forms the cavity pattern for the crucible . the additively manufactured component “ w ” is then re - melted within the crucible to facilitate formation of the single crystal microstructure . however , the crucible , being formed by the additive manufactured structure , may have a relatively poor surface finish typically not acceptable for use as a blade or vane in the gas turbine engine . that is , the airfoil surfaces of the blade and vanes in the gas turbine engine necessarily require particular contour tolerances and surface finishes that are typically not achieved by direct additive manufacture or may not be achieved in an additive manufacturing process within a reasonable cycle time . to further improve the finish of an exterior surface of a component “ w ” 160 ( additively manufactured according to any of the above - described embodiments ), a relatively thin layer of a wax material 166 may be applied to an external , aerodynamic surface 168 ( e . g . an airfoil surface ) of the component 160 ( step 604 ; fig1 ). the wax material provides a smoother surface finish than the relatively rough surface of an additively manufactured component 160 . next , a ceramic shell 104 is formed over the structure 160 ( step 606 ). the ceramic shell may be formed over the additively manufactured structure 160 by dipping or other process . the relatively thin layer of a wax material 166 is subsequently removed ( step 608 ). the relatively thin layer of a wax material 166 may be removed by heating or other operation that but does not otherwise effect the additively manufactured structure 160 . then , as described above , to facilitate formation of the single crystal microstructure ( or other ds microstructure ), the additively manufactured superalloy structure 160 is re - melted within the shell of the crucible ( step 610 ), and subjected to processes for creating the single crystal microstructure ( or other ds microstructure type ) within the component 150 . as indicated above , the present disclosure is not limited to any particular technique for creating the single crystal microstructure . it should be further appreciated that the re - melting ( step 610 ) may alternatively be combined with the removal of the relatively thin layer of a wax material 166 ( step 608 ). following solidification , the solidified component w may be removed from the crucible by caustic leaching , to leave the finished single crystal structure 160 of the component w ( step 612 ). after removal , the component w may be further finished such as by machining , threading , surface treating , coating or any other desirable finishing operation ( step 614 ). the method disclosed herein facilitates the relatively rapid additive manufacture of single crystal microstructure ( or other ds microstructure type ; e . g ., columnar grain ) components with complex internal passages and heretofore unavailable surface finishes to withstand the high temperature , high stress operating environment of a gas turbine engine environment . while some of the illustrative embodiments described herein related to the use of metal materials , other materials may be used . for example , in some embodiments a material that may be used may include silicon . it should be understood that relative positional terms such as “ forward ,” “ aft ,” “ upper ,” “ lower ,” “ above ,” “ below ,” and the like are with reference to the normal operational attitude of the vehicle and should not be considered otherwise limiting . it should be understood that like reference numerals identify corresponding or similar elements throughout the several drawings . it should also be understood that although a particular component arrangement is disclosed in the illustrated embodiment , other arrangements will benefit here from . although particular step sequences are shown , described , and claimed , it should be understood that steps may be performed in any order , separated or combined unless otherwise indicated and will still benefit from the present disclosure . the foregoing description is exemplary rather than defined by the limitations within . various non - limiting embodiments are disclosed herein , however , one of ordinary skill in the art would recognize that various modifications and variations in light of the above teachings will fall within the scope of the appended claims . it is therefore to be understood that within the scope of the appended claims , the disclosure may be practiced other than as specifically described . for that reason the appended claims should be studied to determine true scope and content .	5
the inventors show that dpn can be performed accurately in single plasmonic microwells . furthermore , they have shown that the se ( r ) rs readout of these single microwell array dots can be read in isolation by fast line scanning ( see fig1 b , c and d ) or excited remotely from a point close to but not exactly on the collection point ( when collecting in a confocal or semi - confocal set - up .) the inventors also show that it is possible to write lines of material onto non - flat nanostructured surfaces using suitable cantilevers and methods . the lithography method differs according to the type of se ( r ) rs surface used . for example , nanostructured gold surfaces of the type detailed by perney and co - workers [ 13 ] ( and shown in fig1 a ) rely on a inverse pyramid structure with topography and spatial features on the microscale (˜ 1 . 3 μm pitch ). this design feature is necessary to create surface plasmon resonances and areas of strong electric field ( necessary for se ( r ) rs enhancement ) at the surface . the surface topography means that it is very difficult to print evenly into this small 3d domain , by conventional methods . furthermore , each surface “ well ” also contains a large amount of roughened gold . points of curvature or features suitable for enhancing the local electric field , further increase the enhancement effect of the se ( r ) rs ( or fluorescence signals ). these ( often delicate ) sub wavelength sized features are integral to almost all se ( r ) rs substrates . therefore , any contact lithography method cannot deploy a large force to critical areas , without damage occurring . too great a force acting on the surface damages the gold surface , causing scratches and damaging the delicate nanostructured interior of the well , ultimately resulting in both a reduction in both se ( r ) rs enchantment and the reproducibility of the signals arising from each feature . this is important as a scratch or area where gold particles are brought together in close proximity may result in a significant increase in local se ( r ) rs intensity , whereas an area with little or less roughened gold will result in a decrease in over se ( r ) rs enhancement . dot patterning results in the least potential for sample damage as the tip is lifted between contact points . however , in order to achieve a consistent and strong signal for many se ( r ) rs surfaces it is often necessary to raster the tip within the sample area in order to deliver capture or analyte material to either a ) the whole active area of the feature , or b ) specific areas where the electric field is strongest . this method , along with line patterning across features requires contact to be maintained across areas where significant z travel is required ( such as from centre of one well to another in the example shown in fig1 b ). specifically , it is the combination of the spring constant [ k ] of the cantilever and the aspect ratio of the tip that is critical in achieving effective se ( r ) rs patterning in many types of se ( r ) rs surface . for example , using standard aspect ratio a type pyramid afm / dpn probes ( nanoink , skokie , ill .) it was found that the “ a - frame ” end with a spring constant [ k ] of 0 . 1 n / m was not suitable for dpn lithography on this surface . conversely effective lithography in both line / raster and dot modes can be achieved by the use of a lower spring constant cantilever ( e . g . 0 . 041 n / m ). this is because the force that is applied is smaller when the tip approaches the non - flat regions of the feature and the cantilever is forced to bend . if the aspect ( height to width ) ratio of the tip is smaller than that of the 3d surface feature that is being written , then the sides of the tip will cause damage to the sides of the feature as the afm tries to stay in contact . furthermore , the gains or values in the feedback system to keep the tip in contact cannot be set too high when patterning at higher tip speeds in 3d se ( r ) rs structures . this is due to the fact that the tip will not respond quickly enough to the large change in z height as it approaches microscale features ( such as the side walls of each well in the example in fig1 ). when the tip contacts the side of the well in this way without the lithography device ( e . g . the afm or similar device ) lifting off quickly enough then sample damage will occur to the roughened gold as a disproportionally high force is applied by the x and y motors via the side of the tip to the feature wall . dpn se ( r ) rs arrays can also be patterned using tips that have a ‘ dog - leg ’ or bend . these allow patterning of some surface single faced features , but are not suitable in cases where the feature contains 2 or more facets , unless rotation or realignment is used . 2 ) se ( r ) rs “ reading ”: the relationship between surface features , dpn features and the efficiency of the over se ( r ) rs system . dpn or similar contact lithography can be used to create patterns on non - flat surfaces suitable for se ( r ) rs . if the pattern is written in lines or dotted ( using the methods described above ), then the overall efficiency of the se ( r ) rs array can be optimised . for example , using suitable tip speed , aspect ratio and k ( as described above ), to pattern continuous lines allows patterns to be created that are highly suited to a line scanning raman mapping approach ( fig4 a ). raman line scanning ( e . g . renishaw streamline system ) utilises a line defocused beam to raster across the area to be scanned . a number of spectra are simultaneously recorded from the area under the beam across a large area of the ccd . dpn line writing onto se ( r ) rs substrates creates a new type of biosensor array . by scanning across the written lines orthogonally a highly efficient read - out system is generated . the line focussing is particularly suited to dpn generated arrays as this type of system effectively sacrifices laser power density ( by line focussing ) and increases effective exposure time ( by line scanning ) to compensate . plasmonic se ( r ) rs surfaces of this type primarily contain only monolayer or sub - monolayer amounts of material to be detected , and this is key to the highly sensitive measurements that can be achieved using them . therefore , only low power densities ( order of ˜ 10 − 4 w · cm − 2 ) are suitable for these arrays , as excess power will cause damage to both the analyte / capture material ( either by photo - bleaching / photo - dissociation or localised heating - thermal degradation ). equivalent point mapping / confocal scanning requires the use of neutral density filters ( ndf ) to attenuate the laser power to between 1 to 0 . 01 % of the original power . as the line scanning method utilising only low surface power density , the combined dpn - se ( r ) rs - line scanning array technique is more that 100 times efficient in terms of laser power than both point mapping or scanning confocal raman measurements . the inventors have shown this experimentally where the use of efficient surface modification chemistry ( fig2 ) produces highly efficient and even se ( r ) rs signals from the surface features . using these dpn - directed modification methods it is possible to run a line scanning system at the maximum speed permissible by the stage and ccd . depending on the optics used the line scanning system can read 30 - 60 times more spectra than the equivalent point mapping system . a further advantage of this combined method is the fact sample alignment is minimised . information density in this arrangement can be very high ( and utilise sub - wavelength features due to the information rich spectra of se ( r ) rs ) as the width of the lines can be very small ( currently as small as 14 nm ), however an advantage of the dpn / nanoprobe writing system is that the lines can be many orders of magnitude in length . therefore , as long as the sample is arranged roughly in an orthogonal manner to the laser line spatially then the system will read the sample in a manner similar to a barcode . it is possible to isolate the se ( r ) rs signal from a single well ( fig1 above ). it is also possible to collect the scattered light from a point offset from the major laser focus point . this is due to the fact that the surface plasmons are able to travel several micrometers on gold surfaces ( depending on wavelength and the composition of the substrate ). therefore , it is possible to use dpn to deposit features sufficiently close to a central spot ( under which the region is effectively sacrificed ) in order to gain enhancement and se ( r ) rs from the beam in the surrounding wells . collecting at points either spatially offset ( or by blocking the major focus point through use of optics ) allows the localised heating and photodegradation of the samples to be reduced whilst simultaneously taking advantage of the se ( r ) rs ( fig4 c ). although the se ( r ) rs is weaker at point spatially offset from the laser focus point , it is still strong enough to provide significant signals for detection without the need for complicated or specialist optics . use of a masked or “ hollow ” laser spot can be used to create the inverse of this set - up maximising sensitivity ( but sacrificing the outer surface features in order to enhance the scattering from the central feature / well . in either case , dpn on the 3d surfaces provides the versatility to fabricate such array types . the inventors have also proven that it is possible to use the very narrow se ( r ) rs lines in a spectrum to image directly using a narrow bandpass filter . dpn can be used to either modify the array surface in order to achieve additional functionality or in order to create enhanced or optimised se ( r ) rs conditions . three examples are detailed below : conventionally , se ( r ) rs arises from the molecules very close to the surface feature under examination . this is due to the fact that the electric field decays with distance away from the surface . however , some se ( r ) rs substrates ( such as that shown in fig1 ) possess micro and nanostructures to allow considerable electric field strength to be generated in areas that are a significant distance above the surface . therefore , this allows some se ( r ) rs substrates to function despite the fact that there is an additional layer between the metal surface and the analyte . this material can either be a capture material ( such as the dna and thiol chemistry shown in fig2 and 3 ) or a generic material that increases the effectiveness of the dpn writing for some materials . for example : on gold surfaces thiol chemistry is most often used . however , it is necessary in some cases ( especially using proteins ) that an additional molecular layer is placed between the metal surface and the analyte , in order to provide a “ molecular mattress ” to cushion the interaction between proteins and the gold surface . without this layer the tertiary structure of the protein ( and the effectiveness of the array ) is often lost . although many types of coating can be created by spin - coating or evaporation , it is possible to use dpn to pre - modify the se ( r ) rs surface . this has and advantage in that the dpn can write directly and exclusively into the features of interest , meaning that less material is wasted coating surrounding areas . this also has the effect that surface plasmons are free to propagate across areas of the surface that are not directly involved in scattering ( se ( r ) rs ). this increases the overall efficiency of the array . a large number of materials that can be used to pre - modify surfaces including : a ) thiol - alkylchain - poly - ethylene glycol molecules [ on gold or silver ], or b ) nitrocellulose [ onto any surface ]. nitrocellulose coating is particularly useful as it provides an inert substrate for , for example , protein writing that allows the capture protein to retain its tertiary structure and function . it is possible to write by dpn onto s surface modified by very thin layers of nitrocellulose . the method requires that the tip is first modified by a material that allows protein molecules to interact effectively with it , building up a bulk layer . for gold coated tips the method involves modification using a thiol - polyethylene glycol molecule that is terminated in a carboxylic acid . the tip is then incubated in a buffered solution containing the protein for 30 minutes to several hours . this allows several layers of protein to build up on the surface . dpn writing can then be achieved ( using slower tip speeds than would be used conventionally ) relying on the weak van der waals forces between the nitrocellulose surface and the protein . a full range of dpn pattering can be achieved using this method , including writing onto se ( r ) rs surfaces . signals can be achieved by capture of an analyte molecule . in particular the response of the array is increased significantly by addition of a dye labelled counterpart to the capture protein . with the most efficient detection being achieved if the dye chosen has a electronic absorption maximum that is close to the laser being used for se ( r ) rs excitation and the surface plasmon resonance of the se ( r ) rs substrate . the ability of dpn to place capture chemistry into precise locations either in a particular well or surface feature , or even within a single well , allows a new hybrid detection array to be generated . this type of array is particularly suited to a fast responsive light source such as that provided by piezo controlled micro - mirrors or dynamic structured illumination . the array would rely on a capture chemistry being placed in an area of high electric field within the feature or well , such as the corners or junctions between facets of the microwells shown in fig1 g , h . the addition of a target molecule followed by the addition of a complementary nanoparticle modified counter part has two effects . with precise positioning of the initial capture chemistry , the proximity of the nanoparticle to the surface will have the effect of increasing the local electric field at this point , increasing the se ( r ) rs intensity . however , in addition to this , the addition of the nanoparticle will dramatically affect the reflectivity characteristic of the substrate , with very high sensitivity in a similar manner to a surface plasmon resonance detector . dpn pattering of se ( r ) rs surfaces allows for the first time the creation of a highly sensitive but also selective combined spr - se ( r ) rs monitor array . such an array could be monitored using broadband white ( or suitable monochromatic light ) in order to detect any changes in reflectivity . the substrate surface can also be angle tuned to provide sensitivity at different points in the feature or microwell . upon the detection of a change in reflectivity at a point in the array , the sensor could then scan the area in higher detail / resolution in order to verify and identify via se ( r ) rs the binding event that led to the capture of the large molecule ( e . g . a protein ) or nanoparticle . dpn can be used to create new types of se ( r ) rs substrates . this relies on the fact that the strongest local electric field occur on features that that have sub - wavelength dimensions . dpn can be used to place capture chemistry in precise locations to selectively immobilise nanoparticles , nanorods or similar nanomaterials in spatial arrangements such that the local electric field is maximised . dpn can also be used to create patterns of lines , curves and dots that can then be selectively etched and metalized in order to create structures that have surface plasmon resonances at suitable wavelengths for efficient se ( r ) rs detection . thus , initial dpn writing can be carried out to apply a coating material onto a substrate , which can capture se ( r ) rs active material , or it is possible to write passifying materials into areas where it is necessary to ‘ keep clear ’ for the purposes of efficient surface plasmon propagation . in one embodiment the present invention is the combination of dip pin nanolithography to deposit the capture or analyte molecules in dimensions appropriate for optimal se ( r ) s signals ( i . e . the near field ). this is a novel approach method is applicable with many of the structured metal surfaces used to provide the surface enhancement for se ( r ) rs which are incorporated herein by reference . [ ref 13 ] for instance a routinely available surface is klarite ® which contains inverted square based pyramids where the dimensions of the pyramid are 1 . 3 microns . to deposit into an individual well using conventional techniques is almost impossible , however , the use of dpn has allowed the deposition of materials into the individual micron sized wells and subsequent examination by se ( r ) rs . furthermore , dpn allows patterning in dimensions well below the diffraction limit . detection by quantum dots , molecular fluorescence or other rayleigh scattering methods is limited in the amount of information that can be embedded into a given spacial area . this is because the optical signature of the reporters in each case are very similar , especially so when using a single wavelength of excitation . quantum dots are an exception to this in that many can be excited in the blue or uv region of the spectrum , whilst retaining distinct fluorescent shifts that allow for up to 608 different reporters within the range of most detectors . however , excitation in the uv or blue is not suitable as background auto fluorescence can be obtained from many sample matrices , in addition to the potential for sample damage . sers or serrs provides an information rich spectrum that can be overlaid with other spectra whilst retaining linearity of the concentration dependant response . therefore , sample spots can be placed by dpn with spacing &# 39 ; s ( pitches ) smaller than the diffraction limit and yet still allow resolution of the features by raman mapping or imaging methods . this allows the spectroscopic “ tag ” and the spatial co - ordinates of the array to be retained in a biosensor array at a resolution many orders of magnitude lower than conventional arrays . in the case of biosensors arrays designed to be read by simple cheap optic techniques and single optical sources , the effective combination of se ( r ) rs , dpn and non - flat plasmon resonant surfaces represents a significant improvement in the art . in addition , the dpn method allows writing of very thin line features of a molecule ( capture or analyte ) material in a manner that is not easily achievable by other ligthography methods . this allows even greater throughput to be achieved using suitable optics and mapping methods . for example writing se ( r ) rs active line features onto a non flat plasmon resonance surface allows the pattern to be read very quickly and effectively by raman line mapping methods . the line mapping method works by focussing the excitation source into a line and rastering over the surface , orthogonally to the deposited line on the surface , simultaneously collecting spectra from a large number of points along the line . by placing the dpn generated lines for example horizontally in the array maximum throughput can be achieved ( see fig4 a below ). in addition this “ barcode ” type readout removes the need for x and y spacial correlation , as the line length in the x axis is very long compared with the y . again this allows the throughput of the biosensor array to be maximised . the readout simply begins at the start and rasters through the entire array vertically in x . the line thickness of the features in dpn can be as small as 14 nm . as stated above a major advantage of sers is that multiple target spectra can be overlaid and read without significant hindrance . therefore , a simple mapping system with a lateral resolution of approximately 1 μm could potentially read out 30 or more reporters within this spacial region . current biosensors arrays have feature sizes in the in the range 3 - 80 μm utilizing only a single reporter in each spot . combined se ( r ) rs - dpn generated arrays can possess many orders of magnitude more information density per unit area . furthermore the surface plasmons are able to travel a significant distance over the surface in some cases . this allows capture / analyte dot features to be placed in such an arrangement that a strong laser could be directed at a different point ( such as a central point — as shown in fig4 c ) and the optics adapted to read sample points around the central laser delivery point . this allows potential surface burning / damage or localised heating to be reduced ( on the spot where the laser is directed ) whilst spectra can be read from each array dot point surrounding the sample due to the travelling surface plasmons ( see fig4 c ). scattering ( including se ( r ) rs ) will be produced at these points remote from the initial laser focus point . dpn allows the placement of samples with such precision ( i . e . within the surface plasmon travel distance ) to allow this type of array to be generated . this also significantly increases the amount of individual locations that can be read by a single point mapping or readout system . the combination of dpn , se ( r ) rs and structured plasmonic substrates is ideally suited to structured or patterned illumination . more specifically , optical methods exist whereby complex patterns of lines or dots can be obtained using diffractive or similar optics . these lines or dots can be generated with special very small resolutions making them ideal illumination sources for large dpn patterned arrays ( see fig4 a - b ). 1 r . d . piner , j . zhu , f . xu , s . hong , c . a . mirkin , science 1999 , 283 , 661 . 1 l . m . demers , d . s . ginger , s - j . park , z . li , s - w chung , c . a . mirkin , science 2002 , 296 , 1836 . 1 l . m . demers , s - j park , t . a . taton , z . li , c . a . mirkin , angew . chem . int . ed . 2001 , 40 , 3071 . 1 d . s . ginger , h . zhang , c . a . mirkin , angew . chem . int . ed . 2004 , 43 , 30 ( and references therein .) 1 t . vo - dinh , k . houck , d . l . stokes , anal . chem ., 1994 , 66 ( 20 ), 3379 - 3383 . 1 l . r . allain , t . vo - dinh , anal . chim . acta ., 2002 469 , 149 - 154 . 1 y . c . cao , r . jin , c . a . mirkin , science , 2002 , 297 ( 5586 ), 1536 - 1540 . 1 r . j . stokes , a . macaskill , p . j . lundahl , k . faulds , w . e . smith , d . graham , small 2007 , 3 ( 9 ), 1593 - 1601 . 1 r . j . stokes , a . macaskill , j . a . dougan , p . g . hargreaves , h . m . stanford , w . e . smith , k . faulds , d . graham , chem . commun . 2007 , 2811 - 2813 . 1 a . j . haes , c . l . haynes , a . d . mcfarland , s . zou , g . c . schatz , and r . p . van duyne , mrs bulletin , 2005 , 30 , 368 . 1 l . r . allain , t . vo - dinh , anal . chim . acta ., 2002 , 469 , 149 - 154 . 1 daniel m . kuncicky , brian g . prevo and orlin d . velev , j . mater . chem ., 2006 , 16 , 1207 . 1 n . m . b . perney , j . j . baumberg , m . e . zoorob , m . d . b . charlton , s . mahnkopf , c . m . netti , optics express , 2006 14 ( 2 ), 847 - 857 . 1 ( a ) d . graham , c mclaughlin , g . mcanally , j . c . jones , p . c . white , w . e . smith , chem commun . 1998 , 1187 . ( b ) g . m . mcanally , c . mclaughlin , r . brown , d . robson , k . faulds , d . r . tackley , w . e . smith , d . graham , analyst , 2002 , 127 , 838 . 1 r . j . stokes , a . ingram , j . gallagher , d . armstrong , w . e . smith , d . graham , chem . commun . 2008 , 567 . 1 k . faulds , f . mckenzie , d . graham , angew . chem . int . ed . 2007 , 46 , 1829 - 1831 .	6
turning to fig4 , a cycler 30 includes a dialysate container 11 connected to a pump 31 . the pump 31 is connected to a pressure sensor 32 . the pump 31 and pressure sensor 32 are disposed in - line in a lumen 33 that connects the dialysate container 11 to a catheter 34 . control valves are provided at 35 , 199 . a drain container 13 is also connected to a pump 36 which is connected to a sensor 37 . the pump 36 and sensor 37 are also connected in - line to a lumen 38 which connects the drain container 13 to the catheter 34 . control valves are again provided at 41 , 42 . during the fill , the pump 31 pumps dialystate from the container 11 through the lumen 33 and catheter 34 into the peritoneum ( not shown ) of the patient 12 . during this time , the sensor 37 monitors and measures the intraperitoneal pressure . a signal is sent to the controller of the cycler 30 shown schematically at 43 . a control panel is indicated generally at 44 . during the drain , the sensor 32 can accurately monitor and measure the intraperitoneal pressure of the patient 12 . in the embodiment illustrated in fig4 , no pumps or control valves are disposed between the sensor 32 and the patient 12 . turning to fig5 , a cycler 50 is illustrated which includes reversible pumping chambers 51 , 52 with sensors 53 , 54 disposed between the reversible pumping chambers 51 , 52 and the patient 12 respectively . control valves 55 and 56 are disposed on another side of the reversible pumping chamber 51 and the sensor 53 and control valves 57 , 58 are provided on either side of the reversible pumping chamber 52 and sensor 54 . the sensors 53 , 54 actually measure the pressure on the diaphragms of the reversible pumping chambers 51 , 52 . turning to fig6 , a cycler 60 is illustrated with a chamber 61 for accommodating the drain container 13 and a chamber 62 for accommodating the dialysate container 11 . each chamber 61 , 62 is equipped with an integrated valve assembly and pressure sensor shown at 63 , 64 . in the embodiment 60 shown in fig6 , the chamber 61 must be capable of being evacuated . dialysate may flow from the dialysate container 11 by way of gravity or pressure fill . again , the sensors of the valve assembly / sensor combinations 63 , 64 monitor the intraperitoneal pressure of the patient 12 as discussed above . in the embodiment 70 illustrated in fig7 , the dialysate container 11 and drain container 13 are both connected to integrated control valves and pressure sensors 71 , 72 . each of the integrated control valves and pressure sensors 71 , 72 are connected to lumens 73 , 74 respectively which are connected to the catheter 75 a by way of a y - connection . the details of all the y - connections and clamps are not shown but are known to those skilled in the art . flow from the dialysate container 11 to the patient is carried out under the gravitational head shown at 75 while flow from the patient to the drain container 13 is carried out under the gravitational head shown at 76 . fig8 illustrates one in - line pressure sensor 80 that is suitable for use with the present invention . redundant load cells 81 , 82 are connected to the flexible pressure sensing membrane 83 by a vacuum connected by the line 84 , 85 . a lumen connecting the cycler to the patient is shown at 86 . fig9 illustrates a dual - pumping chamber cassette 87 which includes an output line 88 which connects the cassette 87 to the patient and an input line 89 connecting the patient to the cassette 87 . the line 90 connects the cassette 87 to the dialysate container ( not shown ). each pumping chamber 91 , 92 are in communication with all three lines 88 , 89 and 90 . thus , every line can be connected to either pumping chamber 91 , 92 . the pumping chambers 91 , 92 are bound on one side by a common diaphragm shown at 93 . flow is controlled by the use of diaphragm valves shown at 94 , 95 , 96 and 97 . pressure sensors are shown at 120 , 121 , 122 , 123 , 124 , 125 . however , pressure sensors 123 and 120 are the sensors used to measure intraperitoneal pressure in accordance with the present invention . the remaining sensors 121 , 122 , 124 , 125 are used to monitor the operation of the pumps 126 , 127 . when the left diaphragm pump 126 is pushing dialysate to the patient , the sensor 123 can measure the intraperitoneal pressure through the line 89 . when the left diaphragm pump 126 is draining fluid from the patient through the line 89 , the sensor 120 can measure intraperitoneal pressure through the line 88 and while the right pump 127 is pumping fluid to the drain container ( not shown ) through the drain line shown schematically at 128 . when the right diaphragm pump 127 is being used to drain fluid from the patient , the sensor 120 can measure intraperitoneal pressure while the left diaphragm pump 126 is pumping fluid to the drain container ( not shown ) through the drain line shown schematically at 129 . fig1 and 11 illustrate a dual - lumen catheter 100 which includes separate passageways 101 , 102 . the employment of a dual lumen catheter 100 as compared to a dual lumen patient line can move the point at which the pressure is measured to within the peritoneum itself by way of communication through the separate flowpaths 101 , 102 . the dual lumen catheter 100 installs like a single lumen catheter , yet will function either as a flow through or a standard catheter . both fluid pathways 101 , 102 are used to withdraw and deliver fluid during the drain and fill . while one pathway delivers fluid , the other pathway drains . the end section , shown generally at 103 , is perforated . a comparison of an apd therapy for a prior art apd cyclers and one manufactured in accordance with the present invention are summarized as follows : inspection of table 1 shows that cycler 1 woke the patient at around 4 : 30 in the morning with a negative uf alarm at the beginning of fill 5 . the patient bypassed the alarm because he did not feel overfull and immediately fell back asleep . he woke up about minutes later when he had difficulty breathing and felt extremely overfull . he manually drained about 1500 ml but was unable to go back to sleep . he filed a formal product complaint with the manufacturer . the data of table i shows that cycler 2 ran a completely normal therapy but the total therapy clearance ( calculated based upon the sum of the night patient volumes ) was only 84 . 5 % of that obtained by cycler 3 , which was using the cycler that used the method of the current invention . the data of table 1 shows that cycler 3 ran a completely normal therapy and that the fill volume was limited on one occasion by the maximum fill volume but on four occasions by the patient &# 39 ; s intraperitoneal pressure . this patient never felt any discomfort and had no alarms during the night . the limit on the ipp prevented him from being overfilled even though he had successive drains that were not complete . the volume of fluid in his peritoneum never exceeded 3 liters . the patient on cycler 1 had an intraperitoneal pressure in excess of 14 mm hg during dwells 3 and 4 . his breathing may have been impaired and his heart may have had to work harder but the discomfort was not enough to wake him up from a sound sleep until it peaked at 4 , 099 ml during dwell 5 . in conclusion , the method of the present invention provides for optimum fills and therefore more clearance while preventing overfills that bring discomfort and inhibit the function of vital body organs . a negative uf alarm would seldom occur because overfills of the required magnitude would be prevented by the ipp sensors . in order to calculate the ipp , one may first calculate the patient head height correction using conservation of energy : the velocity v of fluid through the patient line is the same at both ends of the line as is the fluid density , so this equation can be written as ( p 2 − p 1 ) − pa g ( h 2 h ,)+ frictional losses = 0 frictional losses = 39130 ( gram / cm )/( cm 2 - sec 2 ) with flow of 197 cm / min in a 4 mm id line at a velocity of approximately 172 cm / sec , wherein frictional losses = 39130 ( gram / cm )/( cm 2 - sec 2 ) with flow of 197 cmn / min in a 4 mm id line at a velocity of approximately 172 cm / sec , wherein the patient head height can be established at the beginning of each fill . any changes in the head height that occur during the fill can be attributed to an increase in intraperitoneal pressure ( ipp ) since the patient is asleep . turning to fig1 , the concentration gradient between the urea concentration 110 in the patient &# 39 ; s blood and the urea concentration 111 in the dialysate for typical apd cyclers is illustrated graphically . comparing the results illustrated in fig1 and 14 , it is evident that apd cyclers equipped with the sensors of the present invention provide superior results . specifically , the data illustrated graphically in fig1 was obtained using a prior art apd cycler . the data obtained in fig1 was obtained using an apd cycler utilizing two sensors for monitoring intraperitoneal pressure . note that the urea concentration 110 in the bloodstream is lower in fig1 than in fig1 . further note , the dialysate volume or fill volume is lower for the therapy illustrated in fig1 than the therapy illustrated in fig1 . thus , the present invention provides improved urea clearance with lower fill volumes . it should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art . such changes and modifications may be made without departing from the spirit and scope of the present invention and without diminishing its attendant advantages . it is , therefore , intended that such changes and modifications be covered by the appended claims .	0
the present invention can be illustrated by reference to an image display cathode ray tube 10 such as seen in fig1 . the image display cathode ray tube 10 has a neck portion 12 containing electron gun means not shown , which direct an electron beam through the enlarged funnel portion 14 of the tube , to impact upon a phosphor display screen 16 , disposed on the interior surface of the faceplate 18 of the tube 10 . high levels of ambient light such as from sunlight directed onto the faceplate produce multiple reflections from the faceplate surface which make it very difficult to view the display image which is generated by the phosphor screen 16 on the interior surface of faceplate 18 . in a greatly enlarged representation of the faceplate 18 seen in fig2 a conventional phosphor screen 16 is seen disposed on the tube interior side of the faceplate 18 . the optical output surface 20 is the faceplate surface upon which ambient light impacts , and through which the viewer sees the displayed image from the phosphor screen . the index of refraction of a typical vitreous material glass faceplate is about n = 1 . 5 . a buried ion phase layer 22 of a predetermined thickness d 2 is disposed within the faceplate member and spaced by uniformed distance d 1 from the optical output surface 20 of the faceplate 18 . this buried phase ion layer 22 is formed by ion implanting ions such as aluminum or titanium into the vitreous material through the optical output surface 20 at a controlled voltage and ion fluence . it is believed that the aluminum and titanium ions replace silicon ions in the vitreous faceplate by ion exchange and form an equilibrium stoichiometric phase oxide such as al 2 o 3 for implanted aluminum ions , and tio 2 for implanted titanium ions . for the enlarged faceplate cross section seen in fig2 it can be shown that when air is the ambient medium , that impedance matching will be optimized at a wavelength λ 0 if : wherein n 1 is the index of refraction of the vitreous faceplate and d 1 is the distance between the optical output surface and the buried ion phase layer , and from the above it can be shown that where n 2 is the index of refraction of the buried phase and d 2 is the thickness of the buried phase . these equations imply that the index of refraction of the buried phase must be n 1 3 / 2 , and therefore the index of refraction of the buried phase must be larger than that of the vitreous medium . it can also be appreciated from the above equations that the buried ion phase must extend over a thickness of which is approximately equal to 770 angstroms for impedance matching for peak greean output wavelength λ 0 of 5500 angstroms . the index of refraction of al 2 o 3 is approximately equal to 1 . 785 , and the thickness of glass d 1 from the output surface to the buried phase layer 22 to minimize reflection is given by the above analysis of the preferred embodiment demonstrates that a buried ion phase can be formed within a vitreous optical member and the reflectivity from the surface of the optical member can be minimized when the buried ion phase layer has a higher index of refraction than that of the vitreous member or substrate , and that such a buried ion phase can be formed by an ion implantation technique . the optical property of the buried ion phase layer can be controlled by the process variables such as the chemical nature of the implanted ion which controls chemical nature of the buried phase formed within the vitreous member , and also by controlling the energy and flux of the implanted ion which controls the optical dimensions involved in the thickness of the buried phase . ion implantation energies of from about 50 to about 200 kev can be utilized with an ion fluence of about 10 16 to 2 × 10 17 ions per square centimeter . the use of aluminum ions which are implanted to form aluminum oxide buried ion phase layer produces a buried phase layer with an index of refraction of about 1 . 785 . the use of titanium ion as the implanted ion and a buried ion phase layer of titanium dioxide will exhibit an index of refraction of about 2 . 16 so as to be usable with vitreous optical members having a higher index of refraction than the normal faceplate glass . ion implantation of aluminum has been carried out at implantation or ion acceleration energies of about 50 kev and ion concentrations of 7 . 5 × 10 16 ions per square centimeter to 1 . 25 × 10 17 ions per square centimeter , and have yielded significantly reduced reflectivity compared to untreated glass . titanium ions have been implanted at ion implantation energies of about 100 kev with an ion concentration level of 4 × 10 16 titanium ions per square centimeter , and significantly reduced reflectivity has been provided compared to an untreated glass member . a significant advantage of the reduced reflectivity member produced for the present invention is that the vitreous optical output surface is unaltered and such vitreous surfaces are well known to be resistant to environmental attacks such as from high temperatures and humidity and ultraviolet radiation . the vitreous member thus plays the role of an antireflective coating with respect to the buried ion phase layer formed for the present invention . the aluminum and titanium ions are described by way of example . the implanted ion is selected to replace silicon atoms in the vitreous optical member , and to form a transparent or light transmissive guide having a refractive index higher than that of the vitreous optical member . the glass or vitreous optical member may need to be annealed at temperatures of 200 °- 500 ° c . to treat any localized damage caused by the implanted ions , or to stabilize the implanted buried ion layer .	2
in fig1 a complete side view is seen of a walkway of acceleration containing the handrail system of the present invention . the walkway of acceleration consists of 5 areas : area a of boarding at slow speed ; area b of acceleration , area c of maximum speed , area d of deceleration , and area e of exit at slow speed . in fig2 a handrail system for this walkway of acceleration is seen in more detail . the handrail is made up of a great number of fixed length stretches ( 1 ) or handles , and by some extendable elements ( 2 ) inserted between the fixed length stretches ( 1 ), which can be some bellows in the preferred configuration . other configurations are possible without extendable elements ( 2 ), as will be described with reference to fig9 and 10 . in the boarding area , the fixed length stretches ( 1 ) mesh with a slow speed chain ( 3 ). in fig5 it is possible to see in more detail how this meshing takes place . the fixed length stretches ( 1 ) have a rack profile with two valleys ( 1 a and 1 b ). in these two valleys two elements ( 3 a and 3 b ) engage , which preferably are in 2 articulations of the chain ( 3 ), although the only condition necessary is that both elements are firmly joined to the chain . this chain ( 3 ) on moving , pulls the fixed length stretches ( 1 ); whilst the fixed pieces ( 1 ) pull the extendable elements ( 2 ). in this way the movement of the handrail is produced in the slow speed area . in the area of acceleration the transition takes place progressively of the fixed length stretches ( 1 ) from the slow speed chain ( 3 ) to the following chain ( 4 ) which runs at a slightly higher speed ; and from the latter to the successive ones , until the maximum speed chain ( 8 ) is reached . in fig2 an example is shown with 5 transitions in the acceleration , although this logically depends on the speed ratio it is desired to achieve . with greater detail , a fixed length stretch ( 1 ) can be seen in fig4 and 8 making the transition between chains ( 3 ) and ( 4 ). due to the arrangement of the guides ( 3 c ) of the lower speed chain ( 3 ) and the guides ( 4 c ) of the higher speed chain ( 4 ), and to the relative position of both chains ( 3 and 4 ), disengaging of each fixed length stretch ( 1 ) is achieved from chain ( 3 ) in order to mesh it with chain ( 4 ). the process evolves in the following manner : in the first place , the front hook ( 3 a ) of the slow speed chain ( 3 ) leaves the first valley ( 1 a ) of the fixed length stretch ( 1 ). subsequently , the leading hook ( 4 a ) of the high speed chain ( 4 ) occupies this first valley ( 1 ) of the fixed length stretch ( 3 ). simultaneously , the second hook ( 3 b ) of the slow speed chain ( 3 ) leaves the second valley ( 1 b ) of the fixed length stretch ( 1 ). finally , the followed hook ( 4 b ) of the high speed chain ( 4 ) occupies the second valley ( 1 b ) of the fixed length stretch , the fixed piece ( 1 ) becoming that pulled by the high speed chain ( 4 ). this process is repeated in the transition from chain ( 4 ) to chain ( 5 ), from this to chain ( 6 ), and so forth . the speed ratio between chain ( 3 ) and chain ( 4 ) is achieved using a common axle ( 16 ) with 2 pinions ( 3 d and 4 d ) of different diameter and number of teeth . to get greater smoothness in the transition , use can be made of a variable speed gear arrangement , or a cam type system like that described in fig6 . thus , each handrail fixed length stretch ( 1 ) has a profile ( 1 c ) which is pushed by the lever ( 17 ), articulated on the support of wheels 3 d and 4 d , and which in turn is moved by the cam ( 18 ), a gradual acceleration taking place in this way from the speed of the slow chain ( 3 ) to the speed of the fast chain ( 4 ). this cam ( 18 ) is moved by the same axle ( 16 ) of the pinions ( 3 d and 4 d ), whereby synchronization of the movements is guaranteed . of course , other solutions could also be used to transmit the movement to the cam ( 16 ), which would allow the design thereof to be altered . other possible solutions exist to smooth the transition . one of them is to give elastic properties to the extendable element ( 2 ), so that the difference in length between two consecutive expandable elements , in areas of different speed produces a force on the fixed length stretches ( 1 ) in the transition areas , which allows the speed of the fixed length stretches ( 1 ) to be adapted to that of the chain that will engage thereon . the remaining transitions are carried out in an identical manner , whereby each fixed length segment ( 1 ) arrives at the area of maximum speed . here , it is the chain ( 8 ) which moves the fixed length stretches ( 1 ) by the same procedure as described in fig5 . when the area of maximum speed has finished , each fixed length stretch ( 1 ) begins a series of transitions again , reducing the speed in each one thereof , as can be seen in fig3 . the transitions are carried out in the same way as has been described previously in the acceleration , although in this case the higher speed chains are abandoned in order to mesh with the lower speed chains . lastly , in the exit area , each handrail fixed length stretch ( 1 ) meshes with the slow speed chain ( 13 ), turns around in the final part of the walkway , and returns , repeating the same process as has been described previously for the working part . as can be appreciated in fig7 and 8 , the aforementioned guides run immediately inside the profile or belt which constitutes the handrail and defines , at least in the transition areas , two parallel longitudinal paths ( 3 c and 4 c ), through each of which one of the chains circulates ( 3 and 4 ) which converge in this area . between these two chains penetrates the toothed profile of the fixed length stretches ( 1 ), which has two walls { 20 and 21 ) which form a like number of identical , parallel and coincident toothed arrangements , meshing the elements ( 3 a and 3 b ) of the chain ( 3 ) with the toothed arrangement ( 20 ), whilst the elements ( 4 a and 4 b ) of the chain ( 4 ) will mesh with toothed arrangement 21 . for greater stability of the system , the fixed length elements ( 1 ) can also have sheaves or roller elements ( 22 ) which will run on the interior of the profile which forms the guide , as is shown in fig7 and 8 . in fig9 and 10 , a possible handrail configuration is described constituted only by fixed length stretches ( 1 ). in fig9 a possible definition of said handle ( 1 ) can be seen , constituted by two equal parallel and coincident toothed profiles ( 20 and 21 ), by some rolling elements ( 22 ), two in this case , and by the handle ( 23 ) itself , which slides in a profile ( 24 ) complementary to the handle ( 23 ). the profile ( 24 ) has a form such that the entrance slot of the handle ( 23 ) toward the area of mechanisms is hidden for the user . also , the profile ( 24 ) has some longitudinal slots ( 25 ) complementary to the pins ( 26 ) present in the handle ( 23 ). thus they decrease the risk of becoming trapped . evidently other configurations are possible : for example , without pins ( 25 ); with more entrance slots of handles { 23 ) to the area of the mechanism ; with brushes or protective rubber in said slots , etc . in fig9 the fixed length stretch ( 1 ) circulates in the maximum speed area , and the toothed profile ( 21 ) meshes with elements ( 8 a and 8 b ) of the maximum speed chain ( 8 ). fig1 is a detail of the handrail according to the configuration described in fig9 in which a fixed length stretch ( 1 ) is observed entering the hidden area of the mechanism . as can be appreciated , the configuration proposed allows a safety system ( 27 ) to be implemented in a very small slot with respect to the handle ( 23 ).	1
the liquid sample shown in fig1 is contained by its surface tension between surfaces 2 and 7 also shown in fig1 . light 3 from the system source ( such as 74 in fig4 a ) coming through the fiber 11 contained in surface 7 radiates upward 3 through the liquid sample 9 and is collected by the larger fiber or light pipe 6 in the upper surface 2 and sent on to the analysis photometer or spectrometer ( such as 70 in fig4 a ) for absorbance measurements . measurements of the level of fluorescence of samples can be made by adding an excitation filter to the light source ( not shown ) and an emission filter to the detector ( also not shown ) to specifically reject all light from the excitation source at the detector . the level of fluorescence will , thus , be directly dependent on the length of the optical path between the anvils . the excitation can also be brought to the sample 9 through fibers 83 surrounding the collection fiber 6 as is shown in fig2 . this reduces the need for a high level of excitation wavelength rejection on the part of the spectrometer or other detector collecting the light from the sample through collection fiber 6 . samples are loaded onto one of two roughly identical anvil surfaces , usually the lower anvil surface , with a pipetting means 40 , ( fig3 a ) such as a 2 microliter pipetteman ® from the ranin ® corporation of woburn , mass ., part of the tip of which is shown in 40 . the droplet 5 when emptied from the pipette 40 , if of sufficient volume , will spread to cover the lower anvil surface 7 , fig1 which is typically the end of an industry standard sma fiber optic connector 10 , fig3 a ( found as connectors on the ends of optical patch cords like p / n p - 400 - 2 - uv - vis from ocean optics inc . of dunedin , fla .) until it encounters the sharp edge shown as 4 , fig1 . for most sma connectors the approximate 2 mm end diameter can be effectively covered with 2 microliters of sweater or a water - based solutions . alternatively the spread of the sample can be limited by a change in the surface tension characteristic . this is shown in fig1 a and 12 b . here a polymer surface of a material like teflon ™ can be used to limit the spread by the edge of the polymer film to an area bounded either on the inside , as seen at 21 , fig1 a , or outside , as seen at 22 in fig1 b . the second anvil surface 2 is brought into the measurement position 18 , fig3 b , and then into dose proximity 20 to the first anvil surface 7 , fig3 c , making contact with the deposited droplet 5 wetting the entire confining surface before returning to the sample measurement position and drawing up the sample measurement column 9 , fig3 d , shown at 25 . alternatively the anvils can be of unequal size as shown in fig4 a , 4 b , and 4 c . here the lower , larger anvil 8 presents a larger loading target . the sample will stay within the edge 4 defining the boundary of the anvil . when the smaller , upper anvil 13 is brought into sample compression position as shown in fig4 b , the sample will be pulled into the gap between anvils by capillary action . the smaller second anvil diameter serves to center small samples in the measurement path 3 , fig1 when the measurement column 9 , fig4 c , is pulled . the larger diameter 15 is shown in the lower anvil with the smaller fiber 17 in the smaller anvil . by applying blank samples , samples missing the component being analyzed , the difference in transmitted light intensity can be used to characterize the sample according to where l 0 is intensity of transmitted light through the blank sample , a sample with the component being analyzed absent , and l is the intensity of light transmitted through the sample and a is the absorbance value which can be related to the concentration of the component being analyzed by beer &# 39 ; s law which states that for solutions 1 and 2 that ( absorbance   1 ) ( absorbance   2 ) = ( concentration   1 ) ( concentration   2 ) thus , when compared with a blank sample , the concentration of the component of interest being analyzed can be directly determined from the absorbance a . alternatively , the sample 32 can be loaded as shown in fig1 where the pipette tip 40 applies the sample to the space between the anvils while they are ion close proximity as in the compression position shown in fig3 c . this is similar to the sample loading procedure taught by gross et al . the measurement column can then be drawn to an appropriate length and the photrometric or spectrophotometric measurement made . the sma optical fiber connectors can be held in place by apparatus shown in fig5 a and 5 b . the light from the system source 74 ( ocean optics inc . p / n dt - 1000 , a combined deuterium arc and quartz halogen incandescent lamp , alternatively a xenon flashlamp can be used ) is coupled through a bifurcated optical fiber assembly 78 ( ocean optics inc . p / n bif - 100 - 2 - uv - vis ) to the apparatus 50 with the second fiber of the bifurcated assembly 78 going to reference slave spectrometer 72 ( ocean optics p / n sd2000 ). the sma connectors 53 are mounted to the apparatus by means of threaded couplers 52 ( world precision instruments p / n 13370 ) which are threaded into the apparatus . the swing arm 56 carrying the upper optical fiber 53 can be lowered to align the source with the detection fiber as is shown in 60 , fig4 b . the swing arm spacing is controlled by pin 62 resting on the plunger 67 of solenoid 68 ( lucas ledex of vandalia , ohio p / n 174534 - 033 ) shown mounted below the apparatus . the other end of the solenoid plunger 67 rests on spring plunger 58 ( manhattan supply of plainview , n . y . p / n 82412032 ). the sample can be compressed as is shown in 20 , fig3 c , by manually pushing on the swing arm 56 so as to push the solenoid plunger to the limit of its travel or by actuating the solenoid electrically and pulling the plunger to its stop . the swing arm is held in both its up and its down , position by magnet 64 ( edmund scientific of barrington , n . j . p / n j35 - 105 ) attracted to either post 65 or allen head cap screw 54 . with the swing arm in its raised position , the sample detection surfaces may be cleaned by wiping the sample from both the lower and upper sma connector ends before reloading . light transmitted through the sample is collected by the upper fiber and coupled to the detection master spectrometer 70 ( ocean optics p / n sd2000 ). the fiber is confined to minimize flexure of the fiber which would cause unnecessary variability in its transmission and thus unnecessary variation in measured absorbances . the swing arm is precision pivoted on a shaft turning in two preloaded ball bearings 66 . note that the instrument is opened by turning the swing arm 50 through an arc sufficient to permit loading and cleaning of the anvil surfaces . see fig5 a . preferably it is opened at least 90 degrees as seen in fig5 a and more preferably the arc approaches 160 degrees as seen in fig7 . in order to accomplish illumination of the sample for fluorescence as shown in fig2 the upper fiber assembly is made so as to surround the collection fiber 6 with illumination fibers 83 . these would be bundled and illuminated with the source wavelength compatible for use with the sample . as seen in fig6 a and 6 b , two or more of the photometeric devices can be grouped in unitary form to measure multiple samples simultaneously . such a multiple parallel photometer system can be employed with a multi - pipette robot system such as the multiprobe ii made by packard instrument company of meriden , conn . in fig6 the four signal fibers 53 ( which correspond to fiber 6 of fig1 ) each feed a fiber optic spectrometer and the spectra are taken simultaneously . the four source fibers , not shown , are illuminated from a single source which may be referenced with a single reference spectrometer as with the single channel system . in fig6 b the apparatus is shown closed 100 and , in fig6 a , open for loading 110 . opening and closing are controlled by a rotary actuator 108 such as p / n 195191 - 031 made by lucas ledex of vandalia , ohio and cam 106 . spring plunger 104 such as p / n 3408a35 sold by mcmaster - carr of new brunswick , n . j . controls the position and provides the spring force against which the compression over - travel is accomplished for initial wetting of the upper anvil surface by the sample . samples for photometric analysis can also be loaded into the sample handling apparatus in two parts , one on each of the opposing surfaces . this is especially useful where the sample of interest is a two part reacting mixture where the one or more of the beginning absorbance , the ending absorbance , and the rate of reaction are of interest and can be measured photometrically of fluorometrically . samples of this sort can be loaded into the open spectrophotometer as shown in fig7 where two pipetter tips 205 are shown loading the two parts of the mixture , each on either side of the measurement apparatus 200 . when closed as shown in fig5 b , measurement can be made from onset of any reaction . the exact time of sample mixing or the initiation of a reaction can be determined from photometric or fluorometric measurement through the apparatus optical fibers . samples can also be measured with a differential absorbance path as shown in fig8 . here sample absorbance can be measured by changing the optical path over which the absorbance is measured , measuring the sample at each of one or more path lengths , where the difference in path length combined with the difference in transmitted intensity can be used to calculate the sample absorbance . this can be of significant value where the sample is strongly absorbing and the difference in path length can be determined more accurately than the absolute path length of the apparatus in the measurement position . measurements are taken as shown in fig8 where sample 9 is shown with a relatively long path p 1 and with a relatively short path length p 2 between the moveable anvils with one or more path differences δp with the absorbance at the shorter path p 2 being subtracted from the absorbance of one or more of the longer paths to arrive at the absorbance of the sample . samples can also be contained between two thin sheets of optically transparent material like teflon ™ or polyethylene films . as shown in fig9 the same sort of column drawn between the two parts of the sample apparatus can be drawn between the two thin optical sheets 400 where the anvils of the apparatus are wetted to the film surfaces to minimize reflection at the interface and aid in pulling the measurement column . this would be of significant use where samples are corrosive or dangerous to handle for safety reasons and containment of the sample is preferred . the two containing sheets 400 allow the two anvil surfaces 2 and 7 of the sample apparatus to draw the sample 9 into column 410 . differential measurement of the sort discussed above in conjunction with fig8 would be of significant value in this sort of measurement as the effects of the interfaces could be minimized with differential measurement . the two sheets 400 can be replaced by a small vessel 412 , see fig1 , with flexible walls 414 such that the sample contained can be pulled into a measurement column . the column is pulled by pushing the anvils of the apparatus into the film of walls 414 until contact with the sample is made by both films , then drawing the measurement column . if separation of the anvils in the measurement position is less than the separation of the outside surfaces of the containing walls 414 , the compliance of the walls will cause them to remain in contact with the anvils . wetting the anvils before making contact will assist in maintaining contact and in minimizing reflection at the interface between the film and the optical fiber imbedded in the anvil . once the measurement column is pulled , absorbance can be measured as a difference in absorbance between two path lengths .	6
various modifications are possible in various embodiments of the present invention and specific embodiments are illustrated in drawings and related detailed descriptions are listed . accordingly , the present invention is not intended to limit specific embodiments and is understood that it should include all modifications , equivalents , and substitutes within the scope and technical range of the present invention . fig1 is a block diagram illustrating a current - voltage conversion amplifier circuit according to an embodiment of the present invention . referring to fig1 , a current - voltage conversion amplifier circuit 100 includes first to nth light receiving devices pd 1 to pdn , a multiplier unit 110 , a multi input amplifier unit 120 , a multiplexing unit 130 , and an analog digital converter ( adc ) unit 140 . the first to nth light receiving devices pd 1 to pdn , as a device converting optical signal into current signal , may include photodiodes and photo transistors . as light hits , the first to nth light receiving devices pd 1 to pdn generate electrons and positively charged holes and due to this , current signal is generated . the first to nth light receiving devices pd 1 to pdn apply the generated current signal to the multiplier unit 110 . the multiplier unit 110 includes first to nth multipliers 111 to 11 n . the first to nth multipliers 111 to 11 n receive current signals from the first to nth light receiving devices pd 1 to pdn , respectively . the first to nth multipliers 111 to 11 n amplify current signals . the first to nth multipliers 111 to 11 n may operate in a current or voltage mode . when operating in a current mode , the first to nth multipliers 111 to 11 n amplify current signals and then apply the amplified current signals to the multi input amplifier unit 120 . when operating in a voltage mode , the first to nth multipliers 111 to 11 n amplify current signals and after converting the amplified current signals into first voltage signals , applies the converted first voltage signals to the multi input amplifier unit 120 . the multi input amplifier unit 120 includes first to nth multi input amplifiers amp 1 to ampn . an amplified current signal or a first voltage signal and an offset voltage vos are applied to the first to nth multi input amplifiers amp 1 to ampn . when an amplified current signal and an offset voltage vos are applied , the first to nth multi input amplifiers amp 1 to ampn convert them into voltage signals by adjusting a sampling time of a current signal . through the adjustment of a sampling time , the amplification gain of an output voltage signal may vary . when a first voltage signal and an offset voltage vos are applied , the first to nth multi input amplifiers amp 1 to ampn convert the first voltage signal into a second voltage signal . since the first to nth multi input amplifiers amp 1 to ampn cannot adjust a sampling time for voltage signal , amplification according to a predetermined gain is possible only . the first to nth multi input amplifiers amp 1 to ampn apply first and second output signals vout 1 and vout 2 having phases complementary to each other to the multiplexing unit 130 . according to the size of an offset voltage vos , a digital signal output range of the adc unit 140 is determined . the multiplexing unit 130 receives a plurality of first and second output signals vout 1 and vout 2 from the multi input amplifier unit 120 . the multiplexing unit 130 may use an analog multiplexer . the multiplexing unit 130 selects one pair from the plurality of first and second output signals vout 1 and vout 2 and then applies it to the adc unit 140 . the adc unit 140 may use an analog - to - digital signal converter converting an analog signal into a digital signal . the adc unit 140 obtains a difference value between first and second output signals vout 1 and vout 2 in one pair received from the multiplexing unit 130 . the adc unit 140 converts the difference value into a 10 - bit digital signal and outputs it . the current - voltage conversion amplifier circuit 100 amplifies current signals outputted from the first to nth light receiving devices pd 1 to pdn and convert the amplified current signals into voltage signals to output them . when a current signal amplified by the multiplier unit 110 is outputted to the multi input amplifier unit 120 , the multi input amplifier unit 120 may adjust an output gain through the sampling time adjustment of a current signal . fig2 is a circuit diagram illustrating the multiplier shown in fig1 according to an embodiment of the present invention . the multiplier 200 of fig2 is a circuit diagram illustrating the first to nth multipliers 111 to 11 n shown in fig1 . the multiplier 200 includes a start - up unit 210 , a reference voltage generation unit 220 , a discharging unit 230 , a current offset removal unit 240 , a current signal amplifier unit 250 , and a current - voltage selection unit 260 . through a bias terminal ibias , a bias current is applied to a first node n 1 . the voltage of the first node n 1 becomes higher due to the bias current . when the voltage of the first node n 1 is increased to a certain degree , the reference voltage generation unit 220 may have a driving capability . in order to drive the reference voltage generation unit 220 , a first nmos transistor mn 1 of the reference voltage generation unit 220 needs to be turned - on . however , since the magnitude of a bias current is small , the fast voltage rise of the first node n 1 is impossible . the start - up unit 210 helps the fast drive of the reference voltage generation unit 220 . the start - up unit 210 includes a first pmos transistor mp 1 and a first switch sw 1 . in the first pmos transistor mp 1 , a source terminal is connected to a power terminal vdd and a gate terminal and a drain terminal are diode - connected . a source terminal of the first switch sw 1 is connected to the drain terminal and the gate terminal of the first pmos transistor mp 1 and a drain terminal of the first switch sw 1 is connected to the first node n 1 . the start - up unit 210 is driven by a first switching signal s 1 applied to the first switch sw 1 . the first switching signal s 1 has a first voltage level l 1 according to a high state and a second voltage level l 2 according to a low state . when the first nmos transistor mn 1 of the reference voltage generation unit 220 is turned off , the first switching signal s 1 of the second voltage level l 2 is applied to the first switch sw 1 . once the first switch sw 1 is turned - on , a current applied through the first pmos transistor mp 1 is applied to the first node n 1 . since the voltage of the first node n 1 rises faster compared to when a bias current is applied , the fast turn - on of the first nmos transistor mn 1 is possible . when the first nmos transistor mn 1 of the reference voltage generation unit 220 is turned off , the first switching signal s 1 of the second voltage level l 1 is applied to the first switch sw 1 . once the first switch sw 1 is turned off , a current applied to the first node n 1 through the first pmos transistor mp 1 may stop . accordingly , the current consumption of the multiplier 200 may be reduced . the reference voltage generation unit 220 includes first and second nmos transistors mn 1 and mn 2 . a gate terminal of the first nmos transistor mn 1 is connected to the first node n 1 . a drain terminal of the first nmos transistor mn 1 is connected to a second node n 2 and its source terminal is connected to a third node n 3 . a drain terminal of the second nmos transistor mn 2 is connected to the first node n 1 and its source terminal is connected to a ground terminal . a gate terminal of the second nmos transistor mn 2 is connected to a third node n 3 . a light receiving device pd is connected between the third node n 3 and the ground terminal . the first nmos transistor mn 1 is turned - on by the voltage of the first node n 1 applied to its gate terminal . once the first nmos transistor mn 1 is turned - on , the start - up unit 210 stops driving . once the start - up unit 210 stops driving , only voltage by a bias voltage is applied to the gate terminal of the first nmos transistor mn 1 . when light is incident to the light receiving device pd , the reverse biased light receiving device pd applies a current signal to the ground terminal . no current pass is in the reference voltage generation unit 220 . therefore , a current having the same magnitude as a current signal occurring in the light receiving device pd is applied to the second node n 2 through the second pmos transistor mp 2 . since the first nmos transistor mn 1 is in a turned - on state , a current applied through the second pmos transistor mp 2 is applied to the third node n 3 . once the first nmos transistor mn 1 is turned on , the voltage of the third node n 3 rises . a voltage is applied to the gate terminal of the second nmos transistor mn 2 through the third node n 3 and the second nmos transistor mn 2 is turned - on . the voltage of the first node n 1 raised by a bias current is discharged to the ground terminal through the second nmos transistor mn 2 . accordingly , the voltages of the first and third nodes n 1 and n 3 may be maintained as a reference voltage . the discharging unit 230 includes a third nmos transistor mn 3 and a second switch sw 2 . a gate terminal and a drain terminal of the third nmos transistor mn 3 are diode - connected to the third node n 3 . a source terminal of the third nmos transistor mn 3 is connected to a drain terminal of the second switch sw 2 . a source terminal of the second switch sw 2 is connected to the ground terminal . a second switching signal s 2 is applied to a gate terminal of the second switch sw 2 . the second switching signal s 2 has a first voltage level l 1 according to a high state and a second voltage level l 2 according to a low state . as the first nmos transistor mn 1 is turned on , the third node n 3 is in the ground state . a large voltage is applied to the third node n 3 instantaneously by a current applied through the second pmos transistor mp 2 . by the instantaneous large voltage , the voltage of the third node n 3 becomes higher than a voltage by a current signal outputted from the light receiving device pd . at this point , the second switching signal s 2 of the first voltage level l 1 is applied to the second switch sw 2 . the second switch sw 2 is turned - on and the raised voltage of the third node n 3 is discharged to the ground terminal through the third nmos transistor mn 3 . through a discharging process , the magnitude of a current applied through the second pmos transistor mp 2 becomes identical to the magnitude of a current signal outputted from the light receiving device pd . at this point , the second switching signal s 2 of the second voltage level l 2 is applied to the second switch sw 2 and the second switch sw 2 is turned - off . an ideal light receiving device pd generates only a current signal proportional to the amount of incident light . however , a current signal is generated even when light is not incident due to the thermal cause and insulation defect of the light receiving device pd . this is called dark current . in order for accurate current signal measurement and amplification , the current offset removal unit 230 is required . the current offset removal unit 240 includes first to nth current sources cs 1 to csn and first to nth control switches sw 01 to sw 0 n . the current source is a device applying a constant current regardless of an applied voltage . the first to nth current sources cs 1 to csn are connected respectively between source terminals and a power terminal vdd of the first to nth control switches sw 01 to sw 0 n . drain terminals of the first to nth control switches sw 01 to sw 0 n are connected to the second node n 2 and first to nth control signals s 01 to s 0 n are applied to gate terminals , respectively . the first to nth control signals s 01 to s 0 n have a first voltage level l 1 according to a high state and a second voltage level l 2 according to a low state . the magnitude of a dark current generated according to the characteristics of a material constituting the light receiving device pd . accordingly , the first to nth current sources cs 1 to csn activated in accordance with the magnitude of a predetermined dark current are selected . control signals of the second voltage level l 2 are applied to gate terminals of first to nth dark current removal switches sw 01 to sw 0 n connected to the activated first to nth current sources cs 1 to csn . control signals of the first voltage level l 1 are applied to the gate terminals of the first to nth dark current removal switches sw 01 to sw 0 n connected to the inactivated first to nth current sources cs 1 to csn . the activated firsts to nth current sources cs 1 to csn allow a current having a magnitude identical or similar to the magnitude of a dark current to flow . accordingly , a current corresponding to a dark current is not applied to the current signal amplification unit 250 . the current signal amplification unit 250 amplifies the magnitude of a current signal generated from the light receiving device pd . the current signal amplification unit 250 includes second and third pmos transistor mp 2 and mp 3 , first to nth current signal amplification transistors mb 1 to mbn , and first to nth amplification switches swb 1 to swbn . a source terminal of the second pmos transistor mp 2 is connected to the power terminal vdd . a drain terminal and a gate terminal of the second pmos transistor mp 2 are connected to the second node n 2 . a source terminal of the third pmos transistor mp 3 is connected to the power terminal vdd and its drain terminal is connected to a fourth node n 4 . a gate terminal of the third pmos transistor mp 3 is connected to the second node n 2 . accordingly , a gate terminal of the third pmos transistor mp 3 is connected to the drain terminal of the second pmos transistor mp 2 . source terminals of first to nth current signal amplification transistors mb 1 to mbn are connected to the power terminal vdd and their gate terminals are connected to the second node n 2 . drain terminals of first to nth current signal amplification transistors mb 1 to mbn are connected to source terminals of the first to nth amplification switches swb 1 to swbn , respectively . drain terminals of the first to nth amplification switches swb 1 to swbn are connected to the fourth node n 4 and first to nth amplification signals sb 1 to sbn are applied to gate terminals of the first to nth amplification switches swb 1 to swbn . the first to nth amplification signals sb 1 to sbn have a first voltage level l 1 according to a high state and a second voltage level l 2 according to a low state . an output terminal out is connected to the fourth node n 4 . a current signal amplified through the first to nth current signal amplification transistors mb 1 to mbn is outputted to the output terminal out through the fourth node n 4 . since the gate terminals of the first to nth current signal amplification transistors mb 1 to mbn and the second and third pmos transistors mp 2 and mp 3 are all connected to the second node n 2 , an applied gate signal is identical . accordingly , the magnitude of a current flowing in the first to nth current signal amplification transistors mb 1 to mbn and the third pmos transistors mp 3 is identical to the magnitude of a current flowing in the second pmos transistor mp 2 . the magnitude of a current flowing in the second pmos transistor mp 2 is identical to the magnitude of a current signal outputted from the light receiving device pd . therefore , a current having the same magnitude as a current signal outputted from the light receiving device pd is applied to the first to nth current signal amplification transistors mb 1 to mbn . according to the number of the activated first to nth current signal amplification transistors mb 1 to mbn , the amplification of a current signal is adjusted . as one example , in order to amplify a current signal 50 times , first to fiftieth amplification signals sb 1 to sb 50 of the second voltage level l 2 are applied to the gate terminals of first to fiftieth amplification switches swb 1 to swb 50 connected to first to fiftieth current signal amplification transistors mb 1 to mb 50 . a current having the same magnitude as a current signal outputted from the light receiving device pd is applied to the fourth node n 4 through the first to fiftieth transistors mb 1 to mb 50 . accordingly , the 50 times amplified current signal is outputted through the output terminal out connected to the fourth node n 4 . as one example , the cross - sectional areas of the first to nth current signal amplification transistors mb 1 to mbn may be different from that of the second pmos transistor mp 2 . as one example , when the ratios of the cross - sectional areas of the first to nth current signal amplification transistors mb 1 to mbn are increased , the number of transistors in the current signal amplification unit 250 may be reduced . the current - voltage selection unit 260 converts an amplified current signal into a voltage signal . the current - voltage selection unit 260 includes a third switch sw 3 and a resistor r . a drain terminal of the third switch sw 3 is connected to the fourth node n 4 and its source terminal is connected to the resistor r . a third switching signal s 3 is applied to a gate terminal of the third switch sw 3 . the third switching signal s 3 has a first voltage level l 1 according to a high state and a second voltage level l 2 according to a low state . the resistor r is connected between a source terminal of the third switch sw 3 and the ground terminal . in the case of a current signal out mode , a third switching signal s 3 of the second voltage level l 2 is applied to the gate terminal of the third switch sw 3 . the third switch sw 3 is turned - off and an amplified current signal is outputted to the output terminal out through the fourth node n 4 . in the case of a voltage signal out mode , the third switching signal s 3 of the second voltage level l 1 is applied to the gate terminal of the third switch sw 3 . the third switch sw 3 is turned - off and an amplified current signal is applied to the resistor r through the fourth node n 4 . the amplified current signal is converted into a first voltage signal by the resistor r . the first signal is outputted again to the output terminal out through the fourth node n 4 . the multiplier 200 amplifies a current signal outputted from the light receiving device pd . the multiplier 200 removes a dark current generated from the light receiving device pd by the current offset removal unit 240 so as to improve output efficiency . additionally , the current - voltage selection unit 260 converts an amplified current signal into a first voltage signal . by outputting an amplified current signal or converting an amplified current signal into a first voltage signal and outputting it , selective output is possible . fig3 is a circuit diagram illustrating the multi input amplifier shown in fig1 according to an embodiment of the present invention . referring to fig3 , the multi input amplifier unit 300 is identical to the first to nth multi input amplifiers amp 1 to ampn shown in fig1 . the multi input amplifier 300 includes a first amplifier unit 310 , a differential amplifier 320 , a first output unit 330 , a second amplifier unit 340 , and a second output unit 350 . the first amplifier unit 310 includes a first reset switch swi 1 , first to seventh switches sw 1 to sw 7 , and first and second capacitors c 1 and c 2 . one end of the first reset switch swi 1 is connected to a first node n 1 and the other end is connected to a common terminal vcm . an input terminal in is connected to a first node n 1 and a current signal or a first voltage signal is applied to the node n 1 . the first switch sw 1 may be connected to between the first and second nodes n 1 and n 2 . one end of the second switch sw 2 is connected to an offset terminal offset and the other end is connected to a third node n 3 . the third switch sw 3 may be connected to between the second and third nodes n 2 and n 3 . the first capacitor c 1 may be connected to between the second and fourth nodes n 2 and n 4 . the second capacitor c 2 may be connected to between the third and fifth nodes n 3 and n 5 . one end of the fourth switch sw 4 is connected to the fourth node n 4 and the other end is connected to the common terminal vcm . one end of the fifth switch sw 5 is connected to the common terminal vcm and the other end is connected to the fifth node n 5 . one end of the sixth switch sw 6 is connected to the fourth node n 4 and the other end is connected to the fifth node n 5 . the other ends of the sixth and seventh switches sw 6 and sw 7 are connected to the differential amplifier 320 . the first output 330 includes a third capacitor c 3 and eighth and ninth switches sw 8 and sw 9 . one end of the eighth switch sw 8 is connected to a sixth node n 6 and other end is connected to the common terminal vcm . one end of the ninth switch sw 9 is connected to the other end of the sixth switch sw 6 and the other end of the ninth switch sw 9 is connected to the common terminal vcm . the third capacitor c 3 is connected to the sixth node n 6 . one end of the ninth switch sw 9 is connected to the sixth node n 6 and other end is connected to the common terminal vcm . a first output terminal out 1 is connected to the sixth node n 6 . the second amplifier unit 340 includes a second reset switch swi 2 , tenth to 16th switches sw 10 to sw 16 , and fourth and fifth capacitors c 4 and c 5 . one end of the second reset switch swi 2 is connected to the seventh node n 7 and the other end is connected to the common terminal vcm . the common terminal vcm is connected to the seventh node n 7 . the tenth switch sw 10 is connected to between the seventh and eighth n 7 and n 8 . one end of the 11th switch sw 11 is connected to the input terminal in and the other end is connected to the ninth node n 9 . the 12 th switch sw 12 is connected between the eighth and ninth nodes n 8 and n 9 . the fourth capacitor c 4 is connected between the eighth and tenth nodes n 8 and n 10 and the fifth capacitor c 5 is connected between the ninth and 11th nodes n 9 and n 11 . one end of the 13th switch sw 13 is connected to the tenth node n 10 and the other end is connected to the common terminal vcm . one end of the 14th switch sw 14 is connected to the common terminal vcm and the other end is connected to the 11th node n 11 . one end of the 15th switch sw 15 is connected to the tenth node n 10 and one end of the 16th switch sw 16 is connected to the 11th node n 11 . the other ends of the 15th and 16th switches are connected to the differential amplifier 320 . the second amplifier unit 350 includes a sixth capacitor c 6 and 17th and 18th switches sw 17 and sw 18 . one end of the 17th switch sw 17 is connected to the 12th node and the other end is connected to the common terminal vcm . one end of the 18th switch sw 18 is connected to the other end of the 15th switch sw 15 . the other end of the 18th switch sw 18 is connected to the common terminal vcm . the sixth capacitor c 6 is connected to the 12th node n 12 . according to the present invention , a common mode voltage is applied through the command terminal vcm . according to the present invention , the first to 18th switches sw 1 to sw 18 and the first and second reset switches swi 1 and swi 2 may be transistors . fig4 is a signal diagram illustrating clock signals inputted to the multi input amplifier shown in fig3 according to an embodiment of the present invention . referring to fig3 and 4 , the first to 18th switches sw 1 to sw 18 and the first and second reset switches swi 1 and swi 2 in the multi input amplifier 300 of fig3 are turned - on or turned - off by a clock signal of fig4 . the multi input amplifier 300 has a structure that is symmetric on the basis of a first output terminal out 1 and a second output terminal out 2 . accordingly , the same clock signal is applied to switches at the symmetric positions . the drive of the multi input amplifier 300 may be largely divided into a sampling mode and an amplification mode and may then be described . in more detail , referring to fig3 and 4 , first and second reset signals irst 1 and irst 2 are applied to the gate terminals of the first and second reset terminals swi 1 and swi 2 . a first initial value sampling signal qr 1 is applied to the gate terminals of the first and tenth switches sw 1 and sw 10 and a second initial sampling signal qr 2 is applied to the gate terminals of the fourth and 13th switches sw 4 and sw 13 . a first data sampling signal qd 1 is applied to the gate terminals of the second and 11th switches sw 2 and sw 11 and a second data sampling signal qd 2 is applied to the gate terminals of the fifth and 14th switches sw 5 and sw 14 . a first sampling mode signal q 1 is applied to the gate terminals of the ninth and 18th switches sw 9 and sw 18 and a second sampling mode signal q 2 is applied to the gate terminals of the eighth and 17th switches sw 8 and sw 17 . an amplification mode signal q 3 is applied to the gate terminals of the third , sixth , seventh , 12th , 15th , and 16th switches sw 3 , sw 6 , sw 7 , sw 12 , sw 15 , and sw 16 . the first and second reset signals irst 1 and irst 2 , the first and second initial value sampling signals qr 1 and qr 2 , the first and second data sampling signals qd 1 and qd 2 , the first and second sampling mode signals q 1 and q 2 , and the amplification mode signal q 3 have a first voltage level l 1 according to a high level and a second voltage level l 2 according to a low state . a current signal or a first voltage signal amplified from the multiplier 200 ( see fig2 ) is applied to the input terminal in . once the first voltage signal is applied to the input terminal in , a first reset signal irst 1 is applied to the gate terminals of the first and second reset switches swi 1 and swi 2 . the first reset signal irst 1 has the second voltage level l 2 at all times . once an amplified current signal is applied to the input terminal in , the second reset signal irst 2 is applied to the gate terminals of the first and second reset switches swi 1 and swi 2 . once an amplified current signal is applied to the input terminal in , at the initial time t 0 , the amplification mode signal q 3 of the second voltage level l 2 is applied to the gate terminals of the third , sixth , and seventh switches sw 3 , sw 6 , and sw 7 . accordingly , the third , sixth , and seventh switches sw 3 , sw 6 , and sw 7 are turned - off . at the first time t 1 , the second reset signal irst 2 of the first voltage level l 1 is applied to the gate terminal of the first reset switch swi 1 . the first initial value sampling signal qr 1 of the first voltage level l 1 is applied to the gate terminal of the first switch sw 1 and the second initial value sampling signal qr 2 is applied to the gate terminal of the fourth switch sw 4 . accordingly , the first reset switch swi 1 and the first and fourth switches sw 1 and sw 4 are turned - on at the same time . as the first reset switch swi 1 is turned - on , a common mode voltage may be applied to the first node n 1 . an amplified current signal applied through the input terminal in may have an initial voltage as a common mode voltage . at the second time t 2 , the second reset signal irst 2 of the second voltage level l 2 is applied to the gate terminal of the first reset switch swi 1 . as the first switch sw 1 is turned - on , the voltage of the second node n 2 rises in proportion to an input of a current signal amplified based on a common mode voltage . when the voltage of the second node n 2 rises , the amount of electric charges charged to the first capacitor c 1 is increased . as the fourth switch sw 4 is turned - on , a common mode voltage is applied to the fourth node n 4 . at the third time t 3 , the first initial value sampling signal qr 1 of the second voltage level l 2 is applied to the gate terminal of the first switch sw 1 . accordingly , the first switch sw 1 is turned - off and charging the first capacitor c 1 stops . the second initial value sampling signal qr 2 applied to the fourth switch sw 4 shifts into the second voltage level l 2 before the third time t 3 . when the first switch sw 1 is turned - off , electric charges remaining in a channel area of the first switch sw 1 may affect the first capacitor c 1 . an amplified current signal and a first voltage signal applied to the input terminal in may vary according to the magnitude of a current signal generated by the light receiving device pd of the multiplier 200 and the amplification degree of the current signal amplifier unit 250 . since a voltage applied to the first switch sw 1 is not constant , this affects the first capacitor c 1 differently . since a common mode voltage is applied to the fourth node n 4 at all times , this affects the first capacitor c 1 constantly . accordingly , when the fourth switch sw 4 is turned - off first , the fourth node n 4 becomes in a floating state . when the first switch sw 1 is turned - off after a predetermined time , due to electric charges remaining in a channel area of the first switch sw 1 , the voltage of the second node n 2 rises and also the voltage of the fourth node n 4 rises at the same time . since the voltages of the second and fourth nodes n 2 and n 4 rise at the same time , the amount of electric charges charged in the first capacitor c 1 does not change . at the first time t 1 , the first and second sampling mode signals q 1 and q 2 of the first voltage level l 1 are generated . the ninth switch sw 9 is turned - on by the first sampling mode signal q 1 of the first voltage level l 1 and the eighth switch sw 8 is turned - on by the second sampling mode signal q 2 . since a common mode voltage is applied to the both ends of the third capacitor c 3 , the third capacitor c 3 is not charged . according to the present invention , a sampling mode starts at the first time t 1 . at the fourth time t 4 , the first and second sampling signals qd 1 and qd 2 of the first voltage level l 1 are generated . the second switch sw 2 is turned - on by the first data sampling signal qd 1 of the first voltage level l 1 and the fifth switch sw 5 is turned - on by the second data sampling signal qd 2 . an offset voltage is applied to the third node n 3 through the second switch sw 2 . a common mode voltage is applied through the fifth switch sw 5 . accordingly , the amount of electric charges proportional to a difference between an offset voltage and a common mode voltage is charged to the second capacitor c 2 disposed between the third node n 3 and the fifth node n 5 . at the sixth time t 6 , the first data sampling signal qd 1 shifts into the second voltage level l 2 . the second data sampling signal qd 2 shifts into the second voltage level l 2 before the sixth time t 6 . accordingly , after the fifth switch sw 5 is turned - off , the second switch sw 2 is turned - off . this is the same reason that the after the fourth switch sw 4 is turned - off , the first switch sw 1 is turned - off . at the sixth time t 6 , the first sampling mode signal q 1 shifts into the second voltage level l 2 . the second sampling mode signal q 2 shifts into the second voltage level l 2 before the sixth time t 6 . accordingly , after the eighth switch sw 8 is turned - off , the ninth switch sw 9 is turned - off . this is the same reason that the after the fourth switch sw 4 is turned - off , the first switch sw 1 is turned - off . according , at the sixth time t 6 , the sampling mode of a signal is terminated . at the seventh time t 7 , the amplification mode signal q 3 of the first voltage level l 1 is generated . accordingly , the third , sixth , and seventh switches sw 3 , sw 6 , and sw 7 are turned - on by the amplification mode signal q 3 of the first voltage level l 1 . the first sampling voltage generated by the amount of electric charges stored in the first capacitor c 1 is applied to the differential amplifier 320 and the third capacitor c 3 through the sixth switch sw 6 . the second sampling voltage generated by the amount of electric charges stored in the second capacitor c 2 is applied to the differential amplifier 320 and the third capacitor c 3 through the seventh switch sw 7 . the first and second sampling voltages are outputted to the sixth node n 6 through the differential amplifier 320 . according to the present invention , a time of the amplification mode signal q 3 of the first voltage level l 1 is defined as an amplification mode . the gain of a first output voltage outputted to the first output terminal out 1 is determined by a ratio of the capacity of the third capacitor c 3 to the sum of the capacities of the first and second capacitors c 1 and c 2 . in more detail , if the sum of the capacities of the first and second capacitors c 1 and c 2 is identical to the capacity of the third capacitor d 3 , the first and second sampling voltages are outputted as a first output voltage to the first output terminal out 1 . if the capacity of the first capacitor c 1 is two times the capacity of the third capacitor c 3 , twice the first and second sampling voltages are outputted as a first output voltage to the first output terminal out 1 . at the eighth time t 8 , the amplification mode signal q 3 shifts into the second voltage level l 2 . the third , sixth , and seventh switches sw 3 , sw 6 , and sw 7 are turned - off and the amplification mode is terminated . the second amplifier unit 340 and the second output unit 350 have symmetric structures to the first input unit 320 and the first output unit 330 , respectively . at the initial time t 0 , the amplification mode signal q 3 of the second signal level l 2 is applied to the 12th , 16th , and 17th switches sw 12 , sw 16 , and sw 17 . accordingly , the 12th , 16th , and 17th switches sw 12 , sw 16 , and sw 17 are turned - off . at the first time t 1 , the second reset signal irst 2 of the first voltage level l 1 is applied to the second reset switch swi 2 . a common mode voltage is applied to the seventh node n 7 through the second reset switch swi 2 . since a common mode voltage is applied to the seventh node n 7 , it is unnecessary to apply a common mode voltage through the second reset switch swi 2 . however , in order for a symmetric structure of the multi input amplifier 300 , the second reset switch swi 2 exists . at the second time t 2 , the second reset signal irst 2 of the second voltage level l 2 is applied to the second reset switch swi 2 . accordingly , the second reset switch swi 2 is turned - off . at the first time t 1 , the first and second initial sampling signals qr 1 and qr 2 of the first voltage level l 1 are generated . the tenth switch sw 10 is turned - on by the first initial sampling signal qr 1 of the first voltage level l 1 . the 13th switch sw 13 is turned - on by the second initial sampling signal qr 2 of the first voltage level l 1 . a common mode voltage is applied to the eighth node n 8 through the tenth switch sw 10 . a common mode voltage is applied to the tenth node n 10 through the 13th switch sw 10 . the fourth capacitor c 4 is connected to between the eighth node n 8 and the tenth node n 10 . since a common mode voltage is applied to the both ends of the fourth capacitor c 4 , electric charges are not charged to the fourth capacitor c 4 . at the third time t 3 , the first initial value sampling signal qr 1 of the second voltage level l 2 is applied to the tenth switch sw 10 . the second initial value sampling signal qr 2 of the second voltage level l 2 is applied to the 13th switch sw 13 before the third time t 3 . accordingly , after the 13th switch sw 13 is turned - off , the tenth switch sw 10 is turned - off . this is not to affect the amount of electric charges charged to the fourth capacitor c 4 . additionally , at the first time t 1 , the first and second sampling mode signals q 1 and q 2 of the first voltage level l 1 are generated . the second sampling mode signal q 2 of the first voltage level l 1 is applied to the gate terminal of the 17th switch sw 17 . the 17th and 18th switches sw 17 and sw 18 are turned - on and a common mode voltage is applied . since the voltages at both ends are the same , electric charges are not charged to the sixth capacitor c 6 connected between the 17th and 18th switches sw 17 and sw 18 . at the first time t 1 , a sampling mode starts . at the fourth time t 4 , the second reset signal irst 2 of the first voltage level l 1 is applied to the first reset switch swi 1 . accordingly , the first reset switch swi 1 is turned - off . the first data sampling signal qd 1 of the first voltage level l 1 is applied to the 11th switch sw 11 . the second data sampling signal qd 2 of the first voltage level l 1 is applied to the 14th switch sw 14 . the 11th and 14th switches sw 11 and sw 14 are turned - on . once the first reset switch swi 1 is turned - on , an amplified current signal applied through the input terminal in may have an initial voltage as a common mode voltage . at the fifth time t 5 , the second reset signal irst 2 of the second voltage level l 2 is applied to the first reset switch swi 1 . the first reset switch swi 1 is turned - off . an amplified current signal is applied to the ninth node n 9 through the 11th switch sw 11 and the voltage of the ninth node n 9 is increased more than a common mode voltage . a common mode voltage is applied to the 11th node n 11 through the 14th switch sw 14 . the fifth capacitor c 5 is connected between the ninth node n 9 and the 11th node n 11 . accordingly , the amount of electric charges of the fifth capacitor c 5 is charged by the increased voltage of the ninth node n 9 . at the sixth time t 6 , the first data sampling signal qd 1 shifts into the second voltage level l 2 . the second data sampling signal qd 2 shifts into the second voltage level l 2 before the sixth time t 6 . when the 14th switch sw 14 is turned - off , the 11th switch sw 11 is turned - off sequentially . this is not to affect the amount of electric charges charged to the fifth capacitor c 5 . at the sixth time t 6 , the first sampling mode signal q 1 shifts into the second voltage level l 2 . the second sampling mode signal q 2 shifts into the second voltage level l 2 before the sixth time t 6 . when the 17th switch sw 17 is turned - off , the 18th switch sw 11 is turned - off sequentially . this is not to affect the amount of electric charges charged to the sixth capacitor c 6 . at the sixth time t 6 , the sampling mode is terminated . at the seventh time t 7 , the amplification mode signal q 3 of the first voltage level l 1 is generated . the amplification mode signal q 3 of the first voltage level l 1 is applied to the 12th , 15th , and 16th switches sw 12 , sw 15 , and sw 16 . accordingly , the 12th , 15th , and 16th switches sw 12 , sw 15 , and sw 16 are turned - on . at the seventh time t 7 , an amplification mode starts . the fifth sampling voltage generated by the amount of electric charges charged to the fifth capacitor c 5 is applied to the differential amplifier 320 and the sixth capacitor c 6 through the 16th switch sw 16 . the fifth sampling voltage is outputted to the 12th node n 12 through the differential amplifier 320 . the gain of a second output voltage outputted through the second output terminal out 2 is determined by a ratio of the capacity of the sixth capacitor c 6 to the sum of the capacities of the fourth and fifth capacitors c 4 and c 5 . at the eighth time t 8 , the amplification mode signal q 3 shifts into the second voltage level l 2 . the 12th , 15th , and 16th switches sw 12 , sw 15 , and sw 16 are turned - off and the amplification mode is terminated . when an amplified current signal is applied to the input terminal in of the multi input amplifier 300 , a charging time of the first and fifth capacitors c 1 and c 5 charged by the amplified current signal may be adjusted . through a charging time adjustment , the magnitudes of the first and fifth sampling voltages are changed . accordingly , an output gain may be adjusted . by adjusting an applying time of the first initial value sampling signal qr 1 and the first data sampling signal qd 1 , a charging time adjustment is possible . according to an embodiment of the present invention , a current - voltage conversion amplifier circuit may select a voltage and current mode in order for amplification . in the case of a current mode , by adjusting a sampling time of a multi input amplifier , a desired output voltage may be obtained . in describing each drawing , like reference numerals refer to like elements . in the accompanying drawings , the dimensions of structures are exaggerated for clarity of illustration . it will be understood that the terms “ first ” and “ second ” are used herein to describe various components but these components should not be limited by these terms . these terms are used only to distinguish one component from other components . for example , a first component may be referred to as a second component and vice versa without departing from the scope of the present invention . the terms of a singular form may include plural forms unless they have a clearly different meaning in the context . as mentioned above , embodiments are disclosed in the drawings and the specification . although specific terms are used herein , this is just to describe the present invention and does not limit the meaning or the scope of the present invention listed in claims . therefore , it is apparent to those skilled in the art that various embodiments and equivalent other embodiments are possible . hence , the real protective scope of the present invention shall be determined by the technical scope of the accompanying claims .	7
the fastener assembly of the present invention is shown generally at 10 . the assembly 10 comprises a fastener 12 having a head 14 with a first predetermined lateral dimension at one end with drive surfaces thereon , in the case depicted , formed as an internal drive recess 16 . a threaded shank 18 extends from the head and has a second lesser predetermined lateral dimension . depending on the application , the thread may be of the self - tapping variety and the tip may have a drill point 19 to enable the fastener to penetrate a variety of materials . the second element of the assembly 10 is washer 20 which is preferably made of a plastic or elastomeric material . washer 20 has a broad load - distributing flange 22 and a centrally located aperture 24 . the aperture defines a third predetermined lateral dimension which is less than the first but greater than the second predetermined dimension . the upper surface of the flange may be provided with a recess 26 of sufficient size to accommodate the head 14 of fastener 12 . a crushable portion 28 is provided adjacent the aperture 24 for purposes which will be detailed hereafter . the upper surface of the flange 22 may be provided with a locater ring 30 to facilitate positioning of a conventional nosepiece 31 from a power screwdriver ( not shown ). in fig1 fastener assembly 10 is depicted in a partially installed position which , but for the features of the present invention , could exist after installation . roofing insulation board 33 is shown as being warped with steel girt 35 positioned therebeneath . as can be appreciated , without crushable portion 28 , there would be little relative change in position between head 16 of fastener 12 and flange 22 of the washer . since many screwguns rely on such an axial displacement in order to disengage the drive through a clutch or the like , lack of such movement creates a problem . no setting of the depth gauge will be correct for successive applications resulting in a high percentage of underdriven and overdriven fasteners . as depicted in fig2 the insulation board 33 is drawn up against girt 35 before the pre - load of crushable region 28 is overcome and the head reaches its fully seated position . of course the amount of pre - load can be varied for each board application by varying the height and diameter of the crushable region . as viewed in fig2 drive to the driver bit 37 has been disengaged or the bit withdrawn from recess 16 , depending on the type of drive employed , as the fastener assembly is fully seated . an additional benefit is that the material from the crushable region collapses toward the shank 18 providing a seal as well as prevailing torque for the fastener . this assembly insures that a certain preloading of the joint occurs before the drive is disengaged . further , it provides a range of acceptable depth settings for the power screwdriver when no particular setting would have been appropriate before . fig4 show an alternative embodiment of the washer 20 usable in the assembly of the present invention . the crushable region is formed as a cylindrical boss 28 &# 39 ; which can again be varied to fit the application . whether the crushable region takes the form of a cylindrical boss or the fillet of the previous embodiment depends largely on the nature of the material of the washer and the desired crush resistance to establish the preload . fig5 and 6 depict the principles of the invention utilized with a low profile metallic washer . with such a low profile , there would be virtually no relative axial movement without the crushable zone 28 . although the fastener assembly has been depicted as being used with roofing insulation , it will be appreciated that this invention may be used with any compressible material where similar problems might arise . various changes , modifications and alternatives will become apparent following a reading of the foregoing specification . accordingly , it is intended that all such changes , modifications and alternatives as come within the scope of the appended claims be considered part of the present invention .	5
fig1 shows an airbag control unit for motor vehicles complete with function blocks evaluation unit 1 , power unit 2 , and a diagnosis computer 3 . the acceleration signals supplied by two acceleration sensors s1 and s2 are fed into evaluation unit 1 for evaluation ; based on these sensor signals , evaluation unit 1 will determine the vehicle state . if these acceleration signals indicate an impending vehicle crash , ignition commands will be passed via line 1a to power unit 2 . if it receives ignition commands , this power unit will generate ignition signals for the trigger agents of airbags 2b , pretensioning system 2a , and buckle switch 2c . the diagnosis computer 3 monitors and checks the functionality of the entire system . according to fig3 the sensors s1 and s2 are offset against each other by 90 °, and , respectively , by 45 ° against the direction of travel p in vehicle f , so that the sensor signals also provide information with regard to the direction of impact . a hardware implementation of evaluation unit 1 according to fig1 is shown in fig2 and comprises a quantification unit 4 and an evaluation circuit 5 . for quantifying the sensor signals the acceleration signal of sensor s1 will be fed respectively into two comparators k11 and k12 , and the sensor signals of sensor s2 into two further comparators k21 and k22 . a positive and a negative threshold s1n , s1p or s2n , s2p are used as thresholds for quantification : the output of quantification unit 4 thus has 4 lines 4a that are applied to the input of an intermediate storage device 6 designed with d flip flops . on each of these lines the information types &# 34 ; no acceleration &# 34 ;, &# 34 ; positive acceleration &# 34 ;, or &# 34 ; negative acceleration &# 34 ; are available for each sensor s1 or s2 . thus , on 4 lines , there are only 6 different types of information that are buffered by means of intermediate storage device 6 at constant time periods defined by a clock pulse signal clk . to this end , the clock pulse signal clk generated by a clock pulse generator 16 is fed into this intermediate storage device 6 via a line 16a , so that the sensor values are applied at its output until the next clock pulse occurs and are thus available at the same time , via a line 6a , at the input of a post - connected adding stage 7 . in this adding stage 7 , the quantified sensor signals are added up such that their sum , for each clock pulse , is available at the output of the adding stage 7 as a 3 bit vector , which sum is then fed via a line 7a to post - connected processing units . this addition represents an evaluation function which is applied to the quantified sensor signals in order to generate with each clock pulse a sensor signal characteristic , that is , the sum . by way of example , the truth table of such an evaluation function for the two sensors s1 and s2 is to be shown below , with the sensitivity axes of these two sensors being arranged according to fig3 . thus sensor s1 -- viewed in the direction of vehicle travel -- can be designated as a left - hand sensor , and the sensor s2 can be designated as a right - hand sensor . ______________________________________ output addingleft - hand sensor s1 right - hand sensor s2 stage 7s1p s1n s2p s2n vector v dec______________________________________1 0 0 0 0 ( 0 , 0 , 0 ) 02 1 0 0 0 ( 0 , 0 , 1 ) + 13 0 1 0 0 ( 1 , 0 , 1 ) - 14 0 0 1 0 ( 0 , 0 , 1 ) + 15 1 0 1 0 ( 0 , 1 , 0 ) + 26 0 1 1 0 ( 0 , 0 , 0 ) 07 0 0 0 1 ( 1 , 0 , 1 ) - 18 1 0 0 1 ( 0 , 0 , 0 ) 09 0 1 0 1 ( 1 , 1 , 0 ) - 2______________________________________ in the columns &# 34 ; left - hand sensor &# 34 ; and &# 34 ; right - hand sensor &# 34 ; this truth table contains the values generated by quantification unit 4 . here , the value &# 34 ; 0 &# 34 ; indicates that the relevant threshold value was not reached , whilst the value &# 34 ; 1 &# 34 ; indicates that the relevant threshold has been reached . thus , &# 34 ; 0 &# 34 ; signifies that there is neither a positive nor a negative acceleration whilst a &# 34 ; 11 &# 34 ; indicates a positive or negative acceleration . in the column &# 34 ; output adding stage 7 &# 34 ;, located next to the above - described columns , the results of the addition are entered as a 3 bit vector v . finally , the last column is provided for the relevant decimal value . as can be seen from this truth table , the evaluation function is defined such that the direction information contained in the sensor signals is essentially lost . thus the sensor signals received in the event of a vehicle crash involving a front left or front right impact are evaluated as (+ 1 ) ( see lines 2 and 4 ) whilst for a corresponding crash involving a left rear or a right rear impact the evaluation is (- 1 ) ( see lines 3 and 7 ). according to lines 5 and 9 , a crash in the direction of travel or against the direction of travel will be evaluated by (+ 2 or - 2 ). in all other cases -- that is , when the specified thresholds are not reached ,-- a 0 vector is output by adding stage 7 in the event of a vehicle crash involving an impact from right or left ( compare line 6 or line 8 ). these vectors v output by adding stage 7 will be fed via the line 7a into a comparator 8 , a register 9 , and a function unit 10 which calculates the difference and its amount from the vector v currently fed in and a vector v 0 generated during the preceding clock pulse . this vector v 0 is stored in register 9 and will be fed to function unit 10 , via a line 9a , in accordance with the clock pulse . the operation carried out in function unit 10 corresponds to a differentiation followed by subsequent addition of the sum of quantified sensor values ; thus the amount of the increase of successive sum values is applied at line 10a which leads to an integrator 13 . in this integrator 13 , the increase values calculated in successive clock pulses will be added up and then form a crash signal p which is compared to a trigger threshold k2 in a post - connected comparator 14 . if this trigger threshold k2 is reached by crash signal p , the safety devices will be triggered . as only positive values are fed to integrator 13 , the integrator content would always continue to increase monotonously ; this would cause undesirable results to appear . therefore , this integrator 13 must be reset at specified points in time ; this is effected by means of the above - mentioned comparator 8 , a counter 11 , and a further comparator 12 . initially , this integrator 13 is to be reset whenever there is no trigger event within a predefined time period . to this end , the counter value generated by counter 11 will be compared , by means of comparator 12 , with a time constant t r provided by a register ram 15 . if the counter value fed to comparator 12 via a line 11a exceeds this time constant t r , a reset impulse will be fed to integrator 13 via a line 12a . the reset input of counter 11 is connected with the output of comparator 8 which comparator , via a line 8a , feeds its output signals also to an and gate 25 that simultaneously receives clock pulse signal clk . the clock pulse signal clk will thus be released for the integrator 13 only if there is an output signal provided by comparator 8 . an output signal will be generated by comparator 8 if a vector generated by the adding stage 7 exceeds a counting threshold k1 . this counting threshold k1 is provided -- via a line 10a -- by the register ram 15 . by way of example , the truth table of such a comparator 8 is to be shown below . ______________________________________ output vector v comparator 8______________________________________ ( 0 , 0 , 0 ) 0 ( 0 , 0 , 1 ) 1 ( 0 , 1 , 0 ) 1 ( 1 , 0 , 1 ) 0 ( 1 , 1 , 0 ) 0______________________________________ this shows that comparator 8 generates an output signal only for the vectors ( 0 , 0 , 1 ) and ( 0 , 1 , 0 ); that is , only if a crash involving a front left or front right impact or a frontal impact in the direction of travel is to be expected . in such a case counter 11 will be reset to &# 34 ; 0 &# 34 ; and also causes integrator 13 to be reset if the crash signal p generated by integrator 13 does not reach the trigger threshold k2 within the time constant t r . this trigger threshold k2 is also stored in register ram 15 . in all other cases of crash events no output signal is generated so that the increase values determined by these vectors v are not up - integrated within integrator 13 as the clock signal clk does not reach the integrator 13 . the two constants k1 and t r must have been made consistent with each other and will be determined by means of the crash data existing for each vehicle type . here , these constants must be selected such that a trigger event is forced to occur whenever this is required , i . e ., erroneous trigger events must not occur . the process implemented by the circuit layout according to fig2 meets these conditions using appropriately selected constants k1 and t r , and in this way classifies all crash events fully ( 100 %), with ignition delay times remaining within acceptable limits . as the point in time at which the safety devices are triggered must occur within a specified time period following detection of a dangerous crash situation by the sensors , the ignition delay time indicates that time interval which exceeds the aforesaid specified time period . instead of a hardware implementation of the process according to the invention , the evaluation of the sensor signals can also be carried out by means of a simple 4 bit processor . evaluation unit 1 according to fig4 thus comprises a quantification unit 4 and a microprocessor μp . the other function units correspond to those shown in fig1 . a software implementation provided for such a microprocessor μp is shown by the program flow chart according to fig5 . following the start of the program , the program variables p , v 0 , and t are initialized in step 1 . here , p represents the value of the up - integrated values of the increase amounts , v 0 is the vector from a preceding clock pulse , belonging to a vector v , and t indicates the clock pulse . if it is known in step 2 that the airbag is operational , the sum of the quantified sensor signals sensl and sensr is calculated as vector v . subsequently , in step 4 , this vector v is compared with counting threshold k1 whose signification has already been described in connection with fig2 . if vector v exceeds this constant k1 , then the absolute amount of the difference between this vector v and the vector v 0 that was calculated during the preceding clock pulse will be calculated and up - integrated according to the formula stated , that is , it will be added to the preceding integrator value p . at the same time , clock pulse t will also be set to &# 34 ; 0 &# 34 ;. in any other case , this step 5 will be skipped , and immediately followed by step 6 where the clock pulse will be compared with time constant t r whose signification has also been described already in connection with fig2 . if the clock pulse t reaches this threshold , integrator value p will then be reset in step 7 . in any other case , step 7 will be skipped . if the clock pulse has not reached this time constant t r , the integrator value p will be compared with a trigger threshold k2 in step 8 ; and , if necessary , the safety devices within the vehicle will be triggered ( compare step 9 ). if trigger threshold k2 has not yet been reached , clock pulse t will be set to t + 1 , and the current vector v will become vector v 0 ( compare step 10 ) before restarting again at step 3 . the process according to the invention described by means of fig2 and 5 is very simple and reliable with regard to the classification behavior . an improvement of the behavior over time will be achieved by means of such an evaluation of the quantified sensor signals that is based on the evaluation of the direction information when using two sensors s1 and s2 arranged within a vehicle according to fig2 . fig6 illustrates a hardware implementation of such an evaluation , with only a section of the circuit layout according to fig2 being shown . instead of the adding stage 7 known from fig2 a parameter matrix is connected in this fig6 as a ram matrix 71 between the intermediate storage device 6 and function unit 10 whose functions have already been described in connection with fig2 . fig7 a and 7b , respectively , show an associated evaluation matrix . according to the embodiment shown in fig7 a , the quantified sensor values of sensors s1 and s2 are each allocated a parameter gi ( i = 0 . . . 8 ). here , the quantified sensor values 0 , 1 , and - 1 represent the information &# 34 ; no acceleration &# 34 ;, &# 34 ; positive acceleration &# 34 ;, or &# 34 ; negative acceleration &# 34 ;. thus the gi values are applied as 3 bit vectors v at the output of ram matrix 71 ; these 3 bit vectors v will then be processed in a fashion corresponding to that used for the vectors v according to fig2 . it has been found here that an accuracy of 3 bit for a gi value is sufficient ; each individual value can thus lie between - 3 and 3 . the optimum layout of ram matrix 71 depends on the respective vehicle signature and must be made consistent with the relevant vehicle by means of crash data . a further improvement of the behavior in time of the process according to the invention is achieved by means of the evaluation matrix according to fig7 b , where quantification of the sensor signals is not effected by means of a positive and negative threshold sn and sp , but where both switching thresholds are positive and quantification is effected using a high and a low threshold , that is , where high or low acceleration becomes detectable . a software implementation is possible even when using such an evaluation matrix as an evaluation function and essentially corresponds to the program flow chart according to fig5 the difference being that the vector is not calculated by adding the quantified sensor values but can be taken from the evaluation matrix . in addition to the process according to the invention which was described by means of the embodiments according to fig2 and 6 , or fig5 it is possible to effect an additional evaluation of the quantified sensor signals ; this will improve ignition time behavior to such an extent that ignition time delays are essentially prevented . this additional evaluation can be implemented by means of hardware according to the circuit layout shown in fig8 or by means of software according to the program flow chart shown in fig9 . fig8 provides only a partial illustration of the circuit layout according to fig2 with the function unit used for implementing the evaluation function being either designed as an adding stage 7 or an evaluation matrix 71 . in this additional evaluation , a trigger threshold z that can be shifted dynamically in an upward direction will be generated ; this trigger threshold z increases exponentially in line with the specified time pattern . as the threshold is low at the start , this means that this process can trigger only at the start of a crash event . in this way , the safety devices will be triggered directly as soon as a serious crash occurs . the quantified sensor values placed in intermediate storage will initially be fed to a comparator 17 , via a line 6a ; this comparator 17 is used to check whether the sensor values -- as present and quantified in each time pulse -- of sensors s1 and s2 are positive ( that is , whether they indicate an impact direction against the direction of vehicle travel ). if this is the case , a start impulse is fed via a line 17a into a counter 18 as well as into a function unit 21 that can be operated either as a shift register or as a counter . at the same time such a signal is applied to a nand gate 19 which , on receiving an appropriate input signal , generates a reset signal for counter 18 via a line 19a . with regard to this counter 18 , such a start signal has the effect that its counter state is increased by &# 34 ; 1 &# 34 ;. in the other case , that is , if both sensor values are not positive , the counter will be reset to &# 34 ; 0 &# 34 ;. in this way , this counter 18 counts those sensor value pairs which successively indicate an acceleration in a positive direction , that is , which fall into the first quadrant . the counter state z of this counter 18 now serves as a crash signal and is fed via a line 18a into a further comparator 23 which effects a comparison with the dynamic trigger threshold ( r + k3 ). if this trigger threshold ( r + k3 ) is exceeded by the crash signal z , the trigger agents of the safety devices will be activated . this shiftable trigger threshold ( r + k3 ) is generated within an adding stage 22 by adding a count value r coming via a line 21a from function unit 21 and increasing in line with the clock pulse to a start value k3 entered via a line 15c of a ram register 15 . in order to allow the trigger threshold to increase exponentially the count value r generated by function unit 21 must increase exponentially in line with the clock pulse . this is implemented in combination with a divider stage 20 which , via a line 15d , receives a divider factor n from ram register 15 as well as , simultaneously , the clock pulse signal clk . this generates a clock pulse signal clk1 with a lower comparative clock frequency than clock pulse signal clk . by means of divider factor n the increase of the exponential trigger threshold can be varied and thus adapted to the vehicle signature . below , the task of function unit 21 is to be further described and explained . initially , it is assumed that its register content is &# 34 ; 0 &# 34 ;. a start impulse generated by comparator 17 now causes a &# 34 ; 1 &# 34 ; to be written at the bit - lowest point which from this point in time onwards will be shifted to the left at each clock pulse signal clk1 generated by means of divider stage 20 , with a &# 34 ; 1 &# 34 ; being inserted at the same time . this continues until the highest - value bit position has been set . at this time there will be an automatic switchover from the &# 34 ; shift register &# 34 ; function to the &# 34 ; counting down &# 34 ; function . now register content r will be counted down to &# 34 ; 0 &# 34 ;. as soon as the highest value bit extinguishes during such a countdown ( that is , as soon as the highest value bit position is &# 34 ; 0 &# 34 ;), an impulse generated by the comparator 17 will again be taken into account so that it is possible to switch over again to the &# 34 ; shift register &# 34 ; function . at first , in the &# 34 ; shift register &# 34 ; function , only small values r =&# 34 ; 1 &# 34 ; and r =&# 34 ; 11 &# 34 ; will be output during the initial time pulses whilst with progressing time pulse the values r will rapidly increase : r =&# 34 ; 111 &# 34 ; and r =&# 34 ; 1111 &# 34 ;. however , counting down is effected on a bit by bit basis and thus considerably slower . the result is that a specified time period needs to expire before the process ( that is , switchover to the &# 34 ; shift register &# 34 ; function ) can be re - activated . the program flow chart shown in fig9 represents the software implementation of this expanded evaluation process by means of a microprocessor . following the start of the program , the counter function z , divider function n , and register content r will be set to &# 34 ; 0 &# 34 ; in step 1 . in step 2 start value k3 is set whose meaning was described in connection with fig8 . if the safety devices are operational ( compare step 3 ), it will be checked in a step 4 whether one of the sensor signals s1 or s2 is &# 34 ; 0 &# 34 ; and the highest - value bit position bit h is set . if this is the case , the operating mode &# 34 ; shift register &# 34 ; will be activated according to step 5 . in any other case , this step 5 will be skipped . if , according to step 6 , both sensor signals s1 and s2 are positive , the counter function z will subsequently be increased by &# 34 ; 1 &# 34 ;. if this is not the case , the counter will be reset to &# 34 ; 0 &# 34 ;, and only step 9 will be carried out . the divider will be increased from n to n + 1 as often as is necessary to reach an upper limit ( step 12 ). when this limit b is reached there will be a shift operation at register r and the divider n will be reset to zero ( step 13 ). there will be a check in step 10 as to whether a register content ( r & gt ; 0 ) exists in operating mode &# 34 ; counting down &# 34 ;. if this is the case , register content r will be decreased by &# 34 ; 1 &# 34 ;, otherwise this step 11 will be skipped . however , if the operating mode &# 34 ; shift register &# 34 ; exists according to step 12 and the counter n has reached a threshold b , then the divider n will be reset to &# 34 ; 0 &# 34 ; and the register content r will be increased by &# 34 ; 1 , whilst at the same time another &# 34 ; 1 &# 34 ; value is inserted ( compare step no . 13 ). threshold b will be selected such that the value in register r changes exponentially over time in an adapted fashion relative to the vehicle type . if the highest - value bit position is set ( bit h = 1 ), the operating mode &# 34 ; counting down &# 34 ; will be set according to step 15 , in any other case step 15 will be skipped in order to proceed with the next step 16 . if , however , the operating mode &# 34 ; shift register &# 34 ; ( compare step 12 ) does not exist or if n & lt ; b , then the sum of register content r and start value k3 is calculated in step 16 , which sum now represents the trigger threshold , and compared to counter state z . if this trigger threshold is exceeded , the safety devices will be triggered ( compare step 17 ); in any other case there will be a return to step 3 . the diagram according to fig1 shows the operating mode of this evaluation process . the curves s1 and s2 indicate the course of the acceleration signals of sensors s1 and s2 during a crash event . at the start of the crash event both sensor signals simultaneously have positive values so that crash signal z increases linearly , whilst at the same time the trigger threshold ( r + k3 ) is generated . at the point where these two curves z and ( r + k3 ) intersect , the safety devices will trigger . advantageously , this additional evaluation process can be made consistent with the embodiments described above such that , in addition to a 100 % crash classification , an excellent time behavior , that is a very fast trigger response in the event of a crash , is achieved .	6
the bisorthodinitriles of the general formula : ## str3 ## are prepared by reacting 4 - aminophthalonitrile with the appropriate isomer of phthalaldehyde in a refluxing solvent . the synthesis involving p - phthalaldehyde proceeds accordingly : ## str4 ## the bisorthodinitriles of the general formula : ## str5 ## are prepared by reacting 4 - aminophthalaldehyde with an aldehydeterminated shiff base ( anil ) of the general formula : r 2 ═ r 3 ═ r 2 in a refluxing solvent . an example of this synthesis is as follows : ## str6 ## the aldehyde - terminated shiff base ( anil ) is prepared by condensing an aromatic diamine with an aromatic dialdehyde in an amount at least 5 mole percent in excess of the stoichiometric amount . the reactants are diamines and dialdehydes of benzene , naphthalene , phenanthrene , anthracene , biphenyl and terphenyl . an example of the synthesis is : ## str7 ## in order to decrease the reaction time for the synthesis of either of the general compounds of this invention , a stoichiometric excess of 4 - aminophthalonitrile is used . the preferred excess is from 5 to 15 mole percent of the stoichiometric amount , which is two moles of 4 - aminophthalonitrile for each mole of the aldehyde terminated reactant . the reactant time can be further reduced by the inclusion of a catalyst such as p - toluenesulfonic acid monohydrate . the refluxing can be carried out with any of the usual refluxing fluids . the most common fluids are preferred , such as , toulene , chlorobenzene , and methyl phenyl ether ( anisole ). the end point of the reaction can be easily determined by monitoring the by - product , water , or one of the reactants . the general nature of the preparation of the bisorthodinitrile have been set forth , the following examples are presented as specific illustrations thereof . it is understood that the invention is not limited to these examples but is susceptible to different modifications that would recognized by one of ordinary skill in the art . a 2 - liter flask was equipped with dean and stark distilling trap and a water - cooled condenser and then charged with p - phthalaldehyde ( 8 . 05 g ; 0106 mole ), 4 - aminophthalonitrile ( 18 . 90 g ; 0 . 132 mole ) and toluene ( 946 ml ). the stirred reaction mixture was refluxed 10 hours . at this point , water ( 2 . 0 ml ) had collected in the distilling trap ( theory , 2 . 16 ml ). the heavy yellow precipitate from the cooled reaction mixture was collected by filtration , washed with toluene ( 200 ml ), and dried . this yellow residue was extracted with boiling acetonitrile ( 2 × 600 ml ) leaving , after drying , 11 . 1 g of the analytical anil , mp 272 °- 275 ° c . cooling the resulting filtrate to 0 ° c . deposited additional crystals , which were collected and dried to give 8 . 9 g more of the analytical anil , mp 272 °- 275 ° c . ; total yield 20 . 0 g ( 86 . 7 %); anal . calcd . for c 24 h 12 n 6 : c , 74 . 99 ; h , 30 . 4 ; n , 21 . 86 ; found : c , 74 . 94 ; h , 3 . 04 ; n , 21 . 94 . note : the above anil can be recrystallized from anisole . a 2 - liter flask was equipped with dean and stark distilling trap and a water - cooled condenser and then charged with p - phthalaldehyde , ( 8 . 05 g ; 0 . 06 mole ), 4 - aminophthalonitrile ( 18 . 90 g ; 0 . 06 mole ), 4 - aminophthalonitrile ( 18 . 90 g ; 0 . 132 mole ) p - toluene - sulfonic acid monohydrate ( 0 . 03 g .). the results were identical to example i . the corresponding m - isomer , i . e ., bis ( 3 , 4 - dicyanoaniline ) n , n &# 39 ;- m - xylylenediidene was prepared in a similar way . the reaction change was m - phthalaldehyde ( 4 . 80 g ; 0 . 358 mole ), 4 - aminophthalinitrile ( 11 . 27 g ; 0787 mole ), 0 . 02 g p - toluenesulfonic acid monohydrate and toluene ( 474 ml ). refluxing the reaction mixture for 4 hours removed 1 . 1 ml of water ( theory 1 . 3 ml ). filtration of the reaction mixture 60 ° c .) left a pale yellow residue after drying of 13 . 6 g , m . p . 253 °- 257 ° c ., 98 . 9 % yield , pure enough for most purposes . recrystallion from anisole or from a 50 : 50 volume mixture of toluene : pyridine leads to the analytical m - dianil , m . p . 254 °- 258 °: a . preparation of the aldehyde - terminated shiff base ( anil ) ## str9 ## a charge of m - phenylenediamine ( 4 . 03 g ; . 0373 mole ), p - phthalaldehyde ( 12 . 70 g ; . 0946 mole ) and 1000 ml of toluene was stirred and refluxed using a dean and stark water distillation trap . after 3 hours 1 . 00 ml of water was collected ( 1 . 34 ml theory ). this gave the crude polymeric aldehyde terminated anil . b . preparation of the bisorthodimitrile ## str10 ## to the reaction solution of part a 4 - aminophthalanitrile ( 11 . 75 g ; 0 . 0820 mole ) was added , and stirring and refluxing was continued for 16 hours . an additional 1 . 20 ml of water accumulated in the water trap . the hot reaction mixture ( 80 ° c .) was filtered to get 13 . 4 g of yellow crystals ( mp 225 °- 245 ° c .). to assure complete reaction this residual was combined with 4 . 00 g of 4 - aminophthalonitrile and toluene ( 473 ml ). further refluxing and stirring led to the removal of 0 . 1 ml water . filtering at 80 ° c . left 10 . 0 of yellow crystals . extraction with boiling acetonitrile ( 200 ml ) left 8 . 07 g of yellow crystals containing no nh 2 or cho groups by ( infrared spectroscopy ), , m . p . 235 °- 250 ° c . a cyano - condensation resin of this invention is synthesized by simply heating one of the aforedescribed bisorthodinitrile above the melting point in an inert atmosphere , such as a vacuum from 1 to 10 mm hg , or aragon , or nitrogen . the preferred temperature is from 1 ° to 30 ° c . above the melting point of the compound and the most preferred is from 5 ° to 15 ° c . higher . gelation generally occurs after 3 to 5 hours . the heating is continued for at least another 20 - 25 hours in order to cure the product to a hard resin . the optimum cure time would have to be determined empirically for each resin . prior to synthesis , it is preferred that the bisorthodinitrile is outgassed by heating the material to a melt under a vacuum . the preferred vacuum is from 1 to 10 mm hg and the preferred time is from 15 to 20 minutes . a cyano - condensation resin is also produced with the inclusion of certain metals and salts with the bisorthodinitrile . the inclusion of a metal or a metal salt causes the reaction to proceed quicker . generally the resins gel and cure from about 10 to 25 percent faster . the optimum cure for any particular resin is , of course , determined by the testing of structural strength of the resins samples over a range of cure times . the preferred amount of metal or metal salt is the stoichiometric amount , i . e ., one at . wt . of metal or one mole of salt for each two moles of bisorthodinitrile . if an excess of a metal or a salt , especially a salt is used , foaming results . exemplary of metals which may be used are chromium , molybdenum , vanadium , beryllium , silver , mercury , aluminum , tin , lead , antimony , calcium , barium , manganese , magnesium , zinc , copper , iron , cobalt , nickel , palladium , and platinum . mixtures of these metals may also be used . the preferred metals are copper , silver , and iron . suitable metal salts include cuprous chloride , cuprous bromide , cuprous cyanide , cuprous ferricyanide , zinc chloride , zinc bromide , zinc iodide , zinc cyanide , ferrocyanide , zinc acetate , zinc sulfide , silver chloride , ferrous chloride , ferric chloride , ferrous ferricyanide , ferrous chloroplatinate , ferrous fluoride , ferrous sulfate , cobaltous chloride , cobaltic sulfate , cobaltous cyanide , nickel chloride , nickel cyanide , nickel sulfate , nickel carbonate , stannic chloride , stannous chloride hydrate , a complex of triphenylphosphine oxide and stannous chloride ( 2tppo / sncl 2 ) and mixtures thereof . the preferred salts are cuprous chloride , stannic chloride , stannous chloride hydrate , and ferrous fluoride . the cyano - condensation resins formed with metal salts have the disadvantage of air spaces in the resin caused by foaming during the preparation . as a consequence resins with a metal salts are not as important as the plain resins or the resins with a metal . in summary the preparation of cyano - condensation resins with a metal or a salt comprises mixing a bisorthodinitrile with a salt or metal , outgassing the mixture as previously described , and heating the mixture to a temperature above the melting point of the bisorthodinitrile . the preferred and most preferred temperatures are the same as those for the syntheses without metal or salts . since the salt or metal becomes part of the cyano - condensation resin , decreasing the particle size provides a more efficient utilization of the salt or metal . thus particle sizes up to 2000 μ are preferred . the preferred amount of the salt or metal is the stoichiometric amount . the following examples are given to illustrate the preparation of the cyano - condensation resins of this invention and are not intended to the limit the specification or the claims to follow : a 1 - gram sample of the above bisorthodinitrile , prepared according to the method of example ii , was heated at 270 ° c . for 24 hours . a hard dark brown resinous material resulted . a 1 - gram sample of the above bisorthodinitrile , prepared according to the method of example ii was mixed with activated copper powder in a dinitrile - to - copper mole ratio of 1 : 2 . the mixture was heated at 270 ° c . for 18 hours . a hard dark brown resinous material was formed . a 1 - gram sample of the bisorthodinitrile , prepared in example iv was heated at 270 ° c . for 24 hours . a hard dark brown resinous material was formed . the examples show that a brown colored resin is formed . it is on account of the brown color rather than a green color that it is believed that a phthalocyanine resin is not formed . the exact chemical identity of the resin is not known other than the resin is a cyano - condensation compound . after cure , the resin is heated further at a temperature from 350 ° to 500 ° c . for at least 12 hours and preferably for 18 hours , in an inert atmosphere , e . g ., argon , a vacuum , or nitrogen . this last heat treatment greatly improves the electrical conductivity of the resin , but does cause a slight weight loss . samples of the bisorthodintrile of example i were mixed with copper flake and cured according to the method of example vi . the samples were then given a final cure for 18 hours at the specified temperature . the conductivities of these resins are listed in table i . as is shown in table i , the best results are achieved with a stoichiometric amount of copper and high final cure temperature . table i______________________________________ cu / bodn final cure condutivitysample no . mole ratio temp ., ° c ohm - con______________________________________1 1 / 1 300 7 . 10 . sup . 82 1 / 1 450 7 . 9 × 10 . sup . 83 1 / 2 450 5 . 4 × 10 . sup . 7______________________________________ obviously many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described .	2
looking at fig1 , it is seen that this unmanned durable goods sales facility 11 is located on a commercial property site which is adjacent to a public highway 15 . the publicly accessible commercial site is bounded by the highway 15 and the property lines 20 , 25 , and 32 . property line 20 measures 300 feet . property line 32 measures 300 feet . property line 25 measures 102 feet . an entrance drive 39 leads from the highway 15 into the facility 11 . the entrance drive 39 also leads to a front parking lot 16 . inside the facility 11 is an automatic electronically controlled barrier , in this case , an automatic electronically controlled rectangular chain link fence with sides 24 , 26 , 31 , and 18 . the front side 18 of the chain link fence possesses a sliding chain link security gate 36 for vehicles and also a personnel chain link gate 17 . in front of the security gate 36 is a proximity reader 37 and in back of the security gate 36 is another proximity reader 35 . the entrance drive 39 leads along a paved path 10 to a rear parking lot 27 . a gate camera 34 scans all vehicles traversing this path 10 in either direction . within the area enclosed by the chain link fence sits a building , in this case a corrugated steel warehouse 12 within which the heating and air - conditioning supplies , the durable goods of this invention , are stored . facing the rear parking lot 27 , adjacent to the warehouse 12 , are a porch 71 , a truck dock 28 , and a loading platform 72 . a door entry security keypad 21 is located at the porch 21 . a rear camera 30 is located at the loading platform 72 and scans all traffic traversing the platform 72 and the truck dock 28 . various vehicles of licensed customers for picking up assorted heating and air - conditioning supplies are shown in fig1 . vehicle 38 is shown in the entrance drive 39 heading for the rear parking lot 27 . vehicle 33 is shown in the paved path 10 leaving the rear parking lot 27 . vehicle 23 is shown parked next to the porch 71 . vehicle 29 is shown parked next to the loading platform 72 . looking at fig2 , it is seen that the aforementioned porch 71 leads to a rear entrance doorway 66 to the inside of the warehouse 12 . the aforementioned truck dock 28 leads to an electric operated overhead door 68 inside the warehouse 12 . the aforementioned loading platform 72 leads to another electric operated overhead door 70 inside the warehouse 12 . in addition to the entrance exit doorway 66 , the warehouse also has another entrance exit doorway 98 . the warehouse 12 , itself , is rectangular in shape measuring 100 feet by 60 feet . near the entrance exit doorway 98 , inside the warehouse , are located an exit sign 97 , a fire extinguisher 96 , a security key pad 95 , a bolt cutter 93 , and two security cameras 92 and 90 . near the entrance exit doorway 66 , inside the warehouse , are located an exit sign 65 , a security keypad 63 , and a bolt cutter 62 . between the electrically operated overhead door 68 and the electrically operated overhead door 70 is located a fire extinguisher 69 . next to the electrically operated overhead door 70 are located two security cameras 74 and 75 . the location of various heating and air conditioning supplies and other items within the warehouse 12 will now be indicated . flexible duct is stored at location 94 . blanket insulation products are stored at location 42 . a security camera 41 is located next to the blanket insulation products . next to the blanket insulation products are a women &# 39 ; s restroom 46 and a men &# 39 ; s restroom 43 . next to the men &# 39 ; s restroom 43 are stored condenser pads and freon at location 44 . a bolt cutter is also stored at location 44 . next to the restrooms are located a fire extinguisher 48 and a security camera 49 . gas package units 12 seer ( seasonal energy efficiency ratio ) are stored at location 53 where there are also located security cameras 51 and 55 . heat pump package units 12 seer are stored at location 56 where there is also located a security camera 57 . gas package units 10 seer are stored at location 59 where there is another security camera 61 . heat pump package units 10 seer are stored at location 60 . air conditioning condensers 10 seer are stored at location 58 . air handlers 10 seer are stored at location 79 . furnaces 80 % afue ( annual fuel utilization efficiency ) are stored at location 77 . heat pump condensers 12 seer are stored at location 80 . air handlers 12 seer are stored at location 76 . high efficient furnaces 90 plus afue are stored at location 78 . heat pump condensers 10 seer are stored at location 82 . ac coils are stored at location 67 , next to which is located a security camera 85 . black iron fittings are stored at location 81 . galvanized pipe is stored at location 83 . at locations 54 , 52 , 50 , and 47 are shelves 36 inches wide , 54 inches tall , and 28 feet long , double sided with 4 shelves , where smaller heating and air conditioning parts are stored . hart & amp ; cooley register products are stored at location 46 on 3 feet by 10 feet two shelf racking 30 inches long . acme prefab products are stored at location 40 on 3 feet by 10 feet two shelf racking 30 inches long . the warehouse 12 also contains an office and computer room 13 , next to which are a security camera 86 and a tv 84 . also , next to the office and computer room , the warehouse 12 contains a security and power room 14 , next to which are a security keypad 89 and a security camera 88 . looking at fig3 , it is seen that the office and computer room 13 has a door 102 and doorway 103 . also , inside this room is desk 100 on which sit a telephone 108 and a computer 99 with its keyboard 107 . a chair 101 sits by the desk . this room also contains an order drop box 104 and a table 105 on which sits a fax machine 106 . a security camera 87 scans activities that take place within the room 13 . looking at fig4 , it is seen that the security and power room 14 has a door 109 and a doorway 110 . the doorway 110 is usually closed with the door 109 being locked . thus , the security and power room 14 is off limits to regular licensed customers of this sales facility and is normally accessible only to the operators of this facility . this room has a 200 amp electrical panel 115 . this room has a fax line terminal 118 , a phone line terminal 117 , and a cayman dsl modem and line terminal 116 . this room has a costar cr1600 - 80 camera server and 19 ″ toshiba color camera server monitor 111 . this room contains a terminal 114 for security system i ( vista - 128bp ) and a terminal 113 for security system ii ( vista 20p ). this room contains a passport remote network access . this room also has a computer and network rack 112 containing the following components : a cayman dsl modem , a cisco 3002 vpn client , a cisco 2924 network switch , a tripplite ups backup power i terminal , a tripplite ups backup power ii terminal , and a panduit patch panel . more information about how this invention operates will now be disclosed . the embodiment of the invention disclosed here is designed to provide qualified customers unlimited self service to heating and air conditioning supplies 24 hours per day , 7 days per week , and 365 days per year . customer safety while entering and exiting this sales facility 11 , while finding , moving , and loading the heating and air conditioning products , and during unusual events is a most important priority . personal safety is maximized through customer training in all aspects of the sales facility operation and through the security , surveillance , and operational systems incorporated in the facility 11 . the warehouse 12 that is central to this facility has a medium size of 6000 square feet . the heating and air conditioning products carried in this warehouse 12 are types that are most needed by the majority of customers in the particular area in which the sales facility 11 is located . if customers need products that are not carried , they may contact the operators of this facility electronically , and request that those products be stocked . once inside this facility 11 , access to the warehouse 12 is granted by presenting an issued proximity card to the proximity card reader 37 at the only electric operated entrance gate 36 . the customer will then drive through the path 10 to the rear of the warehouse 12 to the loading area adjacent to the rear parking lot 27 , where he or she will be required to first enter the warehouse 12 through an entrance doorway 66 protected by a security key pad 21 . the warehouse 12 is protected by two security systems i and ii . the main security system i protects the warehouse 12 from unauthorized access and provides fire and smoke detection . that part of the main security system i guarding access to the warehouse is deactivated when any customer has been granted access by the entrance gate authorization system and remains off until the last customer exits through the entrance gate 36 . the fire and smoke detection part of security system i remain active even when the access guarding part of security system i is disarmed . the gate authorization system keeps track of how many customers are in the warehouse 12 , when they entered , and when they exited . with the disarming of the main security system i , the second security system ii starts a twenty minute arming timer . at the end of the twenty minute timing cycle , a ninety second warning horn alerts all customers in the warehouse 12 that the second security system ii is about to arm itself . it is the responsibility of any customer in the warehouse 12 to deactivate the arming sequence by typing in a four number code and “ off ” on the security keypads provided in the warehouse 12 . the two security keypads 21 and 89 are located respectively by the rear entrance door 66 and near the office and computer room 13 . it is assumed that if the second security system ii is not deactivated , that the customer in the warehouse 12 is unable to do so because of an accident , health problem , or unforeseen event . in that case , the second security system will immediately arm , activate , and dial an electronically connected security central office of the facility &# 39 ; s operators to alert them to the situation . the security central office will immediately dispatch paramedics , fire , police , and appropriate operator personnel to assist the disabled customer . if , as is normally the case , a customer deactivates the second security system ii , it again restarts the twenty minute rearming cycle . these cycles continue until the last customer exits the premises through the entrance gate 36 . it is the purpose of these two security systems i and ii to provide a response action within twenty minutes to a disabled customer any time that the warehouse 12 is occupied . in addition , a multi - camera surveillance system comprising security cameras 30 , 34 , 41 , 49 , 51 , 55 , 57 , 61 , 74 , 75 , 85 , 86 , 87 , 88 , 90 , and 92 monitors and records all activities on the premises of this sales facility 11 . operator personnel can view the surveillance system activities live from any authorized remote network connection at any time . this allows operator personnel to evaluate the main security alarm i activation , a second security system ii disability alarm activation , or a fire notification in a timelier manner . the surveillance system is also in place in the unlikely event that something might happen between customers , other customer &# 39 ; s quests , or any unauthorized persons . in addition , this security system allows operator personnel to help customers find or resolve questions in a real time manner by directing customers to a product or solution . it is the responsibility of everyone to legally behave appropriately towards others and to treat any property that is not theirs legally and with respect . the multi - camera security system helps to deter or resolve any conflicts in this area . backup copies of the camera surveillance are made periodically and saved for a minimum of four years . historical surveillance records can also be accessed by any operator personnel immediately to resolve any unclear situation . in a normal course of operation a customer enters the facility 11 and warehouse 12 , finds and loads all products he or she needs . there are many methods available to record and invoice the customer for products taken . some of them are very technology oriented and can be more complicated . others can be quite simple . the facility operators try to keep it as simple as possible . thus , it is the customer &# 39 ; s responsibility to write the quantity , product code , product description , product serial number ( if applicable ) and customer name on a two part form order pad provided . the customer then separates the two part form , keeping one for his or her records . the original form is then placed in the fax machine 106 and a button pressed to transmit the order to the operators &# 39 ; central branch office . a locked drop box 104 is provided for the customer to place the original order into , so that other customers will not have access to what has been purchased by a competitor . operator personnel pick up the original orders in the drop box 104 on a timely basis . each morning the main operator office branch assembles all the faxed orders sent to them during the previous 24 hours . accounts receivable in operator headquarters generates and sends a report to the main operator office branch of all customers entering the warehouse 12 during the preceding 24 hours . the list and the faxes are compared . if a customer has entered and exited without any orders being faxed , the security camera system is reviewed and the customer called on the telephone to see if there was a problem or if the required products were not available or found . thus , customers of this facility normally leave a record of the durable goods purchased with the facility operators . when customers have picked up everything that they need and the last customer has exited the entrance gate 36 , the second security system ii is disabled and the main security system i completely rearmed . the security system i checks that both electrically operated overhead doors 68 and 70 are closed and that the personal doorways 66 and 98 are closed . if any of these four doors has been left open , the security system i automatically shuts that door . with respect to the process of certifying various persons to become qualified customers for this sales facility 11 , it is the right of the operators of this facility 11 to refuse to issue an entrance proximity card or do business with any business or individual for security or business reasons if warranted . a business requesting to participate in the facility 11 must have completed a credit application and purchase agreement and have been issued a credit account with the operators of the facility . customers on a cash or cod basis are not allowed to participate in the facility . in addition to the business being approved , each individual from that business , who wishes access to particular embodiment of the invention described here , also has to fill out an individual credit authorization form and a background investigation form for approval . pictures of the individual are taken for the proximity card and future identification . the proximity card issued is for the use of the authorized individual only and may not be given to any other person . individuals must be authorized by their respective employers to participate in the facility . the employers are required to accept full responsibility for their employees purchases and actions while in and around the warehouse 12 . a business authorization form needs to be submitted by the company for each individual wishing access to the facility 11 . for any reason , if the company no longer wishes an individual to have access to the facility 11 , a business de - authorization form is submitted to the operators of the facility via fax or mail . each business participating in the facility 11 must have at least one individual that has a valid epa refrigeration certification card on file with the operators and be authorized to purchase refrigerant through the business . forms that are required for authorization include : an access agreement , a credit application and purchase agreement , a business credit and authorization check form , an individual credit authorization form ( for each person wishing access ), a background authorization form ( for each person wishing access ), an individual release form ( for each person wishing access ), an epa refrigerant certification card , individual pictures for proximity card and file , a business owner authorization form , a tour and training check list form of completion , an indemnification agreement , and a forklift certified training card . a tour of the exterior and interior of the facility 11 will be given to each individual qualified for access to the facility . the tour will include all entrance , exits , and loading doors , front locked and chained walk gate , all fire extinguishers , first aid kits , all flash lights , bolt cutters , all security keypads , all telephones for normal or emergency needs , the order / fax process , computer / internet training , all devices for emergency egress from the locked fence area , rest room facilities , and office facilities . with regard to entrance and exit procedures for this invention , entrance to the facility 11 is gained by presenting an authorized proximity card to the proximity reader 37 on the left hand side of the driveway just before the entrance gate 36 . the card does not need to be inserted , just placed close to the reader 37 . it is the intention of the facility operators that only one vehicle pass through the gate 36 in one open and closing cycle . a customer should not allow another vehicle to pass through the gate while he or she is opening the gate . the gate 36 automatically closes approximately 10 seconds after it opens . this allows ample time for a customer to drive through the gate 36 . there is a buried cable in the drive that senses a vehicle in motion through the gate 36 and will not allow the gate 36 to shut if the vehicle is still in the area of the gate 36 . a customer should not attempt to drive through the gate 36 if it is in the process of closing . the authorizing gate system keeps track of the individuals that have gained entrance to the facility 11 and when they leave . if a customer lets another person in with themselves , the system will not know that and such customer will have compromised the integrity of the safety systems of this facility . a customer then drives around to the back of the warehouse 12 and parks near the rear entrance door 71 . this doorway 66 has a keypad entrance system 21 . when the customer types the appropriate five space code the doorway 66 unlocks and the customer may enter the warehouse 12 . after the customer loads the material that he or she needs and has faxed a copy of the order to the central office of the operators , when it is time for the customer to exit , the customer then closes all the doors that he or she has opened to load his or her truck . the overhead doors 68 and 70 are opened and closed using electric door operator buttons . the customer exits the warehouse 12 through the doorway 66 and proceeds to the entrance gate and provides his or her proximity card to the exit proximity reader 35 , just as the customer did for entering . the exit proximity reader 35 is on the left side of the driveway as the customer approaches the gate 36 . if someone else is in the process of entering the premises at the same time as a customer is leaving , the customer should leave enough room for them to pass . the customer should wait until the gate 36 has closed before presenting his or her proximity card to the reader 35 . under no circumstances should a customer attempt to drive out of the facility after someone has just entered and the gate 36 has not closed yet . if a customer does this , the gate security system will not know that the customer has left and the police will be called within 20 minutes . two security systems i and ii are installed in this facility for the safety of the customer . if the warehouse 12 is occupied , the second system ii tries to arm itself every 20 minutes . this second system ii actually sounds an intermittent horn for 90 seconds before it actually arms itself . the 90 second time period allows anyone in the warehouse 12 to go to one of two keypads 63 or 89 , and type a five space code to stop the activation sequence . if someone is in the building and the second security system ii is not deactivated , the assumption is that that person is incapacitated and requires immediate help . the security system then will call the police , rescue , and appropriate operator personnel to come to the warehouse to help . if a customer has just closed the warehouse doors and is ready to leave and the 90 second pre alarm sounds , the customer may drive to the exit proximity card reader 35 and present his or her card . this also will deactivate the arming sequence . the warehouse 12 is protected by a smoke and fire alarm system . if a customer observes any smoke or fire in or near the warehouse 12 , the customer may go to one of the two security keypads 63 and 89 and press the red emergency button labeled “ fire ”. this will call the fire department immediately . under no circumstances should a customer endanger himself or herself or anyone else to activate the above alarm . there are fire extinguishers located throughout the warehouse for customer use if needed . the safety of the customer is the operators &# 39 ; primary concern , and the customer should exit the warehouse building quickly in an emergency and move as far away as possible for his or her own safety . the exit gate , security systems , smoke and fire systems , and computer systems of this facility are on an uninterruptible power backup system and will work for a short period of time . this allows the customer to exit the premises without inconvenience . the telephone 108 is powered by the telephone company and will work unless the telephone lines have been broken . there are two first aid kits in this warehouse . one first aid kit is located next to the rest rooms 43 and 44 , and the other first aid kit is located in the office and computer room 13 . if a customer is hurt on the facility premises , he or she should call the operators immediately so that the operators may help the customer in any way . in case of power outages at night at this facility , there are flashlights located throughout the warehouse 12 . if all power is lost and the personnel gate 17 will not open , bolt cutters 62 and 93 are provided for the customer to cut the chain on the gate 17 for his or her exit . also , in such case , any vehicle that the customer has on the premises should be moved to the back of the property out of any possible danger until help arrives to open the main gate 36 . if another authorized or unauthorized person threatens a customer in any way , the customer should avoid any confrontation at all costs . in this case , the customer should proceed to the nearest keypad 63 or 89 and activate the emergency fire code by pushing the red “ fire ” button . this notifies the fire and police departments that there is an emergency in progress and they will dispatch help immediately . the customer should leave the facility and avoid the confrontational individual for his or her own safety . within the warehouse 12 , there is a forklift available to move heavy equipment and to load vehicles . osha requires that anyone operating a forklift be certified and trained through an approved course . training encompasses care , operation , safety , and limitations of the use of a forklift . if the forklift is used to load a truck , it is not allowed out of the warehouse nor is it allowed to be driven into the back of a truck when the truck dock 28 or the platform 72 is used . the forklift may not be used with a rider along . the forklift may not be used to lift a person off the floor for any reason . safety training is provided by the operators to teach customers the proper techniques in lifting objects to reduce possible injuries to the back , leg , arms , and other areas of the body . instruction is also provided to customers in the proper use of dollies and carts for moving and loading inventory . for the safety of the customers , no climbing on boxes or shelving is allowed at this facility . loading of vehicles is an everyday event for most contractors . customers are encouraged to observe courtesy and common sense when loading around other people &# 39 ; s vehicles and property . the truck dock 28 may be used to load vehicles . the truck dock 28 is below ground level and places the bed of the truck below the floor level of the warehouse 12 . extra caution in using the truck dock 28 and the loading platform 72 is urged on all the customers . a telephone 108 is located on the desk 100 in the office and computer room 13 . when a customer is finished with a telephone conversation , the phone should be returned to its cradle . telephone numbers of operator personnel are posted on a bulletin board above the desk in the office . while in the warehouse , customer access to the internet is provided if needed . use of the provided internet access is intended to be primarily for business related purposes . the facility operators possess the ability to monitor customer use of the internet , and actual web - site connections , and length of time spent on these connections are recorded . excessive use of the provided internet access for non - business related purposes results in the loss of access privileges . the facility network restricts access to sites that are inappropriate for the work place such as adult or sexually explicit sites . entrance to this facility with the use of the proximity card is authorized for the approved individual only . the operators ask that the customer does not let unauthorized individuals enter the facility while he or she is inside the warehouse 12 or while entering or exiting the premises . the authorized individual and his or her company are responsible for any unauthorized individual entering the facility with them . no smoking and no alcoholic beverages are allowed inside the warehouse 12 or on the property site 11 of this facility . each customer who is permitted access to this facility must execute an indemnification agreement form and a release form which must be delivered to the facility operators prior to the initial access to this facility . each applicant for authorized use of this facility is given an instruction manual on how to use this facility and the rules that must be followed by authorized customers . a complete set of forms required for authorization is attached to the instruction manual .	4
the present disclosure may be implemented in any digital image processing system . fig1 shows an implementation of a digital image capture and processing system 100 which may be included in any still or moving image processing technology such as those identified above . in digital image capture and processing system 100 , lens 101 focuses incoming light onto image detector 103 through color filter array 102 . as noted above , image detector 103 may be a charge - coupled device or a cmos detector . the individual color filters of color filter array 102 may be arranged in any suitable pattern , such as the bayer cfa pattern discussed above and described below in connection with fig2 and 3 . color filter array 102 is aligned relative to image detector 103 so that each pixel 203 of image detector 103 is illuminated by light passing through only one color filter element 202 of color filter array 102 . in that way , although the pixels 203 of image detector 103 detect only luminance , each pixel of image detector 103 outputs a signal representing a single color component ( e . g ., red , green or blue in an rgb system ). the output of image detector 103 is processed in digital image signal processor ( isp ) 104 , which as is well known may include any suitable combination of hardware and firmware arranged to perform the functions or methods described below . isp 104 may be an image processing engine of the type used in digital cameras , mobile telephones or other devices . this engine can perform a range of tasks , such as denoise operations , demosaic operations , defect correction , lens shading correction , tone mapping and edge sharpening . signal 105 output by digital isp 104 may be stored or transmitted , for later display by a suitable display device , such as a television or computer monitor , or the screen of a mobile device ( not shown ). fig2 shows two different five - pixel - by - five - pixel areas 200 , 201 of color filter array 102 arranged in the aforementioned bayer cfa configuration . as can be seen , the individual pixel filters 202 are arranged in rows 211 - 215 . each of rows 211 - 215 includes green pixel filters 202 alternating with either red pixel filters 202 or blue pixel filters 202 — i . e ., each row includes either green and red pixel filters only , or green and blue pixel filters only . red pixel filters 202 are identified by the letter “ r ”; blue pixel filters 202 are identified by the letter “ b .” green pixel filters 202 that are located in rows with red pixel filters 202 are identified by the letters “ gr ”; green pixel filters 202 that are located in rows with blue pixel filters 202 are identified by the letters “ gb .” the rows 211 - 215 are arranged so that each row of green and red pixel filters is adjacent only rows of green and blue pixel filters — i . e ., no row of green and red pixel filters is adjacent another row of green and red pixel filters , and no row of green and blue pixel filters is adjacent another row of green and blue pixel filters . the rows of green and blue pixel filters are offset from the rows of green and red pixel filters so that no column including red pixel filters also includes any blue pixel filters , and no column including blue pixel filters also includes red pixel filters . the result is that , as described above , the red and blue pixels are arranged on respective rectangular lattices in their respective sets of rows , while the green pixels are located on a quincunx lattice . although this description is written in terms of the pixels of the color filter array , it will be understood that the pixels values discussed herein are the outputs of individual pixels of detector 103 , each of which is illuminated by light that passes through a particular pixel filter 202 of color filter array 102 . according to implementations of this disclosure , an adjustment may be applied to each green pixel ( whether a gr pixel or a gb pixel ). while the adjustment may be determined once for all gb pixels and once for all gr pixels , or individually for each green pixel ( gb or gr ), it may be convenient to break the color filter array into individual areas or “ kernels ”, and to process each kernel to determine an adjustment for all gr pixels in that particular kernel and all gb pixels in that particular kernel . as explained in more detail below , the adjustments determined according to implementations of this disclosure may be based on the type of image area the pixels are located in . thus , the adjustments may be different for horizontal edges , vertical edges , non - edge areas ( i . e ., areas with no clear edge ), and “ busy ” areas ( i . e ., areas with high - contrast irregular edges ). a basic method 300 according to implementations of this disclosure is diagrammed in fig3 . at 301 , for a particular green pixel , a kernel , each of which includes a plurality of pixels , is constructed around the pixel . for example , kernel 201 may have 25 pixels arranged in five rows and five columns . at 302 , horizontal gradients grad hor 1 and grad hor 2 , and vertical gradients grad ver 1 and grad ver 2 , are determined for the kernel . an example of gradient determination is described in more detail below . at 303 , the pixel of interest — i . e ., the pixel on which the kernel is centered — is classified , for example as described above , as being , on a horizontal edge , on a vertical edge , in a non - edge area , or in a busy area ( although other classifications may be used ). an example of pixel classification is described in more detail below . at 304 , a green compensation value is determined for the pixel of interest , in part , on its classification at 302 , and is applied to the pixel of interest at 305 . an example of determination of green compensation value is described in more detail below . optionally , a demosaic operation can be carried out on the image at the time of green imbalance compensation . this option would be employed , for example , when a video signal is being processed “ on - the - fly ”— i . e ., in real - time — for viewing or transmission ( otherwise the demosaic operation may be performed later ). if processing is being performed on - the - fly , then constructing a kernel around each green pixel to compute green imbalance compensation for that pixel as described above would require additional line buffering . therefore , for on - the - fly processing the image would be broken down into kernels ( some of which will resemble kernel 200 centered on a green pixel , and some of which will resemble kernel 201 centered on a non - green pixel ). the green compensation value would be determined at 304 as described above for each kernel . the green compensation value derived for a particular kernel would be applied at 306 to every green pixel — whether gb or gr — in that kernel . a demosaic operation would then be carried out at 307 . however , it will be apparent that this type of “ per - kernel ” processing also can be used for offline processing instead of the “ per - pixel ” processing described above ( where a kernel is constructed around each green pixel for computation purposes ), even though it might not be necessary to do so . in that case , the demosaic operation would be performed later . except where otherwise indicated , the discussion below assumes that no demosaic operation is intended to be carried out on the image at the time of green imbalance compensation . however , if a demosaic operation is to be carried out on the image at the time of green imbalance compensation , then any reference to the “ pixel of interest ” should be considered a reference to the center pixel of the kernel which , for a kernel 201 , will not be green . continuing to use the examples of kernels resembling five - pixel - by - five - pixel areas 200 , 201 , gradient determination 302 may be performed as follows : if , starting in the upper left corner of a kernel , the five rows 211 - 215 in each kernel are identified as i = 0 , . . . , 4 , and the five columns 221 - 225 in each kernel are identified as j = 0 , . . . , 4 , then for each pixel location ( i , j ), the pixel value may be denoted p [ i ][ j ]. the horizontal and vertical gradients grad hor 1 and grad ver 1 , and grad hor 2 and grad ver 2 , may be calculated as follows : as noted above , the goal of pixel classification 303 is to classify each pixel into one of the following classes : 1 ) class vertical : strong vertical edge indication . 2 ) class horizontal : strong horizontal edge indication . 3 ) class nonedge : lack of strong edge indication . 4 ) class busy : image content with crowded , irregular , high - contrast edges , such as text . one possible implementation of pixel classification 303 begins with busy detection . a counter busy_dec_num may be initialized to 0 and a threshold busy_thre may be computed as follows : where min_busy_thre is determined empirically by the system designer or user to adjust more adaptively to the image brightness . once busy_thre has been determined , the following calculations may be carried out : 1 . if ( min (\| p [ 2 ][ 2 ]− p [ 0 ][ 0 ]\|, \| p [ 2 ][ 2 ]− p [ 0 ][ 2 ]\|, \| p [ 0 ][ 0 ]− p [ 0 ][ 2 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 2 . if ( min (\| p [ 2 ][ 2 ]− p [ 0 ][ 0 ]\|, \| p [ 2 ][ 2 ]− p [ 2 ][ 0 ]\|, \| p [ 0 ][ 0 ]− p [ 2 ][ 0 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 3 . if ( min (\| p [ 2 ][ 2 ]− p [ 0 ][ 4 ]\|, \| p [ 2 ][ 2 ]− p [ 0 ][ 2 ]\|, \| p [ 0 ][ 4 ]− p [ 0 ][ 2 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 4 . if ( min (\| p [ 2 ][ 2 ]− p [ 0 ][ 4 ]\|, \| p [ 2 ][ 2 ]− p [ 2 ][ 4 ]\|, \| p [ 0 ][ 4 ]− p [ 2 ][ 4 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 5 . if ( min (\| p [ 2 ][ 2 ]− p [ 4 ][ 0 ]\|, \| p [ 2 ][ 2 ]− p [ 2 ][ 0 ]\|, \| p [ 2 ][ 0 ]− p [ 4 ][ 0 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 6 . if ( min (\| p [ 2 ][ 2 ]− p [ 4 ][ 0 ]\|, \| p [ 2 ][ 2 ]− p [ 4 ][ 2 ]\|, \| p [ 4 ][ 0 ]− p [ 4 ][ 2 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 7 . if ( min (\| p [ 2 ][ 2 ]− p [ 4 ][ 4 ]\|, \| p [ 2 ][ 2 ]− p [ 2 ][ 4 ]\|, \| p [ 2 ][ 4 ]− p [ 4 ][ 4 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 ; 8 . if ( min (\| p [ 2 ][ 2 ]− p [ 4 ][ 4 ]\|, \| p [ 2 ][ 2 ]− p [ 4 ][ 2 ]\|, \| p [ 4 ][ 2 ]− p [ 4 ][ 4 ]\|)& gt ; busy_thre , increase busy_dec_num by 1 . if , after these calculations , busy_dec_num & gt ; 4 , the pixel of interest is classified as busy . otherwise , further classification proceeds as follows : first , two thresholds thre_grad1 , thre_grad2 for the classification of the pixel of interest as an edge pixel or a non - edge pixel are determined : where min_grad_thr , k_grad1 and k_grad2 are empirically determined by the system designer or user to adjust more adaptively to the image contrast . these thresholds are used with the gradients to perform an initial classification in which the pixel of interest is assigned two classifications — class1 and class2 : else if ( grad ver 1 & gt ; grad hor 1 + thre_grad1 ) then class_1 = horizontal ; else if ( grad ver 2 & gt ; grad hor 2 + thre_grad2 ), then class_2 = horizontal ; a final classification , merging class1 and class2 , may be performed as follows : if ( class_1 = vertical ) { if ( class_2 = horizontal ) then class_final = nonedge ; else class_final = vertical ; } else if ( class_1 = horizontal ) { if ( class_2 = vertical ) then class_final = nonedge ; else class_final = horizontal ; } else class_final = class_2 it will be appreciated , that if the pixel of interest had been determined during busy detection to be in a busy area , then it would have been assigned class_final = busy . after classification has been carried out , the compensation value may be determined . first , separate average values may be calculated for the gr pixels in the kernel ( avggr ) and the gb pixels in the kernel ( avggb ). the averages can be “ fine ,” meaning that separate averages are determined for pixels classified with different edge directions , or “ coarse ,” meaning that the averages are determined without regard to edge direction . the resulting averages may be denoted avggb fine , avggb coarse , avggr fine , and avggr coarse . for a pixel classified as a horizontal edge , the kernel is separated into upper and lower areas ( the middle row may be used in both areas ), and the “ up ” and “ down ” averages are determined separately , and are then used to determine an overall average . in this horizontal edge case , where either the operation is being performed on a pixel basis , or the operation is being performed on a kernel basis and the center pixel of the kernel is green , the averages may be determined as follows : in this horizontal edge case , where the operation is being performed on a kernel basis and the center pixel of the kernel is not green , the averages may be determined as follows : for a pixel classified as a vertical edge , the kernel is separated into left and right areas ( the middle column may be used in both areas ), and the “ left ” and “ right ” averages are determined separately , and are then used to determine an overall average . in this vertical edge case , where either the operation is being performed on a pixel basis , or the operation is being performed on a kernel basis and the center pixel of the kernel is green , the averages may be determined as follows : in this vertical edge case , where the operation is being performed on a kernel basis and the center pixel of the kernel is not green , the averages may be determined as follows : for a pixel that is not on an edge , and where either the operation is being performed on a pixel basis , or the operation is being performed on a kernel basis and the center pixel of the kernel is green , the averages may be determined as follows : avggr fine = avggr coarse =( 4 * g [ 2 ][ 2 ]+ g [ 2 ][ 0 ]+ g [ 0 ][ 2 ]+ g [ 2 ][ 4 ]+ g [ 4 ][ 2 ])/ 8 avggb fine = avggb coarse =( g [ 1 ][ 1 ]+ 2 * g [ 1 ][ 3 ]+ g [ 3 ][ 1 ]+ g [ 3 ][ 3 ])/ 4 for a pixel that is not on an edge , where the operation is being performed on a kernel basis and the center pixel of the kernel is not green , the averages may be determined as follows : avggr fine = avggr coarse =( 2 * g [ 1 ][ 2 ]+ 2 * g [ 3 ][ 2 ]+ g [ 1 ][ 0 ]+ g [ 1 ][ 4 ]+ g 1 [ 3 ][ 0 ]+ g [ 3 ][ 4 ]+ 3 )/ 8 avggr fine = avggr course =( 2 * g [ 2 ][ 1 ]+ 2 * g [ 2 ][ 3 ]+ g [ 0 ][ 1 ]+ g [ 0 ][ 3 ]+ g [ 4 ][ 1 ]+ g [ 4 ][ 1 ]+ 3 )/ 8 for a busy area , it is difficult to compute the compensation values , and in any event the imbalance may be masked by the busyness , so avggb and avggr ( coarse and fine ) may be set to zero . for all areas , the coarse and fine averages may be combined as follows : where smoothness_gb is a system - designer - or user - determined parameter that determines the aggressiveness of the green balance , which may affect image detail . once the averages have been determined , an initial compensation value diff_gb init may be calculated as follows : however , the compensation value may be capped at maxgb allow , where : max gb allow = min (( avggr + avggb )/ 2 )* gb _ thre )/ 256 , max corv ) if \| diff _ gb \|& gt ; max cutv then diff _ gb = 0 ; maxcorv , maxcutv , and gb_thre are parameters that may be selected empirically by the system designer or user . for example , maxgb allow can be adjusted adaptively based on the selection of gb_thre and maxcorv . both gb_thre and maxcorv may be varied based on sensor characteristics such as analog gain and integration time . maxcutv would add another level of protection , in that if the estimated value exceeds maxcutv , it would be known that the estimate is wrong ( and should be , e . g ., reset to 0 ). after the compensation value has been determined , it is subtracted from each gb pixel and added to each gr pixel . where the operation is being performed on a pixel basis , or where the operation is being performed on a kernel basis and the center pixel of the kernel is green , the result is as follows : where the operation is being performed on a kernel basis and the center pixel of the kernel is not green , the result is as follows : the foregoing methods may be carried out by digital image processor 104 ( fig1 ). digital image processor 104 may be hard - wired to perform the methods , and may include firmware and appropriate microcode to perform the methods , or digital image processor 104 may include a general - purpose or specialized processor that can execute software to perform the methods . although the foregoing implementation has been described in the context of an rgb color model , this disclosure may be applicable to other color models where the spectral response of one of the native colors of the model is closer than others of the native colors to the luminance response of human visual system . for example , in a cmyk or rgby color model , yellow may be treated in a manner similar to green in the foregoing implementation . it will be understood that the foregoing is only illustrative of the principles of the invention , and that the invention can be practiced by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow .	7
the following detailed description is of the best presently contemplated mode of carrying out the invention . this description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention since the scope of the invention is best defined by the appended claims . fig1 is a block diagram of an embodiment of the invention . when multiple copies are reproduced from an original document , the number of required copies is selected by pressing a copy setting means ( for example a ten key keyboard 1 ) after closing a power switch ( not shown ) of a copying apparatus . accordingly , the selected number of copies is displayed at a display station 2 which comprises display elements having first and second digits . in the feeding operation , a feeding device 3 provides a single pulse on line 4 whenever each individual copy paper is fed . when the feeding device 3 receives a low level signal from line 23 , the feeding operation is finished , and the required multiple copies have been made . in a copy paper discharge detecting circuit 5 , a micro switch ( not shown ) is disposed on a copy paper transport path for guiding a copy paper after completion of the copying step . whenever the micro switch detects a copy paper being discharged , the copy paper discharge detecting circuit 5 provides a single pulse on line 6 . a paper jam detecting circuit 7 is provided with two micro switches at a distance in the transport direction of the copy paper transport direction . in the case where the micro switch disposed upstream detects the copy paper and then the micro switch disposed downstream does not detect the copy paper after a predetermined time period elapses , or in the case where the micro switch disposed in the down stream continues to detect the copy paper over a predetermined time period , the paper jam detecting circuit 7 recognizes that a paper jamming has occured and provides a high level signal on line 8 . since the paper jam detecting circuit 7 is provided with a reset button ( not shown ), a low level signal is supplied from the paper jam detecting circuit 7 to line 8 by pressing the reset button after a jammed paper has been expelled from the copying apparatus . by pressing the keys of the keyboard 1 , the information indicating the desired number of copies supplied by the keyboard 1 is supplied to a set copy number memory circuit 9 and is also supplied from the set copy number memory circuit 9 via line 10 to an input terminal a of a data selector 11 . the data selector 11 serves to close terminals a and w when a high level signal is supplied to a terminal ka and a low level signal is supplied to a terminal kb . the data selector 11 also serves to close terminals b and w when a low level signal is supplied to the terminal ka and a high level signal is supplied to the terminal kb . since the output signal from the paper jam detecting circuit 7 to line 8 is a low level upon pressing the key of the keyboard 1 , a low level signal is supplied via lines 8 and 14 to the terminal kb and a high level signal from line 16 is supplied from line 8 via a not gate 15 to the terminal ka . accordingly , line 10 is connected with line 12 via the data selector 11 and the information from the set copy number memory circuit 9 is applied via the data selector 11 to a subtracting counter of feeding 17 . the subtracting counter of feeding 17 serves to store an input value from line 12 when an input signal to a load terminal l is at a high level . the set copy number memory circuit 9 provides a high level signal on line 18 by pressing the keys of the keyboard 1 , and the high level signal is supplied from line 20 via line 18 and an or gate 19 to the load terminal l of the subtracting counter of feeding 17 . accordingly , the preset number of copies is stored in the subtracting counter of feeding 17 by pressing the keys of the keyboard 1 . the information stored in the subtracting counter of feeding 17 is displayed as the preset number of copies at the display station 2 via line 21 and a display driving circuit 22 . the information supplied from the set copy number memory circuit 9 is supplied from line 10 via line 24 to a subtracting counter of discharging 25 . the subtracting counter of discharging 25 serves to store the information from line 24 when the load terminal l receives a high level signal . since the high level signal is supplied from the set copy number memory circuit 9 via lines 18 and 26 to the load terminal l of the subtracting counter of discharging 25 , the information from the set copy number memory circuit 9 is stored in the subtracting counter of discharging 25 . when a multiple copying operation is commenced by pressing a print button ( not shown ), the feeding device 3 is enabled to feed copy papers and provides a single pulse on line 4 in for every feeding operation of copy paper . whenever this single pulse is supplied to a terminal ck of the subtracting counter of feeding 17 , the number stored in the subtracting counter of feeding 17 is reduced by one . correspondingly , the value displayed at the display station 2 is also reduced by one via the display driving circuit 22 . at each time when a copy paper fed out of the copying apparatus is detected after completion of a copying operation , the discharge detecting circuit 5 provides a single pulse on line 6 . whenever the terminal ck of the subtracting counter of discharging 25 receives this pulse , the number stored in the subtracting counter of discharging 25 is reduced by one . when the number of the subtracting counter of feeding 17 becomes equal to the preset number of copies , the low level signal is applied from the subtracting counter of feeding 17 via lines 21 and 23 to the feeding device 3 . correspondingly , the feeding device 3 stops feeding copy papers and the preset number of copies are reproduced . assume that the paper jamming occurs on the transport path during a multiple copying operation as described before . then , the paper jam detecting circuit 7 provides a high level signal on line 8 . therefore , the high level signal is supplied from line 14 to the terminal kb of the data selector 11 and the low level signal is supplied via a not gate 15 and line 16 to the terminal ka . since the terminals b and w of the data selector 11 are closed , line 13 is connected with line 12 via the data selector 11 . correspondingly , the information stored in the subtracting counter of discharging 25 is supplied via line 13 , the data selector 11 and line 12 to the subtracting counter of feeding 17 . when the paper jamming has occured , a high level signal is supplied via line 27 shunted from line 8 , the or gate 19 and line 20 to the load terminal l of the subtracting counter of feeding 17 . therefore , the information stored in the subtracting counter of discharging 25 is transferred to and stored in the subtracting counter of feeding 17 . correspondingly , the information stored in the substracting counter of feeding 17 is displayed at the display station 2 via the display driving circuit 22 . the value displayed at the display station 2 changes from the number of copy papers fed before the paper jamming to that of the number of copy papers discharged before the paper jamming . in brief , when the paper jamming occurs , the number of copy papers discharged after completion of the copying operation is subtracted from the preset number of copies and the resultant value is stored in the subtracting counter of feeding 17 and is displayed at the display station 2 . if two copy papers are sequentially jammed in the transporting direction of the copy paper transport path , the value of the subtracting counter of feeding 17 becomes equal to the value of the number of the occasion of the paper jamming plus 2 . similarly , the value of the number of the occasion of the paper jamming plus 2 is displayed at the display station 2 . to release the paper jamming , take a jammed paper out of the copying apparatus ; furthermore , in the case where there is another copy paper on the copy paper transport path , take it together with the jammed paper . then , the reset button ( not shown ) of the paper jam detecting circuit 7 is pressed . thus , the paper jam detecting circuit 7 is reset and an output signal from the paper jam detecting circuit 7 to line 8 becomes a low level . when an output signal supplied from line 8 changes from high level to low level , the data selector 11 causes the terminals a and thereby causes w to close and line 10 to be connected to line 12 . on the contrary , since an output signal supplied from the set copy number memory circuit 9 to line 18 is at a low level , the information of the set copy number memory circuit 9 is never stored in the subtracting counter of feeding 17 . a print button is also pressed after the reset button is pressed , and the preceding preset number of copies set by the keyboard 1 is reproduced without setting the number of copies again . though the stored information of the subtracting counter of discharging 25 is transferred to the subtracting counter of feeding 17 as noted above when the paper jamming occurs , the stored information of the subtracting counter of discharging 25 is not erased yet and remains to be stored . accordingly , even though the paper jamming occurs several times , it is not necessary to again set the number of copies . fig2 is a block diagram of another embodiment of the invention . the same reference numerals designate the corresponding portions shown in fig1 . in this embodiment , adding counters of feeding 30 and of discharging 31 are utilized in order to count the number of copies in place of the subtracting counters of feeding 17 and of discharging 25 of fig1 . the information supplied from the keyboard 1 to the set copy number memory circuit 9 is supplied via line 32 to one input terminal of a comparing circuit 33 . a single pulse corresponding to every feeding of a copy paper is applied via line 35 to a terminal ck of the adding counter of feeding 30 . correspondingly , the adding counter of feeding 30 increases its stored value one by one , starting from a stored value of zero , when the load terminal l receives a low level signal . the value of the adding counter of feeding 30 is displayed at the display station 2 via the display driving circuit 22 . therefore , the value displayed at the display station 2 has one added thereto for every feeding a copy paper . the value of the adding counter of feeding 30 is applied via line 34 to the other input terminal of the comparing circuit 33 . a single pulse is applied via line 36 to the terminal ck of the adding counter of discharging 31 for each time when the discharge detecting circuit 5 detects a discharge of a copy paper , and the value stored in the adding counter of feeding 31 has one added thereto , starting from a stored value of zero . in the comparing circuit 33 , when the input value from line 32 becomes equal to the input value from line 34 , i . e . when the number of copies set by the keyboard 1 equals the value of the adding counter of feeding 30 , a low level signal is supplied from the comparing circuit 33 via line 39 to the feeding device 3 . accordingly , the feeding device 3 stops feeding copy papers and the preset number of copies are reproduced . assume that the paper jamming occurs during the copying operation as above - mentioned . then , a high level signal is applied from the paper jam detecting circuit 7 via line 37 to the load terminal l of the adding counter of feeding 30 . since the value of the adding counter of discharging 31 is applied via line 38 to the adding counter of feeding 30 , the value of the adding counter of discharging 31 is transferred to and is stored in the adding counter of feeding 30 when the load terminal l receives a high level signal . at the same time , the value from the adding counter of discharging 31 is displayed at the display station 2 via the display driving circuit 22 . when the paper jamming occurs , the value of the adding counter of discharging 31 is stored in the adding counter of feeding 30 . therefore , it is not necessary to again set the number of copies after a jammed paper is expelled and the preset number of copies are successively reproduced .	6
before explaining the disclosed embodiment of the present invention in detail , it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . to facilitate a full understanding of the technical scope of this invention the following terms are defined hereafter : center - shot — the horizontal positioning of the arrow in reference to the bow string and vertical adjustment of the arrow rest ; arrow rest — the device attached to the riser of the bow which supports the frontal weight of the arrow and guides the arrow as it leaves the bow during the shooting sequence ; nock — slotted rear end of an arrow ; nock position — the location segment where the arrow is attached to the bow string that determines the vertical alignment of the arrow ; bow tuning — the combination of center - shot and nock positions to provide optimum arrow flight ; and , optimum arrow flight — arrow travel free of erratic movement including fish tailing and / or porpoising . according to this invention the above objects detailed in the summary of the invention can be achieved by a uniquely simple technique of first temporarily mounting a laser arrow rest adjustment fixture to the sight mounting of the bow riser and secondly using said fixture to center - shot position the extant arrow in the arrow rest so that it is fully aligned with the bow string . the advantages and features of the present invention will be apparent upon consideration of the following description . reference should now be made to fig1 to 4 which illustrate the inventive concept by providing two front , one side and one rear view , respectively , of the arrow rest adjustment fixture of the invention . its temporary mounting on the bow makes possible the optimum arrow flight of those arrows fired from simple bows by alignment of the arrow with the bow string . as shown in fig1 - 4 , the arrow rest adjustment fixture 1 is used to correctly position the arrow rest so that the arrow attached to the nock of the bow string and resting on the arrow rest is aligned with the bow string , which is shown and described later in reference to fig5 - 7 a . as shown initially in fig1 the device ( fixture ) 1 consists of : a pivoting light source 2 such as a laser head secured by the laser mount 3 ; a bow mounting plate 4 with bracket mounting holes 20 ; a battery 5 which is connected by the power wire 6 to the laser in the laser head 2 ; the laser head adjustment screw 7 ; the laser head adjustment lock screw 8 ; and , the laser head slide 9 . a motion descriptor m 1 shows the manner in which the laser head 2 slides throughout its horizontal adjustment to align the arrow shaft with the bow string when used in the method of the invention . although the preferred light source is a laser beam as described above , any temporarily mounted light beam housed in the head 2 with a switch to turn a light beam on and off as needed can be used to transverse the arrow shaft to achieve string alignment with the fixture of the invention . a preferred laser light source for the invention can be a laser module such as the red , green and industrial laser modules manufactured by creative technology lasers of concord , calif ., which use a visible laser light source of up to approximately 670 nm . the light source used in the invention is intended to create a visible light marking that can be seen by the user along the length of the arrow . the light source can have a beam diameter that is up to the diameter dimension of the arrow itself . other types of lasers that emit visible beams can include leds ( light emitting diodes ), focused laser pointers , and the like . additionally , non - laser light sources can also be used as long as the beam can be made visible along the arrow itself and meet the objectives of the subject invention . as earlier recited , fig2 is a front view of the laser arrow rest adjustment fixture which describes the movement m 1 of the lateral slide of the laser head to align with the bow string and fig3 is a side view of the laser arrow rest adjustment fixture that demonstrates the rotating motion m 2 of the laser head as it follows the length of the arrow shaft ( the numbering is common with that of fig1 ). as earlier recited , fig4 is a back view of a bow 10 with an adjustable arrow rest 11 and the laser arrow rest adjustment fixture 1 with its pivoting laser head 2 attached to the riser of said bow to facilitate the eventual alignment of the arrow in the rest 11 with the bow string 12 . before considering the rest of the figures , it would be best to discuss the method of using the laser arrow rest adjustment fixture to align the arrow to be fired at rest 11 with the bow string 12 . initially , referring to fig3 , 6 , and 6 a , user will attach the bow mounting plate 4 of the fixture 1 to a flat sided riser portion 110 on a bow 10 by using removable fasteners 125 such as screws and nuts , that pass through the plate mounting holes 20 and into through - holes 120 on the riser portion 110 . generally , most riser portions 110 on bows 10 have existing through - holes 120 for allowing a site to be attached to the bow 10 . the first step after the fixture 1 has been attached to the riser 110 of the strung bow 10 and an arrow end slot portion ( nock ) 30 is positioned about an existing nocking point 130 on a bow string 12 , is to turn on the laser in the head 2 and rotate it toward the bow string 12 while adjusting the horizontal slide 9 in the direction of arrow m 1 until the laser beam 15 a is centered on the string 12 at the nocking point 130 . when the beam 15 a is able to strike the nocking point 130 , the laser head adjustment locking screw is rotated to a locked position fixing the position of the laser head 2 relative to the mounting plate 4 . the second step with the arrow shaft 13 connected to the bow string 12 at the nock point of the bow string 130 and positioned in the rest 11 , the laser head rotation adjustment screw 7 is unlocked by rotating counter - clockwise allowing the laser head 2 to be able to be rotated downward in the direction of arrow m 2 toward the arrow shaft 13 simultaneously as the rest 11 is horizontally moved in the direction of arrow m 3 , until the laser dot 14 is centered on and substantially along the upper surface of the arrow shaft 13 . the final step is to rotate the laser head so that the laser dot transverses substantially the entire length of the arrow shaft 13 . if the position of the rest 11 is adjusted properly , the laser dot should follow the full length of the arrow shaft 13 . if it does not then a further adjustment of the rest 11 is required in order to align the arrow shaft 13 with the bow string 12 . prior to shooting the arrow 13 , the user can remove the fixture 1 by removing the removable fasteners 125 , and taking off the fixture 1 . now with reference to fig5 it shows a side view of a bow 10 and string 12 with a mounted laser arrow rest adjustment fixture 1 and its pivoting laser head 2 positioned above the adjustable arrow rest 11 with its arrow shaft 13 which connected at its slotted end to the nock of the string 12 . please refer now to fig6 and 6 a where the latter is a detailed blow - up view of the former which is a front perspective view of a bow 10 with a mounted laser arrow rest adjustment fixture 1 and pivoting laser head 2 providing a laser beam 15 which is shown as a laser path 14 on the crown of the arrow shaft 13 . as earlier described in fig2 m 1 indicates the lateral movement of the head 2 by means of the laser head adjustment screw 7 until it is properly positioned at which point it is secured by the lock screw 8 . as earlier described in fig3 m 2 indicates the pivotal movement of the head 2 by means of which the laser dot can put on the path 14 along the arrow shaft 13 . m 3 indicates the adjusting movement of the arrow rest 11 perpendicular to the arrow shaft 13 which results in the movement m 4 since the slotted end of the arrow shaft 13 is attached to the nocking point of the bow string 12 . refer now to examples 7 and 7 a , where again the latter is a detailed blow - up view of the former which is a rear perspective view of a bow 10 with a mounted laser arrow rest adjustment fixture 1 and pivoting laser head 2 describing laser path 14 on the crown of the arrow shaft 13 . these figures show the lateral movement m 1 and pivotal movement m 2 of laser head 2 as well as the lateral movement m 3 of the rest 11 whereby the arrow shaft 13 is aligned with the bow string 12 . for the subject invention , the following are advantages of the laser arrow rest adjustment fixture of the invention : increased accuracy ; simplicity of operation ; compactness of structure ; and , only two moving parts for determination of the center - shot of the bow . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .	8
referring now more particularly to fig1 of the drawings , there is shown an illustrative hot runner bushing 10 in accordance with the present invention . the hot runner bushing 10 is usable for conveying a pressurized melt stream such as fluid plastic material in an injection molding machine . in this case , the illustrated hot runner bushing 10 is particularly designed for conveying a melt stream from a supply source to a gate leading to a mold cavity . however , as will be appreciated by those skilled in the art , the present invention is also applicable in other melt stream conveying components of an injection molding machine . moreover , the present invention can be used with any desired plastic resin material whether crystalline or amorphous including resins reinforced with glass . in the illustrated embodiment , the hot runner bushing 10 consists of a cylindrical body 12 having a central flow passageway 14 extending longitudinally through the body 12 for conveying the pressurized melt stream . the hot runner bushing 10 includes an annular flange or head 16 at the inlet or upstream end 18 of the bushing 10 ( see , e . g ., fig1 ) through which the melt stream is directed into the bushing . at the outlet or downstream end 20 of the bushing 10 , a tip 22 is provided , which in this case is a separate member that is received in the downstream end 20 of the bushing 10 and secured in place via a retaining element 23 . the tip 22 has a fluid passageway that communicates with the fluid passageway 14 in the bushing body 10 so that a melt stream directed through the bushing is conveyed into or around the tip . furthermore , the tip 22 includes one or more exit passageways that direct the melt stream through the gate and into the mold cavity . depending on the gating requirements of the particular application , the tip 22 can have a variety of different configurations and the present invention is not in any way limited to any particular tip configuration . for heating the melt stream during its travel through the flow passageway 14 of the bushing body 12 , the hot runner bushing 10 includes a heater 24 . according to one important aspect of the present invention , one or more components of the heater 24 are thermally sprayed ( e . g ., flame sprayed or plasma sprayed ). using thermally sprayed components allows the heater 24 to be manufactured in an easier and more cost effective manner as compared to conventional hot runner bushing heaters . specifically , conventional hot runner bushing heaters require multiple labor - intensive steps to manufacture . in contrast , the use of thermally sprayed components eliminates , for example , the need for swaging as well as manual addition of cement for wire management . the use of thermally sprayed components also enables the heater 24 to have a relatively thin profile as compared to bulky conventional heaters . the reduced profile of the heater 24 makes it less susceptible to condensation and moisture and makes it easier to use with relatively small hot runner components . thermal spraying is a well - known process and , as such , is not described in detail herein . generally , in a thermal spraying process a powdered material is fed in a carrier gas to a flame spray gun or torch ( either arc plasma or gas ). the flame spray gun heats the powdered material and the hot powder fuses together and to the substrate to which it is being applied forming a thin coating or layer . the application of the components of the heater of an exemplary embodiment of the present invention is shown diagrammatically in fig2 . the thermally sprayed components of the heater 24 are applied onto a preformed core 26 ( see fig2 ). the preformed core 26 can be a separate cylindrical sleeve that can be arranged over the bushing body 12 as in the illustrated embodiment or the flame sprayed components of the heater 24 could be applied directly to the outer surface of the bushing body 12 . advantageously , the use of a separate element as the core 26 allows the heater 24 to be easily replaced without discarding the entire bushing 10 . to allow for efficient heat transfer from the heater 24 to the bushing body 12 , the core 26 can be made of any suitable heat conductive material such as , for example , stainless steel . a dielectric substrate layer 28 ( see fig1 and 3 ) is arranged over the outer surface of the core 26 . the dielectric substrate layer 28 consists of a fine powder that is thermally sprayed onto the entire outer surface of the core 26 . the thermally sprayed dielectric substrate layer 28 can be between approximately 0 . 005 inch and 0 . 030 inch thick . according to preferred embodiments of the invention , the dielectric substrate layer 28 can consist of thermally sprayed aluminum oxide powder or an aluminum oxide - titanium oxide powder blend . in order to increase the adhesion of the dielectric substrate layer 28 to the core 26 , a transition layer of flame sprayed ceramic base can be applied to the core 26 before the dielectric substrate layer 28 is applied via thermal spraying . for producing heat , a thermally sprayed resistance element layer 30 is applied over or on top of the dielectric substrate layer 28 ( see fig1 and 3 ). in particular , the resistance element layer 30 consists of an electrically conductive powdered material ( e . g ., nickel chromium or molybdenum - silicon ) that is flame sprayed onto the dielectric substrate layer 28 . in preferred embodiments of the invention , the resistance element layer 30 can be approximately 0 . 005 inch to approximately 0 . 040 inch thick . unlike the dielectric substrate layer 28 , which is generally applied over the entire surface of the core 26 , the resistance element layer 30 is generally formed in a discrete pattern or profile on the heater 24 with areas of the heater remaining uncovered . this pattern or profile enables the heat produced by the heater 24 to be concentrated in certain areas of the hot runner bushing 10 . for example , in the illustrated embodiment , the resistance element layer 30 is formed in a helical pattern , as best shown in fig3 , that concentrates the heat that is produced in areas near either end of the bushing 10 . the resistance element layer 30 can be formed into the desired pattern in at least two different ways . first , the resistance element powder can be flame sprayed over the entire dielectric substrate layer 28 . the desired pattern can then be formed by removing the unwanted areas of the resistance element layer 30 such as by micro sandblasting . the removal process can be facilitated through the use of a mask that covers the portions of the resistance element layer 30 needed for the final pattern . alternatively , a mask with openings in the form of the desired pattern can be used when the resistance element powder is flame sprayed onto the heater 24 . when the mask is removed , the resistance element layer 30 will be in the desired pattern . as will be appreciated , the present invention is not limited to any particular method for forming the resistance element layer 30 into the desired pattern . to ensure efficient thermal conductivity , a thermally sprayed dielectric overlay layer 32 is provided over the resistance element layer 30 . to form the dielectric overlay layer 32 ( shown partially cutaway to expose the resistance element layer in fig1 ), a dielectric powdered material ( e . g ., aluminum oxide powder or an aluminum oxide - titanium oxide powder blend ) is thermally sprayed over or on the resistance element layer 30 . in certain preferred embodiments , the thermally sprayed dielectric overlay layer 32 is approximately 0 . 005 inch to approximately 0 . 040 inch thick . as with the initial dielectric substrate layer 28 , transition layers can be used between the resistance element layer 30 and the dielectric substrate layer 28 and the resistance element layer 30 and the dielectric overlay layer 32 to help improve the adhesion of the layers . to protect the thermally sprayed components of the heater from damage , the heater can be equipped with an outer shell 34 which overlies the dielectric overlay layer as shown in fig4 . for connecting the resistance element layer 30 to an electrical power source , the heater 24 has leads 36 extending radially through an upper end of the outer shell 34 as shown in fig4 . these leads 36 connect to end points 37 of the resistance element layer 30 . when applying the dielectric overlay layer 32 , these end points 37 should remain uncovered so that the power leads 36 can be attached thereto . in order to sense the temperature of the bushing body 12 , a thermocouple 38 extends between the bushing body 12 and heater core 26 to a point approximately midway the axial length of the bushing and has an upstream lead extending from the shell 34 at a location adjacent the heating element leads 36 as shown in fig4 . in an alternative embodiment of the invention , the thermocouple 38 also could comprise a thermally sprayed element that is flame or plasma sprayed onto the heater core 26 . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .	1
fig1 a and 1b collectively show a multi - color electrophoretic image display ( epid ) 10 according to a first embodiment of the invention . the epid 10 comprises a pair of parallel electrodes 11 , 12 sealingly assembled together with spacers 13 to form a liquid and gas sealed enclosure having a small space s between the electrodes 11 , 12 ( fig4 ), and an electrophoretic fluid 14 filling the space s between the electrodes . the electrophoretic fluid 14 is conventional , comprising a dielectric liquid of a dark color , such as a blue or red , having suspended therein millions of polymer / pigment composite dielectric particles 16 ( electrophoretic particles 16 ) of a light color , such as white or yellow , which can be charged in accordance with known techniques . the epid 10 is typically rectangular in shape , although other geometrical configurations can be employed as well . electrode 11 , referred to hereinafter as anode 11 , is constructed from a generally planar sheet of transparent plastic or glass . as shown in fig2 a , the anode 11 includes parallel rows of electrically conductive , transparent electrode or anode lines 18 on an inner surface 17 thereof . the anode lines 18 are typically fabricated by depositing a thin ( about 300 angstroms in thickness ) transparent layer of conductive material , such as indium - tin - oxide ( ito ), on the inner surface of the sheet and selectively etching the layer to form the anode lines . this can be accomplished using conventional thin - film deposition and etching techniques . as shown in fig2 b , a multi - color light filter array 20 is provided on an outer surface 19 of the anode 11 . the light filter array 20 can include a two dimensional array of red , blue , and green colored filters 21 . the filters 21 are typically fabricated using conventional printing or lamination techniques . alternatively as shown in fig2 c , the light filter array 21 can be constructed as alternating rows of red , blue , and green colored filters 22 . the filters 21 are typically colored plastic presenting primary colors red , green and blue . as is well known , such colors can provide all colors of the spectrum , as in conventional color displays . electrode 12 , referred to hereinafter as cathode 12 , is constructed from a generally planar sheet of plastic or glass . as shown in fig3 a , the inner surface 23 of the cathode 12 defines a two dimensional array 24 of cells 25 which resembles an egg - crate structure . each cell 25 of the array includes one or more side walls 26 ( four side walls 26 are illustrated in the embodiment of fig3 a ) which project generally perpendicularly from the inner surface 23 of the cathode 12 . the floor of each cell includes an electrode pad 27 formed by a coating of an electrically conductive material such as ito . the electrode pads 27 can be deposited using conventional semiconductor deposition techniques . as shown in the cross - sectional view of fig4 , each cell 25 of the array 24 is filled with a portion of the electrophoretic fluid 14 and a corresponding portion of the electrophoretic particles 16 dispersed therein , and is operative as one pixel cell for imaging . the cells 25 tend to isolate the electrophoretic particles 16 from each other , therefore , significantly improving the electrical , colloidal , operational , and life - time stability of the epid 10 . moreover , the cells 25 can be easily dimensioned to provide hundreds of pixels per inch , thereby enabling one to obtain extremely fine resolution , hence creating high resolution display capabilities which exceed the resolution of present commercially available display . as shown in fig3 b , an integrated circuit 30 for driving the pixel cells 25 is formed on an outer surface 29 of the cathode 12 . the drive circuit 30 is conventional in design and operation and includes a plurality of diode or transistor amplifiers 31 which are interconnected by electrically conductive lines 32 made for example from ito . the drive circuit 30 can be fabricated on the outer surface 29 of the cathode 12 using well known integrated circuit manufacturing techniques . as shown in the cross - sectional view of fig4 , an electrically conductive through - hole or via 33 , extends through the cathode and electrically connects the electrode pad 27 of each cell 25 to one of the wires 32 of the drive circuit 30 formed on the outer surface 29 of the cathode 12 , thereby permitting each cell 25 to be electrically driven . as one of ordinary skill in the art will recognize , by applying proper biasing potentials on the respective amplifiers 31 , a biasing potential is created between the anode and cathode 11 , 12 which will cause the electrophoretic particles 16 in any cell 25 to move between the anode and the cathode 11 , 12 in accordance with the electrophoretic effect . for example , if the electrophoretic particles 16 are initially disposed in their associated cells 25 of the cathode 12 ( adjacent from corresponding positions on the anode lines 18 ) attracted there by their charge , which is opposite to the applied voltage , reversal of the sign of the applied voltage will cause these particles 16 to move to their corresponding positions on the anode lines 18 of the anode 11 . if the electrophoretic particles 16 are initially disposed on the anode lines 18 of the anode 11 ( adjacent their associated cells 25 ) attracted there by their charge , which is opposite to the applied voltage , reversal of the sign of the applied voltage will cause these particles 16 to move to their associated cells 25 of the cathode 12 . as shown in fig5 a and 5b , when the electrophoretic particles 16 within each cell 25 are electrically driven to a corresponding position on the anode lines 18 of the anode 11 where they remain , the particles 16 on the anode 11 generate a reflective surface thereunder that reflects incoming light passing through each cell &# 39 ; s 25 respective color filter 21 to produce red , blue , and green light . by combining the appropriate number of cells 25 producing red , blue , and green light , a multi - color image can be produced including multi - color alpha numeric characters or graphics , such as television pictures . referring again to fig4 , the spacers 13 are sealed to the inner surfaces of the anode and cathode 11 , 12 around the perimeter of the display using conventional sealing methods . the spacers 13 have a thickness t which is at least 1 mil thicker than the height . h of the cell walls 26 which creates a gap g between the inner surface 17 of the anode 11 and the free edges of the cell walls 26 . this gap g permits the electrophoretic fluid 14 to flow into and fill up each cell 25 of the cathode 12 when the epid 10 is filled with the fluid 14 . in a second embodiment of the epid of the invention , the inner surface 23 of the cathode 12 , as shown in fig6 , defines parallel rows 51 of elongated cells instead of an egg - crate structure as in the first embodiment . each elongated cell 51 operates as a line or row pixel . the light filter array ( not shown ) used in this embodiment can be constructed as described in fig2 c with alternating lines of red , blue , and green colored filters , each of which operates as a light filter for a corresponding one of the cells 51 . fig7 a - 7c collectively illustrate the epid 70 according to a third embodiment of the invention . in this embodiment , the cathode 12 essentially omits the cell side walls which project from the inner surface 23 thereof in the previous embodiments . this allows the drive circuit 30 , to which includes the electrically conductive metal lines 32 that electrically interconnect the diodes or transistors 31 disposed between the pixels , to be formed on the inner surface 23 of the cathode 12 along with the electrode pads 27 so that the electrically conductive through - holes used in the previous embodiments can be eliminated . electrically conductive contact pads 71 , which connect the drive diodes or transistors 31 to a driver chip , are also formed on the inner surface 23 of the cathode 12 adjacent opposing edges of the cathode 12 . fig8 a - 8c collectively illustrate an epid 60 according to a fourth embodiment of the invention . in this embodiment , the epid 60 is constructed by combining three individual epids 61 , 62 , 63 together in a face - to - face manner . the front , middle , and rear epids 61 , 62 , 63 can be constructed essentially as described above in the previous embodiments , but without the filter arrays . each epid 61 , 62 , 63 contains electrophoretic particles preferably of one of the primary colors red , blue , and green . for example , epid 61 can contain red particles , epid 62 can contain blue particles , and epid 63 can contain green particles . thus , the front epid 61 displays only red light , the middle epid 62 displays only blue light , and the rear epid 63 displays only green light . further , the cells or pixels 64 , 65 , 66 of the epids 61 , 62 , 63 are oriented so that the light produced by the cells or pixels 65 , 66 of the middle and rear epids 62 , 63 can be view through the front epid 61 . this can be accomplished , as shown in fig8 c , by spacing apart the cells or pixels 64 , 65 , 66 in each of the epids 61 , 62 , 63 and by aligning the cells 64 , 65 , 66 of the front , middle , and rear epids 61 , 62 , 63 in an offset manner . additionally , both of the electrodes in at least the front and middle epids 61 , 62 , 63 are constructed from transparent plastic or glass sheets and employ transparent electrode lines and electrode pads . in operation , the epid 60 combines the appropriate number of red , blue , and green cells 64 , 65 , 66 from the front , middle , and rear epids 61 , 62 , 63 to produced a multi - color image which is viewed through the front epid 61 . while the foregoing invention has been described with reference to the above embodiments , various modifications and changes can be made without departing from the spirit of the invention . accordingly , all such modifications and changes are considered to be within the scope of the appended claims .	6
referring now to the drawings and , specifically , to fig1 there is depicted a block diagram of a date data processor incorporating a preferred embodiment according to the invention . the date data applied by means of a key group 1 is converted into numerical data representing the input date by a key input unit 2 and the numerical data converted is then loaded into a date storage register 4 by way of an and gate 3 in response to a signal 14a . the register 4 includes a memory area x d for storing &# 34 ; day &# 34 ;, a memory area x m for storing &# 34 ; month &# 34 ; and a memory area x y for storing &# 34 ; year &# 34 ;. these memory areas are defined by a digit timing signal . to the other input of the and gate 3 is applied a control signal 14a from an operation control signal generator 14 which sequentially produces various kinds of necessary signals for operation of the system . the output signal from the date storing register 4 is applied to the unit 10 for calculating the number of days , through a two - input and gate 5 supplied at one input with a control signal 14b . the days calculating unit 10 is controlled by a control signal 14e and operatively associated with w register 20 and z register 21 . the w register includes a memory areas w y , w d and w m . a memory circuit 6 for storing a constant 365 . 25 and a memory circuit 7 for storing a constant 30 . 6 , which may be registers , are associated with the days calculating unit through and gate 8 having one input to which signal 14c is applied and and gate 9 having one input to which signal 14d is applied , respectively . included in the days calculating unit 10 are arithmetic means such as an adder , gating means for interfacing w register 20 and z register 21 , and related gates for executing given arithmetic operations ( not shown ). the days calculating unit 10 calculates the number of days from the input date which is stored in the date storing register 4 to a given reference date , for example , mar . 1 , 1900 , said number being referred to as the days difference or the difference of days . as an example , it will be assumed that the system is operating to calculate the difference of days in the case where the input date data is in a range from mar . 1 , 1900 , to feb . 28 , 2100 , and the reference date is mar . 1 , 1900 . reference is made to the flow chart of fig2 which illustrates the operation of the calculation . at a first step ( 1 ), the contents of register 4 are loaded into the w register 20 associated with the days calculating unit 10 in synchronism with the control signal 14a . at this time , the contents of register 4 are not changed . more specifically , the contents of the memory areas x m , x d and x y are loaded into the memory areas w m , w d and w y , respectively , thereby storing information relating to &# 34 ; month &# 34 ;, &# 34 ; day &# 34 ; and &# 34 ; year &# 34 ; in the areas w m , w d and w y , respectively . then , at a second step ( 2 ), a determination is made as to whether the contents of the memory w m , i . e , &# 34 ; month &# 34 ; are larger than 3 or not . if it is equal to or larger than 3 , the control operation advances to step ( 3 ) and the result of subtraction of 3 from the contents of the memory area w m are reloaded into the memory area w m . if the contents are smaller than 3 , the operation advances to step ( 5 ) where 9 is added to the contents of w m , which sum is reloaded into the w m . thus , the contents of w m obtained by steps ( 3 ) or ( 5 ) is the difference between the month of the input date and the month of the reference date . in this example , the reference month is march and therefore the number of months from march is the month difference . accordingly , in the case of january and february , 10 and 11 months are the difference months from the reference month , i . e , march . this is obtained as shown in step ( 5 ). in this case , the operation proceeds to step ( 6 ) where the results of the subtraction of 1901 from the contents in the memory area w y i . e &# 34 ; year &# 34 ; is reloaded into the w y . january and february are considered as the months in the previous year with respect to the reference month , i . e . march . for this reason , &# 34 ; 1 &# 34 ; must be subtracted from the difference between the year of the input date and the year of the reference date , for purpose of correction . accordingly , the contents of the w y loaded in step ( 6 ) are the difference years between the year of the inputted date data and the year of the reference date . while in the case of step ( 3 ), the year difference is the result of subtraction of the reference year 1900 from the year of the input date and is written into the area w y , as shown in step ( 4 ). in step ( 6 ), if the result is negative , the date data is not calculable in the date data processor , resulting in an error . then , in step ( 7 ) the difference in days between the input date data and the reference date is calculated in response to signal 14e , by using the difference year stored in the memory area w y , the difference month stored in the memory area w m , and the day stored in the area w d . for this purpose , a constant 365 . 25 stored in the memory circuit 6 , corresponding to the average number of days of one year including a leap year , is introduced into the days calculating unit 10 via the gate 8 in synchronism with the control signal 14c . also , a constant 30 . 6 stored in the memory circuit 7 is introduced from the register 7 into the unit 10 via the gate 9 in synchronism with the control signal 14d . the sum of the integer part of the product of the constant 365 . 25 and the year difference loaded into the memory area w y at steps ( 4 ) or ( 6 ), the integer part of the product of the constant 30 . 6 and the month difference loaded into the memory area w m at steps ( 3 ) or ( 5 ), and the day of the memory area w d , is calculated , which sum is the day difference between the input date data and the reference data . the day difference i . e , the sum is loaded into the memory circuit z . then , in step ( 8 ) the contents of the memory circuit z are checked to determine whether the contents are larger than the constant 72989 . when the contents of the memory z are larger than the constant , the input data is beyond feb . 28 , 2100 , and is uncalculable , resulting in an error . in this manner , the days calculating unit 10 calculates the day difference between the input date and the reference date and stores it therein . next , the inverse calculation will be described with reference to fig1 and 3 . the inverse - calculation unit 13 is operatively associated with w register 20 , z register 21 and flip - flop 22 and includes arithmetic means ( e . g . an adder ), gating means for interfacing w register 20 and z register 21 . in response to signal 14h , the unit 13 is enabled . at a step ( 10 ), &# 34 ; 0 &# 34 ; is loaded into the memory areas w y , w m , and w d in w register 20 to set them to initial states . in a step ( 11 ), the contents of the register 6 , i . e . the average days of one year , 365 . 25 , is introduced into the inverse - calculation unit 13 via and gate 11 in synchronism with the control signal 14f . in the unit 13 , the contents of z register 21 which is the number of days is divided by the average days 365 . 25 introduced . the integer part of the quotient as a result of the division is loaded as an inversely - calculated year difference in the memory area w y . in a step ( 12 ), the days difference corresponding to the year difference , that is , the product of the contents of the area w y and 365 . 25 , is subtracted from the contents of z register 21 . then , the subtraction is rounded to one decimal place by adding 0 . 9 thereto which corresponds to the sum of the difference days relating to the difference months and days per se . the integer of a value obtained through this operation , that is the rounded subtraction , is loaded into z register 21 . then , at step ( 13 ), the flip - flop 22 is set . the flip - flop 22 is used for judging whether the inversely - calculated &# 34 ; month &# 34 ; is january or february in the proceeding step . then , in step ( 14 ) the contents of z register 21 are checked to determine whether it is &# 34 ; 0 &# 34 ;. if it is &# 34 ; 0 &# 34 ;, the date is february 29 of a leap year . in this case , at step ( 15 ) 366 is loaded into z register 21 , and at step ( 16 ) the flip - flop 22 is reset . in step ( 17 ), the contents 30 . 6 of the register 7 are loaded into the date inverse - calculation unit 13 via and gate 12 in synchronism with control signal 14g . in the unit 13 , the constant 30 . 6 is used to divide the contents of z register 21 . the integer of the quotient of the division is loaded as an inversely - calculated month difference in the memory area w m . in step ( 18 ), the product of the quotient in step ( 17 ), i . e . the contents of the memory area w m and the constant 30 . 6 are subtracted from the contents of z register 21 . the difference as a result of the subtraction is loaded into z register 21 . the integral part of a value obtained by rounding the figures of the surplus below the decimal point by adding 0 . 5 thereto corresponds to the number of days per se . when the surplus has no integer part , that is the content of z is below 0 . 6 , the following correction is executed . specifically , in step ( 19 ), the contents of z register 21 is checked to determine whether they are larger than 0 . 6 . when the contents are below 0 . 6 in which the surplus has no integer part , the operation proceeds to the next step ( 20 ) where 31 is loaded into z register 21 and , in step ( 21 ), 1 is subtracted from the contents of the memory area w m and the difference obtained is reloaded into the memory area w m . then , the operation advances to step ( 22 ) where 0 . 5 is added to the contents of z register 21 to round the contents at one decimal place . and the integer part of the rounded result is loaded into the memory area w d as an inversly - calculated date . then , the inversely - calculated month difference thus obtained , i . e . the contents of the memory area w m , is the difference counted from march . accordingly , when this value is within 0 to 9 , the inversely - calculated month can be obtained by adding 3 to the value . namely , in step ( 23 ), the contents of the memory area w m are checked to determine if they are larger than 9 or not . if they are equal to or less than 9 , the operation advances to step ( 25 ), where 3 is added to the contents of w m and the result of the addition is reloaded into w m as the inversely - calculated month . then in step ( 26 ) the flip - flop 22 is reset since the inversely - calculated month is within a range from march to december . on the other hand , when the contents of w m is larger than 9 in step ( 23 ), it corresponds to january or february . accordingly , in step ( 24 ), 9 is subtracted from the contents of w m and the result of this subtraction is loaded into the memory area w m as the inversely - calculated month . in the case where the month difference , i . e . the contents of the memory area w m in step ( 23 ), is 10 or 11 months , it corresponds to january or february . in this case , it is required to compensate the correction mentioned relating to the days calculating unit 10 , that is , adding &# 34 ; 1 &# 34 ; to the year difference stored in the memory area w y . accordingly , in step ( 27 ) the state of the flip - flop 22 is checked . if the flip - flop 22 is set , i . e . &# 34 ; 1 &# 34 ;, the operation advances to a step ( 29 ) where 1 is added to the contents w y , i . e . the year difference . a value obtained by adding 1900 to the year difference is the dominical year inversely - calculated . the result of this is again loaded into the memory area w y . on the other hand , unless the flip - flop 22 is &# 34 ; 1 &# 34 ;, step ( 28 ) is performed . in this step , 1900 is added to the contents of w y , i . e . the year difference and the sum thereof is loaded as the dominical year inversely - calculated . in this way , the dominical year , the months and the day , which are inversely calculated , are stored in the memory areas w y , w m and w d in w register 20 , respectively . the date thus calculated is compared with the input date data stored in x register 4 in step ( 30 ). when these are coincident , the input date really exists , and when these are not coincident each other , the input data is unreal . the date thus inversely - calculated is transferred to the register 16 through an and gate 15 in response to a control signal 14i . the outputs of the registers 4 and 16 are applied to an exclusive or gate 17 , the output of which is coupled to the reset input terminal of the r - s flip - flop 18 . the comparison of the contents of the register 4 , that is the date data inputted by the key operation , with the date data inversely - calculated and stored in the register 16 , is carried out in the following maner . firstly , a control signal 14j is generated as a set signal for the r - s flip - flop 18 at an arbitrary time before the generation of the signal 14i , and the output q of the r - s flip - flop 18 is set to logic &# 34 ; 1 &# 34 ;. under this condition , the exclusive or gate 17 produces logic &# 34 ; 1 &# 34 ; and at this time the r - s flip - flop 18 is reset to produce logic &# 34 ; 0 &# 34 ; at the output q and &# 34 ; 1 &# 34 ; at the output q . this state corresponds to a state that the contents of the registers 4 and 16 are not coincident with each other . while logic &# 34 ; 0 &# 34 ; appears at the output of the exclusive or gate 17 and is applied to the reset terminal of the r - s flip - flop 18 , the flip - flop 18 produces logic &# 34 ; 1 &# 34 ; at the output q , and continues this output state . this state indicates that the contents of both the registers 4 and 16 are coincident each other . then , the output q of the r - s flip - flop 18 is applied to the control signal generator 14 to inform it of that the input date data really exists or not . upon receipt of the output q , the control signal generator 14 performs a given operation . if the date data processor is provided with a display device for displaying a special indication and when the output q of the r - s flip - flop 18 is logic &# 34 ; 0 &# 34 ;, an operator visually recognizes that the input date data is erronous . to this end , logic &# 34 ; 1 &# 34 ;, for example , of the output q may be used in place of the &# 34 ; 0 &# 34 ; of the output q . let us consider two cases ; one for the 13th month 1 , 1977 , stored in the register 4 , the other for jan . 1 , 1978 , stored therein . in the case of the 13th month 1 , 1977 , a difference of days is calculated by the days calculating unit 10 and is 28431 . this days difference is applied to the date inverse - calculation unit 13 where it is subjected to the inverse - calculation to obtain jan . 1 , 1978 , which in turn is stored in the register 16 . the combination of the exclusive or gate 17 and the r - s flip - flop 18 compares the 13th month 1 , 1977 , in the register 4 with jan . 1 , 1978 . in this case , the output of the r - s flip - flop 18 is logic &# 34 ; 0 &# 34 ; indicating that the contents in the register 4 are unreal . the controller 14 displays this by the display means and stops the succeeding operation . while in the case of jan . 1 , 1978 , the register 16 also stores jan . 1 , 1978 inversely calculated . the output of the r - s flip - flip 18 is logic &# 34 ; 1 &# 34 ; so that it is judged that the contents of the register 4 really exist . in this case , the controller 14 operates so that the result of this is not displayed and the succeeding operation is performed . as described above , according to the invention , in a small - sized computer executing the operation relating to the date data , it is possible to judge the data which is unreal . accordingly , when an input date is erronous , the succeeding calculation which is nonsense is eliminated . in the above - mentioned embodiment , the reference date is mar . 1 , 1900 , but it is not limited to that . the calculating method for obtaining the number of days and the inverse calculation method may also be changed in accordance with the reference date selected . in the present invention , the register 16 can be eliminated by directly utilizing w register 20 for comparison with the contents of x register 4 where the function of the gate 15 is included in the unit 13 . also in the present invention ramdom access memory circuits may be used in place of registers 4 , 16 , 20 and 21 .	6
fig1 and 2 are a top front perspective view and a top rear perspective view , respectively , of a tornado resistant structure 100 , in accordance with the invention . tornado resistant structure 100 includes a building structure 101 positioned on a base 102 . base 102 is positioned on a ground 103 . building structure 101 can be constructed in many configurations and shapes , such as a dome . here , building structure 101 is a rectangular shape that includes a front deflection wall 104 a , a rear deflection wall 104 c , a side deflection walls 104 b and 104 d , a reinforced corners 105 a , 105 b , 105 c , and 105 d , and a rooftop 106 . an interior 107 ( not shown ) is bounded by rooftop 106 , deflection walls 104 a - d , corners 105 a - d , and base 102 . interior 107 can include many different rooms and arrangements . in this embodiment , interior 107 consists of nine rooms , including a rear room 130 a and frontroom 130 b ( fig5 ). the materials used to make deflection walls 104 a , 104 b , 104 c , and 104 d , reinforced corners 105 a , 105 b , 105 c , and 105 d , and rooftop 106 can be of many types , but the materials used should be able to withstand the strong winds of a tornado , such as bricks or steel - reinforced concrete . further , deflection walls 104 a , 104 b , 104 c , and 104 d , reinforced corners 105 a , 105 b , 105 c , and 105 d , and rooftop 106 can have many shapes and arrangements , such as curved or dome surfaces , although here they are flat . front deflection wall 104 a and rear deflection wall 104 c are positioned spaced apart from and opposing each other on base 102 , with side deflection walls 104 b and 104 d positioned therebetween . front deflection wall 104 a and rear deflection wall 104 c are each positioned roughly perpendicular to side deflection walls 104 b and 104 d , with reinforced corners 105 a - d positioned at their ends . for example , front wall 104 a is perpendicular to side wall 104 b , with reinforced corner 105 a extending between one end of front wall 104 a and one end of side wall 104 b . reinforced corners 105 a - d are provided to strengthen the connections between walls 104 a - d and thus strengthen building structure 101 . if building structure 101 is stronger , it is less likely to be damaged by strong winds during a tornado , and is thus safer for people within building interior 107 . exterior deflection walls 104 a - d and reinforced corners 105 a - d are also sloped to deflect the strong winds from a tornado and to prevent wind damage during a tornado , as will be discussed presently . exterior deflection walls 104 a - d and corners 105 a - d extend upwardly and inwardly from base 102 and ground 103 to rooftop 106 . in this manner , walls 104 a - d and corners 105 a - d are at an angle greater than zero degrees and less than 90 degrees relative to base 102 and ground 103 . in this manner , walls 104 a - d and corners 105 a - d are sloped , an example of which is shown in fig3 . fig3 a shows a sectional view of structure 100 taken along line 110 of fig1 . interior angle θ is formed between wall 104 b and plate 102 as shown . in this embodiment , angle θ is greater than zero and less than 90 degrees . by positioning side deflection wall 104 b so that interior angle θ is greater than zero and less than 90 degrees , wall 104 b will deflect the strong winds from a tornado away from wall 104 b . similarly , by positioning walls 104 a , 104 c , 104 d , and corners 105 a - d with an interior angle greater than zero and less than 90 degrees , they will deflect the strong winds from a tornado away from walls 104 a , 104 c , 104 d , and corners 105 a - d . hence , walls 104 a - d and corners 105 a - d are sloped to deflect the strong winds from a tornado away from structure 100 . deflecting the strong winds from a tornado away from structure 100 will prevent damage to building structure 101 and will prevent injury to people in building interior 107 . it should be noted that fig3 a shows an embodiment with deflection wall 104 b positioned against an interior wall 107 b , bounding a volume 107 c . in other embodiments , deflection wall 104 b , interior wall 107 b , and volume 107 c can be combined to be an integrated deflection wall 104 e , as shown by substitution arrow 115 . rooftop 106 extends above walls 104 a - d , and thus bounds and covers interior 107 in accordance with the invention . rooftop 106 can be of many types . in this embodiment , rooftop 106 is a substantially flat , rectangular surface . rooftop 106 is a flat surface so it more accessible to people and so that rooftop 106 and structure 101 will have a low profile . by being a low profile , structure 101 and rooftop 106 are less likely to be damaged by the strong winds of a tornado . by being more accessible to people , rooftop 106 can be used for other purposes than a roof , such as to grow a garden or for a deck . in this embodiment , rooftop 106 includes a posts 120 , a cables 121 , and a skylights 122 , as will be discussed presently . posts 120 are positioned around the perimeter of and extend upwardly and away from the top surface of rooftop 106 . posts 120 can be of many types , such as round pipes , but here they are square with a pyramid - shaped top . cables 121 are connected to and extend between posts 120 . many numbers of rows of cables can be connected to and extend between posts 120 , but here there are two . posts 120 and cables 121 prevent people from falling off rooftop 106 and allows rooftop 106 to be safely used for purposes other than a roof , as discussed above . skylights 122 are positioned on rooftop 106 and extend therethrough . skylights 122 each include a window 123 and a frame 124 . window 123 allows light to pass through each of skylights 122 , through rooftop 106 , and into building interior 107 . in this manner , skylights 122 can illuminate building interior 107 . skylights 122 can be positioned on rooftop 106 to be aligned and illuminate specific rooms within building interior 107 . windows 123 can be of many materials , such as shatter - resistant glass , but here they are a transparent plastic . the exterior walls 124 a - d of frame 124 are sloped to deflect the strong winds of a tornado away from frame 124 in the same manner as the sloped deflection walls 104 a - d of building structure 101 discussed above . thus , the exterior walls 124 a - d of frame 124 deflect the strong winds of a tornado away from skylight 122 . deflecting the strong winds of a tornado away from skylight 122 will prevent window 123 from breaking , which will prevent the strong winds and flying debris of a tornado from entering building interior 107 . this will prevent injury to people residing within building interior 107 . in addition to skylights 122 , building interior 107 can be illuminated by interior lighting , as will discussed presently . fig3 b shows an embodiment of a sectional view of structure 100 taken along line 110 of fig1 . in this embodiment , structure 100 includes a height h room extending between the bottom surface of roof 106 and the top surface of plate 102 and a height h structure extending from the bottom surface of plate 102 a to the top surface of roof 106 . structure 100 includes a facilities channel 109 and a light emitting element 108 . facilities channel 109 can provide many facilities to structure 100 , such as ductwork for hvac and electrical wiring . light emitting element 108 is provided to illuminate interior 107 . light emitting element 108 can illuminate interior 107 in many ways , such as through a wall fixture mounted flush with wall 107 b . here , light emitting element 108 illuminates interior 107 through a window 111 positioned in wall 107 b . in this manner , interior 107 is illuminated by light emitting element 108 shining through window 111 similarly to a home that does not have an exterior deflection wall 104 b . further , by positioning light emitting element 108 and facilities channel 109 within volume 107 c instead of within interior 107 , the available living space within volume 107 c is increased . by increasing the available living space within interior 107 , h structure can be decreased and h room can be increased . by decreasing h structure , structure 100 is less susceptible to damage and provides better protection to occupants of structure 100 during a tornado . by increasing h room , the comfort of the occupants residing within interior 107 is increased . in this manner , the position of light emitting element 108 and facilities channel 109 within volume 107 c increases the protection and safety of structure 100 during a tornado and increases the comfort of structure 100 . to further increase the protection and safety of structure 100 during a tornado and increase the comfort of structure 100 , structure 101 can be recessed , as will be discussed presently . in this embodiment , plate 102 of structure 100 includes a ground level portion 102 a and a recessed portion 102 b connected by portion 102 c as shown in fig3 b . a ground level 103 a is the level of the ground surrounding structure 100 . portion 102 a is positioned above ground level 103 a , and portion 102 b is positioned below ground level 103 a . a height h exposed extends from level 103 a to the top surface of roof 106 on structure 100 . in this manner , plate 102 a and a portion of interior 107 and structure 100 are positioned above ground level 103 a . a height h recessed extends from level 103 a and the bottom of plate 102 a to the bottom of plate 102 b . in this manner , plate 102 b and a portion of interior 107 and structure 100 are positioned below ground level 103 a . by positioning a portion of interior 107 and structure 100 below ground level , h recessed decreases the height h exposed and / or increases height h room for a structure 100 . by decreasing height h exposed , the amount of structure 100 exposed to the strong winds of a tornado will be decreased . by increasing height h room , the comfort of interior 107 will be increased as discussed above . in this manner , h recessed increases the protection and safety of structure 100 during a tornado and / or increases the comfort of structure 100 . it should be noted that by positioning a portion of interior 107 and structure 100 above and below ground level 103 a , interior 107 and rooftop 106 of structure 100 can both be easily accessed . rooftop 106 and the building interior 107 of structure 101 can be accessed in many ways . in this embodiment , they are accessed using a door and a combination door , as will be discussed presently . fig4 a is a partial top rear perspective view of structure 101 , in accordance with the invention . structure 101 includes a rear entrance 135 that extends through rear deflection wall 104 c into backroom 130 a of interior 107 . in this manner , rear entrance 135 provides access to backroom 130 a and to interior 107 of structure 101 . rear entrance 135 can be positioned in many ways , but here it is positioned with a bottom edge flush with base 102 to allow the low profile of structure 101 as discussed above . backroom 130 a can be of many types , but here it is a garage to contain a vehicle 131 . structure 101 includes a door 136 that is sized to cover rear entrance 135 . door 136 is repeatably movable between a closed position that covers rear entrance 135 , preventing access to backroom 130 a , and an open position that does not cover rear entrance 135 , allowing access to backroom 130 a . in this manner , door 136 closes and opens to prevent and allow access to backroom 130 a and interior 107 of structure 101 . it should be noted that door 136 can be positioned and shaped in many ways . in this embodiment , door 136 is roughly square and is positioned to be flush with wall 104 c . door 136 is flush with wall 104 c so it will be sloped , and will thus deflect strong winds from a tornado in the same manner as the slope in deflection wall 104 c discussed above . fig4 b is a partial top rear perspective view of structure 101 , in accordance with the invention . structure 101 includes a front entrance 137 that extends through front deflection wall 104 a into frontroom 130 b of interior 107 . in this manner , front entrance 137 provides access to frontroom 130 b and to interior 107 of structure 101 . front entrance 137 can be positioned in many ways , but here it is positioned with a bottom edge flush with base 102 to allow the low profile of structure 101 as discussed above . structure 101 also includes a combination door 139 that is sized to cover front entrance 137 . combination door 139 is provided to allow and prevent access to front entrance 137 and roof 106 . it should be noted that combination door 139 can provide access to roof 106 in many ways , such as through an external ramped surface . in this embodiment , combination door 139 includes external stairs 139 a to provide access to roof 106 . in a closed position , combination door 139 covers front entrance 137 to prevent access to frontroom 130 b and allow access to roof 106 . in an open position , combination door 139 does not cover front entrance 137 and allows access to frontroom 130 b and prevents access to rooftop 106 . it should be noted that combination door 139 is repeatably movable between the open position and the closed position . in this manner , combination door 139 opens and closes to allow and prevent access to frontroom 130 b and interior 107 , and rooftop 106 , respectively , of structure 101 . it should be noted that in addition to providing access to roof 106 , the stairs on combination door 139 provide a surface that will deflect strong winds from a tornado in the same manner as the slope in deflection wall 104 a discussed above . fig5 is a top perspective view of tornado - resistant structure 101 with its roof removed , in accordance with the invention . fig5 shows interior 107 with rooms 130 a and 130 b as discussed above . rooms 130 a and 130 b each include a drain 132 . drains 132 can be positioned in many ways , but here they are positioned on and extending through plate 102 , away from openings 135 and 137 in rooms 130 a and 130 b , respectively . drains 132 are needed to remove excess water in the event of flooding that may occur in rooms 130 a and 130 b . flooding in rooms 130 a and 130 b may occur due to the low profile of openings 135 and 137 discussed above . the embodiments and examples set forth herein were presented in order to best explain the present invention and its practical application and to thereby enable those of ordinary skill in the art to make and use the invention . however , those of ordinary skill in the art will recognize that the foregoing description and examples have been presented for the purposes of illustration and example only . the description as set forth is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the teachings above without departing from the spirit and scope of the forthcoming claims .	8
fig5 to 9 show schematic views of exposing and developing processes of a wafer in a semiconductor process according to the present invention . firstly , referring to fig5 , a substrate ( e . g ., a wafer 20 ) is provided . the wafer 20 has a surface 201 and a plurality of bonding pads 21 on the surface 201 . referring to fig6 , a negative - type photosensitive material ( e . g ., polyimide , pi ) passivation layer 22 is formed on the surface 201 of the wafer 20 . referring to fig7 , a first mask 24 is provided . the first mask 24 has a first pattern 241 and a first non - exposed pattern 242 . the first non - exposed pattern 242 corresponds to the area to be exposed ( e . g ., the bonding pads 21 ), so as to expose the area in the subsequent processes . normally , the first mask 24 may have extra impurities or particles ( e . g ., a first particle 243 ), and the first particle 243 is located in the first pattern 241 . after that , a first light beam 26 is utilized to pass through the first mask 24 , so as to perform a first exposure procedure on the pi passivation layer 22 . the first light beam 26 passes through the first pattern 241 , so that the corresponding pi passivation layer 22 has chemical reactions , and is not removed during development . however , as the first particle 243 blocks the first light beam 26 , a part of the area that should be irradiated by the first light beam 26 originally is not irradiated by the first light beam 26 , and does not have chemical reactions . referring to fig8 , a second mask 28 is provided . the second mask 28 has a second pattern 281 and a second non - exposed pattern 282 . the entire texture of the second pattern 281 is identical to that of the first pattern 241 . normally , the second mask 28 may also have extra impurities or particles ( e . g ., a second particle 283 ), and the second particle 283 is located in the second pattern 281 . it can be understood that it is almost impossible for the second particle 283 to be located at the same position as the first particle 243 . a second light beam 30 is utilized to pass through the second mask 24 , so as to perform a second exposure procedure on the pi passivation layer 22 . the second light beam 30 passes through the second pattern 281 , so that the corresponding pi passivation layer 22 has chemical reactions , and is not removed during development . during this exposure procedure , as no particle exists at the position corresponding to the first particle 243 , the area of the pi passivation layer 22 blocked by the first particle 243 and not having chemical reactions on the first exposure procedure will have chemical reactions as it is irradiated by the second light beam 30 in this second exposure procedure . in addition , the area blocked by the second particle 283 has already had chemical reactions in the first exposure procedure . referring to fig9 , after the second mask 28 is removed , a developer is used to perform a developing procedure on the pi passivation layer 22 . after the above two exposure procedures , the area irradiated by the first light beam 26 or the second light beam 30 remains because of the chemical reactions thereon , so as to form a plurality of openings 221 to expose the bonding pads 21 for the subsequent processes . thus , the damage to the pi passivation layer 12 ( as shown in fig4 ) and the yield loss in the conventional art will not occur . it should be noted that the present invention uses two masks having identical patterns for exposing twice , and thus when aligning them , it is possible that the openings 221 in the pi passivation layer 22 are not aligned with or have positional differences compared to the bonding pads 21 because of mechanical errors or human errors . fig1 to 12 are schematic views showing errors when exposing twice by two masks having identical patterns according to the present invention , in which the width of the first non - exposed pattern is identical to that of the second non - exposed pattern . referring to fig1 , the width w 1 of the first non - exposed pattern 242 of the first mask 24 is 60 μm ( identical to the horizontal width of the bonding pads 21 ). then , the first light beam 26 is utilized to pass through the first mask 24 to perform the first exposure procedure on the pi passivation layer 22 . after that , the first mask 24 is removed , and the second mask 28 is provided . referring to fig1 , the width w 2 of the second non - exposed pattern 282 of the second mask 28 is 60 μm . then , the second light beam 30 is used to pass through the second mask 28 to perform the second exposure procedure on the pi passivation layer 22 . the position of the s second mask 28 has a shift of 2 μm relative to the position of the first mask 24 . referring to fig1 , a developer is used to perform a developing procedure on the pi passivation layer 22 . after the above two exposure procedures , the area irradiated by the first light beam 26 or the second light beam 30 remains , so as to form a plurality of openings 221 . the width w 3 of each of the openings 221 is 58 μm , which is smaller than the horizontal width of the bonding pads 21 , so the width of the openings 221 is smaller than the required width . in order to eliminate the above disadvantages , two methods can be adopted when designing the patterns of the masks . the first method is that the width of the second non - exposed pattern 282 of the second mask 28 is the actual required width , and the width of the first non - exposed pattern 242 of the first mask 24 is designed to be larger than the width of the second non - exposed pattern 282 by 2 μm to 4 μm . the second method is that the width of the first non - exposed pattern 242 of the first mask 24 is the actual required width , and the width of the second non - exposed pattern 282 of the second mask 28 is designed to be larger than the width of the first non - exposed pattern 242 by 2 μm to 4 μm . fig1 to 15 are schematic views showing errors when exposing twice by two masks having identical patterns according to the present invention , in which the width of the first non - exposed pattern is greater than that of the second non - exposed pattern , i . e ., the aforementioned first method . referring to fig1 , the width w 1 of the first non - exposed pattern 242 of the first mask 24 is 64 μm ( larger than the horizontal width of the bonding pads 21 ). then , the first light beam 26 is utilized to pass through the first mask 24 to perform the first exposure procedure on the pi passivation layer 22 . after that , the first mask 24 is removed , and the second mask 28 is provided . referring to fig1 , the width w 2 of the second non - exposed pattern 282 of the second mask 28 is 60 μm . then , the second light beam 30 is used to pass through the second mask 28 to perform the second exposure procedure on the pi passivation layer 22 . the position of the second mask 28 has a shift of 2 μm with respect to the position of the first mask 24 . referring to fig1 , a developer is used to perform a developing procedure on the pi passivation layer 22 . after the above two exposure procedures , the area irradiated by the first light beam 26 or the second light beam 30 remains , so as to form a plurality of openings 221 . the width w 3 of each of the openings 221 is 60 μm , which is identical to the horizontal width of the bonding pads 21 . fig1 to 18 are schematic views showing errors when exposing twice by two masks having identical patterns according to the present invention , in which the width of the first non - exposed pattern is smaller than that of the second non - exposed pattern , i . e ., the aforementioned second method . referring to fig1 , the width w 1 of the first non - exposed pattern 242 of the first mask 24 is 60 μm ( identical to the horizontal width of the bonding pads 21 ). then , the first light beam 26 is utilized to pass through the first mask 24 to perform the first exposure procedure on the pi passivation layer 22 . after that , the first mask 24 is removed , and the second mask 28 is provided . referring to fig1 , the width w 2 of the second non - exposed pattern 282 of the second mask 28 is 64 μm . then , the second light beam 30 is used to pass through the second mask 28 to perform the second exposure procedure on the pi passivation layer 22 . the position of the second mask 28 has a shift of 2 μm with respect to the position of the first mask 24 . referring to fig1 , a developer is used to perform a developing procedure on the pi passivation layer 22 . after the above two exposure procedures , the area irradiated by the first light beam 26 or the second light beam 30 remains , so as to form a plurality of openings 221 . the width w 3 of each of the openings 221 is 60 μm , which is identical to the horizontal width of the bonding pads 21 . while several embodiments of the present invention have been illustrated and described , various modifications and improvements can be made by those skilled in the art . the embodiments of the present invention are therefore described in an illustrative but not restrictive sense . it is intended that the present invention should not be limited to the particular forms as illustrated , and that all modifications which maintain the spirit and scope of the present invention are within the scope defined in the appended claims .	6
in a preferred embodiment of the invention , the support base comprises two different antihalation layers , defined as a first antihalation layer that is the one closest to the support , and a second antihalation layer which is coated on said first antihalation layer , said second antihalation layers being overcoated by a protective layer . the coating compositions of the two antihalation layers and the protective layer have different rheological configuration , particularly in terms of different viscosity . the viscosity of the coating composition of the second antihalation layer is higher than the viscosity of both the coating composition of the first antihalation layer and the coating composition of the protective layer , in order to allow the coating composition of the second antihalation layer to improve the stability of the coating flow . preferably , the viscosity of the coating composition of the first antihalation layer is in the range from about 5 to about 12 centipoise , the viscosity of the coating composition of the second antihalation layer is in the range from about 10 to about 30 centipoise and the viscosity of the coating composition of the protective layer is in the range from about 8 to about 20 centipoise . the antihalation layers and the protective layer overcoating said antihalation layers used in the present invention contain the typical compounds and ingredients useful in such layers known in the art , such as binders , very fine gray or black silver filamentary or carbon black , colloidal silver , dyes , uv - absorbers , couplers and surfactants , such as those described in research disclosure , no . 17643 ( december , 1978 ). useful binders include naturally occurring polymers such as gelatin and gelatin derivatives , and synthetic organic polymers such as polyvinyl alcohols and their derivatives , acrylamide polymers , polyvinylacetals , polyacrylates , and additional binders as described in research disclosure , 17643 , paragraph ix , december 1978 . gelatin and gelatin derivatives are the preferred binders . preferably , the gelatin percentage of the coating composition of the first antihalation layer is in the range from about 3 . 5 to about 6 , the gelatin percentage of the coating composition of the second antihalation layer is in the range from about 5 to about 10 , and the gelatin percentage of the coating composition of the protective layer is in the range from about 4 to about 8 . accordingly , the resulting two antihalation layers and the protective layer would also preferably have different amounts of gelatin . the amount of gelatin in the first antihalation dry coated layer is generally from about 0 . 7 to 1 . 1 grams per square meters , preferably from about 0 . 8 to 1 . 0 grams per square meters ; the amount of gelatin in the second antihalation dry coated layer is generally from about 1 . 2 to 1 . 7 grams per square meters , preferably from about 1 . 3 to 1 . 5 grams per square meters ; the amount of gelatin in the protective dry coated layer is generally from about 0 . 8 to 1 . 2 grams per square meter , preferably from about 0 . 9 to 1 . 1 grams per square meters . in addition , each of said first antihalation layer , second antihalation layer and protective layer can contain surfactant agents . surfactants may be non - ionic , anionic , cationic , amphoteric . non - ionic surfactants are , for example , saponin ( steroid - based ), alkyene oxide derivatives ( for example , polyethylene glycol , a polyethylene glycol / polypropylene glycol condensate , polyethylene glycol alkyl ethers or polyethylene glycol alkylaryl ethers , polyethylene glycol esters , polyethylene glycol sorbitan esters , polyalkylene glycol alkylamines or polyalkylene glycol alkylamides , and silicone / polyethylene oxide adducts , and the like ), glycidol derivatives ( for example , alkenylsuccinic acid polyglyceride and alkylphenol polyglyceride , and the like ), fatty acid esters of polyhydric alcohols and alkyl esters of sugar , and the like . anionic surfactant contain , for example , an acidic group , such as a carboxy group , a sulfo group , a phospho group , a sulfuric acid esters group , and a phosphoric acid ester group , for example , alkylcarboxylic acid salts , alkylsulfonic acid salts , alkylbenzenesulfonic acid salts , alkylnaphthlenesulfonic acid salts , alkylsulfuric acid esters , alkylphosphoric acid esters , n - acyl - n - alkyltaurines , sulfosuccinic acid esters , sulfoalkylpolyoxyethylene alkylphenyl ethers , and polyoxyethylene alkylphosphoric acid esters . cationic surfactants contain , for example , alkylamine salts , aliphatic or aromatic quaternary ammonium salts , heterocyclic quaternary ammonium salts ( for example , pyridinium and imidazolium ) and aliphatic or heterocyclic phosphonium or sulfonium salts . amphoteric surfactants contain , for example , amino acids , aminoalkylsulfonic acids , aminoalkylsulfuric acid or aminoalkylphosphoric acid esters , alkylbetaines , and amine oxides . in the present invention , preferred surfactants are the anionic surfactants . particularly preferred surfactants include an alkali metal salt of an alkarylene sulfonic acid , such as the sodium salt of dodecyl benzene sulfonic acid or sodium salts of isopropylnaphthalene sulfonic acids , such as mixtures of di - isopropyl - and tri - isopropylnaphthalene sodium sulfonates ; an alkali metal salt of an alkyl sulfuric acid , such as sodium dodecyl sulfate ; or an alkali metal salt of an alkyl sulfosuccinate , such as sodium bis ( 2 - ethylhexyl ) succinic sulfonate . preferably , the protective layer contains a total amount of surfactant ( s ) that is higher than the total amount of surfactant ( s ) in the first antihalation layer and higher than the total amount of surfactant ( s ) in the second antihalation layer . the percentage of total surfactant ( s ) present in the coating composition of each of the first and the second antihalation layer is generally from about 0 . 001 to 0 . 100 , preferably from about 0 . 01 to 0 . 05 ; while the percentage of total amount of surfactant ( s ) in the coating composition of the protective layer is generally from about 0 . 01 to 0 . 5 , preferably from about 0 . 05 to 0 . 35 . accordingly , the resulting two antihalation layers and the protective layer would also preferably have different amount of surfactants . the total amount of surfactant ( s ) in each of the first and in the second antihalation layer is generally from about 0 . 0002 to 0 . 02 , preferably from about 0 . 002 to 0 . 010 grams per square meter ; while the total amount of surfactant ( s ) in the protective layer is generally from about 0 . 002 to 0 . 1 , preferably from about 0 . 01 to 0 . 07 grams per square meter . the antihalation layers and the protective layer used in the present invention preferably contains density correction dye formulations of the proper hue . said density correction dyes are generally yellow dyes , magenta dyes and cyan dyes . in one preferred embodiment of this invention , the density correction dyes are coated in at least one of the first antihalation layer , the second antihalation layer and / or the protective layer overcoating said antihalation layers . preferred density correction yellow dyes are represented by the structural formula ( i ): wherein r is hydrogen , substituted or unsubstituted alkyl group or substituted or unsubstituted aryl group , r 1 is aryl group or heterocyclic group ; x is o or n — r 2 where r 2 is hydrogen or alkyl group ; y is n — r 3 where r 3 is hydrogen or alkyl group ; n is 0 or 1 ; z is hydrogen , alkyl group or aryl group ; w is hydrogen , or w and z , taken together , represent the atoms necessary to form an aryl group . preferred alkyl groups for r include alkyl containing 1 to 8 carbon atoms , including straight chain or branched chain alkyl , such as methyl , trifluoromethyl , ethyl , propyl , isopropyl , butyl , t - butyl and octyl . preferred aryl groups for r include aryl of from 6 to 10 carbon atoms , such as phenyl and naphthyl . these alkyl and aryl groups may be substituted with any known substituents for alkyl and aryl groups , such as halogen , hydroxy , sulfo , sulfato , sulfonamido , carboxyl , amino , alkyl , alkoxy . preferred aryl groups for r 1 include an aryl group having from 6 to 10 carbon atoms , such as phenyl and naphthyl . these aryl groups may be substituted with any known substituents for aryl groups . useful substituents for the aryl group include aryloxy ( e . g ., phenoxy , p - methoxyphenoxy , p - methylphenoxy , naphthyloxy , and tolyloxy ); acylamino ( e . g ., acetamido , benzamido , butyramido , and t - butylcarbonamido ); sulfonamido ( e . g ., methylsulfonamido , benzenesulfonamido , and p - toluylsulfonamido ); sulfamoyl ( e . g ., n - methylsulfamoyl , n , n - diethylsulfamoyl , and n , n - di - methylsulfamoyl ); carbamoyl ( e . g ., n - methylcarbamoyl , and n , n - dimethylcarbamoyl ); arylsulfonyl ( e . g ., tolylsulfonyl ); aryloxycarbonyl ( e . g ., phenoxycarbonyl ); alkoxycarbonyl ( i . e ., alkoxycarbonyl containing 2 to 10 carbon atoms , for example methoxycarbonyl , ethoxycarbonyl , and benzyloxycarbonyl ); alkoxy - sulfonyl ( i . e ., alkoxysulfonyl containing 2 to 10 carbon atoms , for example methoxy - sulfonyl , octyloxysulfonyl , and 2 - ethylhexylsulfonyl ; aryloxysulfonyl ( e . g ., phenoxysul - fonyl ); alkylureido e . g ., n - methylureido , n , n - dimethylureido , and n , n - dibutylureido ); arylureido ( e . g ., phenylureido ); alkyl ; alkoxy ; nitro ; cyano ; hydroxyl ; sulfo ; carboxyl ; and sulfato . examples of heterocyclic groups for r , include furan , thiophene , pyrrole , pyrazole , pyridine , benzofuran , imidazole and benzoimidazole . the heterocyclic groups may be substituted as described with respect to thearyl groups . preferred alkyl groups for r 2 and r 3 include alkyl from 1 to 4 carbon atoms , including straight chain or branched chain alkyl , such as methyl , ethyl , propyl , isopropyl , butyl , isobutyl , t - butyl . r 2 and r 3 may be substituted , for example with substituents as those described herein for r and r 1 . preferred alkyl groups for z include alkyl groups containing 1 to 8 carbon atoms , which may be substituted , as described above with respect to r . preferred aryl groups for z include aryl of from 6 to 10 carbon atoms , such as phenyl and naphthyl , which may be substituted , as described above with respect to r . when z is hydrogen , alkyl group or aryl group , w is hydrogen . among the substituents of groups on formula ( i ), the yellow dyes for use in the present invention may include solubilizing groups . such solubilizing groups are known in the art and include , for example , sulfo , sulfato , carboxyl , and sulfonamido groups . in a preferred embodiment , the yellow dyes for use in the present invention may include a ballasting group , i . e ., an organic group of such size and configuration as to render the dye to which it is attached non - diffusible from the layer in which is coated in a photographic element . the ballasting group includes an organic hydrophobic residue having 8 to 32 carbon atoms bonded to the dye either directly or through a divalent linking group , such as an alkylene , imino , ether , thioether , carbonamido , sulfonamido , ureido , ester , imido , carbamoyl , and sulfamoyl group . specific examples of suitable ballasting groups include alkyl groups ( linear , branched , or cyclic ), alkenyl groups , alkoxy groups , alkylaryl groups , alkylaryloxy groups , acylamidoalkyl groups , alkoxyalkyl groups , alkoxyaryl groups , alkyl groups substituted with an aryl group or a heterocyclic group , aryl groups substituted with an aryloxyalkoxycarbonyl group , and residues containing both an alkenyl or alkenyl long - chain aliphatic group and a carboxy or sulfo water - soluble group , as described , for example , in u . s . pat . nos . 3 , 337 , 344 , 3 , 418 , 129 , 3 , 892 , 572 , 4 , 138 , 258 , and 4 , 451 , 559 , and in gb 1 , 494 , 777 . when the term “ group ” is used in this invention to describe a chemical compound or substituent , the described chemical material includes the basic group and that group with conventional substitution . where the term “ moiety ” is used to describe a chemical compound or substituent , only the unsubstituted chemical material is intended to be included . for example , “ alkyl group ” includes not only such alkyl moiety as methyl , ethyl , butyl , octyl , stearyl , etc ., but also moieties bearing substituent groups such as halogen , cyano , hydroxyl , nitro , amino , carboxylate , etc . on the other hand , “ alkyl moiety ” includes only methyl , ethyl , stearyl , cyclohexyl , etc . specific examples of densitiy correction yellow dyes for use in the present invention are illustrated below with their wavelength of maximum spectral absorption ( λmax ) measured in methanol , but the present invention should not be construed as being limited thereto . the density correction yellow dyes of formula ( i ) can be prepared according to procedures well known in the art of organic chemical dyes . the synthesis of dyes according to formula ( i ) is described , for example , in european patent application no . 921 , 435 . the density correction yellow dyes of formula ( i ) used in the present invention have their main absorption in the wavelength region of about 400 to 490 , preferably 430 to 460 nm . as stated above , in one preferred embodiment of this invention the density correction dyes are coated in at least one of the first antihalation layer , the second antihalation layer and / or the protective layer overcoating said antihalation layers . preferably , the density correction yellow dyes are coated in the first antihalation layer and / or in the second antihalation layer . the amount of density correction yellow dyes contained in said first antihalation layer and second antihalation layer is generally in the range from 0 . 1 to 1 . 5 , preferably from 0 . 2 to 1 . 0 grams per square meters , while the amount of density correction yellow dyes contained in said protective layer is preferable to be a little lower than in the first and in the second antihalation layer , being generally in the range from 0 to 1 . 0 , preferably from 0 to 0 . 5 grams per square meters . preferred density correction magenta dyes are azo - magenta dyes represented by the structural formula ( ii ): wherein a is a water soluble group , m is an integer of 0 or 1 , g represents an acyl group or an alkylsulfonyl group , preferably having 1 to 4 carbon atoms , or an arylsulfonyl group , preferably having 6 to 8 carbon atoms , and r represents a ballast group . examples of water soluble groups include , for example , — so3m and — coom where m is a hydrogen atom or a cation . particularly useful cations include alkali metal cations such as , for example , sodium and potassium , and n - containing cations such as , for example , ammonium , methylammonium , ethylammonium , diethylammonium , triethylammonium , ethanolammonium , diethanolammonium , and the like , as well as species that can be derived by neutralizing carboxylic and sulfonic acid groups with cyclic amines such as , for example , pyridine , piperidine , aniline , toluidine , p - nitroaniline , and the like . specific examples of density correction magenta azo dyes for use in the present invention are illustrated below , but the present invention should not be construed as being limited thereto . the density correction magenta dyes of formula ( ii ) can be prepared according to procedures well known in the art of organic chemical dyes . the synthesis of dyes according to formula ( ii ) is described , for example , in european patent application no . 725 , 313 . the density correction magenta dyes of formula ( ii ) used in the present invention have their main absorption in the wavelength region of about 500 to 600 nm with a sharp absorption curve . in one preferred embodiment of this invention , the density correction magenta dyes are coated in the second antihalation layer and / or in the protective layer . the amount of density correction magenta dyes contained in said first antihalation layer is very low , generally in the range from 0 to 2 . 0 , preferably from 0 to 1 . 0 grams per square meters , while the amount of density correction magenta dyes contained in said second antihalation layer and in said protective layer is preferable to be a little higher than in the first antihalation layer , being generally in the range from 0 . 1 to 3 . 0 , preferably from 0 . 5 to 2 . 0 grams per square meters . preferred density correction cyan dyes are azomethine dyes represented by the structural formula ( iii ): wherein r 5 is hydrogen , halogen , an alkyl group having 1 to 4 carbon atoms , an aryl group having 6 to 10 carbon atoms or an alkoxy group having 1 to 3 carbon atoms ; r 6 is hydrogen , an alkyl group having 1 to 4 carbon atoms , an alkoxy group having 1 to 3 carbon atoms , halogen , cyano group , s0 2 r 7 , c00r 7 , so 2 or 7 , cor 7 , so 2 nr 7 r 8 conr 7 r 8 ; r 7 is an alkyl group having 1 to 4 carbon atoms or an aryl group having 6 to 10 carbon atoms ; r 8 is hydrogen or r 7 , r 7 and r 8 together may form a five - membered or six - membered , optionally substituted ring ; r 9 is a conventional ballast group ; r 10 and r 11 , being the same or different , are hydrogen , an alkyl group having 1 to 4 carbon atoms , an aryl group having 6 to 10 carbon atoms or an alkoxy group having 1 to 3 carbon atoms ; p is 0 or 1 . preferred ballast groups , alkyl groups aryl groups are for example those described above for the general formulas ( i ) and / or ( ii ). specific examples of density correction cyan azomethine dyes for use in the present invention are illustrated below , but the present invention should not be construed as being limited thereto . the density correction cyan dyes of formula ( iii ) can be prepared according to procedures well known in the art of organic chemical dyes . the synthesis of dyes according to formula ( iii ) is described , for example , in u . s . pat . no . 5 , 108 , 883 . the density correction dyes corresponding to the general formulae ( iii ) are distinguished by a suitable longwave absorption in the red spectral region between 650 and 730 nm as well as by narrow half band widths and low side densities in the green spectral region . in one preferred embodiment of this invention , the density correction cyan dyes are in the protective layer overcoating the first and second antihalation layers . the amount of density correction cyan dyes contained in said first antihalation layer is very low , generally in the range from 0 to 2 . 0 , preferably from 0 to 1 . 0 grams per square meters , while the amount of density correction cyan dyes contained in said second antihalation layer and in said protective layer is preferable to be a little higher than in the first antihalation layer , being generally in the range from 0 . 1 to 3 . 0 , preferably from 0 . 5 to 2 . 0 grams per square meters . the support useful for the present invention can be , for example , cellulose esters supports ( e . g ., cellulose triacetate supports ), paper supports , polyesters film supports ( e . g ., polyethylene terephthalate film supports or polyethylene naphthalate film supports ), and the like , as described in research disclosure 308119 , section xvii , 1989 . in one preferred embodiment of this invention , the support is a cellulose triacetate support . the support base of the present invention can be used in the manufacture of light - sensitive photographic elements . useful examples of light - sensitive photographic elements are represented by radiographic films , such as mammographic films , graphic art films , such as imagesetting films , and color films , such as color negative photographic films , color reversal photographic films , color positive photographic films , false color address photographic films ( such as those disclosed in u . s . pat . no . 4 , 619 , 892 ) and the like . according to a preferred embodiment , the support base of the present invention is used in the manufacture of silver halide multilayer color photographic elements . the silver halide multilayer color photographic elements comprise , coated on a support , a red - sensitive silver halide emulsion layer associated with cyan dye - forming color couplers , a green - sensitive silver halide emulsion layer associated with magenta dye - forming color couplers and a blue - sensitive silver halide emulsion layer associated with yellow dye - forming color couplers . each red -, green - and blue - sensitive layer is usually comprised of multiple ( two or more ) emulsion sub - layers sensitive to a given region of visible spectrum . when multilayer materials contain multiple blue , green or red sub - layers , these can be in any case relatively faster and relatively slower sub - layers . these elements additionally comprise other non - light sensitive layers , such as intermediate layers , filter layers and protective layers , thus forming a multilayer structure . these color photographic elements , after imagewise exposure to actinic radiation , are processed in a chromogenic developer to yield a visible color image . the layer units can be coated in a layer arrangement comprising the red - sensitive layers coated nearest the support and overcoated by the green - sensitive layers , a yellow filter layer and the blue - sensitive layers . suitable color couplers are preferably selected from the couplers having diffusion preventing groups , such as groups having a hydrophobic organic residue of about 8 to 32 carbon atoms , introduced into the coupler molecule in a non - splitting - off position . such a residue is called a “ ballast group ”. the ballast group is bonded to the coupler nucleus directly or through an imino , ether , carbonamido , sulfonamido , ureido , ester , imido , carbamoyl , sulfamoyl bond , etc . examples of suitable ballasting groups are described in u . s . pat . no . 3 , 892 , 572 . said non - diffusible couplers are introduced into the light - sensitive silver halide emulsion layers or into non - light - sensitive layers adjacent thereto . on exposure and color development , said couplers give a color which is complementary to the light color to which the silver halide emulsion layers are sensitive . consequently , at least one non - diffusible cyan - image forming color coupler , generally a phenol or an α - naphthol compound , is associated with red - sensitive silver halide emulsion layers , at least one non - diffusible magenta image - forming color coupler , generally a 5 - pyrazolone or a pyrazolo - triazole compound , is associated with green - sensitive silver halide emulsion layers and at least one non - diffusible yellow image forming color coupler , generally an acylacetanilide compound , is associated with blue - sensitive silver halide emulsion layers . said color couplers may be 4 - equivalent and / or 2 - equivalent couplers , the latter requiring a smaller amount of silver halide for color production . as it is well known , 2 - equivalent couplers derive from 4 - equivalent couplers since , in the coupling position , they contain a substituent which is released during coupling reaction . 2 - equivalent couplers which may be used in silver halide color photographic elements include both those substantially colorless and those which are colored (“ masking couplers ”). the 2 - equivalent couplers also include white couplers which do not form any dye on reaction with the color developer oxidation products . the 2 - equivalent color couplers include also dir couplers which are capable of releasing a diffusing development inhibiting compound on reaction with the color developer oxidation products . the most useful cyan - forming couplers are conventional phenol compounds and α - naphthol compounds . examples of cyan couplers can be selected from those described in u . s . pat . nos . 2 , 369 , 929 ; 2 , 474 , 293 ; 3 , 591 , 383 ; 2 , 895 , 826 ; 3 , 458 , 315 ; 3 , 311 , 476 ; 3 , 419 , 390 ; 3 , 476 , 563 and 3 , 253 , 924 ; in gb 1 , 201 , 110 , and in research disclosure 308119 , section vii , 1989 . the most useful magenta - forming couplers are conventional pyrazolone type compounds , indazolone type compounds , cyanoacetyl compounds , pyrazoletriazole type compounds , etc , and particularly preferred couplers are pyrazolone type compounds . magenta - forming couplers are described for example in u . s . pat . nos . 2 , 600 , 788 , 2 , 983 , 608 , 3 , 062 , 653 , 3 , 127 , 269 , 3 , 311 , 476 , 3 , 419 , 391 , 3 , 519 , 429 , 3 , 558 , 319 , 3 , 582 , 322 , 3 , 615 , 506 , 3 , 834 , 908 and 3 , 891 , 445 , in de patent 1 , 810 , 464 , in de patent applications 2 , 408 , 665 , 2 , 417 , 945 , 2 , 418 , 959 and 2 , 424 , 467 and in jp patent applications 20 , 826 / 76 , 58 , 922 / 77 , 129 , 538 / 74 , 74 , 027 / 74 , 159 , 336 / 75 , 42 , 121 / 77 , 74 , 028 / 74 , 60 , 233 / 75 , 26 , 541 / 76 and 55 , 122 / 78 . the most useful yellow - forming couplers which can be used in combination with the yellow dye - forming couplers described hereinbefore are conventional open - chain ketomethylene type couplers . particular examples of such couplers are benzoyl acetanilide type and pivaloyl acetanilide type compounds . yellow - forming couplers that can be used are specifically described in u . s . pat . nos . 2 , 875 , 057 , 3 , 235 , 924 , 3 , 265 , 506 , 3 , 278 , 658 , 3 , 369 , 859 , 3 , 408 , 194 , 3 , 415 , 652 3 , 528 , 322 , 3 , 551 , 151 , 3 , 682 , 322 , 3 , 725 , 072 and 3 , 891 , 445 , in de 2 , 219 , 917 , 2 , 261 , 361 and 2 , 414 , 006 , in gb 1 , 425 , 020 , in jp 10 , 783 / 76 , 26 , 133 / 72 , 73 , 147 / 73 , 102 , 636 / 76 , 6 , 341 / 75 , 123 , 342 / 75 , 130 , 442 / 75 , 1 , 827 / 76 , 87 , 650 / 75 , 82 , 424 / 77 and 115 , 219 / 77 , and in research disclosure 308119 , section vii , 1989 . colored couplers can be used which include those described for example in u . s . pat . nos . 3 , 476 , 560 , 2 , 521 , 908 and 3 , 034 , 892 , in jp 2 , 016 / 69 , 22 , 335 / 63 , 11 , 304 / 67 , 32 , 461 / 69 , 26 , 034 / 76 and 42 , 121 / 77 and in de 2 , 418 , 959 . the light - sensitive silver halide color photographic element may contain high molecular weight color couplers as described for example in u . s . pat . no . 4 , 080 , 211 , in ep 27 , 284 and in de 1 , 297 , 417 , 2 , 407 , 569 , 3 , 148 , 125 , 3 , 217 , 200 , 3 , 320 , 079 , 3 , 324 , 932 , 3 , 331 , 743 , and 3 , 340 , 376 , and in research disclosure 308119 , section vii , 1989 . colored cyan couplers can be selected from those described in u . s . pat . nos . 3 , 934 , 802 ; 3 , 386 , 301 and 2 , 434 , 272 , colored magenta couplers can be selected from the colored magenta couplers described in u . s . pat . nos . 2 , 434 , 272 ; 3 , 476 , 564 and 3 , 476 , 560 and in gb 1 , 464 , 361 . colorless couplers can be selected from those described in gb 861 , 138 ; 914 , 145 and 1 , 109 , 963 and in u . s . pat . no . 3 , 580 , 722 and in research disclosure 308119 , section vii , 1989 . also , couplers providing diffusible colored dyes can be used together with the above mentioned couplers for improving graininess and specific examples of these couplers are magenta couplers described in u . s . pat . no . 4 , 366 , 237 and gb 2 , 125 , 570 and yellow , magenta and cyan couplers described in ep 96 , 873 , in de 3 , 324 , 533 and in research disclosure 308119 , section vii , 1989 . also , among the 2 - equivalent couplers are those couplers which carry in the coupling position a group which is released in the color development reaction to give a certain photographic activity , e . g . as development inhibitor or accelerator , either directly or after removal of one or further groups from the group originally released . examples of such 2 - equivalent couplers include the known dir couplers as well as dar and far couplers . typical examples of said couplers are described in de 2 , 703 , 145 , 2 , 855 , 697 , 3 , 105 , 026 , 3 , 319 , 428 , 1 , 800 , 420 , 2 , 015 , 867 , 2 , 414 , 006 , 2 , 842 , 063 , 3 , 427 , 235 , 3 , 209 , 110 , and 1 , 547 , 640 , in gb 953 , 454 and 1 , 591 , 641 , in ep 89 , 843 , 117 , 511 , 118 , 087 , and 301 , 477 and in research disclosure 308119 , section vii , 1989 . examples of non - color forming dir coupling compounds which can be used in silver halide color elements include those described in u . s . pat . nos . 3 , 938 , 996 ; 3 , 632 , 345 ; 3 , 639 , 417 ; 3 , 297 , 445 and 3 , 928 , 041 ; in german 2 , 405 , 442 ; 2 , 523 , 705 ; 2 , 460 , 202 ; 2 , 529 , 350 and 2 , 448 , 063 ; in japanese 143 , 538 / 75 and 147 , 716 / 75 , in gb 1 , 423 , 588 and 1 , 542 , 705 and 301 , 477 and in research disclosure 308119 , section vii , 1989 . in order to introduce the couplers into the silver halide emulsion layer , some conventional methods known to the skilled in the art can be employed . according to u . s . pat . nos . 2 , 322 , 027 , 2 , 801 , 170 , 2 , 801 , 171 and 2 , 991 , 177 , the couplers can be incorporated into the silver halide emulsion layer by the dispersion technique , which consists of dissolving the coupler in a water - immiscible high - boiling organic solvent and then dispersing such a solution in a hydrophilic colloidal binder under the form of very small droplets . the preferred colloidal binder is gelatin , even if some other kinds of binders can be used , another type of introduction of the couplers into the silver halide emulsion layer consists of the so - called “ loaded - latex technique ”. a detailed description of such technique can be found in be 853 , 512 and 869 , 816 , in u . s . pat . nos . 4 , 214 , 047 and 4 , 199 , 363 and in ep 14 , 921 . it consists of mixing a solution of the couplers in a water - miscible organic solvent with a polymeric latex consisting of water as a continuous phase and of polymeric particles having a mean diameter ranging from 0 . 02 to 0 . 2 micrometers as a dispersed phase . another useful method is further the fisher process . according to such a process , couplers having a water - soluble group , such as a carboxyl group , a hydroxy group , a sulfonic group or a sulfonamido group , can be added to the photographic layer for example by dissolving them in an alkaline water solution . useful methods of introduction of couplers into silver halide emulsions are described in research disclosure 308119 , section vii , 1989 . the silver halide emulsions used in the multilayer color photographic elements may be a fine dispersion ( emulsion ) of silver chloride , silver bromide , silver chloro - bromide , silver iodo - bromide and silver chloro - iodo - bromide grains in a hydrophilic binder . preferred silver halides are silver iodo - bromide or silver iodo - bromo - chloride containing 1 to 20 % mole silver iodide . in silver iodo - bromide emulsions or silver iodo - bromo - chloride , the iodide can be uniformly distributed among the emulsion grains , or iodide level can varied among the grains . the silver halides can have a uniform grain size or a broad grain size distribution . the silver halide grains may be regular grains having a regular crystal structure such as cubic , octahedral , and tetradecahedral , or the spherical or irregular crystal structure , or those having crystal defects such as twin plane , or those having a tabular form , or the combination thereof . the term “ cubic grains ” is intended to include substantially cubic grains , that is grains which are regular cubic grains bounded by crystallographic faces ( 100 ), or which may have rounded edges and / or vertices or small faces ( 111 ), or may even be nearly spherical when prepared in the presence of soluble iodides or strong ripening agents , such as ammonia . particularly good results are obtained with silver halide grains having average grain sizes in the range from 0 . 2 to 3 μm , more preferably from 0 . 4 to 1 . 5 μm . preparation of silver halide emulsions comprising cubic silver iodobromide grains is described , for example , in research disclosure , vol . 184 , item 18431 , vol . 176 , item 17644 and vol . 308 , item 308119 . other silver halide emulsions are those which employ one or more light - sensitive tabular grain emulsions . the tabular silver halide grains contained in the emulsion have an average diameter : thickness ratio ( often referred to in the art as aspect ratio ) of at least 2 : 1 , preferably 2 : 1 to 20 : 1 , more preferably 3 : 1 to 14 : 1 , and most preferably 3 : 1 to 8 : 1 . average diameters of the tabular silver halide grains range from about 0 . 3 μm to about 5 μm , preferably 0 . 5 μm to 3 μm , more preferably 0 . 8 μm to 1 . 5 μm . the tabular silver halide grains have a thickness of less than 0 . 4 μm , preferably less than 0 . 3 μm and more preferably less than 0 . 2 μm . the tabular grain characteristics described above can be readily ascertained by procedures well known to those skilled in the art . the term “ diameter ” is defined as the diameter of a circle having an area equal to the projected area of the grain . the term “ thickness ” means the distance between two substantially parallel main planes constituting the tabular silver halide grains . from the measure of diameter and thickness of each grain the diameter : thickness ratio of each grain can be calculated , and the diameter : thickness ratios of all tabular grains can be averaged to obtain their average diameter : thickness ratio . by this definition , the average diameter : thickness ratio is the average of individual tabular grain diameter : thickness ratios . in practice , it is simpler to obtain an average diameter and an average thickness of the tabular grains and to calculate the average diameter : thickness ratio as the ratio of these two averages . whatever the used method may be , the average diameter : thickness ratios obtained do not greatly differ . in the silver halide emulsion layer containing tabular silver halide grains , at least 15 %, preferably at least 25 %, and , more preferably , at least 50 % of the silver halide grains are tabular grains having an average diameter : thickness ratio of not less than 2 : 1 . each of the above proportions , “ 15 %”, “ 25 %” and “ 50 %” means the proportion of the total projected area of the tabular grains having a diameter : thickness ratio of at least 2 : 1 and a thickness lower than 0 . 4 μm , as compared to the projected area of all of the silver halide grains in the layer . it is known that photosensitive silver halide emulsions can be formed by precipitating silver halide grains in an aqueous dispersing medium comprising a binder , gelatin preferably being used as a binder . the silver halide grains may be precipitated by a variety of conventional techniques . the silver halide emulsion can be prepared using a single - jet method , a double - jet method , or a combination of these methods or can be matured using , for instance , an ammonia method , a neutralization method , an acid method , or can be performed an accelerated or constant flow rate precipitation , interrupted precipitation , ultrafiltration during precipitation , etc . references can be found in trivelli and smith , the photographic journal , vol . lxxix , may 1939 , pp . 330 - 338 , t . h . james , the theory of the photographic process , 4th edition , chapter 3 , u . s . pat . nos . 2 , 222 , 264 , 3 , 650 , 757 , 3 , 917 , 485 , 3 , 790 , 387 , 3 , 716 , 276 , and 3 , 979 , 213 , research disclosure , december 1989 , item 308119 “ photographic silver halide emulsions , preparations , addenda , processing and systems ”, and research disclosure , september 1976 , item 14987 . one common technique is a batch process commonly referred to as the double - jet precipitation process by which a silver salt solution in water and a halide salt solution in water are concurrently added into a reaction vessel containing the dispersing medium . in the double jet method , in which alkaline halide solution and silver nitrate solution are concurrently added in the gelatin solution , the shape and size of the formed silver halide grains can be controlled by the kind and concentration of the solvent existing in the gelatin solution and by the addition speed . double - jet precipitation processes are described , for example , in gb 1 , 027 , 146 , and 1 , 302 , 405 , u . s . pat . nos . 3 , 801 , 326 , 4 , 046 , 376 , 3 , 790 , 386 , 3 , 897 , 935 , 4 , 147 , 551 , and 4 , 171 , 224 . the single jet method in which a silver nitrate solution is added in a halide and gelatin solution has been long used for manufacturing photographic emulsion . in this method , because the varying concentration of halides in the solution determines which silver halide grains are formed , the formed silver halide grains are a mixture of different kinds of shapes and sizes . precipitation of silver halide grains usually occurs in two distinct stages . in a first stage , nucleation , formation of fine silver halide grain occurs . this is followed by a second stage , the growth stage , in which additional silver halide formed as a reaction product precipitates onto the initially formed silver halide grains , resulting in a growth of these silver halide grains . batch double - jet precipitation processes are typically undertaken under conditions of rapid stirring of reactants in which the volume within the reaction vessel continuously increases during silver halide precipitation and soluble salts are formed in addition to the silver halide grains . in order to avoid soluble salts in the emulsion layers of a photographic material from crystallizing out after coating and other photographic or mechanical disadvantages ( stickiness , brittleness , etc . ), the soluble salts formed during precipitation have to be removed . in preparing the silver halide emulsions , a wide variety of hydrophilic dispersing agents for the silver halides can be employed . as hydrophilic dispersing agent , any hydrophilic polymer conventionally used in photography can be advantageously employed including gelatin , a gelatin derivative such as acylated gelatin , graft gelatin , etc ., albumin , gum arabic , agar agar , a cellulose derivative , such as hydroxyethylcellulose , carboxymethylcellulose , etc ., a synthetic resin , such as polyvinyl alcohol , polyvinylpyrrolidone , polyacrylamide , etc . other hydrophilic materials useful known in the art are described , for example , in research disclosure , vol . 308 , item 308119 , section ix . the silver halide grain emulsion can be chemically sensitized using sensitizing agents known in the art . sulfur containing compounds , gold and noble metal compounds , and polyoxyalkylene compounds are particularly suitable . in particular , the silver halide emulsions may be chemically sensitized with a sulfur sensitizer , such as sodium thiosulfate , allylthiocyanate , allylthiourea , thiosulfinic acid and its sodium salt , sulfonic acid and its sodium salt , allylthiocarbamide , thiourea , cystine , etc . ; an active or inert selenium sensitizer ; a reducing sensitizer such as stannous salt , a polyamine , etc . ; a noble metal sensitizer , such as gold sensitizer , more specifically potassium aurithiocyanate , potassium chloroaurate , etc . ; or a sensitizer of a water soluble salt such as for instance of ruthenium , rhodium , iridium and the like , more specifically , ammonium chloropalladate , potassium chloroplatinate and sodium chloropalladite , etc . ; each being employed either alone or in a suitable combination . other useful examples of chemical sensitizers are described , for example , in research disclosure 17643 , section iii , 1978 and in research disclosure 308119 , section iii , 1989 . the silver halide emulsion can be spectrally sensitized with dyes from a variety of classes , including the polymethyne dye class , which includes the cyanines , merocyanines , complex cyanines and merocyanines , oxonols , hemioxonols , styryls , merostyryls , and streptocyanine . the cyanine spectral sensitizing dyes include , joined by a methine linkage , two basic heterocyclic nuclei , such as those derived from quinoline , pyrimidine , isoquinoline , indole , benzindole , oxazole , thiazole , selenazole , imidazole , benzoxazole , benzothiazole , benzoselenazole , benzoimidazole , naphthoxazole , naphthothiazole , naphthoselenazole , tellurazole , oxatellurazole . the merocyanine spectral sensitizing dyes include , joined by a methine linkage , a basic heterocyclic nucleus of the cyanine - dye type and an acidic nucleus , which can be derived from barbituric acid , 2 - thiobarbituric acid , rhodanine , hydantoin , 2 - thiohydantoin , 2 - pyrazolin - 5 - one , 2 - isoxazolin - 5 - one , indan - 1 , 3 - dione , cyclohexane - 1 , 3 - dione , 1 , 3 - dioxane - 4 , 6 - dione , pyrazolin - 3 , 5 - dione , pentane - 2 , 4 - dione , alkylsulfonylacetonitrile , malononitrile , isoquinolin - 4 - one , chromane - 2 , 4 - dione , and the like . one or more spectral sensitizing dyes may be used . dyes with sensitizing maxima at wavelengths throughout the visible and infrared spectrum and with a great variety of spectral sensitivity curve shapes are known . the choice and relative proportion of dyes depends on the region of the spectrum to which sensitivity is desired and on the shape of the spectral sensitivity desired . examples of sensitizing dyes can be found in venkataraman , the chemistry of synthetic dyes , academic press , new york , 1971 , chapter v , james , the theory of the photographic process , 4th ed ., macmillan , ! 977 , chapter 8 , f . m . hamer , cyanine dyes and related compounds , john wiley and sons , 1964 , and in research disclosure 308119 , section iii , 1989 . the silver halide emulsions can contain optical brighteners , antifogging agents and stabilizers , filtering dyes , hardeners , coating aids , plasticizers and lubricants and other auxiliary substances , as for instance described in research disclosure 17643 , sections v , vi , viii , x , xi and xii , 1978 , and in research disclosure 308119 , sections v , vi , viii , x , xi , and xii , 1989 . the present invention will be illustrated with reference to the following examples , but it should be understood that these examples do not limit the present invention . samples 1 ( reference ) and 2 - 4 ( invention ) have been prepared by coating on a transparent cellulose acetate film support having a thickness of 0 . 12 mm the following layers . the coating amounts are reported in grams per square meter ( g / m 2 ), while the viscosity is expressed in centipoise . hostapur ™ sas 93 is a c12 - c14 alkyl sulfonate anionic surfactant , produced by hoechst co . aerosol ™ ot 75 is a sodium diethylexyl sulfosuccinate anionic surfactant , produced by cyanamid europa co . the samples 1 - 4 have been coated with a slide coater , having a vacuum of 5 mm of water , the gap between the slide coater and the coating roll being 0 . 40 mm and the coating speed 150 meters per minute . the coating quality of samples 1 - 4 has been evaluated by giving scholastic values from 1 to 10 ( from the worst to the best ), according to the consistency of mottle present . the results are shown in table 1 . table 1 shows that reference sample 1 , containing only a first antihalation layer and a protective layer without the second antihalation layer , shows a bad coating quality . on the other hand , samples 2 - 4 of the present invention , containing also the second antihalation layer , present good results . sample 3 , containing a reduced amount of surfactant in the protective layer , showed better results compared with sample 2 . sample 4 , similar to sample 3 but that the magenta dye was contained in the second antihalation layer and in the protective layer , rather than in the first antihalation layer , in the same total amount , and the cyan dye was contained in the protective layer , rather than in the first antihalation layer , in the same amount , showed the best results .	6
the present invention will be described in detail hereinafter with reference to the accompanying drawings , wherein the same reference characters designate corresponding parts throughout several views . it is to be understood that these drawings depict only typical embodiments of the invention and are , therefore , not to be considered limiting in its scope . fig4 is an exploded view of the rock splitter according to the present invention ; fig5 is a sectional view of the rock splitter before operation ; fig6 is a sectional view of the rock splitter after operation . fig7 a is a view of the folding and unfolding means of the present invention in a folded state , and fig7 b is a view of the folding and unfolding means in an extended state . as shown in the drawings , a rock splitter 2 of oil hydraulic piston type includes a housing 10 which has an arch - shaped lower surface and a plurality of concave cylinder chambers which has threaded portions 12 and 13 on its upper side . the housing 10 further includes first and second paths 14 and 15 formed on a side surface thereof and communicated with the cylinder chambers 11 for supplying and discharging oil , and a pair of guide pins 16 protruding from opposite portion thereof . a folding and unfolding means 30 , which is comprised of a fixing member 33 , a connecting member 32 and a locking member 31 , is inserted into each cylinder chamber 11 . the threaded portion 13 of the cylinder chamber 11 engages a threaded portion 31 , and thereby the folding and unfolding means 30 is detachably mounted to the cylinder chamber 11 . when the folding and unfolding means 30 is connected to the cylinder chamber 11 , the folding and unfolding means 30 is inserted into the cylinder chamber 11 through the center of an elastic member 20 of a spring . the elastic member 20 is substantially formed in a conical shape wherein the upper end portion with a small diameter is in contact with the lower end of the fixing member 33 of the folding and unfolding means 30 and a lower end portion with a large diameter is placed in the cylinder chamber 11 in a compressed state . as shown in fig7 a , the folding and unfolding member 30 has gaps 30 a formed between the members 31 , 32 and 33 for passing oil therethrough . when the folding and unfolding means 30 is expanded , the gaps 30 a are sealed as follows . the locking member 31 has a stepped portion 31 bent inward at the upper portion . the connecting member 32 has a stepped portion 32 a bent inward at the upper portion and a stepped portion . also , the fixing member 33 has a stepped portion 31 a bent outward at the lower portion . when the folding and unfolding means 30 is expanded , the stepped portions 31 a , 32 a , 32 b , 33 a of the members 31 , 32 , and 33 are in contact with each other to thereby seal the gaps 30 a between the members 31 , 32 , and 33 . in the meantime , a hollow cylinder 50 is detachably mounted on the folding and unfolding means 30 inside the cylinder chamber 11 by engaging a threaded portion 51 formed on the outer circumference of the hollow cylinder 50 to the threaded portion 12 of the cylinder chamber 11 . the cylinder 50 has a plurality of rings on the inner and outer circumferences for sealing , an upper grove 54 and a lower grove 55 . in the upper groove 54 are a back - up 56 for preventing the outflow of oil and an o - shaped ring 57 for sticking the back - up ring 56 to the upper end of the upper groove 54 . in the lower groove 55 , an o - shaped ring 62 is located between two back - up rings 63 . the back - up rings 63 are stuck to the upper and lower end of the lower groove 55 by the elasticity of the o - shaped ring 62 , thereby preventing any oil leakage . the rings inserted into the inner circumference the cylinder 50 are comprised of a ( 1 ) scraper 61 for preventing the entrance of alien substances from the outside into cylinder 50 , ( 2 ) a step seal 59 arranged at the inner lower portion apart from the a scraper 61 through the center of an o - shaped ring 60 for preventing the outflow of oil from cylinder 50 , and ( 3 ) a wear ring 58 attached to a piston 40 by the resilient force of the o - shaped ring 60 and arranged at the inner lower portion apart from the step seal 59 for preventing lateral movement of the piston 40 which extends and retracts within the cylinder 50 . the wear ring 58 , which is made of a solid material resistive to contraction , is provided not to the seal but to guide the lifting of the piston 40 , and to prevent lateral movement of the piston 40 . the piston 40 has a concave portion 52 formed on the outer circumference and communicated with the second path 15 of the housing 10 . the concave portion 52 has a plurality of oil paths 53 for allowing the oil provided to the second path 15 to flow into the cylinder 50 . as shown in fig4 the piston 40 is arranged inside the cylinder 50 . the piston 40 has a stepped portion 41 formed at the lower portion of the outer circumference thereof and a plurality of grooves 43 and 44 formed at the outer circumference of the stepped portion 41 . a gliding ring 46 is inserted into the upper grove 43 through the center of an o - shaped ring 45 to prevent the oil leakage between the cylinder 50 and the piston 40 . the gliding ring 46 is closely attached to the inner surface of the cylinder 50 by the resilient force of the o - shaped ring 45 . a wear ring 47 is inserted into the lower groove 44 to guide stable vertical movement of the piston 40 without any lateral movement . the oil supplied to the second path 15 of the housing 10 flows into the cylinder through the oil paths 53 of the concave portion 52 of the cylinder 50 , which causes the piston 40 to retract . therefore , a prescribed space is formed between the cylinder and the piston 40 to allow the oil to flow into the cylinder 50 easily . in order to easily apply the oil pressure , which flows into the cylinder 50 , to the stepped portion 41 of the piston 40 , a concave portion 42 is formed along the outer upper circumference of the stepped portion 41 . the rock splitter 2 with the above structure includes an arc - shaped cap 70 which is arranged in the upper portion of the piston 40 . since the cap 70 is formed in the arc shape , the entire front surface of the rock splitter 2 can touch the rock , thereby maximizing the power applied to the rock . the cap 70 has a pair of guide holes 71 formed vertically on the opposite sides of the cap 70 for inserting the guide pins 16 of the housing 10 . when the piston 40 with the arc - shaped upper surface is in contact with the inner surface of the cap 70 , the cap 70 rises , and when the piston 40 retracts , the cap 70 falls by the force of gravity . the rock splitter 2 is assembled as follows . after the large diameter portion of the elastic member 20 is seated in the cylinder chamber 11 of the housing 10 , the fixing member 33 of the folding and unfolding means 30 is arranged on the upper end of the elastic member 20 in the cylinder chamber 11 and the threaded portion 31 of the locking member 31 engages the threaded spiral portion 13 of the cylinder 11 . the scraper 61 , the o - shaped ring 60 , the step seal 59 and the wear ring 58 are arranged on the inner surface of the cylinder 50 . the back - up ring 56 and the o - shaped ring 57 are inserted into the outer upper groove 54 of the cylinder 50 and the back - up ring 63 , the o - shaped ring 62 and the back - up ring 63 are inserted into the lower groove 55 of the cylinder 50 respectively . the cylinder 50 is inserted into the cylinder chamber 11 , after the piston 40 is inserted into the cylinder 50 , which piston 40 has the o - shaped ring 45 , the gliding ring 46 and the wear ring 47 inserted into the grooves 43 and 44 of the stepped piston 41 . at this time , the threaded portion 51 formed on the outer surface of the cylinder 50 engages the threaded portion 12 formed on the inner surface of the cylinder chamber 11 . the upper portion of the piston 40 protrudes through the upper end portion of the cylinder 50 . the cap 70 is situated on the upper portion of the piston 40 and the guide pins 16 of the housing 10 is inserted into the guide holes 71 of the cap 70 . through the above procedure , the rock splitter 2 is completely assembled as shown in fig5 . when the oil is supplied through the first path 14 into the rock splitter 2 , as shown in fig7 a , the oil flows into the cylinder 50 through the gaps 30 a , formed between the members 31 , 32 and 33 of the folding and unfolding means 30 , which are placed inside the cylinder chamber 11 of the housing 10 . when the oil is continuously provided into the cylinder 50 through the gaps 30 a of the folding and unfolding means 30 , the piston 40 is raised in a state such that the piston 40 is sealed by the rings placed between the cylinder 50 and the piston 40 and prevented from moving laterally by virtue of the wear rings 47 and 58 . when the piston 40 rises , the folding and unfolding means 30 is expanded by the elasticity of the member 20 , and at this time , the upper surface of the fixing member 33 keeps the contact state with the bottom surface of the piston 40 . when the piston 40 rises , the oil , which flows into the space between the cylinder 50 and the stepped portion 41 of the piston 40 , is discharged though the oil paths 53 of the cylinder 50 to the second path 15 of the housing 10 . the cap 70 , which is located on the upper portion of the piston 40 , rises with the rising piston 40 through the guidance of the guide pins 16 inserted into the guide holes 71 of the cap 70 . after rising to a prescribed extent , the stepped portion of the rising piston 40 engages the inside of the cylinder 50 and thereby the piston no longer rises , the cap 70 also does not rise any more . at this time , the entire front surface of the arch - shaped cap 70 can easily split the rock by the contact area and the power applied to the rock , which are larger than that of the conventional rock splitter , thereby splitting the rock more easily . at this time , the folding and unfolding means 30 is completely expanded by the piston 40 , as shown in fig6 and 7 b . the completely expanded folding and unfolding means 30 is in the following state . the threaded portion 31 of the locking member 31 is engaged to the threaded portion 13 of the cylinder chamber 11 , the lower stepped portion 32 b of the connecting member 32 is in contact with the upper stepped portion 32 a of the connecting member 32 , such that the gaps 30 a between the members 31 , 32 and 33 are sealed . therefore , the oil supply through the first path 14 into the cylinder 11 blocked , thereby preventing any overload damage to the housing 10 . meanwhile , after splitting the rock , in order to return the rock splitter 2 to its original condition , when the oil is supplied to the second path 15 of the housing 10 , the oil supplied to the second path 15 flows into the cylinder 50 through the oil paths 53 of the cylinder 50 . when the oil continuously flows through the concave portion 42 , the piston 40 drops with the oil pressure applied to the concave portion 42 . when the piston 40 drops , the fixing member 33 , being in contact with the bottom of the piston 40 , is inserted into the connecting member 32 and the connecting member 32 is inserted into the locking member 31 , thereby the folding and unfolding means is folded and the elastic member 20 is again compressed . when folded , the stepped portion 31 a , 32 a , 32 b and 33 a , are separated from each other and thereby , the folding and unfolding means 30 has the gaps 30 a between the members 31 , 32 and 33 . through the gaps 30 a , the oil staying inside the lower portion of the piston 40 is discharged through the fist path 14 of the housing 10 . when the piston 40 falls down in the above manner , the cap 70 which is located on the upper end of the piston 40 is returned to its original position , being guided by the guide pins 16 inserted into the guide holes 71 . when the piston 40 rises within the cylinder 50 , the wear rings 58 and 47 , which are placed on the inner surface of the cylinder 50 and the outer portion of the piston 40 respectively , prevent lateral movement of the piston 40 . the rock splitter 2 according to the present invention includes another cylinder 50 inserted into the cylinder chamber 11 of the housing 10 . in the conventional rock splitter 2 , if the cylinder 50 is damaged by the piston 40 , the entire housing 10 must be replaced . however , in the rock splitter 2 according to the present invention , only the damaged cylinder 50 is replaced without necessitating replacement of the entire housing 10 , thereby reducing the maintenance fees considerably and improving the efficiency of work . additionally , in the conventional rock splitter , the power applied to the rock is limited to the area of the piston 40 , but in the present invention , the power applied to the rock is applied to the entire front surface of the cap 70 , so that the rock can be easily split , while the rising pressure of the piston 40 is maintained in the same intensity as the conventional rock splitter . furthermore , the folding and unfolding means 30 is expanded while the gaps 30 a between members 31 , 32 and 33 are sealed by the engagement of the stepped portions 31 a , 31 b , 32 b and 33 a . when returning to its original position , the members 31 , 32 and 33 are easily returned to their original positions by a small amount of oil pressure passing through the stepped portions , thereby preventing malfunction of the folding and unfolding means 30 . those skilled in the art will readily recognize that these and various other modifications and changes may be made to the present invention without strictly following the exemplary application illustrated and described herein , and without departing from the true spirit and scope of the present invention , which is set forth in the follow claims .	1
in order to obtain an essentially constant release rate according to the present invention the erosion / release rate must increase with time to compensate for the decreasing release surface area , which mathematically requires a modification where the release rate constants are functions of time . q t q ∞ = 1 - ( 1 - ( k r + r t ⁢ t ) c 0 ⁢ r 0 ⁢ t ) 2 ⁢ ( 1 - 2 ⁢ ( k h + h t ⁢ t ) c 0 ⁢ h 0 ⁢ t ) wherein r t and h t are the rate increase constants for radius and thickness . in practice control of the release rate is thus performed by the following factors : amount of active drug type of matrix former viscosity ( i . e . degree of polymerisation , molecular weight ) of the matrix former amount of matrix former type and amount of accelerating agent type and amount of plasticiser granulate size distribution tablet geometry compaction force according to the present invention the drug is a pharmacologically active substance of low aqueous solubility which in this context means that the solubility should be less than 100 mg / ml . particularly interesting drugs for which the invention is applicable are those having a solubility less than 20 mg / ml . due to the low solubility of the drug the gradient driving diffusion of the drug through the hydrated polymer matrix is too small to allow for more than a minute fraction of the release rate . examples of drugs suitable for the release formulation according to the present invention are dicofenac sodium , glipizide , nifedipine , felodipine , cisapride maleate . the hydrophilic polymer matrix glues the particles , drug and excipients , together and acts to retard and control the dissolution of the matrix . examples of hydrophilic polymers forming the matrix are hydroxyethyl cellulose , hydroxypropyl cellulose , hydroxypropyl methylcellulose , guar gum , polyethylene oxide or a mixture thereof . the higher the proportion matrix former is the slower the release rate becomes and this is also used to control the release rate . preferably the matrix former is a mixture of 1 - 10 % by weight hydroxypropyl cellulose and 10 - 50 % by weight hydroxyethyl cellulose , preferably 20 - 30 %. this optional excipient is water soluble but otherwise inert material that is added in order to increase the thermodynamic water gradient into the tablet , thereby , accelerating the erosion / dissolution rate . examples of such excipients are pharmaceutically acceptable water soluble substances eg . sugars such as lactose , sacharose , glucose , sugar alcohols such as sorbitol , mannitol , salts , such as sodium chloride . the accelerating agent should have a solubility of 300 - 1000 g / l , preferably 500 - 800 g / l and constitute 1 - 50 % by weight , preferably 20 - 30 % by weight of the formulation . depending on the nature of the polymer , a plasticiser may be added in order to facilitate the deformation of granules during compaction . the plasticiser should be a gras (= generally regarded as safe ) non volatile agent capable of lowering the glass transition temperature of the matrix former . an example of a suitable plasticiser is low molecular weight polyethylene oxide which are in liquid form at room temperature ( e . g . peo 400 ). a final optional excipient is a low viscosity polymer - binder . examples of such binders are hydroxypropyl cellulose and polyvinyl pyrrolidone . one optional excipient may be inert filler to adjust the size of the matrix , particularly if the dose of the drug is low . any conventional lubricant such as magnesium stearate in amounts varying between 1 and 5 % by weight may be used . the components are wet granulated either using the matrix former as binder or by using an additional binder . the release rate and the acceleration of the release rate is controlled by the rate of water transport into the matrix . this is apart from the composition also dependent on the porosity and structure of the matrix . these factors are controlled by granulate size distribution , granulate plasticity , compaction force and pressure distribution . the latter highly dependent on the axial geometry of the compact . to achieve appropriate function and reproducibility a free flowing granulate of narrow particle size distribution is essential . the granulate should be suffciently plastic to deform under pressure and the axial geometry should be flat to achieve an even force distribution in the granulate bed . glipizide , hec , and lactose are sieved through a 1 mm sieve and dry mixed in an intensity mixer . hpc and peg are dissolved in ethanol and stirred overnight to ensure complete swelling . the powder mixture is continuously granulated with the polymer solution in a fluidised bed . the dry granulate is finally mixed with magnesium stearate and the obtained mixture is compressed into a tablet having 6 mm diameter . release profiles using the usp i method in 0 . 1 m phosphate buffer ph 6 . 8 are given in fig4 which shows that the release rate can be controlled by the amount of hec . composition mg / tablet glipizide 10 . 0 hydroxyethyl cellulose 25 . 0 ( high viscosity quality ) or hydroxyethyl cellulose 50 . 0 ( low viscosity , natrosol 250 hx ) hydroxypropyl cellulose 7 . 8 lactose 55 . 2 peg 400 1 . 0 ethanol 55 . 0 magnesium stearate 1 . 0 manufacture and analysis are performed as in example 1 . the release profile given in fig3 shows that the low viscosity polymer requires twice the amount of the high viscosity polymer to obtain the same release rate . composition mg / tablet glipizide 10 . 0 hydroxyethyl cellulose 25 . 0 hydroxypropyl cellulose 7 . 8 lactose 55 . 2 peg 400 1 . 0 ethanol 55 . 0 magnesium stearate 1 . 0 glipizide 5 . 0 hydroxyethyl cellulose 5 . 0 hydroxypropyl cellulose 7 . 8 lactose 55 . 2 peg 400 1 . 0 ethanol 55 . 0 magnesium stearate 1 . 0 manufacture and analysis are performed as in example 1 . the release profile using the usp i method in 0 . 1 m phosphate buffer ph 6 . 8 as given in fig2 shows that the release rate is controlled by the matrix and is less affected by the amount of drug . composition mg / tablet nifedipine 30 . 0 hydroxyethyl cellulose 25 . 0 hydroxypropyl cellulose 7 . 8 lactose 35 . 2 peg 400 1 . 0 ethanol 55 . 0 magnesium stearate 1 . 0 manufacture is performed as in example 1 . the release profile is given in fig1 . composition mg / tablet cisapride maleate 40 . 0 hydroxyethyl cellulose 25 . 0 hydroxypropyl cellulose 7 . 8 lactose 25 . 2 peg 400 1 . 0 ethanol 55 . 0 magnesium stearate 1 . 0 manufacture is performed as in example 1 . the release profile is given in fig1 . the different release profiles obtained is probably explained by the different rates of dissolution of the drugs .	8
a keyboard switch assembly 10 in accordance with the invention is designed for use as part of a tone generating telephone as will be recognized from the arrangement of characters on the face thereof . however it will be appreciated by those skilled in the art that the principles of the invention also apply to other types of switch assemblies used in the other types of applications . the keyboard switch assembly 10 includes an actuator assembly 12 having a plurality of actuator keys 14 held in place by a cover plate 16 . the keys 14 reside within apertures 18 in the cover plate 16 , and are prevented from removal by a rim 20 extending outwardly at the midsection of each key 14 . a thin , planar substrate 24 has a printed circuit pattern thereon forming a different set of switch contacts 26 at each of a plurality of key receiving regions 28 on the substrate 24 . each set of contacts 26 comprises three different spaced - apart conductive strips including a column conductor 30 , a row conductor 32 and a common conductor 34 disposed on substrate 24 . a thin , planar dielectric spacer 36 is mounted on the substrate 24 on the side of the substrate containing the sets of contacts 26 . the spacer 36 has a plurality of apertures 38 therein arranged so that a different one of the apertures 38 is disposed adjacent and surrounding a different one of the sets of contacts 26 . a thin , planer layer 40 of polyester film such as mylar or other suitable flexible resilient material is disposed on an opposite side of spacer 36 from substrate 24 . within each key region 28 opposite conductors 30 , 32 , 34 a switch closure conductive contact 42 is disposed on a side of layer 40 adjacent conductors 30 , 32 , 34 in facing relationship thereto . upon the application of switch actuation pressure to layer 40 at a key region 28 , layer 40 is forced into a spacer aperture 38 to bring switch closure contact 42 into conductive mating relationship with the conductors 30 , 32 and 34 . switch closure is thus effected . a thin , planar layer 50 of polyester film such as mylar , or other suitable flexible , resilient material , typically a few mils thick , is disposed on the opposite side of the layer 40 from spacer 36 . the layer 50 is formed with a plurality of bubble or dome - shaped protrusions 52 therein forming a continuation of the layer and extending outwardly from the planar portion of the layer 50 on the opposite side of the layer 50 from the layer 40 and the substrate 24 . the protrusions 52 are arranged such that a different one is disposed over each aperture 38 in the spacer 36 so as to reside above and adjacent the set of contacts 26 at the bottom of the aperture 38 as well as the closure contact 42 on layer 40 . each closure contact 42 thus lies beneath a different one of the protrusions 52 so as to be forced into contact with the particular set of contacts 26 therebelow when the protrusion 52 is depressed downwardly and inverted by action of the associated actuator key 14 . the actuator assembly 12 with its included keys 14 and cover plate 16 is mounted on the layer 50 such that a different one of the keys 14 is disposed above each protrusion 52 in the layer 50 . a key spring 56 in the form of a coil spring is disposed on the outside of each key 14 so as to extend downwardly from the rim 20 into contact with the layer 50 around the outer periphery of the protrusion 52 . the inside of the key 14 has a cylindrical recess 58 within which there is supported a generally cylindrical guide post 60 . a follower 62 has an internal aperture 64 which receives guide post 60 in sliding , guiding relation thereto . an actuation spring 66 which is a helical coil spring of smaller diameter than the key spring 56 is disposed so as to extend between the key 14 at the top of the aperture 58 and the follower 62 . upon manual depression of the key 14 , downward travel of the key 14 is permitted against resistance of the spring 56 . at the same time the actuation spring 66 forces the follower 62 downwardly against the top of the protrusion 52 . typically , when the key 14 has traveled at least about 50 % of its total extent of travel , the protrusion 52 is inverted so as to bring the closure contact at the underside of the layer 40 into contact with the set of contacts 26 on the top surface of the substrate 24 . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention . accordingly , any modifications , variations or equivalent arrangements within the scope of the attached claims should be considered to be within the scope of the invention .	7
the preparation of disazo reactive dyestuffs containing the quaternary group compounds of the present invention of the general formula ( 1 ) can be synthesized through known skills , such reactive dyestuffs of formula ( 1 ) can be prepared as the synthesis below . in this synthesis , first amine compound of formula ( a ) showing below is proceeded with diazotization , which are then coupled with amine compound of formula ( b ) below in an acidic environment between ph = 2 – 5 and a low temperature of 0 – 10 ° c . subsequently it is further coupled with diazo salt of formula ( c ) below under a temperature of 20 – 60 ° c ., while the ph is kept between weak acid and base ( ph = 4 . 0 to 8 . 0 ) to obtain the reactive dyestuffs of formula ( 1 ) of the present invention . the sequence of the reactions of the aforementioned preparation method can also be modified . compound of formula ( c ) and compound of formula ( b ) can first proceed with the reaction then further react with compound of formula ( a ). the same reactive dyestuffs of formula ( 1 ) are then obtained . the dyestuff of the present invention can be produced by the above methods , reaction conditions are fully described in the above description . known processes such as spray drying , precipitation , or filtration can purify the dyestuff of the present invention . they can be in the form of powder , granules , particle or liquid and an auxiliary reagent , for example , retarding agent , leveling agent , assistant agent , surfactant agent , or dispersing agent may be added . the dyestuffs of the present invention all contain at least one anionic group , such as a sulfo group . for convenience they are expressed as free acid in the specification . when the dyestuffs of the present invention are manufactured , purified or used , they often exist in the form of water soluble salts , especially the alkaline metal salts , such as the sodium salt , lithium salt , potassium salt or ammonium salt , preferably sodium salt . the dyestuffs of the present invention can be mixed each other to form a composition . the composition of the present invention can be prepared in several ways . for example , the dye components can be prepared separately and then mixed together to make powder , granular and liquid forms , or a number of individual dyes may be mixed according to the dyeing recipes in a dyehouse . the dye mixtures of the present invention can be prepared , for example , by mixing the individual dyes . the mixing process is carried out , for example , in a suitable mill , such as a ball mill or a pin mill , or kneaders or mixers . the dyestuff according to the present invention can be applied to dye or print fiber materials , especially cellulose fiber or materials containing cellulose . all natural and regenerated cellulose fiber ( e . g . cotton , linen , jute , ramie fiber , viscose rayon ) or fiber materials containing cellulose are the materials to which the dyestuff of the present invention can be applied . the dyestuff according to the present invention is also suitable for dyeing or printing fibers , which contain hydroxyl groups and are contained in blended fabrics . the dyestuff according to the present invention can be applied to the fiber material and fixed on the fiber in various ways , in particular in the form of aqueous dyestuff solutions and printing pastes . they can be applied to cellulose fibers by general dyeing methods , such as exhaustion dyeing , continuous dyeing , cold - pad - batch dyeing or printing that are commonly used in the dyeing of reactive dyestuffs . the dyestuff according to the present invention is distinguishable from others by qualities such as decomposable , low salt , and low base , good fixing property and good build - up property . nevertheless , the present invention also enhances the dye solubility with a high exhaustion . the dyes of the present invention can be applied in a wide range of dyeing temperature ; therefore the dyes are also suitable for dyeing cotton and blending polyester fabrics . printing can also be used with the dyestuff of the present invention . printing is most suitable for cotton , blends of wool and silk , and t / c one - way bath dyeing . the dyestuff according to the present invention exhibits superior substantivity , levelness , migration properties , and high fibers / dyes stability in acid / base in dyeing and printing cellulose fiber materials . besides , the dyed cellulose fiber materials have good properties of light fastness , perspiration - light fastness , and wet fastness , e . g . clean fastness , water fastness , sea water fastness , cross - dyeing fastness , and perspiration fastness , as well as fastness of wrinkling , ironing , and chlorine bleaching . many examples have been used to illustrate the present invention . the examples sited below should not be taken as a limit to the scope of the invention . in these examples , the compounds are represented in the form of dissolved acid . however , in practice , they will exist as alkali salts for mixing and salts for dyeing . in the following examples , quantities are given as parts by weight (%) if there is no indication . the relationship between weight parts and volume parts are the same as that between kilogram and liter . 36 . 1 parts of 1 - aminobenzene - 2 - sulfonic acid - 4 - β - sulfatoethylsulfone are dissolved into 150 parts of ice water ; subsequently the ph is adjusted to ph = 13 with a solution of 45 % sodium hydroxide , and the solution is stirred for 15 minutes to complete the reaction . the ph of the result solution is adjusted to ph = 5 . 0 – 6 . 0 by adding a 32 % hcl aqueous solution . after 12 . 7 parts of nicotinate are added , the solution is stirred at the temperature of 60 ° c . for 2 hours to complete the reaction . the solution is salted out with nacl and filtered to obtain compound ( p - 1 ). 19 . 4 parts of compound ( p - 1 ) are dissolved into 150 parts of ice water , and 12 . 6 parts of 32 % hcl aqueous solution are further added and stirred evenly . subsequently the reacting solution undergoes diazotization by the addition of 3 . 7 parts sodium nitrite aqueous solution in a temperature of 0 to 5 ° c . to this mixture , 9 . 5 parts of powdered 2 , 4 - diaminobenzenesulphonic acid are then added , and the ph is adjusted gradually to ph = 3 . 5 by the addition of sodium bicarbonate . under room temperature the mixture is stirred till coupling reaction has completed . in addition , the reacting solution is further subjected to 14 . 1 parts of 1 - aminobenzene - 4 - β - sulfatoethylsulfone , and the ph is again adjusted gradually to 5 . 0 – 6 . 0 by the addition of soda ash , the mixture is stirred till reaction is completed . the result solution is salted out with nacl and filtered to obtain compound ( 3 ). 20 . 6 parts of 2 - aminonaphthalene - 1 - sulfonic acid - 6 - β - sulfatoethylsulfone are dispersed in 150 parts of ice water , and 12 . 6 parts of 32 % hcl aqueous solution is further added and stirred evenly . subsequently the reacting solution undergoes diazotization by the addition of 3 . 6 parts sodium nitrite aqueous solution in a temperature of 0 to 5 ° c . to this mixture , 9 . 5 parts of powdered 2 , 4 - diaminobenzenesulphonic acid are added , and the ph is adjusted gradually to 3 . 5 by the addition of sodium bicarbonate . under room temperature the mixture is stirred till coupling reaction has completed . upon the reaction is completed , the temperature is dropped to 0 ° c . by the addition of ice . then , the ph is adjusted to ph = 13 with a solution of 45 % sodium hydroxide , and the solution is stirred for 15 minutes ; then 32 % hcl aqueous solution is stirred into so that the ph is further adjusted to 5 . 0 – 6 . 0 . to this mixture , 6 . 4 parts of nicotinate are added and stirred in the presence of heat for 2 hours while the temperature is maintained at 60 ° c . throughout for the reaction to complete . then , the temperature is set to 20 ° c . the diazonium salt of 1 - aminobenzene - 4 - β - sulfatoethylsulfone ( 14 . 1 parts ) is added into the above result solution , and the ph is again adjusted gradually to 5 . 0 – 6 . 0 by the addition of soda ash . the mixture is stirred till reaction is completed . the result solution is salted out with nacl and filtered to obtain compound ( 4 ). 19 . 4 parts of compound ( p - 1 ) are prepared and dissolved in 150 parts of ice water , and 12 . 6 parts of 32 % hcl aqueous solution is further added into and mixed thoroughly . subsequently the reacting solution undergoes diazotization by the addition of 3 . 7 parts sodium nitrite aqueous solution in a temperature of 0 to 5 ° c . to this mixture , 9 . 5 parts of powdered 2 , 4 - diaminobenzenesulphonic acid are added , and the ph is adjusted gradually to 3 . 5 by the addition of sodium bicarbonate . under room temperature the mixture is stirred till coupling reaction has completed . the diazonium salt of 1 - aminobenzene - 4 - β - nicotinicethylsulfone ( 15 . 4 parts ) is added into the above result solution , and the ph is again adjusted gradually to 5 . 0 – 6 . 0 by the addition of soda ash . the mixture is stirred till reaction is completed . the result solution is salted out with nacl and filtered to obtain compound ( 5 ). 14 . 1 parts of 1 - aminobenzene - 3 - β - sulfatoethylsulfone are prepared and dissolved in 150 parts of ice water , and 12 . 6 parts of 32 % hcl aqueous solution is further added into and stirred thoroughly . subsequently the reacting solution undergoes diazotization by the addition of 3 . 6 parts sodium nitrite aqueous solution in a temperature of 0 to 5 ° c . to this mixture , 9 . 5 parts of powdered 2 , 4 - diaminobenzenesulphonic acid are added , and the ph is adjusted gradually to 3 . 5 by the addition of sodium bicarbonate . under room temperature the mixture is stirred till coupling reaction has completed . the diazonium salt of 1 - aminobenzene - 4 - β - nicotinicethylsulfone ( 15 . 4 parts ) is added into the above result solution , and the ph is again adjusted gradually to 5 . 0 – 6 . 0 by the addition of soda ash . the mixture is stirred till reaction is completed . the result solution is salted out with nacl and filtered to obtain compound ( 6 ). generally , with accordance to the procedures of example 1 , example 2 , example 3 and example 4 , the reactive dyestuffs below can be prepared , and upon dyeing with specific dyestuffs , cotton fiber demonstrates fine fastness . a golden yellow compound of the following formula ( 7 ) is obtained . urea 100 parts , reduction retarding agent 10 parts , sodium bicarbonate 20 parts , sodium alginate 55 parts , warm water 815 parts , were stirred in a vessel to give a completely homogeneous printing paste . dyestuff of formula ( 3 ) ( prepared as in example 1 ), 3 parts , and the above printing paste , 100 parts , were mixed together to make a homogeneous colored paste . a 100 mesh printing screen covering an adequate sized piece of cotton fabric was painted with this colored paste on printing screen to give a colored fabric . the colored fabric was placed in an oven at 65 ° c . to dry for 5 minutes then taken out , and put into a steam oven using saturated steam for 10 minutes at 102 – 105 ° c . the colored fabric was washed with cold water , hot water , and soap then dried to obtain an orange fabric with good dyeing properties . dyestuff of formula ( 3 ) ( prepared from the example 1 ), 3 parts was dissolved in 100 parts of water to give a padding liquor . 25 ml of alkali solution ( naoh ( 38 ° be ′) 15 ml / l and glauber &# 39 ; s salt 30 parts / l ) were added to the padding liquor . the resultant solution was put into a pad roller machine . the cotton fabric was padded by the roller pad machine , then was batched for 4 hours . the padded fabric was washed with cold water , hot water , and soap solution then dried to obtain an orange fabric with good dyeing properties . dyestuff of formula ( 3 ) ( prepared from the example 1 ), 0 . 25 parts was dissolved in 250 parts of water . to 40 ml of this solution , in a dyeing bottle , was added cotton fabric , glauber &# 39 ; s salt , 2 . 4 parts , and 32 % alkali solution , 2 . 5 parts . the dyeing bottle was shaken at 60 ° c . for 60 minutes . the colored fabric was washed with cold water , hot water , and soap solution then dried to obtain an orange fabric with good dyeing properties . dyestuff of formula ( 4 ) ( prepared from the example 2 ), 0 . 25 parts was dissolved in 250 parts of water . to 40 ml of this solution , in a dyeing bottle , was added cotton fabric , glauber &# 39 ; s salt , 2 . 4 parts , and 32 % alkali solution , 2 . 5 parts . the dyeing bottle was shaken at 60 ° c . for 60 minutes . the colored fabric was washed with cold water , hot water , and soap solution then dried to obtain an orange fabric with good dyeing properties . dyestuff of formula ( 5 ) ( prepared from the example 3 ), 0 . 25 parts was dissolved in 250 parts of water . to 40 ml of this solution , in a dyeing bottle , was added cotton fabric , glauber &# 39 ; s salt , 2 . 4 parts , and 32 % alkali solution , 2 . 5 parts . the dyeing bottle was shaken at 60 ° c . for 60 minutes . the colored fabric was washed with cold water , hot water , and soap solution then dried to obtain an orange fabric with good dyeing properties . dyestuff of formula ( 6 ) ( prepared from the example 4 ), 0 . 25 parts was dissolved in 250 parts of water . to 40 ml of this solution , in a dyeing bottle , was added cotton fabric , glauber &# 39 ; s salt , 2 . 4 parts , and 32 % alkali solution , 2 . 5 parts . the dyeing bottle was shaken at 60 ° c . for 60 minutes . the colored fabric was washed with cold water , hot water , and soap solution then dried to obtain a golden yellow fabric with good dyeing properties . the series of disazo reactive dyestuffs containing the quaternary groups of the present invention are suitable for common uses and have excellent properties . they can be used to dye cellulose fibers with various dyeing methods , such as exhaustion dyeing , printed - dyeing , or continuous dyeing that are commonly used in the dyeing of reactive dyestuffs . the series of disazo reactive dyestuffs containing the quaternary groups of the present invention are universal dye mixtures , suitable for the dyeing of cellulose fiber materials ; in application it can be use as common reactive dyes , such as in exhaust dyeing , printing , and continuous dyeing . moreover , the product dyed with the dyestuffs exhibit superior properties . the series of disazo reactive dyestuffs containing the quaternary groups of the present invention are economically valued because they are water - soluble , which provides the products with excellent dyeing properties , especially in wash - off , build up , leveling wash , light , rubbing , ironing , and chlorine bleaching fastness . although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the scope of the invention as hereinafter claimed .	2
surfactants are to be understood as water - soluble compounds active at bundary surfaces , a molecule of which possesses at least one hydrophilic component and a hydrophobic remainder . in non - ionic surfactants , the hydrophilic component of the molecule is the location of an electro - neutral group . in non - ionic surfactants , the hydrophilic component of the surfactant molecule is achieved either through the presence of oxygen in the molecule ( as in ethylene oxide or propylene oxide hydrophylic linkages , terminal hydroxyl groups , or oxygen linked directly to nitrogen as in amide groups ) or via sulfonate , phosphate , or carboxylate terminal groups in the case of zwitterionics . the hydrophobic component of a non - ionic surfactant molecule comprises hydrocarbon chains which can be linked to such a hydrophilic component via aliphatic or aromatic ring systems . the combined treatment of circuits boards with two solutions as taught by this invention surprisingly achieves an extremely effective increase in the solderability of conductor paths . the result achieved is considerably better than the improvement in solderability facilitated by previously known processes . the treatment process of this invention is also suitable to reactivate circuit board surfaces which no longer possess solderability . a further advantage consists in that both solutions can easily be removed from the point of view of environmental waste disposal technology after a long period of use . thus , by means of a simple follow - up treatment , the two solutions can be converted into a clear solution which is harmless to the environment and which can be pumped into a waste system . preferably , in accord with the teachings of this invention , a first solution contains a non - ionic surfactant of the ethoxylated type . ethoxylated surfactants are formed by condensing ethylene oxide to form polyether chains using the so - called ethoxylation reaction . if this reaction occurs with a substance which possesses hydrogen atoms which are capable of reacting , for examples , with a fatty acid or a phenol , in the presence of either acidic or basic catalysis , polyether chains develop whose end groups are hydroxyl groups , for example : ## str1 ## in ethoxylation , compounds such as , for examples , fatty acids , aliphatic alcohols , fatty amines , fatty acid amides , alkyl substituted phenols and other phenol homologs , aliphatic mercaptans , terpene alcohols , or the like , are reacted with ethylene oxide . for purposes of the present invention , one commences with compounds which contain from about 10 to 18 carbon atoms per molecule in the form of hydrophobic chains . sufficient ethylene oxide is condensed per molecule therewith to achieve a &# 34 ; degreee of ethoxylation &# 34 ; corresponding to from about 2 to 40 moles ethylene oxide . the &# 34 ; degree of ethoxylation &# 34 ; does not define a clear chain length since , as with all polymers , actual chain length in a given product is statistically distributed about a mean value . examples of suitable non - ionic ethoxylated surfactants include alkyl ethoxylates , ethoxylated alkyl phenols , fatty acid ethanol amides , polymers of ethylene oxide , propylene oxide , and alcohols , and the like , all having incorporated thereinto from about 2 to 40 moles of ethylene oxide per molecule . advantageously , a first solution with ethoxylated alkyl phenol is used as the non - ionic surfactant . when , for example , an aqueous solution comprising from about 20 to 100 grams of ethoxylated alkyl phenol per liter and from about 15 to 80 grams of an organic acid per liter is used as the first solution , an excellent cleansing and a reliable deoxidation of conductor paths on circuit boards is ensured in a first treatment stage of the process of the invention . the first solution is preferably adjusted with such organic acid so as to have a ph of about 2 . the use of a second solution saturated with potassium persulfate has proven to be particularly advantageous . preferably , such a second solution is adjusted to have a ph - value of between about 2 . 0 and 4 . 0 by the addition of sulphuric acid , and thereafter preferably such solution is stabilized against decomposition with concentrated phosphoric acid . the amount of phosphoric so added in solution form ranges from about 0 . 1 to 0 . 5 grams per liter . the circuit board surfaces activated with a second solution of this type are characteristically light in color and possess a uniform smoothness , and during subsequent soldering display excellent wetting characteristics with a uniform solder distribution . in a preferred exemplary embodiment of the process of the invention , the surface of a circuit board with conductor paths is submerged into such a first solution , and the resulting such surface with its conductor paths is flushed with tap water . next , such flushed surface is contacted with such a second solution , and then it is again flushed with tap water . next , such flushed surface is again submerged into such a first solution , and , thereafter , it is once again flushed with tap water before being finally dried in the air . thus , to improve the solderability of a circuit board with conductors composed of a copper or copper alloys , in accordance with this invention , one first contacts with a first solution ( preferably by immersion of the circuit board to be treated ) conductor paths on such a board at least in areas thereof to be soldered . contact time typically ranges from about 1 to 5 minutes , though longer and shorter contact times may be used . the first solution used in such a contacting preferably comprises on a 100 weight percent total weight basis from about 2 to 20 weight percent of at least one dissolved non - ionic surfactant , from about 1 to 20 weight percent of at least one dissolved organic acid capable of producing a ph of not larger than 2 in water solution at a concentration of less than 50 grams per liter , and the balance up to 100 weight percent of any given first solution being water . after such a first contacting , the so - contacted areas are flushed with water ( typically tap water may be used ) for a period of time of at least about 10 seconds . next , one contacts the so first flushed areas with a second solution . typical contact times here range from about 2 to 10 minutes , though longer and shorter contact times may be employed . the second solution employed for such a second contacting preferably comprises on a 100 weight percent total weight basis from about 0 . 5 weight percent up to solution saturation of dissolved potassium persulfate , sufficient added sulfuric acid to produce in any given such solution a ph of from about 1 to 4 , from and including 0 up to about 0 . 5 weight percent of dissolved phosphoric acid , and the balance up to 100 weight percent of any given such second solution being water , after such a second contacting , the so contacted areas are again flushed with water ( typically tap water may be used ) for a period of time of at least about 10 seconds . thereafter , one contacts the so flushed areas with a first solution . contacting times range from about 1 to 50 minutes . the first solution employed here can be the same first solution as used for a first contacting as above described , or such can be a different first solution having a composition as above described . then , the resulting contacted areas are given a final water flushing ( typically tap water may be employed ). a typical flushing operation involves at least about 10 seconds . a preferred class of such organic acids comprises lower alkanoic acids ( e . g . those containing less than seven carbon atoms per molecule ). a more preferred such acid comprises formic acid . with the method of treatment of this invention , a particularly long - lasting improvement in circuit board surface solderability is achieved . if the surfaces of the so processed conductor paths are additionally coated with a conventional soldering agent , a reliable solderability of such conductor paths is ensured even after one year of storage . in order to achieve optimum results , it is necessary to monitor the solutions employed . the first solution charcteristically has a practically unlimited life . however , it is advisable to monitor the density and the ph value of the first solution at intervals . deviations from starting density can be corrected with addition of an aqueous concentrate of surfactant and / or organic acid . evaporation losses are compensated for by adding tap water to a first solution . if after a long period of use , considerable clouding of a first solution through build - up therein of particles of dirt may be noticed , and , if so , it is advisable to discard the preparation . as a result of contact with the conductor paths composed of copper or copper alloys in circuit boards , a second solution is gradually consumed until a maximum copper absorption for a given second solution is achieved . second solution density increases through contact with circuit boards to some maximum value which is dependent upon the particular second solution employed . thus , the second solution loses its effectiveness . the bath monitoring of the second solution consists simply in checking the density and the ph value at intervals . evaporation losses in a second solution are compensated for by adding tap water thereto . second solution ph value tends to rise through use , and this is compensated for by adding small amounts of diluted sulfuric acid thereto . the elimination of the first and second solutions using environmental waste disposal technology is effected by emptying the spent solutions or baths into a concentrate container of a waste water plant effluent system and then neutralizing such with caustic potash and / or caustic soda . the released copper ions are then precipitated as copper hydroxide by which the majority of the surfactants is absorbed . the surfactants and the formic acid are oxidized by the perioxide to form carbon dioxide . the neutral solution obtained in this way can now be harmlessly pumped via a filter assembly into waste effluent as a waterclear potassium sulphate solution which presents no danger to the environment , and is biologically useful . the present invention is further illustrated by reference to the following examples . those skilled in the art will appreciate that other and further embodiments are obvious and within the spirit and scope of this invention from the teachings of these present examples taken with the accompanying specification . following their production , circuit boards are submerged into a first solution for a length of time between about 1 an 3 minutes , and are subsequently slowly withdrawn therefrom in order to keep the discharge of adhering liquid small . the temperature of the first solution , which characteristically depends upon the pollution associated with the circuit boards , generally corresponds approximately to room temperature . the first solution here comprises one liter of tap water in which is dissolved both 25 grams of ethoxylated alkyl phenol with a degree of ethoxylation of from about 8 to 14 and 20 grams of 100 % formic acid . following a flushing treatment of about 12 seconds duration in room temperature tap water , the circuit boards are submerged into a second solution . the surfaces of the circuit boards are then activated in this second solution at room temperature without moving or agitation of the system . the period of dwell of the circuit boards in this second solution amounts to about 5 minutes . the second solution is prepared by dissolving potassium persulfate salt at the rate of 54 grams per liter of tap water at a water temperature of 20 ° c . followed by adding thereto about 10 % sulphuric acid . the quantity of sulphuric acid so added is sufficient to produce in the resulting solution a ph value of 2 . for the purposes of stabilization , 0 . 5 gram per liter of concentrated orthosphosphoric acid ( h 3 po 4 ) is added to the preparation . following removal from this second solution , the circuit boards are subjected to another such flushing treatment of about 12 seconds in tap water . then , the circuit boards are again for a period of about 1 minute submerged into the first solution ( or alternatively , into a solution corresponding to the first solution in composition ), and then , as before , the circuit boards are slowly withdrawn in order to keep the loss as slight as possible . following a new flushing treatment in tap water , lasting about 12 seconds , the circuit boards are then dried with the aid of oil - free compressed air . thereafter , the dried boards are provided with a 7 to 10 micron thick coating of a soldering agent . the soldering agent can be applied by dipping , spraying , or rolling - on . suitable soldering agents , for examples , are colophony , soldering lacquers , or the like . when the soldering agent has been dried first in air , and then in a fresh - air circulating furnace at a temperature of about 60 ° c ., the resulting circuit boards can then be stored . the solutions employed are monitored . the first solution is found to have a practically unlimited life . the first solution appears to have an optimum starting density of about 1 , 004 g / cm 3 and 0 . 7 ° be ( degree - baume ) and an optimum ph value of 2 . deviations are corrected by addition of fresh solution , or by addition of concentrated formic acid . evaporation losses are compensated for by adding tap water to the first solution . after a long period of use , considerable clouding of the first solution through particles is noticed , and this used solution is discarded . when freshly made , the second solution possesses a starting density of 1 . 033 g / cm 3 or 4 . 9 ° be and a ph value 2 . as a result of contact with the conductor paths composed of copper or copper alloys in circuit boards , such solution is gradually consumed until a maximum copper absorption of 12 g / l and a corresponding density of the solution of 1 . 057 g / cm 3 or 7 . 9 ° be is observed . thus , the second solution loses its effectiveness . the bath monitoring of the second solution consists in checking the density and the ph value at intervals . evaporation losses are compensated by supplying tap water to such second solution . the ph value of such second solution is corrected by adding thereto small quantities of diluted sulphuric acid . to ensure sufficient reliability of this second solution for the activation of circuit boards , this second solution is discarded when its density reaches a value of 1 . 054 g / cm 3 or 7 . 5 ° be . the spent first and second solutions are emptied into a container and neutralized with caustic potash and / or caustic soda . the neutral solution so obtained after filtration is a water - clear potassium sulfate solution .	1
to avoid a redundant description , like or same reference numerals are given to those components which are the same as the corresponding components of the first embodiment . a first embodiment of the present invention will now be described with reference to fig1 and 2 . the rear axle 1 includes an axle body 3 and upper and lower bosses 4 , 5 as in the prior art rear axle 31 . the axle body 3 includes a vertical plate 6 and horizontal plates 7 a , 7 b , which are located at the upper and lower edges of the vertical plate and are parallel to one another . the upper and lower bosses 4 , 5 are welded to the ends of the horizontal plates 7 a , 7 b . each boss 4 , 5 includes a pin housing 24 . a hole 8 is formed in the pin housing 24 of each boss 4 , 5 . a kingpin 9 is rotatably received in the bosses 4 , 5 through needle bearings 10 a , 10 b . a thrust bearing 12 is attached to the kingpin 9 between a steering knuckle 11 and the upper boss 4 . the thrust bearing 12 permits relative rotation between the steering knuckle 11 and the upper boss 4 . the steering knuckle 11 includes a spindle 13 , which extends horizontally . a cylindrical hub 14 is rotatably supported on the spindle 13 through bearings 15 , 16 . a wheel rim 18 is integrally attached to the hub 14 by bolts 19 and nuts 20 , thus allowing a tire 17 to rotate with respect to the rear axle 1 . the attachment structure of the upper boss 4 to the axle body 3 will now be described . the upper boss 4 includes a projection 21 , which is received in the axle body 3 , between the vertical plate 6 and the upper horizontal plate 7 a . the upper and lower surfaces of the projection 21 are parallel , rectangular and planar . the projection 21 has the same width and about half the thickness as the boss 4 . the upper boss 4 and the projection 21 are forged . a concavity , or a corner recess 21 b , is formed on the upper surface of the proximal end of the projection 21 a , between the projection 21 and the housing so that the end surface of the upper horizontal plate 7 a makes good contact with the upper boss 4 and so that the upper surface of the projection 21 a makes good contact with the lower surface of the upper horizontal plate 7 a . as shown in fig1 in the axle body 3 , a step 6 a is formed on the vertical plate 6 to correspond to the projection 21 of the upper boss 4 . the upper surface of the projection 21 a contacts the lower surface of the upper horizontal plate 7 a , and the lower surface of the projection 21 contacts the upper surface of the step 6 a . that is , the projection 21 of the upper boss 4 is received between the vertical plate 6 and the lower surface of the upper horizontal plate 7 a . the upper boss 4 is welded to the axle body 3 at seven types of corners c 1 - c 7 . a first corner type c 1 is defined between the upper surface of the upper horizontal plate 7 a and the proximal end surface of the upper boss 4 . a second corner type c 2 is defined between the end surface of the upper horizontal plate 7 a and sides of the upper boss 4 . a third corner type c 3 is defined between the lower surface of the upper horizontal plate 7 a and the sides of the projection 21 . a fourth corner type c 4 is defined between the lower surface of the upper horizontal plate 7 a and the exposed parts of the end surface of the projection 21 . a fifth corner type c 5 is defined between the side surfaces of the vertical plate 6 and the end surface of the projection 21 . a sixth corner type c 6 is defined between the side surfaces of the vertical plate 6 and the lower surface 21 c of the projection 21 . a seventh corner type c 7 is defined between the end surface of the vertical plate 6 and the lower surface 21 c of the projection 21 . the welds are referred to collectively as weld beads 22 . the reaction force of the load on the wheel 2 is applied to the upper and lower bosses 4 , 5 . since the force applied to the steering knuckle 11 is transmitted to the upper boss 4 through the thrust bearing 12 , the upper boss 4 receives most of the load . the projection 21 of the upper boss 4 is received between the vertical plate 6 and the upper horizontal plate 7 a , and the upper boss 4 is welded to the axle body 3 . accordingly , when a load is applied to the upper boss 4 , the axle body 3 directly receives the load through direct engagement with the upper boss 4 . this reduces the load received by the weld beads 22 ( per unit length of weld ) compared to the prior art , in which the weld beads receive the entire load . manufacturing the upper boss 4 and the axle body 3 is relatively easy because the projection 21 is rectangular and formation of the step 6 a is the only additional step to be performed on the axle body 3 . when a force , whether upward or downward , is applied to the upper boss 4 , most of the force is received by the vertical plate 6 and the upper horizontal plate 7 a because the upper surface of the step 6 a and the lower surface of the upper horizontal plate 7 a are parallel to and in contact with one another . since part of the load applied to the upper boss 4 is transferred directly to the axle body 3 and the total length of the weld beads 22 is longer , the proportion of the load transferred through the weld beads 22 per unit length of weld bead is reduced . the shape of the projection 21 may have other shapes , such as triangular , semi - circular and polygonal shapes . in this case , substantially the same advantages are obtained . as shown in fig3 an inclined surface 6 b , or a chamfer , may be formed on a part of the vertical plate 6 corresponding to the upper boss 4 . the projection 21 of the upper boss 4 is wedge - shaped corresponding to a wedge - shaped space between the lower surface of the upper horizontal plate 7 a and the inclined surface 6 b . the weld beads 22 shown in fig3 are located in corner types corners c 1 , c 3 , c 5 and c 7 . a first corner type c 1 is defined between the upper surface of the upper horizontal plate 7 a and the proximal end surface of the upper boss 4 . a further corner type c 3 is defined between the lower surface of the upper horizontal plate 7 a and the side surfaces of the projection 21 . another corner type c 5 is defined between the side surfaces of the vertical plate 6 and the end surface of the projection 21 . another corner type c 7 is defined between the end surface of the vertical plate 6 and the lower surface 21 c of the projection 21 . in the embodiment of fig3 the load ( per unit length ) received by the weld beads 22 is reduced because the axle body 3 directly receives part of the load applied to the upper boss 4 through direct engagement with the upper boss 4 . however , compared to the first embodiment , the load received by the weld beads 22 is higher . in other words , when a vertical load is applied to the upper boss 4 , the proportion of the load received directly by the axle body 3 is greater in the embodiment of fig1 than in the embodiment of fig3 . as shown in fig4 the axle body 3 and the projection 21 are the same as those of fig3 however , the weld locations have been changed . the weld zones of the embodiment of fig4 do not include weld beads in the corners designated by c 3 in fig3 . in the embodiment of fig4 the load received by the weld beads 22 is reduced because part of the load applied to the upper boss 4 is received directly by the axle body 3 through engagement with the upper boss 4 . the omission of the weld beads 22 at the corners designated as c 3 in fig3 does not greatly increase the load transmitted by the remaining weld beads 22 . the projection 21 may have any shape as long as it is received between the vertical plate 6 and the upper horizontal plate 7 a . the load received by the weld bead 22 is reduced when the projection 21 is received between the vertical and upper horizontal plates 6 , 7 a , and part of the load applied to the upper boss 4 is transferred directly to the axle body 3 . the upper boss may not have the projection 21 received between the vertical plate 6 and the upper horizontal plate 7 a . as shown in fig5 ( a ) and 5 ( b ), the upper boss has a uniform thickness , its proximal end is triangular , and the plates 6 , 7 a are shaped to correspond to the triangular proximal end . that is , contact between the upper boss 4 and the axle body 3 is distributed over a combination of planes . corners c 8 are welded . corners c 8 are defined between each of the contact planes and a perpendicular surface . in this case , the proximal end of the upper boss 4 is not received between the plates 6 , 7 a , and most of the load applied to the upper boss 4 is received by the weld beads 22 . however , unlike the prior art , the proximal end surface of the upper boss 4 is not a single planar surface that is perpendicular to the longitudinal axis of the rear axle 1 and is a combination of different planes . accordingly , the length of the weld beads 22 is longer than that of the prior art and the load received by the weld beads 22 per unit length is reduced . the upper boss 4 and the axle body 3 are easily machined because the proximal end surface is formed by planar surfaces . if the proximal end surface of the upper boss 4 were curved or a combination of a curved surface and a planar surface , machining the upper boss 4 and the axle body 3 would be more difficult . also , the axle body 3 is easily machined . the upper boss 4 can have any shape as long as the contact between the upper boss 4 and the axle body 3 is distributed over a combination of planes . as shown in fig6 the proximal end of the upper boss 4 may have a triangular recess . as shown in fig7 the proximal end of the upper boss 4 may have a tapered section and a rectangular projection extending from the tapered section . when increasing the length of the weld beads 22 by changing the shape of the proximal end of the upper boss 4 , the vertical plate 6 need not be machined as in fig5 ( b ). that is , only the upper horizontal plate 7 a could be machined so that the lower surface of the upper boss 4 contacts the upper edge of the vertical plate 6 . the lower boss 5 may be formed in the same shape as the upper boss 4 and the lower boss 5 may be welded to the axle body 3 such that the lower boss 5 is a mirror image of the upper boss 4 . in this case , the weld strength of the lower boss 5 is improved and the upper and lower bosses are common parts . this reduces the cost per unit of the bosses 4 , 5 . when the bosses 4 , 5 are attached to the axle body 3 , the axes of the holes 8 does not have to be vertical , that is , the camber angle is not necessarily zero degrees . the axes of the holes 8 may be inclined . it should be apparent to those skilled in the art that the present invention may be embodied in many other specific forms without departing from the spirit or scope of the invention . therefore , the present examples and embodiments are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope and equivalence of the appended claims .	1
in fig1 - 4 , there is illustrated one embodiment of the invention and comprises a package p1 comprising a plate means 2 having a generally planar front surface 4 and a generally planar rear surface 6 . the plate means 2 has a top edge portion 8 , a bottom edge portion 10 and two side edge portions 12 and 14 , all of which extend in a linear direction . a reinforcing rib 16 projects outwardly from the front surface 4 and extends in a linear direction between the side edge portions 12 and 14 and is generally parallel to the top and bottom edge portions 8 and 10 . the reinforcing rib 16 terminates a short distance away from each of the side edge portions 12 and 14 . an opening 18 is formed in the plate means 2 adjacent to the top edge portion 8 . an integral flange 20 projects outwardly from the front surface 4 and is provided with a central groove 22 extending therethrough to cooperate in placing the package p1 on a display hook ( not shown ). an integral u - shaped member 30 extends downwardly from the bottom edge portion 10 so as to form an inner opening 32 having a continuous edge comprising a top edge 34 , a bottom edge 36 and two side edges 38 and 40 . the u - shaped member 30 lies in the same plane as the plate means 2 . the u - shaped member 30 has a generally planar front surface 42 and a generally planar rear surface 44 . as illustrated in fig1 and 4 , a portion of the inner opening 32 is formed by a central cut - out portion of the plate means 2 . a pair of spaced apart , integral projections 50 and 52 extend outwardly from the front surface 4 . a connecting means 54 extends between and is integral with the projections 50 and 52 and cooperates therewith and with portion 56 of the plate means 2 and portion 58 of the u - shaped member 30 to form an enclosure means for enclosing a portion 60 of the electrician &# 39 ; s pliers 62 , as illustrated in fig3 . the spaced apart projections 50 and 52 have top edge portions 64 lying in the same plane and bottom edge portions 66 lying in the same plane . also , the spaced apart projections 50 and 52 have upper portions 68 having generally planar exposed surfaces and lower portions 70 having arcuately shaped exposed surfaces which provide reinforcement therefor . the connecting means 54 has a u - shaped top edge portion 72 with portions 74 thereof lying in the same plane as the top edge portions 64 and a bottom edge portion 76 lying in a plane spaced from the plane of the bottom edge portions 66 and located between the plane of the bottom edge portions 66 and the bottom edge portion 10 of the plate means 2 . the distance between the projections 50 and 52 at their juncture with the front surface 4 is greater than the distance between the projections 50 and 52 at their junction with the connecting means 54 . an integral support prong 80 extends upwardly from the bottom edge 36 in a direction toward the top edge 34 . the support prong 80 has a first portion 82 having generally planar front and rear surfaces 84 and 86 and lying in the same plane as the u - shaped member 30 ; a second portion 88 having generally planar front and rear surfaces 90 and 92 and a third portion 94 having front and rear surfaces 96 and 98 . the front surfaces 84 and 90 form an obtuse angle of between about 125 and 145 degrees and preferably about 135 degrees . the front surfaces 90 and 96 form an angle of between about 215 and 235 degrees and preferably about 225 degrees . a reinforcing rib 100 extends outwardly from th front surfaces 84 and 90 and is integral therewith and with a portion of the front surface 42 . a reinforcing rib 102 is integral with the rear surfaces 86 , 92 and 98 and extends inwardly toward the inner opening 32 and includes a support fin 104 for supporting the merchandise . the back surfaces 6 and 44 are provided with reinforcing rib means comprising a linearly extending reinforcing rib 106 extending outwardly from the back surfaces 6 and 44 and located close to and parallel to the side edge 38 ; a linearly extending reinforcing rib 108 extending outwardly from the back surfaces 6 and 44 and located close to and parallel to the side edge 40 ; and a pair of spaced apart , linearly extending reinforcing ribs 110 and 112 extending outwardly from the back surface 44 and located close to and parallel to the bottom edge 36 . in fig5 - 8 , there is illustrated the preferred embodiment of the invention and comprises a package p2 comprising a plate means 122 having a generally planar front surface 124 and a generally planar rear surface 126 . the plate means 122 has a top edge portion 128 , a bottom edge portion 130 and two side edge portions 132 and 134 , all of which extend in a linear direction . if desired , a reinforcing rib similar to the reinforcing rib 16 of fig1 may be provided on the front surface 124 . an opening 138 is formed in the plate means 122 adjacent to the top edge portion 128 . an integral flange 140 projects outwardly from the front surface 124 and is provided with a central groove 142 extending therethrough to cooperate in placing the package p2 on a display hook ( not shown ). an integral u - shaped member 150 extends downwardly from the bottom edge portion 130 so as to form an inner opening 152 having a continuous edge comprising a top edge 154 , a bottom edge 156 and two side edges 158 and 160 . the u - shaped member 150 lies in the same plane as the plate means 122 . the u - shaped member 150 has a generally planar front surface 162 and a generally planar rear surface 164 . as illustrated in fig5 and 8 , a portion of the inner opening 152 is formed by a central cut - out portion of the plate means 122 and includes an arcuately shaped portion 166 for providing space for a portion of the pair of pliers during the insertion thereof . a pair of spaced apart , integral projections 170 and 172 extend outwardly from the front surface 124 . a connecting means 174 extends between and is integral with the projections 170 and 172 and cooperates therewith and with portion 176 of the plate means 122 and portion 178 of the u - shaped member 150 to form an enclosure means for enclosing a portion 180 of the conventional pliers 182 as illustrated in fig7 . the spaced apart projections 170 and 172 have top edge portions 184 lying in the same plane and bottom edge portions 186 lying in the same plane . the distance between the top and bottom edge portions 184 and 186 at their juncture with the front surface 124 is greater than the distance between the top and bottom edge portions 184 and 186 at their juncture with the connecting means 174 . the top edge portion 188 of the connecting means 174 lies in the same plane as the top edge portions 184 and the bottom edge portion 190 of the the connecting means 174 lies in the same plane as the bottom edge portions 186 . the distance between the projections 170 and 172 at their juncture with the front surface 124 is greater than the distance between the projections 170 and 172 at their juncture with the connecting means 174 . an integral support prong 200 extends upwardly from the bottom edge 156 in a direction toward the top edge 154 . the support prong 200 has a first portion 202 having generally planar front and rear surfaces 204 and 206 and lying in the same plane as the u - shaped member 150 ; a second portion 208 having generally planar front and rear surfaces 210 and 212 and a third portion 214 having generally planar front and rear surfaces 216 and 218 . the front surfaces 204 and 210 form an obtuse angle of between about 125 and 145 degrees and preferably about 135 degrees . the front surfaces 210 and 216 form an angle of between about 215 and 235 degrees and preferably about 225 degrees . a reinforcing rib 220 extends outwardly from the front surfaces 204 and 210 and is integral therewith and with a portion of the front surface 62 . a reinforcing rib 222 integral with the rear surfaces 206 , 212 and 218 extends inwardly toward the inner opening 152 . the merchandise is supported by the second portion 208 . the back surfaces 126 and 164 are provided with reinforcing rib means comprising a linearly extending reinforcing rib 224 extending outwardly from the back surfaces 126 and 164 and located close to and parallel to the side edge 158 ; a linearly extending reinforcing rib 226 extending outwardly from the back surfaces 126 and 164 and located close to and parallel to the side edge 160 ; and a pair of spaced apart , linearly extending reinforcing ribs 228 and 230 extending outwardly from the back surface 164 and located close to and parallel to the bottom edge 156 . in the preferred embodiments of the invention , the package is integrally molded using a high density plastic material such as polypropylene or other similar material . the package has a generally uniform thickness in the range from about 1 . 0 mm to 3 . 0 mm . the relative sizes of the various portions of the package may be varied to accommodate different articles of merchandise . for example , the plate means 122 of the package p2 , illustrated in fig5 has a length from the top edge portion 128 to bottom edge portion 130 of about 10 cm , a width of about 9 . 2 cm , the u - shaped member 150 extends downwardly from the bottom edge portion 130 a distance of about 5 . 5 cm and has a width of about 4 . 5 cm , the projections 170 and 172 extend outwardly for a distance of about 1 . 7 cm and the width of the connecting means 174 is about 3 . 3 cm . the front surface 216 of the third portion 214 lies in a plane that is spaced from the plane of the front surface 162 of the u - shaped member 150 a distance of about 1 . 2 cm . the plate means 2 of the package p1 , illustrated in fig1 has a length from the top edge portion 8 to bottom edge portion 10 of about 10 cm , a width of about 9 . 2 cm , the u - shaped member 30 extends downwardly from the bottom edge portion 10 a distance of about 3 . 8 cm and has a width of about 5 . 0 cm , the projections 50 and 52 extend outwardly for a distance of about 1 . 5 cm and the width of the connecting means 54 is about 3 . 3 cm . the front surface 96 of the third portion 94 lies in a plane that is spaced from the plane of the front surface 42 of the u - shaped member 30 a distance of about 1 . 3 cm . in operation , a portion of the merchandise , such as the pair of pliers in fig3 and 7 , is placed against the support prong and a force is applied to deflect the support prong into the inner opening . the merchandise is pushed through the opening between the projections and th connecting means and moved toward the top edge portion of the plate means . as soon as the merchandise provides a space , such as the space 228 or 230 between the handles of the pliers , the support prong , because of its resilient characteristic , moves out of the inner opening and back into its supporting location . the merchandise is then moved in a direction toward the support prong until it is contacted thereby . the merchandise is then packaged for display . in fig3 the electricians pliers 62 are illustrated in an intermediate position and have a slot 232 into which the fin 104 moves when the electricians pliers have been moved into the support position . while an illustrative and presently preferred embodiment of the invention has been described in detail herein , it is to be understood that the inventive concepts may be otherwise variously embodied and employed and that the appended claims are intended to be construed to include such variations except insofar as limited by the prior art .	1
as illustrated in fig1 , the satellite system of the present invention includes a receiving satellite that is connected to a head - in equipment frequency processor 44 . it is at this head - in equipment frequency processor where the signals ( vertical - polarized signals and horizontal - polarized signals or left - hand circular and right - hand circular polarization signals ) are received simultaneously and then transmitted via a single coaxial cable 13 to the head - out receiver processor 45 or 46 . from the receiver processor , the signals are transported to a satellite receiver 27 or 41 and to a source 29 or 43 ( this figure illustrates a television as its source ). as illustrated , the receiving satellite 1 is connected to a low - noise block converter ( lnb ) 2 for amplifying the respective polarized signals ( vertical - polarized signals and horizontal - polarized signals or left - hand circular and right - hand circular polarization signals ). this lnb is coupled to the head - in equipment frequency processor 44 . accordingly , after signals are received , they pass the low - noise block converter 2 , to provide for the signals to enter the head - in equipment frequency processor 44 ( illustrated in dashed lines ) via conduits 3 and 4 . the head - in equipment frequency processor 44 provides for the signals via lines 3 and 4 to be converted to the frequencies which the present day amplifiers can transport via converters 5 and 7 , respectively . from the conduits 3 and 4 , the signals or transponders are transmitted to a first converter or down converter 5 and a second converter or up converter 7 , respectfully . these frequency converters convert the entered frequencies to frequencies which the present day amplifiers can transport . the utilization of two converters permits for the acceptance of two signals or polarized transponders that are of a different frequency . in the down converter 5 , the transponders are converted down to a specified frequency . this specified frequency is the frequency that is required for the present day amplifiers to transport . the newly converted frequencies are amplified through the amplifying means 6 . at means 6 , the converted frequencies are amplified so not to create second harmonics . these signals are then transferred to a four way splitter 10 . in the up converter 7 , the transponders are converted up to a specified frequency . the converted frequencies then are converted down via down converter 8 . this process of converting up and then down provides for frequencies to be converted without difficulties and avoiding the forbidden conversion area . the converted signals are transferred to the four way splitter 10 in order to combine the frequency of the amplifier signal of 6 and frequency from converter 8 . to synchronized the system , the frequencies from the phase lock loop ( pll ) transmitter 9 are transmitted to the splitter 10 . from 10 , the signals are passed through an a . c . power separator 11 which routes 60 volts power to a d . c . power supply of 18 volts . this will permit for the dual frequencies from the satellite dish to be transmitted simultaneously via a single coaxial cable 13 . dependent upon the length of the cable , an optional amplifier 14 can be coupled thereto . power from a power source 16 is inserted into the lines via a power inserter 15 . the signals are amplified , as needed , with an additional amplifier 17 . it is noted that the amplifiers are optional and are dependent to the distance that the head - in frequency processor 44 is located from the head - out receiver processor 45 or 46 . the power supply and power source 16 energize the head - in frequency processor 44 . from the single coaxial cable 13 , the signals are adjusted via a tap 18 or 31 to permit for the appropriate decibels that is required for the head - out receiver processor 45 or 46 . the head - out frequency processor includes a plurality of embodiments . the design and configuration of the head - out frequency processor is dependent on the source in combination with the satellite receiver . the first embodiment for the head - out receiver processor is illustrated in fig1 and is represented by way of dashed lines 45 . as seen in this head - out receiver processor , the simultaneously transmitted signals enter the processor via conduit 19 . the conduit is coupled to a four ( 4 ) way splitter 20 . a phase lock loop ( pll ) receiver 21 is coupled to the splitter 20 to permit for the signals to be locked to the proper and desired frequencies . from the splitter , the first frequency is transmitted to a first converter 22 in order to permit signals or transponders to be converted up to a specified frequency . this up converted signal is then transmitted to the satellite receiver 27 by way of a conduit 26 . the second frequencies are transmitted to a first or up converter 23 and then is transmitted to a second or down converter 24 . this will permit for the signals to be converted to the desired frequency . the conversion of the signals from up to down provides the benefit of converting the frequencies without any mishap or error . this method of conversion will avoid the forbidden conversion area . this second or down converter 24 is coupled to the satellite receiver 27 via conduit 25 . the signals received from the satellite 1 can then be transmitted to the source 29 by line 28 . as illustrated , this head - out receiver processor 45 is the reverse process of the head - in processor 44 . this is to provide for the signals to reconvert to its original frequencies so as to provide for the satellite receiver and source to accept the signals . the single cable 13 accepts the signals at frequencies different than that of the source 29 . accordingly the head - out receiver processor 45 must reconvert the signals to the frequencies that are utilized by the source . this design and configuration of the head - out receiver processor is dependent on the design and configuration of the satellite . an alteration of the satellite receiver requires an alteration in the head - out receiver processor . this alteration is illustrated in fig1 and is shown in outline and designated as reference 46 . in this design and configuration , the satellite receiver utilizes only one wire 40 and accepts only one type of signals , at a time , such as left - hand circular or right - hand circular polarized signals . as seen , the frequencies are tapped via 31 . the tap 31 is coupled to the head - out receiver processor 46 via line 32 which is connected to a four ( 4 ) way splitter 33 . to provide for the signals to be locked in proper frequencies , the four way splitter 33 is coupled to a phase lock loop ( pll ) receiver 34 . from the splitter 33 , the first signal is transmitted to a first or up converter 36 and then is transmitted to a second or down converter 37 . the conversion of the signals from up to down provides the benefit of converting the frequencies without any mishap or error . this method of conversion will avoid the forbidden conversion area . the signals , from the splitter 33 are transmitted to an up converter 35 which will inherently convert the signals . a polarity switch 39 is connected to converters 35 , 36 , 37 in order to permit for the head - out receiver processor to be coupled to the satellite receiver 41 via a single cable 40 and a joining means 38 which is a four ( 4 ) way splitter . the satellite receiver 41 is connected by way of line 42 to a source 43 . it is noted that fig1 illustrates the use of two head - out receiver processors , but in actuality , only one head - out receiver processor is utilized with the head - in processor 44 . the type and embodiment for the head - out receiver processor is dependent to the combination of the satellite receiver and source that are utilized . the satellite system of the present invention will permit for two signals of different frequency and polarities to travel simultaneously via a single coaxial cable . the use of this will provide for a satellite system that is versatile , economical , and compact . the usage of the single cable permits for a system that can accept satellite broadcasting in places that were previously rendered impossible . these places includes mid / high - rise office buildings , condominiums , hospitals , schools , etc . the unique design and configuration enables the signals to be transmitted via the existing wiring of the buildings . the only renovations that may need to be done is the upgrading of the existing amplifiers . while the invention has been particularly shown and described with reference to an embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention .	7
hereinafter , an exemplary embodiment of the closure will be described in detail with reference to drawings . however , the ideas of the closure is not limited to the presented embodiment and one skilled in the art understanding the ideas of the closure may easily propose another embodiment within the same range of the ideas . fig1 shows a shape of a vacuum cleaner according to an exemplary embodiment of the disclosure , fig2 shows a condition in which a visualization device for dust collection of a vacuum cleaner according to an exemplary embodiment of the disclosure is mounted in one side of a suction nozzle and fig3 and 4 show a mounting structure for the visualization device for dust collection of the vacuum cleaner according to an exemplary embodiment of the disclosure . as shown in these drawings , a vacuum cleaner according to the disclosure includes a body 1 generating a suction force using a suction motor , a connection portion 20 transmitting the suction force generated by the body 1 , and a suction nozzle 100 disposed at one side of the connection portion 20 and a suction nozzle sucking a foreign material scattered at a side to be cleaned , along an air . the connection portion 20 , in which the suction nozzle 100 is mounted at its one end , includes a length - adjustable extension tube 22 , and a connection tube 24 made of a flexible material and connecting the extension tube 22 and the body 1 to each other . the shape of the suction nozzle 100 is formed by a case 120 and the case 120 includes an upper case 124 and a lower case 122 to be coupled to each other . further , a connection portion 140 having a diameter corresponding to the diameter of the extension tube 22 so as to be infilled - mounted in the extension tube 22 is disposed at a lateral end of the upper case 124 and the lower case 122 . on the other hand , a visualization device for dust collection 200 visualizing a collecting condition of the foreign material in one side of a transmitting course of the suction force generated by the body 1 into the outside is disposed at one side of the case 120 . the visualization device for dust collection 200 according to an exemplary embodiment of the disclosure displays a accommodating condition of the dust to the outside by accommodating a portion of the air and the dust contained in the air collected through the suction nozzle 100 and shields the portion of the flowing course of the air moving into the body 1 , disposed at a front of the connection portion 140 . therefore , the portion of the air moving into the body 1 may be introduced into the inside of the visualization device for dust collection 200 . on the other hand , the suction nozzle 100 to be showed is infilled - mounted in the extension tube 22 to clean a bed linen such as a covers or a mattress or knitted goods with a number of fine hairs or fluffs such as a blanket or a carpet and includes a turbine 160 generating a vibration to the inside of the case 120 , and a vibration frame 180 generating the vibration by a rotation of the turbine 160 . further , an air inlet hole 123 introducing the outer air into a position corresponding to a mounting position of the turbine 160 is disposed at the upper case 124 so as to smoothly rotate the turbine 160 . therefore , the turbine 160 rotates by using the air introduced into the air inlet hole 123 along the air introduced from the inlet ( not shown ) formed in a bottom of the suction nozzle 100 . further , the turbine 160 is connected to the vibration frame 180 by using an eccentric cam and the vibration frame 180 connected to the turbine 160 vibrates when the turbine 160 rotates . in addition , the mounting position of the turbine 160 is positioned at a front of the visualization device for dust collection 200 , and the air forcibly flowed by the turbine 160 and the dust contained in the air may be easily introduced into the inside of the visualization device for dust collection 200 . hereinafter , the visualization device for dust collection 200 having the mounting position mentioned above will be described with reference to drawings . fig5 shows a detailed configuration for the visualization device for dust collection of the vacuum cleaner according to an exemplary embodiment of the disclosure . fig6 shows the condition in which a push - button is pressed in the fig5 . as shown in these drawings , the visualization device for dust collection 200 of the vacuum cleaner according to an exemplary embodiment of the disclosure includes a collecting unit 220 guiding the introduction into the inside of the air and the dust , a dust collecting unit 240 extrinsically exposing the dust introduced through the collecting unit 220 , a foreign material discharge means 300 removing the dust remaining in the dust collecting unit 240 , and a discharge unit 260 communicated with the dust collecting unit 240 and guiding the discharge of the dust and the air . in detail , the collecting unit 220 is formed by a cylindrical shape having an upper opening and is provided with a mounting projection 221 formed to be projected from the outside so that the air and the dust suctioned into the inside of the case 120 are not leaked into the mounting portion whiling maintaining a fixed position mounted in the case 120 at the top edge . further , the portion of the outside of the collecting unit 220 is formed to be projected toward the mounting position of the turbine 160 , and the inlet 222 is disposed at the projection portion formed above so that the air and the dust are introduced into the inside of the collecting unit 220 . the inlet 222 is formed to guide the flowing of the air in the direction of the tangent line for the inside of the collecting unit 220 , and the air introduced into the inside of the collecting unit 220 moves while rotating along with its inside . one hand , the dust collecting unit 240 accommodating the air transferred while rotating through the inlet 222 and the dust contained in the transferred air is mounted in the top of the collecting unit 220 . the dust collecting unit 240 is made of a transparent material so that the accommodating condition of the dust may be exposed into the outside , and includes a second housing 244 directly fastened to the top of the collecting unit 220 and a first housing 242 sliding - movably provided to the outside of the second housing 244 . the second housing 244 is formed of shape of a cup having a diameter slightly greater than the opened top of the collecting unit 220 and is configured to be fastened to top of the collecting unit 220 while rotating . to this end , the fastening projection ( not given reference numerals ) projected from the outside of the collecting unit 220 is disposed at the top of the collecting unit 220 . when the fastening projection is accommodated into the second housing 244 to rotate the second housing 244 or the collecting unit 220 , a fastener 245 is further formed so that the fastening projection is inserted while moving toward one direction . that is , the fastener 245 is projected from the outside of the second housing 244 to form a space to enable the fastening projection to insert and mount , and the collecting unit 220 may be coupled with the second housing 244 by inserting and mounting the fastening projection into the space . further , the rod 249 to be projected upward is disposed at the top side of the second housing 244 . the description relating to the 249 will be described in more detail below . the first housing 242 is formed of shape of a cup surrounding the second housing 244 , and is connected to the push - button 310 to be described below to allow the sliding to move toward a pressurization direction together with the push - button 310 when pressing the push - button . to this end , a guide rib 246 is longitudinally formed on the inside of the first housing 242 in a sliding moving direction , a guide groove ( not shown ) at a position corresponding to the guide rib 246 is formed on the outside of the second housing 244 . meanwhile , the guide rib 246 is formed on the outside of the second housing 244 , and it is possible to form the guide groove on the inside of the first housing 242 . further , the center of the first housing 242 and the push - button 310 are punched to enable the rod ( 249 ) to pass . therefore , the first housing 242 and the push - button 310 is able to slide downward without interference along with the rod 249 when pressurizing the push - button 310 . on the other hand , the dust transferred through the collecting unit 220 when operating the vacuum cleaner is stacked while rotating in the dust collecting unit 240 formed above . further , when the dust is stacked in the dust collecting unit 240 , a user operates the foreign material discharge means 300 so as to discharge the dust . the foreign material discharge means 300 forces the air to flow into the portion in which the dust is not easily discharged in the dust collecting unit 240 , that is , the corner such as a contact portion between the second housing 244 and the collecting unit 220 , thereby easily discharging the dust in the dust collecting unit 240 . to this end , first , the dust collecting unit 240 is formed with a second vent 243 punched near the top of the collecting unit 220 in the bottom of the second housing 244 , and the second vent 243 is disposed so that the outer air is introduced into the inside of the second housing 244 . further , a first vent 241 punched at the position higher than the position of the second vent 243 is formed in the first housing 242 , and the push - button 310 is disposed at the top of the first housing 242 so that first vent 241 and the second vent 243 may be selectively communicated to enable the external pressure to be transferred into the first housing 242 . further , when an external pressure applied to the push - button 310 is released for the foreign material discharge means 300 , the push - button 310 and the first housing 242 returns to its initial position . an elastic member 320 is inserted into the rod 249 to elastically support a space between the first housing 242 and the second housing 244 so that the outer air is not introduced into the inside of the second housing 244 through the first vent 241 and the second vent 243 . therefore , when discharging the dust from the inside of the dust collecting unit 240 , that is , the inside of the second housing 244 , after the operation of the vacuum cleaner is stopped , the user presses the push - button 310 . then , when the first housing 242 is sliding - moving downward , the second vent 243 formed in the second housing 244 and the first vent 241 of the first housing 242 are communicated with each other , and the air is introduced into the inside of the second housing 244 . that is , when stopping the vacuum cleaner , there is some degree of vacuum pressure on the inside of the suction nozzle 100 . when the first vent 241 and the second vent 243 are communicated with each other by pressing the push - button 310 , the outer air is rapidly introduced into the inside of the second housing 244 . further , the introduced air is introduced into the top of the collecting unit 220 , that is , the inside of the second housing 244 and therefore , the dust remaining in the corner is removed by the introduced air . the removed air falls through opened top of the collecting unit 220 . on the other hand , the discharge unit 260 guiding the discharge of the air circulating the dust collecting unit 240 and a filth is also disposed at the bottom of the collecting unit 220 . as shown in fig5 , the discharge unit 260 is formed of shape of a fence projecting with a predetermined height from the bottom of the collecting unit 220 and includes the discharge port 262 , in which one side of the discharge unit 260 is opened , discharging the air introduced into the discharge unit 260 into the outside of the collecting unit 220 on the other hand , the discharge unit 260 has a side with slant to be connected with the collecting unit 220 at the opened one side , is projected exteriorly with fixed length from the one surface of the slanted discharge unit 260 and includes the discharge port 262 opened from the projected portion to the slanted side ( refer to fig6 ). therefore , the air and the dust passing through the dust collecting unit 240 may be smoothly guided and discharged by the discharge unit 260 and the discharge port 262 formed at the same . that is , when operating the vacuum cleaner , the portion of the air and the dust introduced through the suction nozzle 100 is introduced into the inside of the dust collecting unit 240 through the collecting unit 220 , and the rotating condition of the dust introduced into the inside of the dust collecting unit 240 is exposed into the outside of the dust collecting unit 240 . the user checks the amount of dust exposed into the outside of the dust collecting unit 240 , determines time empting the dust of the dust collecting unit 240 , and presses the push - button 310 when empting the dust . when the user presses the push - button 310 , the push - button 310 and the first hosing 242 connected to the same move downward to allow the first vent 241 and the second vent 243 to position on the same line . then , the second vent 243 is opened and the dust stacked at its inside is removed by introducing the outer air into the inside of the second hosing 244 . further , when the user presses the push - button 310 , the elastic member 320 is compressed . when the pressure applied to the push - button 310 is released , the push - button 310 and the first housing 242 move upward by the elastic member 320 . then , the second vent 243 that has been communicated is shielded . on the other hand , a cone 270 ( refer to fig7 ) forming a cyclone flowing of the introduced air is also disposed at the inside of the visualization device for dust collecting 200 according to the closure . fig7 shows the condition in which the dust of the inside of the visualization device for dust collection of the vacuum cleaner according to another embodiment of the disclosure is removed . as shown , a cone 270 forming the cyclone flowing is also disposed at the top of the collecting unit 220 according to above - described embodiment of another embodiment of the disclosure . in addition , the position of the second vent 243 formed in the second housing 244 is disposed at the bottom side of the cone 270 according to above - described embodiment and the first vent 241 of the first housing 242 is formed to be positioned at the position higher than the position of the second vent 243 . since other remaining configuration is the same as the above - described embodiment , the detailed description will be omitted . when operating the vacuum cleaner according to another embodiment configured above , the rotation of the dust and the air introduced through the collecting unit 220 is more smoothly performed by the cone 270 to separate the dust among the air , thereby collecting the separated dust into the dust collecting unit , that is , the inside of the second housing 244 . if the user press the push - button 310 under the same condition as above , the first vent 241 moving downward by the pressure applied to the second vent 243 disposed at the bottom of the cone 270 , and the push - button 310 is communicated to introduce the air . the introduced outer air transfers the dust along with the top of the cone 270 from the bottom of the cone 270 so as to discharge into the center of the cone 270 , such that the dust of the inside of the dust collecting unit 240 is removed more efficiently . on the other hand , the visualization device for dust collection 200 according to the disclosure may be configured as another type . fig8 shows a detailed configuration for the visualization device for dust collection of the vacuum cleaner according to an exemplary embodiment of the disclosure . fig9 shows the condition that a push - button is pressed in the fig8 . as shown in these drawings , the dust collecting unit 240 is configured as type different from above - described embodiment according to another embodiment of the disclosure . in the dust collecting unit 240 according to another embodiment of the disclosure , the first housing 242 forming the shape is fastened to the collecting unit 220 . further , the second housing 244 is sliding - movably disposed vertically at the inside of the first housing 242 by the foreign material discharge means 300 to be described below and the outer air is introduced into the inside of the second housing 244 to discharge the collected dust . in detail , the foreign material discharge means 300 includes the first vent 241 and the second vent 243 formed in the first housing 242 and the second housing 244 , respectively , and the push - button 310 and the elastic member 320 sliding - moving the second housing 244 so that the first vent 241 and the second vent 243 are communicated with each other . the first vent 241 , formed in the first housing 242 , is formed in the top of the collecting unit 220 and the portion in which the first housing 242 is fastened . in addition , the second vent 243 , formed in the second housing 244 , is formed in the position higher than the position of the first vent 241 . further , the push - button 310 penetrates the top of the first housing 242 to contact the second housing 244 . therefore , when the user presses the push - button 310 , the second housing 244 is pressurized by the push - button 310 , thereby sliding - moving . further , the elastic member 320 is disposed at the bottom of the second housing 244 so that the second housing 244 moves downward by the push - button 310 and then may return to its initial position . the elastic member 320 may be configured in a type of a pocket spring and a number of the elastic member 320 may be disposed to support at least two spots of the second housing 244 . on the other hand , although not shown , in another embodiment of the disclosure , the cone 270 shown in fig7 is disposed at the top of the collecting unit 220 , and the first vent 241 and the second vent 243 may be disposed at the bottom side of the cone 270 . fig1 shows a detailed configuration for the visualization device for dust collection of the vacuum cleaner according to another exemplary embodiment of the disclosure and fig1 is an exploded perspective view of fig1 . as shown in these drawings , in another embodiment of the disclosure , the dust collecting unit 240 to be fastened to the collecting unit 220 is formed of a housing . a number of a suction hole 290 are formed in the top of the dust collecting unit 240 so that the outer air may be introduced into the inside of the dust collecting unit 240 . the top of the dust collecting unit 240 has a diameter narrower than that of the bottom thereof , the top of the dust collecting unit 240 is selectively shielded by the foreign material discharge means 300 to be described below , and therefore , the introduction of the outer air discharging the dust into the inside of the dust collecting unit 240 may be performed if necessary . the foreign material discharge means 300 includes the suction hole 290 , a shield member 340 sliding - moving in the inside of the dust collecting unit 240 and shielding the top having narrow diameter of the dust collecting unit 240 , the push - button 310 and the elastic member 320 sliding — moving the shield member 340 , and a discharge guide 360 disposed at the bottom of the shield member 340 and guiding the flowing of the introduced air . in detail , in the push - button 310 , the top thereof is exposed to the outside of the dust collecting unit 240 and the portion of the bottom thereof is mounted to penetrate the center of the dust collecting unit 240 further , the shield member 340 is mounted in the bottom of the push - button 310 positioned at the inside of the dust collecting unit 240 to be sled together with the push - button 310 . in addition , the elastic member 320 is disposed between the push - button 310 and the dust collecting unit 240 and elastically compressed when pressurizing the push - button . then , the elastic member 320 is elastically restored when pressure - releasing to enable the push - button 310 to return to its initial position . as shown , the diameter of the shield member 340 is smaller as it goes from the bottom thereof to the top thereof . the bottom thereof contacts the inside wall of the top of the dust collecting unit 240 to shield the suction hole 290 on the other hand , the discharge guide 360 is extended toward the bottom , that is , combination portion of the top of the collecting unit 220 and the dust collecting unit 240 to be lined up with the inside wall of the dust collecting unit 240 at the position slightly spaced inward from a edge of the shield member 340 accordingly , when the push - button 310 is pressurized and the suction hole 290 is opened while sliding — moving the shield member 340 , the outer air introduced through the suction hole 290 is guided to the space of the discharge guide 360 and the inside wall of the dust collecting unit 240 to be supplied toward the combination portion of the top of the collecting unit 220 and the dust collecting unit 240 , thereby easily removing the dust positioned at the corner of the inside of the dust collecting unit 240 . on the other hand , a cone 270 ( refer to fig1 ) forming a cyclone flowing is also disposed at the inside of the dust collecting unit 240 as above - described embodiment according to another embodiment of the disclosure configured as above . fig1 shows the condition in which the dusts are discharged in another exemplary embodiment of the disclosure . the configuration of fig1 is the same configuration as the configuration of embodiment shown in fig1 and fig1 according to another embodiment of the disclosure but the cone 270 is further disposed at the inside of the dust collecting unit 240 . the dust and the air introduced through the collecting unit 220 is separated while being subjected to the cyclone flowing by the cone 270 . the separated dust is collected into the inside of the dust collecting unit 240 and the collected dust is exposed to the outside through transparent dust collecting unit 240 , such that the user may check the suction condition of the dust . further , when a great deal of dust is collected into the inside of the dust collecting unit 240 , the user presses the push - button 310 . at this time , the discharge guide 360 extended toward the bottom of the cone 270 from the one side of the shield member 340 guides the air introduced into the inside of the dust collecting unit 240 to the bottom of the cone 270 , such that the air moves along with the outside from the bottom of the cone 270 to remove and discharge the dust ( refer to drawing on the right of fig1 ).	0
the following definitions and explanations provide background information pertaining to the technical field of the present invention , and are intended to facilitate the understanding of the present invention without limiting its scope : api : application program interface , a language and message format used by an application program to communicate with the operating system or some other control program such as a database management system ( dbms ) or communications protocol . c / c ++: c is a high - level programming language that is able to manipulate the computer at a low level like assembly language . c ++ is an object - oriented version of c that has been widely used to develop enterprise and commercial applications . c and c ++ are written as a series of functions that call each other for processing . the body of the program is a function named “ main .” functions are flexible , allowing programmers to choose from the standard library that comes with the compiler , to use third party libraries or to develop their own libraries . fig1 illustrates an exemplary content management system 100 comprising a memory management functions system 10 installed in a library server or a compiler 15 . in addition , content management system 100 comprises resource manager 20 and application programming interface 35 . the memory management functions system 10 includes a software programming code or computer program product that is typically embedded within , or installed on a computer . a client computer 25 including a client application 30 , is coupled to content management system 100 via the application program interface ( api ) 35 . upon receipt of a call for any one or more of the following functions : malloc , free , calloc , or realloc , these calls are replaced by a compiler with new corresponding functions in the memory management functions system 10 . the new functions are denoted with a prefix icm , to distinguish them from the corresponding original function . as an example , the commands used to replace each of these four functions are listed below : icmmalloc ( file , line , size , . . . ), wherein malloc is replaced with icmmalloc . icmcalloc ( file , line , size , . . . ), wherein calloc is replaced with icmcalloc . the library server 15 builds a table 205 of all the allocated memory , as exemplified by fig2 . when icmmalloc is called , the library server 15 records the function name 210 that called icmmalloc in addition to the line number 215 , the allocated size 220 , and the actual address 225 of the memory . an exemplary record 230 , where the function that called malloc was “ logon ”, at line 1085 , requesting 128 bytes , at address ox145732 . in actual performance , table 205 that is created by the library server 15 , may contain several hundreds or thousands of records . in addition , in a preferred embodiment , the memory management functions system 10 inserts an index 235 stored at the beginning of the memory block . the index 235 could represent a row number of the record 235 . this feature of the memory management functions system 10 allows faster access of memory records . for example , in a situation where table 205 contains thousands of records , and the free function is called , conventionally , the only information that would be passed to the free function was the address . this required the free function to search each line ( or record , e . g ., record 230 ) for the address , slowing down the overall systemic performance . the memory management functions system 10 of the present invention adds 8 bytes to each memory block 300 reserved by icmmalloc , as shown by fig3 and 6 . of these 8 bytes , 4 bytes are allocated for the size record 305 , and the other 4 bytes are allocated for the table index 235 in an index record 310 . when used with a 64 bit operating system , the address field will be extended to 8 bytes . when the free function is called , the index value is extracted and used to find the record in the table in fig2 , e . g ., record 230 . in a situation where memory is freed , system 10 initializes the size 220 and the address 225 to zero , but leaves the index record 230 intact , until the application is exited . in addition , the memory at the location specified in the call to free is returned to the operating system . the record 230 may be used to record a reference to allocated memory by a future call to malloc or callod . when the application is exited , the library server 15 frees the table in fig2 . if tracing has been requested , the library server 15 then records in the system log the call to the free function and the address that was freed . the calloc function is replaced with icmcalloc by library server 15 . icmcalloc is generally similar to icmmalloc , except that it initializes the memory at address 225 to zero . as for the icmmalloc function , library server 15 then adds a record to the table 205 . the realloc function is replaced with the icmrealloc function by library server 15 . icmrealloc reallocates memory at the specified address 225 , adding memory to that address 225 . for example , a prior call may have allocated 100 bytes to address a : icmrealloc is used to increase the memory at address a to , for example , 500 bytes : primarily , two memory errors occur with the use of the free function . the first error occurs if the programmer forgets to add a free function call to free memory allocated by a malloc function call . the second memory error occurs if the programmer attempts to free memory at an address which has not been allocated , or which has allready been freed . the memory management functions system 10 addresses the first memory error by adding memory management functionality to functions such as exit server function , as illustrated by process 400 of fig4 . a memory leak occurs if memory is allocated by a malloc or icmmalloc call but not released by a free call . a function of the library server 15 such as logon is called at block 405 . the function logon calls the malloc function at block 410 . the compiler replaces the malloc ( size ) function with an icmmalloc ( size ) function , and allocates a block of memory to the requested size . in this example , several functions are called subsequent to the malloc call at block 410 . the user program then calls the free ( address ) function at block 415 . in response , the library server 15 calls icmfree ( address ) function , and frees the memory at the specified address . several functions are called subsequent to the free call at block 415 . the user program then calls a function that requests memory , such as the malloc ( size ) function at block 420 . the library server 15 calls icmmalloc ( size , . . . ) function , and allocates a block of memory of the requested size . several functions are called subsequent to the malloc function ( block 420 ). the user program then calls an exit server function , such as the icm exit server function , to exit the program . since the memory allocated at block 420 has not been freed , this would create a memory leak as shown by block 430 . the memory management functions system 10 adds new functionality to the exit server function ( block 425 ). the icm exit server function ( block 425 ) reads table 205 of the allocated memory , and reports any leak , that is memory which has been allocated by not freed , to the library server log with an appropriate message . the icm exit server function ( block 425 ) then frees the memory to eliminate the memory leak ( block 430 ). the icm exit server function at block 425 , provides a parity or error check for the call functions , such as the four exemplary functions discussed herein , reporting memory leaks to the library server 15 under many different conditions . the library server 15 , in turn , records these error messages in the library server log . however , in the present exemplary scenario , the programmer may forget to add the function icm exit server to the programming code . this error could potentially cripple the ability of the library server 15 in conjunction with the memory management functions system 10 to capture and record memory errors within the program . to solve this problem , additional functionality is added to predetermined stored procedures such as “ create doc ”. when these predetermined stored procedures are called , the library server 15 accesses a static variable which contains the address of the memory management table . if that variable contains a valid address , then a message such as “ logon did not exit normally ” to the library server log . this enables the programmer to identify and correct the error and free the memory in the programming code . with reference to fig5 , additional functionality has been added to the stored procedures for a method 500 to check for memory leaks that may have occurred while a program is operating . when the exit server ( icmexitserver ) function is called at block 544 , method 500 sets the index to zero , and checks each allocation record 230 . if the address 225 at the record ( index ) is not zero , then the memory at that location is determined at block 548 not to have been freed . the library server 15 writes an appropriate error message to the library server log for the programmer to use in locating the source of the memory leak and frees the memory , thus preventing the memory leak . the functionality of the memory management functions system 10 provides a powerful debugging feature for programmers . on occasion , a programmer may accidentally attempt to store more data in a memory block than the memory block will hold . this error is very difficult to find , especially in programs written in c / c ++. for debugging purposes , the system administrator can configure library server so that the icmmalloc function will allocate additional memory in a “ barrier ”. in this situation , an icmmalloc function call allocates memory as shown in fig6 . the memory block 600 now contains additional memory in the form of a memory barrier 605 . as before , the memory block 600 also contains the size 305 , index 310 , and allocated memory 315 . the barrier 605 is set to a recognizable value , and is allocated , for example , 256 bytes . the programmer then runs the program as before . if the program attempts to store more data in the memory block than is allocated , the data spills over into the barrier 605 , overwriting the barrier 605 . on every call to one of the memory management functions , this barrier 605 is checked to see if any bytes have been changed . if so , an error message is written to the server log . the developer will know that the error was caused between the two previous records written to the log . this technique is generally reserved for debugging , as it could become relatively expensive in terms of memory and processing time . a method of operation 700 of memory management functions system 10 using barriers during a program debugging operation is illustrated in the process flow chart of fig7 . at block 705 , method 700 inquires if memory debug has been configured by the system administrator . if it has , method 700 allocates memory at block 725 . in this embodiment , the memory that is allocated , or needed is equal to the memory size that is requested plus 8 bytes plus 256 bytes , as shown in fig6 . method 700 then initializes a barrier 605 at block 730 . if at decision block 705 method 700 determines that memory debug has not been configured , it allocates memory at block 715 . in this embodiment , the memory that is allocated , or needed is equal to the memory size that is requested plus 8 bytes , as shown in fig3 . method 700 then stores , at block 735 , the calling function name , the line number , the size , and the address in a table . size is stored at the beginning of the memory ; the index is stored at the beginning of the memory plus 4 bytes ; and the address is set to return as the beginning memory plus 8 bytes . method 700 then returns to the calling function at block 740 . it is to be understood that the specific embodiments of the invention that have been described are merely illustrative of certain application of the principle of the present invention . numerous modifications may be made to the system and method for memory detecting memory management programming errors invention described herein without departing from the spirit and scope of the present invention .	6
a nozzle for uniform spray onto the filters , being positioned on the upper part of the chamber ; means for the supply of solution into the chamber , being positioned on the upper part of the chamber ; means for vacuumizing by which driving force is exerted for the solution to pass through the filter . in the aerosol generator , the means for the supply of solution may further comprise means for controlling flow rate of the solution , and the means for vacuumizing may further comprise a trap of liquid nitrogen so as to collect liquid . also , a ceramic filter such as glass , metal and alumina , etc . or polymeric filter having an average pore size of 20 to 30 μm which is prepared by sintering uniform and fine particles , may be employed as the multiporous filter , and , a pneumatic nozzle and vacuum pump are preferably employed as the nozzle and the means for vacuumizing , respectively . apparatus producing ultrafine particles of the invention which is equipped with the aerosol generator comprises : an aerosol generator equipped with a chamber having a multiporous filter , nozzle , and means for the supply of solution and air , so as to generate droplets ; a pyrogenetic reactor to dry and pyrolyze droplets produced by the aerosol generator to give ultrafine particles ; an ultrafine particle collector to collect the ultrafine particles obtained by the pyrogenetic reactor ; and , means for vacuumizing by which driving force is exerted for the solution to pass the filter and for droplets to pass the pyrogenetic reactor . in the apparatus producing ultrafine particles , the conventional furnace may be employed as the pyrogenetic reactor and the pyrogenetic reactor may further comprises means for controlling the environment of inside of the reactor , and the particle collector conventionally used in the art may be employed as the ultrafine particle collector . the aerosol generator and apparatus of the present invention is explained in detail with references on the accompanying drawings , which should not be taken to limit the scope of the invention . referring to fig1 a schematic diagram depicting the aerosol generator of the invention is provided . as can be seen in fig1 the aerosol generator comprises chambers ( 2 ) having multiporous filters ( 1 ) to generate droplets ; nozzles ( 3 ) for uniform spray of solution onto the filters ( 1 ), being positioned on the upper part of the chambers ( 2 ); means ( 4 ) for the supply of solution into the chambers ( 2 ), being positioned on the upper part of the chambers ( 2 ); means ( 5 ) for the supply of air into the nozzles ( 3 ); and , means ( 6 ) for vacuumizing by which driving force is exerted for the solutions to pass the filters ( l ). in this connection , the means ( 4 ) for the supply of solution may further comprise means ( 7 ) for controlling flow rate of the solution being supplied , and the means ( 6 ) for vacuumizing may further comprise a trap ( 8 ) of liquid nitrogen for collection of liquid so as to prevent the influx of liquid . and , a pressure gauge ( 9 ) to measure the degree of vacuum inside the aerosol generator is positioned in the aerosol generator . a glass filter whose average pore size is 25 μm and thickness is about 5 mm , which is prepared by sintering uniform and fine glass particles , is perferably employed as the multiporous filter . in the aerosol generator , solution containing a solute is provided from the means ( 4 ) for the supply of the solution through the nozzles ( 3 ) which are connected to the means ( 5 ) for the supply of air , and sprayed onto the multiporous filters ( l ) while maintaining the inside of the aerosol generator at a pressure of 60 torr employing the vacuumizing means ( 6 ). thus , thin layer of the solution is formed on the pore wall of the multiporous filters ( l ), which is , in turn , moved to the lower part of the filters ( l ) through pores of the filters ( l ) by the aid of a carrier gas , i . e ., air . then , the solution and air expand simultaneously at the bottom of the filters ( l ), and a number of droplets of fine size are produced from the numerous pores . since the aerosol generator produces droplets by expansion of the solution through the multiporous filters ( l ), the aerosol generator of the invention is named ` filter expansion aerosol generator ( feag )`. the size of droplets produced by the aerosol generator depends entirely on the size of the pores of the filter ( l ), it can be modulated by the variation of pore size of the filter ( l ). also , a quantity of droplets thus produced can be simply regulated by controlling the flow rate of the solution being supplied by the aid of the means ( 7 ) for controlling flow rate of the solution connected with the means ( 4 ) for the supply of the solution , and by controlling the pressure inside the aerosol generator by the aid of the means ( 6 ) for vacuumizing . according to the aerosol generator of the invention , droplets of about 2 μm size are produced at 60 torr , and the droplets can be produced in large quantity even at 400 torr which is close to atmospheric pressure . as the inside of aerosol generator is maintained at the lower pressure , and as the size of the multiporous filter ( 1 ) becomes larger , the higer production of droplets can be achieved . accordingly , apparatus of high capacity to generate droplets massively , can be easily fabricated by increasing the sizes of the means ( 6 ) for vacuumizing and the multiporous filter ( 1 ). moreover , the aerosol generator of the invention can produce droplets employing various solutions such as aqueous and alcoholic solution , etc ., while the conventional ultrasonic spray apparatus have limitations in the production of droplets owing to surface tension of solution . since the aerosol generator of the invention can produce a large number of droplets even under a low pressure , it can be used effectively in the manufacture of thin layer and the aerosol etching which are carried out under a low pressure . referring to fig2 a schematic diagram depicting an apparatus producing ultrafine particles of the invention which is equipped with the aerosol generator , is provided . as can be seen in fig2 the apparatus producing ultrafine particles of the invention comprises an aerosol generator ( 15 ) equipped with two chambers each of which have a multiporous filter ( 11 ), nozzles ( 12 ), and means ( 13 , 14 ) for the supply of solution and air , so as to generate droplets ; a pyrogenetic reactor ( 16 ) to dry and pyrolyze the droplets produced by the aerosol generator ( 15 ); an ultrafine particle collector ( 17 ) to collect the ultrafine particles prepared by the pyrogenetic reactor ( 16 ); and , means ( 18 ) for vacuumizing by which driving force is exerted for the solution to pass the filters ( 11 ) and for droplets to pass the pyrogenetic reactor ( 16 ). in the apparatus producing ultrafine particles of the invention , droplets containing a solute which is produced by the aerosol generator ( 16 ), pass through the pyrogenetic reactor ( 16 ) to be dried , pyrolyzed , and transformed into ultrafine particles . ultrafine particles thus produced are collected by the ultrafine particle collector ( 17 ). if necessary , environment of nitrogen or inert gas , etc . is provided in the pyrogenetic reactor ( 16 ) by the aid of the means ( not shown ) for controlling environment of the reactor . the apparatus producing ultrafine particles of the invention can easily generate particles of submicron size which comprise : monocomposite oxide such as zno , mn 3 o 4 , cuo , pbo and nio ; metal particles such as ag , ni , cu , pd and au ; multicomposite particles such as yba 2 cu 3 o 7 , batio 3 , srtio 3 , bst and pzt ; and , sulfide particles such as zns and cds . for example , according to the apparatus of the invention , droplets of 2 . 1 μm size can be obtained from 0 . 2 mol / l of aluminum sulfate solution at a condition of 800 ° c . and 60 torr , and the alumina ultrafine particles thus produced have a size of 0 . 37 μm and the degree of dispersion of 1 . 76 . in this connection , as the inside of aerosol generator is maintained at the lower pressure , the higer production of droplets can be achieved , and a large number of droplets can be generated even under a relatively high pressure of 400 torr . also , as the size of the filter becomes larger , the higer production of droplets can be achieved . further , according to the apparatus producing ultrafine particles of the invention , ultrafine particles of nanometer size containing zno , mn 3 o 4 , pdo and cuo particles can be produced from 0 . 1 mol / l zinc acetate , manganese acetate , palladium nitrate , and copper nitrate solution , respectively . production of these ultrafine particles of nanometer size results from the disintegration of large particles in nanophase by the exertion of gas pressure , after the particles are dried at a high temperature and pyrolyzed . compared with the conventional spray pyrolysis were ultrafine particles of nanometer size can be produced by the disintegration of large particles , only when the solution containing specific solutes causing exothermic reaction is employed , the present invention can produce incohesive ultrafine particles of nanometer size employing both acetate and nitrate solutions which cause exothermic and endothermic reaction , respectively . moreover , according to the apparatus producing ultrafine particles of the invention , multicomposite particles of submicron size such as superconductor or superdielectric substance of yba 2 cu 3 o 7 , batio 3 , and srtio 3 can be produced from yttrium nitrate , barium nitrate , strontium nitrate , and copper nitrate solutions . the apparatus can also produce highly crystallized ultrafine particles of multicomponents even under a low temperature . finally , according to the apparatus of the invention , pure silver ( ag ) crystal particles of submicron size can be produced from silver nitrate solution at over 700 ° c . in the environment of nitrogen and air . as the concentration of silver nitrate increased from 0 . 004 to 0 . 5 mol / l , average size of produced silver particles become increased from 0 . 22 to 0 . 72 μm . also , as the concentration of the solution becomes lowered , the more silver particles of uniform size distribution is produced . and , silver particles whose size and distribution are large and broad , can be produced at a high temperature . the apparatus producing ultrafine particles of the invention generates non - cohesive ultrafine particles of nanometer size even under a condition in which only cohesive particles are generated by the conventional apparatus . this advantage results from the steps of generating droplets under a low pressure and pyrolyzing them , which has a distinction over the conventional apparatuses . moreover , the ultrafine particles produced by the apparatus have a high degree of crystallization and large surface area . the aerosol generator of the invention can be used in the apparatus for the manufacture of thin layer of zno , pzt , bst , and yba 2 cu 3 o 7 on the substrate employed in semiconductor , and in the aerosol etching apparatus for a substrate etching , in addition to the apparatus producing ultrafine particles of the invention . as clearly illustrated and demonstrated above , the present invention provides an aerosol generator and an apparatus producing ultrafine particles equipped with the aerosol generator . the aerosol generator of the invention can produce a large number of fine droplets even under a low pressure , control the size of droplets , thus , can be used effectively in the apparatus for production of ultrafine particles , preparation of thin layers , and aerosol etching . also , the apparatus of the invention produces ultrafine particles of submicron size which is not cohesive , and has a high degree of crystallization and large surface area , employing various solutes which can be decomposed by both exothermic and endothermic reactions .	8
fig1 illustrates an exemplary human - wearable recall device . a wearer 100 is shown wearing a recall device 102 on a necklace . it should be understood , however , that a wearer need not be human , but that animals , vehicles , and other objects may wear a recall device for the purpose of selectively recording monitored environmental conditions . an exploded view of the recall device 102 is shown in box 104 . a camera 106 , which may include a fish - eye lens , a wide angle lens , or any other kind of lens , is positioned in the center of the recall device 102 , although the camera 106 may be positioned at other locations in the recall device 102 . four light emitting diodes ( leds ) are shown on the face of the recall device 102 . led 108 signals detection of an audio capture condition , such as an increase in detected audio level over a given threshold or a substantial change in average audio level within a given period . led 110 signals detection of a motion capture condition , such as a detected change of angle of greater than a threshold ( e . g ., 200 °). led 112 signals detection of a light level capture condition , such as a substantial change in average light level within a given period or an increase in detected light level over a given threshold . led 114 signals detection of a temperature capture condition , such as an increase in detected ambient temperature level over a given threshold or a substantial change in ambient temperature level within a given period . other capture conditions than those listed above may alternatively be employed . a serial port 116 is shown in the recall device 102 to download data monitored by the recall device 102 to a computer system . recorded data from various in the recall device 102 is saved into memory in the recall device 102 . such data may also be downloaded via the serial port 116 to a more substantial computer system , such as a desktop computer , for subsequent analysis ( e . g ., using a microsoft excel spreadsheet application or other analysis tools ). internal settings , such as condition parameters , time settings , etc ., may also be uploaded to the recall device 102 via the serial port . a wireless transceiver ( not shown ) is coupled to an antenna running up the cord 118 . the wireless transceiver may be used to upload and download data as well as to interface with wireless networking protocols , such as wi - fi and bluetooth , and to detect radio frequency signals . fig2 illustrates an internal plan view 200 and an external perspective view 202 of an exemplary recall device . specific components of exemplary recall devices are described herein ; however , it should be understood that other components may be employed in other implementations of a recall device . a microcontroller ( not shown ) is mounted to the underside of the printed circuit ( pc ) board 204 . in one implementation , a microchip 20 mhz pic16f876 microcontroller is used . a camera 206 and lens 208 are operably connected to the pc board 204 of the recall device . in one implementation , a 50 mm × 30 mm × 14mm sipix snap 300 kpixel camera module with an additional f2 , f2 . 2 , mm lens from edmunds optics is employed . in an alternative configuration , a philips key008 camera is employed with an added 2 . 9 mm lens from edmunds optics . an interface to the shutter and mode controls of the camera are provided by reed relays , although other switching elements , such as optical mosfet transistors , may alternatively be employed . an accelerometer 210 is mounted to the pc board 204 . in the illustrated implementation , a single dual axis +/− 10 g adxl210 accelerometer from analog devices is employed . in alterative implementations , multiple multi - axis or single axis accelerometers may be employed . for example , individual single axis accelerometers may be configured to detect acceleration in each of three axes ( x , y , and z ). in an alternative implementation , the 3 axes are designated as roll , pitch and yaw , and a gyroscope is used to detect yaw ( rotational acceleration ). a light level sensor 212 mounted to the pc board 204 . in one implementation , a digital ambient light level sensor from taos , inc ., such as the tcs230 , is employed to detect magnitudes of and changes in ambient light levels in experienced by the recall device and , therefore , by the wearer . a change in ambient light level represents an exemplary capture condition that can indicate movement of the wearer from one room to another or from inside to outside . in addition , a change in ambient light level may be imitated by a gesture , such as waving one &# 39 ; s hand across the recall device to create a shadow on the light level sensor . as such , an image capture may be triggered by the wearer &# 39 ; s gestures without requiring the wearer to actually touching a trigger switch on the recall device . in one such implementation , the delay between detection of the capture event and the triggering of the image capture is prolonged at least as long as a predefined delay period in order to allow proper aiming of the camera at a target . an ambient temperature sensor ( not shown ) is mounted to the pc board 204 . in one implementation , a national semiconductor lm75 sensor is employed to detect magnitudes and changes in ambient temperature levels experienced by the recall device . a change in ambient light level represents an exemplary capture condition that can indicate , for example , movement of the wearer from inside to outside . a serial bus port 214 is mounted to the pc board 204 . in one implementation , a universal serial bus interface is employed , although other serial ports , such as an rs - 232 interface or irda interface , or any other data port , may be employed . the serial bus port ( or other interface ) may be used to upload and download data to / from the recall device . leds 216 indicate detection of various capture events , as discussed with regard to fig1 . fig3 illustrates a schematic of components 300 in an exemplary recall device . a microcontroller 302 is coupled to control a camera 304 using a shutter control line 306 and a mode control line 308 . a signal issued by the microcontroller 302 on the shutter control line 306 triggers an image capture in the camera 304 . a signal issued by the microcontroller 302 on the mode control line 308 sets the camera in high resolution mode , low resolution , or triggers an erasure of a captured image . a lens 310 , such as a normal lens , a wide angle lens , or a fish eye lens , is connected to the camera 304 . a battery 312 , such as a nimh aa 1 . 5 volt battery , powers the illustrated recall device , including the camera 304 . a step - up circuit 314 increases the voltage provided by the battery 312 to 3 . 7 volts to power the microcontroller 302 and other components on the pc board . an i 2 c bus 316 connects a memory block 318 to the microcontroller 302 . the memory block 318 may be used to store logged sensor data and captured images and sound . in one implementation , two 128 kbyte flash memory chips ( microchip 24lc512 ) are employed . in an alternative implementation , a larger and possibly removable memory modules , such as an sd or mmc card , can be connected will allow up to 1 gbyte of storage . a real time clock chip 320 ( dallas / maxim ) and an ambient temperature sensor 322 ( national semiconductor lm75 ) also connected to the microcontroller 302 by the i 2 c bus 316 . at least one accelerometer 324 is connected to the microcontroller 302 to detected changes in location and movement . in the illustrated implementation , three single axis accelerometers 326 are employed , one for each axis ( x , y , and z ). a serial bus interface 328 , such as a usb or rs - 232 interface , is connected to the microcontroller 302 to allow uploading and downloading of data . an audio recording circuit 330 is also connected to the microcontroller 302 to record ambient sound . in one implementation , the audio recording circuit 330 can record continuously for a period of time , although in other implementations , the audio recording circuit 330 is triggered to record in response to detection of a capture condition . a digital light level sensor 332 is connected to the microcontroller 302 to detect light level capture conditions . an rf transceiver 334 and an antenna 336 are connected to the microcontroller to provide or detect wi - fi signal communications , to detect rfid transponders , and / or to detect rf signals . in one implementation , a 433 mhz transceiver is employed . in another implementation , a 2 . 4 ghz radio receiver is employed to detect wireless networks . if the recall device is brought into proximity of a computer having wireless communication capabilities , the recall device can access and transfer images , audio , and other sensor data to the computer ( e . g ., using bluetooth or wi - fi ). as such , a remote computer system can be used to provide device settings , such as camera settings , sensor settings , time settings , etc . another user interface mode may be employed in a recall device having a no capacity or limited capacity for switches , buttons , etc . to enable transmission of captured and logged data to a computer system without requiring switches , the camera may be set in a predefined position ( e . g ., face - down on a table ). on power up , one or more accelerometers that detect the predefined position can trigger an automatic download of data to a computer over a wireless network link without any user intervention . other exemplary input components that may be employed for monitoring and logging sensor data , including without limitation a global positioning system ( gps ) transceiver ( e . g ., a gps transceiver from garmin geko with 10 m resolution and geographic location , altitude , and compass direction detection ), a heart rate monitor ( e . g ., a polar monitor ), a video camera , a gyroscope for detecting rotational conditions ( e . g ., adxrs gyroscope from analog devices ), a chemical sensor ( e . g ., a figaro carbon monoxide sensor or a smoke detector ), a reverse - biased led providing a crude optical motion detection based on ambient light changes , and a passive infrared radiation detector ( e . g ., a seiko passive infrared temperature detector ) for detecting humans up to 2 . 5 m from the wearer . other exemplary capture conditions may be satisfied by a change in sound level , a change in light level , a change in motion ( e . g ., as detected by an accelerometer or gyroscope ), a change in heart rate , a change in ambient temperature or the wear &# 39 ; s body temperature , a change in chemical composition of local environment ( e . g ., air ), detection of a wi - fi signal , detection of an rfid transponder , or expiration of a real time clock period . the various combinations of these components may be used to selectively capture ambient sound and images based on detection of a potentially interesting condition , marked by detection of a capture condition . in this manner , the selective image and sound capture make more efficient use of storage resources by avoiding continuous capture of uninteresting conditions . fig4 illustrates exemplary operations 400 of a selective image capture process . a monitoring operation 402 monitors motion of a camera using at least one accelerometer . a detecting operation 404 detects an environmental condition experienced by the camera that is designated as a “ capture condition ”. a capture condition indicates that something that has been previously associated with a potentially interesting environmental event has occurred . for example , if movement from one room to another is deemed to be an interesting environmental event , changes in ambient light level may be deemed to indicate that the wearer has moved to a different room . in one implementation , an exemplary detecting operation includes the following steps described in pseudocode : ( 1 ) read ambient light level in lux using tcs230 in current monitoring interval ( 2 ) compare current light level reading with the light level reading from previous monitoring interval ( e . g ., 1 second ago ) ( 3 ) if current reading & lt ; 50 % of previous reading or current reading & gt ; 200 % of previous reading , then indicate capture condition ( 4 ) goto detect 13 light 13 level a purpose of detecting the capture condition is to “ prime ” the triggering of an image capture . however , as the recall device is a wearable device , subject to jitter , the image capture itself is delayed ( i . e ., managed ) until a stable condition is detected by the accelerometer . therefore , a delay operation 406 delays a trigger operation 408 until a stable condition is detected by the accelerometer ( s ). in this manner , the quality ( e . g ., clarity ) of the captured image is expected to be better than an image from an unmanaged image capture . a stable condition is detected when one or more of the accelerometers in the camera detect movement within a predefined range or at or below a predefined threshold . for example , an exemplary recall device may be set to detect a stable condition when all accelerometers sense no movement in their respective axes . however , this setting may severely limit the likelihood of an image capture during periods of otherwise acceptable camera movement , such as when the wearer is standing nearly still . accordingly , the stable condition may be set to less than a threshold degree change in angle ( e . g ., 20 °) of any given accelerometer output during a measurement period ( e . g ., 1 second ). in one implementation , an exemplary delay operation includes the following steps described in pseudocode : ( 5 ) read tilt angle ( s ) of accelerometer ( s ) in current monitoring interval ( 6 ) compare tilt angle ( s ) with tilt angle ( s ) from previous monitoring interval ( e . g ., 1 second ago ) ( 7 ) if any tilt angle difference exceed 20 degrees , goto capture_image ( 8 ) trigger image capture in camera ( 9 ) return after detection of the stable condition , a triggering operation 408 triggers an image capture through the camera module . in alternative implementations , other environmental states may also be captured , including without limitation an audio recording for a given period of time , a gps reading , a real time clock reading , etc . a purpose of the capture events is to establish a snapshot of the environment as it existed in the temporal proximity of a capture condition . thereafter , the captured data may be downloaded to a computer system to facilitate reconstruction of the environmental conditions associated with a potentially relevant event . in another implementation , image capture ( including video capture ) may occur continuously or periodically , even in the absence of a previous capture condition . for example , the recall device detects a stable condition and triggers an image capture to memory . thereafter , a temporally proximate capture condition is detected so the captured image is maintained in association with the subsequent capture condition . if no temporally proximate capture condition is detected , the captured image may be deleted from memory to manage storage space . in this manner , the environmental conditions existing just prior to a capture event may be captured and efficiently recorded . a similar algorithm may be applied to audio recordings and other sensory data . fig5 illustrates exemplary sensor readings 500 relative to image capture events . data 502 indicates readings of an accelerometer associated with the x axis over time . data 504 indicates readings of an accelerometer associated with the y axis over time . ( accelerometer readings in the chart correspond to an angle . for example , in one implementation , an accelerometer signal with amplitude 0 represents 0 degrees , an accelerometer signal with amplitude 90 represents 90 degrees , etc .) data 506 indicates readings of an ambient light level sensor . data 508 indicates image captures triggered by detection of a capture condition followed by detection of a stable condition . as shown at time 510 , a capture condition has been detected based on the dramatic change in the light level data 506 followed by detection of a stable condition , as indicated by both data 502 and 504 . in contrast , at time 512 , a dramatic change in light level data 506 represents a capture condition , but an image capture is delayed until time 514 , when the stable condition is detected with regard to both data 502 and 504 . by managing captures in this manner , images are selectively captured based on detection of a potentially interesting event coupled with a stable period . fig6 illustrates an image 600 captured through a normal lens , an image 602 captured through a fish - eye lens , and a corrected version 604 of the fish - eye image . using commercially available image editing software , an image captured through the fish - eye lens may be corrected to remove the radial distortion introduced by the fish - eye lens . coupling the fish - eye image capture with the correction software allows a wearer to capture a maximum amount of environment in an image and to later remove the radial distortion to obtain a relatively normal image . as such , the use of a fish - eye lens is particularly suited to a recall device which captures images with relatively random alignment with the environment . it should be understood that a variety of data can be logged and downloaded to a computer system for post - processing and / or analysis in order to reconstruct events in the wearer &# 39 ; s recent experience . exemplary outputs of the recall device may include without limitation a continuous audio log ; a sequence of audio snapshots ; a sequence of image snapshots ; a sequence of gps location , altitude , and direction readings ; a motion log ; an ambient temperature log ; a heart rate log ; an rfid detection log ; and a wireless network detection log . furthermore , in applications intended to facilitate memory recall , a technique referred to as “ rapid serial visual presentation ” or rsvp may be employed . rsvp represents the electronic equivalent of riffling a book in order to assess its content , as described in “ rapid serial visual presentation : a space - time trade - off in information presentation ”, oscar de bruijn and robert spence , http :// www . iis . ee . ic . ac . uk /˜ o . debruijn / avi2000 . pdf , may 2000 . using this technique , a user interface , such as on the recall device or on a client computer system to which the captured data is downloaded , can rapidly display the images in the sequence in which they were captured , under direct user control of various factors , including without limitation speed , direction , and the number of simultaneously visible images . such display may be combined with temporally synchronized audio captured by the recall device or other logged data . manufacturers have not put gps features in small portable digital cameras at present due to high battery drain . the adxl210 accelerometer use about 1 / 130th of the power of a gps transceiver when operating ( typically , 0 . 6 ma ) and , therefore , may be used as an efficient power management component . in one implementation , an accelerometer may be used as a power management component for the gps receiver . as gps receiver integrated circuits generally use much current ( e . g . 80 ma ), the batteries powering the system can be drained easily . by periodically sampling the motion read by the accelerometer ( e . g ., every second or so ), the gps can be switched off if there is no movement because no change in gps location has occurred . when movement is detected by the low power accelerometer , the gps system can be switched back on . a similar power management mechanism can be used to power off the camera , which also has a high current drain . other sensor inputs , such as light level sensors , can be used for power saving . for example , a camera need not powered in the presence of total darkness . the embodiments of the invention described herein are implemented as logical steps in one or more computer systems . the logical operations of the present invention are implemented ( 1 ) as a sequence of processor - implemented steps executing in one or more computer systems and ( 2 ) as interconnected machine modules within one or more computer systems . the implementation is a matter of choice , dependent on the performance requirements of the computer system implementing the invention . accordingly , the logical operations making up the embodiments of the invention described herein are referred to variously as operations , steps , objects , or modules . the above specification , examples and data provide a complete description of the structure and use of exemplary embodiments of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .	7
the present invention relates to a chair tilt control arrangement 10 which is designed to be fixedly disposed onto the bottom side 11 of a chair seat 12 , as shown in fig1 . the chair seat of the present invention may be of a resinous moldable material , and would be held by a lower column support 14 , shown in phantom in fig1 extending from a plurality of legs at its base , not shown . the column support 14 would have a forwardly extending arm 16 which is secured to a lower planer portion of the tilt control mechanism 10 . the tilt control mechanism 10 being attached , as aforementioned to the lower side 11 of the molded chair seat 12 . the chair tilt control mechanism 10 comprises an uppermost generally rectilinear top mounting plate 18 , as may be seen in fig1 and 2 . the top mounting plate 18 , has a mounting hole 20 at each corner thereof , for attachment via bolts or rivets or the like , to the molded seat portion 12 of the chair . the top mounting plate 18 , has a bolt opening 24 disposed along the longitudinal center line of the top mounting plate 18 . the bolt opening 24 is arranged within the forwardmost half of the top mounting plate 18 . the tilt control mechanism 10 also includes a lower mounting plate 26 of generally rectilinear configuration , also having a central bolt opening 28 therethrough . the lower mounting plate 26 is fixedly attached to the distal end of the forward support arm 16 , which arm 16 extends from the chair assembly support column 14 . the lower mounting plate 26 is generally parallel to the top mounting plate 18 , when there is no one sitting in the chair seat 12 . a pair of rectangularly shaped resilient blocks 30 and 32 , are disposed between the top mounting plate 18 and the lower mounting plate 26 . the resilient blocks 30 and 32 are formed of compressible rubber material such as neoprene , or the like , and comprise a &# 34 ; forward &# 34 ; resilient block 32 and a &# 34 ; rearward &# 34 ; resilient block 30 . each resilient block 30 and 32 is of the same thickness and of the same width . the forward resilient block 32 has a forward to rearward dimension of about 1 / 3 that of the forward to rearward dimension of the rearward resilient block 30 , as may be seen in the side elevational view of fig1 . preferably , each resilient block 30 and 32 has a top face plate 34 and 34 &# 39 ;, respectively , and a bottom face plate 36 and 36 &# 39 ; respectively , secured thereto . each top face plate 34 and 34 &# 39 ;, of each resilient block 30 and 32 , is fixedly secured as by fusing or adhesive or the like , to each respective resilient block 30 and 32 . the top face plates 34 and 34 &# 39 ; are secured to the top mounting plate 18 , by a plurality of threaded inserts 40 threadedly received therein . the bottom face plates 36 and 36 &# 39 ; and their respective resilient blocks 30 and 32 are secured together as by fusing or adhesives or the like . the lower mounting plate 26 is attached to the bottom face plates 36 and 36 &# 39 ; by a plurality of threaded inserts 42 extending through the lower mounting plate 26 which inserts 42 are threadedly received into the bottom face plates 36 and 36 &# 39 ;. in an alternative embodiment , each resilient block 30 and 32 may be comprised of a plurality of smaller blocks of circular or polygonal peripheral configuration , not shown , of similar thickness , but of different radii or side dimensions . the smaller blocks would be collectively attached between a pair of plates in a manner similar to each of the pair of resilient blocks 30 and 32 aforementioned . in the preferred embodiment , the forward and rearward resilient blocks 30 and 32 are spaced apart from one another by a gap 44 of about 1 / 8 inch , as may be seen in fig2 . the spaced apart gap 44 between the forward and rearward resilient blocks 30 and 32 is disposed transversely with respect to the forward and rearward longitudinal axis of the chair seat 12 and to the longitudinal axis of the support arm 16 . a threaded fixed bolt 50 extends through the generally conically shaped central opening 24 in the top mounting plate 18 and extends within a channel 52 formed in each respective adjacent side 54 and 54 &# 39 ; of the forward and rearward resilient blocks 32 and 30 which face one another , the bolt 50 extending through the central bolt opening 28 in the lower mounting plate 26 , and being received into a rotatable threaded hub 56 therebeneath . the threaded hub 56 at the lowermost side of the lower mounting plate 26 , has an adjustment handle 58 thereon , the handle 58 being rotatably engaged with the threads 60 on the lowermost end of the threaded fixed bolt 50 extending through the blocks 30 and 32 of the tilt control mechanism 10 . the uppermost end of the threaded fixed bolt 50 has a generally conical shaped head 62 which mates within the central bolt opening 24 at the top mounting plate 18 . movement of an individual seated in the chair seat 12 portion of the chair assembly may , by moving forward ( to the right as may be seen in fig1 ), create a first short moment arm around the top of the threaded fixed bolt 50 by having the forward transverse edge 66 of the top mounting plate 18 pivot downwardly about a short fulcrum between the longitudinal axis about the threaded fixed bolt 50 and the forward edge of the forward resilient block 32 . the shorter &# 34 ; forward to rearward &# 34 ; dimension of the &# 34 ; forward &# 34 ; resilient block 32 thereby provides a less resistance to compressibility and thus permits an easier pivoting of the forward edge of the chair downwardly , than would a rearward moment , compressing the &# 34 ; rearward &# 34 ; resilient block 30 , because of the rearward resilient block &# 39 ; s greater &# 34 ; rearward to forward &# 34 ; dimension thereof . the greater dimension and mass of the &# 34 ; rearward &# 34 ; resilient block 30 thus providing a slightly different , longer length , greater mass to resist compression than the resistance to compression provided by the smaller forward block 32 having a shorter distance between the forward edge of the forward block 32 and the longitudinal axis of the ( compression adjuster ) threaded fixed bolt 50 . the threaded hub 56 on the lower end of the fixed bolt 50 may be rotated with respect to the lower end of that threaded fixed bolt 60 , so as to compress or decompress the forward and rearward resilient blocks 32 and 30 , between the top mounting plate 18 and the lower mounting plate 26 , thus affecting their compressibility , and thus the forward and rearward tiltability of the top mounting plate 18 and hence tiltabilty of the lower seat support portion 12 of the chair assembly . thus , what has been shown is a unique adjustable tilt control mechanism 10 which may be tightened so as to minimize the forward and rearward tilt of a particular chair , or which may be adjusted to decompress those respective resilient blocks 30 and 32 , and thus permit a greater forward and rearward tilting of the seat portion of the molded chair assembly . the view shown in fig3 displays the tilt adjustment mechanism 10 and the support column 14 relative to the bottom side 11 of the seat 12 and the chair assembly 70 itself , which includes a back portion 72 and flexible armrests 74 .	0
the following language and descriptions of various embodiments are set forth in order to provide a thorough understanding of the embodiments described herein . however , it will be understood by those of ordinary skill in the art that no limitations are intended , and that further alterations , modifications , and applications of the principles of the present non - limiting are also included . as used herein , the term “ kneaded ” is defined as comprising performing repeated cycles of pressing and folding , in an algorithmic manner . as used herein , the term “ micronized ” is defined as having been through the process of reducing the average diameter of a solid material &# 39 ; s particles . as used herein , the term “ cross - linking ” is defined as the process of chemically joining two or more polymer chains together . as used herein , the term “ cross - linker ” is defined as a reagent containing two or more reactive ends that are capable of attaching to specific functional groups on proteins or other molecules . as used herein , the term “ hydration ” comprises water contained within a crystalline structure of the biopolymer structure and water bound to or within a biopolymer composition . as used herein , the term “ dried ” is defined as essentially free of water other than water contained within a crystalline structure of the biopolymer structure . as used herein , the term “ pharmaceutically active compound ” refers to a compound or a combination of compounds that are used in manufacturing a drug product . this compound may also have a direct effect on the disease diagnosis , prevention , treatment or cure . some examples of the pharmaceutically active compound that can be used herein are listed supra . as used herein , the term “ receptor antagonist ” refers to a type receptor specific ligand or drug that can block receptor - mediated response by binding to the receptor and preventing the binding of agonists to the receptor . some examples of such receptor antagonist include but are not limited to anti - tnf alpha , anti - interleukin - 1 , anti - interleukin - 6 , anti - epidermal growth factor receptor , anti - dopamine receptor , anti - angiotensin ii receptor , anti - aldosterone receptor and anti - leukotriene receptor . as used herein , the term “ anti - angiogenic compounds ” refer to compounds that inhibit the growth of new blood vessels , reduce the production of pro - angiogenic factors , prevent the pro - angiogenic factors from binding to their receptors , and block the actions of pro - angiogenic factors or a combination thereof . some examples of these compounds include but are not limited to compounds that inhibit the activity of vegf , pdgf , and angiogenesis stimulators . as used herein , the term “ intracellular signaling inhibitors ” refer to compounds that block signaling pathways by blocking the binding of ligands to the receptor involved in cell signaling or signal transduction , the actions of the receptors or the combination thereof . these compounds are useful in treatment , prevention , diagnosis or cure of various diseases . some examples of intracellular signaling inhibitors include but are not limited to jak1 , jak3 and syk . as used herein , the term “ excipient ” is known in the art to refer to a natural or synthetic substance is formulated alongside the pharmaceutically active compound . there are several reasons for using the excipient in a drug composition because they act as a buffer , filler , binder , lubricant , or an osmotic agent . for instance , it may be used for the purpose of bulking up formulations that contain potent pharmaceutically active compounds . it may also be used to confer a therapeutic enhancement on the pharmaceutically active compound in the final dosage form , such as facilitating drug absorption or solubility . further , it may also be used to assist in the handling of the pharmaceutically active compound by enabling powder consistency , non - stick properties or in vitro stability such as prevention of denaturation . some of the factors that affect the selection of the excipient in a drug composition may include but is not limited to the route of administration , dosage form as well as the type of the pharmaceutically active compound in the drug composition . the various classes and types of pharmaceutically active compounds , excipients , polymers , and polyampholytes are familiar to those skilled in the art of drug delivery . as used herein , the term “ macroscopic biopolymer system ” refers to a biopolymer body that is macroscopic in all three space dimensions and is larger than 1 mm in all directions . as used herein , the term “ microscopic biopolymer system ” refers to a biopolymer body that is microscopic in at least one spatial dimension , comprising microparticles and thin films . it is understood that “ micro ” is defined as 1 × 10e - 6 . as used herein , the term “ biocompatible scaffold ” refers to any scaffold or matrix that comprises a biopolymer composition as described herein , wherein the scaffold or matrix is safe when given by any route of administration ( e . g ., intravitreal , topical , oral , intradermal , intraperitoneal , intramuscular , subcutaneous , intravenous , intrathecal , etc ) and will not cause immune rejection . the biopolymer composition may be any of a wide variety of agents , which are known to those skilled in the art . suitable polymers include , but are not limited to , hyaluronic acid , collagen , gelatin , albumin , hemoglobin , keratin , fibrinogen , cellulose - derivatives , biogenic carbohydrates , nucleic acids , carbon hydrate , carrageenan , pectin , alginate , chitosan , casein , and whey protein . the method of manufacturing the micronized hydrophilic biopolymer system is the same for each biopolymer ; however , the physicochemical properties of each biopolymer are maintained throughout the process . the cross - linker may be any of a wide variety of agents , which are known to those skilled in the art . suitable cross - linkers include , but are not limited to , 1 , 4 - butanediol diglycidyl either ( bdde ), dimethyl suberimidate , bissulfosuccinimidyl suberate , 1 - ethyl - 3 -[ 3 - dimethylaminopropyl ] carbodiimide hydrochloride ( edc ), glutaraldehyde , formaldehyde , ( succinimidyl 4 -[ n - maleimidomethyl ] cyclohexane - 1 - carboxylate ) ( smcc ), and ( sulfosuccinimidyl 4 -[ n - maleimidomethyl ] cyclohexane - 1 - carboxylate ) ( sulfo - smcc ). the method of manufacturing the biopolymer system is the same for each cross - linker with respect to the mechanical preparation ; however , the cross - linkers maintain their original chemical properties . according to an exemplary embodiment , hyaluronic acid is partly cross - linked in a highly concentrated and hydrated configuration . the cross - linked configuration is transferred to an aqueous solution ( for example , aqueous hyaluronic acid solution ) for a second cross - linking . in at least one embodiment , the resulting macroscopic system is a translucent , gelatinous composition , having an increased concentration of hyaluronic acid . in other embodiments , the resulting macroscopic composition is a translucent , liquid composition , having an increased concentration of hyaluronic acid . the obtained system can be used as prepared or milled down to microparticles . according to an exemplary embodiment , the cross - linked hyaluronic acid composition is a bulk phase material . as a result , the macroscopic composition comprises a heterogeneous mixture of cross - linked hyaluronic acid at a micro - scale . throughout the composition , sites of low density , attained from dissolved hyaluronic acid crosslinking , and sites of high density , attained from cross - linked micronized hydrated hyaluronic acid , exist , creating a system with increased hyaluronic acid concentration and segment density . according to exemplary embodiments there can be several sizes or size distributions of high concentration hyaluronic acid cross - linked microparticles contained in one system . according to an exemplary embodiment , a partly cross - linked , hydrated biopolymer macroscopic composition is purified , dried and micronized . the micronized composition is further manufactured to predetermined average particle sizes by sieving . according to an exemplary embodiment , a second cross - linking can be conducted to connect both a dissolved biopolymer and a hydrated , partly cross - linked biopolymer system . the resulting fully cross - linked , hydrated biopolymer macroscopic composition is purified , dehydrated and micronized . the micronized composition is further manufactured to predetermined average particle sizes by sieving . according to an exemplary embodiment , the cross - linked biopolymer compositions have an increased longevity in a human or animal body . in at least one embodiment , the cross - linked biopolymer compositions created are functional for use in cosmetic surgery . in another embodiment , the cross - linked biopolymer compositions created are functional for use as delivery matrices for biologics , biomaterials , active pharmaceutical ingredients ( apis ), cosmetics , and foods or food additives . in at least one embodiment , the cross - linked biopolymer compositions created are functional for use in biocompatible scaffolds . in another embodiment , the cross - linked biopolymer compositions created are functional for use in surgical scaffolds . in another embodiment , the cross - linked biopolymer particles can be used to create a plug in a blood circulation system . in at least one embodiment , the cross - linked biopolymer compositions are in a dried and hydrated form wherein the cross - linked biopolymer compositions contain water within a crystalline structure of the biopolymer composition and water bound to or within a biopolymer composition . in at least one embodiment , the cross - linked biopolymer compositions are in a dried and hydrated form wherein the cross - linked biopolymer compositions contain water within a crystalline structure of the biopolymer composition or water bound to or within a biopolymer composition . in at least one embodiment , the cross - linked biopolymer compositions are in a dried and dehydrated form wherein the cross - linked biopolymer compositions do not contain water within a crystalline structure of the biopolymer composition or water bound to or within a biopolymer composition . in at least one embodiment , the micronized , cross - linked biopolymer compositions can be suspended in a macroscopic cross - linked gel , while maintaining an injectable system . various embodiments are further illustrated by the following examples . the following examples shall not limit the scope in any way . one gram of hyaluronic acid was mixed by kneading with 2 ml of a bdde - containing solution ( ratio of bdde to glacial acetic acid : 2 : 1 , ratio of this mixture to water : 1 : 4 ). the product was stored for 4 hours at 60 degrees centigrade . the cross - linked hyaluronic acid - bdde product was then purified and dried . 0 . 5 grams of dried product was then micronized by mechanical milling at 12000 rpm ( pulverisette 14 , fritsch gmbh , germany ). after micronization , the dried cross - linked hyaluronic acid - bdde product was fractionized via sieving . a summary overview of this exemplary process is shown in fig1 . one gram of hyaluronic acid was mixed by kneading with 4 ml of a glutaraldehyde solution ( 99 : 1 ( v / v %) of 50 wt % glutaraldehyde solution : 3m hcl ). the product was stored for 4 hours at 60 degrees centigrade . the cross - linked hyaluronic acid - glutaraldehyde product was then purified and dried . 0 . 5 grams of dried product was then micronized at 12000 rpm ( pulverisette , fritsch gmbh , germany ). after micronization , the dried cross - linked hyaluronic acid - glutaraldehyde product was fractionized via sieving . the procedure of example 2 produced micronized and sieved cross - linked hyaluronic acid - glutaraldehyde product exhibited average particle diameters of about 50 μm to about 100 μm . a summary overview of this exemplary process is shown in fig2 . while the disclosed embodiments have been particularly shown and described with reference to specific embodiments , it should be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the disclosed embodiments as defined by the appended claims . the scope of the disclosed embodiments is thus indicated by the appended claims and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced .	2
the disclosure is now described within the context of one or more embodiments , although the description is intended to be illustrative of embodiments of the invention as a whole , and is not to be construed as limiting other embodiments of the invention to the embodiments shown . it is appreciated that various modifications may occur to those skilled in the art that , while not specifically shown herein , are nevertheless within the true spirit and scope of the invention . as will be appreciated by one skilled in the art , aspects of the present invention may be embodied as a system , method or computer program product . accordingly , aspects of the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , aspects of the present invention may take the form of a computer program product embodied in one or more computer readable medium ( s ) having computer readable program code embodied thereon . any combination of one or more computer readable medium ( s ) may be utilized . the computer readable medium may be a computer readable signal medium or a computer readable storage medium . a computer readable storage medium may be , for example , but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , or device , or any suitable combination of the foregoing . more specific examples ( a non - exhaustive list ) of the computer readable storage medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a magnetic storage device , or any suitable combination of the foregoing . in the context of this document , a computer readable storage medium may be any tangible medium that can contain , or store a program for use by or in connection with an instruction execution system , apparatus , or device . a computer readable signal medium may include a propagated data signal with computer readable program code embodied therein , for example , in baseband or as part of a carrier wave . such a propagated signal may take any of a variety of forms , including , but not limited to , electro - magnetic , optical , or any suitable combination thereof . a computer readable signal medium may be any computer readable medium that is not a computer readable storage medium and that can communicate , propagate , or transport a program for use by or in connection with an instruction execution system , apparatus , or device . program code embodied on a computer readable medium may be transmitted using any appropriate medium , including but not limited to wireless , wireline , optical fiber cable , rf , etc ., or any suitable combination of the foregoing . computer program code for carrying out operations for aspects of the present invention may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). aspects of the present invention are described below with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer readable medium that can direct a computer , other programmable data processing apparatus , or other devices to function in a particular manner , such that the instructions stored in the computer readable medium produce an article of manufacture including instructions which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other devices to cause a series of operational steps to be performed on the computer , other programmable apparatus or other devices to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . reference is now made to fig1 which is a simplified conceptual illustration of a system for pinpointing security vulnerabilities in computer software applications , constructed and operative in accordance with an embodiment of the invention . in the system of fig1 , a scan manager 100 is configured to receive output from , and preferably control , a black - box tester 102 , such as ibm rational appscan ™, commercially - available from international business machines corporation , armonk , n . y . black - box tester 102 is configured to attack a computer software application 104 using conventional black - box testing techniques , such as using attacks designed to test for security vulnerabilities , where computer software application 104 is any computer - based application that may be the subject of conventional black - box testing techniques . scan manager 100 is also configured to receive output from , and preferably control , a static analyzer 106 , such as ibm rational appscan source edition ™, commercially - available from international business machines corporation . static analyzer 106 is configured in accordance with conventional techniques to statically analyze the instructions of computer software application 104 , such as where the instructions are in the form of source code or byte code , to identify instructions that potentially represent security vulnerabilities , and report those instructions identified as security vulnerabilities to scan manager 100 . scan manager 100 is preferably configured using conventional techniques to correlate attacks performed by black - box tester 102 on computer software application 104 , with instructions within computer software application 104 that are reported by static analyzer 106 as potentially representing security vulnerabilities , or otherwise to receive such correlation information . an instruction is typically correlated with a particular type of attack if it is determined that the instruction suffers from a security vulnerability that makes it susceptible to the attack . for any given instruction within computer software application 104 that has been correlated with an attack by black - box tester 102 , scan manager 100 is preferably configured to set a debugging breakpoint within computer software application 104 proximate to the instruction , such as by controlling a debugger 108 to do so , where debugger 108 is any known computer software application debugger , such as such as microsoft visual studio ™ debugger , commercially - available from microsoft corporation , redmond , wash . for any given debugging breakpoint that has been set within computer software application 104 as described hereinabove for a given attack performed by black - box tester 102 on computer software application 104 , and that has been correlated with an instruction within computer software application 104 , scan manager 100 is preferably configured to cause black - box tester 102 to perform the same attack on computer software application 104 during execution of computer software application 104 in a debugging mode , such as when the execution of computer software application 104 is controlled by and / or monitored by debugger 108 . as the attack is correlated with an instruction within computer software application 104 for which a breakpoint has been set , debugger 108 preferably halts the execution of computer software application 104 when the breakpoint is triggered by the attack and initiates an interactive debugging session . during the interactive debugging session debugger 108 preferably displays , such as on a display device of a computer 110 , the instruction for which the breakpoint has been set , such as in the context of a listing of other neighboring instructions of computer software application 104 , and makes one or more execution environment values of computer software application 104 available for inspection , such as variables and stack information . debugger 108 also preferably displays a description of the attack , such as may be provided by black - box tester 102 . for example , debugger 108 may display a specific http request that triggered the breakpoint . any of the elements shown in fig1 are preferably executed by or otherwise made accessible to computer 110 , such as by implementing any of the elements in computer hardware and / or in computer software embodied in a physically - tangible , computer - readable medium in accordance with conventional techniques . reference is now made to fig2 which is a simplified flowchart illustration of an exemplary method of operation of the system of fig1 , operative in accordance with an embodiment of the invention . in the method of fig2 , the instructions of a computer software application are statically analyzed to identify instructions that potentially represent security vulnerabilities ( step 200 ). one or more attacks are performed on the computer software application during its execution , such as where the attacks are designed to aid in identifying security vulnerabilities within the computer software application ( step 202 ). a given attack is correlated with an instruction within the computer software application ( step 204 ). a debugging breakpoint is set within the software application proximate to the instruction that is correlated with the attack ( step 206 ). the same attack is performed on the computer software application during its execution in a debugging mode ( step 208 ). if the breakpoint is triggered ( step 210 ), execution of the computer software application is halted ( step 212 ), and an interactive debugging session is begun ( step 214 ) where the instruction is displayed , preferably in the context of neighboring instructions , preferably where one or more execution environment values of the computer software application are made available for inspection , and preferably where a description of the attack is also displayed . reference is now made to fig3 which is a simplified conceptual illustration of a system for pinpointing security vulnerabilities in computer software applications , constructed and operative in accordance with an alternative embodiment of the invention . the system of fig3 is substantially similar to the system of fig1 , with the notable exception that in place of static analyzer 106 , an execution monitor 300 is shown , such as acunetix web vulnerability scanner ™, commercially - available from acunetix ltd ., portomaso , malta . execution monitor 300 preferably instruments computer software application 104 in accordance with conventional techniques , and monitors computer software application 104 during its execution so as to detect where attacks by black - box tester 102 occur within computer software application 104 , and thereby identify which instructions within computer software application 104 represent security vulnerabilities . execution monitor 300 preferably reports those instructions identified as security vulnerabilities to scan manager 100 . as before , an instruction is typically correlated with a particular type of attack if it is determined that the instruction suffers from a security vulnerability that makes it susceptible to the attack . reference is now made to fig4 which is a simplified flowchart illustration of an exemplary method of operation of the system of fig3 , operative in accordance with an embodiment of the invention . in the method of fig4 , a computer software application is instrumented to detect attacks performed on the application during its execution ( step 400 ). one or more attacks are performed on the instrumented computer software application during its execution , such as where the attacks are designed to aid in identifying security vulnerabilities within the computer software application ( step 402 ). when an attack is detected by the instrumentation , the attack is correlated with an instruction within the computer software application ( step 404 ). a debugging breakpoint is set within the software application proximate to the instruction that is correlated with the attack ( step 406 ). the same attack is performed on the computer software application during its execution in a debugging mode ( step 408 ). if the breakpoint is triggered ( step 410 ), execution of the computer software application is halted ( step 412 ), and an interactive debugging session is begun ( step 414 ) where the instruction is displayed , preferably in the context of neighboring instructions , preferably where one or more execution environment values of the computer software application are made available for inspection , and preferably where a description of the attack is also displayed . referring now to fig5 , block diagram 500 illustrates an exemplary hardware implementation of a computing system in accordance with which one or more components / methodologies of the invention ( e . g ., components / methodologies described in the context of fig1 - 4 ) may be implemented , according to an embodiment of the invention . as shown , the techniques for controlling access to at least one resource may be implemented in accordance with a processor 510 , a memory 512 , i / o devices 514 , and a network interface 516 , coupled via a computer bus 518 or alternate connection arrangement . it is to be appreciated that the term “ processor ” as used herein is intended to include any processing device , such as , for example , one that includes a cpu ( central processing unit ) and / or other processing circuitry . it is also to be understood that the term “ processor ” may refer to more than one processing device and that various elements associated with a processing device may be shared by other processing devices . the term “ memory ” as used herein is intended to include memory associated with a processor or cpu , such as , for example , ram , rom , a fixed memory device ( e . g ., hard drive ), a removable memory device ( e . g ., diskette ), flash memory , etc . such memory may be considered a computer readable storage medium . in addition , the phrase “ input / output devices ” or “ i / o devices ” as used herein is intended to include , for example , one or more input devices ( e . g ., keyboard , mouse , scanner , etc .) for entering data to the processing unit , and / or one or more output devices ( e . g ., speaker , display , printer , etc .) for presenting results associated with the processing unit . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods and computer program products according to various embodiments of the invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that , in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts , or combinations of special purpose hardware and computer instructions . it will be appreciated that any of the elements described hereinabove may be implemented as a computer program product embodied in a computer - readable medium , such as in the form of computer program instructions stored on magnetic or optical storage media or embedded within computer hardware , and may be executed by or otherwise accessible to a computer ( not shown ). while the methods and apparatus herein may or may not have been described with reference to specific computer hardware or software , it is appreciated that the methods and apparatus described herein may be readily implemented in computer hardware or software using conventional techniques . while the invention has been described with reference to one or more specific embodiments , the description is intended to be illustrative of the invention as a whole and is not to be construed as limiting the invention to the embodiments shown . it is appreciated that various modifications may occur to those skilled in the art that , while not specifically shown herein , are nevertheless within the true spirit and scope of the invention .	6
fig1 shows the process flow for fabrication of high mobility n - channel tfts . the process steps are described in conjunction with the ensuing figures . fig2 reveals a silicon substrate 12 and display glass substrate 14 prior to electrostatic bonding . single crystal silicon substrate 12 is p - type has a boron concentration greater than 8 × 10 18 atoms / cm 3 , a ( 100 ) orientation , ( p ++ ) and a thickness of approximately 0 . 5 millimeters . silicon substrate 12 is initially thermally oxidized in dry oxygen to produce about 0 . 5 micron of high quality silicon dioxide on surface 16 . the thermal silicon dioxide is then patterned and etched to produce gate dielectric regions 18 for the tfts to be fabricated . the pattern on the oxide also includes alignment keys for registration of the subsequent layers to gate dielectric regions 18 . next , approximately 1 . 5 microns of lightly doped epitaxial ( epi ) silicon 20 is grown on top of silicon wafer 12 containing oxide islands 18 . because an sio 2 layer presents a difficult nucleation surface for silicon chemical vapor deposition ( cvd ), lateral epitaxy results on top of oxide islands 18 . thus , a uniform epitaxial layer 20 of lightly boron doped , high mobility silicon of about a 1 . 5 micron thickness is produced by a selective epitaxial process . layer 20 may have a thickness between 0 . 01 and 5 microns . on top of layer 20 , a si 3 n 4 barrier layer 22 is deposited with a thickness of about 0 . 25 micron via plasma cvd . barrier layer 22 serves as an isolation layer . silicon dioxide deposited by plasma cvd may also be used as a barrier layer . barrier layer 22 may have a thickness between 0 . 1 and 2 microns . on layer 22 , a light shield layer 24 of about 0 . 2 micron is deposited . light shield layer 24 may be any other thickness between 0 . 01 and 2 microns . after deposition of layer 24 , silicon wafer 12 is then ready for bonding . light shield layer 24 may be composed of refractory metal or similar substance , which is compatible with the electrostatic bonding process and barrier layer 22 . silicon wafer 12 incorporating layers 20 , 22 and 24 , is then electrostatically bonded to display glass substrate 14 at light shield 24 surface of wafer 12 . provision for electrical contact to light shield layer 24 for electrostatic bonding may be made by any one of various means . for example , silicon wafer 12 can be made larger than glass substrate 14 to have access to light shield layer 14 , for electrical contact during bonding . display glass substrate 14 may be corning code 1733 or other like material . substrate 14 is approximately 1 . 1 millimeters thick . electrostatic bonding involves applying approximately 1000 volts direct current across the display glass substrate 14 and wafer 12 for a bonding between layers 14 and 24 at a temperature of about 600 ° c . after the bonding of layers 14 and 24 , p ++ silicon substrate 12 is etched off starting from the surface opposite of surface 16 , down past surface 16 on into layer 20 , including some of islands 18 to a level wherein a portion of thickness of islands 18 is remaining . this etching is accomplished with the use of impurity selective etch 8hac : 3hno3 : 1hf . impurity selective etch preferentially etches the p ++ silicon layer 12 one hundred times faster than the lightly doped epi - silicon layer 20 . this permits a controllable etch removal of p ++ substrate 12 . alternatively , a majority of the silicon wafer 12 may be removed by mechanical grinding and lapping prior to impurity selective preferential etching , for the remainder of wafer 12 . a portion of epi layer 20 and thermal oxide islands 18 are controllably etched to achieve about 1 , 000 angstroms of gate dielectric 18 as shown in fig3 . this etching can be done using wet chemical etching or plasma etching . silicon epi layer 20 , barrier layer 22 and light shield 24 are patterned and etched to form islands 26 for the fabrication of tfts for the active matrix array and display drivers , as shown in fig4 and 5 . the so - called &# 34 ; thermal &# 34 ; silicon dioxide is high quality silicon dioxide characterized by low fixed change densities . the fixed charge density in high quality or &# 34 ; thermal &# 34 ; silicon dioxide is less than 1 × 10 11 charges per square centimeter . &# 34 ; deposited &# 34 ; or low quality silicon dioxide has a fixed charge density equal to or greater than 1 × 10 11 charges per square centimeter . the maximum processing temperature for glass substrate is limited by its &# 34 ; strain point temperature ,&# 34 ; which is the temperature at which the glass begins to deform due to strain . the &# 34 ; anneal temperature &# 34 ; of glass is typically about 50 ° c . higher than the strain point temperature . the anneal temperature is the temperature at which rapid strain relief begins to occur . low temperature glass is defined as glass having a strain point temperature less than 700 ° c . high temperature glass is defined as glass having a strain point temperature equal to or greater than 700 ° c . spin - on - glass 28 ( e . g ., allied chemical accuglass xa03 - 5 ) is applied on substrate 14 and islands 26 , and is patterned and etched as shown in fig6 and 7 . spin - on - glass 28 protects the subsequent gate 30 from shorting to the tft channel . also , spin - on - glass 28 planarizes the surface . then a polysilicon gate 30 is deposited , patterned and etched as shown in fig8 . this is followed by self - aligned source - drain implantation 32 of phosphorus ( p 31 ), and anneal as shown in fig9 . the implant 32 damage is annealed at 600 ° c . in a furnace for 20 hours . implant 32 conditions are selected to achieve an implant 32 range greater than the thickness of gate oxide 18 . then a silicon dioxide intermetal dielectric 34 is deposited by plasma chemical vapor deposition , patterned and the contact vias are etched down to implants 32 , as shown in fig1 . aluminum (+ 1 % silicon ) is then deposited , patterned , and etched to define the source - drain metalization 36 as shown in fig1 . this completes the fabrication of tft 40 for active matrix and integrated drivers . the next step is to fabricate a pixel electrode that electrically connects to the source electrode of the active matrix pixel tft . for amlcds , an indium tin oxide ( ito ) layer , which is a transparent conductor , is deposited , patterned and etched to define the pixel electrode . for clarity , the pixel electrode is not shown in fig1 and 12 . to maintain low leakage currents under high ambient lighting conditions , another light shield 44 is placed on the top of the tft . first a silicon dioxide passivation dielectric layer 42 is deposited on top of source - drain metalization 36 . then a second aluminum layer is deposited , patterned , and etched to obtain top light shield 44 as shown in fig1 . fig1 - 22 are similar to fig9 - 12 , respectively , but , having greater detail , also reveal the nonalignment between gate 30 and oxide island 18 , after the polysilicon gate etch and the source - drain implant . this active matrix substrate with mobility tfts and integrated drivers is then utilized to fabricate high resolution amlcds using conventional liquid crystal display assembly techniques . note that the invention can also be used to fabricate integrated drivers only using the high mobility single crystal silicon tfts , while using an a - si or poly - si tft array for an active matrix . further , the high mobility tfts of this invention can be used to fabricate integrated drivers for tfel and plasma display panels . additionally , the high mobility tfts of this invention can be used to fabricate active matrix tfel displays with integrated drivers . in the case of an active matrix tfel display , a reflective film such as aluminum is used as the pixel electrode . the source - drain aluminum ( see fig1 ) is used to fabricate the reflective electrode for the electroluminescent pixel . the high mobility tft process described above illustrates the procedures for fabricating n - channel tfts . if p - channel tfts are required , a similar process can be employed by changing the dopant in film 20 to phosphorus , and the source - drain implant 32 in fig1 to boron 11 ( b 11 ). also , complimentary metal oxide semiconductor ( cmos ) devices , involving both n -, and p - channel tfts on the same substrate , can be fabricated by masked implantation of the selected tft locations ( gate dielectric regions ) with p 31 or b 11 after selective epitaxial deposition to create n - and p - regions , prior to electrostatic bonding . display drivers using cmos circuitry consume less power . fig1 shows a flow diagram for an alternate processing scheme for fabricating high mobility single crystal silicon tfts on a display glass substrate 46 using a high quality thermal silicon dioxide gate dielectric 48 . this approach is shown in fig1 - 18 . this process uses two single crystal silicon wafers , labelled as a silicon device wafer 50 and a silicon handle wafer 52 , respectively . both wafers 50 and 52 are of p - type with resistivity of about 1 ohm - cm , and ( 100 ) orientation . first , a high quality thermal silicon dioxide layer 48 of about a 5000 angstrom thickness is grown on wafer 52 using dry oxygen at a temperature of about 1000 degrees c . in parallel , a heavily boron doped p ++ silicon etch - stop layer 54 with a thickness of about 2 microns , and a lightly doped ( p - or n - ) device layer 56 with a thickness of about 1 micron are grown on silicon device wafer 50 , using silicon epitaxy . then the two wafers , 50 and 52 , are bonded to each other either by using electrostatic bonding or diffusion bonding . fig1 shows a cross - section through silicon handle wafer 52 and silicon device wafer 50 prior to bonding . after bonding , silicon device wafer 50 is selectively etched away using selective chemical etch such as ethylene diamine pyrocatechol ( edp ). fig1 shows a cross - section through handle wafer 52 after the bonding and selective etching of device wafer 50 . then , silicon handle wafer 52 is photolithographically patterned to etch alignment keys in silicon epi device layer 56 and thermal silicon dioxide gate dielectric 48 . this allows masked implantation anneal of the n - and p - regions in device epi silicon film 56 prior to bonding to low temperature display glass substrate 46 . ( the alignment key fabrication and corresponding masked implantation processes are not shown .) next , a barrier layer 58 ( about a 2500 angstrom thick plasma deposited silicon nitrite or silicon dioxide ), and light shield layer 60 of about 2000 angstroms thick are deposited on top of silicon epi device layer 56 as shown in fig1 . this pre - processed silicon handle wafer 52 is then electrostatically bonded to display glass substrate 46 at light shield layer 60 . after bonding , silicon handle wafer 52 is selectively etched away using the edp etch or potassium hydroxide ( koh ) etch . etch rate of these etches for the thermal silicon dioxide dielectric is insignificant compared to the etch rate for handle silicon wafer 52 . fig1 shows a cross - section through display glass substrate 46 and accompanying layers 48 , 56 , 58 and 60 , after silicon handle wafer 52 is selectively etched away . then , silicon islands 62 along with thermal silicon dioxide dielectric layer 48 , are patterned for the regions requiring tfts , and etched as shown in fig1 . from this point on , the substrate assembly in fig1 is processed similar to the first approach starting from fig5 . the corresponding components of devices 64 and 66 are , respectively , glass substrates 14 and 46 , light shield layers 24 and 60 , barrier layers 22 and 58 , silicon epitaxial layers 20 and 56 , silicon dioxide dielectrics 18 and 48 , and islands 26 and 62 . in summary , the invention permits fabrication of tfts having single crystal silicon for high mobility integrated drivers for active matrix displays wherein high mobility means that in excess of 300 cm2 / v . s ., thermal silicon dioxide gate dielectric for low ( less than 1 volt ) and stable threshold voltage , and light shield for low off - currents ( less than 1 pico ampere ) under high ambient lighting conditions are accomplished . the present invention may utilize variations to the basic processes , illustrated above , such as by using different thicknesses for individual layers , processing temperatures , and other processing conditions .	7
referring initially to fig1 – 3 there is illustrated a primary hanger or bracket shown generally at 25 . the hanger may be formed of steel and galvanized . throughout its length , the hanger is of a substantially uniform channel shape which has a center outwardly extending channel 26 and two relatively long outwardly projecting coplanar flanges 27 and 28 on each side thereof . the bottom of the hanger forms a generally semi - circular upwardly opening trough - shape saddle or support 30 with two straight or vertical portions 31 and 32 on each end thereof . the straight portion 32 terminates at the edge 33 while the straight portion 31 continues upwardly to an angle portion 34 which terminates at the top in a horizontal short section 35 . the base of the channel is provided with a top hole indicated at 36 . the opposite end just short of the edge 33 is also provided with a hole seen at 37 in the base at the center channel . as later described , the primary hanger or bracket may be hung from a threaded rod extending through the hole 36 at the desired elevation and orientation with respect to an overhead structural element of the building . the axially extending flanges of the primary hanger are provided with edge notches at one side seen at 40 and 41 , at the opposite side as seen at 42 and 43 , and in the center bottom as seen at 44 and 45 . these edge notches accommodate spring snap clips as will be described . it will be seen that the configuration of the primary hanger is such that the upwardly opening generally semi - circular support surface 30 is symmetrical about the axis of the top hole 36 and that a substantially open side is provided as seen at 48 . after the secondary hanger or open mesh is secured in place inside the semi - circular support and the cable runs or bundles are positioned within the secondary hanger , the open space 48 may be closed by the retaining strap seen generally at 50 in fig4 . the retaining strap 50 includes a vertical lower end 51 which terminates in a relatively narrow dogleg or tab 52 inwardly offset by shoulder 53 . the main body portion of the strap shown at 54 extends upwardly at an angle of about 45 ° which is the same angle of inclination of the section 34 of the primary hanger . the top of the strap terminates in a horizontal portion 55 which includes on one side a bayonet notch 56 with the outermost edge of the notch being slightly inclined or forming a cam surface 57 . as will hereinafter be described the strap is simply attached to the primary hanger by inserting the tab or dogleg 52 into the hole 37 and then rotating the top upwardly to snap onto the threaded rod above the upper end of the primary hanger to be secured in place by conventional nut fasteners . the strap then provides symmetrical hanging support for both sides of the upwardly opening support 30 as well as enclosing the trough or cable tray formed . referring now to fig5 and 6 there is illustrated a spring snap clip shown generally at 60 which is employed in connection with the flange edge notches to secure the secondary hanger or open flexible mesh seen at 62 in fig9 to the interior of the primary hanger 25 . the spring snap clips each include a generally flat surface 64 with legs 65 and 66 bent in the same direction . the tips of the legs are bent outwardly or away from each other as 25 shown at 67 and 68 , respectively . extending generally coplanar to the outwardly flared tips of the legs of the clip are inwardly struck tangs seen at 69 and 70 . these tangs may be struck from the outer edges of holes 72 and 73 . the profile configuration of the edges and tangs is seen more clearly in fig6 . the spring clips are such that they may simply be pushed on the notch edges such as seen at 44 and 45 so that such edges cam the legs apart with the tangs 69 and 70 snapping over the notch edges . once in place the notches keep the snaps from moving or sliding circumferentially of the primary hanger . the clip seen in fig5 and 6 is made of spring steel . fig7 and 8 illustrate a splice clip shown generally at 76 . the splice clip as hereinafter described is designed to secure the end of one roll of such mesh or fabric 62 to the beginning of the next roll , or to fabricate curves , elbows , tees , branches or even changes in elevation with the transition hereinafter described . the splice clip seen in fig7 and 8 is made of a plastic material such as polypropylene and includes a flat base 78 which has a relatively short rear wall 79 . the rear wall is connected to the top wall or outer corner 80 by a hinge 81 . at the front of the base 78 there is provided a relatively shorter ridge wall 82 and forwardly spaced therefrom a catch wall 83 which has a sloping interior outer edge 84 which terminates in a catch shoulder 85 . the outer cover 80 terminates in an inwardly projecting relatively thin wall 87 which is hinged at 88 to outwardly extending flex edge 90 which includes a forwardly projecting catch 91 adapted to snap under the catch 85 when the splice clip is closed as seen in fig8 . the splice clip can be opened or released simply by elevating the forward edge 90 pivoting clockwise about pivot or hinge 88 as seen in fig8 to disengage the two latches . the clip can be closed simply by pressing the cover 80 down which encloses the interior space 93 . the clip will readily accommodate within the opening 93 a number of strands of the open mesh secondary hanger fabric or even accommodate wire forms . the interior opening top - to - bottom of the clip 76 is approximately a quarter of an inch ( 6 . 35 mm ), while the interior length of the opening 93 is approximately 1 . 4 inches ( 31 . 2 mm ). although other types of fabric may be employed , the preferred open mesh fabric is seen at 62 in roll form in fig9 . it will be seen that the fabric 62 is formed of longitudinal strands 95 and transverse strands 96 . these strands are preferably oriented high density polyethylene extruded with approximately 10 % fiber reinforcing added . the strands are welded to each other to form nodes shown generally at 97 . the thickness of the strands may be typically 0 . 14 ( 3 . 6 mm ) inches while the rectangular or square openings are approximately 1 square inch ( 2 . 54 cm 2 ). this provides a mesh that is approximately 60 % to 90 % voids . although other forms of mesh fabric may be employed , the square open mesh illustrated is preferred for a variety of reasons . one reason is the reduced material involved which in the case of fire minimizes the creation of fumes . also , a substantially open nature of the mesh does not act as an impediment to any sprinkler system which might be above a suspended ceiling . the open mesh also permits visibility of the cables or bundles within the open trough being formed . cables are sometimes color coded and the open mesh may facilitate the location of a cable without completely dismantling the system or a bundle within the trough formed . in addition , the open mesh with the relatively large voids facilitates the branching of cables from the trunk or run within the trough . the cables may simply be branched through the openings in the mesh and if the opening is not sufficiently large for the number of cables involved , the opening can readily be enlarged with scissors or snips . the preferred mesh comes in rolls which are approximately 15 inches wide ( 38 . 1 cm ) and 25 feet in length ( 76 . 2 decimeters ). the material of such rolls can be joined end - to - end using the splice clips of fig7 and 8 as seen in fig1 . in fig1 , the end of one roll is seen at 99 on one side , while the end of another roll is seen at 100 on the opposite side . the fabric is slightly offset for visibility . splice clips 76 seen at 102 , 103 , 104 , 105 , and 106 are employed to join the fabric ends . it is noted that each splice clip is locked about four parallel strands , two from each of the overlapping mesh or fabric ends . fig1 illustrates the two rolls joined and the positioning of the splice clips as the two fabric sections are longitudinally formed into the upwardly opening trough or saddle section conforming to the interior of the primary hanger . fig1 illustrates the trough configuration of the secondary hanger when conforming to and supported by the interior of the primary hanger . referring now to fig1 , 13 , and 14 it will be seen that the primary hanger shown generally at 25 is suspended by threaded rod 110 from a rod hanger clamp 111 fastened to the lower flange 112 of i - beam 113 . the fastener 111 is held in place on the projecting flange 112 by screw clamp 114 . as seen in fig1 , the lower end of the rod 110 is secured to the upper end of the primary hanger 25 by nuts shown generally at 116 both above and below the hole 35 . washers may also be employed . with reference to such figures it will be seen that the mesh fabric 62 has been bent to conform to the interior of the primary hanger and forms the elongated upwardly opening trough shown . the mesh fabric is secured to the interior of the primary hanger by three spring clips 60 seen in fig1 at 118 , 119 , and 120 . the spring clips are simply moved in the direction of the generally radially extending arrows shown to embrace preferably at least two parallel strands of the mesh fabric and snap over the notch edges shown more clearly in fig1 , 2 , and 3 . fig1 illustrates the snap clip 60 embracing transverse strands 122 and 123 of the mesh 62 with the legs of the snap clip projecting through the voids or openings 124 and 125 in the flexible fabric securing the fabric to the interior of the primary hanger 25 . as illustrated , three clips are employed , two securing the edges of the fabric to the upper portions of the hanger while the third secures the center of the fabric to the bottom of the hanger . the tensile strands of the fabric as well as the trough - shape provide flexibility , yet supporting strength for the portion of the secondary hanger which extends between the primary hangers . referring now to fig1 , there is illustrated three primary hangers shown generally at 130 , 131 , and 132 supported from threaded rods from beam flange clamps 133 , 134 , and 135 , respectively , secured to the flanges of beams 136 , 137 , and 138 , respectively . it is noted that the alignment of the primary hangers is not perfect and there is substantial offset or curvature in the alignment . this indicates the type of flexibility or deviation which can be achieved by the support system of the present invention . fig1 illustrates a cable bundle shown generally at 140 positioned within the secondary or open mesh hanger 62 in turn supported by the spaced primary hangers at 130 , 131 , and 132 . after the bundle 140 is within the trough or secondary hanger 62 supported in turn by the primary hangers , the trough may be closed by assembling the retaining strap 50 as seen in fig1 and 17 . in fig1 the tab or dogleg 52 is inserted in the hole 37 . the strap may then pivot from the phantom line position seen at 142 in fig1 in the direction of the arrow 143 to snap the bayonet notch 56 on the rod 110 . when the notch 56 is in place on the threaded rod it is simply tightened down or clamped with suitable hardware 145 such as the nut illustrated in the final position seen in full lines in fig1 . the primary hanger is then supported symmetrically from the center threaded rod 110 and also the trough formed by the secondary hanger supported in turn by the primary hanger has been enclosed . it can be seen that the components of the system so far described are the primary hanger and it &# 39 ; s strap , the secondary hanger in the form of the open mesh or fabric , the metal clip for securing the secondary hanger to the primary hanger , and the plastic splice clip for connecting sections of the secondary hanger to each other . the splice clip is also employed to secure sections of the secondary hanger to a rod form transition seen generally at 148 in fig1 – 22 . with initial reference to fig1 – 20 it will be seen that the transition is a wire rod form fabrication which includes a center form shown generally at 150 which has generally the same profile configuration as the primary hanger 25 . the center form includes a generally semi - circular upwardly opening trough - like support 152 with relatively short vertical extensions 153 and 154 at each side thereof . the extension 153 terminates in a eye 155 , the hole of which has a horizontal axis . the other side of the center form continues upwardly to the inclined portion 156 which terminates in relatively short horizontal leg 157 terminating in eye 158 with the hole having a vertical axis . the axis of the hole of the eye 158 is centered over the upwardly opening trough - like support 152 . in this manner the center support has the same profile configuration as the primary hanger seen in fig1 – 3 and has a vertical axis hole at the top center and a horizontal axis hole at the opposite end . the holes formed by the eyes 155 and 158 then generally correspond to the holes 37 and 36 , respectively seen in fig1 – 3 . this enables the strap 50 seen in fig4 to be employed in the same manner to close the open side 159 of the center form 150 . extending transversely of the center form or longitudinally of the entire transition is a bottom center strut or bar 162 which is welded to the underside of the center form at 163 . also secured to the center bar or strut 162 are symmetrically positioned left form 165 and right form 166 . also secured to the ends of the center bar or strut 162 are paired end forms seen at 168 and 169 , respectively . the intermediate left and right forms 165 and 166 as well as the paired end forms all have the same general upwardly opening profile or trough - shape configuration and all are secured at their centers by welding to the top of the center bar or strut 162 . the upper ends of the end forms terminate in u - shape bends seen at 171 . such u - shape bends terminate in downwardly extending outer legs that extend parallel to the balance of the form so that a strand of the secondary hanger can readily be inserted in the opening . the hooks are designed to be closed or shut simply be squeezing with a pair of plyers . while each of the paired end forms is provided with such hooks on both ends , the intermediate left and right forms are provided with similar hooks indicated at 173 and 174 , but on the opposite end are provided with hooks 175 and 176 directed horizontally toward each other and opening away from each other . these hooks 175 and 176 include a right angle bend 178 which extends parallel to the bottom rod or strut 162 with the hook then being formed to terminate in the outer leg 179 parallel to the leg 178 and also the bottom rod or strut . these hooks again are designed to be closed by compression with a pair of plyers . the wire form fabrication transition is formed with wire rod which may have a diameter of approximately 0 . 188 inches ( 0 . 48 cm or 4 . 8 mm ) and the wire forms may readily be field bent to form a variety of curves , tees , elbows , or even changes in elevation . the wire rod stock is designed to fit easily within the pocket or interior 93 of the splice clips seen in fig7 and 8 . the spacing of the paired end forms is such that both forms of each pair will fit within the pocket 93 of the splice clip so that the splice clip will embrace both end forms as well as at least two strands of the secondary hanger 62 . although it is not necessary that the secondary hanger extend completely through the transition , the secondary hanger may readily be secured to each end of the transition with the various hooks closed about the lateral edge strands of the secondary hanger , and the splice clips utilized to secure the secondary hanger to at least each paired end forms of the transition . the curvature may vary from a relatively sharp elbow such as seen in fig2 to a larger radius curvature , and such desired curvature may readily be obtained by bending the center bar or strut 162 on each side of the center form . similar bending may achieve a change in elevation or provide a grade on each side of the center form . referring now to fig2 there is illustrated a transition 148 bent to form a relatively sharp curve or elbow . the center bar or strut 162 has been bent on each side of the center form 150 . the end of one secondary hanger illustrated at 184 is secured to the right hand side of the transition as seen in fig2 . the edge strands 185 and 186 have been positioned in the hooks 171 , and the hook ends 172 have been bent or crimped to enclose the edge strands . the same is true with the hook end 173 on the intermediate form 165 . in addition , splice clips shown at 188 , 189 , and 190 are closed about parallel transverse strands of the secondary hanger 184 and also about the parallel paired wire rod forms of the end forms 168 . on the opposite leg of the transition , the end of the secondary hanger 192 is positioned within and secured to the transition in the same manner by positioning the edge strands 193 and 194 in the hooks 171 and crimping the same closed . splice clips seen at 195 , 196 , and 197 are employed to embrace parallel strands of the mesh hanger 192 as well as the paired end forms . in this manner the two secondary hangers 192 and 184 may be joined essentially at right angles . because of the relatively short bridge involved , the secondary hanger need not extend completely through the elbow . the transition is supported by the threaded rod 200 which extends through the top eye 158 of the center form 150 . the strap 50 extends from the eye 155 with the dogleg 52 projecting through the eye hole . the bayonet notch 56 is snapped on the rod 200 and the assembly is held in place by the nuts illustrated . it will be appreciated that the degree of bending may vary from slight to the almost elbow illustrated and that the bottom center rod or strut 162 may also be bent so that changes in elevation may be accomplished . referring now to fig2 there is illustrated a transition 148 forming a tee shown generally at 210 . in the tee formation seen in fig2 the bottom center rod or strut 162 has not been bent . within the transition a secondary hanger shown generally at 212 is secured by bending the hooks 171 about the edge strands 213 and 214 . the secondary hanger 212 is also secured in place by the splice clips shown at 215 and 216 at each end securing the secondary hanger to the paired end forms . if employed , the third splice clip at the bottom of the trough at each end is obscured . the secondary hanger has been cut to form a flap shown generally at 220 . the flap has been threaded over the eye 155 of the center form and is attached to further secondary hanger 222 by the splice clips shown at 215 and 216 . the further secondary hanger is shown generally at 222 and extends normal to the secondary hanger 212 . the edge strands 223 and 224 of the secondary hanger 222 at the corner with end strand 225 are engaged within the inwardly directed hooks 175 and 176 on the intermediate forms 165 and 166 . it will be appreciated that the secondary hanger 222 will extend onto a primary hanger forming a run which extends normal to the run formed by the secondary hanger 212 . in fig2 the center form includes the strap 50 extending from the eye 155 to the rod 200 and held in place by the nut fasteners shown . accordingly , a wide variety of constructions may be formed with the transition . while the invention has been shown supported from steel i - beams , it will be appreciated that there are a wide variety of other structures from which the cable support and distribution system of the present invention may be suspended . these include girders , angle bars , a wide variety of purlins , or a metal or concrete deck . it will be appreciated that there are a wide variety of hangers which will suspend threaded rod from such structural members and that with the present invention a low cost easily fabricated support and distribution system for communications cable can readily be retrofitted above a suspended ceiling for the proper organization , care and distribution of such sensitive cable . although the invention has been shown and described with respect to certain preferred embodiments , it is obvious that equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification . the present invention includes all such equivalent alterations and modifications , and is limited only by the scope of the claims .	7
these compositions are suitable for forming the optical components of optical devices ( either as pre - formed shaped articles or otherwise ). in any case the composition is poled to develop the non - linear properties ; if desired stretching may be employed to enhance molecular orientation and hence enhance the effect of the poling . the additives are organic compounds the molecules of which possess a number of electrons incorporated within π - molecular orbitals . the molecules have auxochromes which , in addition to increasing the size of the π - molecular orbitals , cause the π - electrons to move non - linearly on the application of an external electric field . as such , the electrical polarisability of the molecules must be described by an equation which includes linear , quadratic and cubic terms , namely : when β and / or γ are / is large , e . g . β greater than 10 - 30 esu and / or γ greater than 4 × 10 - 35 esu as measured at 1 . 06 μm a number of important effects on radiation of optical frequency are observed . β - values for the compounds listed above as items 1 and 6 are given below : ______________________________________ item β______________________________________ 1 17 × 10 . sup .- 30 esu 6 22 × 10 . sup .- 30 esu______________________________________ the vinylidene fluoride polymer may be a homopolymer or a copolymer with up to 80 mole % of low molecular weight ( e . g . up to 100 ) unsaturated fluorocarbons as comonomers , e . g . monofluoroethylene , trifluoroethylene and tetrafluoroethylene . the compositions typically contain 10 to 95 % of the polymer and 5 to 50 % of the additive . in some cases difficulties arise due to inadequate compatibility between the vinylidene fluoride polymer and the additive . these difficulties may be reduced by incorporating an auxiliary polymer component into the composition . the auxiliary component enhances mixing , e . g . by serving as a solvent . concentrations of up to 60 % of the auxiliary component are acceptable when necessary but it is preferred to use concentrations below 40 %. polymers derived from monomers with molecular weights below 150 and containing one vinyl unsaturation and one carbonyl group are particularly suitable as the auxilliary component . preferred comonomers have a formula selected from : r &# 39 ; is selected from -- ch 3 and -- c 2 h 5 ; r &# 34 ; is selected from -- ch ═ ch 2 and -- c ( ch 3 )═ ch 2 ; x is a bridge selected from a direct bond , -- o --, -- nh -- and -- n ( ch 3 )--; and y and z are linked together so as to form a pyrrolidone ring . poly ( methylacrylate ), poly ( methylmethacrylate ), poly ( vinylacetate ), poly ( n - vinyl - 2 pyrrolidone ) and poly ( nn dimethylarcrylamide ) are particularly suitable . as a preliminary to incorporation in a device the compositions according to the invention may be converted into shaped articles , e . g . fibres or films having a dimension in the range 0 . 1 to 1000 μm , especially 1 to 200 μm . the shaped articles are poled and , if desired , orientated e . g . monoaxially orientated by mechanical stretching . electrodes may be applied to the shaped article , e . g . by a metal sputtering process or by vacuum evaporation . alternatively , the composition may be deposited on a substrate ( avoiding the production of a shaped article as a separate entity ). where this route is adopted the poling will usually be applied after the deposition . compounds which have a high β coefficent do not have a centre of symmetry . in the single crystal form the activity associated therewith may not be fully realised because the crystal lattice may locate asymmetric molecules into positions wherein one molecule is symetrically located with respect to a different molecule whereby the crystal has a centre of symmetry even though its individual molecules do not . thus , this invention produces the required non - linear properties by orientating the additive by electrical ordering or poling of the additive together with its polymeric host , whereby the internal electrical field set up in the piezoelectric polymeric host acts to keep the non - linear optical additive in a preferred alignment and so overcome the effects of thermal randomisation . this invention , which is defined in the claims , includes not only the compositions and shaped articles produced therefrom but also non - linear devices such as parametric amplifiers produced therefrom . several compositions according to the invention will now be described by way of example . the additives used in the examples were : 2 - methyl - 4 - nitroaniline ( conveniently designated mna ), and methyl - n -( 2 , 4 - dinitrophenyl )- alaninate ( conveniently designated map ). the structural formula of mna is given in fig1 and the structual formula of map is given in fig2 . these polymers were obtained under the registered trade marks &# 34 ; kynar &# 34 ; 7200 and &# 34 ; foraflon &# 34 ;. &# 34 ; kynar &# 34 ; 7200 is a copolymer of 30 mole % tetrafluoroethylene and 70 mole o / o vinylidenefluoride . it had a melting point ( by differential scanning calorimetry ) of 130 ° c . approx . &# 34 ; foraflon &# 34 ; was designated copolymer 7 030 and it contained 30 mole % trifluoroethylene and 70 mole % vinylidenefluoride . the auxiliary component used in the examples was a commercially available poly ( methylmethacrylate ), designated pmma , with melting point 130 ° c . three of the reagents specified above , namely mna , &# 34 ; kynar &# 34 ; copolymer 7 030 and pmma , were separately dissolved in acetone to give three 10 % stock solutions . portions of the three stock solutions were mixed to give the solutions , identified by the codes s1 , s2 , s3 and s4 , having the compositions defined in table 1 . ( in each case 10 mls of the solution were produced .) table 1______________________________________ mna pmma kynarcode wt % wt % wt % ______________________________________s1 0 . 3 g 30 0 . 6 g 60 0 . 1 g 10s2 0 . 3 g 30 0 . 5 g 50 0 . 2 g 20s3 0 . 3 g 30 0 . 4 g 40 0 . 3 g 30s4 0 . 3 g 30 0 . 3 g 30 0 . 4 g 40______________________________________ in table 1 , the figures in the columns headed % denote the percentage by weight of the relevant component based on the total film , i . e . after removal of the solvent . each of these solutions was cast into a film through a gap of approximately 200 μm . in each case the additive ( i . e . the mna ) was uniformly dissolved in the blend of the vinylidene fluoride polymer ( i . e . the kynar 7200 ) and the auxiliary . ( i . e . the pmma ). in this example several films were formed by solution processing from acetone ; laminates were formed from these films and these laminates are described in example 3 . all these films were of two components , namely a vinylidene fluoride polymer and an additive having non - linear linear properties . the vinylidene fluoride polymer was &# 34 ; foraflon &# 34 ; copolymer 7 030 . the additive was map . films were prepared by dissolving the two components in acetone to give a solution with a total solid content of 30 % w / w . the solution was spread onto a glass plate using an automatic film spreader ( ici design made by sheen instruments ). the cast solutions were allowed to dry at ambient temperature ( about 20 ° c .) in the absence of draughts for 24 hours . the resulting film was peeled from the glass . the peeled films were stretched ( using an instron tester ) at 16 ° c . at 5 cm / min and the stretched films corona poled for 15 secs by placing the film between two sets of corona discharge wires held at + 10kv and - 10 kv , each spaced 1 cm from the film faces . details of films prepared , including stretch ratio , thicknesses and relevant properties are given in table 2 . table 2______________________________________ truemap draw thickness % ratio μm ri ym g . sub . 31______________________________________0 5 . 2 17 1 . 398 12 . 4 2 . 202 4 . 6 17 1 . 405 12 . 8 1 . 464 4 . 9 20 1 . 413 10 . 1 2 . 566 4 . 7 21 1 . 416 7 . 1 5 . 388 4 . 5 22 1 . 419 7 . 6 6 . 8110 4 . 6 23 1 . 423 6 . 0 8 . 98______________________________________ ( notes on table 2 : ri means refractive index at 589 . 3 nm . the refractive index was substantially constant over the band 450 to 650 nm . ym means young modulus ; the units are 10 . sup . 8 nm . sup .- 2 . g . sub . 31 means piezoelectric coefficient ; the uni ts are 10 . sup .- 2 volts meter per newton . % means by weight based on total film weight . before stretching the thickness of all the films was about 63 μm ; the thickness given in table 2 is the thickness after stretching . the solutions were cast thro ugh a gap 600 μm wide .) the refractive index column indicates that a light guiding structure can be achieved by laminating a film with a high concentration of additive between confining layers , e . g . films with a lower ( or zero ) concentration of additive . examples of such laminates are provided in example 3 . the films used to make the laminates were cast and poled as described in example 2 but they were not stretched . all were 10 μm thick . the films used for the confining layers consisted of pure &# 34 ; foraflon &# 34 ; whereas the films used for the guiding layers contained the percentage ( weight additive per total weight of film ) specified in table 3 . the laminates were prepared by placing the guiding layer between two confining layers and compressing at 40 ° c . under 2 . 8 tonnes / cm 2 . the outer surfaces were metalised to act as electrodes . the laminates were tested and found to be effective wave guides . the refractive index ( ri ) of the guiding layer , measured in the first guiding mode in the laminate , is also given in table 3 . table 3______________________________________guiding layermap % ri______________________________________1 1 . 4082 1 . 4123 1 . 4134 1 . 4165 1 . 417______________________________________ in this example the waveguide was a laminate of two layers only , namely : ( b ) a guiding layer 5 μm thick with 3 % w / w map . it will be understood that air serves as one confining layer . the two layers were compressed together , as in example 3 , and poled at ± 12 kv after lamination . the composite gave a loss of 6 db cm - 1 at 633 nm wavelength .	6
( a ) a rubber selected from the group consisting of natural rubber , a rubber derived from a diene monomer and mixture thereof ; ( c ) from about 1 to about 12 phr of cashew nut oil modified novolak - type phenolic resin ; ( d ) from about 0 . 5 to about 3 phr of a bismaleimide compound of the general formula : ## str1 ## wherein r is divalent and is selected from the group consisting of acyclic aliphatic groups having from about 2 to 16 carbon atoms , cyclic aliphatic groups having from about 5 to 20 carbon atoms , aromatic groups having from about 6 to 18 carbon atoms , and alkylaromatic groups having from about 7 to 24 carbon atoms , wherein these divalent groups may contain a hetero atom selected from o , n and s ; x is o or an integer of from 1 to 3 and y is hydrogen or -- ch 3 ; ( e ) from about 0 . 5 phr to about 3 phr of a sulfenamide compound of the general formula : ## str2 ## wherein r 1 is selected from the group consisting of hydrogen , acyclic aliphatic groups having from about 1 to 10 carbon atoms , and cyclic aliphatic groups having from about 5 to 10 carbon atoms ; and r 2 is selected from the group consisting of cyclic aliphatic groups having from about 5 to 10 carbon atoms and a mercaptobenzothiazolyl group of the formula : ## str3 ## and ( f ) from about 0 . 5 to about 6 phr of sulfur , a sulfur donor or mixtures thereof . there is also disclosed a process for the vulcanization of a rubber compound comprising heating to a temperature ranging from 125 ° c . to 180 ° c . a rubber compound comprising : ( a ) a rubber selected from the group consisting of natural rubber , a rubber derived from a diene monomer and mixture thereof ; ( c ) from about 1 to about 12 phr of cashew nut oil modified novolak - type phenolic resin ; ( d ) from about 0 . 5 to about 3 phr of a bismaleimide compound of the general formula : ## str4 ## wherein r is divalent and is selected from the group consisting of acyclic aliphatic groups having from about 2 to 16 carbon atoms , cyclic aliphatic groups having from about 5 to 20 carbon atoms , aromatic groups having from about 6 to 18 carbon atoms , and alkylaromatic groups having from about 7 to 24 carbon atoms , wherein these divalent groups may contain a hetero atom selected from o , n and s ; x is o or an integer of from 1 to 3 and y is hydrogen or - ch3 ; ( e ) from about 0 . 5 phr to about 3 phr of a sulfenamide compound of the general formula : ## str5 ## wherein r 1 is selected from the group consisting of hydrogen , acyclic aliphatic groups having from about 1 to 10 carbon atoms , and cyclic aliphatic groups having from about 5 to 10 carbon atoms ; and r 2 is selected from the group consisting of cyclic aliphatic groups having from about 5 to 10 carbon atoms and a mercaptobenzothiazolyl group of the formula : ## str6 ## and ( f ) from about 0 . 5 to about 6 phr of sulfur , a sulfur donor or mixtures thereof . the first essential component in the claimed invention is tetrabenzylthiuram disulfide . the tetrabenzylthiuram disulfide is present in an amount of from about 0 . 10 to 0 . 75 phr . preferably , the tetrabenzylthiuram disulfide is present in an amount ranging from about 0 . 10 to about 0 . 50 phr . a cashew nut oil modified novolak - type phenolic resin is the second essential component in the present invention . such resins are commercially available from schenectady chemicals inc under the designation sp - 6700 . the resin is present in an amount ranging from about 1 to 12 phr . preferably , the resin is present in an amount ranging from about 5 to 9 phr . the modification rate of oil based on total novolak - type phenolic resin may range from 10 to 50 percent . for production of the novolak - type phenolic resin modified with cashew nut oil , various processes may be used . for example , phenols such as phenol , cresol and resorcin may be reacted with aldehydes such as formaldehyde , paraformaldehyde and benzaldehyde using acid catalysts . examples of acid catalysts include oxalic acid , hydrochloric acid , sulfuric acid and p - toluenesulfonic acid . after the catalytic reaction , the resin is modified with the oil . the bismaleimide is the third essential component in the claimed invention . the bismaleimide is generally present in an amount of from about 0 . 5 to 3 phr . preferably , the bismaleimide is present in an amount ranging from about 0 . 65 to about 2 phr . representative of the bismaleimides of formula i and which may be used in the present invention include n , n &# 39 ;- ethylenebismaleimide , n , n &# 39 ;- hexamethylenebis - maleimide , n , n &# 39 ;- dodecamethylenebismaleimide , n , n &# 39 ;-( 2 , 2 , 4 - trimethylhexamethylene ) bismaleimide , n , n &# 39 ;-( oxydipropylene ) bismaleimide , n , n &# 39 ;-( aminodipropylene )- bismaleimide , n , n &# 39 ;-( ethylenedioxydipropylene )- bismaleimide , n , n &# 39 ;-( 1 , 4 - cyclohexylene ) bismaleimide , n , n &# 39 ;-( 1 , 3 - cyclohexylene ) bismaleimide , n , n &# 39 ;-( methylene - 1 , 4 - dicyclohexylene ) bismaleimide , n , n &# 39 ;-( isopropylidene - 1 , 4 - dicyclohexylene ) bismaleimide , n , n &# 39 ;-( oxy - 1 , 4 - dicyclohexylene ) bismaleimide , n , n &# 39 ;-( m - phenylene ) bismaleimide , n , n &# 39 ;- p -( phenylene )- bismaleimide , n , n &# 39 ;-( o - phenylene ) bismaleimide , n , n &# 39 ;-( 1 , 3 - naphthylene ) bismaleimide , n , n &# 39 ;-( 1 , 4 - naphthylene )- bismaleimide , n , n &# 39 ;-( 1 , 5 - naphthylene ) bismaleimide , n , n -( 3 , 3 &# 39 ;- dimethyl - 4 , 4 &# 39 ;- diphenylene ) bismaleimide , n , n &# 39 ;-( 3 , 3 - dichloro - 4 , 4 &# 39 ;- biphenylene ) bismaleimide , n , n &# 39 ;-( 2 , 4 - pyridyl ) bismaleimide , n , n &# 39 ;-( 2 , 6 - pyridyl )- bismaleimide , n , n &# 39 ;-( m - tolylene ) bismaleimide , n , n &# 39 ;-( p - tolylene ) bismaleimide , n , n &# 39 ;-( 4 , 6 - dimethyl - 1 , 3 - phenylene ) bismaleimide , n , n &# 39 ;-( 2 , 3 - dimethyl - 1 , 4 - phenylene ) bismaleimide , n , n &# 39 ;-( 4 , 6 - dichloro - 1 , 3 - phenylene ) bismaleimide , n , n &# 39 ;-( 5 - chloro - 1 , 3 - phenylene )- bismaleimide , n , n &# 39 ;-( 5 - hydroxy - 1 , 3 - phenylene )- bismaleimide , n , n &# 39 ;-( 5 - methoxy - 1 , 3 - phenylene )- bismaleimide , n , n &# 39 ;-( m - xylylene ) bismaleimide , n , n &# 39 ;-( p - xylylene ) bismaleimide , n , n &# 39 ;-( methylenedi - p - phenylene )- bismaleimide , n , n &# 39 ;-( isopropylidenedi - p - phenylene )- bismaleimide , n , n &# 39 ;-( oxydi - p - phenylene ) bismaleimide , n , n &# 39 ;-( thiodi - p - phenylene ) bismaleimide , n , n &# 39 ;-( dithiodi - p - phenylene ) bismaleimide , n , n &# 39 ;-( sulfodi - p - phenylene )- bismaleimide , n , n &# 39 ;-( carbonyldi - p - phenylene )- bismaleimide , α , α - bis -( 4 - maleimidophenyl )- meta - diisopropylbenzene , α , α - bis -( 4 - p - phenylene ) bismaleimide , n , n &# 39 ;- m - xylylene - bis - citraconic imide and α , α - bis -( 4 - maleimidophenyl )- para - diisopropylbenzene . the preferred bismaleimide is n , n &# 39 ;-( m - phenylene ) bismaleimide . the sulfenamide compound of formula ii is the 5 fourth essential component of the present invention . the sulfenamide is generally present in an amount of from about 0 . 5 to about 3 phr . preferably , the sulfenamide is present in an amount ranging from about 0 . 70 to about 2 . 0 phr . representative of the sulfenamide compounds of formula ii and which may be used in the present invention include n - cyclohexyl - 2 - benzothiazylsulfenamide , n - t - butyl - 2 - benzothiazylsulfenamide , n , n - dicyclohexyl - 2 - benzothiazylsulfenamide , n - isopropyl - 2 - benzothiazylsulfenamide , and n - t - butylbis -( 2 - benzothiazylsulfen ) amide . preferably , the sulfenamide compound is n - cyclohexyl - 2 - benzothiazylsulfenamide . examples of rubbers for use in the present invention include substituted and unsubstituted , saturated and unsaturated , natural and synthetic polymers . the natural polymers include natural rubber in its various forms , e . g ., pale crepe and smoked sheet , and balata and gutta percha . the synthetic polymers are derived from a diene monomer and include those prepared from a single monomer ( homopolymer ) or a mixture of two or more copolymerizable monomers ( copolymer ) when the monomers are combined in the random distribution or block form . the monomers may be substituted or unsubstituted and may possess one or more double bonds , conjugated and nonconjugated dienes and monoolefins , including cyclic and acyclic monoolefins , especially vinyl and vinylidene monomers . examples of conjugated dienes are 1 , 3 - butadiene , isoprene , chloroprene , 2 - ethyl - 1 , 3 - butadiene , 2 , 3 - dimethyl - 1 , 3 - butadiene and piperylene . examples of nonconjugated dienes are 1 , 4 - pentadiene , 1 , 4 - hexadiene , 1 , 5 - hexadiene , dicyclopentadiene , 1 , 5 - cyclooctadiene , and ethyldiene norbornene . examples of acyclic monoolefins are ethylene , propylene , 1 - butene , isobutylene , 1 - pentene and 1 - hexene . examples of cyclic monoolefins are cyclopentene , cyclohexene , cycloheptene , cyclooctene and 4 - methyl - cyclooctene . examples of vinyl monomers are styrene , acrylonitrile , acrylic acid , ethylacrylate , vinyl chloride , butylacrylate , methyl vinyl ether , vinyl acetate and vinyl pyridine . examples of vinylidene monomers are alpha - methylstyrene , methacrylic acid , methyl methacrylate , itaconic acid , ethyl methacrylate , glycidyl methacrylate and vinylidene chloride . representative examples of the synthetic polymers used in the practice of this invention are polychloroprene homopolymers of a conjugated 1 , 3 - diene such as isoprene and butadiene , and in particular , polyisoprenes and polybutadienes having essentially all of their repeat units combined in a cis - 1 , 4 - structure ; and copolymers of a conjugated 1 , 3 - diene such as isoprene and butadiene with up to 50 % by weight of at least one copolymerizable monomer , including ethylenically unsaturated monomers such as styrene or acrylonitrile ; and butyl rubber , which is a polymerization product of a major proportion of a monoolefin and a minor proportion of a diolefin such as butadiene or isoprene . the rubber may be emulsion polymerized or solution polymerized . the preferred rubbers which may be used with the present invention are cis - 1 , 4 - polyisoprene ( natural or synthetic ), polybutadiene , polychloroprene and the copolymers of isoprene and butadiene , copolymers of acrylonitrile and butadiene , copolymers of acrylonitrile and isoprene , copolymers of styrene , butadiene and isoprene , copolymers of styrene and butadiene and blends thereof . as known to one skilled in the art , in order to cure a rubber stock , one needs to have a sulfur vulcanizing agent . examples of suitable sulfur vulcanizing agents include elemental sulfur ( free sulfur ) or a sulfur donating vulcanizing agent , for example , an amine disulfide , polymeric polysulfide or sulfur olefin adducts . preferably , the sulfur vulcanizing agent is elemental sulfur . the amount of sulfur vulcanizing agent will vary depending on the components of the rubber stock and the particular type of sulfur vulcanizing agent that is used . the sulfur vulcanizing agent is generally present in an amount ranging from about 0 . 5 to about 6 phr . preferably , the sulfur vulcanizing agent is present in an amount ranging from about 0 . 75 phr to about 4 . 0 phr . conventional rubber additives may be incorporated in the rubber stock of the present invention . the additives commonly used in rubber stocks include fillers , plasticizers , waxes , processing oils , retarders , antiozonants , antioxidants and the like . the total amount of filler that may be used may range from about 30 to about 150 phr , with a range of from about 45 to about 100 phr being preferred . fillers include clays , calcium carbonate , calcium silicate , titanium dioxide and carbon black . representatives carbon blacks that are commonly used in rubber stocks include n - 326 , n - 330 , n - 472 , n - 660 , n - 754 , n - 762 , n - 765 and n - 990 . plasticizers are conventionally used in amounts ranging from about 2 to about 50 phr with a range of about 5 to about 30 phr being preferred . the amount of plasticizer used will depend upon the softening effect desired . examples of suitable plasticizers include aromatic extract oils , petroleum softeners including asphaltenes , pentachlorophenol , saturated and unsaturated hydrocarbons and nitrogen bases , coal tar products , cumarone - indane resins and esters such as dibutylphthalate and tricresol phosphate . common waxes which may be used include paraffinic waxes and microcrystalline blends . such waxes are used in amounts ranging from about 0 . 5 to 3 phr . materials used in compounding which function as an accelerator - activator includes metal oxides such as zinc oxide and magnesium oxide which are used in conjunction with acidic materials such as fatty acid , for example , stearic acid , oleic acid , murastic acid , and the like . the amount of the metal oxide may range from about 1 to about 14 phr with a range of from about 2 to about 8 phr being preferred . the amount of fatty acid which may be used may range from about 0 phr to about 5 . 0 phr with a range of from about 0 phr to about 2 phr being preferred . in addition to the claimed combination of accelerators that are non - nitrosamine generators , additional accelerators , preferably also non - nitrosoamine generating may be used . such accelerators are used to control the time and / or temperatures required for vulcanization and to improve the properties of the vulcanizate . for example , as an optional secondary accelerator , n , n &# 39 ;- di - orthotolylguanidine or n , n &# 39 ;- diphenylguanidine may be used in an amount ranging from about 0 . 05 to 3 phr . siliceous pigments may be used in the rubber compound applications of the present invention , including pyrogenic and precipitated siliceous pigments ( silica ), although precipitate silicas are preferred . the siliceous pigments preferably employed in this invention are precipitated silicas such as , for example , those obtained by the acidification of a soluble silicate , e . g ., sodium silicate . such silicas might be characterized , for example , by having a bet surface area , as measured using nitrogen gas , preferably in the range of about 40 to about 600 , and more usually in a range of about 50 to about 300 square meters per gram . the bet method of measuring surface area is described in the journal of the american chemical society , volume 60 , page 304 ( 1930 ). the silica may also be typically characterized by having a dibutylphthalate ( dbp ) absorption value in a range of about 100 to about 400 , and more usually about 150 to about 300 . the silica might be expected to have an average ultimate particle size , for example , in the range of 0 . 01 to 0 . 05 micron as determined by the electron microscope , although the silica particles may be even smaller , or possibly larger , in size . various commercially available silicas may be considered for use in this invention such as , only for example herein , and without limitation , silicas commercially available from ppg industries under the hi - sil trademark with designations 210 , 243 , etc ; silicas available from rhone - poulenc , with , for example , designations of z1165mp and z165gr and silicas available from degussa ag with , for example , designations vn2 and vn3 , etc . the ppg hi - sil silicas are currently preferred . a class of compounding materials known as scorch retarders are commonly used . phthalic anhydride , salicylic acid , sodium acetate and n - cyclohexyl thiophthalimide are known retarders . retarders are generally used in an amount ranging from about 0 . 1 to 0 . 5 phr . in - situ resins may be formed in the rubber stock and involve the reaction of cashew nut oil modified novolak - type phenolic resin and a methylene donor . the term &# 34 ; methylene donor &# 34 ; is intended to mean a compound capable of reacting with the cashew nut oil modified novolak - type phenolic resin and generate the resin in - situ . examples of methylene donors which are suitable for use in the present invention include hexamethylenetetramine , hexaethoxymethylmelamine , hexamethoxymethylmelamine , lauryloxymethylpyridinium chloride , ethoxymethylpyridinium chloride , trioxan hexamethoxymethylmelamine , the hydroxy groups of which may be esterified or partly esterified , and polymers of formaldehyde such as paraformaldehyde . in addition , the methylene donors may be n - substituted oxymethylmelamines , of the general formula : ## str7 ## wherein x is an alkyl having from 1 to 8 carbon atoms , r 7 , r 8 , r 9 , r 10 and r 11 are individually selected from the group consisting of hydrogen , an alkyl having from 1 to 8 carbon atoms , the group -- ch 2 ox or their condensation products . specific methylene donors include hexakis -( methoxymethyl ) melamine , n , n &# 39 ;, n &# 34 ;- trimethyl / n , n &# 39 ;, n &# 34 ;- trimethylolmelamine , hexamethylolmelamine , n , n &# 39 ;, n &# 34 ;- dimethylolmelamine , n - methylolmelamine , n , n &# 39 ;- dimethylolmelamine , n , n &# 39 ;, n &# 34 ;- tris ( methoxymethyl ) melamine and n , n &# 39 ; n &# 34 ;- tributyl - n , n &# 39 ;, n &# 34 ;- trimethylol - melamine . the n - methylol derivatives of melamine are prepared by known methods . the amount of methylene donor that is present in the rubber stock may vary . typically , the amount of methylene donor that is present will range from about 0 . 1 phr to 10 . 0 phr . preferably , the amount of methylene donor ranges from about 2 . 0 phr to 5 . 0 phr . conventionally , antioxidants and sometimes antiozonants , hereinafter referred to as antidegradants , are added to rubber stocks . representative antidegradants include monophenols , hisphenols , thiobisphenols , polyphenols , hydroquinone derivatives , phosphites , thioesters , naphthyl amines , diphenyl - p - phenylenediamines , diphenylamines and other diaryl amine derivatives , para - phenylenediamines , quinolines and mixtures thereof . specific examples of such antidegradants are disclosed in the vanderbilt rubber handbook ( 1990 ), pages 282 - 286 . antidegradants are generally used in amounts from about 0 . 25 to about 5 . 0 phr with a range of from about 1 . 0 to about 3 . 0 phr being preferred . when the compound of the present invention is used as a wire coat or bead coat for use in a tire , the compound generally contains an organo - cobalt compound which serves as a wire adhesion promoter . any of the organo - cobalt compounds known in the art to promote the adhesion of rubber to metal may be used . thus , suitable organo - cobalt compounds which may be employed include cobalt salts of fatty acids such as stearic , palmitic , oleic , linoleic and the like ; cobalt salts of aliphatic or alicyclic carboxylic acids having from 6 to 30 carbon atoms ; cobalt chloride , cobalt naphthenate ; cobalt carboxylate and an organo - cobalt - boron complex commercially available under the designation manobond c from wyrough and loser , inc , trenton , n . j . manobond c is believed to have the structure : ## str8 ## in which r 12 is an alkyl group having from 9 to 12 carbon atoms . amounts of organo - cobalt compound which may be employed depend upon the specific nature of the organo - cobalt compound selected , particularly the amount of cobalt metal present in the compound . since the amount of cobalt metal varies considerably in organo - cobalt compounds which are suitable for use , it is most appropriate and convenient to base the amount of the organo - cobalt compound utilized on the amount of cobalt metal desired in the finished stock composition . accordingly , it may in general be stated that the amount of organo - cobalt compound present in the stock composition should be sufficient to provide from about 0 . 01 percent to about 0 . 35 percent by weight of cobalt metal based upon total weight of the rubber stock composition with the preferred amounts being from about 0 . 03 percent to about 0 . 2 percent by weight of cobalt metal based on total weight of skim stock composition . the rubber compounds of the present invention may also contain a cure activator . a representative cure activator is methyl trialkyl ( c 8 - c 10 ) ammonium chloride commercially available under the trademark adogen ® 464 from sherex chemical company of dublin , ohio . the amount of activator may be used in a range of from 0 . 05 to 5 phr . the sulfur vulcanizable rubber compound is cured at a temperature ranging from about 125 ° c . to 180 ° c . preferably , the temperature ranges from about 135 ° c . to 160 ° c . the presence and relative amounts of the above additives are not considered to be an aspect of the present invention which is more primarily directed to the utilization of specified combination of sulfur , tetrabenzylthiuram disulfide , cashew nut oil modified novolak - type phenolic resin , a bismaleimide compound and a sulfenamide compound . the mixing of the rubber compound can be accomplished by methods known to those having skill in the rubber mixing art . for example , the ingredients are typically mixed in at least two stages , namely at least one non - productive stage followed by a productive mix stage . the final curatives are typically mixed in the final stage which is conventionally called the &# 34 ; productive &# 34 ; mix stage in which the mixing typically occurs at a temperature , or ultimate temperature , lower than the mix temperature ( s ) than the preceding non - productive mix stage ( s ). the cashew nut oil modified novolak - type phenolic resin is mixed in one or more non - productive mix stages . the sulfur , tetrabenzylthiuram disulfide , bismaleimide and sulfenamide compound is generally mixed in the productive mix stage . the terms &# 34 ; non - productive &# 34 ; and &# 34 ; productive &# 34 ; mix stages are well known to those having skill in the rubber mixing art . the rubber composition of this invention can be used for various purposes . for example , it can be used for various tire compounds . such pneumatic tires can be built , shaped , molded and cured by various methods which are known and will be readily apparent to those having skill in such art . preferably , the rubber composition is used as a wire coat or bead coat . as can be appreciated , the tire may be a passenger tire , aircraft tire , truck tire and the like . the present invention may be better understood by reference to the following examples in which the parts or percentages are by weight unless otherwise indicated . the rubber stock was prepared in a two non - productive , one productive banbury mix procedure . other than the ingredients listed in table i , both samples contained the same conventional amount of silica , carbon black processing oil , silica coupler , ozone oxide , adhesion promoter , methylene donor , antidegradants , secondary accelerator and cure activator . table i below shows the remaining ingredients . all parts and percentages are by weight unless otherwise noted . table i______________________________________ controlsample 1 2______________________________________nonproductivepolyisoprene . sup . 1 40 . 00 40 . 00sbr . sup . 2 60 . 00 60 . 00resorcinol 5 . 00 0cashew nut oil modified phenolic resin . sup . 3 0 5 . 00productivesulfur 5 . 00 5 . 00chtp . sup . 4 0 . 15nodbts . sup . 5 1 . 00tbbts . sup . 6 0 . 80bismaleimide . sup . 7 0 . 50tbtd . sup . 8 0 . 20______________________________________ . sup . 1 solution polymerized polyisoprene commercially available from the goodyear tire & amp ; rubber company under the tradmark designation natsyn . rtm 2200 . sup . 2 emulsion polymerized styrene butadiene commercially available from the goodyear tire & amp ; rubber company under the trademark designation plioflex ® 1502 . sup . 3 cashew nut oil modified novolaktype phenolic resin commercially available from schenectady chemicals inc under the designation sp6700 . . sup . 4 ncyclohexylthiophthalimide . sup . 5 noxydiethylene benzothiazole 2sulfenamide . sup . 6 nt - butyl - 2 - benzothiazylsulfenamide . sup . 7 n , n ( m - phenylene ) bismaleimide . sup . 8 tetrabenzylthiuram disulfide cure properties were determined using a monsanto oscillating disc rheometer which was operated at a temperature of 150 ° c . and 100 cycles per minute . a description of oscillating disc rheometers can be found in the vanderbilt rubber handbook edited by robert o . ohm ( norwalk , conn ., r . t . vanderbilt company , inc ., 1990 ), pages 554 - 557 . the use of this cure meter and standardized values read from the curve are specified in astmd - 2084 . a typical cure curve obtained on an oscillating disc rheometer is shown on page 555 of the 1990 edition of the vanderbilt rubber handbook . in such an oscillating disc rheometer , compounded rubber samples are subjected to an oscillating shearing action of constant amplitude . the torque of the oscillating disc embedded in the stock that is being tested that is required to oscillate the rotor at the vulcanization temperature is measured . the values obtained using this cure test are very significant since changes in the rubber or the compounding recipe are very readily detected . it is obvious that it is normally advantageous to have a fast cure rate . the following table ii reports cure properties that were determined from cure curves that were obtained for the rubber stocks that were prepared . these properties include a torque minimum ( min . torque ), a torque maximum ( max . torque ), minutes to 25 % of the torque increase ( t25 ), minutes to 90 percent of the torque increase ( t90 ) and difference between the maximum torque and minimum torque ( delta torque ). table ii______________________________________ controlsample 1 2______________________________________sulfur 5 . 00 5 . 00chtp 0 . 15 0noobts 1 . 00 0tbbts 1 . 00 0 . 80bismaleimide 0 0 . 50tbtd 0 0 . 20resorcinol 5 . 00 0cashew nut oil modified phenolic resin 0 5 . 00stress strain for 40 min cure @ 135 ° c . tensile @ break ( mpa ) 16 . 5 16 . 6elongation @ break (%) 432 34250 % modulus ( mpa ) 3 . 4 4 . 1100 % modulus ( mpa ) 5 . 1 6 . 1150 % modulus ( mpa ) 7 . 1 8 . 6200 % modulus ( mpa ) 9 . 3 11 . 1250 % modulus ( mpa ) 11 . 1 13 . 3shore a hardness @ rt 94 93stress strain for 80 min cure @ 135 ° c . tensile @ break ( mpa ) 17 . 0 14 . 8elongation @ break (%) 267 20050 % modulus ( mpa ) 5 . 3 5 . 8100 % modulus ( mpa ) 8 . 2 8 . 7150 % modulus ( mpa ) 11 . 2 11 . 9200 % modulus ( mpa ) 13 . 8 14 . 7shore a hardness @ rt 95 95bead wire adhesion ( n )* 1010 913rheometer 100 cm @ 135 ° c . max . torque ( dnm ) 90 . 0 92 . 4min . torque ( dnm ) 15 . 3 14 . 0delta torque ( dnm ) 74 . 7 78 . 4t90 ( min .) 80 . 6 87 . 5t25 ( min .) 15 . 0 18 . 4t ( 2 ) ( min .) 6 . 8 9 . 2stress strain for 40 min cure @ 135 ° c . samples aged 7 hours in air bomb at 120 ° c . tensile @ break ( mpa ) 13 . 2 13 . 6elongation @ break (%) 192 15450 % modulus ( mpa ) 5 . 5 6 . 5100 % modulus ( mpa ) 8 . 4 10 . 0150 % modulus ( mpa ) 11 . 2 13 . 3stress strain for 80 min cure @ 135 ° c . samples aged 7 hours in air bomb at 120 ° c . tensile @ break ( mpa ) 13 . 6 13 . 3elongation @ break (%) 132 12550 % modulus ( mpa ) 7 . 4 7 . 5100 % modulus ( mpa ) 11 . 4 11 . 4strebler adhesion at 95 ° c ., 80 min cure , 15 . 2 12 . 510 min lag ( n ) bead wire adhesion ( n )* 959 889______________________________________ * astm d 1871 method 1 rubber block procedure control sample 1 and sample 2 represent a comparison between a conventional cure system which contains nitrosamine generators and volatile resorcinol ( sample 1 ) and sample 2 without either nitrosamine generators or volatile resorcinol . both samples have very similar test results except for sample 2 having slightly greater cure state . the main advantage here is the ability to remove both nitrosamine generators and volatile resorcinol while maintaining critical properties . the rubber stock was prepared in a two nonproductive , one productive mix procedure . other than the ingredients listed in table 3 , all samples were identical to the samples of example 1 . all parts and percentages are by weight unless otherwise noted . table iii______________________________________ controlsample 1 2 3 4______________________________________resorcinol 5 . 00 0 0 0cashew nut oil modified 0 3 . 00 5 . 00 7 . 00phenolic resin . sup . 1sulfur 5 . 00 5 . 00 5 . 00 5 . 00chtp 0 . 15 0 0 0nodbts 1 . 00 0 0 0nchbtd . sup . 2 0 0 . 20 0 . 20 0 . 20bismaleimide 0 1 . 10 1 . 10 1 . 10tbtd 0 0 . 30 0 . 30 0 . 30______________________________________ . sup . 1 sp 6700 . sup . 2 ncyclohexyl benzothiazole sulfenamide table iv______________________________________ controlsample 1 2 3 4______________________________________rheometer 100 cpm @ 150 ° c . max torque ( dnm ) 92 . 8 85 . 2 87 . 2 90 . 6min torque ( dnm ) 15 . 6 16 . 7 16 . 9 17 . 2delta torque ( dnm ) 77 . 2 68 . 5 70 . 3 73 . 4t90 ( min ) 30 . 2 41 . 3 42 . 2 42 . 6t25 ( min ) 6 . 0 9 . 9 10 . 0 9 . 9t2 ( min ) 2 . 5 3 . 9 3 . 8 3 . 6rheometer 100 cpm @ 135 ° c . max torque ( dnm ) 94 . 3 77 . 1 77 . 2 81 . 2min torque ( dnm ) 17 . 9 18 . 0 18 . 2 18 . 8delta torque ( dnm ) 76 . 4 59 . 1 59 . 0 62 . 4t90 ( min ) 78 . 0 94 . 0 94 . 5 95 . 1t25 ( min ) 15 . 2 25 . 3 26 . 1 25 . 0t2 ( min ) 6 . 6 9 . 2 8 . 5 8 . 6stress strain for 40 min cure @ 135 ° c . tensile @ break ( mpa ) 15 . 9 12 . 4 10 . 6 9 . 8elongation @ break (%) 406 452 482 43350 % modulus ( mpa ) 3 . 6 2 . 5 2 . 5 2 . 7100 % modulus ( mpa ) 5 . 0 3 . 4 3 . 2 3 . 3150 % modulus ( mpa ) 6 . 9 4 . 7 4 . 2 4 . 2200 % modulus ( mpa ) 8 . 9 6 . 3 5 . 4 5 . 3250 % modulus ( mpa ) 10 . 7 7 . 9 6 . 7 6 . 5stress strain for 80 min cure @ 135 ° c . tensile @ break ( mpa ) 15 . 4 17 . 1 17 . 1 16 . 8elongation @ break (%) 274 338 330 31850 % modulus ( mpa ) 5 . 1 4 . 0 4 . 3 4 . 8100 % modulus ( mpa ) 7 . 8 6 . 2 6 . 5 6 . 8150 % modulus ( mpa ) 10 . 5 8 . 7 9 . 0 9 . 2200 % modulus ( mpa ) 13 . 1 11 . 4 11 . 6 11 . 5shore a hardnessrt ( 40 min cure @ 135 ° c .) 83 86 86 88rt ( 80 min cure @ 135 ° c .) 89 86 87 83strebler adhesion at 29 . 1 37 . 2 33 . 3 29 . 395 ° c ., 80 min cure , 10min lag ( n ) bead wire adhesion * ( n ) 1095 972 1108 1176______________________________________ astm d 1871 method 1 rubber block procedure the second example demonstrates the advantage of increasing levels of cashew nut oil modified - phenolic resin ( sp6700 ). as the sp6700 was increased in steps from 3 to 7 phr , the main effect was the increasing bead wire adhesion which increased from 972 to 1176 newtons . example 2 also compares the control with each sample in table iv . when control sample 1 was compared with sample 4 , it is evident that sample 4 cures slower , based on both rheometer and tensile / elongation / modulus for stocks cured 40 minutes at 135 ° c . however , when stocks were cured 80 minutes at 135 ° c ., both tensile and elongation for sample 4 were both greater than sample 1 with the modulus only slightly lower . bead wire adhesion for sample 4 was improved over the sample 1 control . thus , it is possible to remove nitrosamine generators and volatile resorcinol and still improve tensile / elongation and wire adhesion .	2
the present inventors have devised a novel system method of providing functionality for users connected to mobile communication networks , such as a cellular phone networks . disclosed is an instant messaging platform having an embedded web browser for internet content . the system also comprises a display and control module , which provides the user interface for the dual instant messaging and web browsing sub - systems . users are informed when an instant message has arrived and may discover who sent the message and the message content without the need to switch applications . in this system , users can easily move back - and - forth between instant messaging and web browsing activities using the user interface without the need to select and open a new program application on their mobile devices . moreover , the present inventors devised a novel business method of improving safety of children on the internet , as well as increasing revenues for communication networking companies . according to the methods , websites are preapproved prior to being made available to users of the network . thus , access of offensive or dangerous website to children it prevented . revenues are increased by only preapproving websites that pay the communication &# 39 ; s network a fee . according to embodiments shown in fig1 , mobile device 100 is shown having integrated instant messaging and web browsing system 105 . mobile device 100 is , according to embodiments , a mobile phone , personal digital assistant ( pda ), other embedded devices , and the like . according to other embodiments , mobile device 100 may comprise a mobile computer . artisans will recognize that although the principles of the present disclosure are couched in terms of mobile computing , the same principles are applicable to nearly any device capable of executing machine readable instruction . accordingly , integrated instant messaging and web browsing system 105 integrates both web browsing module 130 , which provides a platform for viewing content from the internet , and instant messaging module 120 , which provides a platform for sending and receiving instant messages , into a single application . instant messages may be any short message sent from a device to another device over a network . integrated instant messaging and web browsing system 105 provides display and control module 110 to users 400 that allow users 400 to easily switch between instant messaging module 120 and web browsing module 130 ( as shown in fig3 a and 3b ) and display web browsing module 130 , instant messaging module 120 , or both on the screen of mobile device 100 . according to embodiments , for example as shown in fig2 , display and control module 110 manages all user interaction from a mobile device &# 39 ; s input mechanism , such as the keypad of a mobile phone , manages separate threads of activities of integrated instant messaging and browsing system 105 , including website browsing and instant messaging activities that may be executing in parallel , and displays content on the screen of mobile device 100 . as shown according to the embodiment of fig2 , display and control module 110 comprises user interface 111 and background threads 115 . user interface 111 comprises a thread that captures inputs from user 400 and renders outputs from several background threads 115 executing in parallel , according to embodiments . user interface 111 comprises the following components : main window module 112 , message bar 113 , and input mechanisms and menu buttons module 114 . according to embodiments , main window module 112 renders the primary content selected by user 400 on a display . it may comprise rendering a web page on the display , an instant messaging dialog that is currently in progress on the display , or a system menu , according to embodiments . similarly according to embodiments , main window module 112 displays instant messages and web browser content simultaneously ( in parallel ). artisans will understand how to implement an appropriate output to a display without undue experimentation . likewise according to embodiments , message bar 113 conveys messages to user 400 , including the arrival of new instant messaging messages , for example . according to embodiments , message bar 113 is super - imposed over the content of main window module 112 that is being displayed for a brief time while the message is conveyed to the user . according to similar embodiments , message bar 113 may occupy a portion of the display permanently , until cleared , or for a short period of time . the other contents of the display will be shifted around the portion of the display having a message bar 113 . according to still other embodiments , message bar 113 is “ ticker tape ”- tape banner that occupies a relatively small portion of the display and provides user 400 with instant messaging alerts , such as an instant message received , or other messages from integrated instant messaging and browsing system 105 or mobile device 100 . accordingly , in some embodiments , user 400 will be able to choose the desired behavior of message bar 113 as a modifiable setting . according to embodiments , message bar 113 may also display a notification when each web page has completed downloading and rendering and is ready to be viewed . finally , input mechanisms and menu buttons module 114 allow user to interact with display and control module 110 . they form a set of commands and inputs that are interpreted when the user activates specific input mechanisms on mobile device 100 . according to embodiments , input mechanisms are buttons , thumb wheels , touch pads , touch screens , and other input mechanisms for mobile devices and non - mobile devices . moreover , input mechanisms and menu buttons module 114 map commands to corresponding input mechanisms on a device . for example and as shown in fig3 a and fig3 b , the “ switch ” and “ enter ” commands are mapped to the buttons that they reside in closest proximity with . another example is the input of text from the number pad of a cellular phone . similarly , for example , menu items are navigated with arrow keys ; as each menu option is navigated to with the arrow keys , it is highlighted . pressing an “ enter ” or “ ok ” button will send a command to select the highlighted option . artisans will known and understand the many variations of mapping input mechanisms with commands and inputs . input from input mechanisms and menu buttons module 114 is interpreted based on the type of content in main window 112 , according to embodiments . for example and according to embodiments , a down - arrow on mobile device 100 does not have a function ( associated command to execute ) when main window 112 is rendering an instant messaging dialog . however , it moves a logical cursor when main window 112 is rendering a system menu or a web page with links . thus , input mechanisms and menu buttons module 114 may be context sensitive , depending on the thread or threads being shown on the display , according to embodiments . typically , for example , user 400 may be viewing a web page within main window 112 and receive a new instant messaging message , which is indicated to the user via message bar 113 . user 400 may then continue with web browsing in main window 112 or execute a command using input mechanisms and menu buttons module 114 to switch to a revised main window 112 showing the instant messaging dialog and allow user 400 to engage in a conversation with another user . background threads 115 , operating in parallel , comprise instant messaging reader thread 117 , instant messenger writer thread 117 , and web browser thread 118 . instant messaging reader thread 117 invokes instant messaging module 120 with instructions to accept messages sent by instant messaging server 300 , according to embodiments . similarly , instant messenger reader thread 117 interacts with user interface 111 to display incoming instant messages , according to embodiments . for example , instant messenger reader thread 117 causes message bar 113 to alert user 400 that a new instant message has arrived if content displayed by main window module 112 is displaying web pages ; if the content displayed by main window module 112 is instant messaging , then instant messenger reader thread 117 causes the incoming message to be accordingly displayed . according to embodiments , instant messaging writer thread 117 invokes the instant messaging module 120 with instructions to send messages to messaging server 300 . instant messaging writer thread 117 is invoked , according to embodiments , when user 400 activates input mechanisms and menu buttons module 114 with one or more commands wherein text is entered and a command indicating that the test that has been entered and is ready to pass to instant messaging module 120 . according to embodiments , web browser thread 118 invokes web browser module with instructions to request a specific web - based service and then caches ( stores ) the reply results . web browser thread 118 also interacts with user interface 111 to both display stored web pages and receive input from user 400 directing instant messaging and web browsing system 105 to the webpages to be viewed . according to embodiments , users may directly input uniform resource indicator ( uri ) addresses to access specific webpages or may select webpages from a menu . each of instant messaging reader thread 117 , instant messaging writer thread 117 , web browser thread 118 , and user interface 111 occur in parallel : instant messaging messages may be sent , instant messaging messages may be received , and web pages may be requested and cached for rendering simultaneously within the confines of a single program application , according to embodiments . because each thread operates in parallel with the other threads , instant messaging messages , for instance , are received within instant messaging reader thread 117 while user 400 is making web page requests within the web browser thread 118 . according to embodiments , an internal application - programming interface ( api )/ callback mechanism is used to alert user interface 111 when one or more background threads 115 have performed an activity that requires rendering either in main window 112 or in message bar 113 . according to embodiments , when instant message reader thread 117 receives a message , it calls the api within user interface 111 , and then user interface 111 conveys that message in message bar 113 . the other features are similarly communicated between the various modules , threads , and interfaces of the present disclosure . multiple web browser threads 118 may be invoked in parallel , according to embodiments . for example , user interface 111 may render one web page , the result of one thread , and then render the next web page , the result of another thread , as per user &# 39 ; s 400 request as indicated by user 400 using input mechanisms and menu buttons module 114 . according to embodiments , each web browser thread 118 comprises a main window module 112 content set ; thus , user may use a “ switch ” function to browse each individual display page of content much like opening individual web browser windows in traditional computing platforms . fig3 a and 3b show mobile device 100 in two iterations . display and control module 110 a is configured to show both a webpage and a instant messaging area on the screen of mobile device 100 . according to embodiments , user 400 may switch between various displays by activating a “ switch ” command , for example . pressing it once will “ close ” integrated web browser module 130 ( shown at 110 b ). artisans will recognize that as web browsing module 130 and instant messaging module 120 are part of a single program application , according to embodiments , “ closing ” integrated web browser module 130 or instant messaging module 120 merely causes the screen to display only web browser module 130 or instant messaging module 120 depending at the time the input is activated . the “ closed ” module remains available and will continue to operate in the background . thus , a web page may be selected and web browser module 130 will load the webpage , even if the web browser module 130 screen is “ closed ” and instant messaging module 120 screen is activated . according to embodiments , a percentage of a screen may be devoted to web browsing module 130 and a percentage of a screen may simultaneously display instant messaging module ( shown as 110 a in fig3 .) according to embodiments , display and control module 110 a also provides an integrated method of switching between instant messaging mode , as shown as a tool bar at the bottom of the screen with commands “ switch ” and “ enter ” corresponding with two keypad buttons on mobile device 100 . artisans will recognize that other commands may be mapped to a tool bar , according to embodiments . according to other embodiments , toolbar will be omitted to conserve screen space and users 400 must learn which commands correspond to which buttons on their respective input devices . according to embodiments , web browser module 130 manages all interaction with external web servers 200 and assists display and control module 110 when rendering materials is returned by those web servers 200 . likewise according to embodiments , instant messaging module 120 manages all interaction with external instant messaging servers 300 and assists display and control module 110 when rendering messages returned by those instant messaging servers 300 . web browser module 130 and instant messaging module 120 operates in parallel , according to embodiments , so network messages may be received while websites are being browsed . display and control module 110 may display materials received by web server 200 , messages received by instant messaging server 300 , or a combination of both types of materials if both types of materials are be received in parallel . communications between user 400 and the display of display and control module 110 is performed through the physical interface provided by mobile device 100 . for a cellular telephone , for example , this comprises a display screen , keypad , and other input mechanisms built into the telephone . similarly , for pdas may comprise a screen , keyboard and other buttons , thumbwheel , touch screen , or combinations thereof . depending on the device , artisans will recognize the applicable input mechanisms that may be employed to operate the systems and method of the present disclosure . according to embodiments , display and control module 110 is configurable to ensure that user 400 may only request specific web sites . if this configuration has bene employed , then display and control module 110 will only allow those specific web server addresses to be passed to the web browser module 130 . thus , according to embodiments integrated instant messaging and browsing system 105 provides a platform in which responsible parties for mobile device 100 may filter content viewed by users 400 . moreover according to embodiments , mobile communications companies may contract with web sites to provide their website to users 400 of the mobile communications company via integrated instant messaging and web browser system 105 , providing an additional source of revenue to the mobile communications company . according to embodiments , integrated instant messaging and browsing system 105 works in conjunction with existing instant messaging servers 300 and web servers 200 . thus , communications networks need not install any additional server software because integrated instant messaging and web browsing system 105 seamlessly connects to existing instant messaging servers 300 and web servers 200 . integrated instant messaging and web browsing system 105 may either be preloaded on mobile device 100 at part of the operating system , embedded on a chip contained within mobile device 100 ( i . e ., be “ embedded ”), or as an add - on program application . users 400 may also download and install integrated instant messaging and web browsing system 105 , according to embodiments . according to embodiments , communications between the website browser module 130 and web servers 200 is performed using the hypertext transfer protocol ( http ). accordingly , other protocols are similarly contemplated , according to embodiments including , dhcp , dns , ptp , imap4 , irc , mime , pop3 , sip , smtp , snmp , ssh , telnet , http , https , bgp , rpc , rtp , rtcp , tls / ssl , sdp , soap , l2tp , pptp , and others known and understood by artisans , according to embodiments . according to embodiments , website browser module 130 communicates with web servers 200 via tcp internet protocol , which in turn can operate over any of several types of physical networks , including cellular phone networks . other communications protocols are likewise contemplated according to embodiments , such as tcp , tcp / ip , udp , dccp , sctp , gtp , wap datagram protocol , and others that would be known and understood by artisans . according to embodiments , communications between the instant messaging module 120 and instant messaging server 300 is performed using the extensible messaging and presence protocol ( xmpp ), according to embodiments . other instant messaging protocols are likewise contemplated , including gadu - gadu , cspace , irc , meca network , msnp , oscar , protocol for synchronous conferencing , toc , toc2 , sip / simple , yahoo messenger , directnet , xmpp , zephyr notification , gale , skype , and combinations thereof , according to embodiments . instant messaging module 120 also operates over the tcp internet protocol , according to embodiments , and may also operate over any of several types of physical networks as previously described . other communications protocols are likewise contemplated according to embodiments , such as tcp , tcp / ip , udp , dccp , sctp , gtp , wap datagram protocol , and others that would be known and understood by artisans . the integrated instant messaging and web browsing system 105 and method herein may be described in the general context of computer - executable instructions , such as program modules , being executed by a computer . generally , program modules include routines , programs , objects , components , data structures , etc . that perform particular tasks or implement particular abstract data types . the system may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network . in a distributed computing environment , program modules may be located in both local and remote computer storage media including memory storage devices . the computer programs are stored in a memory medium or storage medium or they may be provided to a processing unit through a network or i / o bus . in one aspect , integrated instant messaging and web browsing system 105 disclosed includes at least one central processing unit ( cpu ) or processor . the cpu can be coupled to a memory , rom or computer readable media containing the computer - executable instructions for generating and using fingerprints for integrity management . computer readable media can be any available media that can be accessed by the system and includes both volatile and nonvolatile media , removable and non - removable media implemented in any method or technology for storage of information such as computer readable instructions , data structures , program modules or other data . computer storage media includes , but is not limited to , ram , rom , eeprom , flash memory , portable memory or other memory technology , cd - rom , digital versatile disks ( dvd ) or other optical disk storage , magnetic cassettes , magnetic tape , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by the fingerprint generation and matching systems . the computer readable media may store instructions or data which implement all or part of the system described herein . also disclosed herein and shown in fig4 are business methods for wireless communications companies . according to embodiments , wireless communications companies may employ the use of a software suite , such as integrated instant messaging and web browsing system 105 disclosed herein . the mobile communications company , according to embodiments , allows access only to websites preapproved by the mobile communications company . accordingly , by limiting users access to only preapproved web content , mobile communications companies may provide a value added to parent and guardians who are worried about the content their children view on the internet . moreover , according to embodiments , by making the list or preapproved website available to parents and guardians , the parents and guardians may know exactly what content is viewable on children &# 39 ; s mobile communications devices . similarly and according to embodiments , mobile communications companies may earn revenue by preapproving only web sites that subscribe to the mobile communications companies &# 39 ; approval list . for example , acme . com may offer child friendly content of cartoon episode recaps . acme . com would be attractive and safe for children to view , which would make acme . com eligible to be included in the preapproved websites available to children . however , the mobile communications company would not include acme . com until acme . com paid a set price to be listed and available to subscribers of the mobile communications network . according to an embodiment , a website is submitted to an entity having a network with which mobile device can communicate 1010 . the first step , according to an embodiment , is a process of screening the content of the website 1020 . after the content is found to be nonobjectionable , the website must pay a fee to the entity having a network 1030 . the fee payment and content approval steps may be juxtaposed according to embodiments . according to still other embodiments , the step requiring payment of a few 1030 is optional and may be omitted from the method . if either the content is not approved or a fee is not paid , the website is not approved 1040 and users of the network will be unable to access the website 1050 . conversely , it the website is approved 1060 , users of the network will be able access the website via the network and view the contents of the website 1070 . accordingly , a preapproved website list may be included as part of the software suite provided on user &# 39 ; s mobile device that is compatible with a given network . thus , users would not be able to directly type in uri and view the content of the uri , but would rather select an available website from a preexisting list built into the software . to that end , according to embodiments , mobile communications companies may sort websites according to the subscription fee paid by the website to make those that paid a higher subscription fee more visible to subscribers to the mobile communication company &# 39 ; s network . according to still similar embodiments , available networks are categorized ( e . g ., news , sports , children &# 39 ; s , television , etc .). thus , users navigate to a website after navigating to a specific category . according to embodiments , the first available websites shown would be those that paid a premium subscription rate . while the apparatus and method have been described in terms of what are presently considered to be the most practical and effective embodiments , it is to be understood that the disclosure need not be limited to the disclosed embodiments . it is intended to cover various modifications and similar arrangements included within the spirit and scope of the claims , the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structures . the present disclosure includes any and all embodiments of the following claims .	6
the present invention provides methods for inducing or enhancing the immune response of newborns . in some cases , the methods comprise administration of a compound or agent that is an agonist of both toll - like receptors 7 and 8 ( tlr7 / 8 ). in other cases , the methods include administering a compound or agent that is a tlr8 - selective agonist . the following definitions are provided for specific terms which are used in the following written description . as used herein , “ toll - like receptor 8 ” or “ tlr8 ” or “ toll - like receptors 7 and 8 ” or “ tlr7 / 8 ” refers to a receptor that is a member of the toll - like receptor ( tlr ) family . tlrs are transmembrane proteins characterized by an extracellular leucine - rich domain and a cytoplasmic tail that contains a conserved region called the toll / il - 1 receptor ( tir ) domain . tlrs are predominantly expressed in tissues involved in immune function , such as spleen and peripheral blood leukocytes , as well as those exposed to the external environment such as lung and the gastrointestinal tract . the natural ligand of tlr8 is currently unknown , however , tlr8 is known to bind some small molecules such as resiquimod , an imidazoquinoline compound with antiviral activity . non - limiting examples of tlr8 receptors are found in genebank at accession numbers aaf64061 , aaf78036 , aak62677 , aaq88663 , np — 057694 and np — 61952 . the term “ tlr8 ” is also intended to encompass homologues and allelic variants thereof . as used herein , the term “ agonist ” refers to any compound or agent that stimulates or increases activity mediated by a receptor ( e . g ., a tlr ). thus , the term “ tlr8 agonist ” includes any compound or agent that stimulates or increases tlr8 activity . a tlr8 agonist can be an agent that binds to tlr8 thereby inducing signal transduction mediated by the receptor . the term tlr8 agonist , as used herein , also encompasses compounds or agents that induce the activity of a downstream signaling molecules that are activated by tlr8 . tlr8 agonists include , for example , antibodies , as defined herein , and molecules having antibody - like function such as synthetic analogues of antibodies , e . g ., single - chain antigen binding molecules , small binding peptides , or mixtures thereof . agents having agonist activity also includes small organic molecules , natural products , peptides , aptamers , peptidomimetics , dna and rna . as used herein , the term “ tlr8 - selective agonist ” refers to a tlr8 agonist that stimulates tlr8 to a significantly greater degree than it stimulates any other tlr . thus , while “ tlr8 - selective agonist ” may refer to a compound or agent that acts as an agonist of tlr8 and for no other tlr , it may also refer to a compound or agent that acts primarily as an agonist of tlr8 , but also induces minor levels of activity mediated by another tlr . as used herein , the singular ( e . g ., “ a ,” “ an ,” “ the ,”) includes the plural . thus , for example , the singular term “ tlr7 / 8 agonist ” also includes the plural “ tlr7 / 8 agonists .” as used herein , the terms “ tlr8 activity ” refers to tlr8 - mediated signal transduction . as used herein , the term “ antibody ”, includes human and animal mabs , and preparations of polyclonal antibodies , as well as antibody fragments , synthetic antibodies , including recombinant antibodies ( antisera ), chimeric antibodies , including humanized antibodies , anti - idiotopic antibodies and derivatives thereof . as used herein , the term “ administering ” to a patient ( i . e . newborn ) includes dispensing , delivering or applying an active compound or agent in a pharmaceutical formulation to a subject by any suitable route for delivery of the active compound to the desired location in the subject , including delivery by either the parenteral or oral route , intramuscular injection , subcutaneous / intradermal injection , intravenous injection , buccal administration , transdermal delivery and administration by the rectal , colonic , vaginal , intranasal or respiratory tract route . the agents may , for example , be administered to a comatose , anesthetized or paralyzed subject via an intravenous injection . specific routes of administration may include topical application ( such as by eyedrops , creams or erodible formulations to be placed under the eyelid , intraocular injection into the aqueous or the vitreous humor , injection into the external layers of the eye , creams or erodable formulations that can be applied to dermal and mucosal tissues , such as via subconjunctival injection , parenteral administration or via oral routes . the term “ administering ” to a patient ( i . e . newborn ) is also intended to include administration to a pregnant mother , such that the compound or agent crosses the placenta and is delivered to the neonatal host indirectly . as used herein , “ effective amount ” of a compound or agent is an amount sufficient to achieve a desired therapeutic or pharmacological effect , such as an amount sufficient to induce the activity of tlr8 . an effective amount of a compound or agent as defined herein may vary according to factors such as the disease state and weight of the subject , and the ability of the agent to elicit a desired response in the subject . dosage regimens may be adjusted to provide the optimum therapeutic response . an effective amount is also one in which any toxic or detrimental effects of the active compound are outweighed by the therapeutically beneficial effects . a therapeutically effective amount or dosage of an agent may range from about 100 ng / kg to about 50 mg / kg body weight , although in some embodiments the agent may be administered in a dose outside this range . for example , an agent may be administered in a dose ranging from about 0 . 001 to 30 mg / kg body weight , with other ranges of the invention including about 0 . 01 to 25 mg / kg body weight , about 0 . 1 to 20 mg / kg body weight , about 1 to 10 mg / kg , 2 to 9 mg / kg , 3 to 8 mg / kg , 4 to 7 mg / kg , and 5 to 6 mg / kg body weight . the skilled artisan will appreciate that certain factors may influence the dosage required to effectively treat a subject , including but not limited to the severity of the disease or disorder , the general health of the subject , and other diseases present . moreover , treatment of a subject with a therapeutically effective amount of an active compound can include a single treatment or a series of treatments . in one example , a subject is treated with an agent in the range of between about 0 . 1 to 20 m / kg body weight , one time per week for between about 1 to 10 weeks , alternatively between 2 to 8 weeks , between about 3 to 7 weeks , or for about 4 , 5 , or 6 weeks . it will also be appreciated that the effective dosage of an agent used for treatment may increase or decrease over the course of a particular treatment . an agonist can be administered before , concurrently with , or after administration of another agent ( e . g ., an antigen ). unless otherwise indicated , reference to a compound or agent can include the compound or agent in any pharmaceutically acceptable form , including any isomer ( e . g ., diastereomer or enantiomer ), salt , solvate , polymorph , and the like . in particular , if a compound is optically active , reference to the compound or agent can include each of the compound &# 39 ; s or agent &# 39 ; s enantiomers as well as racemic mixtures of the enantiomers . also herein , the recitations of numerical ranges by endpoints include all numbers subsumed within that range ( e . g ., 1 to 5 includes 1 , 1 . 5 , 2 , 2 . 75 , 3 , 3 . 80 , 4 , 5 , etc .). as used herein , the term “ patient ” or “ subject ” or “ animal ” or “ host ” refers to any “ newborn ” mammal . the patient is preferably a human , but can also be a mammal in need of veterinary treatment , e . g ., domestic animals ( e . g ., dogs , cats , and the like ), farm animals ( e . g ., cows , sheep , fowl , pigs , horses , and the like ) and laboratory animals ( e . g ., rats , mice , guinea pigs , and the like ). as used herein , the terms “ newborn ” or “ neonate ” refer to a baby that is 0 - 28 days old . as used herein , the terms “ enhance ” and / or “ enhancing ” refer to the strengthening ( augmenting ) of an existing immune response to a pathogen in a neonatal host . the term also refers to the initiation of ( initiating , inducing ) an immune response to a pathogen in a newborn . some pathogens include , for example , bacteria ( e . g ., group b streptococcus , bordetella pertussis , bordetella parapertussis , bronchiseptica , listeria monocytogenes , bacillus anthracis , s . pneumoniae , n . meningiditis ), viruses ( e . g ., hepatitis , measles , poliovirus , human immunodeficiency virus , influenza virus , parainfluenza virus , respiratory syncytial virus , herpes simplex virus ), mycobacteria ( e . g . m . tuberculosis and non - tuberculous myobacteria ), parasites ( leishmania , schistosomes , trypanosomes , toxoplasma , pneumocystis ) and fungi ( e . g ., candida spp ., cryptococcus , coccidiodes , aspergillus spp . ), as well as others . various aspects of the invention are described in further detail in the following subsections : the therapy described herein comprises administering to a newborn an agonist of tlr8 , preferably a tlr8 - selective agonist , such that the immune response of a newborn is stimulated . the tlr8 agonist can be administered before , concurrently with , or after administration of another agent . for example , the agonist can be administered with a vaccine to enhance the immune response of the newborn to the vaccine antigen . alternatively the agonist can be administered before , concurrently with , or after administration of an additional therapeutic agent . when another agent is administered and the agents are administered at different times , they are preferably administered within a suitable time period to provide substantial overlap of the pharmacological activity of the agents . the skilled artisan will be able to determine the appropriate timing for co - administration of the agonist and the additional agent depending on the particular agents selected and other factors . the tlr8 agonist can be dna , rna , a small organic molecule , a natural product , protein ( e . g ., antibody ), peptide or peptidomimetic . agonists can be identified , for example , by screening libraries or collections of molecules , such as , the chemical repository of the national cancer institute , as described herein or using other suitable methods . suitable screening methods that can be used to identify tlr8 agonists for use in the present invention , as well as known tlr8 agonists , are described in u . s . patent application no .&# 39 ; s 20040132079 and 20030139364 and pct publication wo 03 / 094836 , which are herein incorporated by reference in their entirety . in one preferred embodiment , the agonist is a small molecule immune response modifier ( irm ) compound . generally , irms include compounds that possess potent immunomodulating activity including but not limited to antiviral and antitumor activity . certain irms modulate the production and secretion of cytokines . for example , certain irm compounds induce the production and secretion of cytokines such as , e . g ., type i interferons , tnf - α , il - 1 , il - 6 , il - 8 , il - 10 , il - 12 , mip - 1 , and / or mcp - 1 . as another example , certain irm compounds can inhibit production and secretion of certain t h 2 cytokines , such as il - 4 and il - 5 . certain irms are small organic molecules ( e . g ., molecular weight under about 1000 daltons , preferably under about 500 daltons , as opposed to large biological molecules such as proteins , peptides , and the like ) such as those disclosed in , for example , u . s . pat . nos . 4 , 689 , 338 ; 4 , 929 , 624 ; 5 , 266 , 575 ; 5 , 268 , 376 ; 5 , 346 , 905 ; 5 , 352 , 784 ; 5 , 389 , 640 ; 5 , 446 , 153 ; 5 , 482 , 936 ; 5 , 756 , 747 ; 6 , 110 , 929 ; 6 , 194 , 425 ; 6 , 627 , 638 ; 6 , 331 , 539 ; 6 , 376 , 669 ; 6 , 440 , 992 ; 6 , 451 , 810 ; 6 , 525 , 064 ; 6 , 541 , 485 ; 6 , 545 , 016 ; 6 , 545 , 017 ; 6 , 573 , 273 ; 6 , 656 , 938 ; 6 , 660 , 735 ; 6 , 660 , 747 ; 6 , 664 , 260 ; 6 , 664 , 264 ; 6 , 664 , 265 ; 6 , 667 , 312 ; 6 , 670 , 372 ; 6 , 677 , 347 ; 6 , 677 , 348 ; 6 , 677 , 349 ; 6 , 683 , 088 ; 6 , 756 , 382 ; 6 , 797 , 718 ; and 6 , 818 , 650 ; u . s . patent publication nos . 2004 / 0091491 ; 2004 / 0147543 ; 2004 / 0176367 ; and 2005 / 0021334 ; international publication nos . wo 2005 / 18551 , wo 2005 / 18556 , and wo 2005 / 20999 ; and u . s . provisional patent ser . no . 60 / 651585 , the entire contents of which are incorporated herein by reference . additional examples of small molecule irms include certain purine derivatives ( such as those described in u . s . pat . nos . 6 , 376 , 501 , and 6 , 028 , 076 ), certain imidazoquinoline amide derivatives ( such as those described in u . s . pat . no . 6 , 069 , 149 ), certain imidazopyridine derivatives ( such as those described in u . s . pat . no . 6 , 518 , 265 ), certain benzimidazole derivatives ( such as those described in u . s . pat . no . 6 , 387 , 938 ), certain derivatives of a 4 - aminopyrimidine fused to a five membered nitrogen containing heterocyclic ring ( such as adenine derivatives described in u . s . pat . nos . 6 , 376 , 501 ; 6 , 028 , 076 and 6 , 329 , 381 ; and in wo 02 / 08905 ), and certain 3 - β - d - ribofuranosylthiazolo [ 4 , 5 - d ] pyrimidine derivatives ( such as those described in u . s . publication no . 2003 / 0199461 ). in one preferred embodiment , the agonist is ssrna , such as ssrna40 / lyovec , which is comprised of single - stranded gu - rich oligonucleotide ( 5 ′- gscscscsgsuscsusgsususgsusgsusgsascsusc - 3 ′ ( seq id no : 1 ); where “ s ” depicts a phosphothioate linkage ) complexed with the cationic lipid “ lyovec ” to protect the rna from degradation and enhance is uptake by immune cells . such ssrna can be purchased from invivogen ( san diego , calif .). the tlr agonism for a particular compound may be assessed in any suitable manner . for example , assays and recombinant cell lines suitable for detecting tlr agonism of test compounds are described , for example , in u . s . patent publication nos . us2004 / 0014779 , us2004 / 0132079 , us2004 / 0162309 , and us2004 / 0197865 , the entire contents of which are incorporated herein by reference . regardless of the particular assay employed , a compound can be identified as an agonist of a particular tlr if performing the assay with a compound results in at least a certain threshold increase of some biological activity mediated by the particular tlr . conversely , a compound may be identified as not acting as an agonist of a specified tlr if , when used to perform an assay designed to detect biological activity mediated by the specified tlr , the compound fails to elicit a threshold increase in the biological activity . unless otherwise indicated , an increase in biological activity refers to an increase in the same biological activity over that observed in an appropriate control . an assay may or may not be performed in conjunction with the appropriate control . with experience , one skilled in the art may develop sufficient familiarity with a particular assay ( e . g ., the range of values observed in an appropriate control under specific assay conditions ) that performing a control may not always be necessary to determine the tlr agonism of a compound in a particular assay . the precise threshold increase of tlr - mediated biological activity for determining whether a particular compound is or is not an agonist of a particular tlr in a given assay may vary according to factors known in the art including but not limited to the biological activity observed as the endpoint of the assay , the method used to measure or detect the endpoint of the assay , the signal - to - noise ratio of the assay , the precision of the assay , and whether the same assay is being used to determine the agonism of a compound for both tlrs . accordingly it is not practical to set forth generally the threshold increase of tlr - mediated biological activity required to identify a compound as being an agonist or a non - agonist of a particular tlr for all possible assays . those of ordinary skill in the art , however , can readily determine the appropriate threshold with due consideration of such factors . moreover , a compound may be identified as “ selective ” if it induces activity of one tlr when administered at a concentration significantly lower than necessary to induce activity of other tlrs . a significant degree may be , for example , inducing activity mediated by one tlr ( e . g ., tlr8 ) when administered at half the concentration necessary to induce activity through another tlr ( e . g ., tlr7 ). examples of tlr8 - selective compounds include 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 2 - propylthiazolo [ 4 , 5 - c ] quinoline - 4 , 8 - diamine , and 2 - butylthiazolo [ 4 , 5 - c ][ 1 , 5 ] naphthyridin - 4 - amine . some tlr8 - selective compounds such as , for example , n -{ 3 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] propyl }- 5 -( dimethylamino ) naphthalene - 1 - sulfonamide and tert - butyl 2 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] ethylcarbamate can induce tlr8 activity at a concentration between about one half to about one - fifth ( i . e ., at about a two - fold to about a five - fold dilution ) of that necessary to induce tlr7 - mediated activity . other tlr8 - selective compounds such as , for example , 2 -( 1 - methylethyl ) thiazolo [ 4 , 5 - c ] quinolin - 4 - amine ; 2 -( 2 - methylpropyl ) thiazolo [ 4 , 5 - c ] quinolin - 4 - amine ; 8 - methyl - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine ; 7 - fluoro - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine ; 2 - propylthiazolo [ 4 , 5 - c [ 1 , 5 ] naphthyridin - 4 - amine ; n -[ 3 -( 4 - amino - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) phenyl ] methanesulfonamide ; tert - butyl 3 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] propylcarbamate ; n -{ 6 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] hexyl } methanesulfonamide ; tert - butyl 2 -{ 2 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] ethoxy } ethylcarbamate ; 7 -[ 2 -( 2 - chloroethoxy ) ethoxy ]- 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 4 - amine can induce tlr8 activity at a concentration less than one - fifth ( i . e ., at a dilution greater than five - fold ) of that necessary to induce tlr7 - mediated activity . the above - identified tlr8 - selective compounds are described in , for example , u . s . pat . nos . 6 , 110 , 929 ; 6 , 627 , 638 ; 6 , 440 , 992 ; u . s . patent publication no . 2005 / 0021334 ; and u . s . pat . ser . no . 60 / 651585 , the entire contents of which are incorporated herein by reference . assays employing hek293 cells transfected with an expressible tlr structural gene may use a threshold of , for example , at least a three - fold increase in a tlr - mediated biological activity ( e . g ., nfκb activation ) when the compound is provided at a concentration of , for example , from about 1 μm to about 10 μm for identifying a compound as an agonist of the tlr transfected into the cell . however , different thresholds and / or different concentration ranges may be suitable in certain circumstances . also , different thresholds may be appropriate for different assays . the screening assays used to identify tlr8 agonists can have any of a number of possible readout systems based upon either the tlr8 signaling pathway or other assays suitable for assaying tlr signaling activity . in one preferred embodiment , the readout for the screening assay is based on the use of native genes or , alternatively , cotransfected or otherwise co - introduced reporter gene constructs which are responsive to the tlr signal transduction pathway involving myd88 , traf6 , p38 , and / or erk ( hacker h et al ., embo j 18 : 6973 - 6982 ( 1999 )). these pathways activate kinases including kappa b kinase complex and c - jun n - terminal kinases . thus reporter genes and reporter gene constructs particularly useful for the assays can include a reporter gene operatively linked to a promoter sensitive to nf - kappa b . examples of such promoters include , without limitation , those for nf - kappa b , il - 1beta , il - 6 , il - 8 , il - 12 p40 , cd80 , cd86 , and tnf - α . the reporter gene operatively linked to the tlr8 - sensitive promoter can include , without limitation , an enzyme ( e . g ., luciferase , alkaline phosphatase , beta - galactosidase , chloramphenicol acetyltransferase ( cat ), etc . ), a bioluminescence marker ( e . g ., green - fluorescent protein ( gfp , u . s . pat . no . 5 , 491 , 084 ), etc . ), a surface - expressed molecule ( e . g ., cd25 ), and a secreted molecule ( e . g ., il - 8 , il - 12 p40 , tnf - α ). in one preferred embodiment the reporter is selected from il - 8 , tnf - α , nf - kappa b - luciferase ( nf - kappa b - luc ; hacker h et al ., embo j 18 : 6973 - 6982 ( 1999 )), il - 12 p40 - luc ( murphy t l et al ., mol cell biol 15 : 5258 - 5267 ( 1995 )), and tnf - luc ( hacker h et al ., embo j 18 : 6973 - 6982 ( 1999 )). in assays relying on enzyme activity readout , substrate can be supplied as part of the assay , and detection can involve measurement of chemiluminescence , fluorescence , color development , incorporation of radioactive label , drug resistance , or other marker of enzyme activity . for assays relying on surface expression of a molecule , detection can be accomplished using flow cytometry analysis or functional assays . secreted molecules can be assayed using enzyme - linked immunosorbent assay ( elisa ) or bioassays . many such readout systems are well known in the art and are commercially available . another source of agonists is combinatorial libraries which can comprise many structurally distinct molecular species . combinatorial libraries can be used to identify lead compounds or to optimize a previously identified lead . such libraries can be manufactured by well - known methods of combinatorial chemistry and screened by suitable methods , such as the methods described herein . the term “ peptide ”, as used herein , refers to a compound consisting of from about two to about ninety amino acid residues wherein the amino group of one amino acid is linked to the carboxyl group of another amino acid by a peptide bond . a peptide can be , for example , derived or removed from a native protein by enzymatic or chemical cleavage , or can be prepared using conventional peptide synthesis techniques ( e . g ., solid phase synthesis ) or molecular biology techniques ( see sambrook , j . et al ., molecular cloning : a laboratory manual , cold spring harbor press , cold spring harbor , n . y . ( 1989 )). a “ peptide ” can comprise any suitable l - and / or d - amino acid , for example , common a - amino acids ( e . g ., alanine , glycine , valine ), non - a - amino acids ( e . g ., p - alanine , 4 - aminobutyric acid , 6 aminocaproic acid , sarcosine , statine ), and unusual amino acids ( e . g ., citrulline , homocitruline , homoserine , norleucine , norvaline , omithine ). the amino , carboxyl and / or other functional groups on a peptide can be free ( e . g ., unmodified ) or protected with a suitable protecting group . suitable protecting groups for amino and carboxyl groups , and means for adding or removing protecting groups are known in the art and are disclosed in , for example , green and wuts , “ protecting groups in organic synthesis ”, john wiley and sons , 1991 . the functional groups of a peptide can also be derivatized ( e . g ., alkylated ) using art - known methods . peptides can be synthesized and assembled into libraries comprising a few to many discrete molecular species . such libraries can be prepared using well - known methods of combinatorial chemistry , and can be screened as described herein or using other suitable methods to determine if the library comprises peptides which can activate tlr8 function . such peptide agonists can then be isolated by suitable means . the term “ peptidomimetic ”, as used herein , refers to molecules which are not polypeptides , but which mimic aspects of their structures . for example , polysaccharides can be prepared that have the same functional groups as peptides which can activate tlr8 . peptidomimetics can be designed , for example , by establishing the three dimensional structure of a peptide agent in the environment in which it is bound or will bind to tlr8 . the peptidomimetic comprises at least two components , the binding moiety or moieties and the backbone or supporting structure . these compounds can be manufactured by known methods . for example , a polyester peptidomimetic can be prepared by substituting a hydroxyl group for the corresponding a - amino group on amino acids , thereby preparing a hydroxyacid and sequentially esterifying the hydroxyacids , optionally blocking the basic and acidic side chains to minimize side reactions . an appropriate chemical synthesis route can generally be readily identified upon determining the desired chemical structure of the peptidomimetic . peptidomimetics can be synthesized and assembled into libraries comprising a few to many discrete molecular species . such libraries can be prepared using well known methods of combinatorial chemistry , and can be screened as described herein to determine if the library comprises one or more peptidomimetics which activate tlr function . such peptidomimetic agonists can then be isolated by suitable methods . antibodies can also be screened for their ability to activate tlr8 and used in methods of the invention . as used herein , the term “ antibody ” encompasses polyclonal or monoclonal antibodies as well as functional fragments of antibodies , including fragments of chimeric , human , humanized , primatized , veneered or single - chain antibodies . functional fragments include antigen - binding fragments which bind to tlr8 . for example , antibody fragments capable of binding to tlr8 or portions thereof , including , but not limited to fv , fab , fab ′ and f ( ab ′) 2 fragments can be used . such fragments can be produced by enzymatic cleavage or by recombinant techniques . for example , papain or pepsin cleavage can generate fab or f ( ab ′) 2 fragments , respectively . other proteases with the requisite substrate specificity can also be used to generate fab or f ( ab ′) 2 fragments . antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site . for example , a chimeric gene encoding a f ( ab ′) 2 heavy chain portion can be designed to include dna sequences encoding the ch , domain and hinge region of the heavy chain . the various portions of these antibodies can be joined together chemically by conventional techniques , or can be prepared as a contiguous protein using genetic engineering techniques . for example , nucleic acids encoding a chimeric or humanized chain can be expressed to produce a contiguous protein . see , e . g ., cabilly et al ., u . s . pat . no . 4 , 816 , 567 ; cabilly et al ., european patent no . 0 , 125 , 023 b1 ; boss et al ., u . s . pat . no . 4 , 816 , 397 ; boss et al ., european patent no . 0 , 120 , 694 b1 ; neuberger , m . s . et al ., wo 86 / 01533 ; neuberger , m . s . et al ., european patent no . 0 , 194 , 276 b1 ; winter , u . s . pat . no . 5 , 225 , 539 ; winter , european patent no . 0 , 239 , 400 b1 ; queen et al ., european patent no . 0451216 b1 and padlan , e . a . et al ., ep 0519596 a1 . see also , newman , r . et al ., biotechnology , 10 : 1455 - 1460 ( 1992 ), regarding primatized antibody , and ladner et al ., u . s . pat . no . 4 , 946 , 778 and bird , r . e . et al ., science , 242 : 423 - 426 ( 1988 )) regarding single - chain antibodies . humanized antibodies can be produced using synthetic or recombinant dna technology using standard methods or other suitable techniques . nucleic acid ( e . g ., cdna ) sequences coding for humanized variable regions can also be constructed using pcr mutagenesis methods to alter dna sequences encoding a human or humanized chain , such as a dna template from a previously humanized variable region ( see e . g ., kamman , m ., et al ., nucl . acids res ., 17 : 5404 ( 1989 )); sato , k ., et al ., cancer research , 53 : 851 - 856 ( 1993 ); daugherty , b . l . et al ., nucleic acids res ., 19 ( 9 ): 2471 - 2476 ( 1991 ); and lewis , a . p . and j . s . crowe , gene , 101 : 297 - 302 ( 1991 )). using these or other suitable methods , variants can also be readily produced . in one embodiment , cloned variable regions can be mutated , and sequences encoding variants with the desired specificity can be selected ( e . g ., from a phage library ; see e . g ., krebber et al ., u . s . pat . no . 5 , 514 , 548 ; hoogenboom et al ., wo 93 / 06213 , published apr . 1 , 1993 ). antibodies which are specific for mammalian ( e . g ., human ) tlr8 can be raised against an appropriate immunogen , such as isolated and / or recombinant human tlr8 or portions thereof ( including synthetic molecules , such as synthetic peptides ). agonists of tlr8 useful in the methods of the present invention include irm compounds having a 2 - aminopyridine fused to a five membered nitrogen - containing heterocyclic ring . such compounds include , for example , imidazoquinoline amines including but not limited to substituted imidazoquinoline amines such as , for example , amide substituted imidazoquinoline amines , sulfonamide substituted imidazoquinoline amines , urea substituted imidazoquinoline amines , aryl ether substituted imidazoquinoline amines , heterocyclic ether substituted imidazoquinoline amines , amido ether substituted imidazoquinoline amines , sulfonamido ether substituted imidazoquinoline amines , urea substituted imidazoquinoline ethers , thioether substituted imidazoquinoline amines , hydroxylamine substituted imidazoquinoline amines , oxime substituted imidazoquinoline amines , 6 -, 7 -, 8 -, or 9 - aryl , heteroaryl , aryloxy or arylalkyleneoxy substituted imidazoquinoline amines , and imidazoquinoline diamines ; tetrahydroimidazoquinoline amines including but not limited to amide substituted tetrahydroimidazoquinoline amines , sulfonamide substituted tetrahydroimidazoquinoline amines , urea substituted tetrahydroimidazoquinoline amines , aryl ether substituted tetrahydroimidazoquinoline amines , heterocyclic ether substituted tetrahydroimidazoquinoline amines , amido ether substituted tetrahydroimidazoquinoline amines , sulfonamido ether substituted tetrahydroimidazoquinoline amines , urea substituted tetrahydroimidazoquinoline ethers , thioether substituted tetrahydroimidazoquinoline amines , hydroxylamine substituted tetrahydroimidazoquinoline amines , oxime substituted tetrahydroimidazoquinoline amines , and tetrahydroimidazoquinoline diamines ; imidazopyridine amines including but not limited to amide substituted imidazopyridine amines , sulfonamide substituted imidazopyridine amines , urea substituted imidazopyridine amines , aryl ether substituted imidazopyridine amines , heterocyclic ether substituted imidazopyridine amines , amido ether substituted imidazopyridine amines , sulfonamido ether substituted imidazopyridine amines , urea substituted imidazopyridine ethers , and thioether substituted imidazopyridine amines ; 1 , 2 - bridged imidazoquinoline amines ; 6 , 7 - fused cycloalkylimidazopyridine amines ; imidazonaphthyridine amines ; tetrahydroimidazonaphthyridine amines ; oxazoloquinoline amines ; thiazoloquinoline amines ; oxazolopyridine amines ; thiazolopyridine amines ; oxazolonaphthyridine amines ; thiazolonaphthyridine amines ; pyrazolopyridine amines ; pyrazoloquinoline amines ; tetrahydropyrazoloquinoline amines ; pyrazolonaphthyridine amines ; tetrahydropyrazolonaphthyridine amines ; and 1h - imidazo dimers fused to pyridine amines , quinoline amines , tetrahydroquinoline amines , naphthyridine amines , or tetrahydronaphthyridine amines . in certain embodiments , the tlr8 agonist may be one of the following : 4 - amino - 2 -( ethoxymethyl )- α , α - dimethyl - 6 , 7 , 8 , 9 - tetrahydro - 1h - imidazo [ 4 , 5 - c ] quinoline - 1 - ethanol from example 91 of u . s . pat . no . 5 , 352 , 784 is an agonist of both tlr7 and tlr8 ; 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine from example 12 of u . s . pat . no . 6 , 110 , 929 ; n -( 2 -{ 2 -[- amino - 2 -( 2 - methoxyethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ethoxy } ethyl ) hexadecanamide which is irm3 of u . s . pat . app . no . 2004 / 0091491 ; n -{ 2 -[ 4 - amino - 2 -( ethoxymethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ] ethyl } methanesulfonamide from u . s . pat . no . 6 , 331 , 539 ; 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 4 - amine , a predominantly tlr8 agonist cited in wo 04 / 091500 ; 4 - amino - α , α - dimethyl - 2 - ethoxymethyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - ethanol , the synthesis of which is described in example 99 of u . s . pat . no . 5 , 389 , 640 ; n -{ 4 -[ 4 - amino - 2 -( 2 - methoxyethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ] butyl } quinoline - 3 - carboxamide described in example 182 of u . s . pat . no . 2003 / 0144283 ; n -{ 4 -[ 4 - amino - 2 -( 2 - methoxyethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ] butyl } quinoxaline - 2 - carboxamide described in example 183 of u . s . pat . no . 2003 / 0144283 ; n -[ 4 -( 4 - amino - 2 - propyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ) butyl ] morpholine - 4 - carboxamide described in u . s . pat . no . 6 , 541 , 485 ; 2 - propylthiazolo [ 4 , 5 - c ] quinoli - n - 4 - amine described in example 12 of u . s . pat . no . 6 , 110 , 929 ; n 1 -[ 2 -( 4 - amino - 2 - butyl - 1h - imidazo [ 4 , 5 - c [ 1 , 5 ] naphthyridin - 1 - yl ) ethyl ]- 2 - amino - 4 - methylpentanamide described in example 102 of u . s . pat . no . 6 , 194 , 425 ; n 1 -[ 4 -( 4 - amino - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ) butyl ]- 2 - phenoxybenzamide described in example 14 of u . s . pat . no . 6 , 451 , 810 ; n 1 -[ 2 -( 4 - amino - 2 - butyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ) ethyl ]- 1 - propanesulfonamide described in example 17 of u . s . pat . no . 6 , 331 , 539 ; n -{ 2 -[ 2 -( 4 - amino - 2 - ethyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ) ethoxy ] ethyl }- n ′- phenylurea described in example 50 of u . s . pat . app . no . 2003 / 0130518 ; 1 -{ 4 -[( 3 , 5 - dichlorophenyl ) thio ] butyl }- 2 - ethyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 4 - amine described in example 44 of u . s . pat . app . no . 2003 / 0100764 ; n -{ 2 -[ 4 - amino - 2 -( ethoxymethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ] ethyl }- n ′-( 3 - cyanophenyl ) urea described in wo 00 / 76518 ; 4 - amino - 2 - ethoxymethyl - α , α - dimethyl - 6 , 7 , 8 , 9 - tetrahydro - 1h - imidazo [ 4 , 5 - c ] quinoline - 1 - ethanol described in example 91 of u . s . pat . no . 5 , 352 , 784 ; 4 - amino - α , α - dimethyl - 2 - methoxye - thyl - 1h - imidazo [ 4 , 5 - c ] quinoline - 1 - ethanol described in example 111 of u . s . pat . no . 5 , 389 , 640 ; 4 - amino - 2 - butyl - α , α , 6 , 7 - tetramethyl - 1h - imidazo [ 4 , 5 - c ] pyridine - 1 - ethanol described in example 52 of u . s . pat . no . 5 , 494 , 916 ; n -( 2 -{ 2 -[ 4 - amino - 2 -( 2 - methoxyethyl )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ) ethoxy } ethyl )- n ′- phenylurea described in example 1 in wo 02 / 46191 ; 1 -{ 4 -[( 3 , 5 - dichlorophenyl ) sulfonyl ] butyl }- 2 - ethyl - 1h - imidazo [ 4 , 5 - c ] quinolin - 4 - amine described in example 46 of u . s . pat . app . no . 2003 / 0100764 ; n -{ 2 -[ 4 - amino - 2 -( 2 - methoxyethy - 1 )- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ] ethyl }- n ′- sec - butylthiourea described in wo 00 / 76518 ; and n -{ 2 -[ 4 - amino - 2 -( 2 - methoxyethyl )- 6 , 7 ,- 8 , 9 - tetrahydro - 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl ]- 1 , 1 - dimethylethyl } methanesulfonamide u . s . pat . no . 6 , 331 , 539 . in certain embodiments , the tlr8 agonist is a tlr8 - selective small molecule immune response modifier ( irm ) compound . such compounds include , for example , thiazoloquinoline amines including but not limited to 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 2 - propylthiazolo [ 4 , 5 - c ] quinoline - 4 , 8 - diamine , 2 - butylthiazolo [ 4 , 5 - c [ 1 , 5 ] naphthyridin - 4 - amine , n -{ 3 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] propyl }- 5 -( dimethylamino ) naphthalene - 1 - sulfonamide , tert - butyl 2 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] ethylcarbamate , 2 -( 1 - methylethyl ) thiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 2 -( 2 - methylpropyl ) thiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 8 - methyl - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 7 - fluoro - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 4 - amine , 2 - propylthiazolo [ 4 , 5 - c ][ 1 , 5 ] naphthyridin - 4 - amine , n -[ 3 -( 4 - amino - 2 - propylthiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) phenyl ] methanesulfonamide , tert - butyl 3 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] propylcarbamate , n -{ 6 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] hexyl } methanesulfonamide , tert - butyl 2 -{ 2 -[( 4 - amino - 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 7 - yl ) oxy ] ethoxy } ethylcarbamate , and 7 -[ 2 -( 2 - chloroethoxy ) ethoxy ]- 2 - propyl [ 1 , 3 ] thiazolo [ 4 , 5 - c ] quinolin - 4 - amine , which are described in , for example , u . s . pat . nos . 6 , 110 , 929 ; 6 , 627 , 638 ; 6 , 440 , 992 ; u . s . patent publication no . 2005 / 0021334 ; and u . s . patent ser . no . 60 / 651585 . the compounds or agents of the present invention can be contained in pharmaceutically acceptable formulations . such a pharmaceutically acceptable formulation may include a pharmaceutically acceptable carrier ( s ) and / or excipient ( s ). as used herein , “ pharmaceutically acceptable carrier ” includes any and all solvents , dispersion media , coatings , antibacterial and anti fungal agents , isotonic and absorption delaying agents , and the like that are physiologically compatible . for example , the carrier can be suitable for injection into the cerebrospinal fluid . excipients include pharmaceutically acceptable stabilizers . the present invention pertains to any pharmaceutically acceptable formulations , including synthetic or natural polymers in the form of macromolecular complexes , nanocapsules , microspheres , or beads , and lipid - based formulations including oil - in - water emulsions , micelles , mixed micelles , synthetic membrane vesicles , and resealed erythrocytes . in some embodiments , the tlr8 agonist may be administered to a subject in a formulation that includes , for example , from about 0 . 001 % to about 10 % tlr8 agonist ( unless otherwise indicated , all percentages provided herein are weight / weight with respect to the total formulation ), although in some embodiments the tlr8 agonist may be administered using a formulation that provides the tlr8 agonist in a concentration outside this range . in certain embodiments , the formulation may include from about 0 . 01 % to about 1 % tlr8 agonist such as , for example , from about 0 . 1 % to about 0 . 5 % tlr8 agonist . in one embodiment , the pharmaceutically acceptable formulations comprise a polymeric matrix . the terms “ polymer ” or “ polymeric ” are art - recognized and include a structural framework comprised of repeating monomer units which is capable of delivering an agent such that treatment of a targeted condition occurs . the terms also include co - polymers and homopolymers such as synthetic or naturally occurring . linear polymers , branched polymers , and cross - linked polymers are also meant to be included . for example , polymeric materials suitable for forming the pharmaceutically acceptable formulation employed in the present invention , include naturally derived polymers such as albumin , alginate , cellulose derivatives , collagen , fibrin , gelatin , and polysaccharides , as well as synthetic polymers such as polyesters ( pla , plga ), polyethylene glycol , poloxomers , polyanhydrides , and pluronics . these polymers are biocompatible and biodegradable without producing any toxic byproducts of degradation , and they possess the ability to modify the manner and duration of the active compound release by manipulating the polymer &# 39 ; s kinetic characteristics . as used herein , the term “ biodegradable ” means that the polymer will degrade over time by the action of enzymes , by hydrolytic action and / or by other similar mechanisms in the body of the subject . as used herein , the term “ biocompatible ” means that the polymer is compatible with a living tissue or a living organism by not being toxic or injurious and by not causing an immunological rejection . polymers can be prepared using methods known in the art . the polymeric formulations can be formed by dispersion of the active compound within liquefied polymer , as described in u . s . pat . no . 4 , 883 , 666 , the teachings of which are incorporated herein by reference or by such methods as bulk polymerization , interfacial polymerization , solution polymerization and ring polymerization as described in odian g ., principles of polymerization and ring opening polymerization , 2nd ed ., john wiley & amp ; sons , new york , 1981 , the contents of which are incorporated herein by reference . the properties and characteristics of the formulations are controlled by varying such parameters as the reaction temperature , concentrations of polymer and the active compound , the types of solvent used , and reaction times . the active therapeutic compound can be encapsulated in one or more pharmaceutically acceptable polymers , to form a microcapsule , microsphere , or microparticle , terms used herein interchangeably . microcapsules , microspheres , and microparticles are conventionally free - flowing powders consisting of spherical particles of 2 millimeters or less in diameter , usually 500 microns or less in diameter . particles less than 1 micron are conventionally referred to as nanocapsules , nanoparticles or nanospheres . for the most part , the difference between a microcapsule and a nanocapsule , a microsphere and a nanosphere , or microparticle and nanoparticle is size ; generally there is little , if any , difference between the internal structure of the two . in one aspect of the present invention , the mean average diameter is less than about 45 μm , preferably less than 20 μm , and more preferably between about 0 . 1 and 10 μm . in another embodiment , the pharmaceutically acceptable formulations comprise lipid - based formulations . any of the known lipid - based drug delivery systems can be used in the practice of the invention . for instance , multivesicular liposomes , multilamellar liposomes and unilamellar liposomes can all be used so long as a sustained release rate of the encapsulated active compound can be established . methods of making controlled release multivesicular liposome drug delivery systems are described in pct application publication nos : wo 9703652 , wo 9513796 , and wo 9423697 , the contents of which are incorporated herein by reference . the composition of the synthetic membrane vesicle is usually a combination of phospholipids , usually in combination with steroids , especially cholesterol . other phospholipids or other lipids may also be used . examples of lipids useful in synthetic membrane vesicle production include phosphatidylglycerols , phosphatidylcholines , phosphatidylserines , phosphatidylethanolamines , sphingolipids , cerebrosides , and gangliosides , with preferable embodiments including egg phosphatidylcholine , dipalmitoylphosphatidylcholine , distearoylphosphatidyleholine , dioleoylphosphatidylcholine , dipalmitoylphosphatidylglycerol , and dioleoylphosphatidylglycerol . in preparing lipid - based vesicles containing an active compound such variables as the efficiency of active compound encapsulation , labiality of the active compound , homogeneity and size of the resulting population of vesicles , active compound - to - lipid ratio , permeability , instability of the preparation , and pharmaceutical acceptability of the formulation should be considered . prior to introduction , the formulations can be sterilized , by any of the numerous available techniques of the art , such as with gamma radiation or electron beam sterilization . ophthalmic products for topical use may be packaged in multidose form . preservatives are thus required to prevent microbial contamination during use . suitable preservatives include : benzalkonium chloride , thimerosal , chlorobutanol , methyl paraben , propyl paraben , phenylethyl alcohol , edetate disodium , sorbic acid , polyquatemium - 1 , or other agents known to those skilled in the art . such preservatives are typically employed at a level of from 0 . 001 to 1 . 0 % weight / volume (“% w / v ”). such preparations may be packaged in dropper bottles or tubes suitable for safe administration to the eye , along with instructions for use . when the agents or compounds are delivered to a patient , they can be administered by any suitable route , including , for example , orally ( e . g ., in capsules , suspensions or tablets ) or by parenteral administration . parenteral administration can include , for example , intramuscular , intravenous , intraarticular , intraarterial , intrathecal , subcutaneous , or intraperitoneal administration . the agent can also be administered orally , transdermally , topically , by inhalation ( e . g ., intrabronchial , intranasal , oral inhalation or intranasal drops ) or rectally . administration can be local or systemic as indicated . agents can also be delivered using viral vectors , which are well known to those skilled in the art . both local and systemic administration are contemplated by the invention . desirable features of local administration include achieving effective local concentrations of the active compound as well as avoiding adverse side effects from systemic administration of the active compound . the pharmaceutically acceptable formulations can be suspended in aqueous vehicles and introduced through conventional hypodermic needles or using infusion pumps . in one embodiment , the active compound formulation described herein is co - administered with another therapeutic agent or vaccine . the tlr8 agonist can be administered before , concurrently with , or after administration of the additional agent . the amount of agent administered to the individual will depend on the characteristics of the individual , such as general health , age , sex , body weight and tolerance to drugs as well as the degree , severity and type of rejection . the skilled artisan will be able to determine appropriate dosages depending on these and other factors . typically , an effective amount can range from about 0 . 1 m / kg per day to about 100 m / kg per day . antibodies and antigen - binding fragments thereof , particularly human , humanized and chimeric antibodies and antigen - binding fragments can often be administered less frequently than other types of therapeutics . for example , an effective amount of such an antibody can range from about 0 . 01 m / kg to about 5 or 10 m / kg administered daily , weekly , biweekly , monthly or less frequently . in one preferred embodiment , a tlr8 agonist is used as an adjuvant to enhance / induce the immune response of a newborn to an antigen of a vaccine formulation . the agonists of the invention can be used with antigens derived from any pathogen , e . g . any bacteria , fungus , parasite , or virus , provided the antigen does not get destroyed or denatured . examples of some antigens , and certainly not by way of limitation , are erysipelothrix rhusiopathiae antigens , bordetella bronchiseptica antigens , antigens of toxigenic strains of pasteurella multocida , antigens of escherichia coli strains that cause neonatal diarrhea , actinobacillus pleuropneumoniae antigens , pasteurella haemiolytica antigens , or any combination of the above . adjuvants of the invention are also useful in vaccine compositions that contain an antigen described in u . s . pat . nos . 5 , 616 , 328 and 5 , 084 , 269 . acute infections that can be treated by methods of the invention include any viral , fugal , parasitic , or bacterial infection caused by any pathogen . some pathogens include , for example , group b streptococcus , bordetella spp ., listeria monocytogenes , bacillus anthracis , s . pneumoniae , n . meninigiditis , hepatitis , measles , poliovirus , human immunodeficiency virus , influenza virus , parainfluenza virus , respiratory syncytial virus , herpes simplex virus , m . tuberculosis , leishmania , schistosomes , trypanosomes , toxoplasma , pneumocystis and candida spp ., cryptococcus , coccidiodes , aspergillus spp ., as well as others . in one embodiment , the tlr8 immunomodulatory agonist of the invention is used in a vaccine for immunotherapy of cancer in a newborn . such cancer vaccines are known to those in the art . it is understood that the foregoing detailed description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the invention . various changes and modifications to the disclosed embodiments , which will be apparent to those skilled in the art , may be made without departing from the spirit and scope of the present invention . further , all patents , patent applications and publications cited herein are incorporated herein by reference . peripheral blood was collected from healthy adult volunteers ( n = 26 individual volunteers ; mean age 27 years ; 45 % male , 55 % female ) and newborn cord blood ( n = 63 ; mean gestational age 39 weeks ; 43 % male , 57 % female ) collected immediately after cesarean section delivery ( epidural anesthesia ) of the placenta or from the umbilical cord immediately after vaginal birth but prior to delivery of the placenta . births at which antibiotics were administered during labor and / or delivery , and births to hiv - positive mothers were excluded . human experimentation guidelines of the us department of health and human services and the brigham & amp ; women &# 39 ; s hospital were observed , following protocols approved by the local institutional review board . blood was anticoagulated with 129 mm sodium citrate ( becton dickinson , franklin lakes , n . j .). hemocytes were collected by centrifugation of blood , followed by washing three times with hank &# 39 ; s balanced salt solution ( hbss ) buffer without magnesium or calcium ( gibco brl , grand island , n . y .) and then resuspension in either autologous or heterologous 100 % plasma . tlr ligands included the synthetic triacylated blp ( tblp ) pam3 - cssna ( bachem bioscience , king of prussia , pa ) corresponding to the n - terminus of a blp from e . coli b / r ( biesert et al . 1987 . eur j biochem 162 : 651 ), the synthetic diacylated blp macrophage - activating lipopeptide - 2 ( malp ; s -( 2 , 3 - bisacyloxypropyl )- cysteine - gnndesnisfkek ; alexis biochemicals , lausen , switzerland ) from mycoplasma fermentans ( muhlradt et al . 1997 . j exp med . 185 : 1951 ), ultrapure re 595 lps from salmonella minnesota ( list biologicals , campbell , calif . ), and the irm compounds imiquimod ( 3m pharmaceuticals , northridge , calif . ), and resiquimod ( invivogen , san diego , calif .). specificity of individual tlr ligands for their cognate receptors was confirmed using either nf - κb luciferase reporter and tlr co - transfected human embryonic kidney ( hek ) 293 cells or a neutralizing mab to tlr2 ( levy , o . et al . 2003 . infect immun 71 : 6344 ), as previously described . heparinized blood was layered onto ficoll - hypaque gradients , the peripheral blood mononuclear cell ( pbmc ) layer collected , and subjected to hypotonic lysis to remove red blood cells . monocytes were isolated from pbmc by positive selection using magnetic microbeads coupled to an anti - cd14 mab according to the manufacturer &# 39 ; s instructions ( miltenyi biotec , auburn , calif .) and stimulated in the presence of 100 % autologous serum . after incubation of tlr ligands in blood or monocyte suspensions for 5 hours at 37 ° c . with end - over - end rotation , samples were diluted with five volumes of ice - cold rpmi medium ( gibco brl ) and centrifuged at 1 , 000 × g at 4 ° c . for 5 minutes . the supernatant was recovered and stored at − 20 ° c . until assay of tnf - α by elisa ( r & amp ; d systems , minneapolis , minn .). both purified recombinant human scd14 and scd14 elisa for measurement of concentrations in citrated newborn and adult plasma or serum were from r & amp ; d systems . for experiments in which scd14 was replenished in newborn cord blood , either 500 or 1 , 000 ng of pure scd14 were added per ml of whole blood . total rna was isolated using a silica - gel - based membrane ( rneasy , qiagen , valencia , calif .) and treated with dnase ( qiagen ) to avoid contamination with genomic dna . random - primed cdna was prepared using a reverse transcription kit per the manufacturer &# 39 ; s instructions ( clontech , palo alto , calif .). taqman pcr was performed to measure the relative mrna levels of the tlr or tlr - related molecules as previously described ( zarember , k . a . et al . 2002 . [ erratum appears in j immunol jul . 15 , 2002 ; 169 ( 2 ): 1136 ]. j immunol . 168 : 554 . ), except for tirap primers : forward 5 ′- cctgagctccgattcatgt - 3 ′ ( seq id no : 2 ), probe fam - 5 ′- ccctgatggtggctttcgtcaa - 3 ′- tamra ( seq id no : 3 ), and reverse 5 ′- cgcatgacagcttctttga - 3 ′ ( seq id no : 4 ). bonferroni &# 39 ; s method of statistical analysis for multiple comparisons was employed to compare relative mrna expression in newborn and adult monocytes . human tnf - α mrna was measured using specific predeveloped assay reagents ( applied biosystems , foster city , calif .). total cellular tlr2 content of purified monocytes or control thp - 1 cells was measured using a tlr2 elisa as follows . maxisorp plates were coated with 0 . 25 μg / well mab # 2420 in pbs overnight at 4 ° c . after a brief wash with pbs , plates were incubated with shaking at room temperature in blocking buffer ( 150 mm nacl , 10 mm hepes ph 7 . 2 , 0 . 25 % bsa , 0 . 05 % tween - 20 , 1 mm edta , 0 . 05 % nan3 ). cel lysates wert prepared in 1 % triton - x - 100 , 150 mm nacl , 10 % glycerol , 2 mm edta , 25 mm hepes , ph 7 . 2 supplemented with a standard protease inhibitor cocktail . 100 μl fresh blocking buffer was added to each well followed by up to 100 μl of sample ( balance block solution ) and incubated at 4 ° c . with shaking overnight . after washing 3 × with pbs , each well was incubated with 200 μl mab # 2392 : hrpo conjugate for 1 hour then washed 3 × with pbs / 0 . 05 % tween - 20 , once with pbs , developed with 100 μl abts solution ( calbiochem , san diego , calif . ), stopped with 1m h2so4 ( 100 μl ) and measured at 405 mn . tlr2 elisa specificity was confirmed by testing lysates prepared from hek293 cells transiently transfected with plasmids encoding tagged versions of all human tlrs ( 1 - 10 ), with only tlr2 expressing cells producing a measurable signal . tlr ligands were added to citrated blood at a final concentration of 100 ng / ml ( lps ) or 10 μg / ml ( tblp ). in some experiments , 10 μg / ml of brefeldin a ( sigma - aldrich , st . louis , mo .) was added to the blood before the tlr ligand to inhibit tnf - α secretion and enhance detection of intracellular tnf - α . quantitative surface expression of tlrs and cd14 was measured using phycoerythrin ( pe )- conjugated mabs ( ebiosciences , san diego , calif .) incubated at rt for 30 minutes . to identify monocytes , samples stained for tlrs with pe - conjugated mab &# 39 ; s were co - stained for cd14 using a fitc - conjugated cd14 mab ( ebiosciences ). after red blood cell lysis using 1 × facslyse solution and permeabilization using 1 × facsperm2 solution ( bd biosciences ), samples were washed with 1 × pbs / 0 . 5 % hsa . to determine which blood leukocytes synthesize tnf - α in response to tlr ligands , cells were stained for intracellular tnf - α according to the manufacturer &# 39 ; s protocol ( bd biosciences ). tnf - α was stained with a pe - conjugated tnf - α mab using murine igg1 as control and monocytes were identified using fitc - conjugated cd14 mab . phosphorylated p38 map kinase was stained in permeabilized cells using a pe - conjugated phospho - specific ( pt180 / py182 ) p38 mouse igg1 mab ( clone 36 , bd biosciences ). flow cytometry was performed using a moflo cytometer ( dakocytomation , fort collins , colo .) with a 488 - nm laser . data were analyzed with summit v 7 . 19 software ( dakocytomation ). to compare intracellular tnf - α production by monocytes in newborn and adult blood , a tnf - α production index was calculated based on the mean fluorescence intensity ( mfi ): (% of total leukocytes that are monocytes )×(% monocytes that are tnf - α - positive )×( mfi of tnf - α positive monocytes / mfi of monocytes stained with an isotype control antibody ). tlr ligand - induced tnf - α release in whole human blood ex vivo as described above in example 1 . the single stranded ribonucleic acid ( ssrna ) tested in this example was ssrna40 / lyovec purchased from invivogen ( san diego , calif .) comprised of single - stranded gu - rich oligonucleotide ( 5 ′- gscscscsgsuscsusgsususgsusgsusgsascsusc - 3 ′ ( seq id no : 1 ); where “ s ” depicts a phosphothioate linkage complexed with the cationic lipid lyovec that protects the rna from degradation and enhance is uptake by immune cells . the guanosine analog loxoribine ( tlr7 ligand ) was purchased from invivogen . cd40 expression on mdcs was studied in whole newborn cord blood , in comparison to those of adult peripheral blood , using four - color flow cytometry ( bd biosciences ). mdcs were identified as lineage 1 -/ hla - dr +/ cd11c + cells . upregulation of surface cd40 expression was measured using a phycoerythrin - conjugated anti - cd40 mab . data for the effects of imiquimod ( tlr7 ) and resiquimod ( tlr 7 / 8 ) are shown in fig1 a - 15d . newborn ( 1 day old ) and adult ( 6 - 8 week old ) balb / c mice ( obtained from the jackson laboratory ) may be immunized subcutaneously with ova in the absence or presence of a tlr7 / 8 agonist ( selected from those in table i based upon consistent and potent stimulatory activity of neonatal apcs as measured in example 5 ) or the tlr4 agonist lps , neonatal responses to which are often impaired . antigen - specific cd4 + and cd8 + t cells as well as antibody responses may be measured . tlr agonists may be injected at day zero with ova . splenic and lymph node t cells may be studied at multiple time - points after immunization . blood may be collected to prepare serum that may be tested for ova - specific antibodies . t cell proliferation assays may be performed at 7 days post - immunization and antibodies may be measured at 0 , 7 , 14 , and 21 days post - immunization ( robust antibody production by day 14 may occur ). specific protocols are described below : immunization . groups of five neonatal ( 1 day old ; derived from pregnant female mice ; the jackson laboratory ) and five adult ( 6 - 8 week old ) balb / c mice may be injected subcutaneously ( s . c .) at the base of tail with a total of 100 μl of fluid containing one of the following stimuli : 1 ) ova ( 100 μg / mouse ) ( grade iii ; sigma , st louis , mo .) in 100 μl of phosphate - buffered saline ( pbs ), 2 ) ova with lps , 3 ) ova with tlr8 (± 7 ) agonist . seven days later , the mice may be sacrificed ( according to institutional and irb - approved standards ) and the draining lymph nodes ( ln ) harvested for preparation of ova - specific t - cell lines and clones . interpretable and consistent results from the first experiment with 5 mice in each group prove , indicate immunizing another 10 mice in each group ( i . e ., total of 15 mice per group ). preparation of splenocytes and lymph node ( ln ) cells . for preparation of ln cells , draining lns may be removed from mice 7 days after immunization witn ova . single - cell suspensions may be prepared by gentle grinding of lns on stainless steel sieves in pbs . after washing with pbs , the cells may be counted and resuspended in culture medium at an appropriate concentration . to prepare a single - cell suspension of spleen cells ( splenocytes ), spleens may be removed from mice and gently ground on stainless steel sieves in 5 ml of pbs . after centrifugation at 1500 g for 5 min and erythrocyte lysis ( lysis buffer ; sigma ), remaining cells ( including t and b lymphocytes , macrophages and dcs ) may be washed , counted and resuspended in culture medium at an appropriate concentration . cytokine analysis . splenocytes ( 5 × 10 6 ) from mice following immunization may be incubated in wells of 24 - well costar plates in the presence of 250 μg / ml ova ( or buffer control ) for 3 days at 37 ° c ./ 5 % co 2 . secretion of the th1 - polarizing polarizing cytokines il - 2 , il - 4 and ifn - γ into the culture supernatant may be quantified by elisa ( r & amp ; d systems ). proliferation assays . freshly prepared draining ln cells and splenocytes ( 4 × 10 5 ) from mice post - immunization may be incubated in 96 - well flat - bottomed plates ( nunc , roskilde , denmark ) with irradiated stimulatory t cells or ova , at different concentrations in a total volume of 200 μl of r10 . cultures may be incubated at 37 ° in 5 % co2 for 4 days . during the last 8 hr of incubation , [ 3 h ] thymidine ([ 3 h ] tdr , 0 . 5 μci ) may be added to each well . con a may be used as a positive and medium alone as a negative control . the cells may be harvested onto fiber - glass filters and radioactivity measured using a microbeta trilux lsc counter ( eg & amp ; g wallac , turku , finland ). antibody measurement . ova - specific antibodies may be measured by elisa . 96 - well microplates may be coated with ova ( 150 μg / well ) in carbonate buffer ( ph 9 . 6 ) and incubated overnight at 4 ° c . serum samples may be diluted in a total volume of 200 μl pbs at 37 ° c . for 1 h , followed by isotype specific hrp - conjugated rabbit anti - mouse abs ( zymed , san francisco ), and substrate : o - phenylenediamine in citrate buffer ( ph 5 . 0 ) and 0 . 02 % h 2 o 2 . absorbance may be read at 490 nm . specific ova isotype titers may be calculated by the product of absorbance and the reciprocal of the sera dilution from an average of two points in the linear portion of the dilution curve . the th1 - polarizing adjuvant activity of tlr 8 (± 7 ) may be associated with increases in the proportion of anti - ova antibodies of the igg2a sub - class . the references cited throughout the specification are incorporated herein in their entirety by reference . 1 . lewis , d . b . and c . b . wilson , developmental immunology and role of host defenses in fetal and neonatal susceptibility to infection , in infectious diseases of the fetus and newborn infant , j . remington and j . klein , editors . 2001 , w . b . saunders : philadelphia . p . 25 - 138 . 2 . tappero , j . w ., et al ., immunogenicity of 2 serogroup b outer - membrane protein meningococcal vaccines : a randomized controlled trial in chile . [ see comment ]. jama , 1999 . 281 ( 16 ): p . 1520 - 7 . 3 . adkins , b ., development of neonatal th1 / th2 function . international reviews of immunology , 2000 . 19 ( 2 - 3 ): p . 157 - 71 . 4 . akira , s . and k . takeda , toll - like receptor signaling . nature reviews immunology , 2004 . 4 : p . 499 - 511 . 5 . levy , o ., et al ., selective impairment of toll - like receptor - mediated innate immunity in human newborns : neonatal blood plasma reduces monocyte tnf - alpha induction by bacterial lipopeptides , lipopolysaccharide , and imiquimod but preserves response to r - 848 . j immunol , 2004 . 173 : p . 4627 - 4634 . 6 . banchereau , j ., et al ., immunobiology of dendritic cells . annual review of immunology , 2000 . 18 : p . 767 - 811 . 7 . steinman , r . m . and k . inaba , myeloid dendritic cells . journal of leukocyte biology , 1999 . 66 ( 2 ): p . 205 - 8 . 8 . janeway , c . a ., jr . and r . medzhitov , innate immune recognition . annual review of immunology , 2002 . 20 : p . 197 - 216 . 9 . grewal , i . s . and r . a . flavell , cd40 and cd154 in cell - mediated immunity . annual review of immunology , 1998 . 16 : p . 111 - 35 . 10 . quezada , s . a ., et al ., cd40 / cd154 interactions at the interface of tolerance and immunity . annual review of immunology , 2004 . 22 : p . 307 - 28 . 11 . trinchieri , g ., interleukin - 12 , in inflammation : basic principles and clinical correlates , j . i . gallin and r . snyderman , editors . 1999 , lippincott williams & amp ; wilkins : philadelphia . p . 505 - 512 . 12 . evans , j . t ., et al ., enhancement of antigen - specific immunity via the tlr4 ligands mpl adjuvant and ribi . 529 . expert review of vaccines , 2003 . 2 ( 2 ): p . 219 - 29 . 13 . hunt , d . w ., et al ., studies of human cord blood dendritic cells : evidence for functional immaturity . blood , 1994 . 84 ( 12 ): p . 4333 - 43 . 14 . adkins , b ., c . leclerc , and s . marshall - clarke , neonatal adaptive immunity comes of age . nature reviews . immunology ., 2004 . 4 ( 7 ): p . 553 - 64 . 15 . goriely , s ., et al ., a defect in nucleosome remodeling prevents il - 12 ( p35 ) gene transcription in neonatal dendritic cells . journal of experimental medicine , 2004 . 199 ( 7 ): p . 1011 - 6 . 16 . vekemans , j ., et al ., neonatal bacillus calmette - guerin vaccination induces adult - like ifn - gamma production by cd4 + t lymphocytes . european journal of immunology , 2001 . 31 ( 5 ): p . 1531 - 5 . 17 . du , x ., et al ., three novel mammalian toll - like receptors : gene structure , expression , and evolution . european cytokine network ., 2000 . 11 ( 3 ): p . 362 - 71 . 18 . chuang , t . h . and r . j . ulevitch , cloning and characterization of a sub - family of human toll - like receptors : htlr7 , htlr8 and htlr9 . european cytokine network ., 2000 . 11 ( 3 ): p . 372 - 8 . 19 . hemmi , h ., et al ., small anti - viral compounds activate immune cells via the tlr7 myd88 - dependent signaling pathway . [ comment ]. nature immunology ., 2002 . 3 ( 2 ): p . 196 - 200 . 20 . heil , f ., et al ., species - specific recognition of single - stranded rna via toll - like receptor 7 and 8 . [ see comment ]. science , 2004 . 303 ( 5663 ): p . 1526 - 9 . 21 . levy , o ., et al ., human newborn blood monocytes demonstrate low tnf - alpha but high il - 6 responses to an array of toll - like receptor ligands : role of a low - molecular weight plasma inhibitor of tnf - alpha release . journal of endotoxin research ( conference abstracts ), 2004 . 10 ( 5 ) p . 370 . 22 . ahonen , c . l ., et al ., dendritic cell maturation and subsequent enhanced t - cell stimulation induced with the novel synthetic immune response modifier r - 848 . cellular immunology , 1999 . 197 ( 1 ): p . 62 - 72 . 23 . gorden , k . b ., et al ., synthetic tlr agonists reveal functional differences between human tlr7 and tlr8 . journal of immunology , 2005 . 174 ( 3 ): p . 1259 - 68 . 24 . jurk , m ., et al ., human tlr7 or tlr8 independently confer responsiveness to the antiviral compound r - 848 . [ comment ]. nature immunology ., 2002 . 3 ( 6 ): p . 499 . 25 . galanos , c ., et al ., malp - 2 , a mycoplasma lipopeptide with classical endotoxic properties : end of an era of lps monopoly ? journal of endotoxin research ., 2000 . 6 ( 6 ): p . 471 - 6 . 26 . hoshino , k ., et al ., cutting edge : toll - like receptor 4 ( tlr4 )- deficient mice are hyporesponsive to lipopolysaccharide : evidence for tlr4 as the lps gene product . journal of immunology , 1999 . 162 ( 7 ): p . 3749 - 52 . 27 . heil , f ., et al ., the toll - like receptor 7 ( tlr7 )- specific stimulus loxoribine uncovers a strong relationship within the tlr7 , 8 and 9 subfamily . european journal of immunology , 2003 . 33 ( 11 ): p . 2987 - 97 . 28 . bender , a ., et al ., improved methods for the generation of dendritic cells from nonproliferating progenitors in human blood . journal of immunological methods , 1996 . 196 ( 2 ): p . 121 - 35 . 29 . kruisbeek , a . and e . shevach , proliferative assays for t cell function , in current protocols in immunology , r . coicio , editor . 1991 , john wiley & amp ; sons , inc . : bethesda , md . p . 3 . 12 . 1 - 3 . 12 . 14 . 30 . smith , k ., c . beadling , and e . jacobson , interleukin - 2 , in inflammation : basic principles and clinical correlates , j . i . gallin and r . snyderman , editors . 1999 , lippincott williams & amp ; wilkins : philadelphia . 31 . thomsen , l . l ., et al ., imiquimod and resiquimod in a mouse model : adjuvants for dna vaccination by particle - mediated immunotherapeutic delivery . vaccine , 2004 . 22 ( 13 - 14 ): p . 1799 - 809 .	0
the invention now will be described more fully hereinafter with reference to the accompanying drawings , in which illustrative embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . further , the singular forms and the articles “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless expressly stated otherwise . it will be further understood that the terms : includes , comprises , including and / or comprising , when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . further , it will be understood that when an element , including component or subsystem , is referred to and / or shown as being connected or coupled to another element , it can be directly connected or coupled to the other element or intervening elements may be present . fig1 shows a reduced pupil imaging system 10 which has been constructed according to the principles of the present invention . the incoming optical wavefront of light 8 is captured by an input lens array 105 . the input lens array 105 comprises an array of lenslets 106 - 1 , 106 - 2 , 106 - 3 , . . . , 106 - n . these lenslets 106 focus the incoming light onto an corresponding array of optical input couplers 104 - 1 , 104 - 2 , 104 - 3 , 104 - 4 , . . . , 104 - n that are arranged on a top face of a waveguide chip 202 . although not strictly necessary , the lens array 105 provides increased collection of the desired light while reducing the collection of unwanted light that is outside the field - of - view . the input couplers 104 can be implemented a number of ways . examples include gratings , etched mirrors , and plasmonic antennae . these input optical couplers couple the incoming light into a matched pathlength combining waveguide array 50 that is implemented in the waveguide chip 202 . this matched pathlength combining waveguide array 50 transmits the light to an array of output optical couplers 110 - 1 , 110 - 2 , 110 - 3 , . . . , 104 - m . preferably , number ( m ) of output optical couplers 110 is less than the number ( n ) of optical input couplers 104 . this is a consequence of the combining waveguide array 50 . this has the advantage of reducing space contention on the waveguide chip 202 as the waveguides converge to the output couplers 110 . in one example , the ratio of input couplers 104 to optical couplers 110 is greater than 4 : 1 , and is usually greater than 16 : 1 in addition , for many embodiments , lateral extent ( b ) ( length and width ) of the array of output optical couplers 110 is smaller than the lateral extent ( a ) ( length and width ) of the array of input couplers 104 . as a result , the waveguide chip 202 has the effect of reducing the pupil size of the imaging system 10 over typical lens - base imaging systems . in a typical example , the lateral extent ( a ) of the array of input couplers 104 is at least four times larger than the lateral extent ( b ) of the array of output couplers 110 . the light travels across the chip 202 and is then re - emitted using a similar shaped , but more compact array of output couplers 110 . if the waveguide pathlengths are kept exactly equal , this new wavefront is identical ( except smaller ) then the incident wavefront 8 . this new wavefront can be reimaged using standard optics ( which is much smaller than that which would be necessary to image the original wavefront ), producing an image that contains all the resolution information in the original wavefront . in some embodiments , the waveguide chip 202 is a silicon wafer . the matched pathlength combining waveguide array 50 is fabricated within a thickness of the chip 202 . the optical waveguides may be made of glass or another material that is optically transparent at wavelengths of interest . the optical waveguides may be solid or they may be hollow , such as a hollow defined by a bore in the thickness of the wafer , and partially evacuated or filled with gas , such as air or dry nitrogen . the optical waveguides may be defined by a difference between a refractive index of the optical medium of the waveguides and a refractive index of the substrate or other material surrounding the optical waveguides . the waveguide chip may be fabricated using conventional semiconductor fabrication processes , such as the conventional cmos process . an output lens array 107 comprises output lenslets 108 - 1 , 108 - 2 , . . . , 108 - m , corresponding to the array of output couplers 110 . these guide the light exiting from the waveguide chip 202 to imaging optics 210 . the imaging optics 210 then forms an image at an image plane . in the illustrated example , an image detector 212 , such as a ccd array or cmos detector is located at the image plane in order to detect the image . although resolution is preserved , field - of - view is sacrificed . the field - of - view can be steered , however , by moving the lens array . for this method to work , precise pathlength control is necessary to preserve the wavefront . although current fabrication methods are extremely precise , some fine tuning , such as active phase shifters are expected to be required to achieve the sub - wavelength control necessary for this application . it is also possible to alter the waveguide pathlengths in a controlled manner to produce desired results at the output . for example , a lens can be effectively built into the waveguides by altering the pathlengths to produce the same pathlength delays that an additional lens would . it is also possible to alter the locations of the outputs to produce a similar effect . fig2 shows the arrangement of the matched pathlength waveguide tiles in the matched pathlength combining waveguide array 50 . in the illustrated example , the waveguides are arranged into several matched pathlength combining waveguide tiles 100 - 1 , 100 - 2 , 100 - 3 , 100 - 4 . each of these tiles 100 combines the light received at several optical input couplers 104 and combines the feeds from those input couplers , successively , through a branching waveguide network 115 until the light from the optical couplers 104 for a tile 100 is combined onto a final root waveguide 124 that terminates in an output coupler 110 . in general , the average phase is preserved through the tiles 100 , and then the output couplers 110 of the tiles 100 are arranged in an array to produce a smaller copy of the incident wavefront . this method can be used to reduce the number of output elements necessary . although shown in a regular arrangement , other arrangements of the tiles 100 are possible . in general , a larger field - of - view ( without sacrificing resolution ) requires more output elements and therefore more complexity . together these methods create a means for choosing the size of the field - of - view based on the application , while providing methods of steering the field - of - view for a large field - of - view . specifically , in the illustrated example , the light received by the input optical couplers 104 of the first matched pathlength combining waveguide tile 100 - 1 , for example , is successively combined in the branching waveguide network 115 - 1 until the combined optical signal is provided on its corresponding root waveguide 124 - 1 . all together , the root optical waveguides 124 - 1 , 124 - 2 , 124 - 3 , 124 - 4 for the respective tiles 100 - 1 , 100 - 2 , 100 - 3 , 100 - 4 each provide their light to its corresponding optical output coupler 110 - 1 , 110 - 2 , 110 - 3 , 110 - 4 so that it can be subsequently imaged by the imaging optics 210 onto the image detector 212 . in some embodiments , phase jump tuners 350 - 1 , 350 - 2 , 250 - 3 , 350 - 4 are further provided on the root waveguides 124 - 1 , 124 - 2 , 124 - 3 , 124 - 4 of each of the tiles 100 - 1 , 100 - 2 , 100 - 3 , 100 - 4 . these phase jump tuners 350 - 1 , 350 - 2 , 250 - 3 , 350 - 4 control the relative phases of the light from each of the tiles . these are used to steer the field of view to higher angles by compensating for a tilted wavefront across the extent of the matched pathlength combining waveguide array 50 . the jump tuners 350 - 1 , 350 - 2 , 250 - 3 , 350 - 4 provide each tile 100 incremental jumps in phase delay . fig3 is a schematic diagram showing a plan view of a matched pathlength combining waveguide tile 100 . this illustrated example shows an h - tree arrangement . other arrangements of optical couplers are anticipated , such as arrangements that provide an asymmetric effective field - of - view . yet other arrangements of optical couplers are also anticipated . for example , x - trees may be used , although x - trees may require crossing optical paths . however , for simplicity , the following examples are described herein using h - trees . the illustrated tile 100 shows a 32 × 32 array of input couplers 104 feeding to a single output computer 110 . the optical input couplers 104 are connected to leaves or first level waveguides 112 of the h - tree branching waveguide network 115 . ( for clarify of the figure , only the upper right portion of the branching waveguide network 115 is labeled with reference numerals . due to the symmetry of the network , this description applies to the other sections as well .) the first level optical waveguides 112 each meet at first level optical combiners 118 . the first level optical combiners 118 in turn feed second level waveguides 116 . the feeds from the second level waveguides 116 are then combined in second level combiners 120 . the second level combiners 120 in turn feed third level combiner 122 . depending on the depth of the branching waveguide network 115 , the optical signals are combined through successive combinations of waveguides and combiners until the root waveguide 124 is reached . in the specific illustrated network , there are fourth level combiners 126 , fifth level combiners 128 , sixth level combiners 130 , and seventh level combiners 132 , until a final eighth level combiner 134 feeds the single root waveguide 124 . the optical waveguides of the same level are of matched , specifically equal , lengths . similarly , other pairs of optical waveguides that meet at common combiners are of equal lengths . in the illustrated example , the direction of combination alternates ( left - right , up - down ) between successive optical combiners 118 to 120 to 124 to 126 to 128 to 130 to 132 to 134 to ensure each signal combination occurs in phase . the resulting branching phased array 115 operates over a broad range of wavelengths . the entire array 115 feeds a root optical waveguide 124 , which is referred to herein as a “ root ” of the h - tree . in some embodiments , the optical couplers 104 are sized and spaced apart by less than one wavelength . if elements are this close then the input lens array 105 and its array of lenslets 106 - 1 , 106 - 2 , 106 - 3 , . . . , 106 - n . are not used . however , in other embodiments , the optical couplers 104 may be spaced apart by more than one wavelength , including tens or hundreds of wavelengths . in these cases , then the input lens array 105 is used . the illustrated embodiment includes an array of 32 × 32 optical couplers 104 with 100 μm spacing . fig4 is a schematic perspective illustration of a building bloc portion of a combining waveguide tile 100 of fig3 . specifically four optical input couplers 104 - 1 , 104 - 2 , 104 - 3 , and 104 - 4 are arranged in an array . these optical couplers 104 - 1 , 104 - 2 , 104 - 3 , 104 - 4 feed the first level waveguides 112 - 1 , 112 - 2 , 112 - 3 , 112 - 4 . the first level waveguides 112 terminate in first level combiners 118 - 1 , 118 - 2 . these first level couplers feed second level waveguides 116 - 1 , 116 - 2 , which terminate in a second level combiner 120 . the second level combiner in turn feeds a third level waveguide 121 . design of the optical combiners , such as optical combiners 118 , 120 , 122 , 126 , 128 , 132 , and 134 , should be selected for low loss and coherent power combination . for example , multi - mode interferometers ( mmi ), which are compact and perform over somewhat large bandwidths , may be used as optical combining / splitting elements . other possible combiner / splitter designs that are possible are adiabatic couplers , resonant couplers , and hybrid - ring combiners . fig5 a and 5b illustrate the operation of a preferred embodiment in which phase shifters are provided for each input optical couplers 104 in order to provide for the steering of the field - of - view . in more detail , with respect to fig5 a , consider the downrange view 70 for a matched pathlength combining waveguide array 50 . light received from the object of interest 72 has a tilted wavefront from the perspective of the matched pathlength combining waveguide array 50 . as a result , light from the object of interest 72 will not be in - phase and thus will destructively interfere in the cascade of combiners 118 , 122 , etc in each tile 100 . fig5 b shows the addition of a phase shifting system 300 within the matched pathlength combining waveguide array 50 . the field - of - view of the waveguide array 50 is steered by adding a phase shift to the feeds from each of the input optical couplers 104 . it is thus possible to steer to the field - of - view . the phase shifting system 300 compensates for the tilted wavefront 74 of off - axis light and allows off - axis light to constructively interfere within the cascade of combiners 118 , 122 . as shown , the phase shifting system 300 imparts a different , but predictable phase shift to the feeds from each input optical coupler 104 . of note is the fact that all the tiles 100 on the matched pathlength combining waveguide array 50 require ( precisely ) the same phase shifts ; so it is possible to control all the all the tiles 100 in the array 50 with the same drive electronics . fig6 a - 6d show the results of a simulation illustrating how the field - of - view can be steered . fig6 a shows the case without steering . shown is the downrange view 70 . the object of interest 72 is in the lower part of the view . the field - of - view 74 of the imaging system 10 is in the center of the downrange view 70 . fig6 b shows the light output from the unsteered array 50 . there is nothing in the image since no light escapes the matched pathlength combining waveguide array 50 . fig6 c shows the case with steering . shown is the downrange view 70 . the object of interest 72 is in the lower part of the view . the field - of - view 74 of the imaging system 10 is steered to be coincident with the object of interest 72 . fig6 d shows the light output from the steered array 50 . now there is an image since light from the object of interest 72 escapes through the matched pathlength combining waveguide array 50 . fig7 is a schematic diagram showing the implementation of the phase shifting system 300 into the branching waveguide network 115 of a portion of a tile 100 . the optical waveguides 112 , 116 , 121 of each of the respective levels include respective exemplary pathlength tuners 312 , 316 , 321 . these pathlength tuners 312 , 316 , 321 provide dynamically tunable optical delays for the optical signal exiting each level of optical combiners 118 , 120 , 126 . in one implementation , the pathlength tuners 312 , 316 , 321 are heated sections of the waveguides , controlling the index of refraction . heaters are preferably fabricated in the waveguide chip 202 . the amount of heat generated by each heater is controlled by the phase controller 360 , which also controls the phase jump tuner 350 . thus , each dynamically tunable optical delay line includes a thermally phase - tunable optical delay line . in should be noted that in some embodiments , trimming portions are additionally included into the optical waveguides 112 , 116 , 121 . each trimming section is made of a material whose refractive index can be permanently changed , such as by annealing the material in the trimming section . thus , the waveguides of the array can be adjusted as part of a manufacturing / calibration operation to ensure matching optical delays within the branching waveguide network 115 of each tile 100 . in the illustrated example , the feeds from input optical couplers 104 - 1 and 104 - 2 are combined in first level combiner 118 - 1 . the relative delay between these feeds is controlled by pathlength tuners 312 - 1 and 312 - 2 under the control of the phase controller 360 . in a similar way , feeds from input optical couplers 104 - 3 and 104 - 4 are combined in first level combiner 118 - 2 . the relative delay between these feeds is controlled by pathlength tuners 312 - 3 and 312 - 4 also under the control of the phase controller 360 . then delay in the signals at the second level combiners 120 can also be tuned . for example , the delay of the light from combiner 118 - 1 is modulated by the control of the pathlength tuners 316 - 1 and the delay of the light from combiner 118 - 2 is modulated by the control of the pathlength tuners 316 - 2 . in the illustrated embodiment subsequent pathlength tuners 340 and 342 are provided to enable pathlength control deeper in the network 115 to further facility steering control via the phase controller 360 . fig8 shows the details of one embodiment of the phase jump tuner 350 that provides additional phase adjustment for each tile 100 . it is anticipated that that the pathlength tuners 312 , 316 , 321 within the waveguides will be able to compensate for the tilted wavefront across the extent of a tile . however , to compensate for the tilted wavefront across the extent of the matched pathlength combining waveguide array 50 , each tile 100 will need to provide incremental jumps in phase . in one embodiment , the phase jump tuner 350 comprises a series of optical switches 352 , 354 , 356 that switch the optical signal on the root waveguide 124 from the branching network 115 between respective short paths 361 , 363 , 365 , and long paths 362 , 364 , 366 . in this way , increments of delay can be added for each tile 100 under the control of the phase controller 360 to facilitate steering to higher angles . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	6
this invention 20 ( see fig9 a ) relates to dynamically controlled electronic article surveillance ( eas ) systems whereby an array of antenna elements ( ant . 1 , ant . 2 , . . . ant . k ) is digitally phased and actively driven for concurrent transmission 22 and digitally phased and then combined in the receiver unit 24 to improve detection of a security tag 10 . all of this is arranged from a central coordination 26 ( e . g ., processor ). in particular , the transmit and receive interrogating field is digitally scanned such that detection may be reinforced in some desired locations and still be insensitive to tag orientation suppressed in some other locations . in one manifestation of the invention , active phasing of multiple antenna elements for concurrent transmission is performed digitally using a direct digital synthesizer ( dds ). fig1 shows a high - level view of the dds 100 . a phase delta 101 controlling the output frequency is accumulated ( i . e ., digitally - integrated in time ) and quantized to generate an index 102 that is mapped by the sine / cosine lookup table 103 to generate the output rf waveform 104 . after the phase accumulation 105 , a desired phase offset 106 is added to the result prior to quantization . the phase delta and phase offset can be set or changed dynamically in terms of cycles per sample over a wide range of the rf spectrum . for example , a phase delta of one tenth ( 1 / 10 ) and a phase offset of one hundredth ( 1 / 100 ) implies that in 10 time samples , one sinusoid is completed with a phase shift of 360 / 100 degrees . the dds output is then presented to a digital - to - analog converter ( dac ) 107 and a low - pass filter 108 to yield the analog , transmit waveform . different phase offset registers are used , one for each antenna element , to produce a digital phasing network such that the same lookup table can be time - division multiplexed to produce a plurality of rf waveforms . furthermore , with the availability of both the sine and cosine outputs from the same lookup table , a pair of transmit signals are readily generated with a phase separation of 90 °. in another manifestation of the invention , active phasing of multiple antenna elements for concurrent transmission is performed using a digital phase - shift , up - convert network . a template in - phase ( i ) and quadrature ( q ) baseband signal is first designed and presented to a digital phase shift network followed by a digital up - converter ( duc ). fig1 shows a digital phase shift network 200 obtained using a network of multipliers and adders to perform a plurality of vector rotations according to the rotation matrix [ i ^ k q ^ k ] = [ cos ⁢ ⁢ θ k sin ⁢ ⁢ θ k - sin ⁢ ⁢ θ k cos ⁢ ⁢ θ k ] ⁡ [ i q ] [ î k , { circumflex over ( q )} k ] represents the rotated waveform for antenna element k , and θ k represents the phase shift for antenna element k . fig1 shows a phased shifted output being up - converted in frequency using the cascade integrator comb ( cic ) up - sampling filter 201 and the dds 100 . the final up - converted signal is given according to : s k ( n )= { tilde over ( x )} k ( n ) cos ( ω 0 n )− { tilde over ( y )} k ( n ) sin ( ω 0 n ) where [{ tilde over ( x )} k , { tilde over ( y )} k ] represents the cic output for antenna element k ω 0 represents the desired angular frequency of the rf waveform . the same dds is employed to perform the frequency up shifting for all of the transmit antenna elements . unlike an analog phase - shift network that is appropriate for use only at a single ( or narrowband ) frequency , the same digital phase shift network 200 ( of fig1 ) can be used over a wide range of the rf spectrum simply by adjusting the dds &# 39 ; s phase delta . in another facet of the invention , to achieve substantial far - field suppression for regulatory compliance , the vector summation of the plurality of phase shift employed to drive the transmit antenna array must equal zero in the far field . the choice of phase shifts employed to drive the transmit antenna array is crucial not only to the pattern of the interrogating field generated , but also to the field strength far away from the antenna . in order that the far - field energy is suppressed for regulatory purposes , a constraint is imposed here as shown in fig1 such that substantial far - field suppression is achieved regardless of the antenna structure and the number of antenna elements present in the system . for example , in a system with three identical antenna elements , if two of the phase shifts were 0 ° and 120 °, then it would be desirable to choose a phase shift of 240 ° for the third antenna element such that the vector sum of all phase shifts equals zero . for another facet of the invention , the plurality of rf / if receive signals from the antenna array are digitally processed using a down - convert , phase - shift network . the received rf signal for each antenna is presented to a digital down - converter ( ddc ) followed by a digital phase shifter . fig1 shows a received rf signal being down - converted in frequency using the dds 100 and the cic down sampling filter 400 . the frequency down - converted output corresponds to the baseband i / q signal in a reverse fashion to operations in the transmit mode . the same dds and digital phase shift network used during the transmit mode are employed in the receive mode to perform the frequency down shifting and phase shifting for all of the receive antenna elements . for tag detection , a composite receive signal is derived by combining the plurality of down - converted , phase - shifted , receive signals using a coherent envelope detector that performs the square - of - sum operation . fig1 shows a block diagram for the generation of a new composite signal computed as the square - of - sum 500 of data for a plurality of receive antennas . for n identical elements , the summation gives a sensitivity that is n times the sensitivity of a single element . the effect of the coherent summation is to rotate and align the i / q - vectors from the plurality of receiving antenna elements along the same direction such that the resulting vector summation equals the magnitude sum of the induced voltage on the receiving antenna elements . by varying the choice of the rotation angles , one can adjust the spatial sensitivity or directivity of the receive field as needed to detect a resonating label at different spatial coordinate and orientation with respect to the antenna array structure . this is particularly appropriate in cases where the mutual coupling between the antenna elements must be accounted for . in addition , as the angle of flux line intersection between the emitted fields vary continuously in space , the induced voltage on the receive antennas can have a mutual phase difference that depends on the location and orientation of the tag . the invention is also possible of creating , for tag detection , a plurality of composite receive signals derived from the many down - converted , phase - shifted , receive signals using a coherent envelope detector that performs the square - of - sum 500 operation . because the choice of the phase shifts employed in the receive mode determines the spatial sensitivity or directivity of the receive field , different sets of phase shifts may be required to best detect a tag entering the interrogating field at different locations , especially when the signal - to - noise ratio is poor . fig1 shows a scheme that produces two composite receive signals derived from an array of receive antennas using two different sets of phase shifts . the idea is that while one set of phase shifting is appropriate for the detection of a resonating tag located in a specific region , the other set is appropriate for the detection of the resonating tag located in a different region . as another embodiment of the invention , for tag detection , a composite receive signal is derived from the plurality of down - converted signals using an incoherent envelope detector that performs the sum - of - square operation . fig1 shows a block diagram for generating a new composite signal computed using the sum - of - square 700 operation on data from a plurality of receive antennas . this corresponds to having a square - law detector ( envelope detector ) for each antenna element and then adding the power ( magnitude ) from the elements to get a final signal measure . for incoherent summation , the implementation is more straightforward as compared to coherent summation but the sensitivity being √{ square root over ( n )}, is somewhat less optimum compared to n for coherent summation . the individual frequency and phase of the plurality of transmit signals are dynamically altered to allow for automated manipulation ( steering ) of the transmit field pattern . with the use of high - speed computer control ( microcontroller , microprocessor , fpga , etc ) and a phased array antenna system , the transmit field pattern can be rapidly scanned by controlling the phasing and excitation of the individual antenna element . fig1 shows a block diagram whereby an array of antenna elements is dynamically phased and actively driven for concurrent transmission . a digitally controlled array antenna can give eas the flexibility needed to adapt and perform in ways best suited for tag detection for the particular retail store environment . furthermore , frequency scanning is made possible with the frequency of transmission changing at will from time to time . these functions may be programmed adaptively to exercise effective automatic management such that the field pattern may be reinforced in some desired locations and suppressed in some other locations to localize the detection region . the individual frequency and phase of the plurality of receive signals are dynamically altered to allow for automated manipulation ( steering ) of the receive field sensitivity . fig1 shows a block diagram whereby an array of antenna elements is dynamically phased and combined in the receiver unit to improve detection . the performance of tag detection is affected by the transmit field pattern as well as the receive field sensitivity due to the law of reciprocity . in particular , for an eas system operating in pulsed mode , a reciprocity exists between the transmit field intensity and the receive field sensitivity , in relation to the decay of field strength as distance increases . thus , for tag detection , the dynamic phasing of the plurality of transmit signals is only effective if dynamic phasing of the plurality of receive signals is also performed . for wide aisle antenna configuration , the antenna elements are arranged to form a pedestal pair such that half of the elements having a phase shift of 0 ≦ φ i & lt ; π are located coplanar on one side of the exit aisle while the other half of the antenna elements having a phase shift of π ≦ φ j & lt ; 2π of are located coplanar on the other side of the exit aisle . in particular , fig2 shows such a scheme 1000 consisting of four antenna elements whereby the 0 ° and 90 ° loops are arranged in a common plane on one side of the exit aisle , while the 180 ° and the 270 ° loops are arranged in a common plane on the other side . note that the sum of all the transmit phases is 360 ° so that the far - field emission is substantially reduced . the antenna structures for the dynamic eas system can be constructed in a variety of ways . for instance , rather than being constructed as air - loops , the antenna elements 210 may consist of windings 206 about electromagnetic cores 204 , such as a ferrite ceramic material , separated by non - ferrous spacers 202 , such as shown in fig2 . distinct loops may share a common core or be linearly disposed on adjacent or nearly adjacent segments of material , or in a variety of other arrangements . by way of example only , fig2 depicts a loop antenna la ( e . g ., typically used as an “ in - lane ” antenna ) comprising a double loop l 2 and a triple loop l 3 . fig2 depicts a ferrite core antenna fca ( similar to that discussed with regard to fig2 ) comprising , again by way of example only , four phase elements pe 1 - pe 4 wherein pe 1 and pe 3 are electrically coupled together and pe 2 and pe 4 are electrically coupled together . in the parent application namely , a ser . no . 12 / 134 , 827 entitled “ dynamic eas detection system and method ” each loop antenna la or ferrite core antenna fca comprises a reader / transmitter board ( e . g ., 22 - 1 through 22 - k ) and a dedicated reader / transmitter / driver ( txl 2 and txl 3 ) for each loop l 2 and l 3 ( see fig2 ) in the loop antenna la or a dedicated reader / transmitter / driver ( txpe 13 and txpe 24 ) for each phase element pair pe 1 / pe 3 and pe 2 / pe 4 ( see fig2 ) in each ferrite core antenna fca . the improvement of the present application eliminates the need for a dedicated reader / transmitter / driver for each component of the loop antenna la or phase element pairs in the ferrite core antenna fca . in particular , as shown in fig2 a , a phase coupler 1100 is coupled between a single reader / transmitter / driver tx and each of the loops l 2 and l 3 of a single antenna ; similarly , as shown in fig2 a , a phase coupler 1100 is coupled between a single reader / transmitter / driver tx and each of the phase element pairs pe 1 / pe 3 and pe 2 / pe 4 . the end result is that using the phase coupler 1100 , permits the second reader / transmitter / driver on the reader / transmitter board ( e . g ., 22 - 1 through 22 - k ) to be available to either drive a second loop antenna la or ferrite core antenna fca via another coupler 1100 . alternatively , instead of driving a second loop antenna la or ferrite core antenna fca , the second reader / transmitter / driver can drive a deactivator antenna d , as shown in phantom in fig2 a and 25a . fig2 a shows two loop antennas la 1 and la 2 at a checkout location and which are driven using the system and coupler 1100 ( not shown ) of the present invention . thus , using the system and coupler 1100 , dual pedestal aisle application can be controlled using a single electronics board . no synchronization cables or dc power cables need to be connected between the two pedestals . it should also be noted that the electronics boards can be localized within the pedestals or can be remotely - located . with two antenna structures controlled by one electronics board , this permits digitally - phasing the two antenna structures for detection enhancement . as a result of the foregoing , the system uses less power and is readily more adaptable and flexible for installation in more retail environments . fig2 b depicts the alternative where a single loop antenna la 1 at the checkout location is driven by the system and coupler 1100 of the present invention as well as a deactivator antenna d . fig2 depicts a schematic of the coupler 1100 by way of example only . in particular , the coupler 1100 comprises an input from the reader / transmitter tx which is passed through a transformer t 1 ( e . g ., 1 . 2 μh acts as 75 ω at 8 . 2 mhz ). a circuit comprising l 1 and c 1 and c 2 acts as a power divider ( 50 %) and a 90 ° phase shifter for generating the respective drive signals for l 2 and l 3 ( or pe 1 / pe 3 and pe 2 / pe 4 ) and both of which form inductively coupled outputs via t 2 and t 3 for proper isolation . the shunt capacitors sc 1 / sc 2 are tunable for different antennas and therefore can vary in the range of 24 pf to 39 pf . thus , both the amplitude and phase of the driver signals can be tuned for optimal near field detection and far field cancellation . while the invention has been described in detail and with reference to specific examples thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .	6
as used herein , the term ‘ primate pluripotent stem cell ’ ( ppsc ) refers to cells of primate origin which have the characteristic of being capable under appropriate conditions of producing progeny of different cell types that are derivatives of all of the three germinal layers ( i . e ., endoderm , mesoderm and ectoderm ) or the ability to form identifiable cells of all three germ layers in tissue culture . included in the definition of pluripotent stem cells are embryonic cells of various types , exemplified by human embryonic stem cells ( hesc ), described by thomson et al . ( science , 1998 . 282 , 1145 - 47 ), induced pluripotent stem cells ( ipsc ), described by takahashi et al . ( cell , 2007 . 131 , 861 - 872 ) produced by reprogramming differentiated cells and parthenogenetic human embryonic stem cells ( phesc ), described by revazova et al . ( cloning stem cells . 2007 , 9 ( 3 ), 432 - 449 ), derived from an embryo produced without fertilisation . recently kilmanskaya et al . ( nature , 2006 . 444 , 481 - 485 ) described a single blastomere biopsy method for isolating hesc from single blastomeres without destroying the embryo . furthermore chung et al . ( cell stem cell , february 2008 . 2 ( 2 ), p . 113 - 7 ) demonstrated the derivation of five hesc lines without embryo destruction , including one without hesc co - culture . the blastomeres were removed using a technique similar to pre - implantation genetic diagnosis and the procedure did not appear to interfere with subsequent blastocyst development of the parent embryo . for the avoidance of doubt , any cells of primate origin which are fully pluripotent ( capable of producing progeny that are derivatives of all three germinal layers ) are included in the definition of ppsc , regardless of whether or not they are derived from embryonic tissue , foetal tissue , adult tissue ( e . g . ipsc ) or other sources . the h1 human es cell line was acquired from wicell research institute ( madison , wis . ), propagated on matrigel - coated vessels ( around 0 . 3 mg / ml when coating ) and cultured in mtesr ( both obtained from stemcell tech ). the h7 human es cell line was propagated and maintained on matrigel coated vessels in x - vivo10 medium ( lonza ), supplemented with 80 ng / ml fgf2 and 0 . 5 ng / ml tgfbi ( r & amp ; d systems ) in feeder - free , serum - free conditions . cells were passaged when approximately 80 % confluent by treatment with 5 mg / ml collagenase iv for 5 min , washing with pbs and trypsynized with 0 . 25 % trypsin - edta ( all from life technologies ). 10 % fbs ( paa ) in rpmi 1640 medium ( life technologies ) was used to stop trypsinization . the number of total and viable cells was determined using a nucleocounter yc - 100 ( chemometec ). collagenase iv was used to detach the boundaries of colonies in the flasks to be passaged . the cells were then washed with pbs , scraped in medium and passaged onto new matrigel coated vessels at the cell density of 0 . 5 - 0 . 6 × 10 5 cells / cm 2 . medium was changed daily . definitive endoderm formation : hesc were passaged onto the appropriate culture flasks or plates at 0 . 6 × 10 5 cells / cm 2 and cultured for 2 days . to initiate definitive endoderm differentiation hesc were washed once with pbs and cultured in rmpi 1640 medium ( life technologies ) supplemented with 100 ng / ml of activin a ( r & amp ; d systems ) and 0 . 25 to 2 % of dmso ( sigma ). fbs ( 0 . 2 %) was added after first 24 hours and cells were cultured for four days with media changed daily . hepatic specification : hesc - derived definitive endoderm cells were washed once with pbs and cultured in ko - dmem medium and 2 % kosr supplemented with 1 mm l - glutamine , neaa ( all from life technologies ), b - mercaptoethanol ( sigma ), 30 ng / ml bmp2 , 10 ng / ml fgf4 , 0 . 5 % dmso for 5 days with bmp4 . hepatoblast - like cells were then washed with pbs , trypsynised and plated onto new matrigel - coated vessels at 0 . 4 × 10 5 cells / cm 2 and cultured in the same medium for subsequent 3 days but with bmp4 substituted for 10 ng / ml hgf . next , cells were washed with pbs and cultured for six days in hepatozyme medium ( life technologies ) supplemented with 2 % fbs , 1 mm l - glutamine , 2 ug / ml insulin ( roche ), 2 ug / ml ascorbic acid ( sigma ), 10 − 7 m dexamethasone ( sigma ), 10 ng / ml hgf and 10 ng / ml osm ( r & amp ; d systems ) with daily medium changes . cells were then for cultured for ten days in l - 15 medium ( phenol red - free , life technologies ) supplemented with 2 % fbs , 2 ug / ml ascorbic acid , 10 mm hepes ( life technologies ), 2 ug / ml insulin , 10 − 7 m dexamethasone , and 10 ng / ml osm with daily medium changes . the liver hepatocellular carcinoma hepg2 cell line ( attc ) was cultured in rpmi 1640 medium supplemented with 1 mm l - glutamine , neaa 10 % fbs on poly - d - lysine coated vessels at the density of 0 . 4 × 10 5 cells / cm 2 for two days before use . for detection of stage - specific markers , cells were grown and differentiated in 96 well plates ( uclear black plate with clear flat bottom , greiner ). cells were rinsed twice with pbs and fixed in 4 % paraformaldehyde ( usb ) for 15 min at room temperature and then washed twice with pbs and blocked for 30 min at rt in 1 % bsa ( life technologies ) and 0 . 1 mg / ml human igg ( sigma ) in perm / wash buffer ( bd ). cells were subsequently stained for 2 hours at rt or overnight at 4 ° c . with primary rabbit anti - oct4 ( cell signaling ), mouse and anti - sox17 ( abcam ) antibodies diluted in perm / wash buffer . cells were subsequently washed several times with perm / wash buffer and incubated at 4 ° c . in the dark with goat anti - mouse - fitc and chicken anti - rabbit - cy5 ( molecular probes ) diluted 1 : 400 in perm / wash buffer . after 1 hour incubation , cells were washed several times with pbs and incubated with hoechst 33342 ( life technologies ) for 15 min at room temperature . after subsequent washing with pbs , 96 well plates were then imaged on in cell analyzer 2000 ( ge healthcare ). cells cultured in 6 well plates were washed twice in pbs and treated with 0 . 25 % trypsin - edta ( life technologies ) to obtain single cell suspensions . trypsin was inactivated after 5 min of incubation by adding medium containing 10 % fbs . cells were counted , centrifuged at 300 g for 5 min , washed twice with pbs and subsequently fixed in 2 % paraformaldehyde ( usb ). following 15 min incubation at room temperature cells were washed in pbs and perm / wash buffer ( pwb ) ( bd ) and subsequently resuspended at 4 × 10 6 cells / ml in perm / wash buffer supplemented with 0 . 1 mg / ml human igg ( sigma ) and 10 % serum from the species of secondary antibody ( life technologies ). cells were incubated for 30 min at 4 ° c . and then 50 μl aliquots ( 2 × 10 5 cells ) were transferred to individual 5 ml polystyrene round - bottom facs assay tubes . for double staining of cells with oct4 and sox17 , cells were stained in perm / wash buffer first with mouse anti - oct4 ( cell signalling ) and incubated for 1 h at room temperature , following by two washes with pbs and incubation in perm / wash buffer with goat anti - mouse - fitc ( molecular probes ) and goat anti - sox17 - apc ( r & amp ; d systems ). following 1 h incubation at 4 ° c ., samples were washed twice and resuspended in 0 . 2 % fbs in pbs in a final volume of 3000 / tube . separate staining for oct4 and sox17 was performed analogously . cells were analysed on a bd facscalibur flow cytometer and data analysed using cellquest software . isolation of total cellular rna was performed using an illustra rnaspin mini rna isolation kit ( ge healthcare ) and the concentration of rna in each sample measured on a nanodrop 1000 spectrophotometer . 1 μg of extracted total rna was reverse transcribed using high capacity cdna reverse transcription kit ( applied biosystems ). taqman quantitative pcr was performed using unlabelled pcr primers and fam - based probes ( applied biosystems by life technologies ) in conjunction with taqman universal pcr master mix , no amperase ung ( applied biosystems ). concentrated taqman pcr master mix ( 2 ×) was combined with water and cdna . the final concentration of master mix was achieved by addition of appropriate concentrations of primers / fam probes diluted in water . reactions were carried out on a 7900ht fast real - time pcr system ( applied biosystems ). qrt - pcr cycling conditions were : 95 ° c . for 10 min , and subsequently 45 cycles of 95 ° c . for 10 sec and 60 ° c . for 1 min . each sample was run in triplicate with gapdh as a reference gene . analysis of results was performed in sds software for the 7900ht fast real - time pcr system . relative quantification was calculated against gapdh and b - actin housekeeping genes and standard derivations report n = 3 replicates from each sample . analysis of oct 4 and sox 17 expression by flow cytometry ( fig1 ) showed that addition of 0 . 5 % and 1 % dmso to activin a containing medium produced a decrease in oct4 expressing cells and an increase in sox17 expressing cells relative to control cells treated with activin a alone . nodal signalling is crucial for the specification of definitive endoderm in vertebrates in vivo and use of activin a at 100 ng / ml is standard practice in the field to recapitulate this signalling pathway in vitro to stimulate differentiation to de . the growth factors fgf2 and wnt3a have been reported to aid in de differentiation ( d &# 39 ; amour , k . a ., et al ., nat biotechnol , 2005 . 23 ( 12 ), 1534 - 41 ; d &# 39 ; amour , k . a ., et al . nat biotechnol , 2006 . 24 ( 11 ), 1392 - 401 ) when used in conjunction with activin a . supplementation of activin a with either fgf2 or wnt3a proved to yield inferior differentiation to de when compared with activin a and dmso ( fig1 ). qrt - pcr and further flow cytometry analysis ( fig2 ) confirmed the action of dmso in promoting de formation when used to potentiate the action of activin a . qrt - pcr ( fig2 a & amp ; b ) showed that increasing concentrations of dmso produced a significant dose dependent decrease in oct4 expression and up regulation of sox17 , gata4 and cxcr4 , with down regulation of oct4 confirmed by flow cytometry analysis ( c ). further analysis of dmso enhancement of activin a driven differentiation to de by immunofluorescence imaging ( fig3 ) confirmed that increasing concentrations of dmso ( a + x % dmso ) produced down regulation of oct4 expression from 0 % to 2 % dmso . sox 17 staining was maximum at 0 . 6 % dmso . these data indicate an optimum concentration range for dmso of 0 . 5 % to 0 . 6 %. treatment of cells with activin a + dmso in a preliminary de specification stage 1 was found to be essential for further differentiation of cells towards a hepatic phenotype ( fig4 ). treatment of cells with activin a and dmso produced significant down regulation of oct4 and up regulation of sox17 at day 4 ( fig4 b ; a ) which was not observed in the absence of this initial specification step ( fig4 b ; b ), inclusion of the initial activin a + dmso stage 1 specification step also up regulated cell afp expression ( fig4 b ; c ) at day 12 of differentiation towards hepatic like cells compared to cells not primed with activin a and dmso ( fig4 b ; f ). correlation analysis of marker gene expression ( fig5 ) confirmed the enhancement of differentiation provided by dmso across the full extent of differentiation from de to hepatic like cells . linear correlation of oct4 down regulation and sox17 up regulation at day 4 of de differentiation was observed ( fig5 a ) in the presence of different concentrations of dmso ( x % dmso ). good correlation ( fig5 b ) was also observed between increasing sox17 at day 4 ( definitive endoderm ) and alb expression at day 28 ( hepatic like cells ) with increasing concentrations of dmso ( x % dmso ). finally good correlation was recorded ( fig5 c ) between decreased oct4 at day 4 ( definitive endoderm ) and increased alb expression at day 28 ( hepatic like cells ) with increasing concentrations of dmso ( x % dmso ). comparison of the method of the present invention with an established prior art method ( fig6 ) showed a significant improvement from use of dmso to potentate the activity of activin a in de differentiation . qrt - pcr gene expression profiling ( fig6 a ) of gene pluripotency and differentiation genes in hesc and hepg2 control cells and in hesc differentiated to de at day 5 using the method of hay et al ( hay d5 ) and at day 4 using the dmso method of the present invention ( kcge d4 ). ( b ) qrt - pcr data for individual genes in hesc and hepg2 control cells and in hesc differentiated to de at day 5 using the method of hay et al ( hay d5 ) and at day 4 using the dmso method of the present invention ( kcge d4 ). these data show a statistically significant ( p & lt ; 0 . 05 and * p & lt ; 0 . 01 ) difference between the standard prior art hay et al . protocol and the kcge method of the present invention . the improvement provided by the method of the present invention was confirmed by immunofluorescence analysis ( fig7 ) of sox17 and oct4 expression in de cells produced by the prior art hay et al . method and the kcge method of the present invention . the method of the present invention produced a large decrease in oct4 expression and increased sox17 expression when compared to the prior art method . overall these data confirm that dmso potentiates the action of activin a in promoting hesc differentiation to de and subsequently to further differentiated progeny . dmso has been shown to be active over the concentration range 0 . 25 % to 2 % with the most beneficial effects based on gene expression and cell morphology and viability observed in the concentration range 0 . 25 % to 0 . 75 % dmso , with maximal benefit observed at 0 . 5 %- 0 . 6 % dmso . while the mechanism of action of dmso in cell culture and differentiation remains unknown , it is postulated that this small molecule may function partially as histone deacetylase inhibitor ( marks , p . a . and r . breslow . nat biotechnol , 2007 . 25 ( 1 ), 84 - 90 ) constraining the activity of histone deacetylase and in turn maintaining chromatin in a less compacted state and thus more available for transcription ( johnstone , r . w ., nat rev drug discov , 2002 . 1 ( 4 ), 287 - 99 ). without being limited to any specific hypothesis , it may be that in definitive endoderm differentiation the addition of dmso within a specific concentration range to activin a - based medium increases the availability for expression in de - priming genes thereby positively affecting the transcription machinery orchestrating formation of this germ layer . in the present invention , the addition of 0 . 5 % to 0 . 6 % of the small molecule dmso to the activin a - based medium during definitive endoderm derivation resulted in a rapid down regulation of pluripotency genes and as a consequence of this effect dmso significantly potentiated the ability of activin a to orchestrate definitive endoderm formation . parallel differentiation of this protocol with the hay et al protocol which uses the histone deacetylase inhibitor na butyrate during de specification ( hay , d . c ., et al ., 2008 . 26 ( 4 ), 894 - 902 ) further confirmed the significant effects achieved by dmso in effectively down regulating the pluripotency transcription factor oct4 . a further and surprising feature of including this small molecule during the de differentiation stage was observed in the downstream stages of hepatic specification , as shown by the significantly up regulated levels of albumin , demonstrating that short term down regulation of pluripotency genes immediately after initiating cellular differentiation is crucial for cells to efficiently respond long term to the differentiating signals throughout a multi - stage differentiation process . while preferred illustrative embodiments of the present invention are described , one skilled in the art will appreciate that the present invention can be practiced by other than the described embodiments , which are presented for purposes of illustration only and not by way of limitation . the present invention is limited only by the claims that follow .	2
referring to fig1 and 2 , the preferred embodiment of the present invention includes a collar 12 , illustrated as a conical frustrum , having an inner circular top 14 and an inner circular base 16 , each having an inner circumference 18 and 20 , respectively . the cut - away portion of side 22 illustrates a pin 24 directed inwardly from the inside surface 26 of collar 12 . the purpose of pin 24 will later be described . a sleeve 30 is illustrated in fig2 as having an annular top 32 and an annular base 34 , each shaped to form a circle having outer and inner circumferences 36a , 36b , 38a , and 38b , respectively . the outer surface of collar 12 may be any suitable shape . however , the inner circumference 20 of the collar at base 16 is smaller than outer circumference 38a , yet greater than circumference 36a of sleeve 30 . the sleeve 30 is shaped as a conical frustum having the annular top 32 and annular base 34 , the outer circumference 38a of which is greater than the outer circumference 36a of the top . in the preferred embodiment , the outer circumference of the larger end of the sleeve 30 is greater than the inner circumference of the larger end of the collar 12 but the outer circumference of the smaller end of the sleeve 30 is smaller than that of the smaller end of the collar . sleeve 30 includes an outer conical surface 40 and is illustrated as having a cylindrical inner surface 41 in the preferred embodiment . the sleeve 30 is split to provide a slit 42 which extends from its top 32 to its base 34 . the slit 42 has a generally helical portion 44a , with a lower edge 44b and upper edge 44c , extending from its initiation point on the outer and inner circumferences 36a and 36b , respectively , to a point 46 at which it turns downwardly to a point 48 , then bends ninety degrees to define a short horizontal portion 50 extending to point 52 at which point slit 42 widens to form a bulbous area 54 , which narrows again at point 56 . the slit 42 then bends downwardly at ninety degrees and enlarges to define a relatively wide open area 58 which narrows at point 62 and continues to outer and inner circumferences 38a and 38b , respectively . the slit includes a small , upwardly extending open area 60 immediately adjacent point 56 and large open area 58 narrows at point 62 and continues to outer and inner circumferences 38a and 38b , respectively . as shown in fig2 and 3 , legs 64 , 66 and 68 extend downwardly from the base 34 of sleeve 30 . the assembled configuration of the support system 70 of the invention comprising collar 12 , sleeve 30 , and a post 80 is illustrated in fig3 . as shown , the sleeve 30 is mounted on a right cylinder post column 80 having vertically spaced annular grooves 82 , 84 , 86 and 88 . column 80 may , of course , have any horizontal cross sectional shape , as may inner surface 41 of sleeve 30 . the surface 41 may have a horizontal cross sectional shape different from that of column 80 , but maximum efficiency is achieved when inner surface 41 and column 80 are similarly shaped . the sleeve 30 is placed on column 80 so that circumference 36b of top 32 circumscribes the outer surface of column 80 . collar 12 is configured to nest loosely upon sleeve 30 and is placed upon sleeve 30 such that pin 24 projects into open area 58 . as collar 12 is urged in a downward direction , its inner surface 26 presses against outer surface 40 of sleeve 30 . due to the slideably engaging conical frustum shapes of inner surface 26 of collar 12 and outer surface 40 of sleeve 30 , downward forces on the exterior of collar 12 are redirected to compression forces tending to close the slit 42 . the compression forces are translated to frictional forces between the surface of column 80 and the inner surface of sleeve 30 . outer surface 40 is illustrated as frusto - conical while inner surface 41 is illustrated as a right cylinder having an inner circumference slightly larger than the cross sectional circumference of column 80 . in operation , when the parts are assembled as shown in fig3 and the rotary sleeve system 70 is to be moved , the pin 24 is raised to area 60 of open area 58 . when pin 24 is located in area 60 , collar 12 is lifted from sleeve 30 , sleeve 30 is unlocked from its close contact position against column 80 and the sleeve and collar assembly may easily be moved up column 80 . pin 24 may then be moved into bulbous area 54 , to a free movement position , and the assembly may be moved up or down column 80 . by moving pin 24 into bulbous area 54 , the assembly may easily be moved up since pin 24 engages the upper surface defining bulbous area 54 to pull sleeve 30 up when the collar 12 is lifted . the assembly may also easily be moved down since pin 24 engages the lower surface defining bulbous area 54 to push sleeve 30 down column 80 without closing slit 42 when the collar 12 is lowered . this prevents pin 24 and collar 12 from sliding down upon sleeve 30 which would force slit 42 to close and the sleeve tightly to engage the column 80 . thus , when pin 24 is in bulbous area 54 , the rotary sleeve system 70 may be moved freely down column 80 without closing or tightening as it is moved . when assembly 70 reaches its desired location along the column 80 , pin 24 is moved from bulbous area 54 to notch 60 and collar 12 is moved down along the surface 40 of sleeve 30 , while pin 24 moves to the lower portion of open area 58 . this motion forces slit 42 to close causing the sleeve 30 snugly to engage column 80 . as the force placed on collar 12 is increased , slit 42 becomes narrower forcing a tighter fit against column 80 until inner circumference 36 essentially equals the circumference of column 80 . thus , as a downward force is placed on collar 12 , the resistance to downward motion of the assembly 70 is increased . as shown in fig3 a rib 90 may be added to the inner surface 41 of the sleeve 30 to mate with any one of annular grooves 82 , 84 , 86 and 88 to provide a more positive locking engagement of the assembly 70 relative to the column 80 . the helical portion 44a of the slot 42 in the sleeve 30 may act as a ramp to further spread the sleeve open . with the pin 24 of collar 12 in either position 54 or 60 , and when an upward force is applied to the collar 12 , the pin 24 will lift the helical edge 44b into contact with edge 44c such that the edges 44b and 44c slide one on the other in screw - like fashion . therefore , the sleeve will distort vertically and its inside circumferences 36b and 38b will become enlarged . a downward force of the pin 24 at position 54 will cause edge 44c to contact edge 44b and sleeve 30 will behave in the reverse manner to that described above . if the rib 90 is added to the sleeve , it will be distorted along with the sleeve . such distortion will reshape the rib from a planar ring to a helical ring so that the rib will not engage the annular grooves 82 , 84 , 86 , or 88 in the column 80 until the pin 24 is again moved down in the slot 58 . the sleeve , collar , column system of the present invention provides an arrangement for positively locking in position any item which may be attached to collar 12 . an excellent application for the rotary sleeve system 70 involves the attachment of an item , such as a shelf , to collar 12 , as illustrated in fig4 . each of the corners of the shelf or any convenient parts thereof may be attached to a respective collar 12 to direct a downward force to collar 12 to close slit 42 of sleeve 30 . the shelf may rest on the top 14 of collar 12 or it may be mounted circumferentially on side 22 . referring now to fig4 a shelf 100 is illustrated as having a corner location mounted on a sleeve 12 . the shelf 100 is illustrated as being mounted so that it engages collar 12 at its top 14 . however , the shelf may be secured to each collar 12 at the midpoint of its side 22 or at any point along its side 22 . to place shelf 100 in position on columns 80 , shelf 100 may be raised or lowered into position by first lifting shelf 100 which raises collars 12 from sleeves 30 , moving pins 24 upwardly in open areas 58 . once collar 12 is lifted from its rest position on sleeve 30 , slit 42 expands and inner circumference 36 increases to a value greater than the circumference of column 80 . in this position , shelf 100 may be raised to a new position at which point the exertion of a downward force on shelf 10 will urge pin 24 to the lower portion of area 58 of the sleeve 30 , and enabling the collar 12 to close the slit 42 . when the shelf 100 is to be lowered on columns 80 , it is first lifted , as indicated , in conjunction with the raising operation to lift collar 12 from surface 40 of the sleeve 30 . this action moves the pin 24 to the upper portion of area 58 of the slit 42 . thus , the sleeve 30 is rotated so that the pin 24 moves through narrow area 56 and into bulbous area 54 where downward motion of the collar 12 with respect to the sleeve 30 is restricted . once this procedure is accomplished for all four support locations of shelf 100 , the shelf may be lowered to a new position on columns 80 . upon reaching the new position , the sleeves 30 are rotated so that the pin 24 moves from bulbous area 54 of slit 42 through narrow area 56 into the upper portion of open area 58 . the shelf 100 is then lowered urging the pin 24 to the lower portion of area 58 and allowing the collar 12 to act on the sleeve 30 to close slit 42 . as indicated previously , a rib 90 may be added to inner surface 41 of the sleeve 30 , to mate with annular grooves found in the column 80 . the rib 90 may be configured such that when slit 42 is in its full open position , the rib will touch the surface of column 80 to add a slight frictional force to retard free motion of the sleeve 30 in either the upward or downward direction . thus , once the pin 24 of collar 12 is moved to bulbous area 54 of the sleeve 30 , the shelf 100 will not drop to the surface directly below it . the present invention may also be incorporated in systems having a single column with one or more sleeve , collar assemblies mounted on it . one such application is , for example , in mounting containers of intravenously administered liquid on a single post in hospitals . accordingly , the present invention provides a method and apparatus for positively locking into position a shelf or the like onto a post or column . in the preferred embodiment , the shelf is attached to the sleeve , collar system such that the sleeves travel with the shelf . however , the rotary sleeve system described may be used separately from the shelf since it is configured in such a manner that the collar and sleeve remain together as a unit and can operate independently . the configuration of the system of the present invention improves upon multi - piece systems for which pieces may be lost . the system of the present invention , also permits adjustment or placement of an element like a shelf with minimum effort . while the present invention has been described with reference to a preferred embodiment , it is to be understood that this is for illustrative purposes only and that the present invention should not be limited thereto , but only by the scope of the following claims :	5
preferred modes or embodiments of the present invention will be described by reference to examples . fig1 and 2 show a first embodiment of the present invention . fig1 shows the overall configuration of an apparatus for automatically leveling automobile headlamps according to the first embodiment ; and fig2 shows a flowchart pertaining to a control unit of the automatic leveling apparatus . reference numeral 1 shown in fig1 designates an automobile headlamp . a front lens 4 is attached to the front opening section of a lamp body 2 , thus constituting a lamp chamber s . a parabolic reflector 5 having a light bulb 6 fitted therein is supported in the lamp chamber s so as to be pivotable about a horizontal pivotal axis ( an axis perpendicular to the drawing sheet of fig1 ). the reflector 5 can be pivoted by means of a motor 10 which serves as an actuator . an automatic leveling apparatus for use with the headlamp 1 comprises the motor 10 serving as an actuator for pivoting the light axis l of the headlamp 1 in a vertical direction ; a vehicle speed sensor 12 serving as vehicle speed detection means for detecting the speed of a vehicle ; a vehicle height sensor 14 constituting a part of means for detecting a pitch angle of the vehicle ; and a cpu 16 which computes the speed and pitch angle of the vehicle on the basis of signals output from the vehicle speed sensor 12 and the vehicle height sensor 14 and which outputs a signal to a motor driver 18 for driving the motor 10 according to preset conditions . upon receipt of a signal from the vehicle speed sensor 12 , the cpu 16 computes the speed and acceleration of the vehicle on the basis of the signal , thus determining whether or not the vehicle is stationary or travelling or whether or not the vehicle travels stably . upon receipt of a signal from the vehicle height sensor 14 , the cpu 16 calculates the inclination of the vehicle in a longitudinal direction ( i . e ., the pitch angle of the vehicle ) from the signal corresponding to the amount of displacement of the vehicle &# 39 ; s suspensions . in a case where the vehicle height sensor comprises two sensors ; i . e ., a sensor disposed on a set of front wheels and another sensor provided on a set of rear wheels , a pitch angle can be determined from the amount of displacement of vehicle height in the longitudinal direction and the length of a wheel base . in contrast , in a case where the vehicle height sensor comprises a single sensor disposed on either a set of front wheels or a set of rear wheels , a pitch angle can be estimated from the amount of variation in the vehicle height . the cpu 16 outputs a signal to the motor driver 18 for pivoting the light axis l through a predetermined angle so as to cancel the pitch angle . at the time of detection of a signal from the vehicle height sensor 14 , the cpu 16 performs an operation by use of a comparatively high sampling time while the vehicle is stationary . while the vehicle is traveling , in order to exclude external perturbations , the pitch angle of the vehicle is calculated only when the vehicle speed is equal to or faster than a reference value , an acceleration is equal to or smaller than a reference value , and this state ( i . e ., the vehicle speed is equal to or greater than the reference speed and the acceleration of the vehicle is equal to or smaller than the reference value ) is in effect for more than a predetermined continuous period of time . when the vehicle travels over a bad road including factors which will cause external perturbations , such as irregularities on the road surface , the vehicle cannot travel at a speed of more than 30 km / h . an appropriate measure for preventing hard acceleration or deceleration , which would otherwise change the orientation of the vehicle , is to limit the acceleration of the vehicle to 0 . 5 m / s2or less . stable travel is achieved under conditions that a travel speed of 30 km / h or more and an acceleration of 0 . 5 m / s2 or less are continued for more than three seconds . since the pitch angle of the vehicle is calculated only when the above conditions are satisfied , detection of a sporadic , abnormal value or influence of such an abnormal value on the calculation of a pitch angle is prevented . next , the control of operation of the motor 10 by the cpu 16 that acts as a control unit is described according to a flowchart shown in fig2 . in step 100 , the cpu 16 determines , on the basis of a signal output from the vehicle speed sensor 12 , whether or not the vehicle is stationary . if yes ( stationary ) is selected in step 100 , a pitch angle θ 1 , of the stationary vehicle is calculated in step 102 . on the basis of the pitch angle θ 1 , in step 104 a signal is output to the motor driver 18 in order to activate the motor 10 , and processing returns to step 100 . if no ( traveling ) is selected in step 100 , in step 110 the cpu 16 determines whether or not the pitch angle is corrected during travel of the vehicle . if no ( i . e ., the pitch angle is not corrected during travel ) is selected in step 110 , in step 112 the cpu 16 determines whether or not the vehicle speed exceeds a reference speed ( 30 km / h ). if yes ( the vehicle speed exceeds 30 km / h ) is selected in step 112 , in step 114 the cpu 16 determines whether or not the acceleration is less than a reference acceleration ( 0 . 5 m / s 2 ). if yes ( acceleration is less than 0 . 5 m / s 2 ) is selected in step 114 , in step 116 the cpu 16 determines whether or not the vehicle speed exceeds 30 km / h and whether or not the acceleration of less than 0 . 5 m / s 2 is continued for more than a predetermined time ( three seconds ). if yes is selected in step 116 ( i . e ., the acceleration of 0 . 5 m / s 2 is continued for more than three seconds ), processing proceeds to step 118 , where a pitch angle θ 2 of the vehicle obtained while the vehicle is in stable travel is calculated . in step 104 , the result of such calculation is output to the motor driver 18 so as to activate the motor 10 on the basis of the pitch angle θ 2 . processing then returns to step 100 . if yes ( the pitch angle is corrected during travel ) is selected in step 110 , or if no is selected in one of the steps 112 , 114 , and 116 ( i . e ., when the vehicle speed is less than the reference value of 30 km / h , the acceleration of the vehicle is more than the reference value of 0 . 5 m / s 2 , or such a state is not continued for more than three seconds ), processing returns to step 100 . fig3 is a flowchart showing a flow of operation relating to a control unit which serves as the principal section of a headlamp automatic leveling apparatus according to a second embodiment of the present invention . in the first embodiment , the pitch angle θ 2 is detected , and the pitch angle θ 1 is inevitably corrected so as to become equal to the pitch angle θ 2 . in contrast , in the second embodiment , only when the difference between the pitch angle θ 1 and the pitch angle θ 2 is greater than a predetermined reference value , the pitch angle θ 1 is corrected so as to become equal to the pitch angle θ 2 . in short , the cpu 16 determines , in step 200 on the basis of a signal output from the vehicle speed sensor 12 , whether or not the vehicle is stationary . if yes ( stationary ) is selected in step 200 , the pitch angle θ 1 is calculated in step 202 . if a flag has already been set , the flag is reset in step 203 . in step 204 , on the basis of the pitch angle θ 1 , a signal is output to the motor driver 18 so as to activate the motor 10 , and processing returns to step 200 . if no is selected in step 200 , in step 210 the cpu 16 determines whether or not the flag has been set . if the flag has already been reset , in step 212 the cpu 16 determines whether or not the vehicle speed exceeds the reference value ( of 30 km / h ). if yes is selected in step 212 ( i . e ., the vehicle speed is determined to exceed 30 km / h ), in step 214 the cpu 16 determines whether or not the acceleration of the vehicle is less than the reference value ( of 0 . 5 m / s 2 ). if yes is selected in step 214 ( i . e ., if the acceleration is determined to be less than 0 . 5 m / s 2 ), in step 216 the cpu 16 determines whether or not the such a state is continued for more than a predetermined period of time ( three seconds ). if yes is selected in step 216 ( i . e ., the state is continued for more than three seconds ), processing proceeds to step 218 , where the pitch angle θ 2 is calculated . in step 220 , the flag is set , and processing proceeds to step 222 . in step 222 , the cpu 16 determines whether or not a difference between the thus - calculated pitch angle θ 2 and the pitch angle θ 1 is greater than a predetermined reference value ( more than 0 . 1 degree ). if yes is selected ( i . e ., the pitch angle difference is greater than 0 . 1 degree ), a signal is output in step 204 to the motor driver 18 in order to activate the motor 10 on the basis of the pitch angle θ 2 . processing then returns to step 200 . if no is selected in step 222 ( i . e ., the difference between the pitch angles θ 1 and θ 2 is less than 0 . 1 degrees ), processing returns to step 200 . if no is selected in step 210 ( i . e ., when the flag has been set ) or no is selected in one of steps 212 , 214 , and 216 ( i . e ., when the vehicle speed is less than the reference speed , the acceleration is greater than the reference value , or a predetermined period of time has not yet lapsed ), processing returns to step 200 . fig4 is a flowchart showing a flow of operation relating to a control unit which serves as the principal section of a headlamp automatic leveling apparatus according to a third embodiment of the present invention . the third embodiment differs from the first and second embodiments in that when the difference between the pitch angles θ 1 and θ 2 is smaller than the predetermined reference value , the pitch angle θ 2 is used as control data . in contrast , if the difference is greater than the predetermined reference value , the pitch angel θ 2 is detected two or more times while the vehicle is in a stable traveling state . a mean angle of the thus - detected pitch angles θ 2 , or a pitch angle which most frequently occurs , is used as control data . steps 300 , 302 , and 304 are identical with steps 100 , 102 , and 104 , respectively . further , steps 310 , 312 , 314 , 316 , and 318 are identical with steps 110 , 112 , 114 , 116 , and 118 , respectively . hence , repetition of their explanations is omitted here . processing shifts from step 318 to step 320 , in which the cpu 16 determines whether or not the calculation in step 318 of the pitch angle θ 2 while the vehicle is in a stable traveling state represents the first calculation . if yes is selected in step 320 ( i . e ., the calculation of the pitch angle θ 2 representing the first calculation ), processing proceeds to step 322 . the cpu 16 then determines whether or not a difference between the pitch angles θ 1 and θ 2 is greater than the predetermined reference value ( 0 . 1 degree ). if no is selected ( i . e ., the difference is less than the predetermined reference value of 0 . 1 degree ), in step 304 a signal is output to the motor driver 18 on the basis of the pitch angle θ 2 in order to activate the motor 10 . processing then returns to step 300 . if yes is selected in step 322 ( i . e ., the difference between the pitch angles θ 1 and θ 2 is greater than 0 . 1 degree ), processing then proceeds to step 324 . the pitch angle θ 2 ( θ 21 ) is stored in a storage section , and processing then returns to step 300 . if no is selected in step 320 ( i . e ., the calculation of the pitch angle θ 2 in step 318 does not represent the first calculation ), processing proceeds to step 326 . the cpu 16 determines whether or not the calculation of the pitch angle θ 2 in step 318 represents the second calculation . if yes is selected in step 326 ( i . e ., the calculation of the pitch angle θ 2 represents the second calculation ), processing proceeds to step 328 . the second pitch angle θ 22 is stored in the storage section , and processing returns to step 300 . in contrast , if no is selected in step 326 ( the calculation of the pitch angle θ 2 does not represent the second calculation ), processing returns to step 330 . the cpu 16 determines whether or not the calculation of the pitch angle θ 2 in step 318 represents the third calculation . if yes is selected in step 330 ( i . e ., the calculation of the pitch angle θ 2 represents the third calculation ), processing then proceeds to step 332 . a third pitch angle θ 23 obtained while the vehicle is in a stable traveling state is stored in the storage section , and processing returns to step 300 . if no is selected in step 330 ( the calculation of the pitch angle θ 2 represents not the third calculation but the fourth calculation ), processing proceeds to step 334 . a mean value of the pitch angles θ 21 , θ 22 and θ 23 obtained at the first through third states in which the vehicle travels stably , or a pitch angle which most frequently occurs , is selected as an optimum pitch angle . processing then proceeds to step 304 . in step 304 , a signal is output to the motor driver 18 on the basis of the optimum pitch angle so as to activate the motor 10 , and processing returns to step 300 . if no is selected in step 310 ( the pitch angle is not corrected at the time of travel of the vehicle ), or if no is selected in any one of steps 312 , 314 , and 316 ( when the vehicle speed is lower than the reference value , the acceleration is greater than the reference value , or a predetermined period of time has not yet elapsed ), processing returns to step 300 . fig5 is a flowchart showing a flow of operation relating to a control unit which serves as the principal section of a headlamp automatic leveling apparatus according to a fourth embodiment of the present invention . in the third embodiment , in either of the case where the difference between the pitch angles θ 1 and θ 2 is large and the case where the difference is small , the pitch angle θ 1 is inevitably corrected to as to become equal to the pitch angle θ 2 . in contrast , the fourth embodiment is arranged such that the pitch angle θ 1 is corrected so as to become equal to the pitch angle θ 2 only when the difference therebetween is great . steps 400 , 402 , 403 , and 404 are identical with steps 200 , 202 , 203 , and 204 , respectively . further , steps 410 , 412 , 414 , 416 , and 418 are identical with steps 210 , 212 , 214 , 216 , and 218 , respectively . hence , repetition of their explanations is omitted here . in step 420 , the cpu 16 determines whether or not the calculation in step 418 of the pitch angle θ 2 of the vehicle while the vehicle is in a stable traveling state is the first calculation . if yes is selected ( i . e ., the calculation of the pitch angle θ 2 represents the first calculation ), processing proceeds to step 422 . the cpu 16 then determines whether or not a difference between the pitch angles θ 1 and θ 2 is greater than the predetermined reference value ( 0 . 1 degree ). if no is selected ( i . e ., the difference is less than the predetermined reference value of 0 . 1 degrees ), a flag is reset in step 423 , and processing then returns to step 400 . if yes is selected in step 422 ( i . e ., the difference between the pitch angles θ 1 and θ 2 is greater than 0 . 1 degree ), processing then proceeds to step 424 . the pitch angle θ 2 ( θ 21 ) is stored in a storage section , and processing then returns to step 400 . if no is selected in step 420 ( i . e ., the calculation of pitch angleθ 2 in step 418 does represent the first calculation ), processing proceeds to step 426 . the cpu 16 determines whether or not the calculation of the pitch angle θ 2 in step 418 represents the second calculation . if yes is selected in step 426 ( i . e ., the calculation of pitch angle θ 2 represents the second calculation ), and processing proceeds to step 428 . the second pitch angle θ 22 is stored in the storage section , processing then returns to step 400 . in contrast , if no is selected in step 426 ( the calculation of the pitch angle θ 2 does not represent the second calculation but the third calculation ), processing proceeds to step 432 . a third pitch angle θ 23 obtained while the vehicle is in a stable traveling state is stored in the storage section , and processing returns to step 434 . a mean pitch angle of the pitch angles θ 21 , θ 22 , and θ 23 obtained at the first through third states in which the vehicle travels stably , or a pitch angle which occurs most frequently , is selected as an optimum pitch angle . in step 435 , the flag is set , and processing proceeds to step 404 . in step 404 , a signal is output to the motor driver 18 on the basis of the optimum pitch angle so as to activate the motor 10 , and processing returns to step 400 . if no is selected in step 410 ( the flag is set or the calculation of the pitch angle θ 2 represents the fourth calculation ), or if no is selected in any one of steps 412 , 414 , and 416 ( when the vehicle speed is less than the reference value , the acceleration is greater than the reference value , or when a predetermined period of time has not yet elapsed ), processing returns to step 400 . in the first through fourth embodiments , calculation of the pitch angle θ 2 of the vehicle while the vehicle is in a stable traveling state requires that the vehicle travels at a speed of 30 km / h or more with an acceleration of 0 . 5 m / s 2 or less for more than three seconds . however , the elements of the set of the conditions : 30 km / h , 0 . 5 m / s 2 , and three seconds , are illustrative , and the present invention is not limited to these requirements . the previous embodiments pertain to the apparatus for automatically leveling a reflector - type headlamp comprising the lamp body 2 mounted on the vehicle body and the reflector 5 attached to the lamp body 2 so as to be pivotable . the same also applies to the automatic leveling of a movable unit - type headlamp comprising a lamp housing mounted on a vehicle body and a lamp body reflector unit attached to the lamp housing so as to be pivotable . as is evident from the foregoing description , in the headlamp automatic leveling apparatus according to the first aspect of the present invention , the automatic leveling operation is effected only when the vehicle is stationary and when the vehicle is in a stable traveling state . accordingly , the number of times the actuator is operated is small , resulting in reduced power conservation . further , the constituent members of a drive mechanism undergo less wear . as a result , there is provided an inexpensive automatic headlamp leveling apparatus which operates correctly . in one preferred mode of the present invention , since the pitch angle obtained while the vehicle is in a stable traveling state is taken into consideration , an automatic leveling operation is prevented from being effected on the basis of a false pitch angle obtained while the vehicle is stationary . as a result , there is provided an automatic headlamp leveling apparatus which operates correctly . in another preferred mode of the present invention , at the time of travel of the vehicle , a pitch angle obtained while the vehicle is in a stable traveling state is used as control data in place of the pitch angle obtained while the vehicle is stationary . as a result , an automatic leveling operation is prevented from being performed on the basis of a false pitch angle obtained while the vehicle is stationary . therefore , there is provided an automatic headlamp leveling apparatus which operates correctly . in another preferred mode of the present invention , if the pitch angle θ 2 obtained while the vehicle is in a stable traveling state is analogous to the pitch angle θ 1 obtained while the vehicle is stationary , the pitch angle θ 1 , which is considered more accurate than the pitch angle θ 2 , is used as control data . if a large difference exists between the pitch angles θ 1 and θ 2 , the pitch angle θ 1 has a great possibility of being in error . since the pitch angle θ 2 is used as control data , an automatic leveling operation is prevented from being effected on the basis of the false pitch angle θ 1 . in another preferred embodiment of the present invention , if a large difference exists between the pitch angles θ 1 and θ 2 , the operation of the actuator is controlled on the basis of a mean value of pitch angles obtained at a plurality of times during which the vehicle travels stably , or a pitch angle which most frequently occurs . the pitch angle ( or control data ) obtained while the vehicle is in a stable traveling state is considered highly reliable , thus enabling a correct automatic leveling operation . in one preferred embodiment of the present invention , detection of a pitch angle at the time of stable traveling occurs over a longer time , and hence the detected pitch angle is highly reliable , thus enabling a correct automatic leveling operation .	1
turning to fig1 and 2 , there is shown an implantable device 10 for providing systemic release of a therapeutic agent in tissue . device 10 is representative of a great number of devices for systemic release of a therapeutic agent . this specific embodiment 10 is a sterile , bioerodible plug for the intraocular delivery of pharmaceutically active compounds . placement of the device 10 is illustrated in fig2 as it may be inserted into an eye 12 specifically , the sclera 14 proximate the lens 16 and iris 18 for release of the drug into the sclera , choroid , retina and vitreous cavity . by way of example , the retinal plug , or device , 10 , may have a weight of about 0 . 5 to about 10 milligrams , have a diameter of about 0 . 5 and about 2 millimeters and a length of between one and 12 millimeters . a hole 20 through a proximal end 22 of the device 10 enables a suture 24 to be used for securing the device 10 , as shown in fig2 with a distal end 26 thereof protruding into a vitreous cavity 30 . any suitable therapeutic agent may be utilized . the diversity of therapeutic agents that can be delivered by the present invention is great and known to those skilled in the art . examples include but are not limited to antibiotics , antifungals and antivirals such as erythromycin , tetracycline , aminoglycosides , cephalosporins , quinolones , penicilins , sulfonamides , ketoconazole , miconazole , acyclovir , ganciclovir , azidothymidine , interferon ; anticonvulsants such as phenytoin and valproic acid ; antidepressants such as amitriptyline and trazodone ; antiparkinsonism drugs ; cardiovascular agents such as calcium channel blockers , antiarythmics , beta blockers ; antineoplastics such as cisplatin and methotrexate , corticosteroids such as dexamethasone , hydrocortisone , prednisolone , and triamcinolone ; nsaids such as ibuprofen , salicylates indomethacin , piroxicam ; hormones such as progesterone , estrogen , testosterone ; growth factors ; carbonic anhydrase inhibitors such as acetazolamide ; prostaglandins ; antiangiogenic agents ; neuroprotectants ; other drugs known to those skilled in the art to benefit from controlled or sustained release from implantable devices or combinations thereof . these active agents may be incorporated into a bioerodible polymer such as a poly ester , poly ( ortho ester ), poly ( phosphazine ), poly ( phosphate ester ), poly - caprolactone , poly ( hydroxybutyric acid ), natural polymer such as gelatin or collagen , or a polymeric blend . in addition , the present invention may also improve the biocompatibility of non - erodible polymeric implants . importantly , a retinoid is incorporated into the device 10 for improving the biocompatibility thereof . all of the components of the device 10 are extruded as a homogeneous system in the shape of a plug . the device 10 may be optimized to resist sclera and choroidal erosion in order to prevent disintegration or fragmentation of the plug 10 into the vitreous cavity 30 . this may be accomplished , as is well known in the art , by altering the surface , finish of the plug 10 , coating the plug with another biodegradable semipermeable polymer , or the addition of another polymer to the blend . because the plug is a homogeneous system , ease of manufacture is provided through simple extrusion techniques or injection molding . the mechanism and rate of drug release may be controlled by the choice polymer , polymer molecular weight , polymer crystallinity , copolymer ratios , processing conditions , surface finish , geometry , excipient addition , and polymeric coatings , with the drug being released from the device 10 by diffusion , erosion , dissolution or osmosis . the fabrication of various sclera plugs and the mechanism of controlling the drug release is well known in the art as set forth in numerous publications such as , for example , “ sclera plug of biodegradable polymers for controlling drug release in vitreous ”, mototane hashizoe , archophthalmol / volume 112 , page 1380 - 1384 , october , 1994 ; “ a new vitreal drug delivery systems using an implantable biodegradable polymeric device ”, hideya kimura et al , investigative ophthalmology and visual science , volume 35 , page 2815 - 2819 , may , 1994 , and u . s . pat . no 5 , 466 , 233 , all of which are incorporated herein in their entirety for the purpose of describing sclera plug manufacture , use and mechanisms . all of the active ingredients utilized in the plug device 10 are present in a therapeutic effective amount which is calculated to achieve and maintain a therapeutic level in the vitreous cavity and introduced by the vitreous plug . naturally , the therapeutic amount will vary with the potency of the active agent , the rate of release by the plug device 10 . the amount of incorporated retinoid will depend on the potency and receptor selectivity of the retinoid employed as well as the release rate of the retinoid from the specific implant . typically , the amount of retinoid employed represents 0 . 001 % to 50 %, more typically from 0 . 01 to 20 %. retinoic acid receptor agonists have been utilized for preventing proliferation of retinal pigment epithelium , see copending u . s . patent application ser . no . 08 / 383 , 741 , entitled “ method of preventing proliferation of retinal pigment of epithelium by retinoic acid receptor agonists ”, filed in the name of campochiaro and is to be incorporated herewith in its entirety for describing the use of retinoic acid activity in the vitreous cavity 30 . importantly , it has been discovered that the use of retinoids can improve the biocompatibility of the device 10 in tissue . while the retinoid may be incorporated into the device as a component of the homogeneous mass , as hereinabove described in connection with the plug device 10 , the retinoid may also be used to advantage for improving biocompatibility when disposed as a film 40 on an implanted device 42 as shown in fig3 . the device 42 is a component for a cardiac valve as is described in u . s . pat . no . 5 , 370 , 684 which is to be incorporated herewith in its entirety in describing typical implantable devices 42 suitable in combination with the retinoid for improving biocompatibility thereof . in addition , this patent is to be incorporated herein by the specific reference thereto for the purpose of coating or embedding techniques suitable for bonding the retinoid to the surface 44 of the implant 42 . when applied as a film 40 or imbedded into a surface 44 of the implant 42 , the retinoid may be incorporated in amounts depending on the potency and receptor selectivity of the retinoid employed as well as the release rate of the retinoid from the specific implant . with reference to fig4 there is shown an endovascular stent 80 comprising a single helically wound strand 82 and a pair of counter - wound filaments 84 , 86 . coatings 90 , 92 , 96 respectively disposed on the strand 82 and filaments 84 , 86 improves the biocompatibility of the stent 80 as hereinabove described in connection with the implant 42 shown in fig3 . alternatively , the retinoid may be embedded into the strand 82 and filaments 84 , 86 . the stent 80 may provide delivery of therapeutic and other substances to a location within a patients &# 39 ; vascular system . ( not shown ) the endovascular stent comprises a tubular structure having an initial diameter and being expandable from the initial diame ter to an enlarged diameter . the filaments 84 , 86 , providing a delivery matrix , are interlaced with the tubular structure and expandable therewith from the initial diameter to the enlarged diameter . a bioactive substance is releasably contained within the filament 84 , 86 of the delivery matrix , and is released from said matrix when exposed to the conditions present in the vascular system . the tubular structure may be composed of an elastic material , such as an elastomer polymer , whereby the tubular structure may be initially constrained to set initial diameter and thereafter released to said enlarged diameter , alternatively , the tubular structure could be composed of a non - plastic material , whereby the tubular structure may be expanded from the initial diameter to the typically using a balloon dilatation catheter . the various specific designs for the tubular structure exist , including a helical structure where the filament of the delivery matrix is counter woven with a helical strand of the tubular structure , a helical structure where the filament is laminated to a helically wound strand of the tubular structure , and a perforated cylinder where the filament of the delivery matrixes interwoven through perforations in the cylinder . the filaments 84 , 86 of the delivery matrix may be porous and substantially non - erodible , where the bioactive substance is absorbed or impregnated therein and released over time . alternatively , the filament will be composed of the material which is erodible within the vascular environment , where the bioactive substance is contained or dispersed in the filament and released as the filament material erodes . when an erodible material is used , the retinoid in incorporated therein as hereinabove described . with reference to fig5 there is shown in sectional side elevation , a surgical implant kit 100 including a stud 102 disposed within a hole 104 drilled into a bone 106 with a pin 108 driven into a passage 110 through the stud 102 . a retinoid coating 114 provides biocompatibility as hereinabove discussed . turning to fig6 there is shown a joint prosthesis 120 including a fibrous spacer 122 held in position between bones 126 , 128 to be joined by rigid fixation pins 130 , 132 . the spacer 122 may include a biodegradable polymer , co - polymermixture and / or composite such as described in u . s . pat . no . 6 , 007 , 580 and including a retinoid as herein described to improve biocompatibility . typically , the amount of retinoid employed represents 0 . 001 % to 50 %, more typically from 0 . 01 to 20 %. the retinoid may be either naturally occurring or a synthetic retinoid such as a retinoic acid receptor ( rar ) agonist . naturally occurring retinoids suitable for use in the present invention includes naturally occurring retinoids such as vitamin a ( retinol ), vitamin a aldehyde ( retinal ), vitamin a acid ( retinoic acid ) and their synthetic and natural congeners . these would include but not be limited to the isomers all trans ; 9 - cis ; 11 - cis ; 13 - cis ; 9 , 11 - dicis , and 11 , 13 - dicis as well as physiologically compatible ethers , esters , amides and salts thereof . the 7 , 8 - dihydro and 5 , 6 - dihydro congeners as well as etretinate are also acceptable for the invention . compounds that intrinsically or upon metabolism possess the physiologic properties of retinoids are also included within the scope of this invention . these would include synthetic and natural retinoid compounds having affinity to nuclear retinoic acid receptors ( rars ) and retinoid x receptors ( rxrs ). other synthetically prepared retinoids are also well known in the art . for example , see u . s . pat . no . 5 , 234 , 926 which is incorporated here by reference thereto in its entirety which discloses methods of synthesizing disubstituted acetylenes bearing heteroaeromatic and heterobicyclic groups with a selective activity as rar agonists . u . s . pat . no . 4 , 326 , 055 is incorporated herewith by reference thereto in its entirety for disclosing methods for synthesizing 5 , 6 , 7 , 8 - tetrahydro naphthal and indanyl stilbene derivatives with retinoid - like activity . examples of synthetic agonists suitable for use in the practice of this invention are ethyl 6 -[ 2 -( 4 , 4 - dimethylthiochroman - 6 - yl ) ethynyl ] nicotinate ( compound 168 ) and 6 -[ 2 -( 4 , 4 - dimethylchroman - 6 - yl ) ethynyl ] nicotinic acid ( compound 299 ), whose synthesis is disclosed in u . s . pat . no . 5 , 234 , 926 as examples 6 and 24 , respectively ; and p -[( e )- 2 -( 5 , 6 , 7 , 8 - tetrahydro - 5 , 5 , 8 , 8 - tetramethyl - 2 - naphthyl ) propenyl ]- benzoic acid ( compound 183 ), whose synthesis is disclosed in u . s . pat . no . 4 , 326 , 055 , and 2 -[( e )- 2 -( 5 , 6 , 7 , 8 - tetrahydro - 3 , 5 , 5 , 8 , 8 - pentamethylnaphthaleen - 2 - yl ) propen - 1 - yl ] thiophene - 4 - carboxylic acid ( compound 701 ), whose synthesis is disclosed in u . s . pat . no . 5 , 324 , 840 , example 11 . alternatively , the sclera plug 10 , while being generally homogeneous , may include a film 50 of retinoid thereon in order to improve biocompatibility in a manner similar to the improved biocompatibility of a non - bioerodible device 42 such as shown in fig3 . accompanying the hereinabove described devices is a method in accordance with the present invention for improving the biocompatibility of an implant in tissue which includes the step of providing a therapeutic agent , providing a carrier sized for insertion into the tissue in which the release of a therapeutic agent is desired , incorporating the therapeutic agent into a carrier in a manner enabling the time released of the therapeutic agent and incorporating the retinoid into the carrier in an amount effective for improving the biocompatibility of a carrier in the tissue . this method , of course , corresponds to the device 10 shown in fig1 and 2 . correspondingly , a method in accordance with the present invention relating to the device 42 shown in fig3 include combining the retinoid 40 with the prosthesis 42 . this method may include the deposition of a film 40 on the prosthesis 42 or imbedding the retinoid into surface 44 of the prosthesis . all of the hereinabove recited retinoids may be used in accordance with the method of the present invention . the following example illustrates the effectiveness of the method and devices of the present invention . it should be appreciated that the example is set forth herein for the purpose of illustration only and is not to be regarded as limiting to any of the specific materials or methods disclosed . retinal plugs were manufactured from poly ( d , l ) lactic acid ( pla ) with an intrinsic viscosity of 0 . 6 dl / g . the retinoid 6 -[( 4 , 4 - dimethyl thiochroman - 6 - yl ) ethynl ] nicotinic acid ( agn190299 ) was mixed with polymer in a three - dimensional mixer . the mixture was then extruded at 85 ° c . into a homogeneous rod . the retinoid was incorporated into the polymeric plug at a concentration of 10 %. the extruded plug was then cut to a length of 3 . 0 mm and had a diameter of 1 . 5 mm . a 0 . 5 mm hole was drilled into the distal end of the plug to allow for suture fixation to the sclera . placebo plugs containing no retinoid were also manufactured to the same dimensions . the average weight of the plugs was 8 mg . all plugs were sterilized by gamma irradiation at 1 mrad . the plugs were then implanted into pigmented rabbits as shown in fig2 . the rabbit eyes were vitrectomized and the retinal plugs with or without incorporated retinoid were inserted through a sclerotomy 3 mm posterior to the corneoscleral limbus . the plugs were then fixated with the suture used to close the sclerotomy . an intravitreal injection of 500 , 000 human rpe cells was given to simulate traction retinal detachment . the rabbits were sacrificed at 28 days and histopathology was done . these observed results are shown in fig7 for the placebo plug and in fig8 for the plug 10 including the retinoid as hereinabove described . fig7 is a drawing showing the encapsulation of a placebo plug 28 days after insertion into the vitreous through the sclera . the plug is comprised of polylactic acid . the plug disappears during the processing of the eye ( a ). the tissues surrounding the plug were stained with pas and show a fibrous capsule surrounding the area ( b ) where the placebo was previously located . the capsule that surrounded the polylactic acid plug shows a very prominent inflammatory response with inflammatory cell infiltration ( c ). fig8 is a drawing showing the encapsulation of a retinoid containing plug 28 days after insertion . the polylactic acid plug contain 10 % by weight of the retinoid 6 -[( 4 , 4 - dimethyl thiochroman - 6 - yl ) ethynyl ] nicotinic acid ( agn190299 ). the plug disappears in the processing of the eye ( a ). the tissues surrounding the retinoid containing plug were stained with pas . the figure shows that the capsule surrounding the agn190299 plug ( b ) has very little fibrous inflammation ( c ). although there has been hereinabove described a particular arrangement of implantable devices and methods in accordance with the present invention , for the purpose of illustrating the manner in which the invention may be used to advantage , it should be appreciated that the invention is not limited thereto . accordingly , any and all modifications , variations or equivalent arrangements which may occur to those skilled in the art , should be considered to be within the scope of the present invention as defined in the appended claims .	8
embodiments of the present invention provide a rear - or back - loaded intraocular lens cartridge for use in an iol injector . as explained above , some injectors combine the features of the cartridge and handpiece in one device , and it should be understood that the description herein applies to both separate and such built - in cartridges . referring to fig1 - 3 , which shows an iol cartridge 20 according to an embodiment of the present invention from several perspectives , a cartridge 20 includes a main body 22 extending longitudinally from a proximal opening 24 to a distal tip 26 . a pair of webs 28 a , 28 b project transversely outward from opposite sides of the main body 22 and terminates in a generally vertically - oriented finger grip 30 a , 30 b . the finger grips 30 are substantially identical and the left web 28 b is shorter than the right web 28 a , and specifically does not extend as far as the proximal opening 24 . as a result , a rearwardly - opening longitudinal cutout 32 exists on the left side of the cartridge 20 between the left finger grip 30 b and the main body 22 , seen best in fig3 . as will be clearer below , the cutout 32 is asymmetrically located about a vertical center line of the cartridge 20 and may be configured to mate with a similar male feature on an associated handpiece to ensure proper orientation of the cartridge therein . it will be appreciated that the geometry of the webs 28 a , 28 b and the finger grips 30 a , 30 b may be modified from the illustrated embodiment to suit the requirements or preferences of a particular design . for example , the webs 28 a , 28 b may be made substantially identical so that the webs 28 a , 28 b have the same extent . the main body 22 of the cartridge 20 defines a lumen or hollow interior extending longitudinally from the proximal opening 24 to a distal opening 34 at the distal tip 26 . at the proximal opening 24 , the main body 22 has a somewhat flattened oval shape interrupted by an upper canopy 40 and a lower canopy 42 disposed adjacent the opening 24 . in particular , the periphery of the proximal opening 24 may define a modified oval that generally has a larger horizontal width than its vertical height . in certain embodiments , for example as seen in fig7 , the proximal opening 24 is somewhat bowl - shaped with a convex lower wall that has a smaller radius than the curvature of the slightly convex upper wall . the perimeter of the proximal opening 24 may have other shapes suitable for receiving an iol including , but not limited to , rectangular , circular , oval , and the like . in some embodiments , the perimeter of the proximal opening 24 is defined by a shape that includes corner and / or smooth curves free of inflections ( e . g ., without a change in curvature of a curve from concave to convex or conversely ). the outwardly bulged upper canopy 40 defines therein an upper slot or groove 44 extending in a distal direction , while the outwardly bulged lower canopy 42 defines a lower groove 46 , also extending distally from the opening 24 . the periphery of the proximal opening 24 is thus interrupted twice , once by the upper slot 44 and again by the lower groove 46 — thus defining peripheral openings adjacent the opening 24 . the hollow interior of the main body 22 just inside the proximal opening 24 is termed a load chamber 48 , as it is where the iol is first loaded into the cartridge . with reference to fig3 and 7 , the load chamber 48 , the upper canopy 40 , and the lower canopy 42 together form a complex opening that is defined by the proximal opening 24 and adjacent openings formed by the upper and lower canopies 40 , 42 that are each offset from the proximal opening 24 . the complex opening may be disposed in a single plane , or along a curved or more complex surface . fig3 illustrates an iol held by tongs of forceps 50 . this type of iol includes a central disc - shaped optic 52 , a leading haptic 54 , and a trailing haptic 56 . typically , the optic 52 has opposed convex faces , although the present invention is not limited to handling any particular type of iol . the haptics 54 , 56 are shown as thin arcuate members extending outward from opposite edges of the optic 52 , and generally in the plane of the optic . the haptics 54 , 56 curve in the same direction , in this case a counter - clockwise direction looking down on the iol . other arrangements of haptics around the optic of iols are known , and the present invention is intended to provide a cartridge solution for the illustrated haptic design as well as others . in particular , iols having leading and trailing haptics often encounter difficulties passing through the cartridge with regard to orientation or positioning of the haptics . if one or both of haptics becomes misaligned or otherwise mispositioned within the cartridge , the iol may exit the distal tip of the cartridge in a manner that requires further positioning within the eye . desirably , the surgeon controls delivery of the iol in such a way that it exits the cartridge in the proper orientation to minimize any further need for repositioning . with reference still to fig1 - 3 , and also to the detailed views of fig4 - 8 , additional features of the exemplary cartridge 20 will be described . fig4 illustrates the cartridge 20 from above such that the offset transverse position of the upper canopy 40 is evident . the section line 8 a - 8 a extends along a longitudinal center line of the cartridge 20 . the cartridge 20 generally exhibits symmetry across a vertical plane through this center line , except for the position of the upper canopy 40 and the aforementioned cutout 32 . fig8 a shows an exemplary arrangement of the contours of the walls of the main body 22 , and in particular its hollow interior , along the vertical center line . in the illustrated embodiment , the hollow interior of the main body 22 defines the load chamber 48 . above and below the load chamber 48 are chambers defined by the grooves 44 , 46 . adjacent thereto is a holding area 60 leading to a folding channel 62 that may be gradually tapered . in some embodiments , at least one of the grooves 44 , 46 may border at least a portion of the holding area 60 or even the folding channel 62 . adjacent the folding channel 62 is a delivery channel 64 that extends to the distal opening 34 . the upper wall of the hollow interior of the cartridge main body 22 extends generally parallel to the horizontal , while the lower and side walls gradually taper inward in a distal direction . the lower groove 46 within the lower canopy 42 may form a slight angle with the horizontal so as to create a gradually narrowing ramp 66 in the distal direction . the ramp 66 extends into the folding channel 62 , and is adjacent thereto . other geometries of the hollow interior of the cartridge main body 22 are consistent with embodiments of the iol cartridge 20 . in certain embodiments , the entire lower wall of cartridge hollow interior , encompassing the ramp 66 , is generally angled and gradually converges toward the upper wall in a distal direction . in the illustrated embodiment , the lower wall forms a small angle with the horizontal ; however , this angle may be from 0 degrees to about 30 degrees with the horizontal , and is generally between about 5 degrees and about 20 degrees . in other embodiments , the upper wall of the interior additionally or alternatively is generally angled and gradually converges toward the upper wall in a distal direction . the cartridge is generally configured to mate with a handpiece ( not shown ) having a pushrod which translates generally longitudinally through the cartridge hollow interior and contacts the angled lower wall midway therethrough . in some embodiments , the pushrod has a forked distal end that helps capture the proximal edge of the optic 52 . additionally or alternatively , the distal end of the pushrod may have a lower tip that is configured to insert into the lower groove 46 , for example , to help prevent the pushrod tip from riding on top of or underneath the optic 52 when it is disposed within the cartridge 20 . the slot 44 that interrupts the proximal opening 24 generally extends in a distal direction from the opening 24 and has a length that is generally between about 1 mm and 10 mm , preferably between 2 mm and 6 mm . in the illustrated embodiment , the slot 44 advantageously terminates prior to reaching the holding area 60 . this arrangement can help ensure proper management of a leading haptic as the iol passes through the cartridge , as will be explained below . in another significant change from cartridges of the prior art , the intraocular lens undergoes folding into a generally tubular shape as it passes distally therethrough , and the dimensions of the holding area 60 are such that the intraocular lens undergoes at least some , and in some embodiments a majority , of the deformation of folding by the time it reaches the holding area . for instance , the holding area 60 has a horizontal width of between 2 . 5 - 4 . 5 mm , and the intraocular lens optic has a diameter of at least 5 . 0 mm . to define this feature , the optic of the iol typically folds or rolls into a generally tubular shape , and the majority of deformation of folding may be measured by examining the geometry of the folded optic . in other words , the optic begins generally flat , and may deform into a rolled circle wherein the side edges that fold up and touch are oriented 180 ° from their relaxed orientation . in this simple example , a majority of fold deformation has occurred when the side edges have folded 90 ° or more . it should be understood final configuration of the optic may be more or less circular , depending on the size of the optic relative to the size of the cartridge lumen . each of the finger grips 30 a , 30 b includes a plurality of longitudinal ribs to help facilitate handling of the cartridge . a pair of proximal flanges 70 project outward from the finger grips 30 and define structural features that function as a tactile reference for the proximal end of the cartridge 24 when the cartridge is held by the finger grips 30 . use of the exemplary cartridge 20 of the present invention will now be described . as schematically indicated in fig3 , the process begins by inserting the intraocular lens ( iol ) into the proximal opening 24 of the cartridge . often , a fluid or viscoelastic medium is first introduced into the hollow interior of the cartridge through the proximal opening 24 to facilitate passage of the iol therethrough . typical intraocular lenses have optic diameters of at least 5 . 0 mm , and the proximal opening 24 is sized to easily receive the intraocular lens . for example , the proximal opening 24 has a horizontal width of at least 6 mm such that the iol can be inserted therethrough in a horizontal orientation without touching the opening . as the iol enters the proximal opening 24 , the operator , using forceps 50 or the like , registers the leading haptic 54 with the upper slot 44 . further passage of the iol into the load chamber 48 causes the leading haptic 54 , constrained by the peripheral slot , to deform across one face of the optic , typically the anterior face , as seen in fig1 , 13 , and 14a . the ramp configuration of the inner wall of the canopy 40 facilitates a gradual folding of the leading haptic 54 in this manner . additionally , as seen in fig7 and 11a , the slot 44 is generally trapezoidal in cross - section section , with a larger upper dimension . this helps trap the filament - like haptic 54 therein , and ensures that it remains in the slot 44 as the optic 52 passes there under . the operator passes the iol through the load chamber 48 and into the holding area 60 , as seen in fig1 and 14b . as mentioned above , the holding area 60 has a horizontal width that is less than the diameter of the optic 52 . this causes the lateral edges of the optic 52 to contact the sides of the holding area 60 . because of the bowl - shape of the lead - in load chamber 48 and holding area 60 , the lateral edges of the optic 52 fold or curl upward relative to the center . the lower groove 46 helps in this folding process by providing relief into which the central area of the optic may deform . desirably , the holding area 60 has a substantially constant horizontal width along a length of at least 4 mm , preferably between 4 - 8 mm , and most preferably approximately the diameter of the particular optic 52 . for example , a common optic diameter is 6 mm , so the holding area 60 also has a substantially constant horizontal width of at least 6 mm . as the optic 52 passes through the cartridge 20 , therefore , the hollow interior first narrows from the proximal opening 24 to the holding area 60 , curling the optic , then remains constant in the holding area for the optic to rest , and then narrows further distally to the distal tip 26 . more generally , the holding area 60 has a constant cross - section along its length when the lower groove 46 is excluded . one benefit of the reduced size holding chamber is that a majority of iol folding occurs therein and thus less of the push force applied by the pushrod to the lens is needed for subsequent folding . in an example where the holding area 60 has a horizontal width of 50 - 75 % of the diameter of optic , the optic effectively curls into its delivery shape by the time it reaches the holding area . this helps reduce damage to the optic or slippage of the rod past the iol . one function of the substantially cylindrical and constant cross - section holding area 60 is to provide a sanctuary of sorts for the lens to remain in a stable position between proximal and distal funnels within the cartridge . furthermore , the slot 44 terminates prior to reaching the holding area 60 which reduces the vertical dimension above the optic 52 . by this time , the leading haptic 54 is trapped above the optic 52 and remains so because of the close spacing there above . the trailing haptic 56 presents less of the problem to the operator , as it resiliently straightens out through the cartridge and resumes its original shape once the iol exits the distal tip 26 . at this point , the operator mates the cartridge 20 , having the iol within the holding area 60 , with the handpiece of the injector . as mentioned above , the asymmetrically offset cutout 32 registers with a similar male feature on the handpiece to ensure proper orientation of the cartridge therein . the operator then urges the iol from the holding area 60 through the hollow interior of the cartridge 20 and out of the distal insertion tip 26 , as seen in fig1 and 14c - 14e . the hollow interior gradually narrows and further reduces the profile of the iol for passage into an incision in the eye . the tapered folding channel 62 provides a transition from the bowl shapes of the load chamber 48 and holding area 60 to the circular cross - sections of the delivery channel 64 and distal opening 34 . moreover , the hollow interior is sized to maintain the leading haptic 54 located across one face of the optic 52 until the iol emerges from the distal insertion tip . in this manner , the operator maintains maximum control of the iol and the leading haptic 54 . with reference now to fig1 - 21 , an alternative exemplary iol cartridge 120 similar to the first - described cartridge is shown . as before , the cartridge 120 includes a main body 122 extending longitudinally from a proximal opening 124 to a distal tip 126 . each of a pair of webs 128 a , 128 b projects transversely outward from opposite sides of the main body 122 and terminates in a generally vertically - oriented finger grip 130 a , 130 b . a rearwardly - opening longitudinal cutout 132 exists on the left side of the cartridge 120 between the left finger grip 130 b and the main body 122 . the main body 122 of the cartridge 120 defines a lumen or hollow interior extending longitudinally from the proximal opening 124 to a distal opening 134 at the distal tip 126 . at the proximal opening 124 , the main body 122 has a somewhat flattened oval shape interrupted by an upper canopy 140 and a lower canopy 142 . in particular , the proximal opening 124 may define a modified oval having a larger horizontal width than its vertical height . alternatively , the proximal opening 124 may have any of the shapes discussed above with regard to the proximal opening 24 . the outwardly bulged upper canopy 140 defines therein an upper slot 144 extending in a distal direction , while the outwardly bulged lower canopy 142 defines a lower groove 146 , also extending distally from the opening 124 . the periphery of the proximal opening 124 is thus interrupted twice , once by the upper slot 144 and again by the lower groove 146 — which therefore define peripheral slots . fig1 a and 17b show the longitudinal vertical contours of the walls of the main body 122 , and fig1 shows the horizontal mid - plane contours . the hollow interior begins with a load chamber 148 just inside the proximal opening 124 where the iol is first loaded into the cartridge . adjacent thereto is a holding area 160 leading to a gradually tapering folding channel 162 , and finally to a delivery channel 164 that extends to the distal opening 134 . the bounds of the holding area 160 are best seen in fig1 . the upper wall of the hollow interior of the cartridge main body 122 extends generally parallel to the horizontal , while the lower and side walls taper inward in a distal direction . the load chamber 148 , the upper canopy 140 , and the lower canopy 142 together form a complex opening that is defined by the proximal opening 124 and adjacent proximal openings formed by the upper and lower canopies 140 , 142 that are each offset from the proximal opening 124 . the complex opening may be disposed in a single plane , or along a curved or more complex surface . the lower groove 146 within the lower canopy 142 may define a portion of the load chamber 140 . the lower groove 146 extends generally horizontally until reaching a ramp 166 that tapers inward in the distal direction , generally at an angle of between about 15 - 30 °, and preferably 20 °. the ramp 166 extends into the folding channel 162 , and may form a part thereof . in contrast with the first embodiment , the lower wall of cartridge hollow interior is generally horizontal until the ramp 166 , where it converges relatively quickly toward the upper wall . ultimately , the cartridge mates with a handpiece ( not shown ) having a pushrod which translates generally longitudinally through the cartridge hollow interior and contacts the ramp 166 midway therealong . again , the pushrod may have a forked distal end that helps capture the proximal edge of the optic . the slot 144 that interrupts the proximal opening 124 desirably extends in a distal direction and terminates prior to reaching the holding area 160 . for instance , the slot 144 in the illustrated embodiment extends distally from the proximal opening 124 a distance of about 4 mm , while the holding area 160 commences at a distance of about 9 mm from the proximal opening 124 . this arrangement may help ensure proper management of a leading haptic as the iol passes through the cartridge , as explained above . as before , the intraocular lens undergoes folding into a generally tubular shape as it passes distally therethrough , and the dimensions of the holding area 160 are such that the intraocular lens undergoes at least some deformation of folding by the time it reaches the holding area . for instance , the holding area 160 has a horizontal width of between 2 . 5 - 4 . 5 mm , and the intraocular lens optic has a diameter of at least 5 . 0 mm . advantageously , the holding area 160 has a substantially constant horizontal width along a length of at least 4 mm , preferably between 4 - 8 mm , and most preferably approximately the diameter of the particular optic . for example , a common optic diameter is 6 mm , so the holding area 160 also has a substantially constant horizontal width of at least 6 mm . more generally , the holding area 160 has a constant cross - section along its length ( e . g ., when the lower groove 146 is excluded ). the present invention provides a cartridge where the horizontal width of the opening into the load chamber 148 is greater than or equal to the optic lens diameter , while the width of the holding area 160 is less than the lens diameter , thus compressing the lens at least slightly . as the optic passes through the cartridge 120 , therefore , the hollow interior first narrows from the proximal opening 124 to the holding area 160 , curling the optic , then remains constant in the holding area providing a place for the optic to pause , and then narrows further distally to the distal tip 126 . this can best be seen in fig2 . the lens remains slightly compressed in the holding area 160 while in the cartridge 120 until the time of insertion into the eye . one advantages of this is to maintain a stable and repeatable lens configuration just prior to insert , and subsequently a smooth deformation of the lens upon insertion during surgery . the above description represents the best mode contemplated of carrying out the present invention , and of the manner and process of making and using it , in such full , clear , concise , and exact terms as to enable any person skilled in the art to which it pertains to make and use this invention . this invention is , however , susceptible to modifications and alternate constructions from that described above which are fully equivalent . consequently , it is not the intention to limit this invention to the particular embodiments disclosed . on the contrary , the intention is to cover modifications and alternate constructions coming within the spirit and scope of the invention as generally expressed by the following claims , which particularly point out and distinctly claim the subject matter of the invention .	0
fig1 illustrates a high - speed connection assembly 100 for establishing a large number of high - speed connections between at least one device under test and automatic test equipment ( not shown ), such as an zif connector for use between a dut board and a v5400 or a v5500 test head . a dut assembly 102 is provided on the underside of which are large number of electrical contacts ( not shown ) to one ore more duts . such electrical contacts might be , for example , probe needles if dut assembly 102 is a probe card for use in wafer sort , or sockets if dut board 102 is a contactor board for use in package test . the primary function of dut assembly 102 is to translate electrical signals out of the plane of board 104 so that they are accessible to the connection mechanism , i . e ., interface connection assembly 106 . an exemplary high - speed connector is taught in u . s . pat . no . 6 , 833 , 696 entitled “ methods and apparatus for creating a high speed connection between a device under test and automatic test equipment ”, by roger sinsheimer et al . an exemplary automatic test equipment is the v5400 or v5500 by agilent technologies , inc . of palo alto , calif . high - speed connection assembly 100 may include a dut assembly 102 for translating electrical signals from a board 104 via a plurality of connector circuits 105 to a connection mechanism 106 with a plurality of clamping connectors 108 radially disposed around the connection mechanism to align with connector circuits 105 on the dut assembly 102 . referring to fig2 , an exemplary dut assembly 102 may have a plurality of mating printed circuit boards 202 disposed radially on the dut board 104 which facilitate signal translation . fig3 shows a close - up view of a portion of an exemplary interface connection assembly 106 with clamping connectors 108 that comprise opposing clamp plates 608 with contacts 602 on inner walls 606 of clamp plates 608 . in the prior art , the clamping and release actions for clamp plates 608 are actuated by pneumatic shafts , cylinders or bladders 612 at either end of the clamp plates 608 . there are springs 610 that work against the clamping cylinders 604 to keep the clamping plates 608 apart . fig4 illustrates a blown - up view of one of the connector circuits 105 , which may comprise a mating printed circuit board 302 with contacts 310 on one or both sides and contacts 308 at the bottom of the assembly to mate with corresponding contacts ( not shown ) on the surface of board 104 when the connector circuit 105 is secured in place on board 104 . referring now to fig5 , a zero insertion force connector system according to the invention is shown . specifically , an overall connector clamp housing 501 of the zero insertion force connector system is comprised of a material that will support the contact force necessary to compress all the individual contact elements . for example , connector clamp housing 501 may be made of non - magnetic stainless steel 300 series ; aluminum ; case hardened 440 stainless steel ; case hardened becu ; or a similar material or composite . one or more electrical contact substrates 503 are mounted within the connector clamp housing 501 . the electrical contact substrate 503 may comprise rogers 4350 ; nelco 4000 - 13 si ; standard fr - 4 ; high temperature fr - 4 ; rogers 3000 ; or other similar materials or composites . passive or active components may be mounted on the electrical contact substrate 503 . directly behind the electrical contact substrates 503 and located between the connector clamp housing 501 and the electrical contact substrates 503 are several mechanical spring elements 506 , which apply the force necessary to compress the electrical contact substrates 503 . the mechanical spring elements 506 may comprise musical wire ; becu ; non - magnetic 300 stainless steel ; coil ( belville or wave ); silicone rubber ( solid or foam ) or any similar mechanical spring type elements . around the perimeter of each electrical contact substrate 503 is a vacuum seal 502 that is actuated to unclamp the electrical contact substrates 503 . the vacuum seals may be hollow o - rings ; standard o - rings ; lip seals ; bellows ; vacuum cylinder or other similar vacuum sealing mechanism . the electrical contact substrate 503 is electrically connected to the mating printed circuit board 302 by using a board - to - board interconnect 504 . through out this document , the phrase board - to - board interconnect is used interchangeably with the phrase interposer . the board - to - board interconnect or interposer 504 may be made of a neoconix stamped metal spring laminated to pcb ; kns leaf spring made with a wire bond machine ; intercom c - stack ; hcd super spring ; hcd super button or other similar material . the interposer 504 may have individual electrical contact elements ( 602 in fig3 ) for making electrical contact with the individual electrical contact elements 310 on the mating printed circuit board 302 . alternatively , the interposer 504 may be a z - axis conductive member , such as a sheet of rubber or other insulating material with wires or other conductive features embedded therein perpendicular to the plane of the insulating material . this design would be instead of electrical contact elements 602 . mating printed circuit board 302 is aligned to the connector system 500 by guide pins or other features ( not shown ) located in the connector housing 501 or larger system that the connector housing is mounted on , such as a test head ( not shown ). the mating circuit board 302 may be made of rogers 4350 ; high temperature fr - 4 ; standard fr - 4 ; nelco 4000 - 13 si ; flex circuit wrapped over molded , machined plastic ; or other similar material . the electrical signal may flow from the mating printed circuit board 302 , through the board - to - board interconnect 504 , into the electrical contact substrate 503 and then through a signal transfer members 507 , such as coaxial cable , to and from a target system or device , such as a memory tester ( not shown ). the signal transfer members 507 may be ribbonized rg178 ; tempflex low dk coaxial cable ; goretex tape wrapped coaxial cable ; tensolite standard braid coaxial cable ; tempflex serve shielded coaxial cable or other similar signal transfer means . the electrical signals may also flow in the opposite direction as well . this connector system may be mated and unmated several thousand times without significant degradation to the contact resistance . ribbonized coaxial cables 507 may or may not be mass terminated to the electrical contact substrate 503 by using hot bar process to minimize manufacturing costs . the connector system may be two sided , but may also be one sided either for the vacuum actuation or the contact substrate . in a one - sided case , another member or element may move the stationary jaw to allow insertion of the mating printed circuit board 302 . one application for this connector system 500 is for use as a dut interface or probe card interface in a high pin count memory test system , such as the agilent technologies , inc . v5400 or v5500 memory test system . however , this connector system 500 may be used in other systems requiring connecting and disconnecting large numbers of signal paths between printed circuit boards . improved rf performance may be achieved with the connector system 500 of the present invention by using a rigid printed circuit board for the contact substrate 503 . improved mechanical compressive force may be achieved behind each electrical contact substrate 503 by using an interposer or board - to - board interconnect 504 . improved mechanical repeatability and reliability is achieved by actuating the connector system 500 using a vacuum mechanism 502 . in prior connectors , if the electrical performance of the zif connector was improved , the electrical performance would be decreased and vice versa . prior solutions used a combined interposer and printed circuit board into a flex circuit with gold bumps ( see u . s . pat . no . 6 , 833 , 696 ), in which improving mechanical contact of the gold bumps required the flex circuit to be thinner , which decreased the electrical performance . conversely , to increase the electrical performance , the flex circuit would need to be thicker , which would compromise the mechanical flexibility of the substrate , and thus decrease the mechanical performance . the present zero insertion force connector system 500 decouples the relationship between the electrical performance of the contact substrate 503 and the mechanical force applied to each electrical contact element 602 . the present invention uses a rigid printed circuit board 503 and a separate interposer or board - to - board interconnect 504 , each piece can be optimized individually and the electrical performance is improved and the mechanical loading is more uniform for each electrical contact element 602 . clamping action is supplied by one or several spring members 506 , sized to provide uniform and sufficient clamping force . a vacuum 502 is used to unclamp the connector 500 and retract the contact substrate 503 and the interposer 504 . some implementations may include active or passive circuitry on the mating printed circuit board 302 . some implementations of the connector system 500 may or may not require motion of the contact substrates 503 with active circuitry to achieve clamping action . active circuits may be mounted inside the zif connector housing on the printed circuit board . prior flex circuit solutions do not permit soldering of semiconductor devices or other components to the flex circuit , because the flex circuit would no longer be flexible . in some implementations , a contact substrate 503 may be stationary with the mating circuit assembly moving to actuate the mating and demating processes . as shown in fig1 and 3 , many zero insertion force connector systems 500 may be mounted on a test head 106 in order to enable connections between a tester ( not shown ) and a dut card or probe card 102 . in such a case , there may be many vacuum seals 502 simultaneously actuated to ensure that all the connectors 500 on the test head are actuated and deactuated simultaneously . such a connector system enables a machine , such as a memory testor to be programmed for different tasks by switching out a card or board with complex electronics on it that enables different features of the machine . one such use enables a memory testor to be used in wafer sort to test wafers by making connections between the test head and mating printed circuit boards on a probe card and then to test chips by making connections between the test head and mating printed circuit boards on a dut card . the present invention overcomes of prior mating connectors that either deteriorated the electrical contact elements on the mating printed circuit board or the contacts of the connector , made unreliable connections or the quality of the connections deteriorated after many connections . as will be appreciated by those in the art , the circular layout of the test head and probe card or dut card may be another physical layout other than circular , such as rectilinear , linear , etc .	6
referring now to the drawings in detail , fig3 shows a calibrated custom instrument module 10 comprising a support member 12 having pressed inserts 14 from the bottom side for holding one or more printed circuits 16 that contain one or more analog gauge mechanisms 18 and electrical contacts 20 . the topside of the support member 12 has attached a backlighting member 22 that is connected to backlighting control circuitry 24 , shown mounted to the backside of the support member 12 . attached to the top of the backlighting member 22 is a graphic overlay 26 that is designed to meet or exceed the minimum specific driver information required for a given instrument cluster or vehicle . a pointer 28 is applied and attached to each of the analog gauge mechanisms 18 during an electrical calibration stage of production of the module 10 . a molded bezel and lens assembly 30 , that has been modified with a decoration 32 , is attached to the front of the graphic overlay 26 and the support member 12 . the preferred embodiment of the support member 12 is a flat plastic abs sheet of material that is laser cut based on design of the custom cluster style . fig4 shows a custom design of the support member 12 which includes clearance holes 34 for analog gauge shafts , alignment holes 36 for the pressed inserts 14 , attachments 38 required for the original cluster housing if it is to be used , clearance 40 for backlighting of telltales through the graphics , and provisions 42 for additional attachments such as an odometer or prdnl functions . other alternative constructions for the support member 12 include but are not limited to the following : use of metal material that is processed similar to the abs material , use of a clear sheet of plastic material such as polycarbonate , or use of an injection molding process for higher volume applications . fig5 shows a method for attachment of the gauge mechanisms 18 to the support member 12 is by use of inserts 14 made of brass , which are pressed into the support member 12 . the length of the brass inserts 14 can be adjusted to set the proper spacing between the printed circuit 16 that contains a gauge mechanism 18 and electrical contacts 20 , which will affect the overall height of the pointers 28 . the printed circuits 16 are mechanically screwed to the pressed inserts 14 . this is also a preferred method for most additional attachments to the support member such as an odometer attachment . with use of an injection molding process , the support member 12 could make use of attachment bosses that would eliminate use of pressed inserts . this preferred method of attachment is also shown in fig1 a for attaching a continuous custom printed circuit 16 with attached multiple gauge mechanisms 18 and secured to the support member 12 by means of brass inserts 14 and mechanical screws . if desired , gauges containing electrical contacts may be used in place of gages mounted on one or more circuit boards with attached contacts . fig7 a shows a backlighting member 22 , which is an electro - luminescent flat panel that is attached to the support member 12 with adhesive . the electro - luminescent panel can be easily designed to emit lighting with choices of several colors on specific areas of the backlighting member 22 . the backlighting member 22 is connected to control circuitry 24 that is provided in the module . the control circuitry 24 comprises an adapter interface 44 created from an oem lamp socket that interfaces to the original cluster circuitry lamp socket pad ( see fig8 ) where it picks up the control voltage for nighttime backlighting and dimming control . furthermore , this design requires very little power consumption and very little space in the overall assembly . other alternatives for backlighting could be the use of a support member 12 that is transparent and can be edge lighted with led , incandescent , or other lighting sources . another method of backlighting is the use of a combination of light sources including the use of the existing original instrument cluster light sources . furthermore , the custom instrument module could utilize the existing original instrument cluster light sources only , allowing for removal of the backlighting member 22 . the preferred embodiment for the graphic overlay 26 is the use of screen printing over a thin polycarbonate clear material . the graphic overlay 26 has multiple passes of colors and graphics to help create a unique appearance and instrument customization . the graphic overlay 26 contains the driver information that is required for the vehicle as well as additional information that may be desired . the graphic overlay 26 is attached to the backlighting member 22 or directly to the support member 12 with use of adhesive or sonic welding . in some instances , the graphic overlay 26 and the backlighting member 22 may be combined into one part that comprises the graphics and the lighting . in still another instance , the graphic overlay 26 may be a formed graphic member with 3d characteristics . the preferred embodiment for a custom bezel and lens assembly is an oem molded bezel which is modified to accommodate an additional part or decoration 32 . the oem bezel is modified by use of a steel rule die , laser cutting , or routing . this modification allows an additional part such as a decoration 32 to be attached to the bezel by means of adhesion , such as ultra violet for fast curing , sonic welding , or fastening with screws . a lens is then attached to the custom bezel . in some cases , the oem bezel is simply an open face mask design . in this case , a custom design decorative plane such as carbon fiber , brushed aluminum , or metal could be utilized to cover the graphics much like a bezel style . a decorative part can then be fastened to the decorative plane or attached through the decorative plane and into the support member 12 . fig9 shows the decorative part 32 made from a thin , formable material shaped by a thermoforming process . for example , a decorative thin material such as avery dennison satin chrome finish on abs formable material can be thermoformed into a decorative shape or trim . this shape is then die - cut to fit the modified bezel . the thin and lightweight decorative part is then attached to the bezel through a quick ultra violet adhesion process . alternatively , the decoration 32 can be created by use of an injection molding process which would allow for the creation of additional fasteners for assembly purposes . fig1 shows an operational assembly formed by assembly of the custom gauge module with the original instrument cluster circuitry and illustrating an electrical interface through the tin plated contact pins 20 extending from the custom instrument module to the original instrument cluster circuitry . these pins form an electrical path for the transfer of signals from the gauge box clips on the original cluster circuit to the gauge mechanisms 18 contained in the custom instrument module . fig1 b shows an alternative electrical interface utilizing a connection harness that is wired from a custom printed circuit 16 of a remote custom cluster module to the original instrument cluster circuitry . this allows the new cluster module to be installed into a different area than the original cluster circuitry . fig1 shows another embodiment wherein the custom cluster module includes an additional feature and function not present in the original instrument cluster . this function is provided by adding another instrument , such as a compass , to the custom cluster module itself . although the invention has been described by reference to these specific embodiments , it should be understood that numerous changes may be made within the spirit and scope of the inventive concepts described . accordingly , it is intended that the invention not be limited to the described embodiments , but that it have the full scope defined by the language of the following claims .	1
embodiments of a fuel assembly according to the present invention will be described below with reference to fig1 to 22 . fig1 is a schematic overall cross - sectional view illustrating a first embodiment of the fuel assembly according to the present invention . fig1 illustrates a state in which only a wrapper tube , described hereinafter , is cut out in a right half of the figure from a center line o and liner tubes included in the wrapper tube are also cut out in a left half of the figure from the center line o . as illustrated in fig1 , a fuel assembly 1 according to the present embodiment includes a vertically long wrapper tube 2 . the wrapper tube 2 includes an entrance nozzle 3 at a lower end portion thereof and a handling head 4 at an upper end portion thereof . the wrapper tube 2 stores therein a plurality of vertically long fuel pins 5 extending parallel to one another . the fuel pins 5 are supported at upper and lower end portions thereof by an upper pin support plate 6 provided at an upper end position within the wrapper tube 2 and by a lower pin support plate 7 provided at a lower end position within the wrapper tube 2 . inside the wrapper tube 2 , a plurality of grids 9 are disposed at intervals in the vertical direction ( i . e ., the axial direction ) suitable for holding the fuel pins 5 at regular intervals in the radial direction . further , liner tubes 8 are provided inside the wrapper tube 2 so as to be in contact with the respective grids 9 to support the grids 9 in the axial direction . that is , the grids 9 and the liner tubes 8 are disposed to be alternately adjacent to each other along the axial direction of the wrapper tube 2 . fig2 is an enlarged cross - sectional view ( i . e ., a transverse cross - sectional view ) of fig1 taken along the line ii - ii line in fig1 , which illustrates two liner tubes 8 ( 8 a ) disposed on the upper end side of the wrapper tube 2 and the internal structure of the liner tubes . further , fig3 illustrates a lateral shape of the liner tube 8 ( 8 a ) illustrated in fig2 ( the wrapper tube 2 is omitted ). as illustrated in fig1 to 3 , the wrapper tube 2 and the liner tube 8 ( 8 a ) both have a cross - section of a regular hexagonal shape . each of the two liner tubes 8 ( 8 a ) disposed on the upper side of the fuel assembly 1 , for example , is drilled with communication holes 14 penetrating the tube wall of the liner tube . the communication holes 14 communicate the space inside the liner tube 8 ( 8 a ) with the space between the wrapper tube 2 and the liner tube 8 ( 8 a ). in a nuclear reactor operation , therefore , a coolant can freely flow between the space inside the liner tube 8 ( 8 a ) and the space formed between the wrapper tube 2 and the liner tube 8 ( 8 a ). as the coolant flows from a high fluid pressure side to a low fluid pressure side , the liquid pressure is constantly kept uniform between the two spaces in the operation . in the example illustrated in fig1 to 3 , the communication holes 14 are formed at two positions in the vertical direction in one of the surfaces of each of the liner tubes 8 ( 8 a ). however , the disposition , the number , and the like of the communication holes 14 are not particularly limited . further , as illustrated in fig2 and 3 , engaging portions 10 formed by grooves , holes , or the like are provided to open upward and toward the outer circumferential side , for example , at respective positions in the vicinity of the upper end corners of the respective surfaces forming each of the liner tubes 8 ( 8 a ). the engaging portions 10 formed by grooves , holes , or the like are also provided to open downward and toward the outer circumferential side , for example , at respective positions in the vicinity of the lower end corners of the respective surfaces forming each of the liner tubes 8 ( 8 a ). furthermore , as illustrated in fig3 , a latch pin 11 of a predetermined length is provided for each of the engaging portions 10 so that end portions of the latch pin 11 can be inserted in the corresponding engaging portions 10 formed by grooves or the like . fig4 illustrates a state in which a pair of upper and lower liner tubes 8 ( 8 a ) and a grid 9 disposed therebetween are connected together with the engaging portions 10 and the latch pins 11 . the grid 9 is formed by a grid frame of a regular hexagonal shape and a plurality of fuel pin support rings provided inside the grid frame ( see fig2 and 26 , for example ). as illustrated in fig4 , pin support portions 15 are provided on an outer circumferential side of the grid frame of the grid 9 in an arrangement corresponding to the arrangement of the engaging portions 10 of the liner tubes 8 ( 8 a ). each of the pin support portions 15 is formed as a through hole or the like formed on the outer circumferential side of the grid frame , for example , and is configured to be inserted with the vertically set latch pin 11 in the vertical direction and to support a central portion of the latch pin 11 from the outer circumferential side . in the above - described configuration , the grid 9 is disposed between the pair of the upper and lower liner tubes 8 ( 8 a ), and the central portions of the latch pins 11 are supported by the pin support portions 15 of the grid 9 . further , the upper and lower end portions of the latch pins 11 are inserted in the engaging portions 10 of the upper and lower liner tubes 8 ( 8 a ), which are formed by grooves or the like . therefore , the upper and lower liner tubes 8 ( 8 a ) and the grid 9 can be vertically connected together , with the outer circumferential surfaces of the three components being aligned to one another . according to such configuration , the vertically adjacent liner tubes 8 ( 8 a ) and the grid 9 are fixed to one another in the radial direction . that is , a gap is prevented from being formed between the liner tubes 8 ( 8 a ) and the grid 9 by a positional misalignment in the radial direction . accordingly , it is possible to prevent an unnecessary flow of the coolant and to thereby improve the thermal efficiency of the fuel assembly and stabilize the lifetime performance of the fuel assembly . description will now be made of the configuration of a lower part of the fuel assembly 1 according to the present embodiment . fig5 is an enlarged cross - sectional view taken along the line v - v in fig1 , which illustrates the configuration of liner tubes 8 ( 8 b ) of the fuel assembly 1 disposed below the two upper liner tubes 8 ( 8 a ), for example . fig6 is a side view of the liner tube 8 ( 8 b ) illustrated in fig5 . the liner tube 8 ( 8 b ) illustrated in fig5 and 6 is in the shape of a cylinder , the basic form of which is a regular hexagon . the liner tube 8 ( 8 b ) is configured such that the peripheral wall corresponding to the respective sides of the liner tube 8 ( 8 b ) is partially bent toward the inner circumference thereof to form angular concavities and convexities that fill gaps between peripherally disposed ones of the fuel pins 5 . with such concavities and convexities , angular portions ( i . e ., triangular convexities ) 16 are formed as peripheral flow preventing projections projecting toward the inner surface of the liner tube 8 ( 8 b ). accordingly , the gaps between the peripherally disposed ones of the fuel pins 5 can be closed . further , a peripheral flow preventing structure is formed which prevents the coolant from passing through the space between the fuel pins 5 and the inner circumference of the liner tube 8 ( 8 b ) and flowing upward . similarly , as illustrated in fig7 , the peripheral wall corresponding to the respective sides of the grid frame of the grid 9 , having the regular hexagonal basic form , is partially bent toward the inner circumference thereof . thus , the grid frame has angular portions that fill the gaps between the peripherally disposed ones of the fuel pins 5 . in the above - described configuration , each of the liner tubes 8 ( 8 b ) is drilled with the communication holes 14 penetrating the tube wall of the liner tube . the communication holes 14 communicate the space inside the liner tube 8 ( 8 b ) with the space between the wrapper tube 2 and the liner tube 8 ( 8 b ). in the nuclear reactor operation , therefore , the coolant can freely flow between the space inside the liner tube 8 ( 8 b ) and the space formed between the wrapper tube 2 and the liner tube 8 ( 8 b ). as the coolant flows from a high fluid pressure side to a low fluid pressure side , the liquid pressure is constantly kept uniform between the two spaces in the operation . in the example illustrated in fig5 to 7 , the communication holes 14 are formed at two positions in the vertical direction in one of the surfaces of each of the liner tubes 8 ( 8 b ). however , the arrangement , the number , and the like of the communication holes 14 are not particularly limited . as described above , each of the sides of the liner tube 8 ( 8 b ) has the cross section having the concavities and convexities . parts of the outer circumferential surface of the side corresponding to the angular portions 16 form the concavities . in the present configuration , therefore , there is no need to provide the engaging portions 10 illustrated in fig3 and 4 , and the concavities of the angular portions 16 can be used as the engaging portions engaged with the latch pins 11 . fig7 illustrates a state in which a pair of upper and lower liner tubes 8 ( 8 b ) and a grid 9 disposed therebetween are connected together with the angular portions 16 , which serve as the engaging portions , and the latch pins 11 . similarly to each of the liner tubes 8 ( 8 b ), the grid 9 is configured to have an outer circumferential surface having concavities formed by angular portions . therefore , substantially similarly to fig4 , the pin support portions 15 are provided in an arrangement corresponding to that of the concavities of the liner tubes 8 ( 8 b ). in this way , each of the lower liner tubes 8 ( 8 b ) and grids 9 of the present embodiment can be attached with the latch pins 11 on the outer circumference thereof , with no need of being formed with the grooves or the like . accordingly , the upper and lower liner tubes 8 ( 8 b ) and the grid 9 can be vertically connected together , with the outer circumferential surfaces of the three components being aligned to one another , by disposing the grid 9 between the pair of the upper and lower liner tubes 8 ( 8 b ), causing the pin support portions 15 of the grid 9 to support the central portions of the latch pins 11 , and inserting the upper and lower end portions of the latch pins 11 in the concavities of the outer circumferential surfaces of the upper and lower liner tubes 8 ( 8 b ), which are formed by the angular portions 16 . with this configuration , the vertically adjacent liner tubes 8 ( 8 b ) and the grid 9 can be fixed to one another in the radial direction . thus , with a relatively small number of processes , a gap is prevented from being formed between the liner tubes 8 ( 8 b ) and the grid 9 by a positional misalignment in the radial direction . accordingly , it is possible to prevent the unnecessary flow of the coolant , and thus , to improve the thermal efficiency of the fuel assembly and stabilize the lifetime performance of the fuel assembly , for example . it is preferable to set the thickness of the liner tube so as to prevent a gap from being formed in a joining area of the grid and the liner tube , even if a lateral misalignment is caused by the amount of a gap between the wrapper tube and the liner tube . in a second embodiment of the present invention , description will be made of a fuel assembly including a coolant blocking member 17 for preventing the coolant from flowing in a gap between the inner circumference of the wrapper tube 2 and the outer circumference of the liner tube 8 ( 8 b ). fig8 is a schematic overall cross - sectional view illustrating the second embodiment of the fuel assembly according to the present invention . fig8 illustrates a state in which only a wrapper tube is cut out in a right half of the figure from a center line o and liner tubes included in the wrapper tube are also cut out in a left half of the figure from the center line o . as illustrated in fig8 , a fuel assembly 1 according to the present embodiment includes a vertically long wrapper tube 2 . the wrapper tube 2 has an entrance nozzle 3 at a lower end portion thereof and a handling head 4 at an upper end portion thereof . the wrapper tube 2 stores therein a plurality of vertically long fuel pins 5 extending parallel to one another . the fuel pins 5 are supported at upper and lower end portions thereof by an upper pin support plate 6 provided at an upper end position within the wrapper tube 2 and by a lower pin support plate 7 provided at a lower end position within the wrapper tube 2 . inside the wrapper tube 2 , a plurality of grids 9 are disposed at intervals in the vertical direction ( i . e ., the axial direction ) to hold the fuel pins 5 at regular intervals in the radial direction . further , liner tubes 8 are provided inside with the wrapper tube 2 to be in contact with the respective grids 9 to support the grids 9 in the axial direction . that is , the grids 9 and the liner tubes 8 are disposed to be alternately adjacent to each other along the axial direction of the wrapper tube 2 . the present embodiment is similar to the above - described first embodiment in two liner tubes 8 ( 8 a ) disposed on the upper end side of the wrapper tube 2 and in the internal structure of the liner tubes . therefore , description of the liner tubes 8 ( 8 a ) and the internal structure thereof will be omitted . in the present embodiment , description will be mainly made of the configuration of liner tubes 8 ( 8 b ) disposed below the two upper liner tubes 8 ( 8 a ). fig9 is an enlarged cross - sectional view of fig8 taken along the ix - ix line , and fig1 is a transverse cross - sectional view extracting and illustrating only the liner tube 8 ( 8 b ) illustrated in fig9 . as illustrated in the above figures , in the present embodiment , the liner tube 8 ( 8 b ) is in the shape of a cylinder , the basic form of which is a regular hexagon . the liner tube 8 ( 8 b ) is configured such that the peripheral wall corresponding to the respective sides of the liner tube 8 ( 8 b ) is bent toward the inner circumference thereof to form angular concavities and convexities that fill gaps between peripherally disposed ones of the fuel pins 5 . with such concavities and convexities , angular portions ( i . e ., triangular convexities ) 16 are formed as peripheral flow preventing projections projecting toward the inner surface of the liner tube 8 ( 8 b ). accordingly , the gaps between the peripherally disposed ones of the fuel pins 5 can be closed . further , a peripheral flow preventing structure is formed which prevents the coolant from passing through the space between the fuel pins 5 and the inner circumference of the liner tube 8 ( 8 b ) and flowing upward . that is , as illustrated in fig1 , the present embodiment has a structure in which the peripheral wall of the liner tube 8 ( 8 b ) is formed as a concave and convex wall bent toward the inner circumference thereof , and in which the gaps between the outer peripherally disposed ones of the fuel pins 5 are closed by parts of the concave and convex wall projecting toward the inner circumference thereof . further , an end portion of the liner tube 8 ( 8 b ) is provided with closure portions 19 for closing the space on the outer circumferential side of the parts of the concave and convex wall closing the gaps between the outer peripherally disposed ones of the fuel pins 5 . although not illustrated , the inner circumferential surface of a grid frame of the grid 9 may be also provided with a plurality of projections for closing the gaps between the outer peripherally disposed ones of the fuel pins 5 , and the projections may be formed in accordance with the pin pitch of the fuel pins 5 . that is , the present embodiment has a structure in which at least one of the grid frame of the grid 9 and the peripheral wall of the liner tube 8 ( 8 b ) is formed as the concave and convex wall bent toward the inner circumference thereof , and in which the parts of the concave and convex wall projecting toward the inner circumference thereof close the gaps between the outer peripherally disposed ones of the fuel pins 5 . with reference to fig1 to 17 , description will be then made of the liner tube 8 ( 8 b ) provided with the coolant blocking member 17 for preventing the coolant from flowing in the gap between the inner circumference of the wrapper tube 2 and the outer circumference of the liner tube 8 ( 8 b ). as illustrated in fig1 , the coolant blocking member 17 includes contact pieces 18 a , 18 b , and 18 c , which are positioned on an upper end side of the liner tube 8 ( 8 b ) and formed of an elastic material capable of increasing the range of closure in accordance with the expansion of the wrapper tube 2 caused by the irradiation . specifically , as illustrated in fig1 , the coolant blocking member 17 includes the contact pieces 18 a , 18 b , and 18 c , which project from the outer circumferential side of the liner tube 8 ( 8 b ) to come in contact with the inner surface of the wrapper tube 2 . further , the coolant blocking member 17 is a skirt - shaped member hanging from the upper end portion of the liner tube 8 ( 8 b ) along the outer circumferential surface of the liner tube , and is configured to include the contact pieces 18 a , 18 b , and 18 c , which are a plurality of divided pieces divided by vertically extending grooves 18 to individually come in contact with the inner circumferential surface of the wrapper tube 2 . it is preferable to form the coolant blocking member 17 from a high nickel steel such as inconel ( trade name ), for example . thus formed , the coolant blocking member 17 can keep the spring force thereof for a long time . fig1 is a plan view illustrating the configuration of the coolant blocking member 17 illustrated in fig1 , and fig1 is a side view similarly illustrating the configuration of the coolant blocking member 17 . fig1 is a cross - sectional view ( a cross - sectional view of fig1 taken along the line xiv - xiv ) illustrating the specific configuration of the coolant blocking member 17 , and fig1 is a perspective view of the coolant blocking member 17 . fig1 is a plan view illustrating the action of the coolant blocking member 17 , and fig1 is a vertical cross - sectional view of the coolant blocking member 17 . in fig1 , if the wrapper tube 2 is expanded from a state indicated by a virtual line into a state indicated by a solid line due to the thermal expansion occurring in the operation , the contact piece 18 a positioned at the center of each of the sides of the coolant blocking member 17 follows the expanded wrapper tube 2 and moves toward a central portion of the corresponding one of the sides of the wrapper tube 2 , which is the most expanded portion of the wrapper tube 2 . thereby , the contact piece 18 a comes in contact with the inner surface of the wrapper tube 2 , and the space on the inner circumferential side of the wrapper tube 2 can be closed . further , as illustrated in fig1 , an upper end portion of the liner tube 8 ( 8 b ) is provided with the closure portions 19 for closing the space on the outer circumferential side of the parts of the concave and convex wall closing the gaps between the peripherally disposed ones of the fuel pins 5 . as illustrated in fig1 and 17 , the skirt - shaped coolant blocking member 17 is divided into an upper portion 17 a not formed with the grooves 18 , an intermediate portion 17 b formed with the grooves 18 and flared in a skirt shape , and a lower end portion 17 c gradually bent inward toward the lower side . an uppermost portion 17 d serves as a connection portion connected to the liner tube 8 ( 8 b ). although not illustrated , the present embodiment may be configured such that an end portion of either one of the grid frame of the grid 9 and the liner tube 8 ( 8 b ) is provided with the closure portions for closing the space on the outer circumferential side of the parts of the convex and concave wall closing the gaps between the peripherally disposed ones of the fuel pins 5 . as described above , the present embodiment is configured such that the coolant blocking member 17 is provided on the outer circumferential surface side of the liner tube 8 ( 8 b ) for preventing the coolant from flowing in the gap between the outer circumferential surface of the liner tube 8 ( 8 b ) and the inner circumferential surface of the wrapper tube 2 , and that the coolant blocking member 17 includes the contact pieces 18 a , 18 b , and 18 c formed of an elastic material capable of increasing the range of closure in accordance with the expansion of the gap caused by the expansion of the wrapper tube 2 due to the irradiation expansion . the present embodiment is further configured such that the coolant blocking member 17 is formed as a ring - shaped spring plate , which is disposed on the outer circumferential surface side of the liner tube 8 ( 8 b ) along the circumferential direction , and which includes the contact pieces 18 a , 18 b , and 18 c formed by a plurality of divided pieces divided by the vertically formed grooves 18 to individually come in contact with the inner circumferential surface of the wrapper tube 2 . according to the present embodiment , therefore , even if a flow passage is opened in the gap between the wrapper tube 2 and the liner tube 8 , an unnecessary flow of the coolant can be prevented by the coolant blocking member 17 . further , the present embodiment has a configuration similar to the configuration of the first embodiment . thus , the liner tubes 8 and the grids 9 are alternately stacked to determine the positions of the grids 9 , and the mutual relative positions of the liner tubes 8 and the grids 9 are fixed by using the latch pins 11 between the liner tubes 8 and the grids 9 . a misalignment in the radial direction can be thereby prevented . furthermore , the communication holes 14 are formed to communicate the internal pressure of the liner tubes 8 with the internal pressure of the wrapper tube 2 . accordingly , the deformation of the liner tubes 8 can be prevented . further , the so - called gap flow preventing plate is provided in the gap between the wrapper tube 2 and the liner tubes 8 to prevent the coolant from flowing in the gap even if the liner tubes 8 and the grids 9 are misaligned . the deformation is greater in a near - center portion than in a corner portion of each of the surfaces of the wrapper tube 2 . since the above gap flow preventing plate has a structure of a spring divided in the circumferential direction , the gap flow preventing plate can reliably close the flow passage even if there is such a difference in expansion . fig1 is a partial cross - sectional view illustrating a third embodiment of the present invention , and fig1 is a transverse cross - sectional view of fig1 . as illustrated in the above figures , in the present embodiment , the inner circumferential surface of the liner tube 8 is provided with a plurality of rods 20 extending along the axial direction . each of the rods 20 has a substantially angular cross section and is disposed in accordance with the pin pitch of fuel pins 5 . further , the rods 20 are configured to close the gaps between the outer peripherally disposed ones of the fuel pins 5 . that is , the inner circumferential surface of the liner tube 8 is provided with the plurality of the rods 20 , each of which has the substantially angular cross section , and which are disposed in accordance with the pin pitch of the fuel pins 5 along the axial direction to close the gap between the inner circumferential surface of the liner tube 8 and the fuel pins 5 . according to the present embodiment , a peripheral flow can be prevented by providing the peripheral flow preventing rods 20 , each of which has a triangular cross section , instead of forming the peripheral flow preventing structure . fig2 is a schematic view illustrating a fourth embodiment of the present invention , and fig2 is a partially enlarged cross - sectional view of fig2 . further , fig2 is an enlarged view of main parts of fig2 . the present embodiment is configured such that an upper end portion in the wrapper tube 2 is provided with the upper pin support plate 6 for supporting the fuel pins 5 , and that a tie rod 21 penetrating the upper pin support plate 6 has an upper end which can be pressed down by an upper end plug 25 via an elastic member 24 such as a compression coil spring . the grids 9 and the liner tubes 8 are pressed and held downward by the elastic member 24 . that is , an upper pin support ring 23 is provided at an upper end position in the wrapper tube 2 , and the upper end of the tie rod 21 penetrating the upper pin support ring 23 is pressed down by the upper end plug 25 via the elastic member 24 such as a compression coil spring . thus , the grids 9 and the liner tubes 8 are pressed and held downward by the elastic member 24 with the elastic force . according to the above - described configuration , the entirety of the components can be held by causing the upper end plug 25 of the tie rod 21 ( the fuel pin 5 ) to press the uppermost grid 9 via the elastic member 24 in a manner such that the liner tubes 8 and the grids 9 will not be misaligned . accordingly , even if the expansion occurs due to the heat of the fuel and the irradiation , the entirety of the components can be reliably held by causing the fuel pin 5 itself to pull the entirety of the components . at the same time , the other fuel pins 5 are allowed to freely expand . it is preferable to provide a ring having the same shape as the shape of the outer diameter of the ring element to properly apply the elastic force of the elastic member 24 to the grid 9 to thereby reliably apply the pressing force to the grid 9 . with the liner tubes 8 and the grids 9 thus held with the elastic member 24 by the upper end plug 25 of one of the fuel pins 5 , the fuel pins 5 , the grids 9 , and the liner tubes 8 can be integrally handled , and the free expansion of the other fuel pins 5 is not interrupted . the present invention is not limited to the embodiments described above , and other alterations and modifications may be made in the present invention as long as not departing from the scope of the appended claims .	8
referring initially to fig1 and 2 it is seen that the dry cleaner 2 of the present invention is generally of known construction in that it includes a pair of nested tubs 4 , 6 having a common horizontal access with the outer tub 6 generally stationarily supported and the inner tub 4 rotatably supported , and an outer cabinet 8 ( shown in dotted lines in fig1 ) having an access opening in alignment with the open end of the tubs and supporting a front opening door 9 for access to the inner tub 4 . the cabinet 8 encloses the other operative elements of the dry cleaner such as the drive motor ( see fig4 ) coupled through a well - known belt and pulley drive to the inner tub 4 for either reversibly slowly rotating the tub or spinning the tub at a relatively high speed . also included is a pump 24 for pumping the dry cleaning solvent from a storage tank 20 into the tub 6 through a filter 14 in the housing 36 , and back into the storage tank and a blower 16 for circulating heated air through the tubs for drying the clothes . the forward concentric openings of the tubs 4 and 6 are spaced from the wall of the cabinet having the opening to accommodate therebetween a header chamber 11 . this chamber has opposed walls 11a defining concentric openings which in turn are in alignment with the cabinet opening and tub openings respectively to provide an access opening therethrough for the clothes . the walls of the chamber are also sealingly attached to the cabinet structure and outer tub 6 , with the periphery of the forward opening bounded by a forwardly extending flange for sealingly engaging the inner face of the door when in a closed position . the upper portion of the chamber above the openings defines a plenum into which the air from the air blower is directed so that it enters the tubs at the forwardmost portion thereof , and also from which exhaust air is drawn as will be explained later . the complete operation of the electrical components dictating the type of operation being performed is controlled through a well known timer mechanism 18 generally enclosed adjacent the rear of the housing in an area generally inaccessible to the customer / user . the operative cycle of such a machine , maintained normally in a stand - by condition , includes , after the cleaning cycle is initiated , a washing portion wherein the solvent is delivered to the tub 6 during slow speed rotation thereof so that the clothes are randomly moved about within the solvent , a drain portion wherein the solvent is drained from the tub 6 , a spin or centrifuging portion wherein the solvent is extracted from the clothes , and a drying portion when the clothes are again randomly moved about within the tub 4 in the presence of circulating heated air . the present invention is better described with specific detail to the separate circulating systems within the machine . in this regard each system will be described as it functions through the various distinct portions of the complete cleaning cycle . anytime the machine is not being used it is in a stand - by condition ready for use by merely closing the access door and depositing the appropriate coins . while in the stand - by condition there is no flow of the solvent within the machine , with the solvent being stored in tank 20 . after the clothes are loaded into the inner tub 4 , the cleaning cycle is initiated , as by closing the access door 9 and depositing the correct change , which energizes the solvent pump 24 . this pumps the solvent from the storage tank 20 through pump inlet line 22 into pump 24 , hence to discharge pipe 26 and in one side 28a of a diverter valve 28 normally oriented to direct the flow into line 30 through nipple 29 . from line 30 the solvent passes through another diverter valve 32 which normally directs the flow into pipe 34 which is the inlet pipe of a housing 36 enclosing a pair of pleated paper and charcoal filters ( not shown ). after passing through the filters , the solvent exits the housing through outlet 38 which leads through a sight - glass 40 and manual valve 42 into leg 44 of a t - connector 46 . the opposite leg of the t - connector leads to a oneway valve 48 which is set up to prevent flow therethrough from the connector . thus , the solvent goes to another diverter valve 50 normally directing the flow into yet another diverter valve 54 through a nipple 52 . valve 54 normally directs the flow into pipe 56 which leads into the outer tub 6 . once the tub 6 fills to a predetermined level , any further solvent coming into the tub causes the solvent to flow out the tub 6 through the overflow line 60 . it is to be noted that a drain or dump line 62 also leads from the tub 6 , but as this line is closed by a motor drive valve 64 at this time , the solvent can exit the tub only via line 60 . line 60 also has a motor driven overflow valve 66 which at this time is open permitting flow of the solvent into line 68 connected to a housing 70 containing a button trap ( as is well known in the art ) enclosing a perforated container 72 interposed between the inlet and the outlet pipe 74 leading back to the storage tank 20 . this recirculation of the solvent from the storage tank through the filters , into the tubs , through the button trap , and back to the tank , is continuous throughout the fill and wash portion of the cycle . at the termination of the wash cycle , although the clothes tub 4 continues to tumble the clothes , the abovedescribed flow circuit is altered to provide two separate solvent flow paths . the first provides continuous filtration of the solvent by continuing to pump the solvent from the tank 20 through the filters via the route described above with the exception being that valve 54 has now been energized and directs the solvent into line 76 which leads directly back to tank 20 . thus , no more solvent enters the tubs . the other path dumps the solvent already in the tubs into the tank 20 . this is done by opening valve 64 of line 62 for flow therethrough into another inlet pipe 78 of button basket 72 before flowing through outlet pipe 74 to the storage tank 20 . this flow path is maintained all during the drain and subsequent spin portion of the cycle . also , for purposes of air pressure balance through the solvent distributing system , overflow valve 66 remains open during this portion of the cycle . during this portion of the cycle the solvent continues to flow through the filtering cycle above described ; however , valves 64 and 66 are closed , which in conjunction with valve 54 closing the solvent inlet line to the tub , ( as is the case with the filtration flowpath utilized ), the solvent flow system is isolated from any evaporative air circulated during the dry cycle . during the last minute of the cycle , the solvent which has been flowing in one direction through the filters , is caused to flow through the filters in a reversed direction in an operation known as &# 34 ; backwash &# 34 ;. ( again see the u . s . pat . no . 3 , 253 , 431 of common assignee .) thus , as before , the solvent is drawn from tank 20 through pipe 22 into pump 24 and discharged to line 26 into valve 28 . this diverter valve has now been energized to direct the flow into line 88 and into valve 50 which also has been energized to direct flow into leg 44 of connector 46 , thence through manual valve 42 , sight - glass 40 and into the outlet 38 of the filter housing 36 . the solvent exits the housing 36 through inlet 34 and into diverter valve 32 which is energized to divert the solvent into line 82 leading to the top of the button tank 70 which , as is also well known , houses a backwash bag which filters particles from the solvent as it passes therethrough into the button basket for return to the tank 20 via line 74 . a filter housing breather line 86 connects the upper end of the filter housing 36 with the button basket tank 70 to bleed any air entrapped therein out of the housing and into a suitable place . any solvent that may flow therethrough goes directly to the button tank 70 and back to the storage tank 20 . it is important to note that valves 54 , 64 , and 66 still maintain the solvent distributing system isolated from the circulating drying air . to complete the solvent flow system , a safety line 132 connects the top of the button tank 70 with a line 128 ( a solvent vapor handling line to be explained subsequently ) leading directly into storage tank 20 . this line 132 accommodates the solvent flow in the event the button trap 70 becomes clogged to the extent that return flow to the tank 20 through line 74 is blocked . thus , under this condition , the button trap would fill with solvent to the line 132 which would deliver it back to the tank 20 at a rate capable of accommodating the pump capacity during the filtering portion of the cycle . as previously explained , the header chamber 11 is attached to the outer tub 6 at the tub &# 39 ; s forward opening . this header chamber 11 thus is in air - flow communication with the inner tub 4 through the forward facing opening of the tub . the header chamber has attached thereto a pair of airflow hoses 118 and 122 . another air hose 96 is attached to the stationary outer tub 6 at some point axially remote from the header chamber 59 . each hose in turn is associated with an electrically energized oneway valve 90 , 92 , and 94 respectively , for controlling the flow through these hoses , these being the only airflow ingress or egress lines connected to the tubs . during this time there is no airflow as no blower is energized and valve 90 , 92 and 94 are normally closed . however , should the door become open , a door switch immediately energizes valve 92 and an exhaust blower 120 . thus , it is seen ambient room air is drawn through the front opening and immediately drawn into the upper portion of the header chamber 11 with minimal penetration into the interior of the tubs so that the solvent vapors within the tub are not exhausted while the air is being drawn through the front opening to prevent the user , when loading or unloading clothes , from encountering solvent vapor fumes . again there is no airflow during this portion of the cleaning cycle as valves 90 , 92 and 94 remain closed and no blower is energized . thus , during this portion of the cycle the solvent in the tub is not exposed to any circulating air . during the drain portion of the cycle , valve 90 associated with the air inlet side of header chamber 59 and valve 94 associated with the air outlet side of the tub 6 are both open to assist in balancing the air pressure throughout the interior of the machine ( with no blower being energized ) as the solvent is drained from the tubs . however , once the drain portion is completed and the inner clothes tub 4 is energized to spin , all valves 90 and 94 are again closed . this again isolates the air within the tubs and prevents any air circulation through the air distributing system which could be induced by the spinning tub even though no blower was energized if such valves were open . elimination of the airflow through the clothes during spin by isolating the tubs as above described is important with respect to minimizing the undesirable phenomena associated with dry cleaning and referred to in the trade as &# 34 ; streaks and swales &# 34 ;. these are darker areas in the form of spots and lines that form in the clothes when certain areas dry faster than others and before the solvent has a chance to be distributed generally equally throughout the clothes . thus , in these areas , generally adjacent the creases or folds in the clothes which are dried quite rapidly , a concentration of non - volatile residue ( n . v . r .) carried by the solvent as a result of cleaning the clothes , is present which is highly visible as darker streaks at the interface of the faster dried areas and the subsequently dried area of the clothes . it logically follows that the greater the volatility of the solvent , i . e . the more readily the solvent vaporizes , the more likely it will be for uneven drying to occur , forming the streaks and swales . the uneven drying as accenuated by the spinning tub , which in addition to maintaining the clothes in a fixed position by virtue of the centrifugal force , also normally induces an air circulation through the tub , created by the high speed spinning of the clothes and tub acting as a blower . it has been found that the formation of the streaks swales can be greatly reduced and even eliminated by preventing airflow through the tub during the spin cycle . this , in addition to decreasing the vaporization of the solvent from the exposed surfaces of the clothes due to air movement , prevents escape of the vaporized solvent , thereby permitting the vapor pressure within the tub to increase somewhat which itself retards further vaporization . thus , although a solvent having a higher degree of volatility is used in this machine , the formation of streaks and swales is greatly reduced by having valves 90 and 94 closed during centrifugal extraction . one minute after the start of the drying portion of the cycle wherein the tub 4 is again reversibly driven at a tumble speed , valves 90 and 94 are opened . this initial minute with the above valves closed permits the clothes to be in a tumbling mode before the flow of drying air is initiated . this is in furtherance of preventing rapid drying of selective areas for eliminating streaks of swales by letting the clothes move randomly about before being subjected to the rapid drying affects of the hot air . once the valves 90 and 94 are opened and blower 16 energized , the air and vapor mixture exits the tubs 4 , 6 through hose 96 which leads into a lint box 98 having a lint screen 100 . after passing through the lint box , air goes through valve 94 , and then to hose 102 of the inlet of blower housing 104 enclosing the blower 16 . from there the air / vapor mixture goes through hose 106 and into condenser housing 108 . condenser housing 108 contains the evaporator coils 110 of a refrigeration unit ( to be described ) which condense the solvent vapor from this air and vapor mixture . the air exits housing 108 through hose 112 which leads into a heater box 114 enclosing a cast aluminum finned resistance heater 116 , where the temperatures of air is elevated to a predetermined level . ( it is noted in fig3 that the heater has been energized a sufficient length of time prior to the flow thereover to insure the heater is at the elevated temperature when the airflow through the tub 4 begins .) from the heater box 114 the heated air flows into inlet valve 90 and thence into the inlet of header 59 to flow through the clothes in the tub 4 , vaporizing the solvent from the clothes and repeating the closed circulation path described continuously through the dry portion of the cycle . at the termination of the dry portion of the cycle the blower 16 stops , valves 90 and 94 close and the front opening access door is permitted to be electrically unlocked by manual depression of a door opening switch . ( it should be pointed out that once the cycle has been initiated the door is mechanically locked in a manner that can only be unlocked through the electrical energization of a solenoid that is prevented from being energized until the cycle is complete and subsequently described with reference to fig4 .) once the dry portion of the cycle is completed as above described , the machine is no longer controlled by the timer but is in a stand - by condition ready to repeat a cleaning cycle . however , for removal of the clean clothes , the access door must be open . and , as previously explained , anytime the door is open an exhaust fan 120 is energized through a door switch 10 ( see fig4 ) along with exhaust valve 92 , also energized through the door switch 10 , being opened . thus , air is forced to enter the front opening , flow directly into the header chamber 11 , through valve 92 attached thereto and into the blower 120 . from the blower the air flows through hose 122 which in turn is to be connected to a venting system for the building housing the dry cleaner . the airflow with the door open is thus limited to an exit path that is exclusive for exhausting and does not cause air to flow through the interior of the tubs 4 , 6 thus minimizing the loss of solvent vapor to the exhaust . also , the exhaust , to satisfy established requirements , causes air to flow through the door opening at a minimum rate of 100 linear feet per minute . during the fill portion of the cycle , the air in the tubs 4 , 6 is displaced by the incoming solvent . also , the warmer surfaces of the tubs cause some of the incoming solvent to vaporize . the closed door prevents this vapor from escaping through it and with the valves 90 and 94 closed , the air / vapor mixture is forced ( by pressure ) into hose 96 leading to lint box 98 . an exit hose 124 leads from the lint box to an expandable closed impervious bag 126 , preferably plastic and housed in a container ( not shown ) located in the upper portion of the machine . the bag expands to accommodate and retain the air - vapor mixture . this bag keeps the pressure within the machine within low enough limits such that positively sealing the machine against the existing pressure to prevent leakage does not become prohibitively expensive as it would if the solvent vapor remained in the confines of the tub and attached hoses . in practice the pressure within the machine tends to stabilize at approximately one - half psi as opposed to approximately ten psi without the bag . a safety release valve 130 is interposed in line 124 and adjusted to open under a somewhat greater pressure than one - half psi to insure that the internal stays within an acceptably low limit . however , under most circumstances valve 130 will not be required to open . during the wash portion of the cycle , the vapor pressure within the tubs and line 96 tends to stabilize so that there is minimal air / vapor movement . also , during the dump portion of the cycle , even though valves 90 and 94 are open , there is very little air / vapor flow from the bag 126 as the increasing volume in the tubs decreases the vapor pressure which in turn permits more solvent to vaporize to fill this space . the valves 90 and 94 being again closed for the spin portion of the cycle prevent air / vapor flow from the bag . however , during the dry portion of the cycle with valves 90 and 94 open , the air is circulated as previously described . it is noted that line 24 is on the suction side of recirculating blower 16 so that with the blower 16 energized , the air / vapor mixture in the bag , being at a greater pressure and at an elevated position with respect to the suction inlet to the blower , is forced back into the flow stream via the lint box 98 , until the bag 126 is evacuated . the vapor in this air / vapor mixture is then recovered in the same manner as the vapor driven from the clothes during the drying operation is recovered . the bag is evacuated well before the termination of the drying operation . the relatively warm ambient temperature causes some of the solvent in the storage tank 20 to vaporize . this vapor is removed from the tank ( to prevent pressure buildup therein ) by a breather line 128 leading to condenser box 108 . as the air passage through the condenser box 108 is blocked by valves 90 and 94 during all portions of the cycle except drain and dry , the box 108 and the hoses connected thereto act like a chamber providing additional volume to accumulate and retain the vapors . however , during this time , should the pressure increase beyond an acceptable level , ( i . e . somewhat less than one - half psi ) the vapors can by this pressure , be forced through line 106 , backwards ( in relation to the normal direction of flow ) through recirculating fan 16 , into hose 102 . this pressure is then on the back face of closed valves 94 which is oriented to prevent flow in the other direction , but with back - pressure thereon , opens sufficiently for the vapors to leak through it and into box 98 . from there the vapors go through line 124 for retention in the expandable bag 126 for subsequent reclamation as previously described . during the drain portion of the cycle , the vapors generated in the tank 20 and directed to the condenser housing 108 are permitted to flow through the heater box 114 and into the tubs 4 , 6 through the then open valve 90 for subsequent reclamation during the dry portion of the cycle , whereas during the dry portion , when the evaporator 110 is operating , the vapors directed into the condenser box 108 from either the tub or the tank are condensed . in addition to condensing solvent vapor , the evaporator 10 in the condenser housing also condenses water vapor evaporated from the clothes during the dry portion of the cycle . this water / solvent mixture is directed from the condenser housing 108 by gravity flow through line 134 to the water separator housing 136 where , because of the difference in the specific gravity between the two liquids , the solvent can be removed from the water by lines exiting the separator at different levels as is well known in the art . thus , the water goes through the separator 136 through line 138 into a closed container 140 for intermittent manual dumping . the solvent exits the housing 136 through line 142 to return to the storage tank 20 . a compression - type refrigeration system is provided in the dry cleaner for condensing the vapors in the condenser box 108 and also for maintaining the liquid solvent in the storage 20 at a predetermined temperature to minimize the vaporization therein . the system is best seen in fig2 and operates to cool the storage tank under all portions of the cycle except the drying portion . thus , the description for stand - by includes these other portions of the cycle . thus , whenever the thermostat 141 within the tank 20 exceeds a predetermined limit ( 80 ° f ) the refrigeration unit is energized with cooling directed to the evaporator coil 144 in the storage tank 20 . in the system shown the refrigerant flow path includes a compressor 146 with a compressed refrigerant directed therefrom through line 148 to refrigerant condenser 150 , accumulator 152 , filter 154 and sight - glass 156 to t - connector 158 . of the two lines 160 and 162 leading from the t - connector 158 , line 160 contains a normally closed valve 164 which thus prevents flow therethrough . however , line 162 contains a normally open valve 166 permitting the refrigerant to flow into line 168 leading to expansion valve 170 and evaporator coils 144 in the storage tank 20 . from there the refrigerant is directed back to the compressor 146 through line 172 and t - connector 174 . once the solvent in the tank has been cooled to around 75 ° f , the refrigeration system is deenergized , but ready to repeat the cycle whenever the temperature exceeds 80 ° f . during the dry portion of the cleaning cycle the refrigeration unit is continuously energized through a switch 143 ( see fig4 ) controlled by the timer . at this time the refrigerant flow from the compressor 146 is identical to that described above until it reaches the t - connector 158 . the flow path from there is altered by the normally closed valve 164 being energized to an open position and the normally open valve 166 being energized to a closed position . thus , the refrigerant is directed into evaporater coil 110 of the condenser housing 108 for continuous condensing of the solvent vapors passing therethrough during this time , and maintaining a substantially fixed temperature therein over the varying load conditions . from there the refrigerant 146 passes through line 176 leading to t - connector 174 . it is noted that during the dry portion of the cycle , the temperature of the solvent in the storage tank 20 can exceed the 80 ° f temperature without refrigeration being directed thereto . however , as this dry portion is a relatively short - term operation , the temperature rise is never too much beyond the 80 ° f and also the increased rate of vaporization is accommodated through the breather line 128 directing the vapor to the condenser housing where it is condensed and returned to the storage tank , as previously explained , as relatively cool solvent . further , as the refrigeration unit is sized in accordance with the heat removal required of it during the drying portion of the cycle ( this being the greatest load it must accommodate ) its refrigeration capacity is greatly in excess of that needed to maintain the solvent within the predetermined temperature range during all other portions of the cycle . thus an alternative refrigeration control system would be to eliminate the normally closed valve 164 in line 160 and make valve 166 ( previously identical as being normally closed valve . in this arrangement , during all portions of the cleaning cycle except drying , the now normally closed valve 166 would be opened in response to the thermostat sensing a predetermined limit and the refrigerant would then flow into the evaporator coils 144 in the tank 20 . as the refrigerant line to the evaporator coils 110 is also opened ( because there is no valve ) a portion of the refrigeration would also flow into it , however , because of the oversized capacity of the unit , sufficient refrigerant would flow to the coils 144 to cool the tank . during the dry portion of the cycle , valve 166 would be prevented from being energized by the thermostat , and thus being a normally closed valve , would direct all the refrigerant into the coils 110 to condense the vapors in the circulating drying air . this last described system permits the elimination of one valve ( 164 ) from the previously described system . thus , the refrigeration system has a single compressor for alternatively primarily cooling two distinct evaporator coils under either a continuously timed demand for one coil or a cyclical temperature responsive demand for the other coil , with the time demand having precedent . as previously stated and as is well known in the art , the automatic dry cleaning machine is controlled for the most part through a timer mechanism 18 mounted in the back portion of the housing so as to be generally accessible to only certain personnel so that the cleaning cycle cannot normally be altered in any way . however , in the present invention , provision is made for purposely altering the timer operation to provide what would normally be a dry portion of the cycle , but without rotating the tub or advancing the timer to other portions of the cycle . this modified dry operation is thus utilized to dry the filter cartridges , which must occasionally be replaced , prior to them being discarded to reclaim any residual solvent or solvent vapors therein that remain after the filters are removed from their housing 36 for replacement . normally , the proprietor would know when it was time to change the filters and would preferably allow the machine to remain quiescent for some period of time to permit solvent to gravitationally drain from the filters . however , as this does not remove all the recoverable solvent , the present machine permits the filters to be placed within the tub 4 and the control mechanism set to provide the above operation identified as &# 34 ; cartridge dry &# 34 ; on the timer control panel . to actuate the mechanism to this procedure , a switch ( to be discussed ) is included on the control panel having one switch arm serially connected in the timer motor circuit and another switch arm serially connected in the main motor circuit so that in the &# 34 ; cartridge dry &# 34 ; position of this switch , both motors are inactive . after placing the switch in this position , the timer is manually turned to any point in the dry portion of the cycle , thereby actuating all elements previously identified to accomplish a drying process within the machine . after some length of time sufficient to dry the cartridges , the cycle is manually terminated by turning the timer to an &# 34 ; off &# 34 ; position and returning the &# 34 ; cartridge dry &# 34 ; switch to the normal position , thereby readying the machine for further use by the customer . reference is now made to fig4 to briefly describe the controls of the machine and particularly those applicable to the &# 34 ; cartridge dry &# 34 ; operation . thus , it is seen that the control circuit includes a door switch 160 which , and the position shown , represents the access door being closed , and which is necessary for the machine to operate . it is noted that in the door open position , switch 160 would simultaneously energize the exhaust valve 92 and exhaust door 120 for air flow through the access opening as previously explained . a control box switch 162 is in series with one side of the door switch and , in the position shown , indicates the termination of the cleaning cycle and thus the stand - by position . as the access door is mechanically locked , whenever closed , it can only be unlocked for access when this switch 162 is in the position shown by manually depressing a door unlock switch 164 which energizes an unlocking solenoid 168 . once coins are deposited to initiate the cleaning cycle , the control box switch moves to its other position to energize the appropriate timer contacts and deactivate the line having the door unlock switch 164 so that the door can no longer be unlocked . the timer 18 as well known , includes a plurality of cam actuated switches ( only certain ones being illustrated ) with the controlling cams rotatingly driven by a timer advancing motor 174 . also , as can be seen , the main motor 176 of the machine is controlled through a timer switch . the &# 34 ; cartridge dry &# 34 ; switch 172 is interposed in each motor line so that when moved to the &# 34 ; cartridge dry &# 34 ; position , contact 172a to the timer motor is opened along with contact 172b to the tumble winding of the main motor ( the tumble winding being the winding that is energized through the timer when the timer is positioned in the dry portion of the cycle ) thus preventing either advancement of the timer mechanism or rotation of the inner tub 4 . when it has been determined that the cartridges are dry , the machine is returned to the normal operating condition by closing switch 172 and returning the timer to the initiation point of the dry cleaning cycle .	3
a downhill racing sled suitable for incorporating the features of the invention is described with particularity in sellers , u . s . pat . no . 4 , 666 , 171 , the contents of which are herein incorporated by reference . as shown in fig1 - 3 , the sled includes a one - piece elongated molded hull 10 , preferably of vacuum - molded thermoplastic . the hull 10 has a bow or front - end , which is on the right as viewed in fig1 and 2 , and a stern , or rear - end , which is on the left as viewed in fig1 and 2 . the hull 10 presents a generally crescent - shaped profile , best seen in fig2 . an upper outwardly rolled molded edge of the hull 10 forms continuous railings or gunwales 12 surrounding the hull 10 . the gunwales 12 are raised at the bow to afford handholds and to protect against the intrusion of snow . the bottom of the hull 10 while generally curved in profile as shown in fig2 includes certain features that enhance the sled &# 39 ; s performance in deep snow . in fig3 a cross - section of the hull 10 reveals a pair of generally flat parallel runners 14 , 16 defined by molded downwardly protruding parallel ribs 18 , 20 , 22 , 24 . flat areas 26 , 28 between the pairs of ribs act like wide skis to support the hull 10 as it moves through the snow . the ribs 18 , 20 , 22 , 24 guide the hull 10 in a straight path and enhance tracking in packed snow . in fig3 a pair of steps formed on the sides of the hull 10 define a pair of generally flat steering runners 44 a - b integral with the hull 10 . the steering runners 44 a - b define a downwardly extending arc , best seen in fig2 and 19 , that is positioned high enough on the hull 10 so that when the hull 10 is level , the lowest points of both steering runners 44 a - b are above the level of the snow . however , when the rider banks the hull 10 beyond a critical angle , a sharp edge 46 of one steering runner 44 b contacts the snow . a downward component of the combined weight of the rider and sled is thus concentrated on the relatively small surface area of the edge 46 . the extent of this downward component , and hence the pressure on the edge 46 , depends on the extent to which the rider banks the hull 10 , as well as on the slope of the prevailing terrain . when the edge 46 contacts the snow , the force acting on the edge 46 generates drag . since only one of the two steering runners 44 a - b is in contact with the snow at any time , this drag tends to turn the hull 10 . in this way , the steering runners 44 a - b assist the rider in executing sharp turns . the steering runners 44 a - b are of particular use in icy or crusty conditions . under these conditions , the pressure exerted by the edge 46 of a steering runner 44 b enables it to bite into hard , icy surfaces . to further enhance this ability , a sharpened steel edge can be fastened onto the steering runner 44 a - b . between the two runners 14 and 16 , a main central channel 30 extends longitudinally from the bow to the stern of the hull 10 , with progressively increasing depth as shown in fig2 and 3 . the inside ribs 20 and 22 define the edges of the channel 30 and are slightly outwardly flared with gradually increasing spacing at both ends of the hull 10 . inside the hull 10 , the molded channel 30 forms a large longitudinal central rib or keel - like hump 32 running down the center of the hull 10 . because of the increasing depth of the snow channel 30 toward the rear of the hull 10 , the hump 32 becomes more pronounced toward the rear as shown in phantom in fig2 . an outwardly molded stern portion of the hull 10 extends into a rear - facing lip 48 , hereafter referred to as a “ snow brake ,” that rolls downward , as shown in fig4 and 5 . the snow - brake 48 , which wraps around the stern portion of the hull 10 , includes a rear portion 50 and two side portions 52 a - b . the greatest extension of the snow - brake 48 , both rearward and downward , is at its rear portion 50 . the extent to which the snow - brake 48 projects outward and downward progressively decreases along the two side portions 52 a - b until the snow - brake 48 merges smoothly with the gunwale 12 . to use the snow - brake 48 , a rider leans back , as shown in fig6 . this causes the hull &# 39 ; s bow to rise and its stern to sink . as the stern sinks , the rear portion 50 of the snow - brake 48 comes into contact with the snow and creates drag . the extent of this drag depends on the extent to which the stern sinks . this , in turn , is controlled by the extent to which the rider leans back . by leaning backward and sideways at the same time , the rider can cause one side of the hull 10 to sink and the other to rise . as one side sinks , the side portion of the snow - brake 48 comes into contact with the snow and also creates drag . this drag , which only acts on one side of the hull 10 , causes the hull 10 to turn swiftly in that direction . the snow - brake 48 can thus be used as a type of rudder as well as a brake . optional gripping aids 54 can extend downward from the edges of the snow - brake to provide additional drag in icy conditions . these gripping aids can include teeth , as shown in fig1 - 19 , studs , or claws , as shown in fig4 . the gripping aids 54 can be integral with the snow - brake 48 or formed on a metal plate which is then attached or fastened to the rim of the snow - brake 48 . a side - mounted snow - brake 49 can also be mounted on the gunwale 12 at the side of the hull 10 as shown in fig1 . such a snow - brake 49 is formed by outwardly rolling the gunwale 12 so that it projects outward and downward part - way toward the snow . the side - mounted snow - brake 49 , steering rails 44 a - b , and ribs 18 , 24 collectively provide the rider with three progressively more effective ways to brake the sled when the sled is oriented in a direction having a component transverse to the fall line . the rider can lean sideways into a skid using the edges of the ribs 18 , 24 for mild braking action , or the rider can lean further to engage the steering rails 44 a - b for more effective braking . if necessary , the rider can lean far enough to engage the side - mounted snow - brake 49 and bring the sled to an abrupt stop . referring now to fig7 side portions of the gunwale 12 are rolled outward to form a lip 56 . this lip 56 curls downward to form a rim portion 58 parallel to the hull 10 and separated therefrom by a gap 60 . an outboard hole 62 through the rim portion 58 is aligned with an inboard hole 64 through the hull 10 . molded retaining walls 66 a - b , seem in isometric view in fig8 flank the inboard hole 64 and extend outward from the hull 10 , part way across the gap 60 . a knee strap 36 has a grommet 68 at each of its two ends , one of which is shown in fig9 . to attach the knee strap 36 to the hull 10 , a grommet hole 70 defined by the grommet 60 is aligned with the inboard hole 64 . then , a threaded { fraction ( 1 / 2 )} inch bolt 72 is passed through the grommet hole 70 and through the inboard hole 64 . the bolt 72 is long enough to extend through the inboard hole 64 and all the way to the outboard hole 62 . preferably , the bolt 72 extends approximately { fraction ( 3 / 16 )} inches beyond the outboard hole 62 to ensure adequate support by the edge of the outboard hole 62 . a nut 74 is then threaded onto the bolt 72 to secure the bolt 72 to the hull 10 . when the nut 74 is fully tightened , it comes to rest snugly between the retaining fins 66 a - b , as shown in fig8 . the retaining fins 66 a - b thus limit rotation of the nut 74 in response to torque transmitted by the strap 36 . by doing so , the retaining fins 66 a - b reduce the likelihood that the nut 74 will loosen during use . because of its strength , metal is typically used for making the nut 74 and bolt 72 . however , other materials such as plastic can be used . a shear force exerted on the strap 36 is transmitted to the hull 10 by the bolt 72 . however , the hull 10 supports the bolt 72 at two different points , namely at the edge of the inboard hole 64 and also at the edge of the outboard hole 62 . as a result , the strap - anchoring configuration shown in fig7 - 9 resists the tendency of the bolt 72 to pivot about a single support in response to a shear force . it does so by resisting shear force using shear resistance provided by the hull 10 at two different support points . by concealing the nut 74 and bolt 72 from view , the rim portion 58 of the lip provides the hull 10 with a more attractive and streamlined appearance . this appearance can be enhanced by coloring the end of the bolt 72 or by extending the end of the bolt 72 slightly beyond the rim portion 58 so it can be capped . in addition , by covering the nut 74 and bolt 72 , the rim portion 58 also prevents the nut 74 and bolt 72 from snagging on nearby objects , such as the rider &# 39 ; s clothing . referring back to fig1 a pair of optional contoured shin pads 40 are used in combination with the knee strap 36 to maintain the axial position of the rider constant relative to the hull 10 . a shin pad 40 , a cross - section of which is shown in fig1 , is a unitary structure having a raised front portion that functions as a knee stop 76 and a raised back portion that functions as a foot stop 78 . between the foot stop 78 and the knee stop 76 is a ribbed portion 80 having transverse ribs 82 for gripping the rider &# 39 ; s shin . a typical rib 82 has a vertical face that faces the rear of the hull 10 and a curved face that faces the front of the hull 10 . in one embodiment , shown in fig1 , the heights of the ribs 82 vary to conform to the radius of curvature of the rider &# 39 ; s shin . fig1 shows an isometric view of the shin pad 40 . the dimensions given in fig1 - 16 are selected to conform to typical adult dimensions ( in inches ). the shin pad 40 slopes downward from the foot stop 78 to the front end of the ribbed portion 80 . past the front end of the ribbed portion 80 , the shin pad 40 slopes upward to form the knee stop 76 . when a rider kneels on the shin pad 40 , as shown in fig1 , the rider &# 39 ; s knee rests on the knee stop 76 and the front of the rider &# 39 ; s foot rests on the foot stop 78 . during sudden deceleration of the sled , deformation of the knee stop 76 and foot stop 78 absorb the rider &# 39 ; s momentum and thereby restrain continued forward motion of the rider . in response to the rider &# 39 ; s weight , the ribs 82 deform . in their deformed state , the ribs 82 exert a force that tends to restore them to their undeformed state . this restoring force , when transmitted to the rider &# 39 ; s shin , tends to grip the shin . although the restoring force exerted by any one rib 82 is small , the collective restoring force exerted by all the ribs 82 is significant . the gripping force exerted by the rib 82 is further enhanced by providing the rib 82 with a vertical leading face 84 . in a rib 82 having a sloped leading face , the rider &# 39 ; s shin has a tendency to slide forward over the rib 82 . in contrast , the vertical leading face 84 of each rib 82 tends to resist this forward - sliding tendency of the shin . the gripping force exerted by each rib 82 depends , in part , on the extent of its deformation . this , in turn , depends in part on the force exerted by the shin on the rib 82 . this force has two components : one arising from the rider &# 39 ; s own weight and another arising from any deceleration of the sled . thus , one advantage of the shin pad 40 is that this gripping force increases momentarily when the sled rapidly decelerates or comes to a sudden stop . other embodiments of the shin pad 40 include those having ribs 82 that extend in directions other than the transverse direction . for example , the shin pad 40 may include ribs 82 oriented in a herring - bone pattern , as shown in fig1 , or diagonally , as shown in fig1 . these configurations provide resistance to tangential forces that result when the sled changes turns . in addition , the shin pad 40 can have an oval footprint , as shown in fig1 and 12 , or a rectangular footprint , as shown in fig1 . the shin pad 40 is made of a resilient material such as a closed cell foam . however , it can also be made of a molded plastic the material used to make the shin pad 40 should be one that enables the ribs 82 to deform in response to the rider &# 39 ; s weight but to resist deformation enough to grip the rider &# 39 ; s shin . in addition , the material should be sufficiently resilient to return to its original shape even after repeated and sustained deformation . when manufactured out of closed cell foam , the ribs 82 of the shin pad 40 are cut out with a heated wire . however , other methods of cutting the ribs 82 of the shin pad 40 , for example , with high - pressure water jets , can also be used . in other embodiments , the shin pad 40 can be molded out of a suitably resilient plastic . the invention has been described in the context of a specific recreational racing sled . however , the various features of the invention can readily be incorporated other types of recreational sleds .	1
referring to fig1 there is illustrated a automobile 10 having a rear deck 12 , a rear window 14 , and a set of brake lights 16 of conventional design . when the driver steps down on the brake pedal , a switch within automobile 10 will be closed and brake lights 16 will become illuminated . the illumination of lights 16 does show to the driver in the following or rear car that the driver in the front car , that is , automobile 10 , has his foot on the brake pedal . there is no information displayed , however showing how much effort is being applied to the brake pedal or how rapidly the automobile is decelerating if at all . in accordance with the principles of this invention , a display bar 18 is mounted in such a fashion as to be visible to the driver in the vehicle following . display bar 18 in this embodiment consists of a pair of extended housing members 22a and 22b having mounted therein a number of lamps 24 , 26 , 28 , 32 , 34 , 36 , 38 , and 42 arranged in a row as illustrated . lamp 43 may be the raised dot - required stop light which would light up when brake lights 16 became illuminated . as will be seen from the discussion which follows , the lamps are paired electrically , for example , lamps 32 and 34 light up together , lamps 28 and 36 light up together , lamps 26 and 38 light up together , and lamps 24 and 42 light up together . each pair is symmetrical about the centerline . also , as will appear later , each pair of lamps may be of a different color . for the details of the system affecting the operation of lamps 24 - 42 , reference is made to fig2 wherein is shown sensor 44 connected to display bar 18 . display bar 18 is enabled by a relay 46 which is closed when brake lights 16 are activated , that is , when the operator of vehicle 10 steps on the brake . an on - off switch sw1 connected between the battery and sensor 44 makes it possible for the operator to turn on or off the entire system , sensor 44 and display bar 18 , when desired . another switch sw2 , in parallel with the switch operated by relay 46 may be provided if it is desired for the driver to have the option to maintain the system even in the absence of braking . the driver would exercise this option if deceleration could occur due to some other reason , such as , the result of down shifting . sensor 44 contains a disk 48 free to roll which moves in the directions shown by arrows a and b . when vehicle 10 is slowing down ( i . e ., decelerating ), disk 48 will move in the forward direction , that is , the direction the vehicle is moving ( to the right in fig2 ) as shown by arrow b , whereas when the vehicle is moving at a steady rate of speed or accelerating , disk 48 will have a resting position toward the rear of sensor 44 , shown by arrow a . the details of construction which determine the position and movement of disk 48 will be described later . within sensor 44 there are four electric eye circuits each consisting of a light source and a detector , for example , light l1 and detector d1 , light l2 and detector d2 , light l3 and detector d3 , and light l4 and detector d4 . each of these detectors contains relays r1 to r4 , respectively , which are connected to their related pair of lamps in display bar 18 . that is , relay r1 in detector d1 is connected to lamps 32 and 34 , so that when relay r1 is closed , lamps 32 and 34 will light up . in similar fashion , detector d2 is connected to lamps 28 and 36 , detector d3 is connected to lamps 26 and 38 , and detector d4 is connected to lamps 24 and 42 . in normal operation , switch sw1 , the on - off switch for the whole system , is closed , switch sw2 is open , sensor 44 is operating but display bar 18 remains disabled until the driver steps on the brake , which results in relay 46 closing to make power available to display bar 18 . with switch sw2 closed , power would be available to display bar 18 all the time , independent of braking . in normal operation , with switch sw2 open , and the driver stepping on the brake , closing relay 46 and enabling the display bar , still none of lamps 24 - 42 become lit until sufficient deceleration occurs to make disk 48 roll forward to block light to detector d1 , causing the latter to close relay r1 , which results in lights 32 and 34 becoming lit . with vehicle 10 accelerating or moving at a steady rate , disk 48 is located to the extreme left of sensor 44 ( that is , toward the rear of vehicle 10 as shown by arrow a in fig2 and to the right as shown in fig3 ) not blocking any of sensor lamps l1 - l4 . when the vehicle decelerates disk 48 acting as an inertial device starts to roll forward , causing the lights along display bar 18 to turn on and off reflecting the deceleration of the automobile . as deceleration of the vehicle increases , disk 48 rolls further to the right ( the forward direction of the vehicle as shown by arrow b shown in fig2 ) blocking detectors d1 - d4 in turn , thus turning on lamp pairs 28 / 36 , 26 / 38 , and 24 / 42 in sequence in accordance with the degree of deceleration taking place . as will be seen from the discussion below , disk 48 is positioned in accordance with the rate of deceleration , so that at maximum deceleration disk 48 is at the far right blocking the light between lamp l4 and detector d4 , lighting up lamp pair 24 / 42 . at somewhat less deceleration , disk 48 would block light between lamp l3 and detector d3 causing lamp pair 26 / 38 to light up and lamp pair 24 / 42 would then shut down . in practice , disk 48 might be rolling back and forth in accordance with the movement and change of speed of the vehicle and the lamps in display bar 18 would reflect these changing conditions with different pairs of lamps lighting up and shutting down , presenting a dynamic picture to the car following of the changing motion of the vehicle in front . since it takes a finite range of deceleration for disc 48 to pass through a particular light beam , it is seen that the glowing of a particular lamp in display bar 18 represents a particular range of deceleration . for the details of how disk 48 moves in the manner described , reference is made to fig3 to 7 . sensor 44 consists of an assembly of flat rectangular members 52 , 54 , 56 and 58 . member 56 shown best in fig6 contains an arc - shaped slot 62 in which disk 48 rides . disk 48 is a circular disk made of a suitable metal such as aluminum . slot 62 is shaped in the form of a circular arc starting at one end 64 which is the lowest part of the arc and therefore the resting position of disk 48 when the vehicle is not decelerating . slot 64 curves upwardly toward the front of the vehicle so that its highest point is at the other end 66 . as vehicle 10 decelerates , disk 48 tends to move toward the front of the vehicle rising as it moves further toward the front of the vehicle , its position along slot 62 being thus determined by the deceleration at that instant . member 52 is provided with four sockets 68a , 68b , 68c , and 68d to accommodate lamps l 1 to l 4 , respectively , spaced and centered along slot 62 . member 52 may be constructed from aluminum . member 54 , which may be constructed from a suitable plastic such as delrin , is provided with smaller holes 72a , 72b , 72c and 72d aligned with sockets 68a to 68d , respectively , to narrow and direct the light beams from lamps l 1 to l 4 , respectively through slot 62 . member 58 which may also be constructed from a suitable plastic such as delrin , is provided with sockets 74a , 74b , 74c and 74d also aligned with openings 72a to 72d and 68a to 68d , respectively , to mount detectors d 1 to d 4 , respectively . members 52 to 58 are sandwiched together as illustrated and held together by bolts or screws 76 . when vehicle 10 is not decelerating , disk 48 is in its initial resting position at end 64 of slot 62 , not blocking light between lamp l 1 and detector d 1 . when the vehicle starts to decelerate disk 48 will start to roll forward and position itself along slot 62 depending on the rate of deceleration . assuming braking is occurring and relay 46 is closed , when disk 48 blocks the light from lamp l 1 to detector d 1 , then lamps 32 / 34 on display bar 18 will light up , and similarly , so would lamp pairs 28 / 36 , 26 / 38 or 24 / 42 depending on the position of disk 48 along slot 62 . as disk 48 rolls along slot 62 , the flashing on and off of light pairs makes an aggregate impression of light moving out and in on the display bar , indicating to the vehicle behind the changing deceleration of the front vehicle . in the event the driver operates the vehicle with switch sw2 closed , then power & amp ; is always available to display bar 18 so that if deceleration of the vehicle occurs as the result of other causes as well as braking , the lights on display bar 18 will indicate the deceleration . other possible causes of deceleration are rapid downshifting , an obstacle in the road , engine malfunction , etc . it is understood that other types of decelerometers may be employed with display bar 18 to activate its lamps to carry out the principles of this invention , and that other arrangements of the lamps are also possible . the lamps on display bar 18 may be color coded to improve their usefulness . for example , lamps 32 and 34 may be yellow , lamps 28 and 36 may be yellow - amber , lamps 26 and 38 may be red - amber , and lamps 24 and 42 may be red . the lamps also may be spaced in a different arrangement if desired . it is seen from the description above that this invention differs from the usual brake light in several important respects . while the conventional brake lights are static in that they glow only when the brake is being applied , in the present invention there is provided a dynamic system which displays changes according to the change in speed of the vehicle . with the present invention many rear end collisions will be avoided . a driver braking hard for an unexpected obstacle in the road , a driver who decides to make a left turn on a road where there is not enough room for others to pass on his right , a driver who momentarily lets his attention wander and has to slow quickly , a driver looking for patterns of deceleration in the traffic before him , all benefit from the use of this invention . while only certain preferred embodiments of this invention have been described it is understood that many variations are possible without departing from the principles of this invention as defined in the claims which follow .	1
fig1 through 5 illustrate a color image recording apparatus according to one embodiment of this invention , in which used is a continuous intermediate image sheet on which intermediate images are recorded . a main body 1 of the image recording apparatus is made up of an upper portion 1a and a lower portion 1b . as shown in fig3 the upper portion 1a is pivotally movable about a fulcrum 24 in counterclockwise direction from the closed state . the lower portion 1b includes an original support stand 2 and a light source unit 26 which is movable along the stand 2 . the light source unit 26 includes an exposure light source 25 , such as a fluorescent lamp , a reflector 27 for upwardly reflecting light , and a filter 28 which allows to pass only light of wavelengths which selectively photocures cyan ( c ), magenta ( m ) and yellow ( y ) microcapsules coated on a photosensitive pressure - sensitive recording medium 11 . as shown in fig4 and 5 , the original support stand 2 includes an original support stand glass 3 on which an intermediate image sheet 10 is placed , a righthand glass holder 4 , a lefthand glass holder 5 , a side plate 6 for regulating the position of the intermediate image sheet 10 , side plate adjusting screws 7 for adjusting the position of the side plate 6 in widthwise direction so that the intermediately image sheet 20 is fittingly placed between the righthand glass holder 4 and the side plate 6 , and original fixing springs 9 for fixedly holding the intermediate image sheet 10 . this stand 2 is movably disposed on a pair of guide rails 8 so as to be projectable from the main body 1 and detachable therefrom . a recording medium cassette holder 15 contains the photosensitive pressure - sensitive recording medium 11 , a recording medium cassette 14 for retaining the recording medium 11 , an original pressing plate 13 , and an original pressing sponge 12 for rendering the recording medium 11 in intimate contact with the intermediate image sheet 10 . this cassette holder 15 is rotatable about a fulcrum 29 . the image recording apparatus further includes a developer sheet cassette 21 in which developer sheets 22 are stacked , a developer sheet feed roller 20 , a pressure developing unit 17 for developing the latent image on the photosensitive pressure - sensitive recording medium under pressure to produce a visible image on the developer sheet 22 , a take - up roller 18 for winding the exhausted recording medium 11 , developer sheet discharge rollers 19 for discharging the developer sheet 22 out of the main body 1 , and a developer sheet tray 23 for receiving the discharged developer sheet 22 . fig6 a through 6c illustrate three examples of the intermediate image sheet 10 on which intermediate images are formed by an intermediate image recording apparatus ( not shown ). in fig6 a and 6b , three color images , i . e . red image 10r , green image 10g and blue image 10b , alignment lines 10d and bar codes 31 representing an image / exposure condition are recorded on a continuous intermediate image sheet 10 . the alignment lines 10d and bar codes 31 are recorded in a monochromatic color . in fig6 c , an image 10m of one of the three primary colors , an alignment line 10d , an arrow 10n indicating a direction of insertion , and a bar code 31 representing an image / exposure condition are similarly recorded on an intermediate image sheet 10 of a cut sheet . referring now to fig7 description will be made with reference to a controller of the image recording apparatus arranged as described above . a cpu ( central processing unit ) 40 constitutes control means and is connected to a rom ( read - only memory ) 56 in which is stored an operational program for the entire apparatus 1 . the cpu 40 is also connected through an input interface 44 to an operation panel 41 having a copy button , a copy number set button , etc ., an optical scanner 42 , such as a bar code reader , for scanning and reading the bar code 31 , and an alignment line detector 43 for detecting the alignment line 10d on the intermediate image sheet 10 . the cpu 40 receives various pieces of data and signals from the units connected thereto . the cpu 40 is further connected to a recording medium cassette holder lifting section 47 , an original support stand moving motor 49 , a light source unit moving motor 51 , a filter selector 53 and a photosensitive pressure - sensitive recording medium motor 55 through an output interface 45 and associated drivers 46 through 54 . the cpu 40 sends various control signals , such as a drive signal , stop signal and drive speed signal , to these units through the output interface 45 , e . g ., actuation means . the operation of the image recording apparatus will be described illustrating means for reading and / or changing recording condition . description will be made with reference to the case where the intermediate image sheet 10 shown in fig6 a is used . on the intermediate image sheet 10 , one of the two alignment lines 10d is drawn in a position slightly apart from the rightside edge of the sheet , and the r - color intermediate image 10r , g - color intermediate image 10g and b - color intermediate image 10b are recorded in the stated order at the left side of that alignment line 10d . there are provided predetermined intervals between the rightside alignment line 10d and the image 10r and between adjacent images . another alignment line 10d is drawn in a position slightly apart from the leftside edge of the sheet . on the lower right and upper left portions of the intermediate image sheet 10 are recorded the bar codes 31 representing an order of the arrangement of the intermediate images ( an order of r , g , and b , for example ) and an exposure condition , e . g . exposure period of time . information relating to the exposure condition needs to be provided , since it is necessary to change the exposure period of time or other factors for the exposure to be in agreement with the kinds of the recording mediums ( thermal - sensitive sheet , transparent film , etc .). the intermediate image sheet 10 on the original support stand 2 is scanned by the light from the light source 25 at a constant speed . therefore , once the alignment line 10d is detected , the position of each of the intermediate images is identified . an operator first lifts the rightside of the upper section 1a and rotate the latter to be in a state shown in fig3 and the intermediate image sheet 10 is placed on the original support stand 2 with its image face up . as best shown in fig4 one longitudinal edge of the sheet 10 is aligned with the side wall of the righthand glass holder 4 and the opposite edge is held by the side wall of the side plate 6 upon adjusting this plate 6 with the screws 7 . the operator then fixes both widthwise edge portions of the intermediate image sheet 10 under the original securing springs 9 . then , the operator closes the upper section 1a ( see fig2 ) and depresses a copy start button provided on the operation panel 41 . in response thereto , the stand 2 moves rightwardly and stops at the rightmost start position . then , the stand 2 moves leftwardly . the optical scanner 42 scans and reads the bar code 31 and the data read out therefrom is sent through the input interface 44 to the cpu 40 . in response to the data sent to the cpu 40 , the latter sends a set of commands to the drivers 46 , 48 , 50 , 52 and 54 through the output interface 45 . those commands are selected from the operational program stored in the rom 56 and provide instructions for the exposure order and exposure condition . more specifically , in the case where the intermediate image sheet 10 in fig6 a is disposed with its left side on the left side of the original support stand 2 and the intermediate image sheet 10 is a thermal - sensitive sheet , the order of blue , green and red together with the proper exposure time for the thermal - sensitive sheet are the contents of the commands issued from the cpu 40 . next , the alignment line detector 43 detects the leftside alignment line 10d in the status shown in fig2 . after the original support stand 2 has moved leftwardly by a given distance from the start position , the photosensitive pressure - sensitive recording medium 11 is fed leftward by a predetermined distance and is wound around the take - up roller 18 , whereby unexposed photosensitive pressure - sensitive recording medium 11 is placed above the intermediate image sheet 10 . the cassette holder 15 is swung clockwise about the fulcrum 29 , so that the recording medium 11 is brought into facial contact with the intermediate image sheet 10 . the photosensitive pressure - sensitive recording medium 11 is made up of a polyester film substrate of about 25 microns in thickness , and on which coated are microcapsules which are made of photosensitive resins selectively having one of three peak sensitivities at wavelengths of 450 , 550 and 650 nm and encapsulate one of cyan ( c ), magenta ( m ) and yellow ( y ) chromogenic materials therein . based on the exposure condition command from the cpu 40 , a blue filter 28b which allows to pass only the light of a wavelength of around 650 nm is positioned above the light source 25 , and the intermediate image sheet 10 is exposed to light in the region between p 1 and p 2 at a scanning speed proper to the thermal - sensitive sheet . at this time , the original support stand 2 is stationary and the light source unit 26 is moving rightwardly at the scanning speed mentioned above . consequently , of the microcapsules coated on the recording medium 11 , only those of the y microcapsules are photocured . subsequently , the cassette holder 15 is moved slightly upwardly and the intermediate image sheet 10 is moved leftwardly by one image pitch . during this period , the light source unit 26 is moved to the leftmost initial position . then , the cassette holder 15 is then descended to bring the intermediate image sheet 10 into intimate contact with the photosensitive pressure - sensitive recording medium 11 . it should be noted that the recording medium 11 remains at the same position and only the intermediate image sheet 10 is fed by one image pitch . therefore , the intermediate image 10g is superposed on the latent image of the intermediate image 10b . thereafter , based on the exposure condition command , the filter 28 is switched to the green filter 28g that allows to pass only the light of a wavelength of around 550 nm , and the light source unit 26 scans and exposes to light the intermediate image sheet 10 in the region between p1 and p2 . as a result , only those of the magenta microcapsules on the photosensitive pressure - sensitive recording medium 11 are photocured . in the subsequent process , the cassette holder 15 is similarly lifted , the light source unit 26 is moved back to the initial position , and the original support stand 2 is moved leftward by one image pitch . as a result , the intermediate image 10r is superposed on the recording medium 11 having the blue and green latent images formed thereon . thereafter , the filter 28 is switched to the red filter 28r that allows to pass only the light of a wavelength of around 450 nm , and the light source unit 26 scans and exposes to light the intermediate image sheet 10 in the same region . after the latent images of b , g and r color images are formed on the recording medium 11 in the superposed manner , the cassette holder 15 is lifted , the light source unit 26 is moved back to the initial position , and the recording medium 11 is transported leftwardly and then upwardly via the guide roller 16 . the developer sheet 22 is fed out from the developer sheet cassette 21 by the feed roller 20 in timed relation to the transportation of the recording medium 11 . the developer sheet 22 and the recording medium 11 are brought into facial contact with each other and enters into the developing unit 17 where the superposed latent images are developed by the aid of a developer material coated on the surface of the developer sheet 22 and a visible color image is produced on the developer sheet 22 . the recording medium 11 is then wound around the take - up roller 18 and the developer sheet 22 is discharged onto the developer sheet tray 23 by the discharge rollers 19 . in order to make a plurality of copies , the above operation may be repeated by the necessary number of times with respect to only a single intermediate image sheet 10 . if the intermediate image sheet 10 is set with its right side on the left side of the original support stand 2 , the scanner 42 scans the lower right bar code 31 in fig6 a and the exposure order of the intermediate images 10r , 10g and 10b is instructed based on the information contained in the bar code 31 . the same color copy is obtained by implementing the above - described operations substantially in the same manner . in the intermediate image sheet shown in fig6 b , there are provided six bar codes in the positions as shown . the firstly scanned bar code ( either the one in the rightside lower portion or the one in the leftside upper portion ) contains information of both the exposure order of the respective color images and the exposure condition of the red color image . the remaining bar codes provided in association with the respective color images contain information of only the exposure condition of the associated color image . the intermediate image sheet 10 shown in fig6 c is of a cut - sheet type , on which one of the three intermediate images is recorded . a bar code 31 is provided to each of the intermediate image sheets 10 , in which contained is information relating to the exposure order and exposure condition in association with the color image thereon . when using such a cut - sheet type intermediate image sheet 10 , the insertion or setting direction of the sheet 10 should be determined in advance . to prevent an error in the direction of insertion or setting of this sheet , an arrow mark 10n is printed on the sheet . although the operator needs to set the intermediate image sheet 10 in the direction indicated by the arrow , the order of setting these sheets is not mandatory , so that an error in making a color copy does not tend to occur when manually setting the sheets . with the use of cut - sheet type intermediate image sheets 10 , it is necessary to move the original support stand 2 in a different fashion from the one described above , but the setting of the exposure condition and the exposure and development processes can be executed in the same manner as described . according to the apparatus according to the present invention , it is also posssible to make a copy of a color original or photograph having a white back surface by setting such an original in intimate contact with the photosensitive pressure - sensitive recording medium 11 on the original support stand 2 and scanning it . it would be apparent to those skilled in the art that this invention is in no way restricted to the above particular embodiment , but can be modified in various manners within the scope and spirit of the invention . for instance , the present image recording apparatus may be designed in such a way that the original support stand 2 is projectable outwardly of the body of the apparatus and in this state the intermediate image sheet 10 can be set thereon . further , the exposure may be performed with a fixedly provided light source rather than moving the light source . since the photosensitive pressure - sensitive recording medium 11 might be exposed to light to a certain extent at the time when the upper section 1a is lifted ( though not particularly mentioned in the foregoing description ), it is necessary to provide a winding device for automatically winding the photosensitive pressure - sensitive recording medium 11 immediately after the upper section 1a is closed . further , although description has been made with respect to a bar code , the present invention is not restricted thereto . any type of machine readable data may be available . as should be understood from the above , according to this invention , an encoded data or a machine readable data representing the image / exposure conditions is recorded on an intermediate image sheet and is read by an optical reader , so that the image / exposure conditions are automatically set on the basis of the information contained in the data . therefore , the operator needs not worry about the direction of setting of the intermediate image sheet or the order of setting a plurality of cut sheets .	6
embodiments relate to systems and methods for providing control of rotary - wing aircraft , and in particular , to control of loading and unloading of loads to and from the rotary - wing aircraft . fig1 depicts a control system architecture in an exemplary embodiment . the control system includes a control device 10 for controlling a rotary - wing aircraft ( e . g ., helicopter ) 100 . control device 10 may be a portable , hand - held , microprocessor - based device having a display screen 12 that provides for a human - machine interface . the processor of control device 10 executes a control application to interface with rotary - wing aircraft 100 . control device 10 also includes wireless communications functionality as described in detail herein . exemplary devices that may serve as control device 10 include tablet computers , personal digital assistants , mobile phones , media players , etc . in the embodiment shown in fig1 , control device 10 communicates with rotary - wing aircraft 100 via a communication system 20 . communication system 20 includes a wireless router 22 and wireless data link 24 . wireless router 22 communicates back and forth with control device 10 using known wireless communications protocols . communications may use packet - based , single channel communications techniques , such as 802 . 11 standards , also referred to as wi - fi . wireless router 22 is in bidirectional communication with data link 24 via a network connection ( e . g ., ethernet ). wireless data link 24 uploads and downloads data to and from rotary - wing aircraft 100 using known uplink / downlink technologies , such as c / l / s / k / ku - band wireless data links . the rotary - wing aircraft 100 includes a data link 102 in bidirectional communication with data link 24 . data link 102 is coupled to a vehicle management system ( vms ) 104 via a network connection ( e . g ., ethernet ) and a sensor package 103 . sensor package 103 provides video or equivalent data to a main or parallel data link system . vms 104 controls rotary - wing aircraft 100 . vms 104 also collects flight status data from rotary - wing aircraft 100 . as described in further detail herein , flight status data from the vms 104 is provided to control device 10 , and commands from control device 10 are provided to the vms 104 to control the rotary - wing aircraft 100 . fig2 depicts a control system architecture in another exemplary embodiment . in the embodiment of fig2 , the control device communication system is implemented using a cellular network 30 . the rotary - wing aircraft 100 includes a cellular network modem 110 in communication with the vms 104 via a network connection ( e . g ., ethernet ). in this embodiment , bidirectional communication between control device 10 and rotary - wing aircraft 100 occurs over cellular network 30 . fig3 depicts a control system architecture in another exemplary embodiment . in the embodiment of fig3 , the control device communication system is implemented using a data link 40 coupled directly to the control device 10 via a wired network connection ( e . g ., ethernet ). the rotary - wing aircraft 100 includes a data link 102 in bidirectional communication with data link 40 . data link 102 is coupled to a vehicle management system ( vms ) 104 and to a sensor package 103 via a network connection ( e . g ., ethernet ). fig4 depicts a control system architecture in another exemplary embodiment . in the embodiment of fig4 , the control device communication system is implemented using a wireless communication element of the control device 10 directly . the communication element may use packet - based , single channel communications techniques , such as 802 . 11 standards , also referred to as wi - fi . the rotary - wing aircraft 100 includes wireless router 120 using the same communications standard as the control device 10 . wireless router 120 is in bidirectional communication with control device 10 . wireless router 120 is coupled to a vehicle management system ( vms ) 104 and to a sensor package 103 via a network connection ( e . g ., ethernet ). fig5 depicts a human - machine interface on a control device 10 in an exemplary embodiment in a receive aircraft mode of a first mode . the human - machine interface will include an available aircraft list 207 of those within range by selecting find aircraft icon 334 . the find aircraft icon 334 searches the area for local rotary - wing aircraft 100 and provides a selection of available aircraft to choose from ( e . g ., bluetooth pairing ). upon selection of a rotary - wing aircraft 100 from the aircraft list 207 , the selection will be highlighted 209 and then either confirmed 211 or canceled 206 via the human - machine interface command icons 204 . another method for aircraft acquisition is a push . in a push operation , an aircraft available notification appears when a rotary - winged aircraft 100 is within range or handoff from main operator of the aircraft is pushed to the control device 10 . the operator of the portable control device 10 would then confirm / accept the rotary - winged aircraft 100 to complete the push transaction . fig6 depicts a human - machine interface on a control device 10 in an exemplary embodiment in an access code mode of the first mode . in the first mode , the user of control device 10 is attempting to obtain access to aircraft control . control device 10 enters an access code mode . the human - machine interface includes a keyboard 333 for entering characters of the access password . the human - machine interface will include a text bar 335 that displays the password as entered via the keyboard 333 . after a rotary - wing aircraft 100 is chosen , and the password for the specific aircraft is entered , selection of the return icon or confirm 211 will send the password from the control device 10 to the rotary - winged aircraft 100 for verification . referring to fig6 , selection of cancel icon 206 cancels access of the rotary - wing aircraft 100 by control device 10 . acceptance by the rotary - winged aircraft 100 initiates second mode screen or if access denied , reverts back to find aircraft screen fig6 and provides incorrect password notification . as shown in fig6 , the command icons 204 also include the cancel icon 206 as well as the find aircraft icon 334 . fig7 and 7a depicts a human - machine interface on a control device 10 in an exemplary embodiment in a hover stationary mode . the mode depicted in fig7 is referred to as hover - stationary , meaning the rotary - wing aircraft 100 is hovering at a set location . the human - machine interface includes a status icon 200 indicating the current mode of control device 10 and rotary - wing aircraft 100 . status information 202 may be presented , and include flight status information such as altitude , speed , heading , etc . this flight status information is communicated to control device 10 from vms 104 . command icons 204 are also presented in the human - machine interface . upon selection of one of the command icons 204 , control device 10 issues commands to the rotary - wing aircraft 100 to execute an operation . command icons 204 in fig7 and 7a include a cancel icon 206 , selection of which cancels current action of the rotary - wing aircraft 100 by control device 10 . command icons 204 also include a hover manual icon 208 , selection of which places control device 10 and rotary - wing aircraft 100 into a mode for manually controlling the rotary - wing aircraft 100 . the command icons 204 also include an enroute icon 210 , selection of which causes the rotary - wing aircraft 100 to follow a preloaded flight plan , stored either in the vms 104 or in the control device 10 . the commands icons 204 also include a land icon 201 , selection of which causes the rotary - wing aircraft 100 to autonomously execute a landing at its current lat / long . command icons 204 may require a confirmation as described with reference to fig8 to proceed with the given commands . fig7 a shows additional command icons 204 and a slide feature to display hidden command icons . in all states , cancel 206 is a fixed icon and available at all times . the other three available icon spaces can be scrolled . in addition to land 201 , hover manual 208 , and enroute 210 , hover stationary provides video 203 and sensor 205 icons for additional functionality . the video 203 and sensor 205 icons obtain real - time streaming video or sensor data from the rotary - wing aircraft 100 to the control device 10 for situational awareness . the video 203 and sensor 205 modes are available in a number of modes , such as hover manual and ground , as described further herein . upon selection of land 201 , the control device 10 will ask for confirmation as shown in fig8 . the human machine interface will provide the option to confirm 211 or cancel 206 the last command . a confirm 211 will send the command to the rotary wing aircraft 100 for verification prior to execution . fig9 and 9a depict a human - machine interface on a control device 10 in an exemplary embodiment in the hover manual mode , entered upon selection of the hover manual icon 208 in fig7 . the command icons 204 are updated to reflect currently available operations . the hover manual mode is designated by status icon 200 . a number of flight control icons are presented . altitude control icons include an up icon 212 and down icon 214 to control height of the rotary - wing aircraft 100 . selection of the up icon 212 or down icon 214 may cause a change in altitude based on a number of feet per selection ( e . g ., 2 feet per click ) or continuous transition at a predetermined rate for as long as it is held ( with limits defined by the vms 104 ). position control icons include left icon 216 , right icon 218 , forward icon 220 and back icon 222 . selection of the position control icons causes a change in position based on a number of feet per selection ( e . g ., 2 foot per click ) or continuous transition at a predetermined rate for as long as it is held ( maintain travel as icon is held ). heading control icons include rotational icons including clockwise rotation icon 224 and counter - clockwise rotation icon 226 . selection of the rotational icons causes a change in heading , such as a number of degrees per selection or continuous yaw change at a predetermined rate . command icons 204 are updated once the control device 10 enters hover manual mode . as shown in fig9 and 9a , the command icons include cancel icon 206 , auto load icon 230 , lift load icon 232 , hover stationary icon 234 , video / sensor icons 203 / 205 . other icons may be added if needed . the command icons 204 are generated dependent upon whether the rotary - wing aircraft 100 currently has an auto load system attached , is secured to a load , or is not secured to a load . cancel 206 is always available . the other command icons 204 slide to show the commands that cannot fit in the default menu ( e . g ., three commands ) and are as a result hidden ( such as the video / sensor icons 203 / 205 ). the command icons in fig9 and 9a are presented when no load is detected by the vms 104 . fig9 and 9a depict a human - machine interface on a control device in an exemplary embodiment in a hover manual mode , in which a load is not attached to the rotary - wing aircraft 100 . in fig9 and 9a , selection of cancel icon 206 cancels control of the rotary - wing aircraft 100 by control device 10 and transitions the aircraft to hover stationary mode . selection of hover stationary icon 234 causes the control device 10 to enter hover stationary mode , with rotary - wing aircraft 100 hovering at a fixed position . the auto load icon 230 causes the vms 104 to execute a flight control process that automatically positions the rotary - wing aircraft 100 over a load . the load may be manually or automatically secured to rotary - wing aircraft 100 . once the load is secured , the lift load icon 232 can be selected to cause the rotary - wing aircraft 100 to lift the load to a predetermined height and hover . this entire process can be done autonomously via the selection of the auto load icon 230 ( i . e . autonomous load systems attached ). video / sensor icon 203 / 205 initiates a subcategory of the current third mode . video / sensor icons 203 / 205 will access data from a sensor / video devices 103 on the rotary - winged aircraft 100 and display it on the human - machine interface of the control device 10 . fig1 and 10a depict a human - machine interface on a control device in an exemplary embodiment , in hover manual mode in which a load is attached to the rotary - wing aircraft 100 . as noted above , the command icons 204 are updated to reflect currently available operations , based on flight information received from the vms 104 . the command icons 204 include cancel icon 206 , release load icon 240 , place load icon 242 and hover stationary icon 234 . selection of cancel icon 206 cancels control of the rotary - wing aircraft 100 by control device 10 . selection of hover stationary icon 234 causes the rotary - wing aircraft 100 to enter hover stationary mode , with rotary - wing aircraft 100 hovering at a fixed position . selection of the place load icon 242 causes the rotary - wing aircraft 100 to rest the load on the ground . selection of the release load icon 240 causes the rotary - wing aircraft 100 to lower the load to the ground at the current aircraft position and release the load from the rotary - wing aircraft 100 ( e . g ., release a sling attachment , open hook , open auto load device ) whereas place load 242 lowers the load to the ground at the current aircraft position , but does not release the load . video / sensor icons 203 / 205 will access video or sensor data from sensor / video devices on the rotary - winged aircraft 100 and display it on the human - machine interface of the control device 10 . fig1 depicts a human machine interface on a control device 10 in an exemplary embodiment in a ground mode . the command icons 204 displayed across the bottom of the human machine interface include cancel 206 , take off 213 , video 203 and sensor 205 . video 203 and sensor 205 commands activate an onboard video / sensor devices 103 on the rotary - wing aircraft 100 and transmit the data to the control device 10 where it is displayed for the operator . take off 213 will send a command to the aircraft to transition from ground mode to hover stationary . selection of cancel icon 206 cancels control of the rotary - wing aircraft 100 by control device 10 . upon selection of takeoff 213 , the control device 10 will ask for confirmation as shown in fig1 . the human machine interface will provide the option to confirm 211 or reject 206 the last command . a confirm 211 will send the takeoff command to the aircraft for verification by the vsm 104 prior to commanding the rotary - wing aircraft to transition from ground mode to hover stationary at a predetermined altitude . fig1 , 13 a and 13 b depict a human - machine interface on a control device 10 in an exemplary embodiment in the hover manual mode , entered upon the selection of the video icon 203 in fig9 a or 10 a . this embodiment uses the same method of control as the embodiment in fig9 and fig1 with the exception that there is a real time video underlay on the human - machine interface . fig1 , 14 a and 14 b depict a human - machine interface on a control device 10 in an exemplary embodiment in the hover manual mode . the command icons 204 remain the same as in the respective modes in fig9 a and fig1 a , however , position control in this embodiment is inputted into the control device 10 by clicking the desired location on screen 12 via the downward looking camera video underlay 236 . altitude and heading commands are inputted the same way as in fig9 and fig1 , using the up 212 and down 214 icons . fig1 depicts operational states of the rotary - wing aircraft 100 and control device 10 in exemplary embodiments . rotary - wing aircraft 100 may be manned or un - manned when control device 10 is issuing control commands to rotary - wing aircraft 100 . at 300 , control device 10 receives a list of available aircraft . this list may be pulled by control device 10 or pushed to control device 10 by local aircraft requesting control . at 302 , the control device 10 may query a user for an access code to ensure that only authorized users control the rotary - wing aircraft 100 . upon establishing communications between the control device 10 and the vms 104 to receive aircraft 300 and entering the appropriate access code 302 , the control device 10 is set to hover stationary mode 322 , ground stationary mode 408 , or enroute 304 ( which will automatically transfer to hover stationary at the completion of the current flight plan leg ) at 400 to reflect the actual mode of the rotary - wing aircraft 100 . from hover stationary 322 , the user can enter various modes , including enroute 304 , hover manual 306 , or ground mode 408 . enroute mode 304 causes the rotary - wing aircraft 100 to follow a preloaded flight plan , which is implemented by vms 104 . ground mode 408 causes the rotary - wing aircraft 100 to land and enter ground mode 408 . the hover manual mode 306 allows the user to control altitude , position and heading of the rotary - wing aircraft 100 using the icons described above . hover stationary 322 also allows user to display sensor / video data at 409 . hover manual mode 306 also includes two command sets , unloaded 308 and loaded 310 . in the unloaded mode 308 , the control device 10 may be used to auto - load 312 or lift load 314 . other unloaded mode operations include but are not limited to selecting a load 336 , centering over a load 338 and hooking the load 340 . in the loaded mode , the control device 10 may be used to place a load 318 , release a load 320 and return to hover stationary 322 . other loaded mode operations include , but are not limited to , auto release of a load 328 , release a sling 330 and dropping load at a point 332 . hover manual mode 306 also allows transition back to hover stationary 322 or entry of flight control commands at 316 . hover manual 306 allows a user to display sensor / video data 409 in video underlay mode 324 and allows entry of flight heading by selecting points on the video underlay in a point and go mode 326 , as described above with reference to fig1 . control device 10 is designed to provide a control device operator with fewer , dedicated commands that can be operated on a small , control device . additionally , the high level of autonomy on the rotary - wing aircraft enables a more simplistic human - machine interface , not currently used today on fielded systems . the control device 10 has applications for military , civilian and commercial applications . with the widespread use of smart devices ( e . g ., by military personnel ), embodiments offer the opportunity to utilize these smart devices to host control applications for rotary - wing aircraft in a myriad of applications . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . while the description of the present invention has been presented for purposes of illustration and description , it is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications , variations , alterations , substitutions , or equivalent arrangement not hereto described will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . additionally , while various embodiment of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims .	6
the present disclosure will now describe in detail embodiments of a surgical access port with reference to the drawings in which like reference numerals designate identical or substantially similar parts in each view . throughout the description , the term “ proximal ” will refer to the portion of the assembly closest to the operator , whereas the term “ distal ” will refer to the portion of the assembly farthest from the operator . although discussed in terms of an incision for a minimally invasive procedure , the presently disclosed surgical access port may be used in any naturally occurring orifice ( e . g . mouth , anus , or vagina ). referring initially to fig1 , a surgical access port 100 is shown . the surgical access port 100 includes a cylindrical member 110 having a generally hourglass shape , a proximal end 140 a and a distal end 140 b , and defining a longitudinal axis a 1 . the proximal end 140 a and the distal end 140 b are substantially perpendicular to the longitudinal axis a 1 and are each surrounded by an outer rim 150 a and 150 b , respectively . extending through the cylindrical member 110 along the longitudinal axis a 1 is at least one lumen 120 , and in embodiments , a plurality of lumens 120 . an example of an access port is disclosed in u . s . patent application publication no . 2010 / 0240960 a1 , the entire disclosure of which is incorporated by reference herein . also within the cylindrical member 110 , separate from the lumens 120 , is an internal inflation cavity 130 . the internal inflation cavity 130 may be symmetrical and centrally disposed as shown here , but in embodiments , may be of shape , plurality , and placement so as to maximize its effect on the surrounding lumens 120 . in embodiments , internal inflation cavity 130 may be of a generally “ x ” shape , with rounded edges . the internal inflation cavity 130 extends from some distance along the longitudinal axis a 1 from the proximal end 140 a of the cylindrical member 110 , and terminates at some distance along the longitudinal axis a 1 before the distal end 140 b of the cylindrical member 110 . coupled to the internal inflation cavity 130 is an inflation coupling 160 , which may be in the form of a tube or a port configured to be attached to the source of inflation fluid 170 . the inflation coupling 160 is coupled on its distal end to the internal inflation cavity 130 , and on its proximal end to a source of inflation fluid 170 . the internal inflation cavity 130 will be capable of retaining the inflation fluid . to this end , the internal inflation cavity 130 or the inflation coupling 160 may incorporate a structure to control the flow of inflation fluid to the internal inflation cavity . this structure may be a ball valve or other suitable flow control . additionally , the inflation coupling 160 may contain a structure to contribute to maintaining a substantially fluid - tight seal with the surgical access port 100 . such structure may be a press - fit member , bayonet - type , or threaded configuration . the source of inflation fluid 170 may be any source capable of supplying the inflation fluid to the internal inflation cavity 160 . such a capable source may be a syringe , pump , or reservoir . the source of inflation fluid 170 will supply inflation fluid that is biocompatible and suitable for surgical procedures , such as co 2 , air , or saline . in embodiments , a surgical access port 100 may also include a port for the communication of insufflation fluid to an internal body cavity 220 ( see fig4 ). alternatively , one of the lumens 120 may communicate the insufflation fluid to the internal body cavity 220 . turning to fig2 , the surgical access port 100 is shown in cross section along section line 2 - 2 . in this view , each of the lumens 120 can be seen disposed radially about the internal inflation cavity 130 . the lumens 120 are placed such that an expansion of the inflation cavity 130 will cause a shifting in the relative placement of the lumens 120 . such a shifting may allow greater dexterity and range in performing a surgical procedure with instruments 210 ( see fig3 ) disposed within the lumens 120 . when the inflation cavity 130 is not inflated , as shown here , a first state is defined . in a first state , the inflation cavity 130 has an internal pressure that is essentially equalized with that of the surrounding environment . a first state diameter d 1 is associated with the first state , measured transverse to the longitudinal axis a 1 . referring to fig3 , the surgical access port 100 is shown in top perspective view inserted into tissue 180 through an incision site 190 . the proximal end 140 a of the cylindrical member 110 can be seen extending through the surface of the tissue 180 . in this arrangement , surgical instruments 210 can be inserted into lumens 120 , and can be seen extending therethrough as shown in phantom view . also shown in phantom view is the internal inflation cavity 130 . extending through the top of the proximal end 140 a of cylindrical member 110 is inflation coupling 160 . thus , the surgical access port 100 in fig3 is shown in a first , unexpanded , state . turning to fig4 , a side view of the surgical access port of 100 is shown . in this view , the surgical instruments 210 can be seen extending completely through the lumens 120 ( shown in phantom view ). also shown is a relative spacing measurement x 1 , measured transverse to the longitudinal axis a 1 between the centers of lumens 120 , while the surgical access port 100 is in a first , unexpanded , state . in use , the operator of the surgical access port 100 will first place the surgical access port 100 in an incision site 190 such that the surgical access port is disposed within a layer of tissue 180 , as shown in fig3 . the operator of the surgical access port 100 will then couple the inflation coupling 160 to the source of inflation fluid 170 , allowing the internal inflation cavity 130 to expand when fluid is introduced to the internal inflation cavity 130 . the source of inflation fluid 170 supplies pressurized fluid to expand the internal inflation cavity 130 . this may be accomplished by pumps or reservoirs , or any other suitable pressure - generating apparatus . the operator of the surgical access port 100 will allow the internal inflation cavity 130 to expand such that the walls of the cylindrical member 110 expand to fill the space between the cylindrical member 110 and the walls of the incision site 190 , until a substantially fluid - tight seal is formed between the walls of the cylindrical member 110 and the walls of the incision site 190 . the surgical access port 100 is then ready for surgical instruments and tools 210 to be inserted therethrough for use in minimally invasive surgical procedures . referring now to fig5 , a cross - sectional view along the line 2 - 2 as shown in fig2 is shown , now with the surgical access port 100 in an expanded , second state . here , the second state diameter d 2 is shown , clearly different than first state diameter d 1 . it is also shown that internal inflation cavity 130 has expanded and cylindrical member 110 has expanded in response . turning to fig6 , the surgical access port 100 is in an expanded second state . the relative spacing measurement x 2 , measured transverse to the longitudinal axis between the centers of lumens 120 ( shown in phantom view ) is clearly different than the relative spacing measurement of the first state , x 1 . as a result , the lumens 120 enjoy greater relative spacing and greater freedom of movement . this greater spacing may also provide access to point in an internal body cavity 220 that may have been accessible by the surgical instruments 210 while the surgical access port 100 was in the first state . additionally , the forces exerted by the expanded surgical access port 100 may also serve to retract tissue outward from an incision site 190 . further , the compressible nature of the cylindrical member 110 may cause the lumens 120 to form a tighter seal about surgical instruments 210 disposed therethrough in the second state . in order to remove the device , the operator of the surgical access port 100 will uncouple the source of inflation fluid 170 from the inflation coupling 160 . surgical instruments and tools 210 will then be removed from the lumens 120 , and inflation fluid will be released from the internal inflation cavity 130 . this latter step may include opening a plug , seal , or other port in order to release pressurized inflation fluid . the surgical access port 100 will then transition from a second state to a first state , with a corresponding decrease in diameter , measured transverse to the longitudinal axis a 1 . the surgical access port can then be easily removed from an incision site 180 . referring to fig7 , a surgical access port 200 is shown in a first state , with four lumens 120 spaced evenly about the longitudinal axis a 1 , as well as four separate inflation cavities 230 , shown here evenly spaced about the longitudinal axis a 1 . separate internal inflation cavities 230 may function to maximize spacing between lumens 120 upon transition of the surgical access port 200 from a first state to a second state . it is additionally contemplated that the surgical access port may be coated with any number of medicating substances or materials to facilitate healing , or to make the use of the surgical access port during surgery more effective . it will be understood that various modifications may be made to the embodiments disclosed herein . therefore , the above description should not be construed as limiting , but merely as exemplifications of embodiments . those skilled in the art will envision other modifications within the scope and spirit of the present disclosure . what d	0
referring now to the drawings wherein like characters or like reference numerals represent like or similar parts , and in particular to fig1 there is disclosed an angle valve generally designated at 10 , the angle valve being particularly adapted for use with the present invention . however , the angle valve shown in fig1 discloses a coupling joint generally designated at 12 of the type used in the prior art . while the coupling joint of the present invention will be described in connection with an angle valve , such as the angle valve 10 , it will be understood by those skilled in the art that there are many other uses for the coupling joint other than in angle valves , and it may be used wherever it is necessary to couple together two telescoping members in a fluid distribution system or the like . the angle valve 10 includes a valve body member 14 having a tapered bore 16 through a portion thereof which communicates with a transverse bore 18 in a leg 20 . the tapered bore is arranged to receive a tapered valve element or key 22 through its larger end , the tapered valve body being retained in the bore 16 by retaining and valve operating means generally designated at 24 . a passageway 26 is provided through the tapered valve body 22 , the passageway being selectively in communication with the inlet and outlet of the valve body when the valve retaining and operating means 24 is actuated . in order to provide for smooth flow through the valve element from a tube or pipe connected thereto , a tubular bushing 28 has been provided in the end portion of the valve body , the end portion being hereinafter referred to as the first tubular member and identified by the numeral 30 . in this respect , the bushing 28 will be referred to in the specification hereinafter as the second tubular member which is arranged to telescope within the first tubular member 30 and to provide a flow passage conforming to the inside diameter of a pipe p connected to the valve and to the inside diameter of the flow passage 28 so as to avoid abrupt changes in the direction of flow of fluid into the valve element or key 22 , thereby reducing turbulence within the valve . as heretofore mentioned in the introductory portion of the specification , the second tubular member 28 could be held in position within the first tubular member by a press fit such as shown in the aforementioned ford u . s . pat . no . 2 , 993 , 677 . also , the second tubular member has in the past been retained in the first tubular member by the arrangement shown in fig1 to 3 , inclusive . in this arrangment , the second tubular member 28 is initially formed as shown in fig2 with a slight inward taper terminating at one end in a circumferential flange or shoulder 32 having an outside diameter slightly less than the inside diameter of the first tubular member 30 . the second tubular member 28 was provided at its other end with an enlarged annular shoulder 34 of a diameter greater than the inside diameter of the first tubular member 30 . the bore of the first tubular member 30 was provided with an internal annular groove 36 , the groove 36 being arranged to receive the flange or shoulder 32 when the bushing or second tubular member 28 was inserted into the first tubular member 30 and after insertion , its tubular body portion 29 had been expanded radially outwardly . the groove 36 had to have a sufficient axial dimension to accommodate manufacturing tolerances , and when the second tubular member 28 was positioned in the first tubular member 30 with its flange 32 in the groove 36 , the second tubular member was rather loosely retained in the first tubular member . threads 38 were provided on the exterior of the first tubular member 30 for receiving a tubular coupling nut 40 which was arranged to retain the flared end 42 of a tube or pipe p . when the coupling nut 40 was installed , a metal - to - metal seal resulted at 44 , but this could only be used when the pipe p was metal , otherwise the torques necessary for the nut to obtain the metal - to - metal seal would be too high to use plastic tubing having a flared end as the flared end would be damaged or weakened by too much extrusion . if the tubing p is plastic , a sealing ring 46 was provided between the enlarged annular shoulder 34 and the end of the first tubular member 30 , as shown in fig3 . the arrangement of retaining the bushing or second tubular member 28 in the first tubular member 30 encountered the same problems as encountered in the arrangement disclosed in the aforementioned ford u . s . pat . no . 2 , 993 , 677 in that once the second tubular member had either been press fit into place or expanded into place , it could not be removed for servicing of the valve or replacement with a second tubular member of a different interior design . additionally , in the situation where the second tubular member 28 was loosely held in the first tubular member , dirt and debris could work between the two tubular members and possibly affect operation of the valve . referring now to fig4 to 6 , inclusive , the coupling joint 50 of the present invention is disclosed , and it includes a first tubular member 52 which could form a portion of a valve body such as the valve body 14 and a second tubular member 54 which functions the same as the bushing or second tubular member 28 previously described . additionally , the coupling joint 50 includes means generally designated at 56 for releasably connecting the telescoping coupling members 52 and 54 together , the means 56 also functioning as a secondary seal between the first and second tubular members 52 and 54 , respectively . an annular seal generally designated at 58 is provided between the first or outer tubular member 52 and the portion of the second or inner telescoping tubular member 54 which extends out of the first member , the seal 58 being a metal - to - metal seal as shown in fig4 or , if desired , a resilient ring seal 58 &# 39 ; such as an o - ring as shown in fig5 . the first tubular member is externally threaded as indicated at 60 for receiving the coupling nut 62 which clamps a flared end 64 of the pipe p between it and an annular enlargement or shoulder 66 on the portion of the second tubular member extending out of the first tubular member . as better shown in fig5 and 6 , the means 56 for releasably connecting the first tubular member 52 and the second tubular member 54 is so designed as to continuously urge the second tubular member 54 in an inward direction to cause its annular enlargement or shoulder 66 to abut with and stay abutted against the end of the first tubular member 50 . in this respect , the bushing or second tubular member 54 is provided on its exterior portion with an annular groove 68 rectangular in axial cross - section and defined by a first radial wall 69 separated from a second radial wall 71 by bottom wall 73 . additionally , the interior surface of the first tubular member 52 is provided with an annular groove 70 which is defined by a diverging wall 72 , a bottom wall 74 and a radially extending wall 76 . the grooves 68 and 70 oppose one another when the second tubular member is properly inserted into the first tubular member as shown in fig5 and 6 . a resilient ring 80 , preferably an o - ring , is carried or retained in the rectangular shaped groove 68 of the second tubular member 54 during assembly or disassembly of the tubular members 52 and 54 . the axial length of the groove 68 is greater than the diameter of the o - ring to permit the o - ring to be compressed upon insertion of the second tubular member 54 into the first tubular member 52 , but when the two grooves 68 and 70 are opposed to one another the cumulative radial dimension anywhere along an axis of the grooves is small enough to still exert compressive forces onto o - ring 80 . as shown in fig6 when the second tubular member 54 is properly telescoped within the first tubular member 52 , triplanar forces are created on the o - ring at the approximate positions indicated by the arrows by engagement of the o - ring with the diverging wall 72 of the first tubular member 52 , the radial wall 69 of the groove 68 in the second tubular member as well as engagement with the bottom wall 73 of groove 68 . since the wall 72 is diverging , a resultant force r is created by the resilient o - ring seeking to expand , and this resultant force urges the second tubular member 54 inwardly of the first tubular member 52 until such time either a metal - to - metal seal is made at 58 or a seal is made by the o - ring 58 &# 39 ; between the annular enlargement 66 and the end of the first tubular member 52 . this arrangement results in the bushing or second tubular member 54 being tightly held in the first tubular member once assembled and , thus , no debris or dirt can enter between the seal 58 and the o - ring 80 . however , since the diverging surface or wall 72 of the groove 70 is facing inwardly of the joint , the tubular member 54 may be removed axially from the tubular member 52 as the wall 72 cams the o - ring 80 into compression solely within the groove 68 . the coupling joint of the present invention has utility , particularly in fluid distribution systems , as the bushing or second tubular member 54 may be removed and replaced , or it may be removed to permit servicing of a valve if the coupling joint is used in such an environment . it has been found that the angle for the diverging wall 72 should be an acute angle in a range of 4 ° to 45 °, and preferably no more than 36 °, to permit ease of disassembly and yet still retain the camming action of the diverging surface in holding the two tubular members tightly together . a preferred acute angle for the wall 72 which provides good sealing and ease of disassembly for a joint having standard manufacturing tolerances is in the order of 18 °. as shown in fig4 to 6 , inclusive , the diverging wall 72 of the first tubular member is frusto - conical . however , in fig7 a modification is shown where the diverging wall 72 &# 39 ; of the groove 70 &# 39 ; of the first tubular member 52 &# 39 ; includes a first frusto - conical wall portion 82 extending at a predetermined acute angle to the common axis of the first and second tubular members 52 &# 39 ; and 54 &# 39 ;, the wall portion 82 being contiguous with a second frusto - conical wall portion 84 extending at a greater acute angle to the common axis of the tubular members . again , in the modification shown in fig7 the diverging wall 72 &# 39 ; made up by the wall portions 82 and 84 faces inwardly to permit the second tubular member 54 &# 39 ; to be removed from the first tubular member 52 &# 39 ; and yet still provide resultant forces on the tubular members which urge the tubular members in such a way that the second tubular member tends to move inwardly of the first tubular member . fig8 shows another modification wherein the diverging wall portion 72 &# 34 ; of the groove 70 &# 34 ; of the first tubular portion 52 &# 34 ; is convexly curved and is facing inwardly of the coupling joint . again , triplanar forces are exerted on the o - ring 80 when positioned in the opposed grooves with a resultant force tending to move the second tubular member inwardly of the first tubular member . fig9 dislcoses a still further modification of the present invention in that in this modification the joint is provided with the o - ring retaining groove 68 &# 34 ;&# 39 ; in the first tubular member 52 &# 34 ;&# 39 ;, this being the groove which is rectangular in axial cross - section . it is still desired for the o - ring to exert resultant forces on the tubular members 52 &# 34 ;&# 39 ; and 54 &# 34 ;&# 39 ; so that the member 54 &# 34 ;&# 39 ; is urged inwardly of the member 52 &# 34 ;&# 39 ; and , consequently , the groove 70 &# 34 ;&# 39 ; found in this modification on the second tubular member 54 &# 34 ;&# 39 ; has the diverging wall 72 &# 34 ;&# 39 ;, but it will be noted that it faces outwardly of the coupling joint so as to permit the members to be disassembled . in the arrangement shown in fig9 the o - ring 80 is retained in the first tubular member 52 &# 34 ;&# 39 ; during both assembly and disassembly of the tubular members . also , it should be noted at this time , the arrangements shown in fig7 or 8 can be modified similar to fig9 so long as the diverging wall or camming surface is facing in the proper direction . while the bushing or tubular member 54 and the modifications of the same are preferably made of a metal , such as brass or steel , they may also in the environment of the present invention be molded from a hard plastic material such as teflon . a plastic material could not be satisfactorily used in situations such as found in the prior art and described with respect to fig1 to 3 , or with respect to the ford u . s . pat . no . 2 , 993 , 677 wherein the bushing was either expanded or press fitted into the outer or first tubular member . the terminology used in this specification is for the purpose of description and not limitation , the scope of the invention being defined by the claims .	8
the rigid multi - cone kite 11 , as shown from below in fig1 and from above , front and rear , in fig2 and 3 , hereinafter referred to as the cone kite , is made of a lightweight but rigid substance , such as , for example , polystyrene foam plastic . as shown in fig4 and 5 , the entire kite 11 is made up of the three sections 12 , 13 and 14 , which in the present example , are of die - stamped polystyrene foam , 1 . 5 millimeters or less in thickness . the width 22 of each section of this embodiment measures 10 . 5 centimeters , and the length 23 measures 30 centimeters , and consists of six frustoconical protrusions arranged in rows of two cones down the length of the section . referring to fig6 and 7 , which show individual cones 17 in plan view and side section , each cone measures 5 centimeters in diameter 31 across the base and rises 4 centimeters from the upper face of the section to a height 30 , forming a slightly flattened apex two centimeters , in diameter . the centers of the adjacent cones 17 are about 5 . 5 centimeters apart . as shown in fig4 and 5 , the three sections 12 , 13 and 14 of the kite 11 are joined by a bonding strip of quick - bonding cyanoacrylate glue about 30 centimeters long and about 2 centimeters wide , and of minimal thickness , so that each of the long sides of each section base is connected along junctions 20 and 21 . when the sections 12 and 14 are bent inwardly toward center section 13 , cones adjacent to junctions 20 and 21 touch at points 26 . because the sections 12 , 13 and 14 are in such proximity , glue is applied where the bases of the sections touch along junctions 20 and 21 , as well as at points 26 where the cones touch . in accordance with a preferred embodiment , as shown in fig5 the cone kite 11 , when joined in the above manner , has a bowed appearance so that when resting on the underside , the lateral sections 12 and 14 each form an external angle of about 30 degrees 27 , with the bases of the central section 13 . the dimensions of the kite , after bowing by having lateral sections 12 and 14 bent inwardly , are 28 centimeters in width 24 , and 30 centimeters in length 23 . as shown in fig4 and 5 , attached along the outer opposite edges and running the length of each lateral section 12 and 14 , is a pair of die - stamped flanges 15 and 16 , each 25 centimeters long . each flange is folded at the intersection with the edges of lateral sides 12 and 14 to form a die - stamped hinge 38 , thus forming , in each case , a variable external angle with the principal plane of the section . as shown in fig4 each flange 15 and 16 has two perforations 19a , 19b , and 19c and 19d , one pair of perforations 19a and 19b being one centimeter from the front end 28 , and one centimeter from the long edge , and another pair 19c and 19d being 20 centimeters from the front end 28 and one centimeter from the long edge . the perforations 19a , 19b , 19c and 19d can be die - stamped or cut out by hand . each perforation may be reinforced with a quick - bonding glue around its edges . as shown in fig5 as a means of reinforcing the bow of the kite 11 , a string 25 is glued across the tops and down the sides of the corner cones 17 . these strings which may , for example , be any type of conventional cotton cord , should be sufficiently taut as to maintain the natural bow of the kite 11 . as shown in the overall view of fig4 and the detailed view in fig6 when viewed from the top or cone surface , the lower one - third of each cone 17 is seen to have a cut - away portion 18 so as to allow air to pass through . as shown in fig4 the interstices 37 of adjacent cones 17 are diamond - shaped . as shown in fig5 , and 7 , a pinched projection 34 which may be elliptical in outline , extending slightly above the lower edge of cutout 18 in height , is created on the bottom side of the surface between each of the cones 17 where the cones touch . these rounded pinched projections function aerodynamically . referring to fig7 the lower edge 36 of the cutout area 18 , which in a preferred embodiment , is 5 centimeters across 31 , and comprises an arc of about 108 degrees , is located about 0 . 8 centimeters above and parallel to the base of the cone 17 . referring also to fig6 the lower edge 36 of cutout 18 is bounded on each side by a slightly curved side edge 18 , 18a , 18b which , at its upper end intersects the edge of the apex area 33 , the length 32 , of which is 1 . 8 centimeters . the cutouts or air vents 18 can also be formed during the stamping process or cut out later by hand . referring again to fig1 two bridle strings 39a , 39b are attached to the flanges 15 and 16 through the four perforations 19a , 19b , 19c and 19d . quick - bonding glue around the edges of the four perforations 19a , 19b , 19c and 19d prevents the bridle strings 39a , 39b from cutting through the polystyrene foam . in accordance with a preferred embodiment , the bridles 39a , 39b may be of conventional cotton kite string and are attached to the underside of the kite 11 through the holes 19a , 19b , 19c and 19d in the flanges 15 and 16 . one bridle 39a is 42 . 5 centimeters long and is secured to the two front holes 19a , 19b , and another is 45 centimeters long and is attached to the two back holes 19c , 19d . a tether 40 is tied to both strings 39a and 39b so that it can be adjusted by sliding from side - to - side for centering . the kite should have a tether 40 long enough to enable optimum lift by the wind currents . in the present embodiment , the tether is preferably about 12 meters in length , and is made of material strong enough , such as , conventional twine or kite string , to enable the kite to be returned to the ground when its use is completed . two tails 41a , 41b of equal length are attached to the back corners 29 and 35 of the kite for stability . a suggested length is 60 centimeters or more as needed . the kite of the present invention can be die - stamped in three sections 12 , 13 and 14 which are later joined ; or alternatively , it can be stamped as one unit 11 whose sections need to be bent to the proper angles 27 . the dimensions of the kite can be increased by increasing the number of cones 17 on each section 12 , 13 and 14 . increased dimensions may necessitate an increase in the thickness of the polystyrene material . a particular advantage of the kite of the present invention is that it is aerodynamically suited to provide greater lift than kites of the prior art , having significantly more stability of structure through the use of conical air pockets and polystyrene plastic . the kite of the present invention is best operated in an outside area with few trees , and should be flown in fair weather when there are moderately strong winds . it is contemplated that the kite of the present invention will also be flown with the base of the frustoconical members and the bridle strings and tether facing the ground . although by way of illustration the present invention has been described with reference to a particular embodiment , it will be understood that the invention is not limited to the specific structures or dimensions disclosed , but only by the scope of the appended claims .	0
referring now to fig1 , there is illustrated a block diagram of an exemplary audio decoder 100 in accordance with an embodiment of the present invention . the audio decoder comprises a controller 105 for receiving the audio data and providing parameters , and a computation engine 110 for calculating at least one of a number of predetermined functions for the parameters . the audio decoder 100 receives encoded audio data at the controller 105 . to decode the audio data , a number of mathematical or logic functions are performed on portions of the audio data . the process of encoding audio data can include application of mathematical or logic functions . these functions can include , for example , the inverse modified discrete cosine transformation ( imdct ), or the inverse fast fourier transformation ( ifft ), to name a couple . accordingly , the encoded audio data includes the results of the foregoing functions . inverse functions are applied to decode the audio data . the inverse functions can be computationally intense . accordingly , controller 105 provides the portions of the encoded audio data , parameters upon which the inverse functions ( which are also functions ) are to be applied . the computation engine 110 applies the functions to the parameters . referring now to fig2 , there is illustrated a block diagram of an exemplary audio encoder 200 in accordance with an embodiment of the present invention . the audio encoder comprises a controller 205 for receiving the audio data and providing parameters , and a computation engine 210 for calculating at least one of a number of predetermined functions for the parameters . the audio encoder 200 receives audio data . the process of encoding audio data can include application of mathematical or logic functions . these functions can include , for example , the modified discrete cosine transformation , or the fast fourier transformation , to name a couple . the functions can be computationally intense . accordingly , controller 205 provides the portions of the audio data , parameters upon which the functions are to be applied . the computation engine 210 applies the functions to the parameters . aspects of the present invention can be used with a variety of audio encoding standards . by way of example , embodiments of the present invention will now be described in the context of the mpeg - 1 , part 3 standard . discussion will now turn to a brief description of the mpeg - 1 , part 3 standard , followed by exemplary embodiments of the present invention in the context of the mpeg - 1 , part 3 standard . fig3 illustrates a block diagram describing the encoding of an audio signal 301 , in accordance with the mpeg - 1 , layer 3 standard , mpeg - 4 aac or dolby digital ac - 3 decoder . the audio signal 301 is captured and used for further audio post processing depending upon the speed . the samples of the audio signal 301 are then grouped into frames 303 ( f 0 . . . f n ) of 1024 samples such as , for example , ( f x ( 0 ) . . . f x ( 1023 )) the frames 303 ( f 0 . . . f n ) are then grouped into windows 305 ( w 0 . . . w n ) each one of which comprises 2048 samples or two frames such as , for example , ( w x ( 0 ) . . . w x ( 2047 )) comprising frames ( f x ( 0 ) . . . f x ( 1023 )) and ( f x + 1 ( 0 ) . . . f x + 1 ( 1023 )). however , each window 305 w x has a 50 % overlap with the previous window 305 w x − 1 . accordingly , the first 1024 samples of a window 305 w x are the same as the last 1024 samples of the previous window 105 w x − 1 . for example , w 0 =( w 0 ( 0 ) . . . w 0 ( 2047 ))=( f 0 ( 0 ) . . . f 0 ( 1023 )) and ( f 1 ( 0 ) . . . f 1 ( 1023 )), and w 1 =( w 1 ( 0 ) . . . w 1 ( 2047 ))=( f 1 ( 0 ) . . . f 1 ( 1023 )) and ( f 2 ( 0 ) . . . f 2 ( 1023 )). hence , in the example , w 0 and w 1 contain frames ( f 1 ( 0 ) . . . f 1 ( 1023 )). a window function w ( t ) is then applied to each window 305 ( w 0 . . . w n ), resulting in sets ( ww 0 . . . ww n ) of 2048 windowed samples 307 such as , for example , ( ww x ( 0 ) . . . ww x ( 2047 )). a modified discrete cosine or fourier transform ( mdct / ft ) is then applied to each set ( ww 0 . . . ww n ) of windowed samples 307 ( ww x ( 0 ) . . . ww x ( 2047 )), resulting sets ( mdct 0 . . . mdct n ) of 1024 frequency coefficients 309 such as , for example , ( mdct x ( 0 ) . . . mdct x ( 1023 )). the sets of frequency coefficients 309 ( mdct 0 . . . mdct n ) are then quantized and coded for transmission , forming an audio elementary stream ( aes ). the aes can be multiplexed with other aess . the multiplexed signal , known as the audio transport stream ( audio ts ) can then be stored and / or transported for playback on a playback device . the playback device can either be at a local or remote located from the encoder . where the playback device is remotely located , the multiplexed signal is transported over a communication medium such as , for example , the internet . the multiplexed signal can also be transported to a remote playback device using a storage medium such as , for example , a compact disk . during playback , the audio ts is de - multiplexed , resulting in the constituent aes signals . the constituent aes signals are then decoded , yielding the audio signal . during playback the speed of the signal may be decreased to produce the original audio at a slower speed . fig4 is a block diagram describing the decoding of an encoded audio signal . the encoded audio signal comprises sets ( mdct 0 . . . mdct n ) of 1024 frequency coefficients 409 . an inverse modified discrete cosine transform ( imdct ) is applied to each set ( mdct 0 . . . mdct n ) of 1024 frequency coefficients 409 . the result of applying the imdct is the sets ( ww 0 . . . ww n ) of windowed samples 407 ( ww x ( 0 ) . . . ww x ( 2047 ) equivalent to sets ( ww 0 . . . ww n ) of windowed samples 407 ( ww x ( 0 ) . . . ww x ( 2047 )) of fig3 . an inverse window function w i ( t ) is then applied to each set ( ww 0 . . . ww n ) of 2048 windowed samples 407 , resulting in windows 405 ( w 0 . . . w n ) each one of which comprises 2048 samples . each window 405 ( w 0 . . . w n ) comprises 2048 samples from two frames such as , for example , ( w x ( 0 ) . . . w x ( 2047 )) comprising frames ( f x ( 0 ) . . . f x ( 1023 )) and ( f x + 1 ( 0 ) . . . f x + 1 ( 1023 )) as illustrated in fig3 . the frames 403 ( f 0 . . . f n ) of 1024 samples such as , for example , ( f x ( 0 ) . . . f x ( 1023 )), are then extracted from the windows 405 ( w 0 . . . w n ). a window function wf is then applied to frames 402 ( fr 0 . . . fr m ) to “ smooth out ” the samples and ensure that the resulting signal does not have any artifacts that may result from repeating each frame . the window function results in the windowed frames 404 ( wf 0 . . . wf l ) of 1024 samples . the window function wf can be one of many widely known and used window functions , or can be designed to accommodate the design requirements of the system . the windowed frames 404 ( wf 0 . . . wf l ) of 1024 samples are then run through a digital - to - analog converter ( dac ) to get an analog signal 401 . referring now to fig5 , there is illustrated a block diagram describing an exemplary audio encoder 500 in accordance with an embodiment of the present invention . the audio encoder 500 will be described with reference to fig3 . the audio encoder 500 comprises a controller 505 , a computation engine 510 , and memory 515 . the controller 505 is adapted to receive the audio data 301 . the audio data 301 comprises samples from an analog signal . as noted above , pursuant to the mpeg - 1 , part 3 standard , a wide variety of mathematical and logical functions are performed on the audio data 301 to encode the audio data 301 . these functions can include application of a windowing function , the modified discrete cosine transformation , or the fast fourier transformation . the computation engine 510 connected to the controller , calculates the appropriate one of the functions on the audio data 301 . the computation engine 510 can be a hardware accelerator that is specifically designed for performing the calculations of the mathematical or logical function . according to certain aspects of the present invention , the controller 505 can provide inputs to the computation engine 510 that select the particular function to be performed . in certain embodiments , a memory 515 connected to the controller can store the audio data 201 . the controller 505 can provide pointers to addresses in the memory 515 storing the audio data 301 upon which a particular function is to be performed . additionally , the computation engine 510 can write the results functions to the memory 515 . referring now to fig6 , there is illustrated a block diagram describing an exemplary audio decoder 600 in accordance with an embodiment of the present invention . the audio decoder 600 will be described with reference to fig4 . the audio decoder 600 comprises a controller 605 , a computation engine 610 , and memory 615 . the controller 605 receives encoded audio data . the encoded audio data comprises sets ( mdct 0 . . . mdct n ) of 1024 frequency coefficients 409 . the controller 605 can provide the frequency coefficients 409 , as parameters , for application of the inverse modified cosine transformation or inverse fast fourier transformation . the computation engine 610 connected to the controller , calculates the appropriate one of the functions on the parameters . the computation engine 610 can be a hardware accelerator that is specifically designed for performing the calculations of the mathematical or logical function . according to certain aspects of the present invention , the controller 605 can provide inputs to the computation engine 610 that select the particular function to be performed . in certain embodiments , a memory 615 connected to the controller can store the frequency coefficients 409 . the controller 605 can provide pointers to addresses in the memory 615 storing the frequency coefficients 409 upon which a particular function is to be performed . additionally , the computation engine 610 can write the results functions to the memory 615 . in certain embodiments of the present invention , the controller 605 and computation engine 610 can work in parallel . the controller 605 can be preparing the next set of data for the computation engine 610 , while computation engine 610 is busy in decoding the current data . with the foregoing parallelism , decoder speed can be increased . additionally , the foregoing aids the decoding of different standard streams , if scheduling is done on a frame by frame basis . additionally , in certain embodiments of the present invention , two different audio formats are simultaneous as the computation engines work in parallel . the controller can operate on audio data in a first format , while the controller can operate on audio data in a second format . the degree of integration of the system will primarily be determined by the speed and cost considerations . because of the sophisticated nature of modern processor , it is possible to utilize a commercially available processor , which may be implemented external to an asic implementation . if the processor is available as an asic core or logic block , then the commercially available processor can be implemented as part of an asic device wherein certain functions can be implemented in firmware . in one embodiment , the foregoing can be integrated into an integrated circuit . additionally , the functions can be implemented as hardware accelerator units controlled by the processor . while the invention has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention . in addition , many modifications may be made to adapt particular situation or material to the teachings of the invention without departing from its scope . therefore , it is intended that the invention not be limited to the particular embodiment ( s ) disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .	6
a preferred embodiment of the self - catheterization aid 10 manufactured in accordance with the present invention is depicted in fig1 . the self - catheterization aid 10 comprises a semi - annular arcuate strip 12 . the strip 12 is flexible , and it lies generally flat when not flexed in use . it is preferably made of a material such as fabric - backed foam rubber . standard foam rubber without the fabric - backing would also suffice . in any event , closed cell foam rubber is preferred since it would not absorb moisture and is comfortable to the patient . any other flexible or semi - rigid materials would suffice as a material for strip 12 . strip 12 is formed in a one piece semi - annular arcuate shape that includes a concave inner edge 14 , a convex outer edge 16 , and two laterally spaced apart opposite generally pointed ends 18 and 20 . both inner edge 14 and outer edge 16 are rounded between the broad inner and outer surfaces of the strip so the device is more comfortable for the user . ends 18 and 20 have fastening strips 22 and 24 attached thereto . fastening strips 22 and 24 are preferably velcro ®. in that case fastening strip 22 would be the 37 eye &# 34 ; portion of the velcro ®, and fastening strip 24 would be the &# 34 ; hook &# 34 ; portion of the velcro ®. other fastening systems such as a standard snap type device would suffice , but velcro ® is preferred because it is very easy for a patient having impaired hand and finger movement to fasten and unfasten . velcro ®- type fasteners also provide infinite adjustability . fastening strip 22 ( the eye portion ) is attached to the upper side 28 of strip 12 on end 18 . fastening strip 24 ( the hook portion ) is attached to the lower side 30 of strip 12 on end 20 . both fastening strips 22 and 24 are attached to strip 12 by stitching the fastening strip to the foam rubber . other conventional means of attachment , such as glue , would suffice . strip 12 also includes a handle 26 to provided the user a convenient and easily accessible handhold . handle 26 is preferably a flexible cloth material , such as a 3 / 8 inch wide nylon strap , formed into a loop and stitched into the upper side 28 of strip 12 . other flexible strapping material or handle type devices would suffice . in use , ends 18 and 20 are coupled together by joining them together and fastening them with fastening strips 22 and 24 . as noted , fastening strip 22 is attached to the upper side 28 of strip 12 on end 18 . fastening strip 24 is attached to the lower side 30 of strip 12 on end 20 . thus , to fasten the two ends 18 and 20 together , end 20 is laid over end 18 such that the fastening strips 22 and 24 overlap each other . when the fastening strips are in this position the ends 18 and 20 are pressed together to fasten the velcro ®. the self - catheterization aid 10 generally describes a hollow frustum when ends 18 and 20 are fastened ( fig3 and 4 ). when ends 18 and 20 are fastened together an opening 36 is formed at the apex end 32 of the frustum , and a relatively larger opening 37 is formed at the base end 34 of the frustum . a central passageway 39 , which is generally frusto - conical in shape , larger at the base and relatively smaller at the apex , runs through the length of the frustum . varying the distance that end 20 overlaps end 18 varies the diameter of the openings 36 and 37 . the diameter of openings 36 and 37 can be increased by decreasing the distance that end 20 overlaps end 18 . similarly , the diameter of openings 36 and 37 may be decreased by increasing the distance that end 20 overlaps end 18 . when a velcro ®- type fastening system is utilized the amount of overlap of fastening strips 22 and 24 is infinitely adjustable within the lengths of the respective strips . use of the self - catheterization aid 10 is depicted schematically in fig5 . without the aid of the present invention it would be extremely difficult or impossible for a patient having impaired hand and finger movement to insert an internal catheter into the urethra because the penis 36 is unsupported and flexible . however , as seen in fig5 the self - catheterization device 10 , when applied to the penis 36 such that it forms a frusto - conical circumferential support platform for the penis , enables the patient perform self - catheterization by inserting an internal catheter into the urethra . the device stabilizes the patient &# 39 ; s penis so that self - catheterization is a relatively easy procedure , even for patient &# 39 ; s with severely impaired hand and finger movement . to apply the self - catheterization aid 10 of the present invention to the penis 36 , the patient places the open , uncoupled device ( fig1 ) under the penis 36 such that the ends 18 and 20 are directed away from the patient &# 39 ; s body . thus , the outer convex edge 16 rests against the patient &# 39 ; s groin area below the penis 36 . the patient grasps handle 26 in one hand and end 18 in the other , and draws the ends together over and around the penis . ends 18 and 20 are drawn together until the self - catheterization aid 10 completely encircles the penis , at which time end 20 is pressed onto end 18 to couple fastening strips 22 and 24 . when ends 18 and 20 are fastened together , base end 34 of the device rests against the patient &# 39 ; s abdomen and groin area around the base 38 of the penis 36 . the fastened device therefore forms a frusto - conically shaped tubular support platform that completely encircles the patient &# 39 ; s penis . the glans 40 of the patient &# 39 ; s penis 36 extends through opening 36 at the apex end 32 of the assembled self - catheterization aid 10 to provide the patient easy access to his urethra . the size of opening 36 is adjusted by the patient so that it is substantially the same diameter as the patient &# 39 ; s penis 36 , and thus supports and engages the penis . the shaft 42 of the patient &# 39 ; s penis 36 extends through central passageway 39 , and the glans 40 is held generally external to the apex end 32 of the assembled device . because base end 34 has a larger opening 37 than the opening 36 at apex end 32 , and because base end 34 rests against the patient &# 39 ; s abdomen and groin area around the base 38 of the penis 36 , the patient &# 39 ; s penis is supported and stabilized to limit movement in any direction . this greatly facilitates self - catheterization . once applied to the patient as seen in fig5 the patient may insert an internal catheter into his urethra and bladder to evacuate urine from his bladder . the self - catheterization aid 10 of the present invention may be used equally well with intermittent internal catheters , and indwelling catheters . when an intermittent internal catheter is used , the catheter is removed from the urethra once bladder drainage is complete , and the self - catheterization aid 10 is unfastened and removed from the patient &# 39 ; s penis 36 . it has been found that the self - catheterization aid 10 of the present invention may also be used to facilitate self - application of a condom catheter . an alternative embodiment of the self - catheterization aid 10 of the present invention is depicted in fig6 . in this embodiment the strip 42 comprises a substantially rectangular strip having opposite ends 44 and 46 . as with the preferred embodiment , the embodiment depicted in fig6 is preferably made of a flexible material such as fabric - backed foam rubber . strip 42 lies flat when not flexed in use . the &# 34 ; eye &# 34 ; portion 48 of the velcro ® fastening strip is attached to top side 52 of strip 42 at end 44 . the &# 34 ; hook &# 34 ; portion 50 of the velcro ® fastening strip is attached to the bottom side 54 of strip 42 at end 46 . a loop of fabric as a handle 56 is stitched to the top side 52 of strip 42 at end 46 . when ends 44 and 46 are fastened together ( fig7 ), the device forms a cylinder having a base end 58 and a distal end 60 . the cylinder has a first opening 62 at base end 58 , a second opening 64 at distal end 60 , and a central passageway 66 therebetween . as with the preferred embodiment , the diameter of first opening 62 and second opening 64 , and also central passageway 66 are adjustable and may be increased or decreased by varying the amount of overlap of end 46 on end 44 . in use , the diameter of the cylinder is adjusted by the user to coincide substantially with the diameter of the penis 36 . thus , in use the assembled device forms a cylindrical tube for supporting the patient &# 39 ; s penis . application of the embodiment shown in fig6 and 7 is similar to that described above for the preferred embodiment . the patient places the open strip ( fig6 ) beneath the underside of the penis such that the long - axis of the rectangular strip is generally perpendicular to the longitudinal axis of the patient &# 39 ; s penis . the device is wrapped around the penis by grasping the handle 56 in one hand and end 44 in the other , then drawing the two ends 44 and 46 over and around the penis . the ends are then fastened together by overlapping the two parts of the velcro ® fastening strip and pressing them together . while the present invention has been described in accordance with preferred embodiments , it is to be understood that certain substitutions and alterations may be made thereto without departing from the spirit and scope of the appended claims .	0
described herein is a method for accommodating high priority calls on a congested communication link of a wide area or other communication network . in the following discussion , examples of specific embodiments of the present invention are set forth in order to provide the reader with a through understanding of the present invention . however , many of the details described below can be accomplished using equivalent methods or apparatus to those presented herein . accordingly , the broader spirit and scope of the present invention is set forth in the claims that follow this detailed description and it is that broader spirit and scope ( and not merely the specific examples set forth below ) that should be recognized as defining the boundaries the present invention . the basic mechanism adopted in the present invention is easily understood with reference to fig2 . process 200 describes a bandwidth renegotiation scheme for accommodating high priority calls over otherwise congested communication links in a wide area or other communications network . when a high priority call is received at a node of the network , a check is made to determine whether the call can be accommodated within the existing bandwidth utilization in the network . for example , in the network 100 illustrated in fig1 , if a high priority call is received at node 102 , controller 116 may be configured to determine whether the call can be accommodated on communication link 106 according to the existing bandwidth utilization thereof . if the call can be so accommodated , it is connected in the customary fashion . if the call cannot be so accommodated , however , the present bandwidth renegotiation scheme is employed to free up bandwidth on communication link 106 to the point where the high priority call can be accommodated . rather than simply dropping calls , by renegotiating the bandwidth utilization among existing calls , these calls as well as the new high priority call can be accommodated within network 100 . to more fully appreciate the processes involved in the present scheme , it is helpful to understand how calls are handled in network 100 in accordance with the present invention . when a call is received from a cpe at node 102 , it is mapped to an associated network address . for example , associated with controller 116 may be a database configured to provide appropriate mappings between dialed telephone numbers and network ( e . g ., atm or internet protocol ( ip ) addresses ). an example of such a database 300 is shown in fig3 . in this example , the telephone number ( 123 ) 456 - 7891 is mapped to the network address 123 . 221 . 456 . 78 . for the case of atm network 100 , this network address is associated with a virtual circuit ( e . g ., a permanent virtual circuit or pvc ) between network nodes 102 and 104 , supported on communication link 106 . thus , when the incoming call is parsed at node 102 , the dialed number may be extracted to determine the node for which the call is destined , according to the network address . in some cases , the dialed number and / or associated network address may be flagged as a high priority call . for example , the dialed number 911 may be flagged as a call of the highest possible priority ( e . g ., where more that two priority levels are available ). in this way , incoming calls can be recognized as high priority or not . as mentioned above , for voice calls a variety of compression schemes are available , depending upon the codec ( coder - decoder ) resources available at the end points of the communication link over which the call is transported . each call ( e . g ., each inbound ti channel at node 102 ) may negotiate for a particular compression scheme to be employed at the time a connection is established , or a default compression scheme may be used where no negotiation takes place . in accordance with the present invention , each voice port supported by the atm interfaces 108 has a profile defining the available codec resources for that port . incoming calls are mapped to these voice ports for communications across communication link 106 and in one embodiment , atm interfaces 108 may each have up to 24 voice ports . the profiles of the voice ports may be established by a network manager at the time pvcs are set up within network 100 . alternatively , or in addition , profiles may be exchanged between ports as part of a call set up process in the case of switched virtual circuits ( svcs ). on mechanism for the exchange of such profiles is the atm adaptation layer type 2 ( aal2 ) protocol . recently , the atm forum has promulgated standards document af - vota - 0113 . 000 , entitled “ atm trunk networking using aal2 for narrowband services ” ( february 1999 ). in that document , which is incorporated herein by reference as is set forth in its entirety , a scheme for selecting and managing encoding algorithms at nodes of an atm network according to prearranged agreements is described . this scheme calls for the exchange of profile information in a manner suitable for use in accordance with the present invention . by exchanging profiles , each node at an end of a communication link is aware of the codec ( e . g ., dsp ) resources available at each corresponding voice port . thus , the nodes can reach an agreement on which codec ( i . e ., which compression scheme ) to use for a particular call . as noted above , compression schemes that provide high compression ratios tend to utilize less bandwidth than those that use low compression ratios do . so , assuming that sufficient codec resources are available , when an incoming high priority call is recognized , if there is insufficient bandwidth available on communication link 106 to accommodate the new call , node 102 can instruct node 104 to adopt new compression schemes on one or more voice channels ( i . e ., calls ) so as to free up bandwidth on communication link 106 to support the new call . this process can be repeated , as required , until no available codec resources remain . the renegotiation process described above may be implemented using oam ( operations , administration and maintenance ) cells that are exchanged between nodes 102 and 104 . oam cells are often exchanged between nodes of an atm network and are used to convey a variety of information . in accordance with the present invention , the oam cells are configured with payloads ( e . g ., cell type , function type and / or function specific fields ) that contain instructions for moving to different compression schemes , and acknowledgements thereto . the format and use of oam cells are well known in the art and need not be further described herein . what is unique is the use of such cells ( which may be transmitted from a high priority queue within a node so as to ensure rapid call handling ) to negotiate compression schemes for a channel on the fly . thus , a scheme for bandwidth renegotiation for accommodating high priority calls has been described . although discussed with respect to specific embodiments , however , the broader applicability of the present invention should not be limited thereby . for example , although discussed with respect to the negotiation of compression schemes on the fly , other call parameters or connection parameters could be so negotiated on the fly . thus , this broader applicability of the present invention is recited in the claims that follow .	7
the following description is presented to enable any person skilled in the art to make and use the invention , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present invention . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . with reference now to fig1 , a block diagram illustrating a system 300 for spectrally masking mri or fmri gradient coil noise is depicted in which the present invention may be implemented . system 300 employs a peripheral component interconnect ( pci ) local bus architecture . although the depicted example employs a pci bus , other bus architectures such as accelerated graphics port ( agp ) and industry standard architecture ( isa ) may be used . processor 302 and main memory 304 are connected to pci local bus 306 through pci bridge 308 . pci bridge 308 also may include an integrated memory controller and cache memory for processor 302 . additional connections to pci local bus 306 may be made through direct component interconnection or through add - in boards . in the depicted example , local area network ( lan ) adapter 110 , scsi host bus adapter 312 , and expansion bus interface 314 are connected to pci local bus 306 by direct component connection . it will be understood that lan adapter 310 may also include an internet browser . in contrast , audio adapter 316 , graphics adapter 318 , and audio / video adapter 319 are connected to pci local bus 306 by add - in boards inserted into expansion slots . expansion bus interface 314 provides a connection for a keyboard and mouse adapter 320 , modem 322 , and additional memory 324 . small computer system interface ( scsi ) host bus adapter 312 provides a connection for hard disk drive 326 , tape drive 328 , and cd - rom drive 330 . typical pci local bus implementations will support pci expansion slots or add - in connectors . an operating system runs on processor 302 and is used to coordinate and provide control of various components within data processing system 31 . data processing system 31 may be configured to process stored music 22 as described herein . the operating system may be any suitable commercially available operating system . in addition , an object oriented programming system such as java may run in conjunction with the operating system and provide calls to the operating system from java programs or applications executing on data processing system 300 . “ java ” is a trademark of sun microsystems , inc . instructions for the operating system , the object - oriented operating system , and applications or programs are located on storage devices , such as hard disk drive 326 , and may be loaded into main memory 304 for execution by processor 302 . system 300 may be configured to process stored music as described herein in real time or store preprocessed music as described herein in memory 324 . similarly , music , preprocessed or otherwise , may be introduce to system 300 via cd - rom 300 , tape 328 , or disk 326 . in some embodiments , such an adaptation may be incorporated within system 300 . in particular , system 300 may include storage medium 324 with program instructions ( see fig2 ) executable by processor 302 to spectrally mask music stored in memory 324 . in general , input may be transmitted to system 300 to execute program instructions ( see fig2 ) within storage medium 324 . storage medium 324 may include any device for storing program instructions , such as a read - only memory , a random access memory , a magnetic or optical disk , or a magnetic tape . program instructions ( see fig2 ) may include any instructions by which to perform the spectral masking processes described below . those of ordinary skill in the art will appreciate that the hardware in fig1 may vary depending on the implementation . other internal hardware or peripheral devices , such as flash read - only memory ( rom ), equivalent nonvolatile memory , or optical disk drives and the like , may be used in addition to or in place of the hardware depicted in fig1 . still referring to fig1 , an acoustic measurement device 10 measures the power spectrum associated with the mri pulse sequence being used . the measured power spectrum is used by the principal frequency component identifier 12 to identify one or more principal frequency components and their relative magnitudes . the number of principal frequency components identified can either be a number that is manually selected or automatically determined based on the acoustic power spectrum measurement . the number of principal components chosen may vary based on the properties of the power spectrum associated with a particular mri pulse sequence . still referring to fig1 , acoustic measurement device 10 may be any suitable acoustic measuring device , such as , but not limited to instantaneous sound level meter , an integrating sound level meter ; or a data logging sound level meter . similarly , acoustic measurement device 10 may be any device meeting international standards such as iec 60651 , iec 60804 and ansi s1 . 4 and graded as type for class ) 0 - 3 . in addition , acoustic measurement device also includes an analog - to - digital converter ( adc ). the adc may be any suitable adc such as , but not limited to , 8 - bit or 16 - bit sampling , 11 , 22 , or 44 khz sampling , and stereo or mono . principal frequency component identifier may be any suitable principal frequency component identifier . for example , the fast fourier transform ( fft ) or the time - based fast fourier transform ( tfft ) may be used to discern the desired principal frequency components exceeding one or more predetermined threshold levels . referring to fig3 there is shown a representative acoustic measurement of a mri pulse sequence . for the sample power spectrum in fig3 , three principal frequency components generated by mri gradient coils are identified for use in further processing ; or in other words to be masked by music stored in memory 22 . it will be understood that the number three is only an example , and that any suitable number of principal frequency components may be chosen . referring also to fig2 there is shown fig2 a method diagram fur the spectrally masking mri or fmri noise in accordance with the present invention shown in fig1 . the acoustic power spectrum of the mri pulse is measured 30 by acoustic measuring device 10 . principal frequency component identifier 12 identifies 32 one or more principal frequency components . music is selected for processing from stored music 22 . it will be appreciated that stored music may be grouped or cataloged in accordance with user preferences , mri or fmri gradient coil characteristics , or mri or fmri study objectives . parametric equalizer 14 guided by the one or more principal frequency components identified in step 32 boosts or attenuates 36 comparable frequency components in the music selected for processing . thus , for example , the comparable principal frequency components in the music selection are boosted in a manner analogous to the principal frequency components relative magnitudes in the mri acoustic power spectrum , thus producing a processed or modified music selection . it will also be appreciated that parametric equalizer 14 , controlled by a program of instructions , via processor 302 , may modify stored music 22 in accordance with a psychoacoustic model which may include a patient &# 39 ; s high frequency limit , threshold of hearing , and other acoustic parameters associated with human anatomy . while a parametric equalizer is preferred it will be understood that any suitable audio equalizer may be used . for example , in certain environments , a suitable graphic equalizer may he used to step 32 boosts or attenuates 36 comparable frequency components in the music selected for processing . attenuator 16 attenuates 38 the overall sound level of the modified music selection being processed so as not to produce over modulation . dynamic range compression processor 18 applies 40 dynamic range compressions and amplifier 20 applies 42 appropriate gains to the modified music to further enhance audibility to patient via speaker 24 . it will be understood that speaker 24 may be any suitable speaker , or headset , for operation in an mri or fmri environment . for example , but not limited to , speaker 24 may be non - magnetic circum - aural headphones , supra - aural headphones , or ear - bud headphones . similarly , it is understood that dynamic range compression processor 18 may be any suitable dynamic range compressor for reducing the dynamic range of the modified music . it will be appreciated that music or sound processed in the manner described above may be stored in memory 324 for later retrieval by rdbms 31 . it should be understood that the foregoing description is only illustrative of the invention . thus , various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances that fall within the scope of the appended claims .	7
fig1 to 5 show the embodiments of the present invention . in fig1 reference numeral 2 indicates the continuously variable transmission , 4 a belt , 6 a driving side pulley , 8 a driving side fixed pulley part , 10 a driving side movable pulley part , 12 a driven side pulley , 14 a driven side fixed pulley part , and 16 a driven side movable pulley part . the driving side pulley 6 has the driving side fixed pulley part 8 fixed to a rotating shaft 18 rotated by a motor , as shown in fig1 and the driving side movable pulley part 10 is supported on the shaft 18 so as to be movable in the direction of the axis of the shaft 18 but not to rotate relative thereto . the driven side pulley 12 is constructed similar to the driving side pulley 6 with regard to its driven side fixed pulley part 14 and driven side movable pulley part 16 . the driving side movable pulley part 10 and driven side movable pulley part 12 have respective first and second housings 20 and 22 mounted thereon to form respective first and second oil pressure chambers 24 and 26 . in the second oil pressure chamber 26 for the driven side , a pressing spring 28 urges the driven side movable pulley part 16 toward the driven side fixed pulley part 14 . on an end part of the shaft 18 , an oil pump 30 is provided . this oil pump 30 feeds oil from an oil pan or sump 32 to the first and second oil pressure chambers 24 and 26 through first and second oil passages 38 and 40 of an oil pressure circuit via an oil filter 34 . the first oil passage 38 communicates with a primary pressure control valve 44 of a speed change control valve constituting a pressure control unit 42 so as to control the primary pressure of an input shaft sheave pressure . a constant pressure control valve 48 for controlling a line pressure from line 40 ( generally 5 to 25 kg / cm 2 ) to a constant pressure in line 70 ( for instance , 3 to 4 kg / cm 2 ) communicates through a third oil passage 46 with the second oil passage 40 from the oil pump 30 . further , the primary pressure control valve 44 communicates with a first three - way electromagnetic valve 52 for controlling the primary pressure through a fourth oil passage 50 . the third oil passage 40 communicates with a line pressure control valve 54 having a release or regulating valve function for controlling the line pressure or pump pressure through a fifth oil passage 56 . the line pressure control valve 54 is connected to a second threeway electromagnetic valve 60 through a sixth oil passage 58 . further , the second oil passage 40 , between the second oil pressure chamber 26 and line pressure control valve 54 , communicates with a clutch pressure control valve 62 for controlling a clutch pressure . this clutch pressure control valve 62 communicates with a third three - way electromagnetic valve 68 through an eighth oil passage 66 . the primary pressure control valve 44 , the primary pressure controlling first electromagnetic valve 52 , the constant pressure control valve 48 , the line pressure control valve 54 , the line pressure controlling second three - way electromagnetic valve 60 , the clutch pressure control valve 62 and the clutch pressure controlling third three - way electromagnetic valve 68 each communicate with a ninth oil passage 70 . the clutch pressure control valve 62 is connected to an oil pressure controlled clutch 74 through a tenth oil passage 72 and a seventh oil passage 64 . the tenth oil passage 72 communicates with a pressure intensifier or sensor 78 through a path 76 . this pressure intensifier 78 can directly detect the clutch oil pressure at the time of controlling the clutch pressure in hold and start modes etc ., and helps in controlling the detected oil pressure to be a target clutch pressure and controlling the line pressure in drive mode since the clutch pressure is then substantially equal to the line pressure . the oil pressure clutch includes a piston 80 , an annular spring 82 , a first pressure plate 84 , a friction plate 86 , and a second pressure plate 88 . a microprocessor - based electronic control unit ( ecu ) 90 is provided for controlling a speed change based on inputting of various conditions such as the state of pressure sensor 78 , the opening degree of the throttle of a carburetor ( not shown ) of the vehicle and the speed of revolution of the engine , in particular by controlling the opening and closing of the primary pressure controlling first three - way electromagnetic valve 52 , the line pressure controlling second three - way electromagnetic valve 60 and the clutch pressure controlling third three - way electromagnetic valve 68 . various input signals inputted to the control unit 90 will now be described in detail as to their functions : facilitates control of the line pressure , belt ratio and clutch pressure required for respective ranges represented by respective shift position signals such as p , r , n , d and l . facilitates correction of a carburetor throttle opening sensor and improvement of accuracy in the control . indicates the degree of stepping down of an accelerator pedal , from which the intention of a driver is detected to facilitate control at the time of travel or starting . indicates the presence and absence of stepping on a brake pedal and facilitates disengagement control of the clutch . this optional driver - controlled signal selects sporty power performance or economical performance . the control arrangement controls the belt ratio to have the target belt ratio value determined from the opening of the throttle , namely by controlling the operations of the respective electromagnetic valves , when starting the vehicle on a road having a small road surface friction coefficient , such as a snowy or frozen road in a cold place . more specifically , as shown in fig2 when an input signal to the control unit 90 is turned on , for instance by using an optional snow mode switch , the control is directed at 204 and 208 to 206 , where the control mode ratmod of the belt ratio is implemented to effect feeding back of the belt ratio ratc to the target belt ratio value ratsp , as shown in fig5 and as described in more detail later . when this target belt ratio value ratsp is to be used because of the selection of the snow mode , then as shown at 309 in fig3 and as described in detail later , ratsp is set according to the opening of the throttle from a memory map ( for instance the map shown in fig4 and relating the opening of the throttle to target belt ratio values ). the target belt ratio value ratsp according to the memory map in fig4 represents a value roughly equivalent to the drive ratio of the second or third gear of a conventional manual transmission . in the memory map in fig4 when the opening of the throttle is small , the target belt ratio value is defined to be 1 . 5 and when the opening of the throttle is more than 30 %, the target belt ratio value ratsp is defined to be 1 . 0 . namely , when the opening of the throttle is large , the engine torque is increased and tends to cause wheel spinning which would disable the vehicle from starting , and therefore in compensation the target belt ratio value ratsp is set to be smaller in that case than when the opening of the throttle is small . accordingly , when the switch for the snow mode is turned on in a hold mode or a normal start mode , the belt ratio is controlled by the target belt ratio value ratsp to facilitate starting on a snowy road . the snow mode is effective only with the hold mode and the normal start mode , and in a drive mode after the oil pressure controlled clutch 74 is locked up , control is shifted to an engine revolution control mode renemod implementing the same control as for ordinary travel . as shown in fig5 in the case of the snow mode , the belt ratio control mode ratmod is selected at 406 to effect feed back of the belt ratio . as shown in fig1 an input shaft rotation detecting gear 102 is externally secured to the first housing 20 and a first rotation detector 104 for the input shaft is disposed in the vicinity of the peripheral part of detecting gear 102 . an output shaft rotation detecting gear 106 is externally secured to the second housing 22 and a second rotation detector 108 for the output shaft is disposed in the vicinity of the peripheral part of detecting gear 106 . the detecting signals of the first rotation detector 104 and the second rotation detector 108 are supplied to the control unit 90 and used for determining the speed of revolution of the engine , and the belt ratio . an output power transmitting gear 110 is coupled to the final output shaft of the oil pressure clutch 74 , and a third rotation detector 112 for detecting the rotation of the final output shaft is disposed in the vicinity of the peripheral part of gear 110 . namely , the third rotation detector 112 detects the rotational speed of the final output shaft , which is coupled to a not - illustrated reduction gear , differential , driving shaft , and tire , and can thus be used to detect the speed of the vehicle . the rotation of the input shaft and the output shaft can be detected by the second rotation detector 108 and third rotation detector 112 to detect the amount of slip of the clutch . as shown in fig1 in the continuously variable transmission 2 , the oil pump 30 situated on the shaft 18 operates according to the rotation of the shaft 18 and oil from the oil pan 32 is drawn through the oil filter 34 . the line pressure or pump pressure is controlled by the line pressure control valve 54 , and when the quantity of fluid released through the line pressure control valve 54 is large the line pressure is lowered , whereas when the release is small the line pressure is higher . the line pressure control valve 54 is controlled by the second exclusive three - way electromagnetic valve 60 , and in particular the line pressure control valve 54 operates by following the operation of the second threeway electromagnetic valve 60 . the second three - way electromagnetic valve 60 is controlled by varying the duty ratio of a constant frequency control signal . namely , a duty ratio of 0 % indicates that the second three - way electromagnetic valve 60 is not operated and an output side is continuously coupled to the atmosphere to bring the oil pressure in path 58 to zero ( atmospheric pressure ). a duty ratio of 100 % indicates that the second three - way electromagnetic valve 60 continuously operates and couples its output side continuously to its input side at 70 and thus obtains in path 58 the maximum output oil pressure , which is the same as the control pressure at 70 . namely , the output oil pressure at 58 is changed according to the change of the duty ratio to the second three - way electromagnetic valve . accordingly , the operation of the second threeway electromagnetic valve 60 causes the line pressure control valve 54 to analogically operate , whereby changing the duty ratio of the control signal for the second three - way electromagnetic valve 60 controls the line pressure at 40 . the operation of the second threeway electromagnetic valve 60 is controlled by the control unit 90 . a speed change controlling primary pressure in line 38 is controlled by the primary pressure control valve 44 , and the operation of this primary pressure control valve 44 is controlled by the first exclusive three - way electromagnetic valve 52 in a manner similar to control of the line pressure control valve 54 by valve 60 . the first three - way electromagnetic valve 52 is used to cause valve 44 to connect the primary pressure at 38 to the line pressure at 40 or to the atmosphere , connection to the line pressure shifting the belt ratio to full overdrive and connection to the atmosphere shifting it to full low , full overdrive and full low respectively being the upper and lower limits of the range of available belt ratios . the clutch pressure control valve 62 for controlling the clutch pressure at 72 is connected to the line pressure at 40 at a time requiring a maximum clutch pressure , and is connected to the atmosphere at a time requiring a minimum clutch pressure . this clutch pressure control valve 62 is controlled by the third exclusive three - way electromagnetic valve 68 in a manner similar to control of the line pressure control valve 54 or primary pressure control valve 44 , so that the explanation thereof will be omitted herein . the clutch pressure is changed within the range from a minimum ( atmospheric pressure or zero ) to a maximum ( line pressure ). the clutch pressure is controlled according to the following seven patterns : when a shift position selector is situated at n or p and the oil pressure clutch is completely disengaged , the clutch pressure is the minimum pressure ( zero ) and the oil clutch is turned off . when the shift position selector is situated at d or r and the throttle is set to indicate no intention to travel , or when it is desired to cut off the engine torque by slowing down during travel , the clutch pressure is high enough in level for the clutch to slightly engage ( 3 . 5 - 4 . 0 kg / cm 2 ), and produces a semi - engaged clutch state ( creep state ). the target belt ratio value is determined according to the opening of the throttle at the time of the start from a memory map correlating the opening of the throttle to a target belt ratio value . when the clutch is engaged at the time of starting or after the clutch has been disengaged , the clutch pressure is set to a proper level according to an engine generated torque ( clutch input torque ), for preventing the blowing up of the engine and for effecting smooth operating of the vehicle . ( a ) the speed of the vehicle is above 8 km / h and a shift selection is repeatedly changed , such as d to n to d , or ( b ) at the time of a slow down when driving , the braking state is cancelled when 8 km / h & lt ; vehicle speed & lt ; 15 km / h . the rotations of the input shaft and the output shaft of the clutch are synchronized to make the amount of clutch slip constant ( for instance 50 rpm ). with a complete travel state established , with the clutch completely engaged ( clutch lock up state ) or substantially in the lock up state after shifting from a start mode , the clutch pressure is set to a level high enough to completely endure the engine torque . of these patterns , neutral mode ( 1 ) is executed exclusively by a changeover valve ( not shown in the drawings ) interlocked with the shift selector , the other modes ( 2 ), ( 3 ), ( 4 ), ( 5 ), ( 6 ) and ( 7 ) being executed by appropriately controlling of duty ratios of control signals for the first , second and third three - way electromagnetic valves 52 , 60 and 68 by the control unit 90 . especially in the state ( 5 ), the oil passage 40 communicates with the tenth oil passage 72 through the clutch pressure control valve 62 to generate the maximum pressure by making the clutch pressure the same as the line pressure . the primary pressure control valve 44 , the line pressure control valve 54 and the clutch pressure control valve 62 are respectively controlled by the output oil pressure from the first , second and third three - way electromagnetic valves 52 , 60 and 68 , and a control oil pressure for use by the first , second and third threeway electromagnetic valves 52 , 60 and 68 is a constant oil pressure regulated by constant pressure control valve 48 . this control oil pressure is always lower than the line pressure , and is a stable and constant pressure . the control oil pressure is also supplied to the control valves 44 , 54 and 62 to stabilize them . now , the electronic control of the continuously variable transmission 2 will be explained . the continuously variable transmission 2 is oil pressure controlled , and the proper line pressure for holding the belt and transferring the torque , the proper primary pressure for changing the belt ratio , and the proper clutch pressure for effectively engaging the oil pressure clutch 74 are all set by respective commands from the control unit 90 . based on the flowchart of fig2 the control of the belt ratio will now be explained . when the program starts , whether the system is in the neutral mode or not is initially determined ( step 201 ). when the result in step 201 is yes because it is in the neutral mode , then in a step 202 a mode rdimod for outputting a fixed duty ratio value is implemented . in the step 201 , in the case of a no because the system is in a mode other than the neutral mode , whether it is in the hold mode or not is determined in a step 203 . in this step 203 , in the case of a yes due to the hold mode , whether the snow mode is in effect or not is determined in a step 204 . in this step 204 , in the case of no snow mode the result is no , the mode rdimod for outputting the fixed duty ratio value is implemented in a step 205 . in the step 204 , when the snow mode is in effect , a ratio control mode ratmod for feeding back the belt ratio to the belt ratio value selection based on the opening of the throttle and the speed of the vehicle is implemented in a step 206 . namely , as shown in fig3 initially the opening θ of the throttle and the shift selector position are used to determine a first revolution value n 1 at 301 from a relationship between the opening of the throttle and the number of engine revolutions which is set forth in a first table . the speed of the vehicle v and the shift selector position are used to determine a second revolution value n 2 at 302 from a relationship between the speed of the vehicle v and the number of engine revolutions which is set forth in a second table . then , the first revolution value n 1 and the second revolution value n 2 are used to set a target revolution value n 3 ( 303 ), to which is applied a first order lag filter ( 305 ) determined by the shift selector position when a first switching part 304 is set to a first contact &# 34 ; a &# 34 ; to thereby obtain a target number of revolutions obtained by a speed change schedule map . when the target revolution value n 3 passes to a second contact &# 34 ; b &# 34 ; of the first switching part ( 304 ), this target revolution value n 3 is divided by the speed of the vehicle v at 306 and is then subjected to a limit processing ( 308 ) for the full overdrive and the full low when a second switching part 307 is set to a third contact &# 34 ; c &# 34 ;. in the case of the snow mode in the hold mode or normal start mode , the target belt ratio value is set by using the opening of the throttle θ to select a target belt ratio value r from a memory map shown at 309 and also in fig4 this target belt ratio value being fed to the limit processing ( 308 ) when the second switching part ( 307 ) is set to a fourth contact &# 34 ; d &# 34 ;. after the limit processing ( 308 ), the target belt ratio value ratsp is obtained . in fig5 the target number of revolutions nespr obtained in fig3 is compared with the number of the revolutions ne of the engine ( 401 ), and a difference therebetween is multiplied by a proportional gain kae ( 402 ) to obtain an engine revolution number for use in control mode rnemod when feeding back the number of revolutions of the engine . the target belt ratio value ratsp obtained in fig3 is compared in fig5 with the belt ratio ratc ( 403 ), and a difference therebetween is multiplied by the proportional gain kar ( 404 ) to obtain a value for use in the ratio control mode ratmod when feeding back the belt ratio . the engine revolution number value for control mode rnemod or the ratio value for control mode ratmod is selected by a fifth contact &# 34 ; e &# 34 ; or sixth contact &# 34 ; f &# 34 ; of a third switching part ( 405 ) based on the presence of mode rnemod or mode ratmod , and is multiplied by a gain kbr ( 406 ) to yield eir . a fourth switching part ( 407 ) is operated for the conditions ratc & lt ; 0 . 60 and eir & lt ; 0 , or ratc & gt ; 2 . 04 and eir ≧ 0 , the output of 407 being multiplied by an integrating gain ( diir ) ( 408 ), and added ( 409 ) to a preceding value z - 1 ( 411 ) which was processed at 410 . the value from 406 and the value from 411 are added at 412 , and at 415 a value rn selected at 414 from a table on the basis of oil temperature has subtracted from it a value from 412 which has been processed at 413 . then , this difference is processed ( 416 ) and , based on the presence or absence of the mode rdimod at 418 , a fixed duty ratio value or a clutch solenoid duty ratio value opwrat is output . in fig2 in the case of no due to a mode other than the hold mode in step 203 , whether the system is in the normal start mode or not is decided in a step 207 . in this step 207 , in the case of yes due to the normal start mode , whether the snow mode is in effect or not is decided in a step 208 . in this step 208 , in case of yes because it is in the snow mode , it moves to the step 206 to shift to the control mode ratmod for feeding back the belt ratio to the target belt ratio value determined based on the opening of the throttle and the speed of the vehicle . in the step 208 , in case the snow mode is not in effect and means no , the mode rdimod for outputting a fixed duty value is implemented in a step 209 . in the step 207 , in the case of no because the mode is not the normal start mode , the presence of special start mode is checked in a step 210 . in this step 210 , in the case of yes due to the special start mode , the engine revolution number control mode rnemod for feeding back the number of revolutions of the engine to the target number of engine revolutions determined from the opening of the throttle and the speed of the vehicle is implemented in a step 211 . in the case of no because the mode is not the special start mode in step 210 , whether it is the coast mode or not is checked in a step 212 . in the case of yes due to the coast mode in step 212 , the control mode ratmod for feeding back the belt ratio to the target belt ratio value determined from the opening of the throttle and the speed of the vehicle is implemented in a step 213 . in the step 212 , in the case of no because the mode is not the coast mode , whether it is the drive mode or not is checked in a step 214 . in this step 214 , in the case of yes due to the drive mode , the control mode rnemod for feeding back the number of engine revolutions to the target number of revolutions determined by the throttle opening and vehicle speed is implemented in a step 215 . in the step 214 , in the case of no because the mode is not the drive mode , control is returned . consequently , at the time of starting on a road having a small road surface friction coefficient , the vehicle is not started from the full low but , according to the snow mode , the ratio is set to an intermediate belt ratio to transfer low engine torque , thereby preventing the wheels from slipping and facilitating easy starting . since the control mode of the belt ratio uses a conventional control mode , a large change in the program is not required , which is practically advantageous . as explained above , there are three control modes , namely rdimod , rnemod and ratmod . the control mode rdimod is used for neutral mode , the hold mode for a no - snow condition , and the normal start mode for a no - snow condition . as shown in fig5 the switch 418 is set to the dotted line position for rdimod . as evident from fig5 the outputs of blocks 402 and 404 are respectively used for the remaining two control modes rnemod and ratmod , and thus the switch 418 must necessarily be set to the solid line position for both rnemod and ratmod , and the switch 405 must obviously be set to positions &# 34 ; e &# 34 ; and &# 34 ; f &# 34 ; for rnemod and ratmod respectively . block 402 clearly requires nespr as an input during rnemod , and as evident from fig3 nespr can be generated only is switch 304 is in position &# 34 ; a &# 34 ;. since as discussed previously , rnemod is used for the special start and drive modes , switch 304 is set to position &# 34 ; a &# 34 ; for special start and drive . in fig5 block 404 clearly requires ratsp as an input during ratmod , and thus in fig3 switch 307 must be appropriately set during ratmod . as discussed previously , ratmod is used during the hold mode for a snow condition , the normal start mode for a snow condition , and the coast mode , and fig3 shows switch 307 is set to &# 34 ; d &# 34 ; for the snow mode in hold or special start , and thus the setting &# 34 ; c &# 34 ; is necessarily used for coast . when switch 307 is set to &# 34 ; c &# 34 ;, switch 304 obviously must be set to &# 34 ; b &# 34 ; to provide the required input to block 306 . in the embodiment disclosed above , the option switch is added in order to select the snow mode , but it is to be understood that a combination of the existing input signals may be used without adding other switches , for example in that snow mode is selected when the shift lever is set to a l range while the p / e ( power / economy ) switch is turned on . as apparent from the detailed explanation hereinabove , according to the present invention the control unit for controlling the belt ratio to have the target belt ratio value set by the opening of the throttle , at the time of starting on a road with a small road surface friction coefficient controls the belt ratio to an intermediate belt ratio transferring the low engine torque to effectively prevent the wheels from slipping and thus achieve easy starting . according to the embodiment of the present invention , the conventional ratio control mode can be used to avoid a large change in the program , which is a practical advantage . although a particular preferred embodiment of the invention has been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention .	8
fig1 shows one embodiment of the present invention . pallet stacking line 10 is built around pallet conveyor 16 . pallet dispenser 18 dispenses single pallets onto pallet conveyor 16 at appropriate times . the pallets are then carried down the pallet conveyor to first build position 26 and second build position 28 . first robot 30 is mounted atop first robot pedestal 54 . it is positioned next to first build position 26 . second robot 32 is mounted atop second robot pedestal 56 , alongside second build position 28 . the assembly line is configured to stack products 14 onto pallets . product conveyor 12 conveys the products to the robots . those skilled in the art will know that such a conveyor can assume many forms . the version shown in fig1 may actually be two conveyors placed side by side in order to increase the delivery of products . the drawing view shows a simplified rendition of this product conveyor . the reader should bear in mind that many other types could be substituted for the belt - type shown . these would include simple gravity feeders , vibratory feeders , and the like . two separate pick positions are provided , with the term “ pick position ” meaning a location where the products are stationary for a period sufficient to allow them to be grabbed by a robot . the product conveyor in fig1 feeds initially to second pick position 24 , under second robot 32 , down ramp 66 , under first robot 30 , and from there to first pick position 22 . fig3 a shows a detail view of second pick position 24 . the products are fed in from the left side of the view . inside feed belt 58 and outside feed belt 60 independently feed products along . these belts preferably feed products along in such a manner that any product picked by a robot from pick position 24 is rapidly replaced . two through - feed gates 64 regulate the flow of products out of the second pick position and down ramp 66 . these through feed gates can be lowered flush with or below the level of the conveyor belts , so that products can pass over them . fig3 b shows a detail view of first pick position 22 . it features stops 68 , which prevent any product going beyond the first pick position . such conveyors and controlling gates are well known to those in the art . however , a brief description may be helpful . still referring to fig3 b , when first robot 30 removes a product from the first pick position , the appropriate conveyor is activated to feed a new product into position . of course , those products reaching the first pick position must first pass through the second pick position . looking at fig3 a , if the second robot picks a product off inside feed belt 58 , the appropriate conveyor is activated to feed a new product to the void . if additional products are needed down at first pick position 22 , the far through - feed gate 64 can be opened for a period to pass products through the second pick position , down the ramp , and over to the first pick position , while the second robot is placing the product just picked . using this approach , product conveyor 12 keeps a steady supply of products at the two pick positions . fig2 shows a typical pick - and - place robot ( in this case ; second robot 32 from the line shown previously ). base 34 attaches the robot to its mount . first pivot 36 allows turret 48 to rotate with respect to base 34 . second pivot 38 allows first arm 50 to pitch with respect to turret 48 . third pivot 40 allows second arm 52 to pitch with respect to first arm 50 . fourth pivot 42 allows wrist 78 to pitch with respect to second arm 52 . fifth pivot 44 allows lifting attachment 46 to rotate with respect to wrist 78 . the lifting attachment also includes devices for lifting a product , such as plates which pinch together , suction points , or similar devices . robots such as shown in fig2 are very flexible . they can handle a variety of different products placed in a variety of different ways . because of these facts a single assembly line can be used to handle a variety of products — such as cardboard boxes one day and soda bottles the next . however , those skilled in the art will know that such flexible robots are often not as fast as custom - configured machinery . the present invention seeks to ameliorate this speed limitation . fig4 through 6b illustrate the proposed assembly line in operation . in fig4 , pallet dispenser 18 has dispensed a pallet 20 onto pallet conveyor 16 . the pallet is then moved down the line and brought to rest at first build position 26 . first robot 30 is then activated . it picks products from first pick position 22 and stacks them on the pallet . in fig5 a , the stack of products 14 on pallet 20 is approaching one half the total specified height of the completed pallet . fig5 b shows the operation just after the first half of the stack has been completed . at this point , the first robot has paused . pallet conveyor 16 is activated to move the first pallet from first build position 26 to second build position 28 ( moving from left to right in the view ). the pallet dispenser is activated while this move is ongoing in order to place a second pallet on the pallet conveyor . fig5 b shows this second pallet approaching first build position 26 . this second pallet is dispensed so that as the first pallet reaches the second build position , the second pallet reaches the first build position . once the first pallet reaches second build position 28 and the second pallet reaches first build position 26 , second robot 32 begins picking products from the second pick position and stacking them on the first pallet in order to build the upper half of the stack . at the same time , first robot 30 is starting anew stack on the second pallet . fig6 a shows this step in the process , with both robots in operation ( fig6 a shows the two pallets after the robots have completed about 70 % of their respective stacking tasks ). once the stack on the first pallet is completed , the entire process indexes one position ( the pallet at the second build position is completed and moved down the line ; the pallet at the first build position moves to the second build position ; and a fresh pallet is placed on the first build position ). fig6 b shows this step in the process . the reader will note that the leading pallet 20 supports a completed stack of products and is moving down the line ( from left to right in the view ). the next pallet 20 supports one half of a completed stack and is moving to second build position 28 . the pallet dispenser is also dispensing a new ( empty pallet ), which is moving toward first build position 26 . the reader will thereby realize that the two robots are in nearly continuous operation , with the first robot building the lower half of each pallet stack and the second robot building the upper half of each pallet stack . the line &# 39 ; s productivity is nearly doubled , since during most of the cycle two pallets are being loaded instead of only one . this productivity enhancement can be easily understood by contemplating the rate at which completed pallets pass down the pallet conveyor . in the conventional approach — using only one robot — a completely stacked pallet rolls down the line at a time interval equal to the time needed for a single robot to stack all the products on the pallet . using the approach shown in fig6 b , a completed pallet moves away from the second build position every time the line “ indexes ” ( moves a pallet from build position to build position ). this indexing occurs at a time interval equal to the time needed for a single robot to stack one half of the products on the pallet . thus , the production rate is nearly doubled . it is not exactly doubled , since some time is lost moving the pallets from station to station , but this time loss is minimal . the approach shown has other advantages as well . a robot having a range of motion encompassing the entire pallet stack is no longer needed . the placing of the second robot at a higher elevation allows the use of a relatively small robot having a relatively limited range of motion . this fact means that the same type of robot can be used for both build positions . of course , those skilled in the art will realize that the approach just described is not limited to the use of two robots . a two - robot approach implies dividing the pallet stack into a lower half and an upper half . if three robots are used , then the pallet stack can be divided into a lower third , a middle third , and an upper third . fig7 shows such an embodiment , employing first robot 30 , second robot 32 , and third robot 72 . third robot 72 sits atop third robot pedestal 74 . a product conveyor is used as before , but the version shown in this embodiment has three pick positions , including the addition of third pick position 70 proximate third robot 72 . the robots are vertically staggered so that the first robot &# 39 ; s range of motion encompasses the lower third of the pallet stack , the second robot &# 39 ; s range of motion encompasses the middle third of the pallet stack , and the third robot &# 39 ; s range of motion encompasses the upper third of the pallet stack . the line shown in fig7 allows simultaneous operations on three pallets , with one being proximate each robot . while the first robot is stacking the lower third , the second robot will be stacking the middle third and the third robot will be stacking the upper third . this configuration nearly triples the output speed of the assembly line . of course , the approach can be expanded to use four or more robots in such a vertically staggered arrangement . a linear assembly line has been illustrated thus far , but those skilled in the art will know that many line configurations can be developed using the present invention . fig8 shows one such approach , designated as alternate stacking line 76 . this version uses a pallet conveyor with a ninety degree bend . two adjoining belts are used , along with a stop gate and various control features . all these assembly line components are conventional and — as they do not form a novel portion of the present invention — they will not be described in further detail . the reader will observe that the pallets pass through first build position 26 and second build position 28 , then change direction to travel further down the line . first robot 30 and second robot 32 are vertically staggered as before , with second robot pedestal 56 being significantly taller . a differed type of product conveyor is used . the product conveyor 12 shown in fig8 approaches the build position from a perpendicular direction . rather than feeding the products through one pick position to reach the next , it simply feeds the two pick positions simultaneously . short inclined sections are used in order to place second pick position 24 at a higher elevation than first pick position 22 . this elevation offset places each respective pick position closer to its respective robot . of course , a single pick position can be used for both robots . such a pick position can be placed at an intermediate elevation . however , line speed is generally enhanced by providing a dedicated pick position for each robot . it also generally allows the use of a robot with a smaller range of motion . fig8 shows only one example of many of the line configurations which can be conceived . line layouts are often dictated by the available floor space and the placement of other components in the overall assembly process . the reader will understand that the novel features of the present invention could be incorporated into literally hundreds of different assembly lines having different appearances . although the preceding descriptions contain significant detail they should not be viewed as limiting the invention but rather as providing examples of the preferred embodiments of the invention . as one example , many types of robots can be substituted for the conventional “ arm ” units shown in the illustrations . gantry - type robots can function just as well using the vertically - staggered approach . accordingly , the scope of the invention should be determined by the following claims , rather than the examples given . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .	1
the following detailed description is presented to enable any person skilled in the art to make and use the invention . for purposes of explanation , specific nomenclature is set forth to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that these specific details are not required to practice the invention . descriptions of specific applications are provided only as representative examples . various modifications to the preferred embodiments will be readily apparent to one skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the scope of the invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest possible scope consistent with the principles and features disclosed herein . the principles of the present invention are achieved through the evaluation of the viability of the viruses with lymphotropism properties by sampling of the biological material , detection of presence of viral rna or dna using the polymerase chain reaction ( pcr ), as briefly discussed hereinabove . as described , a lymphocytes suspension is obtained from healthy human blood and an equal amount of biological material is then added . the aforesaid admixture is stirred , and then incubated at about 37 ° c . for about 6 - 8 hours , resulting in the washing - out of the lymphocytes from the plasma , and the lymphocytes being destroyed . the lymphocytes &# 39 ; cytoplasm is then subjected to a pcr test . as discussed , the detection of viral rna or dna in the cytoplasm of lymphocytes indicates the preserved viability of viruses , whereas the absence of viral rna or dna viruses in the cytoplasm of lymphocytes indicates inactivation of viruses . it should be understood that plasma or blood serums , biopsy samples of tissue or organs , and the washouts from the medical instruments may be used as the biological samples . in this manner , the methodologies and techniques of the instant invention allow assessment of the viability of viruses , particularly the hbv , hcv and hiv viruses . as discussed , another objective of the present invention is the elimination of eia and pcr false - negative results , such as by obtaining blood from patients suspected of being infected by lymphotropic viruses . for this approach , about 6 - 8 ml of such blood is drawn into test tubes , which preferably contain about 2 . 0 ml normal saline and about 2 - 3 drops of heparin . the lymphocytes are then separated from the blood and incubated at about 37 ° c . for about 6 - 8 hours , where lymphocytes are washed - out from the plasma and destroyed , and the cytoplasms of lymphocytes are then subjected to pcr . as discussed hereinabove , the detection of viral rna or dna in the lymphocytes &# 39 ; cytoplasm indicates the presence of viruses , whereas the absence of viral rna or dna in the lymphocytes &# 39 ; cytoplasm indicates the absence of viruses in the blood . the content of a patient &# 39 ; s lymphocyte is thus subjected to pcr - testing . it is known that many viruses , particularly those of the aforementioned hepatitis b virus ( hbv ), hepatitis c virus ( hcv ) and human immunodeficiency virus ( hiv ) can replicate in mononuclear blood cells , particularly , in the lymphocytes and in macrophages . it is known that hbv - and hcv - infections simultaneously cause inflammatory processes in the liver with subsequent hepatitis , as well as secondary immunodeficiency with various degrees of t - lymphopenia and b - lymphopenia , imbalance of regulatory subpopulations of t - lymphocytes ( t - helpers and t - suppressors ), reduction of immune regulatory index ( iri ), and dysgammaglobulinemia . the degree and grade of immunodeficiency , however , has been found to have no relation to the degree of the pathologic process in the liver . indeed , patients with chronic hbv and hcv infections have different intensities of pathological processes in the liver tissue after some time , from weak to expressed , but nonetheless have stable and steady aggravation of secondary immunodeficiencies . the dissociation of the degree of liver tissue injury and the degree of secondary immunodeficiency in various nosological forms of chronic virus hepatitis supports the idea that the hepatitis and secondary immunodeficiency in hbv and hcv infections are associated , mutually aggravating , but not mutually conditional . in other words , hbv and hcv , along with hepatotropic property viruses , possess expressed lymphotropic properties — direct properties that cause secondary immunodeficiencies . the differences in clinical appearances of the liver tissue injuries and the degree of immunodeficiency in hbv and hcv infections are due to differences in the degree of hepatotropic and lymphotropic properties of these viruses . thus , the differences in the degrees of hepatotropic and lymphotropic properties of viruses determine the differences of the pathogenesis , clinical appearance and the pattern of antiviral therapy effects in chronic hbv and hcv infections in various stages of these diseases . the identity of the lymphotropic properties of the aforesaid hbv and hcv , and hiv viruses , besides secondary immunodeficiency forming , is confirmed also by commonality of their epidemiological features , mechanism of transfer , progress of associated opportunistic infections ( frequent respiratory diseases , intestinal infections ), and particularly the development of the lymphogranulomatosis in different tissues of the organism . the development of lymphoid follicles &# 39 ; clusters , which is the aforementioned lymphogranulomatosis , in various organs and tissues of the organism is considered intrinsic for viral infections of the lymphoid cell system . when considering the lymphotropic properties of hbv , it was found that regardless of the serum titer , hbv can permanently persist in high concentrations in the cytoplasm of lymphoid elements . this phenomenon is used in the context of the instant invention for reliable increasing and elimination of the aforesaid false - negative results by eia and pcr , and the detection of lymphotropic viruses in biological material with concentrations of viral particles below the threshold of test - sensitivity for the eia and pcr techniques , as generally described hereinabove . in the instant invention , applicant employed the lymphotropic properties of hbv , hcv and hiv in an evaluation method of virus viability — the ability of these viruses to penetrate and persist intracellularly in the healthy human lymphocytes during their in vitro incubation . it should be understood that the evaluation of the viability of viruses with lymphotropism properties , particularly hbv , hcv and hiv , required the long - term storage of viruses , and the control of the antiviral efficiency of various disinfecting chemicals and physical factors against these viruses , as well as the control of antiviral therapy , as described in more detail hereinbelow . below is a description of a method pursuant to the teachings of an embodiment of the present invention directed to the evaluation of the viability of viruses with lymphotropism properties . in the production of a suspension of viruses , the biological material ( plasma or blood serum , biopsy samples of tissue or organs , and / or the wash - outs from medical instruments ) is obtained . then the biological material is subjected to quantitative pcr for the verification of the presence of viruses with lymphotropism properties , and the quantification of titer of the viruses . viruses contained in the biological material are kept in a frozen state in a refrigerator at below about − 25 ° c . temperature . a ) healthy volunteers are tested for infection with lymphotropic viruses using eia , as described . lymphocytes from healthy people with a negative result for study viruses are used in the investigations ; b ) to receive a sufficient amount of lymphocyte , blood is taken from an ulnar vein in an amount of about 20 - 30 ml in the morning from a fasting , healthy human subject . then about 7 - 8 ml of the blood is transferred to respective centrifuge tubes containing about 2 ml normal saline and about 3 drops of heparin (“ heparin ” concentration of 5000 me / ml ; 3 drops contain 750 me / ml of heparin ). the resulting solution is then stirred thoroughly ; c ) the lymphocytes are separated from the whole heparin containing blood in a ficoll - verografin gradient with density d = 1 . 077 g / ml pursuant to a technique known in the art . then , about 2 ml of the aforesaid ficoll - verografin gradient is poured into a clean centrifuge tube , then the heparinized blood lays on its surface and the tube is centrifuged at about 1500 rpm for about 20 minutes . during centrifugation , all blood cells , excluding lymphocytes , penetrate through the aforesaid ficoll - verografin gradient . blood plasma , however , remains above the gradient . in the border of the ficoll - verografin gradient and the plasma , there is a peculiar turbid ring , consisting of pure lymphocytes so formed . the ring with lymphocytes is then carefully pumped with a pipette and transferred to a clean centrifugal tube ; d ) the lymphocytes are then washed - out with about 10 ml of normal saline 2 - 3 times with further centrifugation at about 1500 rpm for about 20 minutes ; and e ) after the last centrifugation in the previous step , the supernatant is removed . the sediment containing lymphocytes is diluted and re - suspended in about 600 μl of normal saline . it should be understood that a lymphocytes suspension so produced may be stored no more than about a day at a temperature of about + 4 ° c . iii . evaluation of viruses with lymphotropism properties to penetrate and persist intracellularly in the human lymphocytes in vitro 1 ) biological material containing viruses with lymphotropism properties is taken from a refrigerator and thawed at room temperature ; 2 ) an equal amount ( about 300 μl ) of virus - containing biological material and a suspension of healthy human lymphocytes is transferred with a pipette to a clean centrifugal tube , and the contents are mixed and placed for incubation ( incubation of viruses with lymphocytes in vitro ) into a thermostat at about + 37 ° c . for about 6 - 8 hours . the testing tube is preferably mixed with shacking every 1 . 5 - 2 hours ; 3 ) the washing - out of lymphocytes is then done . the aforesaid testing tube is removed from the thermostat . about 6 - 8 ml of normal saline is added , mixed and the admixture centrifuged at about 1500 rpm for about 20 minutes . the lymphocytes are then sediment at the bottom of the tube . the supernatant ( mixture of plasma with saline ) is then entirely removed . the lymphocytes are washed out in normal saline and sediment 2 - 3 times . after the last centrifugation and supernatant removal , the suspension of the lymphocytes ( sediment ) is diluted with about 500 μl of normal saline and transferred to a plastic 1 . 5 lock tube ( eppendorf tube ) or similar tube ; 4 ) thereafter , the tube is placed into a freezer , such as a house grade refrigerator , overnight . the lymphocytes are thereby destroyed under these slow freezing conditions ; 5 ) the removal of the membrane of destroyed lymphocytes . the next day the tubes from the freezer are thawed at room temperature . then the membranes of the aforesaid destroyed lymphocytes are removed by centrifugation at about 3000 rpm for about 30 minutes . membranes are precipitated on the bottom of the tube and the lymphocytes &# 39 ; cytoplasm content remains in the supernatant ; and 6 ) the supernatant from the tube is transferred and subjected to quantitative pcr for testing for possible viral rna or dna in the cytoplasm of the lymphocytes that were previously in the infected patient &# 39 ; s plasma . 1 . positive pcr for the presence of viral rna or dna in the cytoplasm of lymphocytes indicates the remaining virus viability , i . e ., the virus &# 39 ; ability to penetrate and persist in human lymphocytes in vitro . 2 . negative pcr for the presence of viral rna or dna in the cytoplasm of lymphocytes indicates the loss ( inactivation ) of virus viability , i . e ., the loss of the virus &# 39 ; ability to penetrate and persist in human lymphocytes in vitro . the blood is obtained from an ulnar vein of a patient after receiving antiviral therapy for hepatitis c . the plasma is then separated from whole blood and subjected to quantitative pcr for the verification of the presence of hcv and quantification virus titer . in this embodiment , the pcr testing is negative . tested plasma is kept in the freezer at below − 25 ° c . temperature . simultaneously a 20 - 30 ml sample of blood from healthy human volunteers is obtained in the morning from an ulnar vein . the blood plasma portion is then subjected to pcr analysis for viruses with lymphotropism properties infection . the lymphocytes from the healthy humans , with negative testing results for infection , are used for further investigation . then 7 - 8 ml blood aliquots are transferred to centrifuge tubes containing about 2 ml of normal saline and about 3 heparin drops (“ heparin ” concentration is 5000 me / ml , 3 drops contain 750 me / ml of heparin ). the solution in the tube is then mixed thoroughly . as described hereinabove , the lymphocytes are separated from the whole heparinized blood in a ficoll - verografin gradient with d = 1 . 077 g / ml density according to a known method by garib , yu et al . then , about 2 ml of the aforesaid ficoll - verografin gradient is poured into a clean centrifuge tube , where heparinized blood lays on the surface of the gradient and then is centrifuged at about 1500 rpm for about 20 minutes . all blood cells , excluding lymphocytes , penetrate the ficoll - verografin gradient and the sediment underneath . the blood plasma is found above the aforesaid gradient . along the border between the ficoll - verografin gradient and the plasma , the afore - noted peculiar turbid ring with pure lymphocytes suspension is formed . the ring with lymphocytes is then carefully sucked up with a pipette , and transferred to a clean centrifuge tube . the lymphocytes are washed out in normal saline and sedimented about 2 - 3 times . after the last centrifugation , the supernatant is removed . the sediment containing lymphocytes is then diluted with about 600 μl saline and re - suspended . as is understood , the lymphocytes suspension so formed may be stored for about 1 day at about + 4 ° c . temperature . the testing plasma from the freezer is then thawed at room temperature . equal volumes ( about 300 μl ) of plasma and the suspension of lymphocytes are transferred to a clean centrifuge tube with a pipette , mixed and placed for incubation in a thermostat at about + 37 ° c . temperature for about 6 - 8 hours . the tube is then mixed by shaking every about 1 . 5 - 2 hours . after incubation , the tube is removed from the thermostat . then , about 6 - 8 ml of saline is added , mixed and centrifuged at about 1500 rpm for about 20 minutes . as discussed , the lymphocytes sediment at the bottom of the tube . the supernatant ( mixture of plasma and normal saline ) is then removed . with 2 - 3 times wash - out in normal saline and the lymphocytes sedimentation is performed in the same fashion . after the last centrifugation , the supernatant is removed , and a suspension of lymphocytes ( sediment ) is diluted by adding about 300 μl of normal saline , and transferred to a 1 . 5 ml lock tube , such as an eppendorf tube . thereafter , lymphocyte membranes are destroyed by placing them overnight in a house - grade freezer . on the next day , the tubes are thawed at room temperature . then , the membranes of the destroyed lymphocytes are removed from the suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . the membranes are thereby precipitated at the bottom of the tubes , and the lymphocyte cytoplasm contents remain in the supernatant , as also described hereinabove . the supernatant is then transferred from the tube and subjected to a quantitative pcr test for the presence of hcv viruses in the cytoplasm of the lymphocytes . a positive pcr test for hcv , of course , indicates the preservation of the hcm viability and the requirement of further antiviral therapy . a liver tissue , such as sampled by a liver puncture of a patient , who was given antiviral therapy for hepatitis b is obtained . a liver biopsy sample thereof is homogenized in an about 1 . 5 ml normal saline ; transferred to a centrifuge tube , and then centrifuged at about 1500 rpm for about 20 minutes ; and the supernatant transferred to a tube . one part of the supernatant is then subjected to quantitative pcr testing for the presence of hcv virus and quantification of virus titer . if the pcr test for hcv is positive , the biopsy sample is kept in the freezer in the refrigerator at below − 25 ° c . temperature . a lymphocyte suspension from a healthy human is made , as described hereinabove in connection with example # 1 . the supernatant from the aforesaid liver biopsy sample homogenate is thawed at room temperature . then equal volumes ( about 300 μl ) of the supernatant and lymphocyte suspension are added to a tube by an automatic pipette or similar such means ; the resulting solution is admixed and placed for incubation into a thermostat at about + 37 ° c . temperature for about 6 - 8 hours , where the testing tube is mixed by shaking about every 1 . 5 - 2 hours . the tube is the removed from thermostat and about 6 - 8 ml of normal saline is added , admixed and centrifuged at about 1500 rpm for about 20 minutes . the lymphocytes sediment at the bottom of the tube , as described hereinabove . the supernatant ( mixture of plasma with normal saline ) is removed entirely , and treated by a 2 - 3 times wash - out in normal saline , where the aforementioned lymphocytes sedimentation is performed in the same fashion as before . after the last centrifugation , the supernatant is removed and the suspension of lymphocytes ( in the sediment ) is diluted by adding about 300 μl of normal saline . thereafter , the destruction of the lymphocyte membranes is performed by putting the testing tube into a house - grade freezer overnight . accordingly , lymphocyte membranes are destroyed by overnight placement into house - grade freezer . on the next day , the tubes are thawed at room temperature . then , the membranes of destroyed lymphocytes are removed from suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . the membranes are precipitated along the bottom of the tubes and the lymphocyte cytoplasm contents remain in the supernatant , as discussed and described hereinabove . the supernatant is transferred from the tube and subjected to a quantitative pcr test for the presence of hbv virus in the cytoplasm of the lymphocytes , where a negative pcr test for hbv indicates the virus &# 39 ; loss of viability ( inactivation ). this example concerns the detection of viruses with lymphotropism properties in biological material with the concentration of virus below eia and pcr sensitivity thresholds . in a blood center , the blood plasma from about 6 - 8 ml of blood is tested for viruses with lymphotropism properties . one part of the plasma is subjected to quantitative pcr testing for the presence of hbv , hcv or hiv viruses , and the quantification of virus titer , where the pcr test here for the presence of viruses is negative . the tested plasma is stored in a freezer at below about − 25 ° c . the lymphocyte suspension from healthy human subjects is then prepared as described in more detail hereinabove in connection with example # 1 . the testing plasma from the freezer is thawed at room temperature . equal volumes ( about 300 μl ) of plasma and the suspension of lymphocytes is transferred to a clean centrifuge tube using an automatic pipette , admixed and placed for incubation in a thermostat at about + 37 ° c . for about 6 - 8 hours . the tube is mixed by shaking about every 1 . 5 - 2 hours . the tube is then removed from the thermostat , and about 6 - 8 ml of normal saline is added , admixed and centrifuged at about 1500 rpm for about 20 minutes . as described hereinabove , the lymphocytes sediment along the bottom of the tube . the supernatant ( mixture of plasma with normal saline ) is removed entirely , and the remainder 2 - 3 times wash - out in normal saline , where the lymphocytes sedimentation is performed in the same manner as set forth hereinabove . after the last centrifugation , the supernatant is removed and the suspension of lymphocytes ( sediment ) is diluted by adding about 300 μl of normal saline . thereafter , the lymphocyte membranes are destroyed by placing them into a house - grade freezer overnight . on the next day , the tubes are thawed at room temperature . the membranes of the destroyed lymphocytes are removed from suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . as discussed , the membranes precipitated along the bottom of the tubes , and the lymphocyte cytoplasm contents remain in the supernatant . the supernatant is then transferred from the tube and subjected to quantitative pcr testing for the detection of hbv , hcv and hiv viruses in the content of lymphocytes &# 39 ; cytoplasm , where a positive pcr for hcv indicates the presence of hcv virus in the donor plasma , indicating that donor &# 39 ; s ineligibility for transfusion . in this example , about 6 - 8 ml of blood is obtained in the morning from a fasting donor , preferably from an ulnar vein . whole blood is then transferred to a tube , subjected to sedimentation techniques , as described herein , and a serum is obtained ; one part of the serum is subjected to a pcr test for the presence of hbv , hcv or hiv viruses . and the quantification of virus titer , where the pcr tests are negative . the rest of the blood serum is stored in the tube . the lymphocyte suspension from a healthy human subject is performed , as described in more detail hereinabove in connection with example # 1 . the lymphocytes are separated and destroyed by overnight freezing in a house - grade refrigerator , as described . on the next day , the tube is thawed at room temperature . then the membranes of the destroyed lymphocytes are removed from the suspension by centrifugation at about 3000 rpm for about 30 minutes . the membranes precipitate on the bottom of the tube , and lymphocyte cytoplasm contents remain in the supernatant . the supernatant is then transferred from the tube and subjected to a quantitative pcr test for the detection of hbv , hcv and hiv viruses in the cytoplasm of the lymphocytes , where a positive pcr for hbv indicates the presence of hbv in the donor blood . in a standard pcr test , the detection rate of hbv and hcv has been observed at about 2 . 7 %. according to epidemiological data , new cases of hepatitis b ( hbv ) and hepatitis c ( hcv ) transfer occur due to the transfusion of infected blood or its components in about 2 . 2 %- 5 . 6 % of occurrences . to uncover the reasons behind this and techniques for the elimination of hbv infection in recipients , the lymphotropic properties of the virus were used . in particular , serums from 309 donor blood samples were tested by pcr for hbv markers detection rate . pcr revealed hbv in 6 out of 209 serum samples that estimated at about 1 . 94 % of all number of donors &# 39 ; sample . the same pcr study ( study of lymphocytes content from the same donors ) revealed hbv in 17 out of 309 samples , estimated at about 7 . 44 % of all donors &# 39 ; samples . thus , the standard pcr testing of blood serum was false - negative in 5 . 50 % of samples , which indicates that this is the reason for hbv infection in recipients by transfusion of infected blood or the components thereof . while the present invention has been illustrated by the description of the embodiments thereof , and while the embodiments have been described in detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details , representative apparatus and method , and illustrative examples shown and described . accordingly , departures may be made from such details without departure from the breadth or scope of the applicant &# 39 ; s concept . furthermore , although the present invention has been described in connection with a number of exemplary embodiments and implementations , the present invention is not so limited but rather covers various modifications and equivalent arrangements , which fall within the purview of the appended claims .	2
fig1 - a shows the drilling of a typical well bore using the methodology of the present invention . a surface hole is drilled to a selected depth using conventional drilling techniques where an outer casing 21 is set from surface to bottom of this surface drilled hole 11 . cement 31 is circulated into the annulus between the surface hole 11 and the outer casing 21 . the inner casing 22 with a series of large , open , side ports 27 , is set concentrically inside the outer casing 21 to provide an open - annulus path 73 between the two casings . the bottom of the inner casing 22 is sealed against the outer casing 21 by either a short column of cement 32 a or a pack - off system such as an external casing packer 32 a mounted on the inner casing 22 . the top of casing 22 is sealed against the outer casing 21 in the casing head ( not shown in fig1 ) at the surface of the ground with an exit from this casing head through an exit port , a valved manifold , and through discharge pipes to discharge burn pit . in this configuration , fluids can be circulated 72 down the inside of the inner casing 22 , through the open ports 27 , up the annulus between the inner and outer casings , and then out through the casing - head exit port , the valved manifold and the discharge pipes to the burn pit . the well is next deepened by drilling the hole 12 to the desired well total depth . the deeper section of the well 12 is drilled with under balanced drilling fluid as later described by reference to fig3 and 4 , then the formation fluids will flow into the open - hole well bore 12 . if the formation fluids are low density crude oil and / or expandable gases , the resulting decreased pressure gradient and increased flow rate up the drilling annulus 71 between the drill - hole wall 12 and the drill pipe 51 may be very difficult to handle at the surface if the well - control circulation paths 72 and 73 are not present . the well - control fluids of this invention are circulated down the inner - annulus 72 between the inner casing and the drill pipe 51 and thereby divert the upward flowing commingled drilling mud and produced formation fluids 71 out through the open ports 27 and then up through the outer - annulus flow path 73 . the commingled fluids are then discharged out through the above surface stationary , non - rotating casing head , ports , then through the valved manifold , and discharge pipes to the burn pit . the requirement to achieve substantially complete diversion of the upward flowing commingled mud and formation fluids 71 out through the open ports 27 in the inner casing 22 into annulus 73 is that the hydrodynamic well control fluid 72 downward flow velocity must exceed the upward velocity of any produced fluid 71 bubbles or slugs attempting to migrate , by buoyancy forces , upwardly through the downward flowing well control fluid 72 . this objective is realized with lower volumetric rates of injecting the well control fluid down the inner casing 22 by either increasing the control fluid 72 viscosity or by providing an optional partial barrier with a decreased cross - sectional area of flow , as shown by the partial barrier 41 in fig1 and 2 . for example , if a gelled water well - control fluid with a viscosity of 100 centipoise ( cp ) is used and if a barrier 41 with a flow area of 10 % of the drillpipe annulus area 72 is used , then the injection rate for this control fluid would be only 1 / 10th of 1 % ( i . e ., 0 . 001 fraction ) of the rate needed for ungelled water ( i . e ., 1 cp ) flowing down annulus 72 with no partial barrier 41 . typically , the hydrodynamic well control fluid has a viscosity ranging from about 10 to about 70 cp , and a specific gravity ranging from about 1 . 0 to about 1 . 5 , if the an optional barrier 41 is used , the typical inner annulus adjacent to the barrier 41 may have a horizontal cross - sectional area ranging from about 2 to about 20 % of the horizontal cross - sectional area of the inner annules above the barrier 41 . however , in many well conditions these viscosities and densities may be higher or lower than these typical values and in many applications the optional barrier 41 is not used . the partial - flow barrier 41 may consist of any one of many possible configurations , such as a simple , semi - circular cross - section , donut ring of flexible rubber , whose inside diameter is approximately the drill - pipe diameter , but deformable out to the drill - collar diameter , and whose outside diameter is formed by a steel ring designed to slide through the casing 22 and to be seated on a “ no - go ” stop in casing 22 located just above the h - bop circulation port 27 . the flexible rubber donut is designed to permit a restricted , slow , bypass leakage of the downward flowing h - bop control fluid in inner annulus 72 through the small cross - sectional area between the donut barrier 41 and the drill pipe ( or drill collars ) while drilling or tripping the drill string . in the small cross - sectional leakage area , the downward flow velocity will be high enough to prevent any of the produced formation gas in the annulus 71 below from migrating upwardly through the restricted by - pass area of the barrier 41 even when the volume flow rate of the annulus 72 h - bop drilling mud is very low . the flexible rubber donut 41 may be pulled out of the hole on top of the drill bit at the end of each trip of the drill string . a short length ( e . g ., 3 to 5 feet ) of a special fluted drill collar designed with deep fluid by - pass grooves cut in its surface is positioned just above the drill bit . when the fluted drill collar is pulled up into the rubber donut partial barrier 41 , it will provide a means for the drilling mud above the donut to easily flow past the donut barrier 41 to the area below the donut barrier . the fluid by - pass will prevent the donut barrier from swabbing the casing 22 as the donut barrier is being pulled out of the hole on top of the drill bit while tripping the drill string . of course , the oil / gas - well tool design engineers who are skilled in the design , construction , and operation of similar down - hole , well - bore tools may provide many alternative and improved designs for this partial barrier 27 and for a means of by - passing the partial barrier 41 when tripping the drill bit out of the hole . when the partial barrier 41 sitting on top of the drill bit is being tripped out of the hole , it may be useful to inject down the drill pipe a high - viscosity , high - strength , gel plug to fill the bottom few hundred feet of the casing 22 just above the circulation port 27 . the high - viscosity , high - strength , gel plug will minimize the amount of downward flowing h - bop fluid 72 needed to prevent the natural gas content of the produced formation fluids 71 from migrating by buoyancy up through the h - bop fluid 72 . the gel plug typically may have viscosity ranging from about 50 to about 500 cp and a specific gravity equal to the specific gravity of the hydrodynamic control fluid previously used in the inner casing . however , if gas does migrate through the h - bop fluid 72 and reaches the well head , then the regular bop or the rbop can be closed while additional h - bop fluids at higher downward velocity are pumped down the inner casing 22 to re - establish the down - hole h - bop control of the well . again , a high - viscosity , high - strength , gel plug can be circulated down the inner casing 22 to the depth of the circulation port 27 and thereby substantially minimize the future volume rate of injecting a h - bop control fluid 72 to divert essentially all of the produced formation fluids out through the circulation port 27 into the outer annulus 73 and thereby maintain down - hole , h - bop control of the well . so long as the down - hole , h - bop control of this well is maintained , the drill pipe or other tools may be tripped in or out of this well without any pressure on the inner casing 22 or well head and without using the surface bop stack or any surface pressure containment or stripping equipment . however , throughout the pipe / tool tripping operation , the production of formation fluids out of the producing reservoir sands will continue unabated . the well is “ never - killed ” in the producing formations , even though the inner casing 22 above the circulation port 72 is dead with no pressure at the well head to impede tripping pipe and tools in or out of the hole . fig3 shows a series of typical pressure / depth profiles of formation fluid pressures and well - bore fluid pressures . the solid line in fig3 represents a typical pressure / depth profile of formation fluids as found in many strongly overpressured , basin - centered , tight - sand gas resource areas . the dotted lines represent an example of the possible pressure / depth profiles of the well - bore fluids 71 consisting of a commingled mixture of produced formation fluids and drilling mud . the series of well - bore fluid curves 71 represent progressively increasing produced gas content from drilling at about 8 , 000 - foot depth to drilling at about 11 , 000 - foot depth . at the inner casing port 27 , the upwardly flowing well - bore fluid 71 from below is commingled with the downflowing hydrodynamic well - control fluid 72 to create the commingled discharge fluid 73 . the discharge fluid 73 may have a low discharge pressure at the surface where the fluid 73 flows out to the burn pit to be vented to the atmosphere . consequently , the fluid 73 will have a pressure located between point 1 and 3 ( which correspond to the port 27 in the inner casing 22 ) in fig3 . note that if the control fluid 72 is water or gelled water , it will have a pressure / depth gradient of about 0 . 433 psi / ft . of depth as shown by the line ( 1 )/( 2 ) and line ( 3 )/( 4 ) in fig3 . the pressure ( 1 ) or ( 3 ) at the port 27 in the inner casing 22 is determined by the pressure gradient in pressure / depth plot ( fig3 ) of fluid 73 from the surface at a near atmospheric pressure down to the depth of said port 27 . then the control fluid 72 , with a pressure gradient of about 0 . 433 psi / ft ., will stand inside the inner casing 22 at a level ( 2 ) ( e . g . at 1 , 100 - foot depth ) or ( 4 ) ( e . g . at 2 , 500 - foot depth ) in fig3 which is far below the well - head surface level . consequently , the control fluid 72 will be pumped into the inner casing 22 at atmospheric pressure ( i . e ., at zero pressure or a vacuum ) and will free fall down the casing 22 until it reaches the fluid level ( 2 ) ( e . g ., at 1 , 100 - foot depth ) or ( 4 )( e . g ., at 2 , 500 - foot depth ). consequently , the drill pipe and all of its attached equipment can be pulled out of casing 22 through the casing head , with zero fluid pressures . also , there will not be any produced formation gas or other formation fluids coming to the surface through the inner casing 22 because all of the commingled drilling mud and produced formation fluids 71 have been diverted out through port 27 to flow up the outer annulus 73 and then have been discharged to the surface burn pit . the drill pipe and attached equipment may be pulled dry up through the well - control fluid 72 standing at a low level between the depth ( 2 ) ( e . g ., 1 , 100 feet ) and ( 4 ) ( e . g ., 2 , 500 feet .) above the standing fluid level inside casing 22 , the casing 22 contains air at atmospheric pressure . if significant gas enters the drill pipe through the drill - bit ports , while tripping the drill pipe , a mechanical or fluid gel plug can be set inside the drill pipe to prevent gas entry and gas migration . during the tripping of this pipe , the formation gas and other fluids continue to be produced out of the formation at under balanced pressures , and no well - bore fluids will be injected into these formations to cause formation damage . the well is thus not killed while drilling or tripping . fig1 - b illustrates the application of the “ down hole hydrodynamic well control blowout prevention ” invention to the completion and post - completion operations in the well with the same objective of not killing the well during any part of such operations . in fig1 - b , a production casing 23 is run to the total depth ( td ), or a plugged back total depth ( pbtd ), without killing the well by using the same system previously described and illustrated in fig1 - a for tripping the drill pipe . this production casing 23 may be cemented from td or pbtd up to a position below the depth of the casing 22 or , alternatively , a series of external casing packers ( ecp ) 33 a , 33 b , 33 c , 33 d , and 33 e may be set to isolate segments of the open hole for testing and open - hole completion . the production casing 23 may be either a full length casing or may be a casing liner 23 hung and sealed 33 a at the base of the prior inner casing 22 , as shown in fig1 - b . if a full length production casing 23 is used , then it may have an open circulation port directly opposite port 27 in casing 22 . if the production liner from td ( or pbtd ) up to the base of the prior positioned inner casing 22 is used , then the circulation port 27 in casing 22 can be used for this hydrodynamic well control function , just as previously described and as shown in fig1 - b . if high pressure well fracturing operations are used in the well completion process and , if the outer casing 21 does not have an adequate pressure rating , then a fracture casing , like the casing 23 , can be run , without killing the well , to tie into and seal onto the casing liner 23 for the well fracturing operation . furthermore , the fracture casing can be subsequently removed , if desired , without killing the well . a work - over tubing string 52 can be run in and out of the completed well , as shown in fig1 - b , without killing the well production . many of the down hole work - over operations can be conducted in this manner without killing the well and thereby damaging the formation adjacent to the well bore and / or the formation adjacent to the hydraulic fractures extending from the well bore . fig2 - a and 2 - b illustrate an alternative configuration for drilling and completing a well using a larger diameter intermediate depth hole 12 covered by an intermediate diameter casing or hung liner 22 covering that portion of hole and then a smaller diameter deeper hole 13 is drilled in which the smaller diameter casing liner 23 is hung . this configuration in fig2 is especially desirable when the intermediate zone from the bottom of the outer casing 21 to the bottom of the intermediate casing ( or liner ) 22 has significantly different reservoir fluids and / or reservoir rocks requiring different evaluation procedures than the deeper zone 13 below the bottom of the intermediate casing ( liner ) 22 . the down hole , hydrodynamic , well control procedure above the bottom of the outer casing 21 is essentially , the same in both fig1 and 2 . as described above in reference to fig1 the well control in fig2 involves the same downward flow of a well control fluid 72 inside the inner casing 22 , around the optional partial barrier 41 , where it is commingled with the upward flowing well - bore fluids 71 , and both fluids 71 and 72 then flow out through the open port 27 and up the outer annulus 73 to exit out through a control manifold to the surface burn pit . the control of these fluid flows in the passages 71 , 72 , and 73 in fig2 - a and 2 - b will be substantially the same as described above in reference to fig1 - a and 1 - b . fig3 - 7 and 9 - 11 show the typical pressure - depth profiles of well - bore fluids ( a ) during drilling operations ( fig3 ), ( b ) during steady - state gas production ( fig4 ), and ( c ) during snubbing or surface bop shut - in fluid containment operations in a well bore containing 11 lb ./ gal drilling mud ( fig5 ), water ( fig6 ), or wet gas with liquid column water ( fig7 ). the methodology of the present invention prevents the damage to the reservoir rocks or formation fluids , as illustrated in fig1 - 4 . in contrast , fig5 - 7 show how the reservoir productivity can be damaged by shutting in a producing well or by shutting in the annulus flow of a drilling well or well during completion by using a bop , a rotating bop , or a snubbing unit to contain the pressurized , shut - in well - bore fluids in the annulus . when containing the pressurized well - bore fluids in the annulus by shutting in the blow - out preventer ( bop ) or by snubbing the drill pipe or production tubing through a rotating blow - out preventer ( rbop ) or a snubbing unit , the bubbles of gas subsequently migrating upward in the annulus well - bore fluid may create very high annulus pressures , as may be described by reference to fig5 . for example , if a well is drilling at about 11 , 000 feet with 11 lbs ./ gal drilling mud , then the formation gas at 7 , 000 psi in fig5 will flow into the drilling mud at 6 , 300 psi . in this slightly under balanced drilling condition , the 11 - lbs / gal mud will be somewhat gaseated while circulating , resulting in the mud carrying gas , creating a combustion flare out of the mud discharge line in the combustion mud pit at the surface . this flow of gas out of the formation will decrease the gas pressure in the formation , resulting in decreasing gas flow rates into the drilling mud . if the drilling operation is stopped but the mud circulation is continued preparatory to pulling the drill pipe out of the hole ( i . e ., tripping the pipe ) then the diminishing rate of gas flow into the mud results in a decreasing content of gas in the annulus drilling mud . when the circulating mud has very little gas content , then the drilling mud circulation may be discontinued and the drill pipe tripping operation may be started with the well production appearing to be totally dead ( i . e ., killed ). because of the formation gas pressure drawdown of the gas in the formation rock near the well bore by the prior gas production into the mud , the rate of gas flow into the annulus mud column of the nearly dead well may be very slow . however , this slow flow of formation gas into the annulus will create a growing gas bubble in the drilling mud which may range from a few feet to a few hundred feet in height . this low - density gas bubble will start migrating upwardly through the annulus mud column , and the drilling mud will develop a by - pass channel to flow downward around the rising gas bubble . if the top of the annulus is open for discharge into the mud pit , then the mud will start flowing out of the annulus and into the mud pit as the rising gas bubble expands . as this gas bubble migrates upwardly through the annulus mud column , it expands in volume , thereby increasing the discharge of mud out of the annulus and into the mud pit . if this process were allowed to continue , the rising and expanding gas bubble would blow a large volume of the drilling mud into the mud pit , resulting in a partially emptied annulus and a low mud pressure at the bottom of the hole . this would increase the flow of formation gas into the annulus , resulting in a much bigger gas bubble forming at bottom and rising up to annulus to unload more mud , ultimately resulting in a well blow out . to prevent this unloading of drilling mud , the driller will prevent annulus mud flow by closing the bop , or stopping the discharge from under the rbop or snubbing unit . consequently , the shut - in annulus mud pressure will rise as the gas bubble migrates upward in the annulus drilling mud . if the top of the annulus is shut in and if the formations in the open hole below the lowest casing or liner are very low permeability into which the drilling mud cannot easily penetrate , then the gas bubble migrating up through the drilling mud will not be able to expand . consequently , this non - expanding rising gas bubble will maintain the same pressure as it had down hole when the annulus was shut - in . for example , in fig5 if the top of the annulus is shut in with a solid column of 11 . 0 lb / gal drilling mud in the annulus , and if a gas - saturated formation at 11 , 000 - foot depth in the open - drill - hole produces a 7 , 000 psi gas bubble in the drilling mud , then that non - expandable gas bubble would migrate upwardly by buoyancy at a constant 7 , 000 psi . when this upwardly migrating gas bubble reaches a depth of about 8 , 700 feet , the shut - in surface drilling mud pressure will be about 2 , 000 psi and the down - hole drilling mud pressure at 11 , 000 feet will be about 8 , 300 psi , as shown in fig5 . if the open - hole formations have such low permeability that this high pressure mud leak - off into the formations is small compared to the bubble size and the rate of upward migration of the 7 , 000 psi non - expanding gas bubble , then when this 7 , 000 psi gas bubble reaches the 5 , 200 - foot depth in the well - bore annulus , the surface mud pressure will be about 4 , 000 psi and the down - hole mud pressure at 11 , 000 feet will be about 10 , 300 psi . at this down - hole pressure , a hydraulic fracture probably will be initiated in some of the open - hole formations , thereby removing some of the mud from the annulus and allowing the upward migrating gas bubble to expand without further increase of mud pressure . if such hydraulic fracture would not occur , then the upward migrating gas bubble would arrive at the surface at its original 7 , 000 psi , thereby creating a 11 , 000 - foot depth down - hole pressure of about 13 , 300 psi which would be far in excess of the pressure at which an any normal sedimentary formation would hydraulically fracture . in fact , at a far lower pressure , the porosity matrix and natural fractures of many gas sands would be invaded by drilling mud fluid , thereby removing mud from the annulus , allowing the gas bubble to expand , and limiting the rise in mud pressure . under these circumstances , the driller or drilling engineer may discharge to the mud pits such volume of drilling mud as may be necessary to limit this surface drilling mud pressure to some presumed safe value . for example , if 2 , 000 psi is selected as the maximum value for the surface mud pressure , then , when the upward migrating 7 , 000 psi gas bubble reaches the depth of about 8 , 800 feet ( at position a 2 in fig5 ) and the surface annulus mud pressure reaches about 2 , 000 psi ( at position d 2 in fig5 ), sufficient volume of drilling mud is discharged out of the annulus ( below the closed bop , rbop or snubbing unit ) to the mud pit to prevent this pressure from exceeding 2 , 000 psi . consequently , this expanding gas bubble would expand to a pressure of 6 , 000 psi at 7 , 100 - foot depth ( b 2 in fig5 ,) a pressure of 4 , 000 psi at 3 , 500 - foot depth ( c 2 in fig5 ) and to a pressure of 2 , 000 psi at the surface ( d 2 in fig5 ). when the expanding gas bubble reaches the surface at 2 , 000 psi , the gas is slowly discharged to the mud pit and , simultaneously , drilling mud is pumped into the annulus at 2 , 000 psi to replace the volume of the 2 , 000 psi gas bubble discharged from the annulus . by this means , the upward migrating gas bubbles can be worked out of the annulus mud column in such manner which will prevent additional gas bubbles from being produced out of the formation and flowing into the annulus mud column . consequently , the well is successfully killed by creating down - hole annulus drilling mud pressures which are at all depths significantly higher than the gas pressures in every open - hole formation . the process of killing the well by overpressure , as shown in fig5 results in pushing some drilling mud into the formation pore spaces and fractures and thereby damaging the productivity potential of those formations . as shown by the example of 11 - lbs ./ gal drilling mud with a surface pressure of 2 , 000 psi creates an overpressure ( i . e ., mud pressure minus formation pressure ) ranging from 500 psi at 14 , 000 feet , 1 , 000 psi at 12 , 000 feet , 1 , 500 psi at 10 , 000 feet , 2 , 000 psi at 9 , 000 feet , 2 , 500 psi at 8 , 700 feet , and 3 , 000 psi at 7 , 000 feet . the depth of invasion of the drilling mud into the formation porosity matrix and , the formation pre - existing natural fractures , and thereby the damage of formation productivity , is dependent in part on the degree of overpressure created in killing the well , as shown in fig5 and described above . the process of containing pressurized well - bore fluids under the bop , rbop or snubbing unit during well completion operations , using water as the well - bore circulating fluid , is very similar to the above description and the referenced fig5 except that the pressure gradient for water is used instead of the drilling mud pressure gradient . fig6 shows these same pressure - depth relationships as in fig5 except that the water pressure gradient replaces the drilling mud pressure gradient . by using fig6 instead of fig5 the same physical analysis can be made for a water filled annulus pressure containment process during well completion operations , as previously described for a drilling well operation and illustrated in fig5 . fig5 and 6 and the above description thereof illustrate the operational problems which exist in wells on which the present invention described herein is not used . these problems of well control and formation damage during drilling and completion , as described in reference to fig5 and 6 , are eliminated by using the present invention , as described in reference to fig1 , 3 , and 4 herein . also , the methodology of the present invention has great value for use in work - over operations in wells subsequent to a period of production . if any liquid condensate or water is present in the well bore , then the shut - in pressure profile of the well - bore fluid may be about as shown in fig7 . note , that with the progression of time from curve a - a ′, to b - b ′ to c - c ′, to d - d ′ of fig7 this liquid condensate and / or water is being injected into the gas producing porosity zones . the liquid injection may create pore throat liquid blockage which greatly reduces the relative permeability to gas from these gas producing sands . in many of the ultra - tight ( i . e ., low - permeability ) sandstone reservoirs , the great majority of pore throats may have radii of only about 0 . 1 to 0 . 4 microns . in these tight sands , any liquid injected into these pore spaces with pore throats of only 0 . 1 to 0 . 4 micron radii will create a gas flow blockage which may require a very high pressure gradient to remove the liquid blockage before any gas flow can occur . if both hydrocarbon condensate and water are injected into such tight sands , a very difficult to break , three phase , flow blockage may occur , effectively destroying the ability of those sands to produce any gas . for example , a typical tight gas sand reservoir rock may have an initial effective permeability to gas of about 50 to 500 microdarcys ( i . e ., 0 . 05 to 0 . 5 md ) prior to invasion of any well - bore fluids . after invasion of well - bore water into these pore spaces , the effective permeability to gas may be reduced to about 5 to 20 microdarcys . if these pore spaces are invaded by both water and liquid condensate to create a three - phase flow blockage , the effective permeability to gas may be reduced to almost zero . therefore , it is extremely important to prevent the injection of condensate and / or water into these sands , as illustrated in fig7 . for the purpose of under balanced drilling and producing the lance overpressured sands from about 7 , 500 feet to about 11 , 000 feet ( or deeper ), in the sublette county , wyo ., portion of the green river basin , the following drilling / casing design may be used to provide the means for achieving this down hole , hydrodynamic blow - out - preventer ( h - bop ) operation , as illustrated in the attached fig2 : the procedure for drilling / casing this well to achieve under balanced drilling and work - over operations of the gas - producing lance sands from 7 , 500 feet to 11 , 000 feet ( or deeper ), as illustrated in fig2 may be briefly described as follows : ( 2 ) drill 12 ½ ″ surface hole to about 4 , 500 + feet using water / mud with mica flakes to minimize water loss into the low - pressure , high - porosity sands in this section . ( 4 ) run 9 ⅝ ″ surface casing ( 40 #/ ft , c - 95 ) to surface hole total depth and cement back to surface . assemble and test bop stack , consisting of a dbop at bottom , plus a rotating bop ( r - bop ) on top . ( 5 ) drill 8 ¾ ″ hole from about 4 , 500 feet into top of lance at about 7 , 500 feet using from 100 to 200 scf compressed air per barrel of water / mud to give a 12 % to 25 % aerated mud at about 2 , 000 psi bottom - hole pressure . use rotating bop ( r - bop ) to divert aerated and gaseated mud out to burn pit without leakage of gaseated mud up to kb and derrick floor . ( 6 ) run open - hole logs ( array induction and neutron / density logs ) from total depth up to surface casing at about 4 , 500 feet . ( 7 ) run intermediate casing , as follows : ( a ) 7 ″, 23 #/ ft , c - 95 casing with ecp &# 39 ; s , as needed ( i . e ., no cement ), from total depth at about 7 , 500 feet up to about 50 feet above base of 9 ⅝ ″ surface casing . ( b ) 7 ⅝ ″, 26 . 4 #/ ft , c - 75 casing from top of 7 ″ casing up to the surface well head . ( c ) place a large circulation port near the bottom of the 7 ⅝ ″ casing for use as the alpine , down - hole , hydrodynamic bop ( i . e ., h - bop ). ( 8 ) drill 6 ¼ ″ hole with lightly aerated water / mud from bottom of intermediate casing at about 7 , 500 feet down to the geologically selected total depth at about 11 , 000 feet ( or deeper ). when adequate formation gas flow is established , the aeration of mud can stop and natural formation gas flow will maintain a gaseated under balanced mud system throughout the balance of this drilling operation . the h - bop at 4 , 500 - foot depth will permit tripping drill pipe and running casing with under balanced gaseated mud system without killing the well at anytime . ( 9 ) run open - hole logs from total depth up to bottom of the intermediate casing at about 7 , 500 feet . ( 10 ) run 4 ½ ″, 11 . 6 #, p - 110 casing liner to hole total depth and hang this liner on the bottom of the 7 ″ intermediate casing @ at about 7 , 500 feet , using down - hole h - bop to maintain under balanced gaseated mud system without killing the well . proceed with completion program as designed for each well . the procedure for under balanced drilling of the 6 ¼ ″ hole described in step # 8 above is illustrated in the attached fig2 - a for drilling wells and fig2 - b for completed and producing wells . in reference to fig2 - a , the slightly aerated drilling water / mud is pumped down the inside 75 of the drill pipe 51 , then out through the drill bit 53 and up the annulus 71 . for example , in reference to fig3 if the aerated drilling mud pressure at 8 , 000 - foot drilling depth is about 3 , 000 psi ( i . e ., about 200 atm ), then the injection of about 875 scf / min ( i . e ., about 1 , 250 , 000 scud ) of compressed air into the 7 b / m stream of drilling mud at the surface mud pump will create a 10 % aerated mud with a pressure gradient of about 0 . 39 psi / ft at 3 , 000 psi in the annulus just above the drill bit . this 10 % compressed air will expand to 15 % of the mud volume at about 6 , 000 - foot depth and further expand to 20 % of the mud volume at about 4 , 500 - foot depth , resulting in proportionately reduced pressure gradients at these shallower depths , as illustrated in the attached fig3 . any porous sands containing formation gas penetrated by the drill bit with this under balanced aerated mud system will produce formation gas into the annulus to further gasify and reduce the weight of this drilling mud . this relationship of formation pressure and well - bore pressures is illustrated in the attached fig3 for the under balanced drilling of a lance gas producing well . notice that at 4 , 500 - foot depth , the 20 % ( or higher percentage ) gaseated drilling mud in the annulus will have a pressure of only about 1 , 500 psi or less , which is about 450 psi below the normal hydrostatic pressure for this depth . therefore , if a solid column ( i . e ., not gaseated ) of drilling mud with a density slightly greater than water ( i . e . about 8 . 75 lbs / gallon ) is pumped down the annulus 72 between drill pipe 51 and the 7 ⅝ ″ casing 22 , as shown in fig1 then the pressure / depth profile of this drilling water / mud column will be about in fig3 . this pressure / depth plot as shown by the heavy line from ( 1 to 2 in the water column 72 ( fig3 ) runs from about 1 , 500 psi at a depth of about 4 , 500 feet ( 1 up to a zero gauge pressure ( atmospheric pressure ) at a depth of about 1 , 200 feet below the surface 2 as shown in fig3 . consequently , the drilling mud being pumped into annulus 72 at atmospheric pressure will free fall down this annulus 72 to the fluid level ( 2 found at about 1 , 200 - foot depth ( fig3 ). as additional drilling mud is pumped into annulus 72 , then this volume rate of drilling mud flowing down annulus 72 , flows out through the h - bop circulation port 27 at about 4 , 500 feet where it is commingled with the gaseated drilling mud 71 from below . then the resulting commingled fluids ( i . e ., 71 and 72 ) will flow up annulus 73 between the 7 ⅞ inner casing and the 9 ⅝ ″ outer casing . when these commingled fluids 73 reach the surface , they are discharged to the burn pit at approximately atmospheric pressure . if the velocity of the h - bop drilling mud flowing downward in the annulus 72 exceeds the velocity of gas bubbles or gas slugs attempting to migrate upward by buoyancy in this drilling mud , then all of the gaseated mud 71 and its gas content will be diverted out through the h - bop circulation port 27 into annulus 73 . consequently , none of the formation gas ( or mud aeration ) from annulus 71 drilling mud will be able to migrate up through the downflowing drilling mud to escape at the surface from this annulus 72 just below the derrick floor . under these conditions , the drill pipe can be tripped in and out of the hole through the open - ended , zero - pressure , 7 ⅝ ″ casing 22 ( i . e ., without stripping under pressure ) while the hydrodynamic control fluid flows down annulas 72 to circulation port 27 and the produced formation gas continues to flow upward through the annulus 71 out through the circulation port 27 where the hydrodynamic control fluid in annulus 72 commingles with the formation gas in annulus 71 and these commingled fluids then flow upward through annulus 73 to the surface for discharge to the burn pit . for the purpose of reducing the volume rate of injecting the water / mud into the 7 ⅝ ″ casing 22 for h - bop fluid downflow control through annulus 72 , a fluid - flow - restriction or partial - flow - barrier 41 ( fig1 ) may be inserted in the annulus 72 just above the h - bop circulation port 27 . this partial - flow - barrier may consist of any one of many possible configurations , such as a simple , semicircular cross - section , donut ring of flexible rubber , whose inside diameter is approximately the drill - pipe diameter , but deformable out to the drill - collar diameter , and whose outside diameter is formed by a steel ring designed to slide through the 7 ⅝ ″ casing 22 and to be seated on a “ no - go ” stop in casing 22 located just above the h - bop circulation port 27 . this flexible rubber donut is designed to permit a restricted , slow , bypass leakage of the downward flowing h - bop drilling mud in annulus 72 through the small cross - sectional area between this donut barrier and the drill pipe ( or drill collars ) while drilling or tripping the drill string . in this small cross - sectional leakage area , the downward flow velocity will be high enough to prevent any of the produced formation gas in the annulus 71 below from migrating upward through this restricted by - pass area of this barrier 41 even when the volume flow rate of the annulus 72 h - bop drilling mud is very low . this flexible rubber donut 41 may be pulled out of the hole on top of the drill bit at the end of each trip of the drill string . a short length ( i . e ., 3 to 5 feet ) of a special fluted drill collar designed with deep fluid by - pass grooves cut in its surface is positioned just above the drill bit . when this fluted drill collar is pulled up into the rubber donut partial barrier ( 41 ), it will provide a means for the drilling mud above the donut to easily flow past the donut barrier 41 to the area below the donut barrier . this fluid by - pass will prevent this donut barrier from swabbing the 7 ⅝ ″ casing 22 as the donut barrier is being pulled out of the hole on top of the drill bit while tripping the drill string . in many operations , this partial flow barrier 41 is eliminated by substituting a high viscosity gelled water / mud plug emplaced in annulus 72 , just above the circulation port 27 , to accomplish this same objective of down - hole hydrodynamics ( h - bop ) control with a low volume rate of hydrodynamic control fluid injection . so long as the down - hole , h - bop control of this well is maintained , the drill pipe or other tools may be tripped in or out of this well without any pressure on the 7 ⅝ ″ casing 22 or well head and without using the surface bop stack or any surface pressure containment or stripping equipment . however , throughout this pipe / tool tripping operation , the production of formation fluids out of the producing reservoir sands will continue unabated . this well is “ never - killed ” in the producing formations , even though the 7 ⅝ ″ casing 22 above the circulation port 72 is dead with no pressure at the well head to impede tripping pipe and tools in our out of the hole . as shown in fig2 - b , this same down - hole , h - bop control of the well &# 39 ; s continuous production , as described above for the drilling well illustrated in fig2 - a , can be maintained during completion operations and during work - over operations of a completed well . fig4 - a , 4 - b , and 4 - c show the pressure depth profiles of the well - bore fluids 71 , 72 , and 73 during production of formation fluids and using the down - hole h - bop for well control while running work - over tools in the well without killing or interrupting the production . a second example of under balanced drilling and producing the lance overpressured sands from about 7 , 500 feet to about 11 , 500 feet ( or deeper ) in sublette county , wyo ., is a design for slimhole drilling with coiled tubing drilling equipment ( see fig8 a ). in this example , a 2 ″ diameter coiled tubing 51 drilling system is used to drill a 4 . 25 - inch diameter slim hole 13 out from under a 5 ″ uncemented , inner , hydrodynamic - control ( h - bop ) casing 22 hung to 7 , 500 - foot depth inside a 7 inch ( 23 #) outer casing 21 set to 7 , 500 - foot depth . ( note : this same h - bop control system can be used on a conventional drilling rig with conventional jointed drill pipe and with the same 4 . 25 ″ diameter drill bit and bottom - hole assembly as an alternative to the coiled tubing drilling system described herein .) any desired drilling procedure and casing program may be used to drill this hole to the top of the overpressured lance formation at about 7 , 500 - foot depth and to set a 7 ″ o . d . ( 23 #/ ft .) casing 21 to this drill - hole depth of about 7 , 500 feet . drill out the cementing shoe and any cement inside the 7 ″ casing down through the bottom of this casing and to the bottom of the prior drill hole . then the 5 ″ o . d . ( 15 #/ ft .) hydrodynamic - control , inner casing ( hbop ) 22 is run in hole and hung uncemented from the casing head to the bottom of the prior drill hole at or below the bottom of the 7 ″ casing . within the bottom two feet of this 5 ″ o . d . h - bop casing a series of about 8 holes 27 of about 1 . 5 inches diameter are drilled through this casing wall in a pattern which will maintain the maximum structural strength of this casing . a centralizer collar may be used on this 5 ″ h - bop casing 22 inside the 7 ″ outer casing 21 to hold this h - bop casing in a constant centralized position . the cross - sectional area of the annulus 73 between the inner h - bop 5 ″ casing and the outer 7 ″ casing is about 12 . 2 sq . in . this is about the same cross - sectional area as the annulus 71 between the 2 ″ coiled tubing drill string and the 4 . 4 inch average diameter of the open hole 13 drilled by a 4 . 25 ″ diameter drill bit 53 . therefore , the velocity of flow of the well - bore fluids upward ( 1 ) through the open drill hole annulus 71 , ( 2 ) diverted out through the 8 holes of 1 . 5 inch diameter near the bottom of the 5 ″ casing 27 , and then ( 3 ) upward through th e h - bop annulus between the 5 ″ inner casing and the 7 inch outer casing will remain nearly constant . however , the injected hydrodynamic - control fluid flowing down the annulus 72 between 2 ″ coiled tubing drill pipe 51 and the 5 ″ inner casing 22 commingles with the upward flowing open - hole wellbore fluid as they flow together out through the 1 . 5 ″ holes 27 near the bottom of the 5 inch casing . consequently , there is an increased velocity of flow of the resulting commingled fluid upward through the h - bop annulus between the 5 ″ and 7 ″ casings . the pressure depth profile ( see fig9 ) in the h - bop annulus 73 between the 5 ″ and 7 ″ casings will be controlled by ( 1 ) the surface pressure of the commingled fluids discharged from this h - bop 73 annulus and ( 2 ) the volume flow rate of the hydrodynamic - control fluid 72 from inside the inner 5 ″ casing being injected into this h - bop annulus 73 where it is commingled with the well - bore fluids 71 flowing upward from the drilled open - hole section . the objective of exercising these h - bop controls is to establish the pressure at the bottom ( 1 ) of the inner 5 ″ h - bop casing to be equal to or less than the hydrostatic pressure plus friction pressure loss of the h - bop control fluid 72 flowing down the inside of this 5 ″ inner casing . when controlled in this manner , the well - head pressure in the annulus between the 2 ″ coiled tubing drill string and the inner casing will be zero and the top of the fluid level standing in this annulus may be some distance below the surface . ( 2 ) in this properly h - bop controlled condition , the drilling operations can proceed without using any well - head pressure control equipment for pipe stripping or snubbing operations . ( note : this h - bop drilling operation , without using any special well - head pressure control stripping or snubbing equipment , is applicable to drilling with either a coiled tubing drill string or a conventional jointed drill - pipe drill string .) if the top of the hydrodynamic - control fluid level ( 2 ) inside the inner 5 ″ casing rises to the surface or starts to build any significant pressure under the conventional , low pressure , drilling rotating head , then the control valves on the surface discharge flow from h - bop annulus can be opened to reduce the surface discharge pressure . this procedure will reduce the pressure depth profile 73 in the h - bop annulus and thereby reduce the pressure at bottom ( 1 ) of the 5 ″ inner casing and lower the fluid level inside the inner casing . consequently , the volume rate of injecting the hydrodynamic - control fluid into this 5 ″ inner casing can be increased , resulting in a higher rate of injecting this fluid into the h - bop annulus where it is commingled with these annulus fluids . as more of the higher density hydrodynamic - control fluids 72 are injected into and become commingled ( at the bottom 27 of the 5 ″ inner casing ) with the well - bore fluids flowing upward 71 from the drilling open - hole section , then the pressure gradient in this commingled fluid 73 in the h - bop annulus will be increased , thereby restoring pressure control to this system . if the well - head pressure inside the 5 ″ inner casing becomes too high for safe operations with a low pressure rotating head , then the conventional surface bop &# 39 ; s can be closed and the rate of injecting the hydrodynamic - control fluid can be rapidly increased and , if needed , the density of this control fluid 72 can be increased until proper control of this well is restored . when this pressure control is established with a balanced rate of injecting the hydrodynamic - control fluid with a reasonable surface pressure of the commingled fluids 73 discharged from the h - bop annulus , then the conventional well - head bop can be opened and drilling operations can be resumed . the velocity of flow upward through the open - hole drilled interval 71 and upward through the h - bop annulus 73 needs to be sufficient to carry the drill - bit rock cuttings up hole to the surface . the upward flow velocity required to transport the drill cuttings depends upon the gel strength and viscosity of the liquids used and also depends upon the volume of gas produced from the formation during this under balanced drilling operation . as a rough guideline for estimating these velocities , the following table has been calculated for the liquid component only in this flow stream ( i . e ., the produced gas volume must be added to these calculated values ): in this tabulation , note that the h - bop control flow rate is the volume rate of the liquid hydrodynamic - control fluid 72 flowing downward through the annulus 72 between the 2 ″ coiled tubing drill pipe and the 5 inch inner casing . the downward flow velocity of the hbop control fluid must be greater than the upward buoyancy migration rate of gas bubbles or gas slugs in this fluid . increased control fluid viscosity and gel strength will lower this gas migration rate and thereby decrease the control fluid volume rate of injection . also , the hydrodynamic barrier 41 just above the 8 commingling by - pass holes 27 will provide this required downward flow velocity of the control fluid 72 at this point with substantially reduced volume rate of injection of this fluid 72 . the example illustrated in fig9 is based on using a good quality 11 #/ gal . drilling mud for injection both down the drill pipe 75 ( inside 51 ) and down the h - bop control fluid annulus 72 between the drill pipe 51 and the 5 inch h - bop inner casing 22 . one of the objectives of this hydrodynamically controlled , down - hole , blow - out preventer is to establish a nearly fixed control pressure at the location of the commingled fluid mixing holes 27 near the bottom of h - bop inner casing 22 , as shown in fig9 . the h - bop control fluid 72 is a drilling mud with sufficient density to create the pressure gradient from 1 at the commingled mixing hole location 27 to the top 2 of the control fluid column 72 . this top of the control fluid column should be at a location below the well - head elevation , thereby resulting in a zero well - head pressure in the annulus 72 between the moving drill pipe and the stationary inner casing 22 . consequently , all drill pipe movement and operations can be conducted without using any stripping or snubbing pressure control equipment . this down - hole h - bop control system which maintains a nearly fixed control pressure 1 at location 27 in the casing will provide a controlled and continuous under balanced drilling environment between the two pressure profile curves 71 extending downward over the open - hole section below the location 27 of the fluid commingling mixing holes in the inner casing 22 , as shown in fig9 . the higher pressure of these two open - hole pressure profile curves 71 represents a low volume rate of gas production ( perhaps less than 1 mmcf / d ), whereas the lower pressure curve represents a higher rate of gas production ( perhaps several mmcf / d ). the commingling pressure profile curves 73 in the h - bop annulus above the commingling mixing holes 27 represents three different combinations of gas production rates 71 and h - control fluid 72 injection rates commingled at the holes 27 in the inner casing 22 . the discharge of the commingled fluids 73 at varying surface pressures is from t he annulus between casing 21 and casing 22 , which does not require any pressure seals between any moving parts . consequently , this surface discharge of the h - bop annulus commingled fluids 73 through control manifold and valves can be at almost any pressure desired or required . when the drill pipe is being tripped out of the drill hole for drill bit or equipment change and then back into the hole to resume drilling , the pressure profiles shown in fig9 are changed to approximately the pressure profiles shown in fig1 . the major difference between the pressure profile in fig1 compared with fig9 is the pressure profile 71 in the open - drill - hole section below the bottom 27 of the casing 22 . in fig1 , the lower pressure curve 71 represents the pressure profile resulting from a high rate of gas production ( i . e ., probably several mmcf / d ) blowing essentially all of the drilling mud out of the open hole below the inner casing 22 . also , in fig1 , the higher pressure curve 71 represents the pressure profile resulting from a low rate of gas production ( i . e ., probably less than 1 mmcf / d ) bubbling up through a portion of the drilling mud not blown out of this open - hole section . the operator can control the rate of injection of the h - control drilling mud 72 flowing down the inside of casing 22 and the surface pressure of the commingled fluids discharged from annulus 73 between the inner 22 and out 21 casings to maintain approximately the same gas production rate during the drill pipe trip illustrated in fig1 as existed during the drilling operation illustrated in fig9 . at no time is this gas production killed . the gas production continues at approximately the same rate or slightly higher rate during the drill pipe trip illustrated in fig1 as during the drilling operation illustrated in fig9 . after the drill pipe trip is completed with the drill bit back on bottom , drilling mud circulation down drill pipe 51 is slowly resumed until the prior observed drilling pressure profile of fig9 is reestablished . then the drilling operation can be resumed approximately as previously performed prior to making the drill pipe trip . it would be very desirable , either continuously or intermittently , to monitor the pressure both at the commingling holes 27 at the bottom of the inner casing 22 and near the bottom of the drill string 51 near the drill bit 53 . this pressure monitoring objective may be achieved by using either the currently available pressure pulse mwd transmission system or the electromagnetic mwd transmission systems . alternatively , an electric wire line can be attached to the outside of the inner casing 22 to provide monitoring of the pressure gauge at the commingling holes 22 at the bottom of casing 22 . also , the available echo - meter technology may be used to intermittently measure the depth from surface down to the top of the drilling mud in the annulus 72 between the drill pipe 51 and the inner casing 22 . when starting to drill slim hole below the inner casing 22 at about 7 , 500 - foot depth , the drilling mud may have a light weight of about 8 . 5 to 9 . 0 #/ gallon . in this initial slim hole drilling , this 8 . 5 to 9 . 0 #/ gallon mud may provide an approximately balanced drilling program where the pressure of the column of mud approximately equals the formation pore - pressure of the gas in the lance reservoir sands . however , as this drilling proceeds downward through the lance formation , the pore - pressure of the gas increases more rapidly than the mud pressure , resulting in an under balanced drilling operation where the formation gas is produced into the annulus drilling mud . the resulting gas cut drilling mud has a reduced density , resulting in increased underbalance of the annulus drilling mud compared to the formation pressure . to prevent excessive underbalance drilling operations , resulting in excessive draw down of the producing reservoir gas pressure , an increased volume of drilling mud is injected down annulus 72 to be commingled through the holes 27 in the casing 22 with the drilling mud and produced formation gas flowing up through the open - hole drilling annulus 71 . then the resulting commingled streams 71 and 72 will flow upward through the h - bop annulus 73 between the 5 inch inner casing 22 and the 7 ″ outer casing 21 , where high pressure stationary seals between the casing head and these two stationary casing strings permit the discharge of those commingled fluids out through appropriate surface manifolds , valves , and pressure control equipment . as needed for optimum under balanced drilling , the weight of the drilling mud flowing downward through both the drill pipe 51 and the drill pipe annulus 72 may be gradually increased to any weight needed to maintain a zero annulus 72 mud injection pressure and a suitable level of the drilling mud in the drill pipe annulus 72 while maintaining the desired near constant pressure values at the commingling zone 27 at the bottom of the inner h - bop casing 22 . fig9 is drawn to illustrate these control pressure values using an assumed 11 lbs ./ gallon drilling mud at a drilling depth of about 11 , 000 to 12 , 000 feet . during the drill - pipe tripping operation , the desired constant pressure ( 2 ) at the holes 27 in casing 22 and thereby the produced gas pressure profiles 71 can be maintained by either ( a ) inject sufficient - volume and density of drilling mud down 72 inside casing 22 to provide the pressure profiles shown in fig1 or ( b ) close a casing shut - off valve at the bottom of casing 22 or create a high gel strength high viscosity pressure balanced gel plug near the bottom of casing 22 to prevent gas from migrating up the column 72 inside casing 22 . by this mean all formation fluid production will be diverted out the holes 27 into the h - bop annulus 73 to create the pressure profile shown in fig1 . the use of the pressure balanced gel plug in column 72 near the base of the inner casing 22 provides a unique and valuable part of this invention . this gel plug is created and positioned by pumping a volume of pre - gelled fluid down the drill pipe 51 equal to about 500 feet of displacement volume inside the 5 ″ inner casing 22 , plus a volume of non - gelled fluid down drill pipe 51 equal to about 100 feet of displacement volume of the 5 ″ casing 22 while the drill bit is positioned about 600 feet above the commingling holes 27 near the bottom of casing 22 . this will position the gel plug to extend from about 100 feet below the drill bit down 500 feet to the top of the holes 27 near the base of casing 22 . this properly positioned pre - gelled plug is then held in this position until the gel fluid is fully gelled and / or cross - linked . if the pressure ( 1 ) at the holes 27 in casing 22 increases , then the gel plug is pushed up hole raising the level ( 2 ) of the top of the drilling mud column . then the surface discharge pressure from annulus 73 can be reduced by surface controls until the top of drilling mud column ( 2 ) inside casing 22 returns to its original depth and the pressure ( 1 ) at the holes 27 in casing 22 returns to its original value . if the pressure ( 1 ) at holes 27 in casing 22 decreases , then this gel plug will move - downward and the bottom portion of it will be eroded or extruded through the holes 27 in casing 22 and thereby destroyed . consequently , it is very important to monitor either or both the pressure ( 1 ) at the holes 27 in casing 22 or the depth to the top of the drilling mud ( 2 ) inside casing 22 to properly control the location of this gel plug . this properly positioned gel plug and the column of drilling mud above this gel plug provides the means to pull the drill pipe out of the hole with zero pressure on the drilling annulus and still have continuous gas production from the open - hole lance formation producing up through the h - bop annulus 73 between the inner casing 22 and the outer casing 21 and be discharged from this h - bop annulus at the surface through surface pressure control equipment . while running in hole with the drill pipe after tripping , this 500 feet of gel plug can be either drilled up with the drill bit and circulated out through annulus 72 or can be eroded and extruded through the holes 27 and th en circulated out through the h - bop annulus 73 to the surface . as the drill pipe is slowly lowered through the lance open - hole section , drilling mud is circulated through the drill bit to slowly restore in increments , the drilling pressure profile illustrated in fig9 . care must be taken to not allow the drilling mud pressure to exceed production drawn - down pressures of those previously drilled and produced reservoirs . when the prior drilling pressure profiles are restored , then drilling can b e resumed . during the well completion operations , the same pressure profile control must be maintained as described above for the drilling operations . after the drilling and well completion operations are finished , then a bridge plug may be set below the base of the inner casing 22 and this h - bop inner casing 22 can be pulled out of the well and reused for this same purpose in a subsequent well . the foregoing description of the present invention has been presented for purposes of illustration and description . furthermore , the description is not intended to limit the invention to the form disclosed herein . consequently , variations and modifications commensurate with the above teachings , and the skill or knowledge of the relevant art , are within the scope of the present invention . whereas , the example # 1 illustrates the application of the present invention to using a conventional drilling rig with jointed drill pipe for drilling the well bore , as configured in fig2 an alternative , slim - hole version of this well bore could be drilled using a continuous coiled tubing drilling assembly , such as described in example # 2 . conversely , the well bore , as configured in fig8 and as described in example # 2 as a coiled tubing drilled slim hole , alternatively could be drilled with a conventional drilling rig and jointed drill pipe . this present invention is applicable to drilling either normal sized drill holes or reduced sized slim holes with either jointed drill pipe on conventional drilling rigs or with continuous coiled tubing on slim - hole drilling assemblies . engineers skilled in the art of hydraulic fluid flow designs can readily adjust the desired volumetric flow rates used in each of the fluid flow paths ( i . e ., paths 71 , 72 , 73 , and 75 in fig1 , and 8 ) to achieve the flow velocities and pressure gradients needed to achieve the objectives of this invention as described herein . the embodiments described hereinabove are further intended to explain best modes known for practicing the invention and to enable others skilled in the art to utilize the invention in such , or other , embodiments and with various modifications required by the particular applications or uses of the present invention . it is intended that the appended claims be construed to include alternative embodiments to the extent permitted by the prior art .	4
the method and apparatus for assessing the quality of spot welds employs a rapid and robust algorithm for an acoustic or imaging systems . an acoustic microscope system such as one described in u . s . patent application ser . no . 09 / 283 , 397 , filed apr . 1 , 1999 and hereby incorporated by reference , is shown schematically in fig1 . the software and algorithms according to the invention rapidly analyze the information acquired by the acoustic device , and provide a go / no - go response to on - line workers in a real - time fashion . optionally , feedback can be provided to a welding control unit during the inspection process . the spot weld nugget is an anisotropic material with microstructures different from its base metal . with reference to fig2 , the study of acoustic wave propagation in the weld nugget includes metallurgical analysis and characterization of the mechanical and physical properties of weld nuggets , including dendrite structures and ferrous areas . further , the propagation and the interaction of focused acoustic beams inside the spot welds are also analyzed . from this analysis and characterization , the connection between weld nugget structures and the associated acoustic images are understood . the relationship between the acoustic information in spot welds and the quality of spot welds is learned through the study of the acoustic images , including information such as the profile of surfaces , shape and size of weld nuggets , and size of defects . after quantifying this information , it is formulated as a quality index of spot welds , whereby the acoustic image can be analyzed to extract the desired information . in order to quantify and analyze this information , the following three steps must be performed : first , mathematical morphology is used to improve the acoustic images by eliminating noise , improving geometrical shape , and reshaping important objects inside the spot weld . such morphology techniques such as dilation and erosion allow porosity to be grouped geometrically and permit the joint effect of group porosity to be studied . second , segmentation using a thresholding technique to distinguish desirable objects from noise , whereby the most important information is left for analysis . the threshold that separates the peaks on a color / gray level histogram is selected based on knowledge gained from the mathematical morphology . third , edge detection is used to distinguish discontinuity information inside the nugget from the nugget area , and to build up clear and continuous boundaries for those objects . after edge detection , the boundaries obtained in edge detection are used to calculate the area of the desired information . spot weld quality indexes , for correlation with acoustic image parameters , are established through destructive testing . these quality indexes can include the strength of the weld , the nugget size , and a quality judgment based on an expert opinion . the study of the parameters can be approached as a two step process . first , the parameters are analyzed statistically , such as through an analysis of variance ( anova ) method . this contributes to the selection of significant parameters to build up the quality index for welds . after the statistical analysis , a mathematical relationship is built between the weld index and the quantified information . second , the relationship between the weld quality and the screened parameters from the first step are established using artificial neural networks and non - linear regression methods . the artificial neural network method is used to determine the weld index as a non - quantified good / bad judgment , and to establish the relationship between these non - quantified judgments and the quantified weld index information . the non - linear regression method , targeted at simpler weld quality indicators ( e . g ., the size of welds ), is used to build a mathematical relationship between the weld indices obtained in the first step and the quality indicator . by importing the extracted knowledge into a control mechanism , a portable hand - held acoustic device according to the invention provides an intelligent mechanism for spot weld inspection . the quality evaluation methods provide reliable results , the statistical method provides a nugget diameter predictor , and the neural network model determines nugget integrity . regardless of which model is adapted , the portable acoustic device serves as an on - line advisor for workers , and provides closed loop feedback to a robot welding control system . the method and apparatus according to the invention preferably employs an acoustic microscope ( am ) 10 , which has three - dimensional imaging capability . with reference to fig3 , the am 10 includes an acoustic pulse receiver 20 and generator 30 . the pulse generator 30 generates an electrical pulse , and the receiver 20 collects reflected signals . the acoustic wave generated can be a continuous pulse or a short pulse , depending on the system requirements . in the case of matrix array probe , the sam 10 is connected to an acoustic probe 50 by a multiplexor 40 . the acoustic probe 50 includes a planar focus matrix array transducer . most transducers use a piezomaterial element with an optical quality ground lens to provide the desired quality of acoustic beam alignment and focusing . as a contact with sample used either coupling liquid or polystyrene delay . the material of the acoustic lens should have low attenuation and high velocity to minimize aberrations . the probes are designed for operation with the acoustic beam into various frequencies from 5 mhz to 2 ghz . the transducer converts electric pulses into mechanical vibrations or vice versa . the precision of the acoustic beam focus primarily depends on spherical aberration ; consequently , the spherical aberration itself depends on the ratio of the ultrasound propagation velocities in liquid and the velocities inside the sound - guide in the transducer . the am 10 uses a coupling fluid , which provides the acoustic waves a medium to support their propagation . between the acoustic probe 50 and a test specimen 100 , the medium must be a fluid to allow the scanning procedure . two major concerns in choosing a couplant fluid are the fluid &# 39 ; s attenuation to acoustic waves and its applicability to the test specimen . the performance varies under different coupling fluids and different temperatures . of all the coupling fluids , water , ultrasound gel and ethanol are the most preferred . the am 10 is a computer - controlled ultrasonic scanning system designed for examining the detailed internal structure of a wide range of parts . an am 10 generally includes : a piezoelectric transducer to generate a high radio frequency acoustical pulse and an acoustic probe , both components included in the acoustic probe 50 , with a liquid coupling medium for the pulse to propagate through ; an electronic or mechanical scanning system 60 that can relate to the desired region in reliable steps ; a memory unit 70 to store the achieved signal step by step ; an analog to digital converter 80 to transfer signals to images ; and a monitor to display images 90 . the performance of the am 10 depends on the frequency of the ultrasound wave , type of transducer , the nature of the immersion medium , and the properties of the investigating materials . the nature of the frequency of ultrasound affects the resolution of microscopic imaging and the depth of penetration , but in a contrary way . a higher frequency of ultrasound offers a better resolution microscopic image , but shallower penetration of the testing samples . thus , to choose a proper frequency of ultrasound for a particular testing example requires a compromise between the resolving power and the degree of penetration . the microstructure of the nugget region of a spot weld is considered an anisotropic region . in order to assess spot weld quality , it is crucial to formulate the phenomenon of acoustic wave propagation in anisotropic materials . when a weld is deposited , the first grains to solidify are nucleated by the unmelted base metal , and the orientation of crystal grains is in the same direction toward the steepest temperature gradient . while solidifying , metals grow more rapidly in certain crystallographic directions , and the direction of crystal growth is perpendicular to the isotherms . hence , favorably oriented grains grow faster for substantial distances , while the faster growing grains block the growth of others in a non - favorable orientation . the aforementioned favorable crystallographic direction is the [ 100 ] direction in cubic crystals , such as body central cubic or face central cubic . the [ 100 ] direction is the least closely packed direction in cubic crystals . the [ 100 ] crystals &# 39 ; growth directions and the direction of the steepest temperature gradient are the same in a spot weld because there is no welding speed involved . because of the crystals &# 39 ; growth directions , weld pools solidify in a cellular or dendritic growth mode depending on the composition and solidification rates . both modes cause micro - segregation of alloying elements . as a result , the weld metal may be less homogeneous than the base metal . during the welding solidification , three stages of microstructure formulations can be found . in the first stage , epitaxial growth from the base metal is likely to occur initially in the planar growth front because the temperature differences inside a weld range have an extensive range . in the second stage , during further cooling , the temperature gradient decreases , resulting in a planar to cellular microstructure transition . in the third stage , when the temperature gradient further changes , the primary cellular microstructures become unstable and develop secondary arms called dendritic structure . having reviewed wave propagation in an isotropic material and a primitive anisotropic material , wave propagation in the nugget of a spot weld , which is a hexagonal symmetric case with five elastic constants , will now be described . the spot weld nugget is an irregularly shaped artifact with rough surfaces on both sides , and its metallurgical structure is different from the original sheet metal . moreover , the existence of discontinuities , porosity , and inclusion inside the weld nugget makes the acoustic wave propagation more difficult to study . the solidification processes in welds affect the crystallographic orientation . the direction of the grain growth follows the steepest temperature gradient , and the crystal growth direction is the [ 100 ] direction of the cubic crystal . thus , for a spot weld , the examining acoustic waves are going through the [ 100 ] direction of the dendritic crystals . fig4 and 5 demonstrate the temperature distribution in both theoretical and experimental analysis . fig6 shows the possible crystal growth direction in the spot weld nugget , which will be on the equiaxed grain . because acoustic waves propagate through the [ 100 ] direction of the spot weld nugget in the core of the nugget , we can substitute the direction unit into the above equation as l = 1 , m = 0 , and n = 0 . we can derive a simplified wave propagation model as : the longitudinal wave speed and the direction calculated here is proven to be correct in kupperman , d . s ., reimann , k . j ., “ ultrasonic wave propagation and anisotropy in austenitic stainless steel weld metal ”, ieee transactions on sonics and ultrasonics , vol . su - 27 , no . 1 , pp . 7 - 15 , 1980 , hereby incorporated by reference in its entirety . however , the shear waves traveling across the dendrites region with the polarization direction parallel to the dendrites will have a different attenuation pattern compared to the shear waves propagating in other directions . the dendrites in spot weld nuggets are long , cylindrical single crystals with orientation in the vertical [ 100 ] direction . assuming the dendrite &# 39 ; s cylindrical crystal is symmetric about the z - axis , as shown in fig6 , the general orthorhombic symmetry object can be reduced to be hexagonally symmetrical . the independent elastic constants are reduced from nine ( 9 ) to five ( 5 ) according to kupperman and reimann &# 39 ; s study . the five independent elastic constants can be calculated by the modified formula as : c _ 11 ⁢ d = c _ 22 ⁢ d = c _ 11 + 3 ⁢ γ ⁢ ⁢ c 20 c _ 33 ⁢ d = c _ 11 + 2 ⁢ γ ⁢ ⁢ c 5 c _ 44 ⁢ d = c _ 55 ⁢ d = c _ 44 - γ ⁢ ⁢ c 5 c _ 66 ⁢ d = c _ 44 + γ ⁢ ⁢ c 20 c _ 13 ⁢ d = c _ 23 ⁢ d = c _ 12 - γ ⁢ ⁢ c 5 c _ 12 ⁢ d = c _ 12 + γ ⁢ ⁢ c 20 where λ is the texture anisotropy factor and c can be calculated as : c = c 11 − c 12 − 2c 44 . detailed description can be found in dewey , b . r ., et al , “ measurement of ansiotropic elastic constants of type 308 stainless - steel electroslag welds ”, experimental mechanics , vol . 17 , no . 11 , pp . 420 - 26 , 1997 , and ekis , j . w ., “ ultrasound examination for resistance spot welds of filter connectors ”, materials evaluation , vol . 52 , pp . 462 - 63 , 1994 , hereby incorporated by reference in its entirety . there are two ways to calculate the elastic constants for the spot - weld type of anisotropy . the first one is to use static tensile testing and the second one is to use acoustic testing . according to the first method , samples cut in three principal local directions are fabricated . tensile tests are then applied at different direction cosines . the longitudinal elongation and the laterial contraction are then measured . finally , a strain - stress relationship is used to calculate the components of the stiffness matrix . the second method , the acoustic testing method , starts with a fresh cut sample to allow precise directional measurement . then the acoustical velocity is measured relative to a certain locally preferred solidification direction . following this , the method continues with another fresh cut sample . the acoustical velocity is measured relative to another preferred solidification direction . when the directional acoustical velocities have been recorded , the elastic stiffness matrix can be obtained by the christoffel equation . details of these procedures can be found in the study of dewey et al . because the grain growth in the weld nugget is in the [ 100 ] direction in the core region , the behaviors of the acoustic waves can be anticipated . however , in other regions of the weld nugget , the microstructures of equiaxed grain growth make the prediction of acoustic wave behaviors difficult . due to the irregular shape of the nugget , the microstructures in non - core regions of the weld nuggets are equiaxed yet randomly arranged . this affects the pattern of acoustic wave propagation , for example , by misguiding the acoustic waves and return bias signals . the other major factor affecting acoustic wave propagation is the haz of the weld . the haz has usually been recrystallized and its microstructures have been changed , which results in a re - focusing of the acoustic beam and therefore misinterpretation . furthermore , the melted coating material will produce contact between the base metals and allow the acoustic waves to pass through . this may change the results of the analysis of the weld nuggets . in some cases , a deep indentation of weld nuggets can re - focus the acoustic beam and produce signal - free regions . the irregular shape of the nugget raises an interpretation problem for the acoustic method mathematically . an experimental model to predict spot weld quality based on its acoustic information is to be established . by correlating the acoustic parameters and the results from experiments , a reliable index of weld quality can be established . the results of acoustic image analysis are sets of pixel - based pictures with abundant information that allows us to scrutinize the detail of every aspect of the metallurgical and acoustic properties of each spot weld in the study . the acoustic microscopy method can provide the information about quality of spot weld nuggets by examining the non - homogeneous objects inside nuggets such as : bubbles , inclusions , explosive welds , and porosity . the non - homogeneous objects inside , and the surface indentation , guide the acoustic waves and provide a pseudo - acoustic - image for welded nuggets . there are two different types of studies performed for the validity test of the acoustic method . the first one is to verify the results of the acoustic method by using another non - destructive method . the second one is to test the ability of the acoustic method by describing the detection of artifact defects . in the first test , the commonly used optical examination procedure is employed as the tool for verifying the result of the acoustic test . the advantages of an acoustic test is that it permits internal examination of structure , but has the disadvantage that the measurement results need to be calibrated . the optical test has the advantage that it allows visual inspection of nugget size but only surface information is obtained . this approach is aimed at the calibration between the optical method and the acoustic microscope method . instead of peeling the spot weld samples , this approach works on “ peeling nuggets .” the procedures of this approach will be described as follows : 3 . perform acoustic inspection of spot weld samples from both sides . 4 . examine the peeled nuggets from the selected side by the optical method . examine the peeled nugget from both sides by the acoustic method . the acoustic signal windows should be set close to the selected side of the nugget . this step will help to examine the correlation between the acoustic method and the optical method . 5 . peel the nugget into thinner tables , and repeat steps 2 through 4 . 6 . continue peeling the nugget until the desired thickness has been reached . 7 . calibrate the results from the optical method and the acoustic microscope method . three types of welds , categorized by their stack up , were examined to verify results : type 1 ( 0 . 03 ″ stack on 0 . 045 ″), type 2 ( 0 . 04 ″ stack on 0 . 06 ″) and type 3 ( 0 . 06 ″ stack on 0 . 07 ″). two welds of different welding parameters were produced on type 1 , and two and four welds on types 2 and 3 , respectively . for type 1 and type 2 , the acoustic estimation of the nugget diameter typically closely approximates the diameter determined by the optical method . for type 3 , with thicker base metals which need a longer heating process during welding , the haz region is larger than type 1 and 2 . the haz affects the microstructures while recrystallization substantially affects both non - destructive tests . for optical examination , the haz reacts to the etching process , and produces larger images . in comparison , a ring - shaped region is observed by the acoustic method . with reference to fig7 , to study the acoustic image , four practical steps are employed to convert the information into quantities for further studies . first , mathematical morphology is used to characterize geometric structure by numerical value . this method is usually used prior to image recognition and pattern identification to improve the geometric shapes of objects inside an image for further study . the purpose of the process is to filter out information not related to objects . the operations of morphology are dilation , erosion , opening and closing . the effect of the dilation operator on an image is to enlarge the boundaries of selected objects . the effect of the erosion operator on an image is to erode the boundaries of selected objects . the opening operation includes performing erosion followed by dilation . the closing operation includes performing dilation followed by erosion . dilation and erosion operators are used to emphasize the discontinuities inside nuggets . the definition of dilation and erosion operations and their mathematical representation is listed in fig8 . after the acoustic images have been readied for further examination by morphological processes , the thresholding method is used to separate out the interesting objects inside welds , such as weld nugget size , nugget shape , porosity , and inclusion . this algorithm converts a multi - gray - level image into an image containing fewer gray - level values . the operation defined for three gray - level regions for separating noise of image , nugget area , and discontinuities inside nuggets is : g ⁡ ( x , y ) = { g 2 ⁢ ⁢ if ⁢ ⁢ f ⁡ ( x , y ) 〉 ⁢ t 2 g 1 ⁢ ⁢ if ⁢ ⁢ t 1 ≤ f ⁡ ( x , y ) ⁢ 〈 t 2 g 0 ⁢ ⁢ if ⁢ ⁢ f ⁡ ( x , y ) ≤ t 1 } where f ( x , y ) represents the original image ; g ( x , y ) is the image after thresholding ; t 1 and t 2 are thresholding values ; and g 0 , g 0 and g 2 are the values of gray - level . after thresholding , edge detection is performed . this process helps separate objects in acoustic images . the edges of objects are distinguished by the discontinuities or abrupt changes in gray - level intensities . since the gray - level numbers have already been reduced during thresholding , the edges between objects inside the weld nugget are quite clear . several other data processing techniques can be used to further enhance the ultrasonic images . these techniques include usage of weighted calculations for ultrasonic signal processing , tilt compensation , surface peak calibration , and time - of flight compensation . usage of weighted calculations allows distinguishing poor measurement conditions from good ones . for example , when the transducer is not in a contact with the sample or the surface condition does not allow getting correct measurements , the algorithm will indicate that the measurement is impossible . while standard methods would normally produce a result in any case , it would appear completely inconsistent with reality . for example , in the case of a spot weld , this could lead to the erroneous detection of a normal weld when the weld is in fact undersized . this functionality is achieved with weights , which specify the degree of reliability of the data . critical data items are accompanied with this additional weight parameter . ranging from 0 up to 100 %, it specifies the degree of reliability of the data stored in a corresponding item . there are several stages in the data processing pipeline that might change the weight ( s ) associated with the processed data ; mainly weights associated with different transducer elements ( different a - scans ) are updated during the surface peak detection , based on its signal - to - noise ratio . if the surface peak is indistinct ( its amplitude is close to the noise level ), the algorithm may reject the channel from further consideration by attributing zero to the corresponding weight . on the contrary , peaks with normal amplitudes are subjected to following data processing stages with 100 % weights . a - scans having indistinct peaks are marked with intermediate weight values ranging from 0 % up to 100 %. in the case of the spot - weld measurement , interpretation of the final result ( the nugget diameter ) is quite straightforward . for example , if it has 95 % weight , it means that the measurement is likely to be consistent ; on the contrary , the low weight of the final result would indicate that the device most likely could not measure the nugget size and the operator has to repeat the measurement . the tilt compensation method reduces the angular dependence for small , unfocused elements of the matrix transducer . after the algorithm has found the positions and amplitudes of the surface peaks , it measures a global tilt of the surface sample with respect to the transducer surface , which is approximated as a plane . this is done with weighted bilinear regression . using the empiric tilt - amplitude calibration curve , it computes a factor to compensate the amplitude drop due to the tilt . the value of each sample point in each a - scan is multiplied by that factor . this calibration factor is a global value , and is applied for all transducer channels . this allows receiving c - scans with more stable amplitudes that are less dependent on the transducer tilt . the calibration curve is built as a result of a series of measurements on flat - parallel sheets of metal , mapping the amplitude of the signal received from the back face of the sheet . surface peak amplitude calibration is a calibration method that works under assumption that a sample consists of a uniform material . for each transducer channel , it calculates an amplitude multiplication factor that depends on the amplitude of the surface peak . the factor is calculated so that after multiplication , the amplitude of surface peaks are the same for all channels . this calibration method partially compensates for variations of amplitudes due to local surface conditions ( i . e ., topology variations ). time - of - flight ( tof ) compensation is useful since , due to a large difference in the velocity of sound in immersion and in steel , direct mapping of the time axis of an a - scan into the depth is impossible . the sound travels through immersion much slower than it does in metal , and each small variation in immersion thickness causes sufficient displacement of the following signals along the time axis . tof compensation involves shifting each a - scan along its time axis so that the position of surface peaks becomes the same for all channels . this ensures that the c - scan is acquired from the specified depth range relative to the surface . an analogous effect may be achieved by varying the signal gates position according to the surface peak position . the tof compensation method stabilizes the range of depths from which the signal is acquired . the acoustic imaging method provides abundant information after image extraction . however , this information consumes a major part of the processing resource and is computationally exhausting . thus it is desirable to limit the parameters that will be used in determining weld quality . in a preferred embodiment of the present invention , the parameters used include nugget diameter , depth of indentation , and area of reflectors inside nuggets . the ideal quality identifier is the strength of the weld nuggets . quantity is difficult to measure and will vary from process to process . consequently , a substitute quantity — the diameter measured from the destructive test ( peel test )— is used for analyzing the welding quality . these quantity factors are determined as follows . first a group of selected welding coupons is chosen . next , a b - scan and c - scan images from the newly developed acoustic device is captured . a group of parameters is selected according to existing knowledge . destructive tests are conducted on these samples . the nugget diameters of the peel test result are then measured . the anova technique is used to screen out the insignificant parameters . finally , the nugget strength indicator is built up by correlating significant parameters to the nugget diameters produced by peel tests . for a three variable system , α , β , and γ are related to the nugget diameter s . the linear model will be : s = c 1 + c 2 α + c 3 α + c 4 γ + c 5 αβ + c 6 αγ + c 7 βγ + c 8 β 2 + c 9 α 2 + c 10 γ 20 after the formulation , an anova table can be established to investigate the significance of these variables . thus , some of the insignificant parameters can be filtered out . the anova provides the inferential procedure for testing the statistical hypothesis . one of the ways to judge the significance of each variable is by assessing the character of the f - score . a level of confidence for the significance test can be set , for example , as either 95 % or 99 % to select the variables which are to enter the next stage . either the linear multiple regression or the non - linear multiple regression method is then used to establish the constants associated with the acoustic parameters . a variety of commercial software exists for solving non - linear regression . most of them follow this procedure : an initial estimation for each variable is made and a curve defined by the estimation is generated ; the variables adjusted to fit the curve closer to data points using algorithms such as the marquardt method ; the curve is further adjusted to make it closer to the data set . once the pre - set error limit is reached , the procedure is stopped and results are reported . through these procedures , a set of significant parameters are determined and their coefficients found . consequently , the diameter of the weld will be predictable through the cumulative relationship , which will be an indicator of the spot weld quality . to assess a spot weld by a general description such as a good / marginal / bad weld ( instead of a more specific index , like bonding strength ) an artificial neural network ( ann ) is used . this general description is desirable as a criterion that can be easily adopted into industrial standards . ann were originally designed as a model to simulate how the human brain works . with reference to fig9 , the ann is a simplified model that simulates human information passing behavior by artificial neurons . each neuron has input and output which are related to the state of the neuron itself , a threshold function to decide on the input - output relationship , and unidirectional connection communication channels which carry numeric ( as opposed to symbolic ) data . with reference to fig1 , the neural network model of the present invention is a three layer feed - forward model trained with the backpropagation method with logistic function as the activation function . the logistic threshold function is : 1 f ⁡ ( x ) = 1 + ⅇ - x the back propagation method is desirable because it is easy to apply to a practical problem such as the problem examined . this algorithm has been proven as very robust for training multiple layer networks . it is also desirable because it is very effective when the relationship between input / output layers is nonlinear and the training data is abundant . according to a preferred embodiment of the present invention , there are i quantified parameters , j hidden units , and three output units ( representing good / marginal / bad welds ). w ij stands for the weight between input layer i - th unit and j - th unit of the hidden layer . the activation function here has a special property such that f ( x )= f ( x ) ( l − f ( x )). the steps of the back propagation method of the present invention include : 3 . computing the output layer error , where the output differences are equal to the desired values minus the computed values . for the i - th component of error at the output layer : 4 . computing the hidden layer error . for the i - th component of error at the hidden layer : 5 . adjusting the weights for the second layer of the synapses . for the i - th neuron in the hidden layer and the j - th neuron in the output layer : 6 . adjusting the weights for the first layer of the synapses . for the i - th neuron in the input layer and the j - th neuron in the hidden layer : steps 1 though 6 are then repeated on successive training data until a specified value of output layer error is achieved . in the above described backpropagation equations , x , y , z are vectors for the output neurons in the input layer , hidden layer , and output layer , respectively ; w 1 and w 2 are weight matrices between the input - hidden layer and the hidden / output layer ; ρ is the desired output vector ; θ and t are vectors for errors in the output and hidden layers ; θ and τ are vectors of the threshold or bias value for the hidden layer and the output layer ; and μ and λ are learning rate parameters for the hidden layer and the output layer . the back propagation network has the ability to learn any arbitrarily complex nonlinear mapping . with respect to the statistics method , the proposed feed - forward method with one hidden layer is a very close projection pursuit regression . in the preferred embodiment of the present invention , the software acts as an analyzer with image processing tools . it performs neural network training and testing functions . users can load images , perform basic image processing techniques , run default operations ( thresholding / dilation / area calculation ), prepare ann training data , train ann , prepare testing data , and test ann results . in another mode of operation , the software , the software performs spot weld quality examination on pre - trained ann . the above system and methods will now be illustrated with several examples . these examples include examined specimens produced under carefully controlled welding parameters ( welding current , electrode pressure , and holding time ) and identical metal conditions ( e . g ., surface coating , thickness ). due to the continuous hardware improvement , weld specimens were separated into three groups chronologically . the first group , with c - scan images as the results , was examined earlier by ultra - short pulse scanning reflection acoustic microscope ( spsam ). the quality of these specimens was certified by experts from the best to the worst as setup , nominal , minimum , less than minimum , and stick weld , respectively . the minimum quality is the bottom line of an accepted weld . the second group , with c - scan images as the results , was examined by spsam as well . this group was peel tested and served as the verification group to test the artificial neural networks ( ann ) model built by group one . the specimens of group three were examined by both the portable hand - held microscope and spsam . non - destructive acoustic tests were applied to specimens and acoustic information was recorded . then destructive testing was conducted on the second and third groups of specimens for conventional nugget diameter measurement . through destructive tests , the nugget size of each spot weld was found . this information was then integrated into the results together with the parameters recognized by a method described below . the experimental procedures for the specimens are listed in fig1 . two types of metal stack up were studied : type i ( 0 . 03 ″× 0 . 045 ″) and type ii ( 0 . 04 ″× 0 . 06 ″). the criteria for identifying weld quality by experts for each metal stack up is based on the size of the weld nugget . the criteria are listed in fig1 . fig1 lists exemplary results obtained by the acoustic image measurement and analysis methods detailed above . these results involve the quality indicator ( e . g ., setup , nominal , minimum , less than minimum , stick ) and will be adopted in the ann model developed for this study . among these specimens , 120 samples including 24 setup , 24 nominal , 24 minimum , 24 less than minimum , and 24 stick were chosen for each type of stack up to train the ann . the other 75 samples for each type were used to test the neural networks model . in type i stack up , all 75 samples match the actual weld quality of the ann corresponding model . for the type ii stack up , 71 out of 75 samples match the weld quality of the corresponding ann model . the results indicate a coherent performance for this model based on expert knowledge . the results of type ii are plotted in fig1 - 16 according to the selected acoustic parameters ( area , maximum nugget diameter , and minimum nugget diameter ). there exists no clear boundary between weld quality by considering a single parameter . for example , in fig1 , the range of “ minimum ” quality and “ less than minimum ” quality are overlapped between 20 and 30 . in other words , the quality of weld cannot be decided by a single acoustic parameter . the following set of examples include one type of metal stack up ( type i , 0 . 03 ″× 0 . 045 ″). this group of specimens is acoustically examined and peel tested . the acoustic c - scan images are used to test the corresponding ann model built by the specimens of group one . the verification is 100 % consistent to both ( peel test and ann ) models . the results are listed in fig1 . in this set of examples , the three parameters chosen for analyzing the weld quality are surface indentation , nugget diameter ( measured from the acoustic method ), and the total inclusion size inside the nugget . the data of these parameters and the results from the peel test are included in fig1 . the experimental result is normalized and plotted in fig1 to provide visual assistance for choosing a proper interpretation of the weld quality . there is no significant relationship between the normalized data and the diameter measured from the peel test . the only parameter capable of portraying the relationship is the distance between the weld boundaries , the order of which cannot be decided since the coefficient of determination of the first and second order equations are so close . therefore , both linear and nonlinear regression models are tested for determining the suitable model . the appropriate model is then used to carry out the magnitude of the coefficients of the equation . these three variable systems , α , β , and γ , which represent indentation , acoustic diameter , and inclusion , respectively , are related to the diameter from peel test d . the linear model is : d = c 0 + c 1 α + c 2 β + c 2 γ + c 4 α 2 + c 5 β 2 + c 6 γ 2 + c 7 αβ + c 8 βγ + c 9 αγ the coefficients of the linear and nonlinear regression models are shown in fig2 , and the results are plotted in fig2 and fig2 , respectively . fig2 demonstrates that the polynomial model with ten ( 10 ) constants is a closer prediction . the f - score of this model is 170 . 36 , which is substantially greater than the f - critical value of 2 . 17 . therefore , this regression model is useful in predicting the diameters measured by the peel test . the sum of the residual square is reasonably small at 4 . 28 . to reduce the calculation efforts of this model , a t - test for the statistical significance of each parameter is performed . the significance level is chosen as 95 %, and the t - value is 1 . 645 , which suggests that some of the terms are insignificant . hence the reduced equation can be rewritten as : d = c 0 + c 1 α + c 2 β + c 3 α 2 + c 4 β 2 + c 5 γ 2 + c 6 αβ the new model provides an explanation without losing much of the generality of the observed diameter with the coefficient of determination equal to 0 . 969 . the sum of the residual square is 5 . 755 . through these procedures , a set of significant parameters is determined their coefficients are retrieved . the peel diameter of the weld will be predictable through the cumulative relationship , which will be an indicator of spot weld quality . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	6
fig1 depicts a computer system and network 100 suitable for implementing the system and method of providing a social customer care system . a server computer 105 includes an operating system 110 for controlling the overall operation of the server 105 which may connect through a communications network 170 to one or more communication conduits ( social networks ) 160 , a web - based response portal 165 , a user &# 39 ; s browser application 175 and local computers 180 having a user interface device . the server computer 105 hosts a software as a service ( saas ) application comprising the social customer care system platform 115 . the server 105 can also be connected to a customer service agent 185 either through a local communication network or through the communication network 170 . the server 105 allows for the connection of the social customer care system 115 to one or more existing crm systems 195 , marketing intelligence systems 90 and to commercial databases including knowledge databases 95 and crm databases 85 . the customer service agent 185 may also have access to local databases 190 that store various customer records and other information . the social customer care system 115 comprises multiple software applications including an enterprise workflow application 120 , a response portal application 135 , a conversation consolidation and management application 125 , dynamic scoring application 130 , an incentive based social evangelism application 150 , an identity unification application 140 , a quickstart process application 145 and a customer resolver matching application 155 . the social customer care system 100 may operate in real - time to allow for immediate processing of and responses to customer entered questions and problems initiated at a social network communication conduit 160 . the enterprise workflow application 120 provides a configurable software application client for setting up business rules and controlling and coordinating the actions of the modules of the system and method of the social customer care system 115 . the enterprise workflow also controls input to and output from external systems such as social networks 160 , crm systems 195 , marketing intelligence systems 90 and controls access to data such as customer records that may reside in crm databases 85 , knowledge databases 95 and local databases 190 of information available to agents 185 and other users of the social customer care system . the customer response portal 135 provides the functionality for the customer service agent 185 to send a response to a customer through a communication network 170 via the customer &# 39 ; s chosen social network communication conduit 160 . it allows a full response even though the communication conduit 160 may have data and message length restrictions . it allows for customers to take a survey or complete a questionnaire and to otherwise rank and report on service they have received . it does so by providing a shortened link back to a saas application web - hosted and business branded response portal 165 where customers can see more details about the answer to their support request , view knowledge - based articles , see related posts and answers and answer questions about the material provided or the customer service agent &# 39 ; s service . parts of the response portal 165 can be private and confidential for the particular customer and part of the response can be made available to the public . the conversation consolidation and management application 125 provides the functionality for joining multiple public comments about a product or brand in one threaded conversation . public comments , particularly by influential customers or prospects may positively or negatively influence the reputation of a business or the reputation of its products and services and thus have a large impact on the bottom line . in the realm of customer service , to insure proper “ closure ” and a satisfied customer , all parts of the conversation are visible and chronologically ordered . if escalation is required , the entire “ conversation ” ( interaction ) should be transferred as a cohesive unit . the present system and method allows the detection with high probability that different messages from varied sources such as social network communication conduits 160 and usernames are all from the same individual and all part of the same larger conversation . by consolidating customer messages and interactions into one cohesive conversation , the customer service organization is provided a complete picture of present and historical customer interactions with the business . the dynamic scoring based on customer business context application 130 provides the functionality for placing customer comments about the products and services of a business in context . the present system and method analyses the business , its industry and related product categories using the business &# 39 ; s own website and public web content . it forms conclusions using scoring heuristic algorithms that allow better prioritization and disambiguation of comments made about the business or its products and services . agents 185 can validate or override scoring heuristics and the system self - learns to provide better customer service and responses . the incentive based social evangelism application 150 provides the functionality to allow a brand &# 39 ; s customers to place a coupon generation widget or code snippet onto one or many webpages , such that their friends and colleagues see an offer that is recommended by someone they trust . users can use the widget to print a custom , uniquely encoded ( for closed - loop tracking ) coupon , which gives them a discount or other benefit at the promoted merchant . each time a friend or social contact uses ( consumes ) a coupon printed from one of the widgets , the consumer that posed the coupon may be given some form of compensation . the identity unification application 140 provides the functionality for allowing the social customer care system 115 to use data from an existing user profile , called a known reference profile ( krp ) from a customer database such as a crm database 85 or online social community to locate similar profiles across other social networks 160 and database management systems . statistical correlation algorithms use the data gathered to predict which profiles belong to the same individual . for example , a browser may be currently viewing a linkedin profile or crm record of a known customer ( the krp ). upon command ( such as clicking an available button or activating a pull - down menu ), the application 175 extracts key information about the customer from the page such as name , address , hometown , birthdate , employer , college and the like . this application 175 then uses certain values collected to search other social networking sites 160 such as facebook , twitter , google plus and the like for people with similar names . as each list of results comes back , the identity unification application 140 extracts values from those found profiles as well . it then runs a similarity algorithm and predicts which profile from each additional site is most likely to be the same person . it stores this information in a database 190 along with various scoring artifacts . each time a different client runs the calculation , similar results are scored . there are various types of validation thresholds . the first is a certain hit where a unique value found matches another unique value ( such as a user &# 39 ; s email address ). the second is a high - enough correlation score resulting from initial equivalency type algorithms . the third is enough human reviews of the information to verify the same identity . finally , if none of the above validation events occur and no human has indicated this is not the same person , then once a threshold of “ same matching hits ” occurs without the person being connected to someone else , the system assumes it is the same person and no further searching is required . the quickstart process application 145 provides the functionality for scoring the relevancy and priority of product and brand mentions data taken from social media postings . it creates a weighted list of certain keywords to automate the process of routing social posts to the correct support agent or team . it comprises allowing a weighted list of product - related words , phrases , model numbers and the like to be designated as domain specific vocabulary ( dsv ). the present system and method allows the dsv to be automatically assembled rather than manually assembled to be able to configure the scoring and routing process . since this can occur in real - time it is more efficient , does not require manual labor and avoids errors associated with such manual labor . the system and method can begin with only company name and vertical industry of the company . the application crawls the internet , capturing related terms , phrases , model numbers , executive names , and other key data . its algorithms cluster these terms in buckets according to frequency , sentiment indicators and proximity to product or model names . after the clustering , the application runs a second clustering algorithm ( bi - clustering or co - clustering ) to select and weight the terms for placement in the dsv . the results may be displayed for manual confirmation or adjustment by a human 185 or the results can automatically update the dsv with the data derived from the process without human intervention . the consumer resolver matching application 155 provides the functionality for finding other consumers that have had the same problem as that being faced by the current consumer . the two users can be connected directly for self - service and save the cost of a paid - agent resolution or the current consumer can be redirected to the solution documentation created for the original consumer . this content typically resides either in the knowledge base , the community forums or on the response portal ( which is the public - view of the data contained in the whole system described herein ). fig2 illustrates a functional block diagram 200 of an embodiment of the present invention . the social customer care system 205 and its enterprise workflow fig1 provide the functionality for matching , prioritization , workgroup management and routing 210 of customer care requests and problems from social media websites fig1 . the social customer care system and method 205 may be a real time system with continuous self - learning capability , designed to discern the context of each social interaction and automatically determine the optimal support channel to provide the best customer service experience . it can be delivered as a saas - based data service technology platform . the social customer care system 205 provides for agent engagement 215 , knowledge base information lookup automation 220 and expert agent engagement when necessary 225 . the social customer care system 205 integrates with crm systems 255 to allow access to customer records 250 and makes the results of the social care interaction available to the crm systems 255 and to marketing intelligence systems 260 . the social customer care system 205 uploads and downloads information to and from related support forums and applications 230 such as customer support forums 235 , databases containing knowledge - based articles and information 240 and support notes 245 as well as from crm applications . fig3 a and 3b are flow diagrams of the customer response portal function processing 300 . the customer response portal 300 includes a response function ( or widget ) in its web client user interface that acts as a broker to send agent responses through an application server which dispatches and tracks the responses to the third party communication conduit ( for example twitter , facebook and the like ). the customer response portal application 300 receives a broadcast of a support request from a customer via a third party social network communication conduit 305 and displays the threaded - history of a conversation that originated on the social - web , and occurred between the customer and the social support agent 305 . the system response portal assigns and tracks the support request to an agent 310 by placing the post in an available queue so that the next available agent can claim it and begin the conversation . the agent researches , collates documentation , reviews , customer history and makes decisions about customer entitlement ( offers or coupons ) 315 . the agent crafts a response and sends through the present system it to the customer via a social network communication conduit 320 . all communication and other conversation history data is stored in the system database and is available for retrieval , processing or display by any of the system components . if the total length of the response exceeds the limits of the social network communication conduit 325 , then the system &# 39 ; s response portal function will store the full contents of the message for display on the response portal , truncate the message to comply with the limits of the communication conduit and insert a url weblink to the response portal webpage 330 and processing continues in step 335 with the sending of the message to the social network communication conduit . the message recipient on the social network can click the url to view the full conversation thread and message payload within the response portal . if total length of the response does not exceeds the limits of the social network communication conduit 325 , then processing continues in step 335 with the sending of the message to the social network communication conduit . the message may include some or all of the following information : agent and user identification , specific identifies associated with this particular agent - customer communication , source address of the communication conduit , destination address ( for example the customer &# 39 ; s social network communication conduit account ), full detailed response ( or abbreviated response with link to a webpage response portal ), threaded conversation history , links to knowledge based articles and the like . in fig3 b , the customer receives the message from the social customer care application via the communication conduit 345 . if the message contains a response portal website link 350 , the customer visits response portal 355 and may need to be authenticated and then views the agent &# 39 ; s response 360 plus a full thread of prior responses . the response could also include viewing knowledge based articles 360 or other functions as shown herein in fig4 and processing ends 370 . if the message contains all the support response , the customer receives the agent response 365 and processing ends 370 . fig4 is a diagram 400 of customer interaction with an agent &# 39 ; s response through social network communication conduits 405 . the customer interaction can be selected from the following actions : viewing the entire conversation thread 410 ; authenticating the customer as the communication conduit account holder 415 ; viewing or sending private content 420 ; consuming an incentive offer supplied by the agent 425 ; searching and viewing knowledge based articles 430 ; responding and closing the case as resolved 435 ; providing additional information to the agent or amending previously supplied information 440 ; searching for support interactions involving the same or similar issues 445 ; providing feedback via a survey or other means regarding the support the customer received 450 ; or making additional product purchases via an order management system interface connection that is provided to the customer 455 . fig5 is an exemplary depiction of an agent user interface of the social customer care system 500 . it shows work assigned to the agent 505 , pending support requests 510 , due time and date 515 , customer profile 520 for the current support request being processed and customer support request history 525 . it includes links to a knowledge base 530 and template responses , in this case which are organized by computer or peripheral type ( desktop , laptop , mobile device , networking , internet , wireless and storage ) 540 . fig6 is an exemplary depiction of an agent user interface of the social customer care system for reassigning and changing priority 600 . the agent or manager user interface shows the current priority 605 of the support request , its history 610 and assignment 615 . it provides the tools to reassign 620 and change the priority of the request 625 . fig7 is an exemplary depiction of a response with knowledge database information of the social customer care system 700 . the agent user interface 705 depicts the current support request 710 and links to knowledge based articles 715 relevant to the support request . fig8 is an exemplary depiction of a response portal webpage of the social customer care system for responding to a customer problem initiated at a social network communication conduit 800 . the response portal depicts what is displayed to the customer when the customer visits the response portal webpage 805 and views conversation thread ( including agent answers ) support request answer 810 which may for example include survey questions , promotional offers and methods of additional assistance specific to this customer interaction . fig9 is an exemplary depiction of a conversation thread and audit trail of the social customer care system 900 . the agent user interface 905 is able to display all conversation threads 910 so as to have an integrated picture of the customer support request and prior customer support requests 915 , customer support agent responses 920 and any additional information entered by the customer 925 . fig1 is an exemplary depiction an agent &# 39 ; s desktop showing a communication conduit response display of the social customer care system 1000 . the agent user interface 1005 displays all conversation threads 1010 so as to have an integrated picture of the customer support request 1015 , customer support agent response 1020 and any additional information entered by the customer 1025 along with a response box 1030 , history 1035 and open / close status 1040 . fig1 is an exemplary depiction of a supervisor &# 39 ; s desktop of the social customer care system 1100 . the supervisor desktop 1105 depicts workgroup status , system load 1110 and responses over time 1115 , agent activity 1120 , request status 1125 and due dates 1130 . fig1 is an exemplary depiction of an agent user interface showing one - to - many response of the social customer care system 1200 . it depicts multiple responses and support requests 1205 , assignments 1210 , top customer influencers 1215 and knowledge bases 1220 and template responses 1225 available to the agent . fig1 is an exemplary depiction of a manager &# 39 ; s dashboard of the social customer care system 1300 . it gives managers the ability to access support request status data 1305 including time to respond 1310 , average agent responses per hour 1315 , number of support requests closed per agent per hour 1320 , flush rate 1325 , queue backlog 1330 , customer satisfaction scores 1335 , queue backlog and the like . in this example , data can be viewed in graphic 1340 or table form 1345 by date 1350 , priority 1355 , workgroup 1360 and status 1365 . fig1 is a flow diagram of the identity unification processing of the social customer care system 1400 . the following is a glossary of terms for the identity unification function : attribute match score : the component of the “ total match score ” created for a “ found user ” that occurred due to exact match between specific attributes ( e . g . krp . lastname == founduser . lastname ). for example , if the attribute is one of the globally unique ones , this would constitute a “ certain hit ”; certain hit : when a “ guaranteed ” unique value in the krp ( for example , email , phone , social security number , skype handle ) matches a record on a search site , the system associates a certainty percentage that this is the same user , usually 100 percent . data found from the search site may be added to the krp to improve searching and scoring on subsequent sites . certain hits are better and the process can bias “ search - site ” order to prioritize those searches during the processing . community : general term for a social site or online venue where people register and visit . the term community can be used as a “ source ” ( for the krp ) or as a “ search site ” ( to find matching people ); concept overlap score : this is the component of the “ total match score ” created for a “ found user ” that occurs due to abstract concepts ( e . g . sports ) found in free - form text fields on both profiles ; found user ( s ): the data / record representing a user at a “ search site ” who was found using data from the krp to conduct a search . note that these are not necessarily the same person , but the subset of candidates for the comparison & amp ; scoring algorithms ; friend overlap score : the component of the “ total match score ” created for a “ found user ” that occurred due to friends with similar names in the respective friend lists ; fuzzy match score : the component of the “ total match score ” created for a “ found user ” that occurred due to frequency of words found in free - form text fields ; krp : known reference profile is the initial data used to start searching other communities . the “ known ” user - profile whose data is used as the basis for searching other sites to find “ identities ” which ( based on certainty or probability ) can be used to join ( link or unify ) with this “ original ” person / user ; minimum match threshold : this the minimum score that a found record must achieve from the initial scoring process to be kept and considered for further scoring processing . after the second scoring process , records below a ( per - site ) threshold are discarded and only the near - ties ( top - scorers ) are passed to further scoring processes ; search site : an online social or community site where people / users with local identities visit and socialize or support one another . this can be an online site such as facebook , linkedin , twitter , lithium communities and the like . the search site could also be a private crm system but typically , the crm will provide the “ krp ”. tie , top - scorers or near - ties : when several found user records at a given search site score above some minimum threshold but there is no clear winner ( scores are statistically “ near ” each other ), then these records are said to “ tie ” and more data is needed to determine who ( if any ) may be the same person as the krp ; total match score : this invention uses multiple different techniques to measure similarity , meaning the probability of equal - identity , between user - profiles from disparate communities . after the multiple possible scoring passes , each “ profile ” results in “ total match score ” describing its overall likelihood of being the same person as that described by the krp . the “ certain hit ” techniques potentially add additional data to the krp ; and ( user ) profile : a set of fields and values from a “ registered - user ” record in some online service , community or database ( for example , facebook , twitter , linkedin , other social network sites and the like ). the identity management software function takes data from an existing user profile ( called krp for “ known reference profile ”) from a customer database ( for example , crm ) or online social community , and then uses the values found within it to locate similar profiles across other social sites and in a data base management system ( if such a system is available ), and then runs statistical correlation algorithms to predict which profiles belong to the same “ real ” ( human ) person . for example , if a user &# 39 ; s browser is currently viewing a linkedin profile or crm record of a known customer ( the krp ), the user may click a button and the system extracts key values from the page including first , last , hometown , birthdate , employer , college , etc . the identity unification process then uses a few values ( first , last , hometown ) to search other sites such as facebook , twitter , google plus for people with similar names . as each list of results comes back , the process extracts values from those profiles as well . a similarity algorithm is run that predicts which profile from each additional site is most likely to be the same person . it stores this information in a central database along with various scoring artifacts . each time a different client runs the calculation , similar results are scored . there are various types of validation thresholds . the first is a certain hit where a unique value found matches another unique value ( such as a user &# 39 ; s email address ). the second is a high - enough correlation score resulting from initial equivalency type algorithms . the third is enough human reviews of the information to verify the same identity . finally , if none of the above validation events occur and no human has indicated this is not the same person , then once a threshold of “ same matching hits ” occurs without the person being connected to someone else , the system assumes it is the same person and no further searching is required . turning now to fig1 , processing starts 1401 . an existing user profile , also called a krp , of the person to be searched is used as the starting data 1402 . the krp will contain some number of attributes such as those shown in fig2 . krp of the person to be searched for ( the search subject ) may be retrieved from a customer database in a crm system or from an online social community . third party online social media websites to search are determined ( for example , twitter , facebook , linkedin and other social media sites ) 1403 . at least one third party online website is selected and access is confirmed using authorizations or tokens 1404 . the selection of the first online website is to try to find the website that will provide the best information to help identify and verify the person believed to be set forth in the krp for the search subject . this can mean the website that has the largest set of users or is known to have good search results and data rich user profiles to add to the krp . the krp attributes for search subject that are available are sorted into an ordered list of likely uniqueness 1405 . the likelihood of uniqueness may vary by website . the website most likely to yield results is selected to search is based on the now available data 1406 and a search is initiated on that third party website 1407 . if results are not found 1408 , then the next third party website to search is determined based on the krp attributes for the search subjects and likelihood that the website will yield results 1414 . if another website exists 1415 then processing continues in step 1407 . if another website does not exist to search 1415 , then continues in step 1412 . if results are found 1408 , then the search results are added to a master list of found data from third party website 1409 and processing continues in step 1410 . if only one record is found or the search results are otherwise lacking 1410 , new attributes and fuzzy terms are added to the krp for the search subject to assist in future searching and scoring 1411 and processing continues in step 1405 . scoring occurs by attribute similar to what is shown in fig2 . in any case if there are more third party websites to search 1412 , then the next third party website to search is selected 1413 and processing continues in step 1406 . if there are no more third party websites to search 1412 , then the first scoring method process and algorithms are initiated 1416 . then a second alternative scoring method process and algorithms are initiated 1417 . website scores for the krp search subject attributes are compared for near ties 1418 . if there are near ties , another website scoring methods process and algorithm may be initiated 1419 . if there are still near ties , yet another scoring method process and algorithms may be run 1420 . four scoring method processes and algorithms are shown in this fig1 , but there is no limit to the number of scoring method processes and algorithms that may be run by the software . if the result of one of these scoring methods changes a score , then per - site scoring and comparison may be run yet again 1421 . the results are stored by krp attributes , generally to a database 1422 . the process owner ( software and / or human ) is notified that processing is complete 1423 and processing ends 1424 . fig1 is a flow diagram of a site searching process of the identity unification processing of the social customer care system 1500 . processing starts 1501 . if there is access to a user search application programming interface ( api ) for the social media or other website to be searched 1502 , then an authentication is made to api endpoint 1503 . if access is not allowed 1504 , then a “ headless browser ” ( meaning a browser without a graphical user interface ( gui )) is initiated 1510 . the software process logs in to or accesses the website ( which may be via an http command ) 1511 and the desired query is posted 1512 ( which may be via an http post ) and processing continues in step 1506 . if access is allowed 1504 , then a search is initiated via the api using the krp of the search subject and other profile information 1505 to find a person profile and attributes that come close to or match the krp for the search subject . if matching results are found 1506 , the search results ( if any ) are retrieved 1507 , the return results or if there are no results , then an empty set is returned to the calling software program 1508 and processing ends for this current search site 1509 . fig1 is a flow diagram of a scoring process of the identity unification processing of the social customer care system 1600 . processing starts 1601 . the process proceeds to a social media site to be searched 1602 and if there are no more sites with found user records 1603 then processing ends 1604 . otherwise if there are any more sites with found user records 1603 that are similar to the krp for the search subject , a user record is found and examined 1605 . if a found user is found 1606 , then the discrete fields or attribute values available from the krp for the search subject is loaded 1607 . if there any more fields to use for equality testing 1608 and a value is provided in the same field on the found record 1609 , the values are compared 1610 to the krp attribute for the search subject and if they match 1611 then points are assigned as per fig2 1612 . points are cumulative except when defined sets of matches occur and then the system will normally take the highest score . if a value is not provided in the same field on the found record 1609 then step 1607 is repeated . fig1 is a flow diagram of a score compare process of the identity unification processing of the social customer care system 1700 . processing stars 1701 . a unique list of krp words for the search subject for fuzzy matching is created where intersections ( closeness ) between values are worth additional scoring points 1702 . the process proceeds to search a social media website 1603 and if there are no more websites with found user records 1704 then processing ends 1705 . otherwise if there are any more web sites with found user records 1603 that match or are similar to the krp for the study subject , the user record is found and examined 1706 . if there is another record to process 1707 , then words are extracted from its fields and included in the list of fuzzy candidate fields 1708 for the krp . any distinct words are added to the fuzzy match list 1709 . if there are more fuzzy candidate fields with values to use for the fuzzy match process 1710 then the words from this use record are compared to those in the krp 1711 . if a word from a found user record fuzzy list is also found in the krp fuzzy list 1712 , then points are added to a fuzzy match score for the record 1713 by krp attribute . if there are more words to compare , processing continues for this record . otherwise the next user record in examined 1706 and processing continues until there are no more sites and no more records to process 1705 . fig1 is a flow diagram of a score compare process of the identity unification processing of the social customer care system 1800 . processing starts 1801 . the process proceeds to search a website 1802 using the krp for the search subject and if there are no more sites with found user records 1803 then processing ends 1808 . otherwise if another site is found with records 1803 that yield information for the study subject , the information is scored by attribute and all found records from the list with a score that fall below a minimum match threshold are removed 1804 . the remaining records are sorted in an ordered list by score 1805 . records that are near ties are determined by finding all tops scores whose scores fall with a certain percentage of the highest score 1806 . the remaining found users list and the number of records included in the near tie bands are returned as a result 1807 and processing continues in step 1803 . fig1 is a flow diagram of another scoring process of the identity unification processing of the social customer care system 1900 . processing starts 1901 . if the krp for the search subject which is the original or additive krp from an earlier hit does not contain a friend list 1902 , then processing ends 1907 . a friend list is a list of other profiles that are connected to the current customer profile , for example all the people connected to a user of a service such as linkedin or facebook or all the people that the user follows on a service such as twitter . if the krp for the search subject which is the original or additive krp from an earlier hit contains a friend list 1902 , then processing goes to a search web site if it has a list of found records 1903 . if another site with found records exists 1904 , and some records are nearly tied for a highest score for people found at this site 1905 . it connects to a search site to perform authorization sub - processing 1906 . the next found record within the tie group is found 1911 . if there is another user in the tie group 1910 , then a friend list of the current near tie user 1909 is loaded and processing ends 1907 . if there is not another user in the tie group then processing continues in step 1911 . fig2 is a flow diagram of another scoring process of the identity unification processing of the social customer care system 2000 . processing starts 2001 . if the krp for the search subject contains sufficient data for concept scoring 2002 , for each word in the krp fuzzy list , a list of abstract concepts is created 2003 . a krp contains sufficient data for concept scoring if it contains text fields ( e . g . tagline , about - me , favorite - things , caption , status , bio ) containing multiple words that can be generalized to more abstract concepts . for example “ i love apple computers and programming ” could be synthesized as an affinity for the brand “ apple ” and for “ technology ” in general . if two different profiles express overlapping affinity , it indicates more similarity ( that is , it is weighted higher ) than profiles that do not . the process proceeds to search a website for the krp search subject attribute concepts 2004 and if there additional sites 2005 and if the current site returns enough fuzzy data for the concept scoring method to work 2006 for the krp for the search subject then for each near tie record , each fuzzy word found on the profile a list of abstract concepts for that word are assembled 2007 . a concept score is derived by calculating the overlap between the krp abstract concept created in step 2003 and a profile concept list 2008 . if are no more sites to search 2004 or the krp does not contain sufficient data for concept scoring 2002 , then processing ends 2010 . fig2 is a flow diagram of a results storing process of the identity unification processing of the social customer care system 2100 . after the scoring process depicted in fig1 through 20 , and if there is one clear winner remaining in the list of found records 2102 and if a winner was found 2103 then a join record is stored to express the relationship between the krp and winning found - record profiles 2104 . if no site winner was found processing ends 2105 . fig2 is a table showing an exemplary score model of a scoring process of the identity unification processing of the social customer care system 2200 . as an example , scoring model points may be assigned points as per the table . points are cumulative except when defined “ sets ” of matches occur and then the system takes the highest score . fig2 is a flow diagram of a conversation consolidation and management processing of the social customer care system 2300 . conversation consolidation , threading and management ( ccm ) involves detecting with a high probability that different messages from similar or varied sources or user names used by a person ( search subject ) on the web are all from the same individual . unifying the set messages into one cohesive ( threaded ) “ conversation ”, allows a business and its customer service organization to see a complete picture of the issues and emotional state of their customer . public opinions on the internet about a company &# 39 ; s product , brand service by high - influence individuals can impact reputation and sales . companies want to insure proper issue “ closure ” for company &# 39 ; s customer service interaction with a customer and show that the customer is satisfied . in addition , if the company can show public visibility to all hard - earned customer “ satisfaction ”, it &# 39 ; s important that parts of each support / service conversation be visible and chronologically ordered for the support agent handling the issue . if escalation is required , this entire interaction can then be transferred as a cohesive unit to the next agent . while private conversations in email , chat or social media are typically bi - directional ( aka “ threaded ”), the technologies used for public messages ( such as twitter & amp ; blog postings ) often exist standalone ( in a context - free representation ). this means that each expression / utterance by a customer on that social media site is a separate data item and while it may be displayed in date - time order , it is not treated as a discrete - united set of records belonging to that customer . even in cases where posts and responses are threaded and such relatedness - data is preserved by the originating site , this “ relatedness ” information is not typically preserved by listeners and web scrapers which harvest the data for tools such as ours . as such , it &# 39 ; s frequently hard to tell which unique posts in aggregate constitute a single conversation . to make matters worse , support conversations with customer service representatives can switch social media sites , from twitter to a branded - community or company website as an example , and with multiple sources / venues , there is no single “ originating ” source to supply the relatedness information . there are at least four primary processes to capture and display relatedness between disparate social website posts ( also known as records ) to show that there is one “ conversation ” thread that belongs to a customer ( search subject ): customer ( author - handle ) & amp ; source - website identification intersected with an existing open conversation . when a posting on a social media or other website comes from a previously known search subject ( author - handle ) that has been posted on the same social media website or service ( for example twitter ) and is during a time frame in which a customer service representative for a company is interacting ( has an open conversation ) with a customer , then a probability analysis is run to determine if the posting can be added to the information the company has collected during this interaction . manual agent identification entered via the agent ( customer service representative ) user interface . if a post has been linked with a customer but the post is unrelated to the ongoing conversation or not from the customer , a user interface control ( widget ) allows an agent or supervisor to manually detach the post and start new conversation with the unrelated post . this same set of user interface controls allows the agent to merge two separate conversations together . cross - venue via identity unification . this is the processing describe in fig1 through 22 for identifying and unifying information for a search subject . same - parent thread identification provided by originating service . certain data - feeds are robust enough such that each post contains a record - id which points to its parent ( the “ thread - id ”). if such data received and a parent record ( krp for a search subject ) exists , the system merges the new record to the existing thread . turning now to fig2 2300 , if a post is created by a customer ( search subject ) at an internet site 2301 , the post is retrieved and collected a listener / harvester 2302 . the post is delivered to the present system 2303 . a database is checked to see if the “ handle ” for this customer is previously stored in or accessible to the present system ( for example in a crm database ) 2305 . if the customer handle is recognized by the present system 2306 , that is , the customer matches a search subject &# 39 ; s data stored in or accessible to the present system , then the system checks for existing open conversations ( meaning interactions ) with this customer 2307 . if the handle is not recognized by the present system 2306 , then the search subject &# 39 ; s information and handle data is stored 2310 and processing continues in step 2312 . if an existing conversation is found 2308 , then the information is added to the existing conversation data 2314 and processing ends 2317 . if not , then checks are made for known handles for this search subject at other websites and the processing for identity unification described in fig1 through 22 occurs 2309 . if other handles are stored for this search subject 2311 , then a check is made for open interactions ( conversations ) under one of these other handles 2316 . if a conversation is found then processing continues in step 2313 . otherwise , a new interaction ( conversation ) is created 2312 . the conversation is added to an available queue 2315 and processing ends 2317 . fig2 is a flow diagram of a handler checking process of conversation consolidation and management processing of the social customer care system 2400 . processing starts 2401 . the system receives a post ( also known as a message ) from a listener / harvester 2402 from a source information site . the source site and post with the handle ( third party &# 39 ; s web name which is the third party &# 39 ; s social - site profile ) is combined with the author handle to create a unique key ( for example bobjones : twitter ) 2402 . the system performs a database lookup to determine if the key already exists in the present system &# 39 ; s database 2403 . if the key is found to already exist in the database 2402 then the handle becomes marked as known and true 2405 . if the key does not exist in the present system &# 39 ; s database 2404 , then the handle is marked as unknown and false . processing ends 2407 . fig2 is a flow diagram of an open conversation check process of the conversation consolidation and management processing of the social customer care system 2500 . processing starts 2501 . for a given customer ( search subject ), some number of handles that may have been previously retrieved from social media sites are retrieved from a database 2502 . for a search subject , if a handle for the search subject 2503 is found 2504 then , an author identification for this handle is loaded 2505 . a database is checked to determine if conversations ( interaction ) exist for this handle 2506 and if they do , the conversation identification is returned 2508 and processing ends 2509 . if the author handle is not found 2504 processing ends 2509 . fig2 is a flow diagram of a handler process of conversation consolidation and management processing of the social customer care system 2600 . processing starts 2601 . a profile for the current search subject is retrieved from a source website 2602 . a record of this profile is created in a data base 2603 . a handle record is created and linked to the search subject record for the person 2604 . the new handle is returned to the overall process 2605 and processing ends 2606 . fig2 is a flow diagram of known handler process of conversation consolidation and management processing of the social customer care system 2700 . processing starts 2701 . any new interaction ( conversation ) with a customer ( search subject ) is added to the database and linked with that customer &# 39 ; s identification 2702 . post details for the interaction are added to the customer &# 39 ; s identification 2703 . a conversation identification is returned to the overall process of conversation consolidation and management 2704 and processing ends 2705 . fig2 is a flow diagram of the response portal processing of the social customer care system 2800 . prior to the response portal webpage processing of the current system , it has been difficult for businesses to assess and track customer satisfaction measures , surveys , comments and usage patterns for customers , across communication channels that are outside of a company controlled infrastructure . so communications with customers prospects or other parties that are happening via internet social networks and other electronic social interactions have not been adequately tracked to provide important information , about individuals or in the aggregate , about customer satisfaction , responses to questionnaires , comments and other usage patterns that can help a business gauge customer sentiment about a business and its products and services . as used herein , customer may be an actual customer of the business , a prospect or just a user . modern automatic call distribution systems provide customers with the opportunity to complete a questionnaire relating to a specific interaction between the customer and a business . this could , for example , be to report a good or bad service experience or additional related issues at the end of each call . in contrast , when consumers receive a support question response from a company via the web , there is no built - in , homogenous way for them to provide a “ satisfaction rank ” or otherwise report on or about the service they have received . even worse , if they are especially unhappy , they may criticize the company in a public forum . the present system provides a response portal webpage and associated processing for quality measurement and to collect customer data that may lead to improvements in business results or the service process itself , as well as to give the customer a managed and moderated outlet for expression . each time the present system sends a response to a customer , it includes a shortened url link ( with embedded transaction identifier ) pointing back to the response portal webpage where the customer can see more details about the answer , view knowledge - based articles , see related posts and responses , and get answers to basic questions about the solution provided and other information or the customer service representative (“ csr ”) that provided the information . as used here , the term knowledge - based articles includes all forms of peer - to - peer and organizational knowledge produced or aggregated and relating to the topics or issues . discussion items ( parts of the conversation ) that occurred via non - public channels ( meaning private ) are hidden on the response portal webpage until the person viewing the page authenticates their identity via credentials from the originating site or service . this preserves privacy while allowing the public content to be reused by others to resolve similar issues . the system accepts consumer feedback entered via the response portal and uses such feedback as a mechanism to automatically alter the value and relevancy weight of specific knowledge - based articles . if several consumers indicate that a specific article or document is helpful in resolving a certain issue , then that article is ranked as such and will be more likely to be presented to agents , experts or individuals reviewing a customer request , and thereby is more likely to be attached at the top of subsequent responses for similar problems . each time an issue resolution dialog goes back and forth between a consumer and a csr , valuable corporate knowledge is created that could be reused for other customers with the same problem . the present system tags ( categorizes ) these conversation threads and stores them in a publically accessible knowledge - based repository of documents so other consumers can find and employ the solution to an issue they may have . csrs may also access this knowledge - based repository of documents to solve a consumer issue . the system also captures customer feedback such as a quality assessment on the support received . it tracks this and other information collected across multiple social conduits / channels . this allows the system to automatically promote one solution over others as a “ best - fit ” for subsequent searches , improving the efficacy and acceptance by customers of solutions provided via social channels . the present system using the response portal allows large documents ( for example that may exceed social media such as twitter or facebook message size limitations ) to be viewed and downloaded . the present system creates a centralized public & amp ; agent - moderated knowledge - base of common answers and questions and other information , allows for promotional and coupon delivery to aid in product and service upselling , provides for tracking to aggregate knowledge article and solution usage across multiple social channels and provides for using “ prompted ” hashtags to simulate survey completion as well as adjusting these survey results statistically via clustering language patterns to compensate for “ missing ” hashtags . as used herein , hashtags means a word or phrase prefixed with the symbol #, thereby allowing any term to be searchable in a social media context . hashtags can be useful because some consumers will not visit or utilize the response portal webpage to comment on or provide a rating for their recent service experience . to continue to gather meaningful stats for continuous improvement , the present system provides a limited list of “ prompted hash - tags ” that allows consumers to give similar feedback using a social media system such as twitter . the hashtag list may be published on a social media site such as on a twitter profile page for the company and may be included at the end of support tweets . the present systems then culls all posts or status updates ( also known as tweets ) with the same included hashtags and uses the consumer &# 39 ; s author - handle as part of the identification unification function to correlate the feedback to specific support tickets , as well as track total performance metrics . a certain percent of consumers will ignore the “ prompted hash - tag ” response option , but still provide useful feedback in the raw - text of subsequent tweets . the present invention uses language clustering patterns to infer that the language detected within such follow - up tweets , does in fact fall within the satisfaction range found commonly in tweets using “ prompted - tag xyz ” and uses statistics to adjust aggregate metrics to compensate for the “ missing ” hashtag in the overall satisfaction scores . for example , a csr sends answers to users a , b and c answers . user a follows the short - url to the response portal webpage , reads the response and completes a survey stating the csr gave a good answer or otherwise rated the service as good or better . this is one data point to assess the particular csr &# 39 ; s performance . user b does not go to the response portal webpage but instead replies to the csr &# 39 ; s answer tweet and includes hashtag # acmesup + 3 which is the most positive indicator (# acmesup + 1 = fair , # acmesup + 2 = good , 3 = great ). now there are two data points to assess the csr &# 39 ; s performance . user c doesn &# 39 ; t do either of the above but instead tweets that the csr &# 39 ; s service was great . the language clustering function of the present system equates user c &# 39 ; s tweet with the response being great or good . now there are three data points to assess csr competence despite the fact that each data point was acquired through a different technique . turning now to fig2 , the response portal webpage processing starts 2801 . a csr selects the next work item which is usually in the form of a question or request from the system available work queue 2802 . the csr enters a response to a consumer query 2801 . the csr selects the communication conduit or channel to be used for the communication which is typically the same conduit or channel the consumer used and the user - account that the csr will use to send the response 2804 and sends the response 2805 . the present social customer care system and the response portal application store the full response in a database as part of the open and ongoing conversation with this consumer 2806 . a database function creates and returns a conversation identifier 2807 . the response portal application used the conversation identifier to generate a unique portal page identifier 2808 . the application generates a unique url based on the portal page id 2809 . the system appends a shortened version of url in the response message going to customer 2810 . if necessary due to length , sufficient characters are stripped from response message to leave space for short url 2811 . the system sends the message or partial message ( if conduit / channel limits require it ) to the consumer via a third party communication conduit / channel 2812 . proprietary messaging systems ( for example , social media services such as twitter , facebook , blogs , communities and the like ) have unique and varied restrictions on message and attachment characteristics . for example , at the present time twitter restricts messages to 140 characters and facebook does not allow attachment of certain types of external files . to send a private message , twitter also requires that the intended recipient be “ following ” the sender ( meaning that the recipient has chosen the sender as a friend ). these policies burden service and support organizations trying to deliver full and detailed resolution steps to their customers and get accurate feedback for issue closure . the present system automatically tracks the message delivery limits of the underlying delivery conduit , and attaches all undeliverable message artifacts to the destination response portal webpage which may be the webpage and website accessible by the short - url in included the consumer response . the consumer clicks the short - url to access the response portal webpage and retrieve the entire message plus any additional payload or features present on the response portal web page 2813 . the consumer is also allowed to interact with other features of the response portal webpage including but not limited to searching the knowledge - bases for additional information and coupons and upselling information 2814 . turning now to fig2 , which shows a table showing customer options while interacting with the response portal webpage of the social customer care system 2900 . the customer option 2091 may include , but is not limited to , the following actions : seeing the entire conversation thread ( excluding private messages ) 2902 ; authenticating to the source ( communication conduit ) site , in order to see private messages 2903 , answering a survey or other questionnaire 2904 ; claiming and consuming a coupon or special offer 2905 ; downloading and reading a knowledge - based article or other attachment provided by the csr 2906 ; responding back to the csr as the next step in the discussion 2907 , searching the provided knowledge - base for other articles or related solutions 2908 or requesting community ( known as swarming ) support in answering or weighing in with opinions or suggestions on the problem 2909 . although the present invention has been described in detail with reference to certain preferred embodiments , it should be apparent that modifications and adaptations to those embodiments might occur to persons skilled in the art without departing from the spirit and scope of the present invention .	6
with reference now to the drawings , and in particular to fig1 to 8 thereof , a new and improved hose nozzle embodying the principles and concepts of the present invention and generally designated by the reference numerals 10 and 10a will be described . more specifically , the hose nozzle 10 of the instant invention essentially comprises a handle housing 11 integral and orthogonal relative to a directional housing 12 to define a unitary housing member of the nozzle structure 10 , such that the first conduit 13 is directed through - extending the handle housing 11 in fluid communication with a second conduit 14 extending from the first conduit 13 to a second conduit exit end 31 at a forwardmost end of the directional housing 12 spaced from the handle housing 11 ( see fig3 ). the first conduit 13 includes a first conduit entrance 15 extending into the first conduit 13 through the handle housing 11 and entering the handle housing 11 through a handle housing bottom wall 17 and is spaced from the directional housing 12 . the handle housing includes a handle housing side wall 18 that in turn includes a first handle band 19 integral with the side wall 18 and positioned in adjacency relative to the housing bottom wall 17 , with a second handle band 20 mounted to the handle housing 11 and the directional housing 12 at their intersection , such that a trigger member 21 is captured between the first and second handle bands 19 and 20 and extends therebetween for effecting rotation of a valve cylinder 22 ( see fig4 ) positioned within the first conduit 13 within the handle housing 11 . an externally threaded housing boss 16 permits securement of a fluid hose thereto . the valve cylinder 22 , as indicated in fig4 includes a valve cylinder conduit 23 directed therethrough arranged in a first position transversing the first conduit 13 and in a second position , as illustrated in solid line , in fluid communication through the first conduit 13 , wherein a support plate 24 mounted laterally of the valve cylinder 22 and in fixed communication to the valve cylinder ( see fig3 and 4 ) is mounted coaxially of the valve cylinder and is operative through an actuator link 25 fixedly mounted to the valve cylinder such that a first end of the actuator link 25 is mounted to the valve cylinder coaxially thereof , with a second end of the actuator link 25 received within an actuator link slot 26 within the reciprocatable trigger member 21 . respective first and second spring members 27 and 28 are mounted between the handle housing 11 and received within respective first and second wells 30 and 29 within the trigger member 21 , such that the first and second spring members 27 and 28 are spaced an equal distance relative to the first and second handle bands 19 and 20 for maintaining alignment of the trigger member 21 between the handle bands and for biasing the trigger member 21 in an extended orientation , as indicated in fig3 relative to a retracted orientation to effect fluid flow through the first conduit , in a manner as indicated in fig4 . it should be further noted that the trigger member 21 includes a trigger member bottom wall 38 , having a trigger slot 39 arranged to receive a lock button 40 , as indicated in fig6 wherein the lock button 40 includes a lock button slot to receive the trigger member therethrough , as the trigger member includes a trigger member cavity 43 extending around the lock button 40 and an associated abutment boss 41 within the trigger member cavity 43 and a lock button spring 42 interposed between the abutment boss 41 and the lock button to normally orient the lock button slot in alignment with the lowermost edge or bottom wall 38 such that retraction of the trigger member 21 to the second position , as indicated in fig4 in solid line , for the first position , as indicated in phantom in fig4 aligns the trigger member slot 39 with the lock button and such that biasing of the first and second spring members 27 and 28 against the trigger member frictionally maintains the lock button in engagement within the trigger member slot 39 , and wherein the trigger member slot 39 being of a greater width than the lock button 40 , displacement or disengagement of the lock button 40 relative to the trigger member bottom wall 38 within the slot 39 releases the lock button to the projected orientation , as indicated in fig6 . the second conduit 14 , as indicated , is symmetrically oriented about a second conduit axis 14a that intersects a first conduit axis 13a , as indicated in fig3 wherein a cylindrical collar 32 is rotatably mounted about the second conduit exit end 31 mounting a flow metering disc 33 such that the cylindrical disc is rotatably mounted about the forwardmost end of the second conduit 14 and the cylindrical collar 32 coaxially aligned with the axis 14a such that the flow metering disc 33 includes a radial array of spaced flow slots to include a first , second , third , and fourth flow slot configuration 34 , 35 , 36 , and 37 respectively to direct selective fluid flow through the metering disc . the first flow slots 34 and the second flow slots 35 are indicated as orthogonally oriented relative to one another to provide for a spray and stream of such water in a contrasting manner relative to the first and second flow slots , wherein a flow cylindrical opening defines the third flow configuration , and wherein a matrix of flow apertures 37 defines the fourth flow configuration . the fig7 and 8 indicates the use of an optional valve cylinder arrangement 44 within a modified hose nozzle structure 10a that is substantially identical with the exception of the first cylinder structure 44 mounted within the second conduit 14 . the valve cylinder 44 includes a valve cylinder first conduit 45 in fluid communication with the second conduit 14 and substantially aligned therewith such that a valve cylinder second conduit 46 is oriented in a displaced orientation relative to the valve cylinder first conduit 45 in fluid communication with the second conduit exit end 31 through a connecting conduit 49 in fluid communication with the valve cylinder second conduit 46 , wherein a plunger 47 in biased communication with the valve cylinder 44 arranged for alignment with the valve cylinder second conduit 46 includes a plunger spring 48 interposed between the flow metering disc 33 and the plunger 47 , whereupon in this manner pulsed fluid flow through the connecting conduit is effected such that the plunger spring 48 is systematically displaced permitting pulsed fluid flow through the connecting conduit 49 upon buildup of pressure against the plunger 47 to displace the plunger permitting fluid flow to the connecting conduit 49 into communication with the second conduit exit end 31 . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure , and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	1
the following detailed description is merely exemplary in nature and is not intended to limit the invention or the application and uses of the invention . as used herein , the word “ exemplary ” means “ serving as an example , instance , or illustration .” thus , any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . all of the embodiments described herein are exemplary embodiments provided to enable persons skilled in the art to make or use the invention and not to limit the scope of the invention which is defined by the claims . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary , or the following detailed description . those of skill in the art will appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . some of the embodiments and implementations are described above in terms of functional and / or logical block components ( or modules ) and various processing steps . however , it should be appreciated that such block components ( or modules ) may be realized by any number of hardware , software , and / or firmware components configured to perform the specified functions . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . for example , an embodiment of a system or a component may employ various integrated circuit components , e . g ., memory elements , digital signal processing elements , logic elements , look - up tables , or the like , which may carry out a variety of functions under the control of one or more microprocessors or other control devices . in addition , those skilled in the art will appreciate that embodiments described herein are merely exemplary implementations . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose computing device , a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general - purpose processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . a processor may also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor such that the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium may be integral to the processor . the processor and the storage medium may reside in an asic . the asic may reside in a user terminal in the alternative , the processor and the storage medium may reside as discrete components in a user terminal in this document , relational terms such as first and second , and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions . numerical ordinals such as “ first ,” “ second ,” “ third ,” etc . simply denote different singles of a plurality and do not imply any order or sequence unless specifically defined by the claim language . the sequence of the text in any of the claims does not imply that process steps must be performed in a temporal or logical order according to such sequence unless it is specifically defined by the language of the claim . the process steps may be interchanged in any order without departing from the scope of the invention as long as such an interchange does not contradict the claim language and is not logically nonsensical . furthermore , depending on the context , words such as “ connect ” or “ coupled to ” used in describing a relationship between different elements do not imply that a direct physical connection must be made between these elements . for example , two elements may be connected to each other physically , electronically , logically , or in any other manner , through one or more additional elements . fig1 is a simplified diagram an exemplary system suitable for carrying out the various embodiments of the methods disclosed herein . although the methods disclosed here in are suitable for operation in any database , for ease and consistency of explanation , the methods and systems herein will be discussed in the context of a fault model of a complex system . a complex system 1 may be any asset , such as a vehicle , a processing plant , a building , assembly line , etc . without departing from the intended scope of this disclosure . in the field of medicine , the complex system may be a human patient . the complex system , and / or any sub - system or component thereof , is monitored by one of more sensors 20 . sensors 20 may be any type of sensor known in the art or that may be devised in the future to monitor the complex system 1 for evidence of a fault . as used herein , a “ fault ” refers to the observable defect or imperfection in a system . in particular , a fault is an actual , physical defect in a real , material system . as an example , an inoperative light bulb in a specific location on a specific aircraft at a specific time is a “ fault ” or a “ failure .” as used herein , the terms “ fault ” and “ failure ” are synonymous . contrarily , the phrase “ failure mode ” refers to the manner by which a failure or fault is observed in terms of the “ symptoms ” it generates , the functions it affects , its ultimate cause and the corrective actions required to remove the cause . a “ failure mode ” is a conceptual entity used to describe a class of “ faults ” that could occur in the system . a failure mode concept allows analysts to reason about hypothetical fault occurrences and to propose design improvements to reduce their impact and to develop maintenance practices to reduce their occurrence rates and / or ensure their effective remedy . as illustrative examples : “ light bulb fails to illuminate due to internal failure ” and “ light bulb fails to illuminate due to lack of power ” are both examples of “ failure modes .” neither of these refers to a specific physical light bulb . rather , they describe a class of faults / failures that could occur . hence , a “ failure mode ” and a “ fault ” are two distinctly different but related concepts . a “ symptom ” as used herein is the identifiable physical manifestation , or evidence , of a “ fault .” as an illustrative example , a symptom of an open circuit can be an extinguished light bulb in the circuit . likewise , an extinguished light bulb is also a symptom of a defective light bulb . thus , a symptom may be partially indicative evidence of several different faults , which in turn may be indicative of several different failure modes . a symptom can be a test outcome or an observation , such as an extinguished lamp . the operation of the complex system 1 is modeled in software referred to herein as a “ fault model ” 31 which is stored in a memory device 30 . the fault model 31 is essentially a database relating various data types , formula and logic subroutines related to the complex system 1 . in the context of a fault model 31 , these various data types may include sensor input signals ( or “ evidence ”), failure modes , assemblies , sub - assemblies , corrective actions , symptoms , tests , test steps and test results , for example . a fault model is used herein as an exemplary data model . however , the subject matter described herein is not intended to be so limiting and is applicable to all data models . processor 50 , receives evidence from the complex system in real time and refers to the fault model 31 to determine what the failure mode could be , further tests required to disambiguate the failure modes from other failure modes and determine the corrective action for the failure mode . processor 50 also renders a graphical and / or textual report to a display device 40 such as a video screen or a printer as is known in the art . as an exemplary method suitable for disambiguating failure modes in the fault model 31 for a complex system 1 based on symptoms , one can refer to co - owned , co - pending application ser . no . 14 / 194 , 058 , which is incorporated by reference in its entirety . fig2 is an relational diagram showing exemplary relationships between data types in the exemplary fault model 31 . each relationship that exists in its own data table . the exemplary data types are “ assembly ,” “ failure mode ,” “ signal ,” “ corrective action ,” symptom ,” “ interactive test ,” interactive test step ,” and “ interactive test result .” the arrows indicate a direct “ relationship ” between two data types as may be conventionally found in metadata . when there is a need to create a logical path from an assembly to the failure modes for that assembly , there can be multiple paths that the processor 50 may take . a “ path ,” per se , as used herein is any set of entities and relationships between entities that may be logically followed by a processor to navigate through a database from one entity to another . a path is continuous ( i . e ., without interruption ) between the source entity and the destination entity . for example , a representative set of valid relationship paths between “ assembly ” and “ failure mode ” includes : 5 ) the path from assembly - to - failure mode via interactive test , interactive test step , interactive test result and symptom . thus , database operating code would have a plurality of equally plausible paths to relate assembly and failure . calculating and using all possible paths can be quite extensive in a large database structure such as fault model of a complex system . typically , no relationships exist in a “ primary path ,” which is a single step path from a source entity to a destination entity via a single relationship specification . assembly - to - failure mode is an example of a direct path . an “ alternate path ” is any path other than a primary path that can be followed between the source and destination entities . alternate paths reduce the potential list of returned destination data items from a full set of data to only a subset of data items that can be reached through intervening entities following an alternate path to the destination entity specification . to economize on computing overhead and garner increased operational efficiency a path specification 210 or “ path spec ” ( see , fig3 ) may be created to designate a single explicit multiple step path between any two pairs of entities so that automated code of the database operating system would not need to try to calculate and use all possible paths . a path spec is defined using entity specifications and relationship specifications . in use , a path spec uses the entities and relationships to navigate from a start entity to a destination entity . to create a path specification 210 , a new path spec element 220 ( see , fig3 ) is added to the database to store and organize named path specifications . a path specification element includes the name of the path spec 210 and the description of it . to define the actual paths to be followed , the path specification element 220 is created between the path specification 210 and the existing database relationship definition metadata tables 230 ( see , fig3 ). this path specification 210 lists all of the relationships included in a path 211 , it indicates when the relationship is being followed in the forward or reverse context 222 , and it indicates the order of the relationships in the path 211 . each path spec also has a relationship to the ultimate source entity 233 and destination entity 234 . in addition to returning data , the operating software of the database can use the defined path specs 210 when performing path - specific special functions . special functions ( or “ filters ”) include “ common parent ” calculations that will use two different paths from different source entities that each lead to the same destination entity , and includes cascade calculations that use collections of paths to calculate cascaded fault information between two failure modes over any number of cascade paths . this common parent filter uses existing path specifications that are defined against the source entity and destination entity of a primary path . the filter looks to see if any path specifications exist on both the source entity specification and the destination entity specification that each have a common destination entity spec . if a pair of path specifications exist that match this criteria then the common parent filter mechanism allows the user to select an entity from the common destination entity spec . once selected , the list of entities along the x axis of a cross tab editor is reduced to only the set of entities that are linked via the applicable path spec to the selected entity instance . also , the list of entities along the y axis of the cross tab editor is also reduced to only display the set of entities that are linked via the applicable path specification to the selected entity instance . this mechanism allows us to reduce both lists of items to only those that share an alternate relationship to the same entity . cross tab editors are discussed further in co - owned , co - pending application ser . no . 13 / 930 , 061 and is incorporated herein by reference in its entirety . other special functions include a friend - of - a - friend filter . this filter is used by a specialized cross tab editor to display a very localized set of related data to the end user . a cross tab editor is a grid with a list of entities on the x axis and a second list on the y axis . the grid shows which entity on the x axis is related with the corresponding entity on the y axis . with no filters applied , to either list , the displayed data can be very sparsely populated making it very difficult to review the related data . with the friend - of - a - friend filter , a user selects an entity as the entry point for the filter . the friend - of - a - friend filter then removes all entities on the other cross tab axis that do not have a direct relationship to the selected entity . next , with that reduced set of entities on the second axis as an input , the filter is applied to the initial axis . on the initial axis , all entities are removed from the list if they are not related to any one of the entities remaining on the second axis . this filter is only applied on primary paths . fig4 is an exemplary logic flow diagram for a method 300 for using a path specification in the context of an exemplary data retrieval operation . after reading the disclosure herein , those of ordinary skill in the art will readily recognize other uses for the path spec that fall with in the scope and spirit of this disclosure . given the numerous possible uses for a path spec , only exemplary method 300 will be described herein in the interest of brevity and clarity . method 300 is not intended to limit the scope of the disclosure herein to data retrieval only . at process 310 , a relationship specification is determined by the processor 50 from a request for data input by a user . for example , the user may wish to get all failure modes related to a certain symptom being detected by sensor ( s ) 20 . at determination point , 320 , the processor 50 determines when a path spec exists for the desired relationship symptom - failure mode . when a path spec exists , the processor determines if multiple path specs exist for the same relationship at process 330 and presents a list to the user . when multiple path specs exist , an input from the user indicates which path is to be utilized to retrieve the desired failure mode data . at process 370 , the processor returns a list of failure modes from the destination failure mode table based on the data items available on the selected path specification and relationship specification . when only one path spec is determined to exist at decision point 330 , the processor automatically returns a list of failure modes from the destination failure mode table based on the data included in the chosen path spec and the relationship specification at process 360 . when no path specification is determine to exist at determination point 320 , then the processor 50 returns a list of all items in the destination table based solely on the search criteria of the user input . operation with the retrieved data continues at process 380 . while at least one exemplary embodiment has been presented in the foregoing detailed description of the invention , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment of the invention . it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope of the invention as set forth in the appended claims .	6
as used herein , “ a ” or “ an ” means one or more . unless otherwise indicated , the singular contains the plural and the plural contains the singular . as used herein , “ surface ” refers to locations at or above the surface . attention is first directed to fig1 wherein the preferred embodiment is shown . in the preferred embodiment of this invention , there is a well construction method method where a first conduit 4 commonly known to those familiar with the art of well construction as casing is deployed into the earth 18 through the well bore 3 . casing 4 is grouted into a well bore 3 in the earth 18 generally referred to as a well bore 3 . a second conduit , shown in fig1 as conduit 5 , may be deployed into the well bore 3 through the casing 4 . conduit 5 may be a continuous length of tubing , referred to as coiled tubing , and is lowered and extracted from the well through an elastomeric sealing device 6 separating the well pressure environment from the surface environment . it should be understood that although coiled tubing and injector heads is preferred and discussed in this example , any other conduit material , deployment method , and extraction method , familiar to those of ordinary skill in the art , may be used . for example , powered spooling drums , drilling rigs and work over rigs with jointed pipe may be used instead of , or in addition to coiled tubing . the coiled tubing 5 is lowered and extracted from the well with a coiled tubing injector device 7 that mechanically engages the coiled tubing 5 to push or pull it into the well . it is clearly understood to those familiar with the art of well construction that the coiled tubing can be replaced with other types of tubing , such as with jointed tubing that is threaded and lowered into the well with a rig and that the coiled tubing or jointed tubing can be lowered into well tubing or casing but without changing the herein disclosed inventive method . the embodiment shown in fig1 includes a fracture head or well head manifold 8 connected to the casing 4 for the injection of fluids from the surface into the casing 4 . manifold 8 , together with the region that is within casing 4 yet outside of conduit 5 to which manifold 8 is fluidly coupled , comprises the first conduit ( as distinguished from the second conduit 5 ). the stimulation fluid 51 to be injected is pumped from at least one tank or blender 10 through at least one pump 9 into the casing 4 through manifold 8 . the fluid 51 for the purpose of this embodiment is a water based fluid with a polyacrylamide , a friction reducer fluid , mixed into it and is transmitted through the casing 4 and injected through the perforation tunnels 2 into at least one subterranean reservoir 1 . during the injection process of the preferred embodiment , another fluid 17 is injected down the coiled tubing 5 to mixing point 11 . for the purpose of this embodiment fluid 17 is a fluid like hydrogen peroxide that breaks the long chain polymer bonds of polyacrylamide fluid 51 as they are mixed at injection point 11 and continue into the subterranean reservoirs . the position of the mixing point 11 in the well may be modified during the injection process by lowering or raising the coiled tubing 5 with the tubing injector device 7 . in preferred embodiments , mixing point 11 comprises an injection valve on coiled tubing conduit 5 , although mixing point 11 can take any form whereby the fluid paths defined by coiled tubing conduit 5 and that of manifold 8 and the interior of casing 4 come into fluid communication with one another . injection valve 11 preferably contains a back pressure valve or be in combination with a back pressure valve on the coiled tubing 5 in order to keep fluids 51 from the casing 4 from entering the coiled tubing 5 . the second fluid 17 being injected into the well through coiled tubing 5 is pumped from at least one tank 12 at surface through a surface pump 13 into the coiled tubing 5 , which may be partially wound on a coiled tubing reel 21 . although the described preferred embodiment deals with wells and formation having perforated intervals , it should be noted that the method is also applicable to wells and formations which do not have perforated intervals . such perforated intervals can be those that are naturally - occurring and those that are formed by use of explosive charges when drilling the well . in the preferred embodiment there is also a data communication line 14 inside the coiled tubing 5 connected at surface to a data collection device 15 . this data communication line can be connected to a pressure and temperature measurement and / or recorder 16 connected and disposed in the casing 4 on the coiled tubing 5 . the data communication line 14 can be an optical fiber transferring data from the subterranean environment to the surface . the data is collected using analytical and / or recording device 15 . although device 15 is shown at the surface in the fig1 , it should be understood that the analytical data may be collected and recorded in a subterranean environment also . one non - limiting example of device 15 is an optical time domain reflectometer ( otdr ) that launches light down the optical fiber 14 disposed in the coiled tubing 5 and measures the backscattered light up the optical fiber 14 to surface where it is interpreted in the otdr device at surface to yield a distributed temperature profile versus depth along the length of the fiber . other optical , electrical , hydraulic , nuclear , acoustic , and spectroscopic measurements may be used to remotely gather information regarding well conditions , with the resulting data then transmitted via the communication line 14 . preferably this communication transmits real - time data , which can be used to optimize the injection profile of fluids into intervals 1 and 2 in real - time . various fluids and injection methods including , colloidal suspensions , solids and gases can be injected down coiled tubing 5 to affect the injection fluid process where said fluids may include additives that affect , among other things , viscosity , composition , ph , temperature , pressure , and flow rate . other recording and / or analytical devices , known to those of skill in the art , which measure and / or record temperature , pressure , radio - activity , composition , and / or any other relevant parameters may be used , either alternatively or additionally . the communication line 14 may also be an electronic communication line that sends and receives electronic data communications relating to well conditions . as for the case for an electronic communication line , wherein an electronic communication line is used , it is preferable that any data transmitted is transmitted in real - time to permit real - time optimization of fluid injection . additionally , the point or points of data gathering with the data temperature measurement and / or recorder 16 and the distributive sensor optical fiber 14 can be affected similarly by raising or lowering the coiled tubing 5 with the tubing injector device 7 . fig2 illustrates another embodiment in which a fluid 17 is injected into second conduit 5 while fluids comprising injected fluid and reservoir fluids 53 are produced up the first conduit which comprises the volume of casing 4 outside of second conduit 5 and manifolds 8 . in a preferred embodiment , fluids from reservoir 1 and 2 are produced back through the perforations 2 into the casing 4 and back to the surface through manifold 8 or a wellhead while simultaneously injecting a fluid 17 like hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back fluid 53 further treats the fluids 53 in the well thereby reducing and killing bacteria and polymers in the flowed back fluids 53 . it is understood that , in addition to , or in lieu of the fluid hydrogen peroxide , many combinations of other compositions can be added to the coiled tubing of 5 , including but not limited to , bactericides , oxidizers , surfactants , acids , salts , ph modifiers , scale inhibitors and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . this embodiment also teaches that the injection point 11 can be changed to be above or below the perforated interval 1 and or 2 before during and after the fluid is being injected down coiled tubing 5 while fluids 53 are flowing or when the fluids of 53 are not flowing . for example , the coiled tubing 5 with the optical fiber 14 can be lowered with injector head 7 to below both perforated intervals 1 and 2 and an optical survey of the distributive temperatures of the well bore maybe taken by launching light from the otdr device 15 while the well fluids 53 are flowing . conversely , the otdr well temperature profile survey can be obtained when fluids 53 are not flowing . attention is directed to fig3 , which is a specific sub - embodiment of the embodiment of fig1 wherein the coiled tubing 5 with data communication line 14 disposed in the coiled tubing 5 is lowered to point below at least one perforated interval 22 at sometime during the injection process . as a result , mixing point 11 is below at least one perforated interval 22 . this lowering or raising of the coiled tubing 5 in the well can take place at any time during the injection process or after the injection process and the depth of mixing point 11 can be selected by monitoring the distributive temperature profiles of the well on the otdr ( and / or other analytical device ). the injection of crosslinker material can be increased down the coiled tubing 5 such that it causes the fluid 51 being injected from surface through the casing 4 to have a higher viscosity below the perforated interval 22 thus diverting more of the stimulation fluid being injected down the casing 4 into the upper perforated intervals at 22 . many perforated intervals can be treated in a well in this manner by diverting the fluids from the bottom - most perforations sequentially up the well by injecting a viscosity modifier through the coiled tubing , and then adjusting ( raising or lowering ) the coiled tubing injection depth in the well . by thus varying the location of the down - hole mixing , the viscosity profile and hence the fluid injection profile into multiple well intervals can be manipulated . referring now to fig1 in the preferred embodiment , a fluid composition 51 is injected , from a surface tank 10 through a pump 9 wherein the composition comprises a friction reducer chemical such as polyacrylamide . the composition may comprise solids added at the surface . the friction reducer can be blended into the composition ( which may be water ) in the tank 10 or added at the pump 9 at surface ; in either case the friction reducer is added to the composition being injected into the well casing 4 . the composition comprising the friction reducer is then pumped through the manifold 8 into the casing 4 and into the perforations . simultaneously , while the composition is being pumped down the casing 4 , an oxidizer fluid ( such as a fluid comprising hydrogen peroxide ) is injected down the coiled tubing 5 from a surface tank 12 through a pump 13 and into the coiled tubing 5 the well casing through the mixing point 11 where the hydrogen peroxide mixes with the composition in the casing 4 at a depth in the well denoted by 11 . in the preferred embodiment the distal end of the coiled tubing and the mixing point 11 ( preferably an injection valve ) are located at a well depth which is approximately 100 feet above the depth of perforated intervals 1 and 2 . in the preferred embodiment the perforated depth and the casing are located several thousands of feet below the surface of the earth 18 . this allows the friction reducer to form a friction reducing film on the internal diameter of the casing 4 and the outer diameter of the coiled tubing 5 from the surface depth 18 to the depth 11 thereby maximizing the effect of the friction reducer to reduce fluid friction between the injection fluid and the well conduits during the injection . just above the perforated interval at depth 11 , the mixing of the hydrogen peroxide 17 begins a process of breaking down the long polymer chains of the polyacrylamide thereby reducing its molecular length and reducing its adhesion and plugging to reservoir porosity and permeability upon prior to fluid 51 entering the reservoirs 56 . in the preferred embodiment of fig1 , the down - hole pressure is recorded at the recorder 16 and is read at the surface from the data recording device 15 , preferably in real time with the simultaneous injection of the hydrogen peroxide down the coiled tubing 5 and the composition comprising friction reducer 51 down the casing 4 . attention is directed to fig2 which further teaches that once the injection process is completed , the fluid injected into subterranean reservoirs land 2 is produced back into the casing 4 and back to the surface of the earth 18 through manifold 8 or a wellhead while simultaneously injecting a fluid 17 hydrogen peroxide from the surface tank 12 through the coiled tubing 5 into the casing 4 . this simultaneous injection of hydrogen peroxide into the well casing 4 while the well is flowing back the stimulation fluid 53 further treats the injection fluids in the well thereby reducing and killing bacteria and polymers in the flowed back fluids . it is understood that many combinations of chemicals can be added to the coiled tubing of 5 including bactericides , oxidizers , surfactants , acid , and their various concentrations and combinations can be used in this process without deviating from the scope of the invention . in another embodiment , the injection process shown in fig3 comprises the injection of a water based fluid 51 with a gelling agent ( for example , hydroxypropyl guar ( hpg )) blended into water and pumped at the surface down into the well having perforated intervals 22 , 1 , 2 . the fluid is injected through manifold 8 through the casing 4 while a crosslinker fluid ( or other viscosity enhancer for fluid 51 ) is injected down the coiled tubing 5 and mixed into the gelled fluid atthrough mixing point 11 , whereby the blended fluids 51 continue down the casing 4 being transported into the perforated interval 22 and into a subterranean reservoir 56 . by injecting the crosslinker fluid down coiled tubing 5 and mixing with fluid 51 at mixing point 11 the viscosity of fluid 51 in the casing 4 below the perforated interval 22 is higher thereby affecting the injection profile such that fluid 51 is diverted to the upper interval 22 and less to the lower intervals 1 and 2 . in a still further embodiment , a fluid 51 with a catalyst is injected down the casing 4 of fig1 while hydrogen peroxide is injected down the coiled tubing 5 and injected through the injection valve 11 into the casing 4 where the catalyst and the hydrogen peroxide mix in the well and are injected into the reservoir 1 through the perforations 2 and 1 . in some embodiments , the fluid 51 injected down the casing 4 contains a fuel and a magnesium oxide that decomposes or otherwise neutralizes the hydrogen peroxide in the subterranean environment . it should be understood that an almost unlimited combination of gelled fluids , catalyst , fuels , surfactants , and oxidizers can be added to the fluid 51 being pumped down the well casing 4 to be mixed with almost unlimited combination of fluids 17 , catalyst , fuels , surfactants , acids , and oxidizers being injected simultaneously down the coiled tubing 5 . in a preferred embodiment , the use of an analytical instrument to collect , transmit , and possibly record down - hole well information , preferably in real - time at surface , allows for the optimization of the injection of fluids rate and positioning of the injection point . for instance , if data collected indicates an increase in pressure in one or more conduits supplying fluids to the subterranean environment , one may increase the concentration of friction reducer or otherwise change the composition of friction reducer ( for example , going from one friction reducer to another friction reducer ) to optimize performance . likewise , the optical fiber that is a distributive sensor may indicate that a particular injection profile is developed during the fluid injection profile and the location of the injection point of the coiled tubing , or changes in the fluids being injected can be made at surface to modify the injection profile . other examples of optimization should be immediately clear to those of skill in the art . it should also be understood that in any of the embodiments discussed , the compositions injected may be those that increase or decrease viscosity of a resulting fluid when the injected fluid mixes with another fluid . alternatively , other characteristics of the resulting fluid can be modified by injecting various compositions , including , but not limited to , ph modifiers , scale inhibitors , corrosion inhibitors , bacterial contamination inhibitors ( such as bactericides ), surfactants ( to modify surface tension ), etc . variables such as injection and production pressure and flow can be manipulated as well to fine - tune the injection to optimize specific properties . these variables can be changed in real time in response to data collected and monitored using the analytical instrumentation and recording devices described herein . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . the examples given are merely illustrative and not exhaustive . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the invention is intended to encompass within its scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .	8
while the present invention is described with respect to a method and apparatus for securing a hub and shaft in the context of a constant velocity joint application or wheel hub application , the present invention may be adapted and utilized for other shaft and hub connection applications . further , in the following description , various operating parameters and components are described for one constructed embodiment . these specific parameters and components are included as examples and are not meant to be limiting . additionally , in the following detailed description , spatially orienting terms are used such as “ left ,” “ right ,” “ vertical ,” “ horizontal ,” and the like . it is to be understood that these terms are used for convenience of description of the features or embodiments by reference to the drawings . these terms do not necessarily describe the absolute location in space , such as left , right , upward , downward , etc ., that any part must assume . referring now to the drawings wherein like reference numerals are used to identify identical components in the various views , fig1 illustrates a shaft 11 , a hub 41 , and a securing ring 51 in non - detachable arrangement according to an embodiment of the present invention . fig2 shows an enlarged detail of a shaft , securing ring , and hub arrangement according to fig1 . on the shaft 11 , from right to left in the broken view of the shaft body 21 , an external splining 23 , an annular groove 24 , and an annular groove step 55 are visible . the shaft 11 with the external splining 23 ends with a bevel 26 at the end surface 27 , which can also conceptually be referred to as the shaft end . the external splining 23 ends at a spline end 59 at which the splines come to an end . the annular groove 24 has a steep first radial flank 30 on the side closer to the main body of the shaft ( right side ), a cross - sectionally rounded groove bottom adapted to the securing ring , and a steep second radial flank 31 ( left side ) whose height is less than that of the radial flank 30 . the annular groove step 55 has a perpendicular third flank 57 even closer to the end of the shaft 11 . the first , second and third flanks each have an angle of approximately 0 ° with respect to vertical . the hub 41 has a ball track , not shown , which is of no further significance to the connection , and an internal splining 43 that engages the external splining 23 in a form - locked manner in the direction of rotation . the drawing also shows that the hub has an end surface 44 oriented toward the main body of the shaft 11 and an end surface 47 oriented toward the end of the shaft 11 , which are conceptually equivalent to the respective ends . starting from the end surface 44 oriented toward the main body of the shaft 11 , the hub 41 contains an internal cone 45 whose opening angle can correspond to the inclination angle of the spline end 59 of the external splining 23 . in addition , an internal cone is provided which forms a bevel 46 that has a large inclination angle on the internal splining 43 . the bevel 46 cooperates with the spline end 28 , and comprises a first stop that prevents the hub 41 from sliding further onto the shaft 11 when the structurally determined end position has been reached . alternatively , this could also occur , for example , in the region of the internal cone 45 , which would cooperate with the inclined end 59 to form a first stop . at the end surface 47 of the hub 41 oriented toward the end of the shaft 11 , the hub 41 has an annular recess 48 that forms a cylindrical circumference surface 49 and provides a conical stop surface 50 for the securing ring 51 . the conical stop surface has an angle of greater than or equal to 15 ° with respect to vertical . in this example , the securing ring 51 is in the form of a round snap ring . the diameter of the recess 48 can be less than the root diameter of the internal splining 43 , thus permitting the surfaces 49 and 50 to be interrupted by the spline grooves of the internal splining 43 . in fig1 , the internal splining 43 of the hub 41 has been slid axially all the way onto the external splining 23 of the shaft 11 . the securing ring 51 contained in the annular groove 24 of the shaft 11 presses radially outward under its own inherent stress . when the hub is being slid into place , the internal conical surface 45 and the adjoining internal splining 43 press the securing ring 51 into the bottom of the groove 24 . the internal conical surface 45 serves as an insertion bevel and the radial surface of the first flank 30 serves as an opposing or guiding surface . the hub 41 is slid until the bevel 46 of the internal splining 43 comes into contact with the spline end 28 of the external splining 23 . the securing ring 51 springs out from the groove bottom and rests with its outside against the inner cylindrical surface 49 . the annular groove 24 has an annular groove diameter ( d 1 ) and is adjoined in the direction toward the shaft end by the annular groove step 55 with an annular groove step diameter ( d 2 ), wherein d 2 is greater than d 1 . the embodiment of the annular groove 24 and annular groove step 55 according to the invention assures that the hub 41 cannot be nondestructively detached from the shaft 11 since when axial tensile forces are exerted between the hub 41 and the shaft 11 that would pull the hub 41 off from the shaft 11 , the contact surface 50 of the hub 41 does not push the snap ring 51 back into the annular groove 24 , but instead forces it against the edge 60 between the annular groove step 55 and the second flank 31 closer to the end of the shaft 11 . an axial load exerted between the hub 41 and shaft 11 that would pull the hub 41 off , can crush the securing ring 51 so that it becomes completely wedged , thus possibly also causing damage to the internal splining 43 of the hub 41 if a forced removal is attempted . in an advantageous embodiment of the invention , the annular groove step diameter ( d 2 ) is smaller than the root diameter of the external splining 43 on the shaft 11 . in a likewise advantageous embodiment of the invention , the gap width of the annular groove , i . e ., the distance between the first flank 30 and second flank 31 , is greater than or equal to the diameter of the ring cross section of the securing ring , and the gap width of the annular groove step , i . e ., the axial distance between the second flank 31 and the third flank 57 , is less than or equal to the diameter of the ring cross section of the securing ring . in an additional advantageous embodiment of the invention , the gap width of the annular groove 24 is greater than the gap width of the annular groove step 55 . in an additional advantageous embodiment of the invention , the gap width of the annular groove 24 is approximately twice as great as the gap width of the annular groove step 55 . in a particularly advantageous embodiment of the invention , the diameter of the ring cross section of the securing ring 51 is greater than the distance between the groove bottom of the annular groove step 55 and the circumference surface 49 of the recess . fig3 illustrates a shaft 111 , a hub 41 , and a securing ring 51 in detachable arrangement according to an embodiment of the present invention . fig4 shows an enlarged detail of a shaft , securing ring , and hub arrangement according to fig3 . as shown in fig3 and 4 , in the detachable connection of the hub 41 and shaft 111 , the hub has an inclined contact surface 50 and only one annular groove 24 is provided in the shaft 111 . the annular groove 24 has a first flank 30 and a second flank 31 perpendicular to the shaft axis so that when axial tensile forces are exerted between the hub 41 and shaft 111 that would pull the hub from the shaft , the contact surface 50 on the hub 41 pushes the snap ring 51 back into the annular groove 24 and the hub 41 can be slid off the shaft 111 . the following describes details of the shaft 111 , hub 41 , and securing ring 51 . on the shaft 111 , from right to left of the broken view of the shaft body , an external splining 23 and an annular groove 24 are visible . the shaft 111 with the external splining 23 ends with a bevel 26 at the end surface 27 , which can also conceptually be referred to as the end of the shaft 111 . the external splining 23 ends at a spline end 59 in which the spline grooves come to an end . the annular groove 24 has a first steep radial flank 30 on the side closer to the main body of the shaft , a cross - sectionally rounded groove bottom adapted to the securing ring 51 , and a steep second radial flank 31 whose height corresponds to the height of the radial flank 30 . the first and second flanks each have an angle of approximately 0 ° with respect to vertical . the hub 41 has a ball track , not shown , which is of no further significance to the connection , and an internal splining 43 that engages the external splining 23 in a form - locked manner in the direction of rotation . the drawings also show that the hub has an end surface 44 oriented toward the main body of the shaft and an end surface 47 oriented toward the end of the shaft , which are conceptually equivalent to the respective ends . starting from the end surface 44 oriented toward the main body of the shaft , the hub 41 has an internal conical surface 45 whose opening angle can correspond to the inclination angle of the spline end 59 of the external splining 23 . in addition , an internal cone is provided , which forms a bevel 46 that has a large inclination angle on the internal splining 43 , cooperates with the spline end 28 , and forms a first stop that prevents the hub from sliding further onto the shaft when the structurally determined end position has been reached . alternatively , this could also occur , for example , in the region of the internal cone 45 , which would cooperate with the inclined end 59 to constitute a first stop . at the end surface 47 of the hub 41 oriented toward the end of the shaft , the hub has a recess 48 forming a cylindrical circumference surface 49 and providing a conical stop surface 50 for the securing ring 51 . the conical stop surface 50 has an angle of greater than or equal to 15 ° with respect to vertical . the diameter of the recess 48 can be less than the root diameter of the internal splining 43 so that the surfaces 49 and 50 can be interrupted by the spline grooves of the internal splining 43 . in fig3 and 4 , the internal splining 43 of the hub 41 has been slid axially all the way onto the external splining 23 of the shaft 111 . the securing ring 51 contained in the annular groove 24 here presses radially outward under its own inherent stress . in this example , the securing ring 51 is a round snap ring . when the hub 41 is being slid into place , the internal conical surface 45 and the adjoining internal splining 43 press the securing ring 51 into the bottom of the annular groove 24 . the internal conical surface 45 serves as an insertion bevel and the radial surface of the first flank 30 serves as an opposing or guiding surface . the hub 41 is slid until the bevel 46 of the internal splining 43 comes into contact with the spline end 28 of the external splining 23 . the securing ring 51 springs out from the groove bottom and rests with its outside against the inner cylindrical surface 49 . the embodiment of the annular groove 24 according to the invention assures that the hub 41 can be nondestructively detached from the shaft 111 since when axial tensile forces are exerted between the hub 41 and the shaft 111 that would pull the hub 41 off from the shaft 111 , the contact surface 50 of the hub 41 pushes the snap ring 51 back into the annular groove 24 , the second flank 31 serving as an opposing or guiding surface . in all of the embodiments , the internal splining 43 and the external splining 46 can be hardened by heat treatment processes , while the annular groove 24 and / or the annular groove step 55 are not hardened . in another aspect of the invention , a method of manufacturing a shaft for an assembly arrangement according to the present invention includes providing a straight , smooth cylindrical shaft . a first annular groove 24 and annular groove step 55 are cut into the shaft 11 in arbitrary sequence . the annular groove 24 and annular groove step 55 are spaced slightly apart from the shaft end 27 . thereafter , external splining is produced such that it does not cause any function - influencing changes to the annular groove 24 or annular groove step 55 . the external splining 23 can be produced by a spline die , starting from the annular groove 24 and continuing on to the spline end 28 in the shaft body 21 , using an axial pressing process . the external splining 23 can also be rolled into the shaft by beading dies . the annular groove 24 and / or the annular groove step 55 can be manufactured in a single clamping setup of the shaft 11 , together with all other lathe work processes performed on the shaft 11 . the process step of manufacturing the external splining 23 can also be the final machining step performed on the shaft 11 . from the foregoing , it can be seen that there has been brought to the art a new and improved shaft and hub securing system which has advantages over prior shaft and hub securing systems . while the invention has been described in connection with one or more embodiments , it should be understood that the invention is not limited to those embodiments . on the contrary , the invention covers all alternatives , modifications and equivalents as may be included within the spirit and scope of the appended claims .	5
referring now specifically to the drawings , and the illustrative embodiments depicted therein , an accumulation conveyor 10 includes a frame 12 having a pair of vertical support walls 14 which support a plurality of parallel spaced apart shafts 16 , each of which supports a plurality of rollers 18 which are freely rotatable on their respective shaft 16 ( fig1 - 4 ). accumulation conveyor 10 additionally includes a plurality of actuators 20 which selectively raise an endless driven belt 22 , which has been removed from fig1 for clarity , with respect to the plane defined by the tops of rollers 18 . in this manner , when belt 22 is elevated above the tops of rollers 18 by actuators 20 , articles are propelled in the direction indicated by the arrow in fig1 . when actuators 20 lower belt 22 below the tops of the rollers 18 , articles accumulate on accumulation conveyor 10 . actuators 20 raise belt 22 above the tops of rollers 18 in response to an elongated member , such as a rod 24 , being shifted longitudinally toward the left as viewed in fig1 . in the illustrated embodiment , actuators 20 are split - cam eccentric wheel actuators of the type disclosed in u . s . pat . nos . 3 , 854 , 576 for eccentric wheel accumulators and 4 , 878 , 578 for split - cam conveyor rollers , the disclosures of which are hereby incorporated herein by reference . elongated member 24 is longitudinally shifted , in order to operate actuator 20 , by an article sensor 26 . article sensor 26 includes a sensing member 28 which is pivotally mounted by a shaftless bearing 30 . sensing member 28 includes a sensing portion , generally indicated at 34 , which is biased in an upward direction into the path of articles moving along accumulation conveyor 10 by a bias member 32 . in the illustrated embodiment , sensing portion 34 is defined by a pair of fingers which are slidably engaged by articles moving along accumulation conveyor 10 . fingers 34 are joined together downstream of bearing 30 by a lateral support 36 and are joined together at shaftless bearing 30 by a lateral bridge 38 ( fig6 ). in one embodiment , shaftless bearing 30 is a knife - edge bearing defined by a pair of portions 40 defining downward - facing knife edges 42 which are positioned in pockets 44 formed in vertical support walls 14 . shaftless bearing 30 is defined by downward - facing edges 40 which are supported by a lower surface 54 of pockets 44 in a manner which allows portions 40 to rock back and forth . in this manner , sensing member 28 rocks about downward - facing edges 42 within pockets 44 . pockets 44 include upward facing openings 46 which provide access for insertion of bridge portions 40 into pockets 44 . lateral bridge 38 additionally includes upward - extending tabs 48 which are engaged by bias member 32 , which , in the illustrated embodiment , is a coil spring . the other end of spring 32 is engaged in one of a plurality of spaced apart openings 50 defined in vertical support wall 14 . in this manner , bias member 32 biases fingers 34 upwardly into the path of movement of articles along accumulation conveyor 10 . additionally , bias member 32 urges lateral bridge portions 40 into pocket 44 at a corner in the pocket between an up - stream vertical edge 52 and a bottom edge 54 . lateral bridge 38 additionally includes a pair of downward extending arms 56 which engage elongated rod 24 through a compression spring 58 . compression spring 58 has sufficient spring force to allow sensing member 28 to shift elongated rod 24 under normal operating conditions . if , however , rod 24 becomes stalled , because of the position of the eccentric wheels of actuation 20 upon actuation , spring 58 will accommodate the movement of arms 56 until the eccentric wheels become realigned in a position wherein actuation can take place . each finger 34 additionally includes a downward extending hook member 60 having a portion 62 which extends below a shaft 16 . hook member 60 limits the upward travel of fingers 34 . a rubber cushion - sleeve 64 is provided around portion 62 in order to reduce noise upon engagement of hook member 60 and corresponding shaft 16 . each finger 34 has a downward - sloping forward portion 66 which prevents fingers 34 from becoming entangled with a downstream article on accumulation conveyor 10 and allows articles to be manually pushed upstream over sensor 26 . as may be seen by reference to fig6 the vertical distance between the base of tabs 48 and the corresponding downward - facing edge 42 defines a very short lever arm , which is preferably less than 1 inch and most preferably less than one - half ( 1 / 2 ) of an inch . in the illustrated embodiment , this lever arm is approximately three - eighths ( 3 / 8 ) of an inch in length . in order to bias fingers 34 upwardly with such a short lever arm , the spring force of bias member 32 must be commensurately larger . preferably , the composite spring force of bias member 32 is at least approximately 5 . 0 pounds . in the illustrated embodiment , the spring force of each of two springs making up bias member 32 is approximately 3 . 5 pounds which results in a composite spring force of at least approximately 7 . 0 pounds . the combination of a short lever arm and a heavy spring has the advantage that the spring is elongated only a small fraction of its length when article sensor 26 is actuated . because spring force varies proportionate to the amount of elongation of a spring , this arrangement ensures that the spring force applied by bias member 32 is relatively constant through the range of motion of sensing member 28 . advantageously , the use of a shaftless bearing 30 allows a heavy spring force bias member 32 to be utilized . the reason is that , although the heavy spring force asserts a side load on shaftless bearing 30 , the rotational friction of the bearing is relatively unaffected by side load force . this is in distinction to typical shaft bearings which increase significantly in rotational friction in response to side load force . thus , the use of a shaftless bearing 30 in order to rotatably support sensing member 28 not only pivotally supports the sensing member in a manner which provides exceptionally low rotational friction , but does so in a manner which accommodates relatively high side - loading which allows a spring and lever arm arrangement having relatively consistent actuation force throughout the range of motion of the sensing member fingers . in this manner , article sensor 26 may be actuated by a vertical force of less than 1 pound , which would be applied by an empty article container weighing approximately 2 pounds . preferably , article sensor 26 may be actuated by a vertical force of less than approximately 8 ounces , which would be applied by an empty article container weighing approximately 1 pound . most preferably , the present invention is capable of actuation by a downward force of approximately 0 . 4 pounds , which may be applied by an empty article weighing laying approximately 0 . 8 pounds . advantageously , sensing member 28 may be manufactured from a single flat sheet of metal 68 as illustrated in fig7 . flat sheet 68 is bent at right angles along line a in order to form lateral bridge 38 and is formed along lines b and c in order to form fingers 34 . this provides exceptional mechanical rigidity to the sensing member while , concurrently , forming the support edge of the shaftless bearing as well as the lateral support 36 and the other features of sensing member 28 . once the sensing member is formed by the sheet metal processing of stamping sheet 68 and performing the bends in the sheet , the sensing member may then be readily joined with vertical support walls 14 by inserting bridge portions 40 into pockets 44 and connecting bias members 32 between openings 50 and tabs 48 . this provides a stable article sensor with bias member 32 retaining the movable components of the shaftless bearing in their operational relationship . although the invention was illustrated with a mechanically actuated accumulation conveyor , its principles may be applied to a pneumatically actuated accumulation conveyor of the type disclosed in u . s . pat . no . 5 , 191 , 967 for a conveyor system having non - singulating accumulation conveyor , the disclosure which is hereby incorporated herein by reference . in such application , actuators 20 are pneumatically operated in response to selective actuation of a valve by arms 56 . in such configuration , in order to reduce the actuation force , a balance - poppet valve is preferable . the invention is illustrated with fingers as the sensing portion of the sensing member . the sensing portion could be formed in any manner known in the art , such as incorporating a sensing roller of the type disclosed in the &# 39 ; 967 patent . although the invention is illustrated with an extension spring , a compression spring or a torsion spring could be utilized . alternatively , the bias member may be a counterweight , as is known in the art . the present invention additionally provides the capability for a slug discharge for accumulation conveyor 10 . the actuation of the elongated rod through a motion - absorbing compression spring may allow the use of an actuating cylinder , such as an air cylinder , to be utilized in order to join together rod actuators for all accumulation zones . the rods may be actuated irrespective of the position of the associated article sensor as would be appreciated by those of ordinary skill in the art . an alternative embodiment of a shaftless bearing , generally designated 70 , is illustrated in fig8 . shaftless bearing 70 includes a flat , flexible member 72 which is fixed at a lower end 74 in a slot within pocket 44 . actuation of sensing member 28 causes flexible member 72 to flex forwardly in order to pivotally support the sensing member with respect to support wall 14 . shaftless bearing 70 has the same attributes as bearing 30 of very low friction and substantial immunity from the side - loading created by the downward force of actuation . changes and modifications in the specifically described embodiments can be carried out without departing from the principles of the invention , which is intended to be limited only by the scope of the appended claims , as interpreted according to the principles of patent law including the doctrine of equivalents .	1
referring now to the discussion that follows and also to the drawings , illustrative approaches to the disclosed systems and methods are shown in detail . although the drawings represent some possible approaches , the drawings are not necessarily to scale and certain features may be exaggerated , removed , or partially sectioned to better illustrate and explain the present invention . further , the descriptions set forth herein are not intended to be exhaustive or otherwise limit or restrict the claims to the precise forms and configurations shown in the drawings and disclosed in the following detailed description . according to various exemplary illustrations described herein , a needle guide is provided that includes a body portion . the body portion is configurable between an uncompressed position and a compressed position . the body portion further includes at least one channel extending therethrough . at least one slot extends outwardly from the channel . the slot permits at least a portion of the body portion to compress inwardly between the uncompressed position and the compressed position . the channel includes a first diameter and a second diameter , the first diameter defined by the uncompressed position and the second diameter defined by the uncompressed position . the first diameter is greater than the second diameter . turning now to the drawings and in particular to fig1 , an exemplary compression plate 20 is shown , including a plurality of grid - like openings 22 . in the illustration of fig1 , the compression plate 20 is used with a needle guide 30 . prior to the start of a biopsy procedure , the compression plate 20 is pressed against a body area of interest . in a breast biopsy procedure , for example , the compression plate is pressed against the breast , thereby compressing the breast . an introducer 32 with a stylet is inserted into one of the openings 40 of the needle guide 30 where the lesion to be biopsied may be found . the needle guide 30 includes a series of slots 64 that allow for the needle guide 30 to compress inwardly such that the introducer 32 is unable to move inwardly and outwardly from the opening 40 when locked , as discussed in greater detail below . fig2 a is an illustration of the needle guide 30 and the introducer 32 in a first , uncompressed position . the needle guide 30 includes a body portion 44 , an outer periphery 46 , and a proximate face 60 . the needle guide also includes at least one channel 62 extending therethrough . although fig2 a - 2b illustrate the needle guide 30 including nine channels 62 , it should be noted that any number of channels 62 may be used . the series of slots 64 are located along the proximate face 60 of the needle guide 30 . the slots 64 extend outwardly from each of the channels 62 , and towards either of the outer periphery 46 or an adjacent channel 62 , depending on the placement of the slots 64 . that is , if the slot 64 is located adjacent the outer periphery 46 , then the slot 64 extends from the channel 62 to the outer periphery 46 . if the slot 64 is adjacent to another channel 62 , then the slot 64 extends from one of the channels 62 towards another channel 62 . in the illustration as shown , the slots 64 are each located along a middle section m of each of the channels 62 , however the slots 64 may be located along any point of the channels 62 . as illustrated in fig2 a , the slots 64 extend along a length l of the body portion 44 . the length l is parallel with an axis a - a of the needle guide 30 . the slots 64 permit at least a portion of the body portion 44 to compress inwardly between the uncompressed position and a compressed position , which is discussed in greater detail below . in the embodiment shown , each of the channels 62 include two generally opposing slots 64 , with one of the slots 64 located along an upper portion 54 of the channel 62 and the other slot 64 located along a bottom portion 56 of the channel 62 . although fig2 a illustrates the channels 62 having two generally opposing slots 64 along the upper portion 54 and the bottom portion 56 , the slots 64 may also be located at other positions , such as , for example , along opposing sides 58 of the channel 62 as well . in the uncompressed position , the needle guide 30 is loosely engaged with the introducer 32 . more specifically , when the needle guide 30 is in the uncompressed position , an inner surface 66 of the channel 62 is unable to closely engage with an outer diameter od of the introducer 32 . as seen in fig2 a , the channel 62 includes a first unlocked diameter d 1 . the unlocked diameter d 1 is greater than the outer diameter od of the introducer 32 . thus , when in the uncompressed position , the introducer 32 is able to freely move in a direction d towards the needle guide 30 as well as in a direction r that is away from the needle guide 30 . however , as the needle guide 30 is inserted into one of the openings 22 of the compression plate 20 , a compressive force f is exerted along the outer periphery 46 of the needle guide 30 . that is , when the compressive force f is exerted along the outer periphery 46 , the needle guide 30 is urged inwardly from the first uncompressed position ( fig2 a ) into the second compressed position ( fig2 b ). because the needle guide 30 can be selectively compressed inwardly by the compressive force f when in the uncompressed position , the needle guide 30 is unlocked . fig2 b illustrates the needle guide 30 in the compressed position , after the compressive force f has been applied . for clarity , the compression plate 20 has been omitted . the body portion 44 of the needle guide 30 is urged inwardly by the compressive force f when placed inside the opening 22 of the compression plate 20 ( not shown in fig2 b ). in the compressed position , the slots 64 are urged together . in one embodiment , the slots 64 are urged together such that the slots 64 close and the needle guide 30 is unable to compress further inwardly . the needle guide 30 is also unable to expand outwardly because the outer periphery 46 is restrained by the opening 22 of the compression plate 20 . thus , the needle guide 30 is effectively locked in the compressed position . when the needle guide 30 is in the compressed position , as in fig2 b , the channel 62 is defined by a second diameter d 2 . the second diameter d 2 is less than the first diameter d 1 . moreover , the second diameter d 2 is about equal to or slightly less then the outer diameter od of the introducer 32 . therefore , when in the compressed position , the outer diameter od of the introducer 32 is closely engaged with the inner surface 66 of the channel 62 . thus , when in the compressed position , the introducer 32 is unable to move inwardly in the direction d and outwardly in the direction r from the channel 62 . in the illustrations as shown in fig2 a - 2b , the body portion 44 includes an optional support member 68 . the support member 68 is connected to the body portion 44 at a proximate end 70 of the body portion 44 . the support member 68 includes the proximate face 60 . in one illustration as seen in fig2 c , the support member 68 includes a width w ′ that is greater than a width w of the opening 22 of the compression plate 20 . thus , when inserted into the compression plate 20 , the needle guide 30 is seated such that a back surface 80 of the support member 68 is flush with the opening 22 . the back surface 80 of the support member 68 retains the needle guide 30 within the opening 22 of the compression plate 20 such that the needle guide 30 is unable to advance further into the opening 22 , and in the direction d . including the support member 68 may also provide a grip that the user can easily hold on to when a user removes the needle guide 30 from the opening 22 . when the introducer 32 is slid into the channel 62 the needle guide 30 is in the uncompressed position . then , once the introducer 32 is positioned to the desired depth , the needle guide 30 is placed within one of the openings 22 of the compression plate 20 . as seen in fig2 a - 2b , the introducer 32 may also include a series of graduated markings 90 that indicate the depth of the introducer 32 within a breast . when placed within the opening 22 , the needle guide 30 compresses from the uncompressed position ( fig2 a ) to the compressed position ( fig2 b ). this is because the compressive force f urges the needle guide 30 to move inwardly from the uncompressed position to the compressed position . as discussed in greater detail below , the needle guide 30 may also include a snapping movement between the compressed and uncompressed configuration , therefore providing a tactile feedback to a user . the tactile feedback allows the user to know when the needle guide 30 is in the locked versus the unlocked position . in one example of the needle guide 30 , the slot 64 snaps between the uncompressed position and the compressed position . more specifically , the slot 64 only has two positions , a first open position as seen in fig2 a , and a second closed position as seen in fig2 b . thus , when the needle guide 30 is pushed into the opening 22 of the compression plate 20 , the slots 64 will snap shut with an abrupt movement . a sharp sound may also be used to indicate to a user that the needle guide 30 is in the locked position within the compression plate 20 . fig3 a - 3b are alternative embodiments of a needle guide 130 where the proximate face 160 includes a flange 172 located along at least a portion of the outer periphery 146 . the flange 172 extends outwardly from the proximate face 160 , in the direction r . the flange 172 provides a grip such that when the needle guide 130 is placed within the opening 22 of the compression plate 20 , a user will have a surface along the needle guide 130 that is easy to grasp . as best seen in fig3 b , the flange 172 protrudes from the opening 22 of the compression plate 20 . a back surface 174 of the flange 172 is in contact with the compression plate 20 , and the outer periphery 176 of the flange 172 is slightly larger than the opening 22 . therefore , when inserted within the opening 22 , the needle guide 30 is unable to travel past the back surface 174 , and the needle guide 30 is unable to advance further into the opening 22 in the direction d . the flange 172 provides a handle that a user may hold on to when the needle guide 130 is removed from the opening 22 of the compression plate 20 . in yet another alterative illustration of a needle guide 230 , as seen in fig4 a - 4b , a pair of outwardly extending arms 270 are included that extend from opposing sides of the outer periphery 246 . a pivot member p is mounted to a portion of each arm 270 . when the arms 270 are pushed by an inwards force f ′ towards the needle guide 230 and in the direction d , the pivot member p contacts a portion of the compression plate 20 and needle guide 230 is urged into the uncompressed configuration and unlocks . that is , as seen in fig4 b , when the inward force f ′ is exerted upon the arms 270 , the pivot member p cooperates with arms 270 such that needle guide 230 is pushed outwardly and away from the opening 22 of the compression plate 20 and in the direction r . thus , the arms 270 and pivot member p facilitate removal of the needle guide 230 from the opening 22 of the compression plate 20 by a user . yet another alternative illustration of a needle guide 330 is shown in fig5 a . the needle guide 330 includes a moveable ring 370 that encircles the outer periphery 346 . the ring 370 is moveable along a length l ′ that is measured from the back surface 380 of the support member 368 towards a distal end 358 of the body portion 344 of the needle guide 330 . in the illustration as shown , the ring 370 is placed behind the support member 368 . the support member 368 retains the ring 370 along the outer periphery 346 of the needle guide 330 . the ring 370 urges the needle guide 330 into the compressed configuration . more specifically , when the moveable ring 370 is advanced to the proximate face 360 of the needle guide 330 , the slots 364 are urged together , thereby compressing the needle guide 330 into the compressed and locked configuration . fig5 b illustrates a needle guide 330 inserted into an opening 22 of the compression plate 20 . the needle guide 330 is tapered inwardly , and includes a distal end outer periphery dp and a proximate end outer periphery pp . the distal end outer periphery dp is less than the proximate end outer periphery pp . the moveable ring 370 includes an inner diameter 392 that is smaller than the proximate end outer periphery pp but greater than the distal end outer periphery dp . the needle guide 330 is urged inwardly and into the compressed position when the ring 370 is advanced towards the proximate face 360 of the needle guide 330 in the direction r . that is , the inner diameter 392 of the ring 370 compresses the needle guide 330 inwardly , and urges the slots 364 together . when the ring 370 is retracted away from the proximate face 360 , and pushed in the direction d , the needle guide 330 will unlock into the uncompressed position . fig6 - 9 illustrate an arrangement of a selectively lockable introducer assembly 400 that cooperates with a needle guide 402 to maintain a desired position for introducer assembly 400 . introducer assembly 400 , best seen in fig6 and 7 , includes a generally hollow introducer cannula 404 defined by a proximal end 406 and a distal end 408 . an introducer hub 410 may be secured to proximal end 406 of introducer cannula 404 . introducer hub 410 includes an opening therethrough that is in communication with an inner lumen 411 extending through introducer cannula 404 and may also include a haemostatic valve ( not shown ). positioned on an outer portion of introducer cannula 404 is a plurality of retaining members 412 . retaining members 412 extend upwardly from an outer surface of introducer cannula 404 . in one arrangement , retaining members 412 are positioned along a substantial portion of the length of introducer cannula 404 . in another arrangement , retaining members 412 are also positioned so as to be spaced at equi - distance intervals . in another arrangement , two sets of retaining members 412 are positioned on introducer cannula 404 , with the sets being positioned 180 ° apart from one another , as seen in fig7 . retaining members 412 will be explained in further detail below . referring now to fig8 , needle guide 402 will be described . needle guide 402 includes a body portion defined by an outer periphery 414 and at least one channel 416 extending therethrough . although fig8 illustrates the needle guide 402 including nine channels 416 , it should be noted that any number of channels 416 may be used . disposed within each channel 416 is at least one retaining tang 418 positioned on an internal surface 420 of each channel 416 . retaining tangs 418 are positioned so as to extend inwardly into each channel 416 , and away from inside surface 420 of each channel 416 . in one arrangement , a plurality of retaining tangs 418 extend along the length of inside surface 420 of each channel 416 . in another arrangement , there are at least a pair of retaining tangs 418 , with each retaining tang 418 being positioned 180 ° apart from one another , as shown in fig8 . in one arrangement , retaining tangs 418 are formed so as to have a complimentary shape to retaining members 412 , to be explained below . turning now of fig9 a - 9b , the interaction between introducer cannula 404 and needle guide 402 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 402 has been appropriately positioned with a compression plate 20 ( see fig1 ), introducer cannula 404 is inserted into a desired channel 416 . in one exemplary arrangement , to permit introducer cannula 404 to enter needle guide 402 , introducer cannula 404 is appropriately rotated such that retaining members 412 are positioned approximately 90 ° from retaining tangs 418 . in this configuration , introducer cannula 404 may freely slide within channel 416 to a desired depth . to assist with ascertaining the appropriate depth , the outer surface of introducer cannula 404 may be provided with markings or other indicia to indicate depth . after a desired depth for insertion of introducer cannula 404 has been reached , introducer cannula 404 may be selectively locked into position by rotating introducer cannula 404 within channel 416 by approximately 90 .° once rotated , retaining members 412 engage with retaining tangs 418 in a complementary manner . more specifically , retaining members 412 are rotated so as to place a retaining tang 418 between adjacent retaining members 412 . once so engaged , introducer cannula 404 is locked into position with needle guide 402 in the x , y , and z axes . such locking action prevents accidental dislodgement of introducer cannula 404 during a surgical or therapeutic procedure , including accidental sliding of introducer cannula 404 along the z axis . thus , a stable pathway to a site of interest is maintained . once a procedure is complete , introducer cannula 404 may be disengaged from needle guide 402 by simply rotating introducer cannula 404 sufficiently such that retaining members 412 become disengaged with retaining tangs 418 and introducer cannula 404 may be slid out of needle guide 402 . referring to fig1 - 12 , another arrangement of a selectively lockable introducer assembly 500 is shown . similar to the arrangement shown in fig6 - 9 , introducer assembly 500 cooperates with a needle guide 502 to maintain a desired position for introducer assembly 500 . introducer assembly 500 , best seen in fig1 , includes a generally hollow introducer cannula 504 defined by a proximal end 506 and a distal end 508 . an introducer hub 510 may be secured to the proximal end 506 of introducer cannula 504 . introducer hub 510 includes an opening therethrough that is in communication with an inner lumen extending through introducer cannula 504 . introducer hub 510 may also include a haemostatic valve ( not shown ) to minimize blood flow . positioned on an outer portion of introducer cannula 504 is at least one central groove 512 . in one arrangement , a central groove 512 extends along a substantial portion of the length of introducer cannula 504 . extending away from central groove 512 is a plurality of spaced apart engagement grooves 514 that extend radially along the outer surface of introducer cannula 504 . in one arrangement , engagement grooves 514 are spaced apart at equi - distance intervals and are arranged in pairs disposed on either side of central groove 512 , as shown in fig1 . in another arrangement , a second central groove may be formed on the outside surface of introducer cannula 504 , approximately 180 ° from the first central groove 512 . like the first central groove 512 , the second central groove also includes a plurality of engagement grooves . engagement grooves 514 will be explained in further detail below . referring now to fig1 , needle guide 502 will be described . needle guide 502 includes a body portion defined by an outer periphery 516 and at least one channel 518 extending therethrough . although fig1 illustrates the needle guide 502 as having nine channels 518 , it should be noted that any number of channels 518 may be used . disposed within each channel 518 is at least one retaining tang 520 positioned on an internal surface 522 of each channel 518 . retaining tangs 520 are positioned so as to extend inwardly into each channel 518 , and away from inside surface 522 of each channel 518 . in one arrangement , a plurality of retaining tangs 520 may be provided that extend along the length of inside surface 522 of each channel 518 . in another arrangement , there are at least a pair of retaining tangs 520 , with each retaining tang being positioned 180 ° apart from one another , as shown in fig1 . turning now to fig1 , the interaction between introducer cannula 504 and needle guide 502 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 502 has been appropriately positioned within compression plate 20 , introducer cannula 504 is inserted into a desired channel 518 . to permit introducer cannula 504 to enter needle guide 502 , introducer cannula 504 is rotated such that central groove 512 is aligned with retaining tang 520 . retaining tang 520 is appropriately sized to enter central groove 512 such that introducer cannula 504 may freely slide within channel 518 to a desired depth . to assist with ascertaining the appropriate depth , the outer surface of introducer cannula 504 may be provided with markings or indicia to indicate the depth . after a desired depth of introducer cannula 504 has been reached , introducer cannula 504 may be locked into position by slightly rotating introducer cannula 504 . the rotation of introducer cannula 504 causes an engagement groove 514 to slide over retaining tang 520 ( shown in phantom in fig1 ). once retaining tang 520 has been captured in engagement groove 514 , introducer cannula 504 is locked into position within needle guide 502 such that introducer cannula is effectively prohibited from being displaced during a surgical or other therapeutic procedure . once a procedure is complete , introducer cannula 504 may be easily disengaged from needle guide 502 . for example , introducer cannula 504 is rotated in such a manner so as to place retaining tang 520 in central groove 512 . once in central groove 512 , introducer cannula 504 may be slid out of needle guide 502 . referring to fig1 - 15 , another arrangement of a selectively lockable introducer assembly 600 is shown . introducer assembly 600 cooperates with a needle guide 602 to maintain a desired position , in the x , y , and z axes , for introducer assembly 600 . introducer assembly 600 , best seen in fig1 , includes a generally hollow introducer cannula 604 defined by a proximal end 606 and a distal end 608 . an introducer hub 610 may be secured to proximal end 606 of introducer cannula 604 . introducer hub 610 includes an opening therethrough that is in communication with an inner lumen extending through introducer cannula 604 , and may also include a haemostatic valve ( not shown ) to control blood flow from the body . outer surface of introducer cannula 604 is threaded 612 along at least a portion of its length . in one arrangement , outer surface of introducer cannula 604 is threaded along a substantial portion of introducer cannula 604 . in one arrangement , spaced along threads 612 at predetermined intervals are depth indicators 614 , such as indicia or markings . use of depth indicators 614 will be explained in further detail below . referring now to fig1 , needle guide 602 will be described . needle guide 602 includes a body portion defined by an outer periphery 616 and at least one channel 618 extending therethrough . although fig1 illustrates the needle guide 602 including nine channels 618 , it should be noted that any number of channels 618 may be used . each channel 618 is threaded 620 ( see fig1 ) so as to cooperate with threads 612 of introducer cannula 604 ( to be explained below ). referring now of fig1 , the interaction between introducer cannula 604 and needle guide 602 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 602 has been appropriately positioned within compression plate 20 , introducer cannula 604 is directed into a desired channel 618 . introducer cannula 604 is then rotated in a first direction into the desired channel 618 , such that threads 612 of introducer cannula 604 engage with threads 620 of channel 618 . after a desired depth of introducer cannula 604 has been reached , which may be visually indicated by depth indicators 614 , rotation of introducer cannula 604 is stopped . however , due to the interaction of threads 612 and 620 , introducer cannula 604 is effectively prevented from being displaced during a surgical or other therapeutic procedure . once a procedure is complete , introducer cannula 604 may be easily disengaged from needle guide 602 simply by rotating introducer cannula 604 in a second direction so as to disengage threads 612 and 620 from one another until introducer cannula 604 is free of needle guide 502 . while the present disclosure has been particularly shown and described with reference to the foregoing preferred embodiments , it should be understood by those skilled in the art that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure without departing from the spirit and scope of the disclosure as defined in the following claims . it is intended that the following claims define the scope of the disclosure embodiments within the scope of these claims and their equivalents be covered thereby . this description of the disclosure should be understood to include all novel and non - obvious combinations of elements described herein , and claims may be presented in this or a later application to any novel and non - obvious combination of these elements . the foregoing embodiment is illustrative , and no single feature or element is essential to all possible combinations that may be claimed in this or a later application .	0
the signature verification system of the present invention is used in conjunction with a computer - based training (&# 34 ; cbt &# 34 ;) system to verify the identity of the person who participates in a training session . the necessary components of the verification system include the hardware to register the user &# 39 ; s signature and the associated software to read the signature , make certain discrimination measurements , store a representation of the signature and associated discriminator data and detect anomalies in the discriminator data . a brief understanding of a cbt system is necessary to the full description of the present invention . cbt systems rely on a computer to present information to a student and to accept responses from the student relating to questions posed by the training session . an elementary cbt system would have a single computer , a keyboard to input data , a monitor to display information , and a program to run the training session . more sophisticated cbt systems interact with laser disks and / or audio tapes to provide an integrated training environment . a key advantage of cbt systems is that numerous work stations can be available for use by students , without the need for direct supervision by trained personnel , so that students can access and use the cbt system at times convenient to their own personal schedule . fig1 shows a block diagram representation of the hardware components of a system embodying the features of the present invention incorporated into a cbt system . the cbt system 8 includes a student computer 10 which has a keyboard 12 , a monitor 14 , a stylus 22 , and data entry pad 20 . typically , the student computer 10 has a disk drive 16 for reading from and writing to a magnetic disk storage unit 18 . the data entry pad 20 is preferably a digitizing tablet . the data entry pad 20 and stylus 22 , which may be of conventional design , serve as the primary input device for the student &# 39 ; s use in communicating with the computer . the top of the pad is covered with a custom - designed template 21 . as shown in fig3 the template has a signature input area 24 ; the remaining portion of the template is segregated into portions corresponding to characters , symbols and text and is used as a data entry area . the student uses the pad and stylus to input commands to the computer , to respond to test queries from the cbt program and to sign his / her signature . to use the pad and stylus , the student positions the tip of the stylus over an area on the template that corresponds with the desired input and presses down on the stylus to depress the tip 23 . the computer will detect the position of stylus when the tip is depressed and generate the appropriate corresponding command or letter . the student would perform a signature by pressing the stylus against the pad in the signature area 24 with sufficient force to depress the tip 23 of the stylus . the student then uses the stylus as he would a pen to handwrite a signature . when the computer detects the stylus in the signature area the computer will represent the student &# 39 ; s signature on the monitor 14 . when the stylus is in the signature area and the tip is depressed and the stylus is moving , the computer will draw a line on the monitor corresponding with the line motion made by the student . when the stylus is moved without having its tip depressed the computer will not make a line on the monitor . thus , when the student lifts the stylus to start a new word the monitor will show the movement as a space and the words will be properly spaced apart . in addition to the student computer there is also an administration or central computer 50 with an associated disk drive 51 , keyboard 52 , monitor 54 and printer 56 . operationally , the administration computer would be in a secured area not accessible to students who participate in cbt sessions . typically , the two computers would interface by downloading the necessary information from the student computer 10 onto the floppy disk 18 and then manually transporting the disk to the administration computer 50 . alternatively , the administration computer could be connected to the student computer by a hard wire link ( dashed line 60 ) therebetween . a number of such student computers could be networked or linked to a single central administration computer . referring to fig2 the individual steps of the verification system of the present invention will now be explained in detail . a student becomes an authorized user of the cbt system by performing the necessary registration steps with the cbt administration personnel . at the time of authorization the student is required to perform a verified signature . ( alternatively , the verified signature could be collected at the time of the student &# 39 ; s first use of the cbt system .) using the digitizing pad 20 and the stylus 22 ( fig1 ), the student creates a signature in the signature area 24 by using the stylus as a pen and simulating &# 34 ; writing &# 34 ; in the signature area . the pad and stylus create a machine - readable code that represents the student &# 39 ; s signature , which code is &# 34 ; registered &# 34 ; by the computer . ( alternative means for registering the signature , other than by stylus and digitizing tablet , are available . for example , the signature could be written by the student using a standard &# 34 ; mouse &# 34 ; on any flat surface or by using a light pen and writing directly onto the screen of the monitor 14 .) the student &# 39 ; s signature is thereby registered as a verified ( or control ) signature , loaded into the computer &# 39 ; s ram and displayed on the monitor 14 for the student to view . this action is represented by block 70 . after completing the signature the student has the option to accept the signature or erase it and start over . ( this is provided for convenience so someone not familiar with the use of the stylus has a chance to write a more representative signature .) this looping process 72 ( writing signature , accepting or erasing ) is repeated until the student accepts the signature . when the student indicates satisfaction with the signature , discriminator data ( described below ) is registered at 75 and the signature data and discriminator data are then encrypted by means 76 and stored onto a data storage medium 78 which is typically the magnetic disk 18 ( fig1 ). the discriminator data corresponding to the verified signature comprises the signature size , signature density ratio and time to create the signature by the user . the number of erasures may also be recorded . the encrypted , stored verified signature and discriminator data are then , at some later date , transported to , and loaded into , the administration computer 110 . a student will begin a training session by logging onto the computer 10 or loading a disk 18 onto the disk drive 16 of the student computer 10 and executing a program for conducting a training session . training sessions that are part of a series of sessions will typically read information from the student &# 39 ; s personal disk 18 to determine the stage of computer training that should be next executed . the training session then begins and the student follows instructions as presented by the cbt program on the monitor 14 . the verification system may , if desired , be programmed to request a session signature from the student at the beginning of each training session . during the training session , the verification system will randomly generate requests 94 for session signatures form the student at a rate selected by administration personnel . for example , the administration personnel may select a sample rate of 60 minutes in which case the cbt system will query the cbt user for a session signature randomly once each 60 - minute interval . the student must then write his / her name in the signature area 24 of the digitizing pad 20 in order to continue the training session . the signature is displayed graphically on the monitor 14 . after writing the signature the student has the option of accepting the signature or erasing it and writing a new one . when the signature is finally deemed acceptable by the student it is registered and stored in the computer . the system also records the date and time of signature registration and measures and records various discriminator data associated with the signature for use in signature analysis . the discriminator data includes the elapsed time for a student to write a signature , the number of erasures before the student indicates satisfaction with the signature representation , a signature density ratio , and a numerical size indication of the signature . the elapsed time and number of erasures are self - explanatory . the size of the signature is determined by the smallest rectangle that can enclose the signature . apologizing the signature display to the first quadrant of a cartesian coordinate plane -- the computer calculates the maximum x and y and the minimum x and y of bits set ( or pixels on the monitor 14 ) by the signature representation . the maximum x and y and minimum x and y define the four sides of a rectangle that is directly proportional to the numerical size discriminator datum . the density ratio is calculated by dividing the number of bits set by the signature representation into the number of bits within the smallest enclosing rectangle as calculated in the size determination portion of the program described above . the number of bits set reflects the curvilinear length of the signature lines . the signature registration routine is diagrammatically represented by the logic flow diagram shown in fig4 which illustrates the logic flow for the source code reprinted in appendix a . the logic flow diagram is self explanatory and can be understood by those familiar with the art . after the signature is registered , the time , date , and discriminator data along with the signature representation data are then encrypted at 96 for security purposes , so as to prevent tampering , for example , and the encrypted data stored at 98 on a magnetic storage media such as disk 18 . the student &# 39 ; s answers in response to queries by the cbt program at 100 are also encrypted and stored along with the session signature ( s ), time , date and discriminator data . thus , at the end of a training session the student &# 39 ; s disk will contain the results of the cbt training session , including the student &# 39 ; s answers to cbt test queries , and his / her signature representations with time , date and discriminator data . all data is stored in encrypted format . this disk could then be manually transported to the administration computer 110 , or alternatively the information could be sent by a hard - wire network link . after the verified signature , the requested session signatures , the discriminator data , and responses to the cbt queries are loaded into the administration computer it is possible to analyze the data and generate a report for administration personnel . to do so , the data is read into a report program , decrypted by means 112 and a program 114 detects anomalies in the discrimination data . an anomaly is detected when a discriminator datum falls outside a predetermined range of acceptable deviation as compared to the corresponding discriminator datum of the verified signature . the range of acceptable deviation is determined by statistical methods based upon empirical data and is subject to improvement as the data base grows . a source code listing of an exemplary program for comparing and detecting signature anomalies is included in appendix a . this information is then organized into a useful form and a report 118 is generated which can be listed on the printer 56 or monitor 54 . the cbt administrator has the option of viewing signature ( s ) corresponding to anomalous discriminator data on the monitor 54 of the central computer or the printer 56 , and thereby visually comparing , side - by - side , the verified and session signatures . it will be recognized that , instead of storing the encrypted signature information on a disk medium 18 , it would also be feasible to hardwire the student computer 10 to the administration computer 110 . this would eliminate the need to manually transport the disk between the student computer and the administration computer . in addition to the signature discriminator data mentioned above , it is possible to measure and register additional discriminator data depending upon the degree of security required for the cbt system . for example , there are known signature recognition systems that measure other characteristics of a signature such as handwriting speed . one such system is shown in engelbrecht , u . s . pat . no . 3 , 962 , 679 . it will be apparent that such systems could readily be integrated into the present invention to provide different or additional discriminator data to be stored along with the representations of the signatures for use in later comparison . it is also feasible for the operations of the student computer 10 and the administration computer 110 to be performed on the same computer . the present invention separates the system between two computers for security and logistics reasons . however , the steps shown in fig2 and the hardware components of fig1 could easily be accomplished within a single computer system in which security would be maintained by providing limited access to data . data access could be limited by providing security codes that are known only by authorized administration personnel which codes would be required by the computer before permitting access to sensitive data . the source code for the signature registration program is reprinted in appendix a . the majority of the program is coded in the programming language known as &# 34 ; c .&# 34 ; two pages at the end of the listing , written in a data manipulative language known as clipper ®, show the functions comparing the discriminator data of the verified signature with that of the session signature to detect anomalies in the latter . the terms and expressions which have been employed in the foregoing specification are used therein as terms of description and not of limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only by the claims which follow . ## spc1 ##	6
referring now to fig1 - 2 of the invention , an interchangeable display device 10 in this particular embodiment of the invention is a picture frame for hanging on a wall or standing on a horizontal surface . the interchangeable display device 10 has three main components , a three dimensional outer shell 12 , an interchangeable insert 24 and a support ring 30 . the three dimensional outer shell 12 has three dimensional features that give the interchangeable display device 10 a stadium - like appearance . the outer shell 12 has a central aperture 14 formed in a generally central region of the outer shell 12 . a plurality of tiers 16 extend upward from an edge 64 to an upper rim 18 on the outer shell 12 . in addition to adding the overall three - dimensional structure of the interchangeable display device 10 , the plurality of tiers 16 function to give the overall appearance of stadium style seating ( e . g ., bleachers ). a wall 20 extends downward from the upper rim 18 to a bottom edge 22 . the outer shell 12 has a three - dimensional shape and there is a hollow region formed under the plurality of tiers 16 . the three - dimensional outer shell 12 is made of thin , lightweight thermoformed or molded plastic material . preferably , the material is a vacuum formable plastic such as polystyrene or petg clear material . however , if injection molding is used , a suitable injection molding would be used . the outer shell 12 has a substantial amount of flexibility which allows the wall 20 and bottom edge 22 to bend and connect to the interchangeable insert 24 . additionally , it is also possible for the outer shell 12 to have a different shape in order to mimic other stadium structures . for example , the outer shell 12 may have a shape that would more appropriately look like a baseball stadium ( i . e ., a diamond shape ), or it may have a more customized shape to look like a specific well recognized stadium ( e . g ., wrigley field , tiger stadium , ford field , etc .). this way the interchangeable display device 10 is customized to have a certain specialty appearance . the interchangeable insert 24 has a wall 65 that is part of the inner portion 26 that aligns with the edge 64 of the outer shell 12 . an outer portion 28 of the interchangeable insert 24 extends underneath the hollow portion formed under the plurality of tiers 16 and is engageable to the bottom edge 22 of the outer shell 12 . the engagement between the outer portion 28 of the interchangeable insert 24 and the bottom edge 22 is a close tolerance or interference slip fit engagement , such that tabs ( not shown ) along the bottom edge 22 grasp the edge of outer portion 28 . the interchangeable insert 24 provides stability and support to the outer shell 12 . furthermore , the interchangeable insert 24 is used as a backing for mounting the interchangeable display device 10 against a wall , as well as providing a place for mounting an object to be displayed , such as a photograph , award or other object . a bracket 29 can be fixed to the back side of the interchangeable insert 24 to allow the entire interchangeable display device 10 to be hung on a wall using said bracket 29 . the bracket 29 can be connected to the interchangeable display device 24 using fasteners or adhesives . additionally , it is possible for the bracket 29 to be molded to or integrated with the interchangeable display device 10 during the injection molding process . along the upper rim 18 of the outer shell 12 a support ring 30 is connected . the support ring 30 can be connected to the outer shell 12 using several different arrangements . one way of connecting the support ring 30 to the outer shell 12 is to have tabs 31 extending from the bottom of the support ring 30 that align with holes 33 that have been pre - punched on the upper rim 18 . a second way is use other types of fastener arrangements such as snap fitting , screw fasteners or other types of removable fasteners to connect the support ring 30 to the upper rim 18 . the support ring 30 provides protection to the outer shell 12 , as well as adding an overall roof - like appearance to the interchangeable display device 10 . the interchangeable insert 24 has an aperture 32 located in a generally central region of the inner portion 26 . the aperture 32 is used for accessing an object 62 such that a photograph , award or other document can also be attached to the back side of an object supporting member 34 . field markings can be placed on the inner portion 26 . in one particular embodiment , the interchangeable insert 24 is transparent so it simulates glass or ice to look like a hockey rink . the aperture 32 of this particular embodiment is a window . a hollow pocket 60 is formed on the back portion of the window . the hollow pocket 60 allows an object 62 to slide into the pocket and be held in place for viewing . the object 62 is displayed by looking at the object 62 through the window . it should be noted that the hollow pocket 60 can be incorporated as an alternate arrangement on all the other embodiments of the invention in order to ease the process of positioning the object 62 in the aperture 32 . fig3 depicts a cross sectional view taken of section line 3 - 3 in fig2 . in particular fig3 shows how the interchangeable insert 22 snap fits with the outer shell 12 , additionally , the support ring 30 can be seen as connecting to the outer rim 18 using a tab 31 that connects to the apertures 33 in the upper rim 18 . the interchangeable insert 24 has an outer portion 28 that can be seen underneath the plurality of tier 16 of the outer shell 12 . the wall 20 of the outer shell 12 has a bottom edge 22 that flexes to cover the edge of the outer portion 28 of the interchangeable insert 24 . the outer portion 28 of the interchangeable insert 24 also has an elevated ridge 68 that contacts the plurality of tiers 16 to create and interference fit between the elevated ridge 68 and the bottom edge 22 of the outer shell 12 . the wall 65 that serves as a boundary for the inner portion 26 of the interchangeable insert fits next to the edge 64 of the aperture 16 of the outer shell 12 creating an interference fit . under the plurality of tiers 16 there is a hollow cavity 70 . the hollow cavity 70 contributes to making the interchangeable display device 10 lightweight . the wall 65 may also have three - dimensional components incorporated thereon . for example , it may be desirable to have miniaturized objects that look like plexiglas boards similar to those found around a hockey rink . the wall 65 may also contain advertisements faced along the wall 65 interior . these advertisements will give the interchangeable display device 10 a more realistic stadium type feel . additionally , the advertising wall could be used as a promotional item on the insert for advertisers or sponsors who might pay for such items . fig4 - 5 depict an additional embodiment of the interchangeable display device incorporated as a table . as shown , an interchangeable display device 10 has a table backing 46 having an aperture 48 . in this particular embodiment the table backing 46 has a general shape of a rectangle with rounded edges , and an aperture 48 that also generally has the shape of a rectangle with rounded edges . the shape of the table backing 46 and aperture 48 can vary depending upon the type of interchangeable display device 10 being used . for example , with the interchangeable display device 10 were going to depict a tennis court it may be more appropriate to have a rectangular shape aperture . a set of four legs 50 are mounted to the underside of the table backing 46 at a location generally near each of the four rounded corners . the set of four legs 50 allow the interchangeable display device 10 to lay flat at a height high enough to be used as a table . while this particular embodiment depicts the use of four legs 50 it is also possible to have other embodiments that have a fewer or greater number of legs depending on the size of the table backing 46 or weight of the load that the interchangeable display device 10 must hold . at the top of each of the four legs 50 is a post 52 that functions to screw into a recess in the table backing 46 in order to connect the legs 50 and stabilize them to the table backing 46 . for additional support l brackets 56 have been connected between the table backing 46 and with two sides of the table legs 50 . the l brackets 56 provide further structural support for the interchangeable display device 10 . it is within the scope of this invention to have a greater or less number of l brackets 56 depending upon the amount stability and weight that the interchangeable display device 10 will be holding . the interchangeable insert 24 is fastened to the table backing 46 using a plurality of fasteners 54 . once the interchangeable insert 24 has been connected to the table backing 46 the outer shell 12 and support ring 30 can also be connected in the same fashion as described above for the three dimensional picture frame embodiment . this particular embodiment will also include a transparent top 58 that is positioned between the outer shell 12 and the support ring 30 . the transparent top will extend across the upper rim 18 providing a smooth flat planer surface of the interchangeable display device 10 can be used as a table . the transparent panel 58 can be made of glass or any other transparent material such as plastic , sapphire , quartz or the like . fig2 and 5 show the interchangeability of the interchangeable display device 10 . an object support member 34 is connected around the aperture 32 . the object support member 34 can be molded to look like a football , soccer ball , baseball , or hockey puck . fig2 and 5 show the object support member 34 , which has a round hockey puck shape . alternatively , a second object support member 34 ′ can be interchanged with object support member 34 . the second object support member 34 ′ has a football shape . the object support members 34 , 34 ′ have an aperture 35 , 35 ′. while fig2 - 5 show the object 62 being placed in the hollow pocket , it is also possible for the object 62 to be placed under the object support members 34 , 34 ′ and to be viewed through the aperture 35 , 35 ′. in an alternate embodiment , the aperture 35 , 35 ′ in the object support members 34 , 34 ′ also include a generally transparent plastic or glass window that covers the aperture 35 , 35 ′ thus protecting the object being displayed . the aperture 35 , 35 ′ may also be open if desired . fig2 and 5 also show the interchangeable aspects of the interchangeable insert 24 . two interchangeable inserts 24 that each include the inner portions 26 having a design 36 , 36 ′ is adhesively bonded to inner portion 26 . however , embossing , laser printing or etching or the like may be used for imbedding the design in the plastic if desired . the design 36 ′ has markings that mimic a football field . the design 36 has markings that mimic the markings of a hockey rink . the design 36 , 36 ′ has a great deal of detail such as displaying team names , field markings , colors , etc . while only two distinct print or laser designs 36 have been described herein , it is possible to incorporate virtually any desired appearance . for example , it may be possible to have a print or laser design that mimics a soccer field or a basketball court . additionally , the inner portion 26 may also have three - dimensional components fastened to the inner portion 26 . examples of possible three - dimensional components are goal posts , flags , cones , figurines , etc . the outer shell 12 , as well as the support ring 30 , can also be customized . it is also possible to install three - dimensional components on the outer shell 12 of the interchangeable display device 10 . for example , it may be desirable to incorporate safety gates , seat numbers , or other items on the outer shell 12 . the various components of the interchangeable display device can also be color coordinated . for example , the support ring 30 , outer shell 12 , interchangeable insert 24 and object support member 34 , 34 ′ can all have various colors , designs , or patterns on their surfaces . in operation , the support ring 30 provides structural support to the upper rim 18 and generally to outer shell 12 . the support ring 30 may be changed depending on the season or picture displayed . thus , the device is customizable to seasons or an individual &# 39 ; s preferences . additionally , individual sponsors may wish to place advertisements on the support ring . another embodiment of the invention shown in fig2 - 3 involves disposing a light source 72 inside of the hollow cavity 70 . when the light source 72 is illuminated , the surface of the plurality of tiers 16 will glow . the light source 72 is positioned to set on the elevated ridge 68 of the outer portion 28 of the interchangeable insert . the light source 76 can be an incandescent , neon , led or any other suitable light emitting device . a light casing 74 extends over the surface of the light source 72 and extends downward to the surface of the outer portion 28 . a fastener 80 is used to hold the light casing 74 in place . the fastener 80 extends through the outer portion 28 , into a wood backing 82 that circumvents the bottom side of the outer portion 28 of the interchangeable insert 24 . additionally , it is possible to substitute the wood backing 82 with a washer or wing nut that will hold the fastener 80 . in order to supply power to the light source 72 a transformer 78 is mounted to the outer portion 28 and a wire 76 extends from the transformer 78 to the light source 72 for transmitting power to illuminate the light source 72 . the incorporation of a light source 72 can be used on all embodiments of the invention . on the table embodiment of the invention ( shown in fig4 - 5 ) the fastener 80 can be driven into table backing 46 with no wood backing 82 being used . further areas of applicability of the present invention will become apparent from the detailed description provided hereinafter . it should be understood that the detailed description and specific examples , while indicating the preferred embodiment of the invention , are intended for purposes of illustration only and are not intended to limit the scope of the invention .	0
the present invention is based upon the transplantation of mge cells into adult or immature brain so as to form new , functional inhibitory interneurons that can restore or modify neural circuits . a first aspect of the invention is a method of enhancing inhibition in a mammal , comprising transplanting mge cells into the brain of that mammal . the method is of use in diseased brain , in which such interneurons have been functionally impaired , damaged or destroyed , and so the invention advantageously provides for restoring inhibitory interneuron function in the brain . diseases which may benefit from increased inhibitory function in the cns can thus be treated such as those characterised by abnormal excitatory neuron function . in use , an mge cell is transplanted and forms or creates an inhibitory interneuron de novo in the brain . typically a plurality of cells is used , forming a plurality of interneurons . in examples described in more detail below , these are found to have dispersed from the location of transplantation and to have differentiated from the original mge cells . a second aspect of the invention is a method of delivery of an inhibitory interneuron into a first portion of a mammalian brain , comprising transplantation of mge cells into a second portion of the brain , distal from the first . migration and subsequent differentiation of the mge cell delivers the functional interneuron . lack of inhibitory interneuron circuitry is commonly seen across many areas of diseased brain , and it is an advantage that the invention comprises transplantation into one location from which cells and progeny disperse , providing interneuron populations in many distal locations . it is hence not necessary to transplant cells into multiple loci . the interneuron can be genetically engineered to express a heterologous gene . in an example , the interneurons expressed gfp and other cells of the invention can be modified to express other proteins to be delivered to the brain . the interneuron can also be genetically engineered to express a heterologous gene of therapeutic value . for example , mge cells could be used to deliver proteins selected from : proteins for combating cns malignancies ; proteins for treatment of epilepsies , e . g . by modifying specific signalling pathways ; proteins for treatment of neurodegenerative disorders , e . g . alzheimers , including molecules that contribute to the clearance of neurotoxic substances ; and proteins for treatment of neuropsychiatric disorders , e . g . autism and schizophrenia . a further aspect of the invention is a method of creating an inhibitory interneuron , comprising obtaining an mge cell and treating that cell so as to create an inhibitory interneuron . the inhibitory interneuron is preferably part of a neural circuit in which it provides inhibitory feedback via secretion of inhibitory neurotransmitters such as gaba . a suitable treatment is to transplant the cell into mammalian brain , especially diseased brain . the invention is of application generally to mammals , and in particular wherein the mammal is selected from the group consisting of mouse , rat , human , livestock animals and domestic animals . preferably , the mammal is a human and the invention provides compositions containing human cells and methods and uses for treatment of human disease . mge cells are described in a number of reports . for use in the present invention mge cells from a variety of different sources may be used . the cells may be obtained from foetal or embryo brain , for example by dissection of tissue and then dissociation of cells to yield a composition comprising dissociated cells . mge cells may also be obtained by differentiation of a neural stem cell . thus a neural stem cell is treated so as to differentiate into an mge cell . the neural stem cell may be obtained directly from tissue of a patient . it may be obtained by differentiation of a pluripotent cell , such as an es cell . in an embodiment of the invention , mge cells are transplanted into a region of the brain selected from hippocampus , cerebral cortex , subthalamic nuclei , other thalamic or hypothalamic regions , cerebellum , striatum and spinal cord . preferably , the method is for treatment of disease and the patient brain being treated comprises one or more lesions , such as a region with damaged or destroyed inhibitory interneurons , the patient typically being a mammal , especially a human , having consequent reduced inhibitory interneuron activity , or abnormal excitatory activity . in an example set out in more detail below , dissociated mge cells are injected into the brain , preferably in association with a carrier , this carrier preferably being an air - buffered cell culture media . methods described herein are suitable for treatment of a patient afflicted by a disease characterised by inadequate inhibitory interneuron activity or increased excitatory neuron function and such diseases include epilepsy , parkinson &# 39 ; s disease , huntington &# 39 ; s disease , schizophrenia and chronic pain . a further aspect of the invention is a composition , comprising isolated human mge cells in a carrier , suitable for transplantation into a human brain . the composition can easily be loaded into a syringe for administration to the recipient . various carriers are suitable for the purpose , including tissue culture medium . preferably the carrier would have an appropriate osmolarity and ph in order to maintain the viability of the cells . in a typical administration from about 10 5 to 10 7 , preferably from about 3 × 10 5 to 3 × 10 6 , cells are used , generally in from 0 . 5 to 20 μl of medium , and at a concentration of from 5000 to 2 × 10 6 cells / μl , preferably from 5 × 10 4 to 10 6 / μl . it will be appreciated by one of reasonable skill in the art that the number of cells and cell density may be optimized per host ( e . g ., human ) through routine experimentation . still further aspects of the invention lie in the use of an mge cell in manufacture of a composition for enhancing inhibition in a mammal , the composition being preferably for restoring inhibitory interneuron function or counteracting elevated excitatory neural function e . g . for treatment of a disease characterised by inadequate inhibitory interneuron activity or over activity of excitatory neurons such as neuropathic pain . another aspect is the use described for de novo creation of an inhibitory interneuron , in particular in a human . referring to specific embodiments of the invention such as are described in detail below , transplanted cells are mge cells , or have the characteristic phenotype of mge cells . following transplantation , these cells contribute to the inhibitory neuron function of the host brain , integrating into the host &# 39 ; s brain whilst not being tumorigenic . the migration is generally found to be fairly rapid , typically 5 - 10 μm / hour , facilitating distribution of the cells and progeny neurons throughout the brain . this migration allows delivery of interneurons into regions of the brain distinct from the site of transplantation , e . g . transplantation into the cerebral cortex can result in an inhibitory interneuron creation in the hippocampus . transplanted cells may be tracked following implantation using molecular markers ( e . g . gfp ). transplanted mge - like precursors form differentiated interneurons in the host &# 39 ; s brain , adopting the morphology of inhibitory interneurons , and have been found to have the ability to migrate across the lesions in the brain which can occur in neural disease . transplanted cells adopt the phenotype of inhibitory interneurons , such that they express molecules characteristic of mature inhibitory neurons , and are found to alter neural function within the host brain , preferably in a permanent manner . preferably transplanted cells do not form cortical pyramidal neurons and do not increase excitatory neuron activity in the brain , but cause a net increase in inhibitory neuron function in the brain relative to excitatory function . transplanted cells hence are used to restore inhibitory neural function to normal levels in diseases characterised by a lack of inhibitory neural function or pathological excitation . the cells , after integration into the host brain , receive synaptic inputs . the cells , after integration into the host brain , also receive excitatory inputs . an advantage of the invention is that , following transplantation of an mge cell , there is migration of the cell and formation in situ of a functioning inhibitory interneuron . as a result , and referring to the examples subscribed herein , there is enhanced inhibitory interneuron activity in the recipient due to formation of a functional inhibitory interneuron . this interneuron can be a replacement for one lost due to disease or could be an additional interneuron . this interneuron not only receives synaptic inputs but also excitatory inputs . a consequence of the inhibitory outputs , that the cells are capable of producing , is an increase in gaba mediated synaptic events in the vicinity of the mge cell derived inhibitory neuron . a further advantage is that the cells produce mature gaba - secreting interneurons in situ and there is no need artificially to modify transplanted cells so as to secrete gaba . the invention can thus provide treatment for diseases , such as epilepsy and other diseases discussed herein , where lack of inhibitory interneuron function and consequent over - activity or inadequate regulation of excitatory interneurons forms an underlying element to the disease . in an example of the invention discussed in more detail below , mge cells are obtained by mechanical disruption of a dissected portion of foetal and / or embryonic brain . mge cells can thus be obtained for transplantation into humans . it is preferred that any mge cell - containing composition is relatively pure in that other contaminating cells are substantially removed . in certain embodiments of the invention the cellular component of the mge cell - containing composition comprises at least 85 %, at least 90 %, or at least 95 % mge cells . in some embodiments at least 98 % of the cells are mge cells . in the art , drug - based therapies are known in which levels of neurotransmitters such gaba in the brain are increased , sometimes leading to a generalised increase in inhibitory activity . a feature of the present invention is that inhibitory interneurons are formed de novo and in situ in the brain , typically forming functional synapses so as to restore neural circuits — in the case , for example , of epilepsy by restoring normal regulation of neural circuits with formation an inhibitory interneuron . rather than simply treating a symptom of these diseases , an advantage of the invention is that an underlying cause of the disease is directly addressed . it also provides a method to target inhibition to an area restricted by the migration of grafted cells . this is in contrast to therapies that increase inhibition throughout the nervous system . the invention is now described in the following specific examples , with reference to the accompanying drawings , in which : fig1 shows mge cells migrate rapidly following graft and so distribute throughout the host &# 39 ; s brain ; fig2 shows mge cells distributed throughout the host &# 39 ; s brain adopt a mature interneuron morphology ; fig3 shows integrated mge cells in the somatosensory and cingulate cortex express molecules that characterize interneurons ; fig4 shows grafted mge derived cells are present in the dentate gyrus of the hippocampus 60 dat . fig5 shows integrated mge - derived cells function in a manner characteristic of inhibitory interneurons ; fig6 shows recording configuration for analysis of inhibitory current in host brain ; fig7 : shows mge grafted cells alter synaptic function in the host brain ; fig8 shows synaptic inhibitory current is increased in the hippocampus from grafted mice ; fig9 shows glutamatergic synaptic excitation is not altered in neocortex of mge grafted mice ; and fig1 shows cortical brain slices prepared from dix mutant mice transplanted with mge progenitor cells early in development ( p0 - p2 ) exhibit a level of inhibition ( measured as spontaneous and miniature ipscs on postsynaptic pyramidal cell targets in regions containing mge - gfp interneurons ) that is comparable to that observed in control dix heterozygote mice . in more detail , fig1 shows distribution of mge derived cells 3 days after transplantation into neocortex and striatum . ( a ) mge derived cells were detected by immunohistochemistry against gfp . serial sections were utilized to determine the position of labelled cells . notice the wide distribution throughout neocortex , striatum , and hippocampus . ( b ) high magnification of area in a showing mge cells moving away from injection site (). ( c ) detail of a typical mge migrating cell . ( d ) distribution of grafted cells 3 and 60 dat ; number of cells / distance of serial sections . scale bar in a : 1 mm ; b : 250 μm ; d : 25 μm . f , frontal ; d , dorsal ; l , lateral ; fig2 shows acquisition and distribution of mature interneuron morphology at 60 dat . ( a ) camera lucida maps indicating the position of mge graft - derived cells at three rostrocaudal levels after transplantation into neocortex ( ctx ), hippocampus ( hp ), and striatum ( st ). ( b ) detection of grafted cells by immunohistochemistry against gfp in the ipsilateral somatosensory cortex . note the wide distribution of grafted cells in multiple cortical layers . compare the dark background in layers i - ii and v of the injected hemisphere ( b ) versus the contralateral hemisphere ( c ). ( e - k ) gfp detection by immunohistochemistry provides a golgi - like staining of grafted cells . mge - derived cells in cortex differentiated into neurons presenting typical morphology of interneuron subtypes e . g ., bitufted or bipolar cells ( e ), chandelier cells ( f ) with synaptic boutons resembling candlesticks ( arrowheads ), basket cells ( h ), neurons with small body ( i ), and multipolar cells ( j ). in hippocampus , grafted cells accumulated in ca1 ( d ) and dentate gyrus ( g ). in striatum , the vast majority of cells differentiated into medium aspiny interneuron ( k ). scale bars in b , c , d , f , h and i : 100 μm ; e , g , j and k : 50 μm ; fig3 shows molecular characterization of mge graft - derived cells in somatosensory ( a - f , j - o ), and cingulate cortex ( g - i ), 60 dat . immunohistochemical co - localization of grafted gfp + cells with gaba , parvalbumin ( pv ), calretinin ( cr ), somatostatin ( som ), and neuropeptide - y ( np - y ). arrowheads show double positive cells for gfp and specific marker . scale bar 50 μm for a - o ; fig4 shows grafted mge derived cells in the dentate gyrus of the hippocampus 60 dat . immunohistochemical co - localization of mge derived cells expressing gfp with gaba ( a - c ), parvalbumin ( pv ) ( d - f ), and somatostatin ( som ) ( g i ). arrowheads show double positive cells . scale bar 100 μm for a - i ; fig5 shows mge - derived cells exhibit interneuronal firing properties . ( a ) ir - dic image overlayed with an epifluorescence image of an acute coronal slice ( 4 weeks post - grafting ) containing gfp + mge - derived cells ; epifluorescence image at right of a cell filled with alexa red during the patch recording . ( b ) membrane potential of the gfp + cell shown in panel a recorded under current clamp at the resting potential (˜− 71 mv ). note the small degree of inward rectification with hyperpolarizing current steps ( 200 ms ) the lack of spike frequency adaptation with long depolarizing current steps ( 1000 ms ) typical of mature cortical interneurons . ( c ) graph of firing frequency of recorded gfp + cells at depolarizing step of 0 . 2 na ( n = 14 ). note the linear frequency - current relationship ( inset graph ); fig6 shows recording configuration for analysis of inhibitory current in the host brain ( a ) left panel shows a representative example of an acute coronal slice . box indicates region in which electrophysiological recordings were obtained . ( b ) panel shows the acute coronal slice with gfp + cells in layers i - iii visualized under ir - dic and epifluorescence microscope . a recording was obtained from a pyramidal neuron ( asterisk ) in the vicinity of gfp + cells . ( c ) panel shows a higher magnification of the recording site with gfp + mge cells ( green arrows ) and a lucifer yellow filled pyramidal neuron ( yellow asterisk ); fig7 shows mge grafted cells alter synaptic function in the host brain . ( a ) sample traces of sipscs recorded from pyramidal cells ( control brain and grafted brain ); 4 weeks post - grafting . note the increase in ipsc amplitude and frequency for grafted animals vs . age - matched controls . ( b ) cumulative data plots for all ipsc recordings from control ( light gray bars ) and grafted ( black bars ) animals are shown . recordings were made at 2 , 3 , and 4 weeks following grafting . data represent 7 - 10 cells for each bar ; data presented as mean ± s . e . m . ; significance taken as p & lt ; 0 . 05 using one - way anova . ( c , d ) measurement of the total charge transfer for pyramidal cells from control and grafted brain . note the significant increase for grafted brains at 4 weeks . ( e ) cumulative probability plots of sipscs inter - event intervals show higher frequency values for grafted brains ( p & lt ; 0 . 05 ); fig8 shows synaptic inhibitory current is increased in the hippocampus from grafted mice . ( a ) spontaneous ipscs of hippocampal pyramidal cells from control grafted mice with plots of frequency and amplitude of sipscs of hippocampal pyramidal cells from control ( light gray bars ; n = 10 ) and grafted mice ( black bars ; n = 10 ). ( b ) measurement of the total charge transfer of ipscs recorded from ca1 hippocampal pyramidal cells from control and grafted brain . note the significant increase values for grafted brains at 4 weeks . ( c ) cumulative probability plots of sipscs inter - event intervals shown higher frequency values for grafted brains ( p & lt ; 0 . 05 ). error bars indicate sem ; p & lt ; 0 . 001 ; ** p & lt ; 0 . 05 ( anova ); fig9 shows glutamatergic synaptic excitation is not altered in neocortex and of mge grafted mice . ( a ) plots of all cortical pyramidal cells sampled for spontaneous epsc data . sepsc amplitude , decay - time and frequency show no significant difference between controls ( light gray bars ) and grafted ( black bars ) brains ( b ) representative traces of sepscs recorded from a gfp + grafted cell at 4 weeks post - grafting . sepscs were abolished by application of cnqx and apv ( bottom trace ) ( c ) sample of eepsc recording from gfp + grafted cells at different holding potentials showing the reversal membrane potential at 0 mv ( see inset graph ); and fig1 shows cortical brain slices prepared from dix mutant mice transplanted with mge progenitor cells early in development ( p0 - p2 ) exhibit a level of inhibition ( measured as spontaneous and miniature ipscs on postsynaptic pyramidal cell targets in regions containing mge - gfp interneurons ) that is comparable to that observed in control dix heterozygote mice . mge cells were transplanted from mice expressing green fluorescent protein ( gfp ) into the postnatal brain . the time course of migration and differentiation of these neuronal precursors was determined . also the molecular phenotype of transplanted mge precursors was analysed using antibodies directed against gaba , somatostatin ( som ) and neuropeptide y ( npy ). using cortical slices from grafted animals we showed that mge - gfp neurons exhibit intrinsic firing properties similar to fast - firing basket - type cortical interneurons . electrophysiological measurements demonstrate that mge - derived neurons increase the level of gaba - mediated synaptic inhibition , and therefore appear to modify neocortical inhibitory tone . tissue dissection and cell dissociation . ventricular and subventricular layers from the anterior part of the medial ganglionic eminence , where a sulcus clearly divides medial and lateral ganglionic eminences , were dissected from e12 . 5 - e13 . 5 embryonic gfp + transgenic mice ( hadjantonakis et al ., ( 1998 ) mech dev 76 , 79 - 90 ). the day when the sperm plug was detected was considered e0 . 5 . bordering tissue between adjacent regions was discarded during dissection to avoid contamination . tissue explants were mechanically dissociated by repeated pipetting through 200 μl yellow plastic tip ( 10 - 20 times ). dissociated cells were washed with 1 ml of l - 15 medium containing dnase i ( 10 - 100 μg / ml ) and pelleted by centrifugation ( 2 minutes , 800 g ). cells were resuspended in 4 - 5 μl of l - 15 medium and kept on ice until further use . transplantation . highly concentrated cell suspension (˜ 10 6 cells / μl ) was front - loaded into beveled glass micropipettes (˜ 50 μm diameter ) that were pre - filled with mineral oil and l - 15 medium . micropipettes were connected to a microinjector mounted on a stereotactic apparatus specially adapted for neonatal mice . 3 - 4 days old cd - 1 mice ( charles river ) were anesthetized by exposure to − 4 ° c . until pedal reflex was abolished . anesthesia was maintained by performing surgery on a cold aluminum plate . 5 × 10 4 cells / mouse in a 50 - 100 nl volume were injected using a 45 ° inclination angle and the following coordinates from bregma : striatum ( 3 . 3 mm a , 2 . 5 mm l , 2 . 6 mm d ); cortex ( 2 . 2 mm a , 3 . 5 mm l , 1 . 2 mm d ); hippocampus ( 1 . 2 mm a , 1 . 7 mm l , 2 . 0 mm d ). for survival and migration distance estimations , 5 × 10 3 cells were grafted in a single point ( 2 . 5 mm a , 3 . 0 mm l , 2 . 5 - 1 . 5 mm d ). grafted pups were returned to their mothers and analyzed after 3 days , 1 , 2 , 3 , 4 weeks and 3 months . all experimental animals were treated in accordance with ucsf laboratory animal research center guidelines . immunostaining . animals were transcardially perfused with 4 % paraformaldehyde at different ages . brains were removed , postfixed overnight in the same solution , and sectioned coronally ( 50 μm ) using a vibratome . floating brain sections were immunostained with the following antibodies : rabbit anti - gaba ( 1 : 2500 , sigma ), mouse anti - parvalbumin ( 1 : 4000 , sigma ) and rabbit anti - calretinin ( 1 : 4000 , swant swiss abs ), rat anti - somatostatin ( som ) ( 1 : 500 , chemicon ), rabbit anti - neuropeptide y ( 1 : 5000 , immunostar ), and mouse anti - gfp ( 1 : 200 , q - biogene ). the following secondary antibodies were used : cy3 - conjugated donkey anti - mouse , cy3 - conjugated donkey anti - rabbit , cy2 - conjugated donkey anti - mouse and biotin - conjugated donkey anti - mouse ( 1 : 400 , all from jackson immunoresearch , pa ). sections were washed in pbs , blocked for 1 h in pbs containing 10 % donkey serum and 0 . 1 % triton x - 100 at room temperature . sections were then incubated overnight at 4 ° c . in primary antibodies diluted in pbs containing 10 % donkey serum and 0 . 1 % triton x - 100 , then were washed three times in pbs and incubated with secondary antibodies for 1 - 2 h at room temperature in the dark . for gaba immunostaining , triton x - 100 was eliminated from the protocol . biotinylated secondary antibodies and abc kit ( vector ) were used for peroxidase reaction with diaminobenzidine ( dab ). cell counts and quantification . quantifications of cell bodies stained with immunohistochemistry or gfp were counted on digitized images obtained with a dfc480 digital camera and im500 / fw4000 image manager software ( leica microsystems imaging solutions , cambridge , uk ) on a dm6000b microscope ( leica microsystems , wetzlar , germany ). survival percentage of grafted cells was estimated counting all gfp + cells in 10 coronal sections ( 300 μm apart , 1 section with injection site , 4 forward to the injection , and 5 backward ). a representation of cell number vs . distance to injection site was obtained on graph paper . quantification of area under the graph was estimated as total number of survived cells . the percentage of grafted gfp + cells expressing gaba , pv , cr , som or npy after transplantation was calculated in 3 coronal sections through each of the following regions : somatosensory cortex , striatum and hippocampus . for somatosensory each section was 500 μm apart , using stereotaxic coordinates ( bregma levels + 0 . 50 and − 0 . 50 mm ; paxinos and franklin , 2001 ); striatum sections were 400 μm apart , ( bregma levels + 1 . 60 and + 0 . 80 mm ); and for hippocampus , sections were 300 μm apart , ( bregma levels − 1 . 50 and − 2 . 10 mm ). at least 100 gfp + cells (− 50 in cortical layers ii - iv , and ˜ 50 in layers v - vi , visualized using dapi ) were analyzed for each marker in each animal . brains ( n = 5 ) were analyzed at 1 , 3 and 6 months after transplantation . statistical analysis was performed using the student &# 39 ; s t - test . quantifications of neuronal bodies stained by immunohistochemistry for interneuron markers in grafted and contralateral hemispheres were obtained as follows : in somatosensory cortex , 5 coronal sections ( 400 μm apart ) per mouse between septum ( bregma level + 0 . 75 mm ) and dorsal hippocampus ( bregma level − 1 . 25 mm ) were selected . a 1 mm strip of cortex from the white matter to pial surface was analyzed in each section ( 1 . 2 mm 2 each ). in hippocampus , the numbers of positive interneurons in the hilus and ca1 areas were determined in 3 coronal sections ( 300 μm apart , between bregma levels − 1 . 50 and − 2 . 10 mm ) per mouse . in striatum , positive cells were counted in 3 coronal sections ( 400 μm apart , between bregma levels + 1 . 60 and + 0 . 80 mm ) per mouse . brains from at least 5 different grafted mice were counted and averaged . to compare results between grafted and contralateral hemisphere statistical analysis using the student &# 39 ; s t - test was applied and contralateral results were referred as 100 %. results are presented as mean ± sem . significance level was taken as p & lt ; 0 . 05 . electrophysiology . acute tissue slices were prepared from male or female cd - 1 mice 2 , 3 , and 4 weeks after grafted with mge cells or saline ( control ) as previous described ( calcagnotto et al ., ( 2002 ) j neurosci 22 , 7596 - 605 ). whole - cell recordings were obtained from visually identified neurons ( pyramidal cells and gfp + cells ) using an infrared differential interference contrast ( ir - dic ) video microscopy system and epifluorescence microscopy ( molecular devices ). intracellular patch pipette solution used for whole - cell voltage - clamp recordings to study inhibitory postsynaptic current ( ipsc ) contained ( in mm ) 120 cs - gluconate , 10 hepes , 11 egta , 11 cscl 2 , 1 mgcl 2 , 1 . 25 qx314 , 2 na 2 - atp , 0 . 5 na 2 - gtp , ( ph 7 . 25 ; 285 - 290 mosm ); for excitatory postsynaptic current ( epsc ) solution contained ( in mm ) 135 cscl 2 , 10 nacl , 2 mgcl 2 , 10 hepes , 10 egta , 2 na 2 atp , 0 . 2 na 2 gtp , and 1 . 25 qx - 314 , adjusted to ph 7 . 2 with csoh ( 285 - 290 mosm ). to isolate gabaergic currents , slices were perfused with nacsf containing 20 μm 6 - ciano - 7 - dinitroquinoxaline - 2 , 3 - dione ( cnqx ) and 50 μm d -(−)- 2 - amino - 5 - phosphonovaleric acid ( d - apv ) and ipscs were recorded at a holding potential of 0 mv ; for excitatory postsynaptic currents ( epsc ), slices were perfused with nacsf containing 10 μm bicuculline methiodide ( bmi ) and recorded currents at a holding potential of − 75 mv unless otherwise noted . miniature inhibitory synaptic currents ( mipscs ) were recorded in nacsf containing 1 μm tetrodotoxin ( ttx ). ipscs / epscs were recorded on “ aged - matched ” pyramidal neurons ( mge graft - derived or sham - operated ) either in the same slice or in a different one . age - matched refers to slices obtained from mice within a three day time period . evoked currents were elicited using a monopolar electrode placed in the white matter . pyramidal cells were filled with biocytin and analyzed post hoc . to study the intrinsic firing properties of gfp + cells in current - clamp intracellular patch pipette solution contained ( in mm ) 120 kmegluconate , 10 kcl , 1 mgcl 2 , 0 . 025 cacl 2 , 10 hepes , 0 . 2 egta , 2 mg - atp , 0 . 2 na - gtp , ph 7 . 2 , ( 285 - 290 mosm ). cells were depolarized and hyperpolarized , via direct current injection ( 5 - 1000 ms , duration ); cells were filled with alexa red and analyzed post hoc . voltage and current were recorded with an axopatch 1d amplifier ( axon instruments ), and monitored with an oscilloscope and with pclamp 8 . 2 software ( axon instruments ), running on a pc pentium computer ( dell computer company , round rock , tex .). whole - cell voltage - clamp data were low - pass filtered at 1 khz (− 3 db , 8 - pole bessel ), digitally sampled at 10 khz . whole - cell access resistance was carefully monitored throughout the recording and cells were rejected if values changed by more than 25 % ( or exceeded 20 mω ); only recordings with stable series resistance of & lt ; 20 mω were used for analysis ( mini analysis 5 . 6 . 28 software ; synaptosoft , decatur , ga .). results are presented as the mean ± sem . to compare results between different cell types , we used a one - way anova with significance level of p & lt ; 0 . 05 . embryonic mge cells grafted in juvenile brain rapidly disperse long distances . to establish an efficient method for the transplantation and functional assessment of mge progenitors in a host brain , the mge was dissected from transgenic e12 . 5 - e13 . 5 mice expressing green fluorescent protein ( gfp ) ( hadjantonakis et al ., supra ) gfp expression was used to track the migration and differentiation of grafted cells in live or fixed tissue . after mechanical dissociation , gfp + mge cells were loaded into a glass micropipette and grafted into the neocortex and dorsal striatum in the brain of postnatal day 3 or 4 ( p3 - p4 ) mice ( lois and alvarez - buylla , ( 1994 ) science 264 , 1145 - 8 ). host animals were then sacrificed at 3 days , 1 , 2 , 3 and 4 weeks post - grafting . representative examples of the injection sites and post - migratory behaviors of gfp + cells are shown in fig1 a and 2a . three days after transplantation ( dat ) many gfp + cells had migrated away from the injection site ( fig1 b ) into most of the neocortex , striatum and hippocampus ( fig1 a ). survival rate of grafted cells at this time point was 38 . 9 ± 7 . 3 % ( n = 10 ). at 3 dat most gfp + cells had the typical morphology of tangentially migrating interneurons , with a small - elongated cell soma and a forked leading process ( fig1 c ). gfp + cells spread extensively around the injection site in all directions . grafted cells covered a linear distance of 336 ± 82 μm / day ( n = 20 ), with a maximum of 525 μm / day , analyzed 3 dat ; this speed of migration is greater than reported in adults (˜ 120 μm / day ) and similar to that measured in vitro ( 280 μm / day on matrigel ) ( wichterle et al ., ( 1999 ) nat neurosci 2 , 461 - 6 ). a representation of cell number versus migration distances at 3 dat results in a bell - shape curve ( fig1 d ). these data suggest that cells did not have a strong preference for a particular migratory route and disperse in all directions from the injection site . differentiation of grafted mge cells in the host brain . analysis of grafted brains 7 dat revealed a widespread distribution of gfp + mge cells . at 7 dat , most grafted cells no longer exhibited a migratory morphology ; instead they had multiple processes and some cells had a thin and longer axon - like process ( data not shown ). this indicates that initiation of differentiation of grafted mge - derived neuronal precursors occurs between three and seven days after transplantation . fourteen and 21 dat , cells acquired progressively a more mature morphology , showing larger and more elaborated dendritic trees with longer axons . at 30 dat , some gfp + cells were more than 5 mm away from injection site ; their distribution was similar to that found at 3 dat ( fig1 c & amp ; 2a ). however , the survival percentage was reduced to 19 . 9 ± 3 . 9 % ( n = 10 ). a similar level of survival , 21 . 2 ± 4 . 1 % ( n = 10 ), was observed at 90 dat . the morphology of the grafted cells was studied following gfp immunohistochemistry , which provides golgi - like staining . two months after transplantation , gfp + cells had elaborate dendritic trees extending profusely through cortical layers ( fig2 ). axons and their presynaptic terminals could also be visualized ( fig2 b - c ). thus grafted cells appeared to complete their differentiation into functionally integrated interneurons within one month after transplantation . mge - derived cells in the cortex differentiated into neurons with morphologies of at least five different interneuron subtypes e . g ., bitufted or bipolar cells , chandelier cells , basket cells , neurons with small body , and multipolar cells ( fig2 ). for instance , some neurons displayed synaptic buttons resembling arrays of candlesticks , suggesting that they differentiated into chandelier cells ( fig2 b , e , f , h , i , j ). in contrast , grafted cells in the striatum differentiate primarily to medium aspiny interneurons ( fig2 k ), and in the hippocampus to interneurons with morphologies typical for this region ( basket , axo - axonic , and bistratified cells ) ( fig2 d & amp ; g ). none of the mge - derived neurons exhibited morphological features of cortical pyramidal neurons e . g ., triangular cell soma extending a thick spiny apical dendrite . some immature oligodendrocytes were always noted around the injection site ; especially close to the corpus callosum , and occasionally in the cortex where they were radially aligned ( data not shown ). gfp + cells with an astrocytic morphology were not observed . therefore , the mge cells that we grafted are primarily committed to an interneuronal lineage . mge - derived cells exhibit molecular properties of cortical interneurons . recent studies suggest that mge progenitors are the principal source of cortical gabaergic interneurons ( lavdas et al ., ( 1999 ) j neurosci 19 , 7881 - 8 ; sussel et al ., ( 1999 ) development 126 , 3359 - 70 ; anderson et al ., ( 2001 ) development 128 , 353 - 63 ; wichterle et al ., ( 2001 ) development 128 , 3759 - 71 ). interneurons can be classified into several subtypes based on neurochemical markers , such as ca 2 + - binding proteins ( parvalbumin ( pv ), calbindin ( cb ), and calretinin ( cr )), neuropeptides ( e . g ., somatostatin ( som ), neuropeptide y ( npy ), cholecystokinin ( cck ), and vasoactive intestinal polypeptide ( vip )) ( defelipe , ( 1993 ) cereb cortex 3 , 273 - 89 ; kubota et al ., ( 1994 ) brain res 649 , 159 - 73 ; defelipe , ( 1997 ) j chem neuroanat 14 , 1 - 19 ; gonchar and burkhalter , ( 1997 ) cereb cortex 7 , 347 - 58 ; defelipe , ( 2002 ) prog brain res 136 , 215 - 38 ), and recording their physiological properties ( freund and buzsaki , ( 1996 ) hippocampus 6 , 347470 ; cauli et al ., ( 1997 ) j neurosci 17 , 3894 - 906 ; gupta et al ., ( 2000 ) science 287 , 273 - 8 ; klausberger et al ., ( 2003 ) nature 421 , 844 - 8 ). to evaluate the interneuronal phenotype and molecular characteristics of transplanted mge - gfp cells , we performed a series of immunohistochemical studies 60 dat . double - immunofluorescence revealed that approximately 65 - 70 % of cortical gfp + graft - derived cells express gaba ( fig3 ; table 1 ); a comparable level of gfp + cells were double - labeled with an antibody against gad67 (˜ 70 %; data not shown ). subsets of the gfp + neurons express npy , som , pv , and cr ( fig3 ; table 1 ), at expression levels and in a distribution similar to those of the host interneurons . interestingly , som - expressing neurons were enriched in layers i - ii of the cortex , whereas cr positive cells were almost exclusively found in retrosplenial and cingulate cortex . this suggests that local environment contributes to the specification of some interneuron sub - types . mge - derived cells were also immunopositive for these neurotransmitters and markers in the striatum and hippocampus ( fig4 , table 1 ). they were distributed in the same areas that usually contain these types of interneurons . gfp + cells were immuno - negative for antibodies to glial fibrillary acidic protein ( gfap ), or choline acetyl transferase ( chat ), indicating that grafted cells did not differentiate into astrocytes or cholinergic neurons . mge - derived cells exhibit interneuronal firing properties . to assess whether the mge - derived cells had electrophysiological characteristics of cortical interneurons , gfp + cells were targeted for whole - cell current - clamp recording at 4 weeks post grafting . diffusion of alexa red from the patch pipette permitted real - time confirmation of cellular recording site ( fig5 a ). if mge cells mature into an interneuronal phenotype they should exhibit little spike frequency adaptation , which is a hallmark electrical feature of gabaergic interneurons . in current - clamp recordings from fifteen gfp + cells sampled in cortical layer v , we measured mean values of − 70 . 9 ± 0 . 9 mv for resting membrane potential ( rmp ) and 101 . 4 ± 4 . 1 md for input resistance ( r in ). in fourteen gfp + cells , depolarizing current pulses elicited action potentials ( 3 . 0 ± 0 . 4 ms duration ; 69 . 0 ± 3 . 3 mv amplitude ) and hyperpolarizing current pulses evoked a small degree of “ sag ” current ( fig5 b ). these intrinsic membrane properties are in the expected range for “ mature ” non - accommodating cortical interneurons ( markram et al ., ( 2004 ) nat rev neurosci 5 , 793 - 807 ). most importantly , long duration depolarizing pulses ( 1000 ms ) clearly revealed the fast - spiking , little adapting firing activity characteristic of basket - cell cortical interneurons . one cell did not exhibit active firing properties during step depolarisations , but had a rmp of − 70 mv and r in of 100 mω . the high firing frequency typical of gfp + cells sampled is shown in fig5 b ; frequency - current relationships were linear as previously reported for fast - spiking hippocampal interneurons ( fig5 c ) ( smith et al ., ( 1995 ) j . neurophysiol . 74 , 650 - 72 ). transplanted mge cells influence synaptic function in the host animal . to determine whether transplanted mge precursors functionally integrate in the host brain , a series of in vitro electrophysiological studies were performed . regions of neocortex containing gfp + cells were identified under epifluorescence ( fig6 ) and pyramidal neurons in regions surrounded by gfp + cells were chosen for patch - clamp recording . recorded cells were filled with lucifer yellow for post hoc confirmation of cell location and identity ( fig6 a ). brain slices were prepared at various time - points following transplantation ( 2 , 3 and 4 weeks ). spontaneous ipscs on pyramidal neurons ( fig7 a ) reflect activation of postsynaptic gaba receptors following action potential - dependent vesicular transmitter release ; ipscs were completely abolished by 10 μm bmi a gaba a receptor antagonist ( data not shown ). if a significant number of transplanted mge cells integrate into the host micro - circuitry as new gabaergic interneurons , we would expect an increase in the overall level of gaba - evoked synaptic events onto native pyramidal neurons . increments in gaba -, pv - and som - expressing neurons were observed in the cortical hemisphere ipsilateral to the injection site when compared to contralateral hemisphere ( table 2 ). these increments were significant in a 100 μm area around the graft . in concordance with these anatomical observations , there were significant increases in ipsc amplitude and frequency in slices from transplanted animals 4 weeks following surgery . control cortical slices were obtained from sham - operated mice or from the contralateral cortex of transplanted mice ( which lacked gfp + cells ) ( fig7 b - c ). ipsc frequency and amplitude were also increased in the hippocampus of grafted animals at 4 weeks post - transplantation ( fig8 ). consistent with an increase in the number of gaba - producing neurons , mipsc frequencies were also increased in neocortical and hippocampal pyramidal cells 4 weeks after transplantation ( cortex : 2 . 3 ± 0 . 1 hz n = 4 ; ca1 : 2 . 4 ± 0 . 2 hz , n = 3 ) when compared with controls ( cortex : 1 . 3 ± 0 . 2 hz , n = 4 ; ca1 : 1 . 1 ± 0 . 1 hz , n = 3 ; p & lt ; 0 . 05 ). a significant enhancement of gabaergic inhibition was not observed at 2 or 3 weeks following transplantation ; not surprisingly as histological analysis at these times showed an immature phenotype of grafted cells . significant changes in ipsc rise time or decay - time constant were not observed at any time - point ( fig7 b ) suggesting that gross alterations in postsynaptic gaba subunit receptor expression do not occur in grafted animals . to assess the overall level of inhibitory tone in grafted animals , we performed two additional analyses . first , measurement of the total charge transfer ( corresponding to total area under the ipsc current over a specified time period ) indicated that synaptic inhibition was significantly increased in slices containing gfp + cells compared to age - matched controls ( fig7 c - d ). second , consistent with an enhancement of gabaergic tone , there was a significant increase in the frequency of sipscs plotted as a cumulative distribution ( fig7 e ). to test whether the transplanted mge cells synapse onto existing interneurons , and thereby modify cortical excitation ( through inhibition of interneuron function ), epscs were analyzed . epscs recorded from pyramidal neurons ( holding potential of − 75 mv ) in regions containing gfp + cells ; spontaneous epscs were abolished by application of cnqx and apv confirming a role for postsynaptic glutamate receptors . in comparing spontaneous epscs recorded on pyramidal cells from mge transplanted animals ( n = 4 ) and controls ( n = 4 ) no difference in amplitude , decay - time constant , rise - time or frequency was noted ( fig9 a ). these findings suggest that overall excitatory tone in the host brain is not altered following grafting of mge precursors . to address whether transplanted neurons receive excitatory synaptic contact from host axons , we next examined evoked and spontaneous epscs in gfp + neurons . gfp + cells exhibited spontaneous epscs that were blocked by cnqx and apv ( n = 4 ) ( fig9 b ) and evoked epscs with a reversal potential near 0 mv ( fig9 c ). epscs exhibited kinetics similar to those expected for “ normal ” glutamate - mediated synaptic currents . these results confirm an endogenous excitatory excitation of grafted mge - gfp neurons . taken together , these data suggest that mge - derived gfp + cells function as inhibitory interneurons receiving excitatory input from local pyramidal neurons and integrating into cortical synaptic circuitry of the host brain in such a manner as to selectively modify inhibition . the example demonstrates that mge - derived neuronal precursors grafted into the early postnatal brain are capable of long distance dispersion across the neocortex and other areas of the juvenile brain . these cells then acquire morphological , molecular and physiological characteristics of mature gabaergic interneurons . finally , these grafted mge - derived cells functionally integrate and significantly impact synaptic inhibition in the host brain . thus , the present example demonstrates that mge precursors could be used to modify synaptic circuits in a postnatal brain . an ability of these cells to disperse when transplanted into the neonatal brain is demonstrated , reaching maximum migration distances of 5 mm two months after transplantation . as such , a single injection of mge precursors could influence a relatively wide area of the host brain , an important aspect when considering the potential clinical usefulness of transplanted cells . the present results show that more than 65 % of mge - derived cells express gaba . grafted cells also contain som and npy , neuropeptides normally co - localized in subtypes of mature cortical interneurons ( defelipe , ( 1993 ) supra ; kubota et al ., supra ; defelipe , ( 1997 ) supra ; gonchar and burkhalter , supra ). we did not detect pyramidal - like neurons or astrocytes that were derived from transplanted mge cells . importantly , tumors were never observed in our mge grafted mice although this is a common problem when es - derived progenitors are used for transplantation ( wernig et al ., supra ; ruschenschmidt et al ., supra ). mge - derived cells sampled in layer v exhibit an “ electrical fingerprint ” typical of mature gaba - containing interneurons . for example , mge - gfp cells consistently fired at a high frequency and exhibited very little accommodation . these firing properties are consistent with a classification as non - accommodating basket - cell interneurons and it is likely that further current - clamp sampling of gfp + cells across other layers of grafted cortex will uncover additional interneuron sub - types . in previous analysis of functional integration , single - cell recordings focused exclusively on demonstrations that transplanted cells receive synaptic input . here we also demonstrate that transplanted mge - derived cells receive excitatory synaptic input ( see fig6 ). moreover , we present evidence that grafted progenitor cells send inhibitory outputs , which impact ( in a functionally relevant manner ) existing pyramidal neurons . notably , we found that pyramidal cells in regions containing mge - derived cells exhibit an increased number of gaba - mediated synaptic events and that gabaergic tone is significantly enhanced in these regions of the host brain . because mge - derived cells did not alter excitatory cortical circuitry or differentiate to neurons with a pyramidal - cell phenotype , these findings suggest a method for selective enhancement of inhibitory systems . our demonstration that grafted progenitor cells produce functionally integrated gabaergic neurons , even in the presence of endogenous gabaergic neurons , after embryonic stages of neurodevelopment are complete , and in a wide variety of brain regions , suggests that mge - derived cells could be useful in neurological conditions where increased inhibition would be beneficial e . g ., epilepsy or schizophrenia . mge precursors may also be used to correct levels of activity in deafferented brain regions such as in parkinson &# 39 ; s disease , or in conjunction with their inhibitory function , may be used as cellular vectors to deliver therapeutic molecules to wide regions of the brain . 2 estimation of cell increment 1200 μm around of injection site . quantification was performed in 3 slices forward plus 3 slices backward from injection site . significance ( p ) was estimated with a t - student test , n = 10 . robust epileptiform burst activity is more difficult to initiate in slices containing mge progenitors attempts are made to elicit epileptiform burst activity in cortical slices having received mge progenitor cell grafts and control cortical slices that have not received mge progenitors . it is determined to be more difficult to initiate robust epileptiform burst activity in slices containing mge progenitors . this finding supports that mge progenitors migrate and differentiate into functional interneurons in the host brain ( and thus increase synaptic inhibition ). neocortical slices are prepared from wild - type mice with mge grafts and age - matched controls . spontaneous seizure activity is initiated in neocortical slices by raising the extracellular level of potassium , in a step - wise fashion , from 3 to 6 to 9 mm [ k + ] e . previous studies in our laboratory ( baraban and schwartzkroin , epilepsy res . 1995 october ; 22 ( 2 ): 145 - 56 ) and others ( rutecki et al ., j . neurophysiol . 1985 november ; 54 ( 5 ): 1363 - 74 ; traynelis and dingledine , j . neurophysiol . 1988 january ; 59 ( 1 ): 259 - 76 ), demonstrate this is an efficient method to induce spontaneous seizure activity and test anticonvulsant drugs in vitro . the “ high k ” model reliably elicits status - like interictal - like epileptiform activity and is designed to mimic high [ k + ] e observed during clinical seizures . epileptiform activity is monitored using field recording electrodes placed in outer ( layers iv / v ) and inner ( layer ii ) neocortex . epileptiform burst discharge amplitude ( in mv ), duration ( in msec ) and frequency ( in hz ) is used to quantitatively compare bursting between experimental and control animals . a second method to compare interictal “ burst intensity ” in different [ k + ] e involves the use of a coastline bursting index ( cbi ) ( korn et al ., j . neurophysiol . 1987 january ; 57 ( 1 ): 325 - 40 ). cbi is responsive to changes in the number or amplitude of bursts , and it increases when neuronal synchrony , firing frequency or duration changes — thus , it can be considered a sensitive measure of whether integrated mge progenitors influence seizure activity . a separate series of identical experiments is performed using the zero - mg 2 + acute seizure model . removal of mg 2 + from the extracellular bathing medium releases magnesium blockade of nmda - type glutamate receptors and initiates epileptiform activity driven by excess synaptic excitation ( mody et al ., j . neurophysiol . 1987 march ; 57 ( 3 ): 869 - 88 ). epileptiform activity elicited in slices from grafted mice is compared with age - matched controls . analysis is performed as described above . slices are postfixed and immunostained with an antibody to gfp so the number of grafted mge - gfp + cells can be assessed . using these two different mechanisms of action we reliably determine transplanted progenitors exert anticonvulsant action in vitro . results : it is determined to be more difficult to initiate robust epileptiform burst activity in slices containing mge progenitors . this finding supports that mge progenitors migrate and differentiate into functional interneurons in the host brain ( and thus increase synaptic inhibition ). a decrease in burst amplitude , duration or frequency or a change in cbi index provides quantitative evidence that integrated mge progenitors , by increasing inhibition , reduce epileptic hyperexcitability . seizures are more difficult to initiate in mice receiving mge progenitors . following bilateral mge grafting in wild - type mice ( and sham operated controls ; young adult p30 and adult p60 ages ) eeg electrodes are implanted bilaterally in neocortex and animals monitored with video - eeg . after a 1 wk recovery period , following surgery , animals are injected with kainic acid ( ka , a glutamate receptor agonist ) at a concentration previously shown to elicit status epilepticus in the mouse e . g ., 30 - 40 mg / kg i . p . ( baraban et al ., brain res dev brain res . 1997 sep . 20 ; 102 ( 2 ): 189 - 96 ; baraban et al ., j . neurosci . 1997 dec . 1 ; 17 ( 23 ): 8927 - 36 ). in analyzing video - eeg traces following initiation of a ka - induced seizure , the frequency and duration of electrographic seizure events recorded are quantified . behaviors that accompany these discharges are fully characterized by close examination of the video - eeg recordings using an investigator blind to the status of the animal . clinician - scientists in the laboratory with significant clinical eeg experience assist in analysis of this data . a second set of identical experiments are performed using pentylenetetrazole ( a gaba antagonist , 15 - 20 mg / kg i . p .). similar to slice electrophysiology studies , two separate means of seizure induction are used to adequately assess the ability of mge progenitors to decrease / inhibit seizure activity . in all animals , euthanasia and transcardial perfusion are performed at the conclusion of video - eeg experiments . brains are rapidly removed and fixed in paraformaldehyde for post hoc confirmation of eeg electrode placement . in addition , brains are sectioned and stained for analysis of gfp + interneurons . these anatomical studies allow us to correlate numbers of integrated gfp progenitors with antiepileptic activity . results : it is more difficult to initiate seizures in mice receiving mge progenitors . electrographic seizure events , if observed , are brief in transplanted animals and little or no signs of convulsive behavior are observed . animals with large numbers of integrated mge progenitors are most resistant to the development of acute seizure activity . mge progenitors reduce seizure activity in mouse models of spontaneous epilepsy transplanted mge progenitor cells are used to enhance synaptic inhibition such that seizure susceptibility is significantly reduced in the host animal . studies are performed in neocortical tissue sections from wild - type control mice ( following grafting ) and mouse mutants with known cortical interneuron defects . three mutants with a demonstrated reduction in synaptic inhibition and hyperexcitability are used : particularly , dix1 −/− , gad65 −/− and upar −/− . dix1 mice show generalized electrographic seizures and histological evidence of seizure - induced reorganization and hence display a phenotype comparable to that of human epilepsy associated with interneuron loss . gad65 mutants appear to have normal numbers of gabaergic cortical interneurons , but a reduced capacity to synthesize gaba ( kash et al ., proc natl acad sci usa . 1997 dec . 9 ; 94 ( 25 ): 14060 - 5 ). upar mutants appear to have a reduced density of gabaergic interneurons in parietal cortex ( powell et al ., j . neurosci . 2003 jan . 15 ; 23 ( 2 ): 622 - 31 ). hyperexcitable states have been reported in mutants with abnormal cortical interneurons ( gad65 ko ) and in mutants with reduced numbers of cortical interneurons ( upar ko ). first , disruption of the gad65 gene in mice leads to a 50 % decrease in cofactor - inducible gad enzymatic activity ( kash et al ., supra ). gad65 - deficient mice on a c57bi / 6 background are susceptible to infrequent spontaneous seizures and stress - induced seizures . second , inactivation of the urokinase plasminogen activator receptor ( upar ) gene in mice leads to a 50 - 65 % reduction in cortical gabaergic interneurons ( powell et al ., supra ). upar ko mice ( bred on a c57bi / 6 background ) are viable , survive into adulthood , and exhibit overt tonic - clonic seizures or an increased susceptibility to ptz - induced motor convulsions . both strains of mutant mice are used . because background strain can be an important modulator of seizure susceptibility ( schauwecker and steward , proc natl acad sci usa . 1997 apr . 15 ; 94 ( 8 ): 4103 - 8 ; schauwecker , prog brain res . 2002 ; 135 : 139 - 48 ), we are careful to study mutant and wild - type mice bred on only one background strain e . g ., the relatively seizure - resistant c57bi / 6 . following bilateral mge grafting in gad65 −/− or upar −/− mice , and sham operated , strain - and age - matched controls , eeg electrodes are implanted bilaterally in neocortex and monitored with video - eeg . after a 1 wk recovery period , following surgery , animals are monitored each day for 6 hr recording sessions ( 2 wk monitoring period ). in analyzing video - eeg traces the frequency and duration of electrographic seizures recorded are quantified . behaviors that accompany these discharges are fully characterized by close examination of video - eeg recordings using an investigator blind to the status of the animal ; clinician - scientists in the laboratory assist in these studies . the frequency and amplitude of interictal spikes may vary during sleep - wake cycles ( martins da silva et al . electroencephalogr clin neurophysiol . 1984 july ; 58 ( 1 ): 1 - 13 ). as such , interictal spikes are always analyzed during periods of non - rem sleep . because mutant mice can exhibit spontaneous seizure activity ( consisting of frequent abnormal slow waves and interictal discharges with associated convulsive behaviors ) it is not necessary to induce seizures using kainate or ptz . we sacrifice these animals and quantify the number of new gabaergic gfp + interneurons present in neocortex . we correlate the number of gfp + cells with seizure severity ( as determined from analysis of behavior and eeg ). detailed immunocytochemical studies using antibodies to gad , npy , parvalbumin , somatostatin and calbindin are performed . a limited number of slice electrophysiology studies are also performed to analyze sipscs in un - treated and grafted animals . results : the reduction in functional gabaergic interneurons resulting in a spontaneous epileptic phenotype observed in upar ko mice is alleviated by grafting mge progenitors into these animals . interictal spikes and behavioral seizures are reduced ( or eliminated ) in upar ko mice receiving mge grafts . similar results are observed in gad65 mutant mice . mge cells were transplanted into the brains of dix1 −/− mice , a murine model of epilepsy , in a similar manner as described in example 1 . for details on dix1 −/− mice , see cobos et al ., nature neuroscience , 8 : 1059 - 1068 , 2005 , expressly incorporated herein in its entirety by reference . dix1 mice show generalized electrographic seizures and histological evidence of seizure - induced reorganization and hence display a phenotype comparable to that of human epilepsy associated with interneuron loss . dix1 mutant mice transplanted with mge progenitor cells appeared to have a reduced epilepsy phenotype , measured as a reduction in seizure - like behavior upon handling and a lack of eeg - like seizure activity . cortical brain slices prepared from dix mutant mice transplanted with mge progenitor cells early in development ( p0 - p2 ) exhibited a level of inhibition ( measured as spontaneous and miniature ipscs on postsynaptic pyramidal cell targets in regions containing mge - gfp interneurons ) that was comparable to that observed in control dix heterozygote mice . specifically , dix mutants normally showed reduced ipsc frequency and amplitude and these values were “ rescued ” by mge transplantation . see fig1 . at the whole animal level , dix mutants normally exhibited handling induced seizures and spontaneous seizures . dix mutants transplanted with mge cells did not exhibit handling induced seizures and video - eeg recording confirmed the lack of a seizure phenotype . this demonstrated that mge cells can be successfully transplanted into the diseased brain and demonstrated reduction or ablation of epileptic symptoms following transplantation . mge precursors increase seizure latencies and reduce mortality in a rodent seizure model a commonly used rodent seizure model ( e . g ., pilocarpine ) was used to investigate the therapeutic potential of mge - derived interneurons . mge cells from e13 . 5 gfp - expressing mice were transplanted into the postnatal ( p4 ) brain using procedures described above . after allowing for migration and integration to occur , single doses of scopolamine followed by pilocarpine ( 300 mg / kg ) were administered to induce acute seizure activity . mortality and seizure latency were compared among sham - transplanted mice , mge cell - transplanted recipients , and mice pretreated with phenobarbital ( pb ), a conventional aed ( antiepileptic drug ). seizure behaviors were scored on a racine scale by an investigator blind to the status of the animal . it was observed that the transplanted mice and pb - pretreated mice had longer seizure latencies and lower mortality rates compared to sham - transplanted littermates . in grafted mice , seizure protection correlated with the number of newly generated mge - gfp cells . immunohistochemistry and electrophysiology were then carried out as described herein to confirm whether the therapeutic benefit observed in the transplanted mice was due to the inhibitory activity of mge - derived interneurons . the immunohistochemistry revealed that mge - derived transplanted cells in the neocortex and hippocampus were mostly neuronal ( neun +) and gabaergic , as expected . whole - cell electrophysiological recordings of presynaptic gfp + cells and postsynaptic pyramidal cells confirmed that transplanted cells were able to functionally integrate and increase synaptic inhibition , as well as receive excitatory inputs from endogenous pyramidal cells . these results indicate that mge - derived precursor cells are able to migrate large distances and functionally integrate into existing cortical circuitry , thereby reducing the harmful effects of induced seizures in transplanted mice . these in vivo data provide a strong indication that mge - derived precursor cells will have therapeutic value in seizure disorders , and other disorders of inhibition , including epilepsy and other disorders described herein . all references cited are expressly incorporated herein in their entirety by reference .	0
fig2 shows a schematic cross - sectional view of a combined high - pressure - intermediate - pressure ( hpip ) steam turbine according to an embodiment of the invention . as in known devices , such as that shown in fig1 a , the hpip steam turbine 200 of fig2 includes a high - pressure ( hp ) section 210 , an intermediate - pressure ( ip ) section 250 , and a mid - packing section 230 therebetween . the mid - packing section 230 includes a rotor 234 disposed between the hp section 210 and the ip section 250 and a plurality of packing rings 240 a - c along its length . the embodiment of the invention shown in fig2 , however , includes packing rings 240 a - c having pressure drop - limited seals ( shown in fig3 and described in greater detail below ). the use of pressure drop - limited seals is made possible by the inclusion of conduits or “ leak - off lines ” 260 , 262 , 264 between the mid - packing section 230 and steampath stages 212 a , 212 c , 212 e of the hp section 210 , through which a quantity of high - pressure steam may travel ( e . g ., along path b , through conduit 264 ). steam flow through the conduits determines the pressure difference across the packing rings 240 a , 240 b , 240 c . the conduit or leak - off line may be of any material capable of containing and permitting the movement of steam having a temperature and pressure found within the hp section . each conduit or leak - off line 264 includes a first end 264 a adjacent a packing ring 240 c and a second end 264 b adjacent a steampath stage 212 a of the hp section 210 . ( for the sake of simplicity , the first and second ends of the conduit or leak - off line are shown only with respect to conduit or leak - off line 264 . it should be understood , however , that other conduits or leak - off lines 260 , 262 would also include first and second ends .) the resulting pressure difference across the pressure drop - limited seal ( s ) may vary , depending , for example , on the number of conduits or leak - off lines employed . the pressure difference across the seal should , however , be no greater than the maximum design pressure difference of the seal . the maximum design pressure difference of typical brush seals , for example , is between about 14 . 1 kg / cm 2 ( about 200 p . s . i .) and about 21 . 1 kg / cm 2 ( about 300 p . s . i .). in the case where a brush seal is used , therefore , the pressure difference across the brush seal may be no greater than , and preferably less than , about 21 . 1 kg / cm 2 ( about 300 p . s . i . ), more preferably less than about 17 . 6 kg / cm 2 ( about 250 p . s . i . ), and still more preferably less than about 14 . 1 kg / cm 2 ( about 200 p . s . i .). some embodiments of the invention may include as few as one conduit or leak - off line , while other embodiments of the invention , such as that shown in fig2 , may contain a plurality of such conduits or leak - off lines . in addition , some embodiments of the invention may include one packing ring having a pressure drop - limited seal while other embodiments of the invention may contain a plurality of such packing rings . for example , it may be possible , in some embodiments , to substantially reduce mid - packing leakage and / or improve turbine efficiency by the inclusion of a single packing ring having a pressure drop - limited seal , such as a brush seal , and a single conduit or leak - off line . other conventional packing rings , such as those shown in fig1 a - b ( 140 a - e ) may also be employed in such embodiments . in other embodiments of the invention , the inclusion of a plurality of packing rings containing pressure drop - limited seals , while further reducing mid - packing leakage and / or improving turbine efficiency , may confer an additional benefit in that it affords the ability to reduce the overall length of the rotor 234 through the use of fewer , more efficient packing rings ( i . e ., those containing pressure drop - limited seals ). as noted above , increasing the number of packing rings results in an increased bearing span ( longer rotor ), greater rotor flexibility , and larger radial clearances . contrarily , the use of fewer packing rings , as embodiments of the invention make possible , allows for a reduced bearing span ( shorter rotor ), less rotor flexibility , and smaller radial clearances . thus , while embodiments of the invention reduce mid - packing leakage and / or improve turbine efficiency through the use of packing rings having pressure drop - limited seals , the reduced bearing span made possible by the use of such packing rings may yield an additional reduction in mid - packing leakage and / or improvement in turbine efficiency . fig3 shows a schematic cross - sectional view of a packing ring 340 including a brush seal 342 , suitable for use in an embodiment of the invention , and as shown in fig2 ( 240 a - c ). the brush seal 342 comprises a plurality of brushes 342 a radially oriented substantially perpendicular to a longitudinal axis of the rotor to be sealed against ( not shown ) and disposed between an hp block 342 b and an ip block 342 c . as noted above , the invention is not limited to the use of brush seals . any pressure drop - limited seal may be employed , leaf seals being one additional example . the pressure drop - limited seals useful in practicing the various embodiments of the invention include an element ( e . g ., brush , leaf , etc .) capable of movement in response to a pressure difference across the seal . for example , a brush of a brush seal bends or otherwise moves toward a side of the seal experiencing a lower pressure and away from a side of the seal experiencing a higher pressure . leaves of a leaf seal move similarly in response to a pressure difference across the seal . in some embodiments of the invention , the packing ring 340 may further include teeth 344 , 346 , as are often found in known packing rings . in other embodiments of the invention , the reduction in mid - packing leakage effected by the brush seal or leaf seal may obviate the need or desirability for such teeth . fig4 shows a schematic cross - sectional view of a separate hpip steam turbine 400 according to an embodiment of the invention . here , rather than a single mid - packing section between the hp section 410 and the ip section 450 , the steam turbine 400 includes four end - packing sections 470 , 430 a , 430 b , 490 , one on either side of the hp section 410 , one adjacent the ip section 450 , and one adjacent a low - pressure ( lp ) section 452 . in the embodiment shown in fig4 , the conduits 460 - 466 function similarly to those shown in fig2 , permitting the flow of steam between the hp section 410 and the end - packing sections 470 , 430 a , 430 b , 490 . thus , packing rings 420 a - b , 440 a - b , 440 c - d , 480 a - b having a pressure drop - limited seal may be employed in each end - packing section 470 , 430 a , 430 b , 490 . in other embodiments , such packing rings may be employed in fewer than each end - packing section . steam turbine systems according to the invention may include a combined hpip steam turbine or a separate hpip steam turbine such as those described above and a steam - generating apparatus , such as a boiler , for providing a quantity of steam to such an hpip steam turbine . other components of such a steam turbine system will be known to one skilled in the art . this written description uses examples to disclose the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any related or incorporated methods . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal language of the claims .	5
the following detailed description should be read with reference to the drawings , in which like elements in different drawings are numbered in like fashion . the drawings , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of the invention . in some cases , the drawings may be highly diagrammatic in nature . examples of constructions , materials , dimensions , and manufacturing processes are provided for various elements . those skilled in the art will recognize that many of the examples provided have suitable alternatives which may be utilized . fig1 is a cross sectional view of a catheter 100 in accordance with the present invention . catheter 100 has a distal end 102 , a proximal end 104 , and a sheath 106 . sheath 106 of catheter 100 includes a distal end 108 and a proximal end 122 . a sheath housing 124 is disposed about sheath 106 proximate proximal end 122 thereof . sheath 106 defines a sheath lumen 120 extending between distal end 108 and proximal end 122 . in the embodiment of fig1 a first elongate shaft 126 is slidingly disposed within sheath lumen 120 of sheath 106 . first elongate shaft 126 has a distal end 128 , a proximal end 132 , and a first shaft lumen 130 extending therebetween . a first hub 134 is disposed about first elongate shaft 126 proximate proximal end 132 thereof . a second elongate shaft 136 is slidingly disposed within first shaft lumen 130 of first elongate shaft 126 . second elongate shaft 136 has a distal end 138 and a proximal end 142 . in the embodiment of fig1 second elongate shaft 136 forms a point 146 proximate distal end 138 thereof . second elongate shaft also defines an injection port 148 proximate point 146 . a second hub 144 is disposed about second elongate shaft 136 proximate proximal end 142 thereof . second hub 144 defines a proximal port 150 . in a preferred embodiment , proximal port 150 is in fluid communication with injection port 148 via an injection lumen 140 defined by second elongate shaft 136 . in fig1 it may be appreciated that first elongate shaft 126 includes a first curved portion 152 disposed proximate distal end 128 thereof . in the embodiment of fig1 first curved portion 152 of first elongate shaft 126 defines a first plane 154 which is generally coplanar with the plane of fig1 . in the embodiment of fig1 a barrel 162 is partially disposed within sheath lumen 120 of sheath 106 . in a preferred embodiment , barrel 162 includes a radial enlargement 164 . in this preferred embodiment , radial enlargement 164 provides a generally enlarged distal contact area 166 . generally enlarged distal contact area 166 reduces the likelihood that undesired tissue damage will occur when distal end 102 of catheter 100 is urged against bodily tissue . barrel 162 also defines a barrel lumen 170 . as shown in fig1 first elongate shaft 126 is slidingly disposed within barrel lumen 170 . in a preferred embodiment , first elongate shaft 126 and second elongate shaft 136 of catheter 100 comprise hypodermic tubing . first elongate shaft 126 and second elongate shaft 136 may comprise various metallic and non - metallic materials without deviating from the spirit and scope of the present invention . examples of metallic materials which may be suitable in some applications include stainless steel , and nickel - titanium alloy . examples of non - metallic materials which may be suitable in some applications are included in the list below , which is not exhaustive : polycarbonate , poly ( l - lactide ) ( plla ), poly ( d , l - lactide ) ( pla ), polyglycolide ( pga ), poly ( l - lactide - co - d , l - lactide - co - d , l - lactide ) ( plla / pla ), poly ( l - lactide - co - glycolide ) ( plla / pga ), poly ( d , l - lactide - co - glycolide ) ( pla / pga ), poly ( glycolide - co - trimethylene carbonate ) ( pga / ptmc ), polyethylene oxide ( peo ), polydioxanone ( pds ), polycaprolactone ( pcl ), polyhydroxylbutyrate ( phbt ), poly ( phosphazene ), polyd , l - lactide - co - caprolactone ) ( pla / pcl ), poly ( glycolide - co - caprolactone ) ( pga / pcl ), polyanhydrides ( pan ), poly ( ortho esters ), poly ( phosphate ester ), poly ( amino acid ), poly ( hydroxy butyrate ), polyacrylate , polyacrylamide , poly ( hydroxyethyl methacrylate ), polyurethane , polysiloxane and their copolymers . in a preferred embodiment , sheath 106 of catheter 100 comprises an elongate tubular member including a reinforcement member ( e . g ., braided or coiled wire ). sheath 106 may comprise various metallic and non - metallic materials without deviating from the spirit and scope of the present invention . examples of metallic materials which may be suitable in some applications include stainless steel , and nickel - titanium alloy . examples of non - metallic materials which may be suitable in some applications include : polyethylene ( pe ), polypropylene ( pp ), polyvinylchloride ( pvc ), polyurethane , polytetrafluoroethylene ( ptfe ), polyether block amide ( peba ), polyamide , and polyimide . fig2 is a diagrammatic view including catheter 100 of fig1 and a patient 20 . patient 20 has a heart 22 and a vascular system 24 including a blood vessel 26 defining a blood vessel lumen 28 . an access sheath 30 is partially disposed within a leg of patient 20 . a distal end 32 of access sheath 30 is disposed within blood vessel lumen 28 of blood vessel 26 . access sheath 30 may aid in the introduction of catheter 100 into blood vessel lumen 28 . as shown in fig2 a portion of catheter 100 is disposed within blood vessel lumen 28 of blood vessel 26 . distal end 102 ( not visible in fig2 ) of catheter 100 is disposed within heart 22 of patient 20 . in a preferred embodiment , distal end 102 of catheter 100 is disposed proximate a wall of heart 22 . in the embodiment of fig2 a fluid source 34 is coupled to second hub 144 disposed about second elongate shaft 136 of catheter 100 . in the embodiment of fig2 fluid source 34 includes a variable volume chamber 36 defined by a body 38 . in a preferred embodiment , variable volume chamber 36 is in fluid communication with injection lumen 140 of second elongate shaft 136 . a plunger 40 is slidingly disposed within variable volume chamber 36 . urging the plunger distally has the effect of urging fluid into injection lumen 140 of second elongate shaft 136 . a number of energy sources may be utilized to urge plunger 40 distally . energy sources which may be suitable in some applications include springs , compressed gas , a human being , and electricity . various additional embodiments of fluid source 34 are possible without deviating from the spirit and scope of the present invention . examples of fluid sources which may be suitable in some applications include syringes , peristaltic pumps , and an i . v . bag with pressure applied to its outer surface . a method of injecting a fluid into heart 22 of patient 20 may be described with reference to fig2 . the distal end of access sheath 30 may be inserted into blood vessel lumen 28 of blood vessel 26 . distal end 102 of catheter 100 may be inserted into the lumen of access sheath 30 . distal end 102 of catheter 100 may be advanced through access sheath 30 and into blood vessel lumen 28 of blood vessel 26 . catheter 100 may be urged forward through vascular system 24 of patient 20 until distal end 102 is proximate the target tissue ( e . g ., a wall of heart 22 ). in fig2 it may be appreciated that catheter 100 is bent in a plurality of locations to conform with a tortuous path defined by vascular system 24 . in a preferred method , distal end 138 of second elongate shaft 136 and distal end 128 of first elongate shaft 126 are disposed within sheath lumen 120 of sheath 106 during the above steps . for example , distal end 128 of first elongate shaft 126 may be pulled into sheath lumen 120 of sheath 106 urging first hub 134 proximally with respect to sheath housing 124 . in a similar fashion , distal end 138 of second elongate shaft 136 may be pulled into first shaft lumen 130 of first elongate shaft 126 by urging second hub 144 proximally with respect to first hub 134 . once distal end 102 of catheter 100 is positioned proximate the target tissue , first elongate shaft 126 may be advanced so that distal end 128 penetrates the bodily tissue at the target site . a physician may , for example , apply a distally directed force to first hub 134 to urge first elongate shaft 126 distally . second elongate shaft 136 may also be urged distally in concert with first elongate shaft 126 . in a preferred embodiment , first curved portion 152 of first elongate shaft assumes a generally curved shape when it is urged distally out of sheath lumen 120 . second elongate shaft 136 may be advanced so that point 146 penetrates the bodily tissue proximate distal end 128 of first elongate shaft 126 . in a preferred method , second elongate shaft will be advanced until injection port 148 is disposed within the target tissue . with injection port 148 of second elongate shaft 136 disposed within the target tissue , fluid may be urged into the target tissue . for example , force may be applied to plunger 40 urging fluid out of fluid source 34 and into injection lumen 140 of second elongate shaft 136 . the addition of fluid from fluid source 34 results in the injection of fluid into the target tissue . after the injection of fluid , first elongate shaft 126 and second elongate shaft 136 may be withdrawn from the target tissue . in a preferred embodiment , the tortuous path taken by first elongate shaft 126 and second elongate shaft 136 reduce the likelihood that injected fluid will escape from the target tissue after first elongate shaft 126 and second elongate shaft 136 are disengaged from the target tissue . embodiments of catheter 100 have been envisioned in which first elongate shaft 126 and second elongate shaft 136 both include a plurality of curved portions . fig3 is a cross sectional view of an additional embodiment of a catheter 200 in accordance with the present invention . catheter 200 has a distal end 202 , a proximal end 204 , and a sheath 206 . sheath 206 of catheter 200 includes a distal end 208 , a proximal end 222 . a sheath housing 224 is disposed about sheath 206 proximate proximal end 222 thereof . sheath 206 defines a sheath lumen 220 extending between distal end 208 and proximal end 222 . in the embodiment of fig3 a first elongate shaft 226 is slidingly disposed within sheath lumen 220 of sheath 206 . first elongate shaft 226 has a distal end 228 , a proximal end 232 , and a first shaft lumen 230 extending therebetween . a first hub 234 is disposed about first elongate shaft 226 proximate proximal end 232 thereof . a second elongate shaft 236 is slidingly disposed within first shaft lumen 230 of first elongate shaft 226 . second elongate shaft 236 has a distal end 238 and a proximal end 242 . in the embodiment of fig3 second elongate shaft 236 forms a point 246 proximate distal end 238 thereof . second elongate shaft defines an injection port 248 proximate point 246 . a second hub 244 is disposed about second elongate shaft 236 proximate proximal end 242 thereof second hub 244 defines a proximal port 250 . in a preferred embodiment , proximal port 250 is in fluid communication with injection port 248 via an injection lumen 240 defined by second elongate shaft 236 . in fig3 it may be appreciated that first elongate shaft 226 includes a first curved portion 252 disposed proximate distal end 228 thereof . in the embodiment of fig3 first curved portion 252 of first elongate shaft 226 defines a first plane 254 which is generally coplanar with the plane of fig3 . first elongate shaft 226 also includes a second curved portion 256 defining a second plane 258 . in the embodiment of fig3 second plane 258 is substantially orthogonal to first plane 254 . fig4 is a perspective view of a distal portion 360 of an additional embodiment of a catheter 300 in accordance with the present invention . catheter 300 includes a sheath 306 defining a sheath lumen 320 . a first elongate shaft 326 is partially disposed within sheath lumen 320 of sheath 306 . first elongate shaft 326 includes a first curved portion 352 defining a first plane 354 and a second curved portion 356 defining a second plane 358 disposed proximate a distal end 328 thereof . in fig4 it may also be appreciated that first elongate shaft 326 forms a point 329 proximate distal end 328 thereof . catheter 300 also includes a second elongate shaft 336 which is partially disposed in a first shaft lumen 330 defined by first elongate shaft 326 . second elongate shaft 336 defines an injection lumen 340 and an injection port 348 . second elongate shaft 336 also forms a point 346 proximate a distal end 338 thereof . fig5 is a perspective view of a distal portion 460 of an additional embodiment of a catheter 400 in accordance with the present invention . catheter 400 includes a second elongate shaft 436 having a curved portion 472 . a portion of second elongate shaft 436 is disposed within a first lumen 430 defined by a first elongate shaft 426 . first elongate shaft 426 includes a first curved portion 452 and a second curved portion 456 . in fig5 it may also be appreciated that first elongate shaft 426 forms a point 429 proximate distal end 428 thereof . in the embodiment of fig5 first curved portion 452 of first elongate shaft 426 defines a first plane 454 and second curved portion of first elongate shaft 426 defines a second plane 458 . also in the embodiment of fig5 curved portion 472 of second elongate shaft 436 defines a third plane 474 . in the embodiment of fig5 second plane 458 is substantially orthogonal to first plane 454 . also in the embodiment of fig5 third plane 474 is generally co - planar with second plane 458 . in a preferred embodiment , curved portion 472 is biased to return to the shape illustrated in fig5 . in this preferred embodiment , curved portion 472 of second elongate shaft 436 may tend to self - align with second curved portion 456 of first elongate shaft 426 . in a particularly preferred embodiment , the radius of curved portion 472 of second elongate shaft 436 is substantially equal to the radius of second curved portion 456 of first elongate shaft 426 . in a preferred embodiment , the radius of first curved portion 452 of first elongate shaft 426 is selected so that distal end 428 of first elongate shaft 426 will be disposed within a wall of an organ ( e . g ., the heart ) during an injection procedure in accordance with a method of the present invention . also in a preferred embodiment , third plane 474 defined by curved portion 472 of second elongate shaft 436 is substantially orthogonal to first plane 454 defined by first curved portion 452 of first elongate shaft 426 . this relationship reduces the likelihood that the distal end of second elongate shaft 436 will perforate the wall of an organ ( e . g ., the heart ) during an injection procedure in accordance with a method of the present invention . in a preferred embodiment the radius of first curved portion 452 of first elongate shaft 426 is , for example , between about 1 . 0 and about 10 . 0 millimeters . in a particularly preferred embodiment the radius of first curved portion 452 of first elongate shaft 426 is , for example , between about 3 . 0 and about 7 . 0 millimeters . in a preferred embodiment the radius of second curved portion 456 of first elongate shaft 426 is , for example , between about 1 . 0 and about 8 . 0 millimeters . in a particularly preferred embodiment the radius of second curved portion 456 of first elongate shaft 426 is , for example , between about 2 . 0 and about 5 . 0 millimeters . in a preferred embodiment the radius of curved portion 472 of second elongate shaft 436 is , for example , between about 1 . 0 and about 8 . 0 millimeters . in a particularly preferred embodiment the radius of curved portion 472 of second elongate shaft 436 is , for example , between about 2 . 0 and about 5 . 0 millimeters . embodiments of catheter 400 have been envisioned in which first elongate shaft 426 and second elongate shaft 436 both include a plurality of curved portions . in a preferred embodiment , the tortuous path taken by first elongate shaft 426 and second elongate shaft 436 reduces the likelihood that fluid will escape from a target tissue after it has been injected therein . it is to be appreciated that the radius of curved portion 472 may vary along the length of second elongate shaft 436 . likewise , it is to be appreciated that the radius of first curved portion 452 and second curved portion 456 may vary along the length of first elongate shaft 426 . to explain further , a curve of constant radius forms a portion of a circle whereas a curve of variable radius may form a portion of a spiral . first elongate shaft 426 and second elongate shaft 436 both may include a plurality of curved portions having various shapes . embodiments of the present invention have been envisioned in which the injection path includes a plurality of turns . these turns may be any shape . examples of turn shapes which may be suitable in some applications include circular arcs and spiral arcs . embodiments of the present invention have also been envisioned in which the injection path is generally in the shape of a helix having an expanding radial pitch . fig6 is a cross sectional view of an additional embodiment of a catheter 500 in accordance with the present invention . catheter 500 has a distal end 502 , a proximal end 504 , and a sheath 506 . sheath 506 of catheter 500 includes a distal end 508 and a proximal end 522 . a sheath housing 524 is disposed about sheath 506 proximate proximal end 522 thereof . sheath 506 defines a sheath lumen 520 extending between distal end 508 and proximal end 522 . in the embodiment of fig6 a first elongate shaft 526 is slidingly disposed within sheath lumen 520 of sheath 506 . first elongate shaft 526 has a distal end 528 , a proximal end 532 , and a first shaft lumen 530 extending therebetween . a first hub 534 is disposed about first elongate shaft 526 proximate proximal end 532 thereof . a second elongate shaft 536 is slidingly disposed within first shaft lumen 530 of first elongate shaft 526 . a second hub 544 is disposed about second elongate shaft 536 proximate a proximal end 542 thereof . second hub 544 defines a proximal port 550 . in a preferred embodiment , proximal port 550 is in fluid communication with an injection lumen 540 and an injection port 548 defined by second elongate shaft 536 . in the embodiment of fig6 a barrel 562 is partially disposed within sheath lumen 520 of sheath 506 . in a preferred embodiment , barrel 562 includes a radial enlargement 564 . in this preferred embodiment , radial enlargement 564 provides a generally enlarged distal contact area 566 . generally enlarged distal contact area 566 reduces the likelihood that undesired tissue damage will occur when distal end 502 of catheter 500 is urged against bodily tissue . barrel 562 also defines a barrel lumen 570 . as shown in fig6 first elongate shaft 526 is slidingly disposed within barrel lumen 570 . as shown in fig6 sheath housing 524 defines a first guiding surface 510 . first hub 534 has a first mating surface 512 and a second guiding surface 514 . first mating surface 512 of first hub 534 is disposed in sliding engagement with first guiding surface 510 of sheath housing 524 . in a similar fashion , a second mating surface 516 of second hub 544 is disposed in sliding engagement with second guiding surface 514 of first hub 534 . in the embodiment of fig6 first elongate shaft 526 and second elongate shaft 536 are biased to assume curved shapes . in the embodiment of fig6 first elongate shaft 526 and second elongate shaft 536 have been urged proximally so that their respective distal ends are disposed within sheath lumen 520 of sheath 506 . in fig6 it may be appreciated that first elongate shaft 526 and second elongate shaft 536 have been urged into a substantially straight position . in a preferred embodiment , first elongate shaft 526 and second elongate shaft 536 will return to substantially curved shapes when they are urged distally out of sheath lumen 520 . when first elongate shaft 526 and second elongate shaft 536 are advanced into a target tissue , injection lumen 540 of second elongate shaft 536 will define a tortuous injection path . the tortuous injection path defined by injection lumen 540 of second elongate shaft 536 may be described utilizing cylindrical coordinates . cylindrical coordinates are an extension of two dimensional polar coordinates to include a third or longitudinal dimension z . an exemplary tortuous injection path is described in table 1 . the first column of table 1 is the linear distance z which the tortuous injection path extends beyond distal contact area 566 of catheter 500 . the second column in table 1 is the radial distance r in millimeters from the longitudinal axis of barrel lumen 570 of barrel 562 of catheter 500 . the third column of table 1 is an angular dimension φ measured about the longitudinal axis of barrel lumen 570 of barrel 562 of catheter 500 . fig7 is a partial cross sectional view of a distal portion 660 of an additional embodiment of a catheter 600 in accordance with the present invention . catheter 600 includes a first elongate shaft 626 having a distal end 628 and an inside surface 676 defining a first shaft lumen 630 . a barrel 662 is partially disposed within first shaft lumen 630 of first elongate shaft 626 proximate distal end 628 . barrel 662 includes a first helical member 678 comprising a plurality of turns 680 . in the embodiment of fig7 first helical member 678 comprises a first screw thread 682 . a second elongate shaft 636 is partially disposed within first shaft lumen 630 of first elongate shaft 626 . second elongate shaft 636 forms a second helical member 684 . in the embodiment of fig7 second helical member 684 comprises a coil 686 having a plurality of turns 688 . in fig7 it may be appreciated that a plurality of turns 688 of second helical member 684 are disposed between a plurality of turns 680 of first helical member 678 . also in fig7 it may be appreciated that second helical member 684 is biased to expand in diameter . a distal end 638 of second elongate shaft 636 may be advanced into a target tissue by rotating second elongate shaft 636 . fig8 is a partial cross sectional view of a distal portion 760 of an additional embodiment of a catheter 700 in accordance with the present invention . in fig8 it may be appreciated that catheter 700 includes a first helical member 778 comprising a plurality of turns 780 disposed within a first shaft lumen 730 defined by an inside surface 776 of a first elongate shaft 726 . in a preferred embodiment , first helical member 778 is fixed to inside surface 776 of first elongate shaft 726 . in the embodiment of fig8 first helical member 778 comprises a first screw thread 782 . also in the embodiment of fig8 a second helical member 784 comprising a plurality of turns 788 is disposed about a second elongate shaft 736 . in the embodiment of fig8 second helical member 784 is preferably fixed to second elongate shaft 736 . in the embodiment of fig8 second helical member 784 comprises a second screw thread 790 . in fig8 it may be appreciated that a plurality of turns 788 of second helical member 784 are disposed between a plurality of turns 780 of first helical member 778 . in the embodiment of fig8 a barrel 762 defining a barrel lumen 770 is partially disposed within first shaft lumen 730 of first elongate shaft 726 . a coiled portion 792 of second elongate shaft 736 is disposed within barrel lumen 770 of barrel 762 . in fig8 it may be appreciated that coiled portion 792 is biased to expand in diameter . a distal end 738 of second elongate shaft 736 may be advanced into a target tissue by rotating second elongate shaft 736 . fig9 is a partial cross sectional view of a distal portion 860 of an additional embodiment of a catheter 800 in accordance with the present invention . catheter 800 includes a first elongate shaft 826 having a distal end 828 and an inside surface 876 defining a first shaft lumen 830 . catheter 800 also includes a second elongate shaft 836 having a distal end 838 slidingly disposed within first shaft lumen 830 of first elongate shaft 826 . in fig9 it may be appreciated that catheter 800 includes a first helical member 878 comprising a plurality of turns 880 disposed within first shaft lumen 830 of first elongate shaft 826 . in a preferred embodiment , first helical member 878 is fixed to an inside surface 876 of first elongate shaft 826 . in the embodiment of fig9 first helical member 878 comprises a first screw thread 882 . a second helical member 884 is formed by second elongate shaft 836 . in the embodiment of fig9 second helical member 884 comprises a coil 886 having a plurality of turns 888 . in fig9 it may be appreciated that a plurality of turns 888 of second helical member 884 are disposed between a plurality of turns 880 of first helical member 878 . embodiments of the present invention have also been envisioned in which first helical member 878 comprises a coil . in the embodiment of fig9 a barrel 862 defining a barrel lumen 870 is partially disposed within first shaft lumen 830 of first elongate shaft 826 . a coiled portion 892 of second elongate shaft 836 is disposed within barrel lumen 870 of barrel 862 . in fig9 it may be appreciated that coiled portion 892 is biased to expand in diameter . a distal end 838 of second elongate shaft 836 may be advanced into a target tissue by rotating second elongate shaft 836 . fig1 is a partial cross sectional view of a distal portion 960 of an additional embodiment of a catheter 900 in accordance with the present invention . catheter 900 includes a first elongate shaft 926 having a distal end 928 and an inside surface 976 defining a first shaft lumen 930 . a tip member 994 is disposed proximate distal end 928 of first elongate shaft 926 . in a preferred embodiment , tip member 994 is comprised of an elastomeric material . a barrel 962 is partially disposed within first shaft lumen 930 of first elongate shaft 926 proximate tip member 994 . barrel 962 includes a first helical member 978 comprising a plurality of turns 980 . in the embodiment of fig1 , first helical member 978 comprises a first screw thread 982 . a second elongate shaft 936 is partially disposed within first shaft lumen 930 of first elongate shaft 926 . second elongate shaft 936 forms a second helical member 984 . in the embodiment of fig1 , second helical member 984 comprises a coil 986 having a plurality of turns 988 . in fig1 , it may be appreciated that a plurality of turns 988 of second helical member 984 are disposed between a plurality of turns 980 of first helical member 978 . fig1 is a partial cross sectional view of distal portion 960 of catheter 900 of fig1 . in the embodiment of fig1 second elongate shaft 936 has been advanced distally so that a distal portion of second elongate shaft 936 extends beyond barrel 962 . in fig1 , it may be appreciated that second helical member 984 is biased to expand in diameter . also in fig1 , it may be appreciated that the expansion of second helical member 984 has deformed tip member 994 . having thus described the preferred embodiments of the present invention , those of skill in the art will readily appreciate that yet other embodiments may be made and used within the scope of the claims hereto attached . numerous advantages of the invention covered by this document have been set forth in the foregoing description . it will be understood , however , that this disclosure is , in many respects , only illustrative . changes may be made in details , particularly in matters of shape , size , and arrangement of parts without exceeding the scope of the invention . the invention &# 39 ; s scope is , of course , defined in the language in which the appended claims are expressed .	0
turning now to the drawings , fig1 and 2 show a platform 12 with structural support members 14 . the platform 12 is disposed on a chassis ( not shown ) of a flatbed truck 16 . the platform 12 includes hollow rails shown generally at 18 that circumscribe a region in which a floor 20 is disposed . each of the rails 18 has pockets 22 ( fig3 and 3a ) for receiving vertical stakes of a stake body ( not shown ). the platform 12 includes cargo tie - down assemblies 24 that are mounted in an associated one of first tie down cutout openings 26 in the rails 18 . the rails 18 include two side rails 28 spaced apart from each other , which extend along a length of the truck . the rails 18 also include two end rails 30 , which are spaced apart from each other and extend between the side rails 28 along a width of the truck . each of the end rails 30 is connected to an opposite end of the side rails 28 . the side and end rails 28 , 30 may be formed of any suitable structural steel member , such as 12 gauge high strength steel . the platform 12 may have any width , such as 96 inches , and any length , such as 24 feet 5 inches . the platform 12 can fit onto any size truck and accommodate any size stake body . turning now to fig3 a and 4 , it will be seen that the rails 18 include upper and lower surfaces 32 , 34 and a side surface 36 extending between the upper and lower surfaces 32 , 34 . the pockets 22 are formed by a vertical wall which is disposed in the interior of the side and end rails 28 , 30 and extends between the upper and lower rail surfaces 32 , 34 . each of the pockets 22 communicates with a second associated pocket cutout opening 38 formed in the upper rail surface 32 . the pocket cutouts 38 may be any suitable size , one suitable size being 3 . 66 × 1 . 66 inches . the pockets 22 may also be any suitable size , one suitable size being 5 . 5 inches in length , 3 . 56 inches in width and 1 . 76 inches deep . the tie down cutouts 26 are formed in the upper surfaces 32 of the side rails 28 preferably adjacent the pocket cutouts 38 . the tie down cutouts 26 are defined by interior surfaces 40 of the side rails 28 and communicate the area outside the rail upper surfaces 32 of the side rails 36 with the interior 42 of the side rails 28 . the tie down cutouts 26 may be any suitable size , and are preferably the same size as the pocket cutouts 38 . each of the tie down assemblies 24 is disposed in a tie down cutout 26 and can be accommodated within the side rail interior 42 . the side rails 28 also include a shoulder 44 for supporting the floor 20 . the floor 20 may be formed of any material such as wood , steel , or wood with a steel overlay . one example of a suitable wood floor comprises 2 × 4 inch tongue and groove boards . as shown in fig2 the support members 14 include cross members 46 that extend across the width of the truck 16 into the side rail interior 42 between the upper and lower surfaces 32 , 34 of the side rail 28 . the support members 14 also include long sills 48 preferably disposed underneath the cross members 46 and extending along the length of the truck 16 . gussets 50 may also be disposed underneath the platform 12 . other structural supports including support members 51 may also be used as will be apparent to those skilled in the art . the cross members 46 are welded to the side rails 28 . the long sills 48 are welded to the cross members 46 . the gussets 50 are welded against the long sills 48 and the cross members 46 . the long sills 48 and the cross members 46 are welded to the truck chassis . the cross members 46 , the long sills 48 , the gussets 50 and the support members 51 may be formed of structural steel members of any suitable size , gauge , and spacing . for example , the cross members 46 may be 4 inch i - beams with a 3 . 2 pounds / foot nominal weight at 18 inch spacing between centers . the long sills 48 may be 6 inch structural long sill channels with a 34 inch spacing between centers . more specifically , 12 gauge high strength steel may be used for the cross members 46 , the long sills 48 , the gussets 50 and the support members 51 . referring to fig4 a , and 5b , each of the tie down assemblies 24 includes an anchor 52 disposed in an associated one of the tie down cutouts 26 . the anchors 52 are preferably welded to the upper rail surfaces 32 of the side rails 28 . each of the anchors 52 has surfaces 54 which , together with the interior side rail surfaces 40 , define a recess 55 and openings 56 . the openings 56 communicate with the recess 55 and the side rail interior 42 . each of the tie down members 58 is connected to an associated one of the anchors 52 for movement in the openings 56 . each of the anchors 52 preferably includes a body portion 60 having first and second opposing end portions 62 , 64 . the body portion 60 preferably has a curved portion 65 , which forms a region in which one &# 39 ; s hand can fit for gripping the tie down members 58 when they are in the retracted position . two shoulders 66 are each preferably connected to a side of the first body end portion 62 . each of the shoulders 66 preferably has an arm portion 68 spaced apart from the body portion 60 in a direction in which the side rails 28 extend . when the anchors 52 are mounted in an associated one of the tie down cutouts 26 , portions of the body portion 60 , the shoulders 66 , and the arms 68 contact the interior side rail surface 40 . the anchors 52 are fastened to the rails 28 such as by welding . the recess 55 and the two openings 56 are defined by each of the anchors and the associated interior rail surfaces 40 . more specifically , each recess 55 and one of its associated openings 56 are defined by surfaces of one side of the body portion 60 , one of the shoulders 66 and one of the arms 68 , together with the interior side rail surface 40 . each of the tie down members 58 includes two sides 70 and first and second ends 72 , 74 , as best shown by fig4 and 5b . each tie down member has an opening 59 therethrough . each of the sides 70 is received in an associated one of the openings 56 . the tie down members 58 may be any shape , as long as they can protrude from the anchor 52 enough to be fastened in the operative position and be received by the openings 56 , preferably below the upper rail surface 32 , when in the retracted position . the tie down members 58 may be straight or planar , and preferably have a continuous , substantially rectangular shape . the tie down members 58 may also be formed in a ring shape . the tie down members 58 preferably have a curvature along a length of their sides 70 as best shown in fig4 . the tie down members 58 may have any curvature that permits them to be moved , such as by sliding , out of the rail interior 42 into an operative position so that the second tie down member ends 74 contact the lower surface of the anchors 52 . the curvature of the tie down members 58 may vary depending upon the distance between the upper and lower rail surfaces 32 , 34 , the sizes of the tie down members 58 and the anchors 52 , and the size of the tie down cutouts 26 . one suitable tie down member curvature is a 3 . 34 inch radius through an arc of 70 . 23 degrees . the cargo tie down assemblies 24 of the present invention can be used to secure cargo on the platform floor 20 in the following manner . the tie down cutouts 26 are formed in the upper rail surfaces 32 of the truck platform 12 . the tie down members 58 are connected to the anchors 52 so that the anchors extend across the openings 59 . the anchors 52 are welded to the upper surfaces 32 of the side rails 28 in an associated one of the tie down cutouts 26 . when the anchors 52 are in position , the two openings 56 are defined and communicate with the side rail interior 42 . each of the tie down members 58 is disposed in the openings 56 in an associated one of the tie down cutouts 26 . as shown in fig3 a , a lower surface of a fail 18 includes a hole h . to secure the cargo on the platform floor 20 , each of the tie down members 58 is slid out of the side rail interior 42 into the operative position where the second end 74 of the tie down member 58 engages the lower surface of an associated one of the anchors 52 . in the operative position , the first ends 72 of the tie down members 58 extend above the plane of the floor 20 . fasteners such as ropes or cables 76 , which may be secured to hooks 78 , are connected to the tie down members 58 between the side rails 28 . the ropes 76 are pulled tightly against the cargo to secure the cargo on the platform floor 20 . when it is desired to unload the cargo from the platform , the fasteners 76 are removed from the tie down members 58 . the tie down members 58 are then slid into a retracted position in which the second ends 74 move further into the side rail interior 42 . in the retracted position each of the first end portions 72 of the tie down members 58 engages the upper surface of its associated anchor 52 . the first end portions 72 of the tie down members 58 are now disposed in the recesses 55 in a position preferably flush with or below the plane of the upper rail surfaces 32 . although the invention has been described in its preferred form with a certain degree of particularity , it will be understood that the present disclosure of the preferred embodiments has been made only by way of example and that various changes may be resorted to without departing from the true spirit and scope of the invention as hereafter claimed .	1
when r 1 and / or r 2 in formula i is alkanoyl containing 1 - 22 carbon atoms , there are included both unbranched and branced alkenoyl , for example , formyl , acetyl , propionyl , butyryl , isobutyryl , valeryl , isovaleryl , 2 - methylbutanoyl , pivalyl , 3 - methylpentanoyl , 3 , 3 - dimethylbutanoyl , 2 , 2 - dimethylpentanoyl , doco - sanoyl , and 7 , 7 - dimethyloctanoyl . the branched alkanoyl groups are preferred over the unbranched alkanoyl groups . when r 1 and / or r 2 in formula i is alkenoyl having one or two double bonds and having 4 - 22 carbon atoms , there are included , for example , crotonyl , 9 - octadecenoyl , 2 , 5 - hexadienoyl , 3 , 6 - octadienoyl , 10 , 13 - octadecadienoyl , and 5 , 13 - docosadienoyl . when r 1 and / or r 2 in formula i is ## str5 ## there are included for example the cycloalkanecarbonyl and cycloalkanealkanoyl groups : cyclopropanecarbonyl , 1 - methylcyclopropanecarbonyl , cyclopropaneacetyl , alpha - methylcyclopropaneacetyl , 1 - methylcyclopropaneacetyl , 2 - amylcyclopropaneacetyl , cyclopropanepropionyl , alpha - methylcyclopropanepropionyl , 2 - isobutylcyclopropanepropionyl , 2 - hexylcyclopropanecarbonyl , cyclobutanepropionyl , 2 - methylcyclobutanecarbonyl , 1 , 3 - dimethylcyclobutanecarbonyl , 3 , 3 - dimethylcyclobutanecarbonyl , cyclobutaneacetyl , 2 , 2 - dimethyl - 3 - ethylcyclobutaneacetyl , cyclobutanepropionyl , cyclopentanecarbonyl , 1 - methyl - 3 - isopropyl , cyclopentanecarbonyl , cyclopentanepropionyl , cyclohexanecarbonyl , cyclohexaneacetyl , 4 - methylcyclohexaneacetyl , cycloheptanecarbonyl , 4 - methylcycloheptaneacetyl , and cycloheptanepropionyl . when r 1 and / or r 2 in formula i is ( phenyl or substituted ## str6 ## there are included for example benzoyl , phenylacetyl , alpha - phenylpropionyl , beta - phenylpropionyl , p - toluyl , m - toluyl , o - toluyl , o - ethylbenzoyo , p - tert - butylbenzoyl , 3 , 4 - dimethylbenzoyl , 2 - methyl - 4 - ethylbenzoyl , 2 , 4 , 6 - trimethylbenzoyl , m - methylphenylacetyl , p - isobutylphenylacetyl , beta -( p - ethylphenyl )- propionyl , p - anisoyl , m - anisoyl , o - anisoyl , m - isopropxybenzoyl , p - n - butoxybenzoyl , 3 - methoxy - 4 - ethoxybenzoyl , 3 , 4 , 5 - trimethoxybenzoyl , 2 , 4 , 6 - triethoxybenzoyl , p - methoxyphenylacetyl , m - isobutoxyphenylacetyl , 3 , 4 - diethoxyphenylacetyl , beta -( 3 , 4 , 5 - trimethoxyphenyl ) o - iodobenzoyl , m - bromobenzoyl , p - chlorobenzoyl , p - flourobenzoyl , 2 - bromo4 - chlorobenzoyl , 2 , 4 , 6 - trichlorobenzoyl , p - chlorophenylacetyl , alpha -( m - bromophenyl )- propionyl , p - trifluoromethylbenzoyl , 2 , 4 - di -( trifluoromethyl )- benzoyl , m - trifluoromethylphenylacetyl , beta -( p - trifluoromethyl - phenyl ) propionyl , 2 - methyl - 4 - methoxybenzoyl , 3 - chloro4 - ethoxybenzoyl , beta -( 3 - methyl - 4 - chlorophenyl ) propionyl , p - dimethylaminobenzoyl , m - diethylaminobenzoyl , p - dibutylaminobenzoyl , p -( n - methyl - n - ethylamino ) benzoyl , 0 - acetamidobenzoyl , m - propionamidobenzoyl , p - hexanoylaminobenzoyl , 3 - chloro - 4 - acetamidophenylacetyl , and p - acetamidophenylpropionyl . when r 1 and / or r 2 in formula i is napthhalenecarbonyl , there are included 1 - naphthalenecarbonyl and 2 - naphthalenecarbonyl . when r 1 and / or r 2 in formula i is pyridinecarbonyl , there are included picolinoyl ( 2 - pyridinecarbonyl ), nicotinoyl ( 3 - pyridinecarbonyl ), and isonicotinoyl ( 4 - pyridinecarbonyl ), and the opthalmologically acceptable acid - addition salts thereof . while all of the compounds within formula i suffice for the purposes of this application , a preferred group of compounds having exceptional activity at minimal concentration exists as noted below : other aspects of this invention include practicing the method of the invention with a pharmaceutically acceptable ophthalmological carrier as well as typical and coventional polymeric inserts or soft contact lenses . topical administration of a compound of formula i to the eye of a warm - blooded animal effectively lowers intraocular pressure without the concomitant appearance of any significant undesirable side effects associated with the prior art . in accordance with the present invention , the compound of formula i or an ophthalmologically acceptable acid addition salt thereof is applied topically to the eye in an effective opthalmologically acceptable amount , thereby providing a therapeutic useful reduction in intraocular pressure . it is to be understood that the term &# 34 ; effective ophthalmologically acceptable amount &# 34 ; as used herein generally refers to the quantity of the active ingredient necessary to effect a lowering of intraocular pressure without causing any concomitant side effects associated with the prior art as heretofore described . while the administered dose , whether a single dose or a daily dose , will , of course , vary with the individual treated , the dose administered is not subject to definite bounds . however , generally , the dose administered will usually be an effective amount , or the equivalent on a molar basis of the pharmacologically active form produced upon the metabolic release of the active drug to achieve its desired pharmacological and physiological effect , i . e ., a lowering of intraocular pressure . normally , however , a dose of from 50 to 100 μ1 of a solution contaning from 0 . 01 to 2 % once every 6 to 12 hours will suffice to reduce intraocular pressure . the term &# 34 ; ophthalmologically acceptable acid addition salts &# 34 ; as used herein in describing the salts of the compound of formula i is intended to define those salts which are nontoxic and nonirritating on topical application to the eye , stable when stored , and otherwise generally acceptable for ophthalmic formulation . by way of example , there can be mentioned those salts derived from organic or inorganic acids which are nonirritating to the ophthalmic membrane such as hydrochloric , hydrobromic , sulfuric , phosphoric , methanesulfonic , acetic , citric , malic , succinic , lactic , tartaric , benzoic and the like . when the compound of formula i is administered topically to the eye of a warm - blooded animal , it is preferred to maintain the same in an aqueous isotonic vehicle such as a 0 . 9 % sodium chloride solution . normally , one to four drops of such solution is sufficient for reducing intraocular pressure . naturally , other vehicles and additional active ingredients may be included , provided they do not hinder the therapeutic activity of the main active drug , the compound of formula i . in practicing the method of the present invention , ophthalmologically acceptable acid addition salts of the compound of formula i which are exceptionally water soluble , such as the tartrate , bitartrate , sulfate or hydrochloride salts are preferred . without further elaboration , it is believed that one of ordinary skill in the art can , using the preceding description , utilize the present invention to its fullest extent . consequently , the following specific embodiments are , therefore , to be construed as merely illustrative , and not limitative , of the remainder of the specification and claims in any way whatsoever . to a methanol solution containing 44 . 7 g ( 0 . 099 mol ) m , p - dipivalyladrenalone hydroperchlorate at 0 ° was added dropwise with stirring a methanol solution containing 16 . 7 g ( 0 . 099 mol ) cesium chloride . after stirring for 0 . 5 hr . at 0 ° , the cesium perchlorate was removed by filtration and the methanol filtrate was concentrated under reduced pressure to a light yellow solid . recrystallization of isopropanol gave 23 . 1 g ( 0 . 060 mol ), 60 %, m , p - dipivalyladrenalone hydrochloride , mp 201 ° - 203 ° , tlc ( silica gel / chloroform : methanol : formic acid : 30 : 10 : 1 ( viv )) rf = 0 . 65 ; uv ( methanol ): λmax 254 nm , λ280 nm ( sh ); ir ( kbr ) 2980 , 2770 , 1750 , 1685 , 1260 , 1100 and 840 cm - 1 ; pmr ( cd 3 cocd 3 . d 2 0 ) δ 6 . 8 - 7 . 7 ( m , 3h ), 4 . 4 ( s , 2h ), 2 . 5 ( s , 3h ) and 0 . 9 ( s , 18h ) ppm . anal . calcd for c 19 h 28 clno 5 : c , 59 . 13 ; h , 7 . 31 ; n , 3 . 63 ; cs , trace . found : c , 59 . 19 ; h , 7 . 22 ; n , 3 . 76 ; cs , 99 ppm . normal new zealand albino rabbits of either sex , weighing about 2 kg . were used in the studies . the animals were placed in wooden restraining boxes at least a half hour before the experiment and remained there throughout the test . the intraocular pressure was estimated using a standard tonometer , and the pupil diameter was measured with starrett micrometer held at constant distance from observer and animal eyes . prior to each pneuamtonometry the eye was given one drop of proparacaine hcl , ( alcaine ®), 0 . 5 % diluted 1 : 1 with normal saline , which was washed out a few seconds later with normal saline . the compound was dissolved in distilled water . dpa was freely soluble . the solutions were prepared freshly just before the experiment . a dose volume of 0 . 05 ml from an eppendorf pipet was used . the results of all intraocular pressure and mydriatic studies conducted are shown below in tables i and ii . table i__________________________________________________________________________the effect of dpa on intraocularpressure in normal albino rabbits__________________________________________________________________________concentration time ( hours ) __________________________________________________________________________ 0 1 2 4 6 8 10 23__________________________________________________________________________ intraocular pressure mmhg ( x ± s . e . ) __________________________________________________________________________0 % 24 . 8 25 . 2 24 . 2 24 . 8 24 . 7 24 . 8 25 . 2 26 . 2 ± 0 . 8 ± 1 . 0 ± 1 . 2 ± 1 . 0 ± 1 . 4 ± 1 . 2 ± 0 . 7 ± 0 . 70 . 01 % 26 . 2 22 . 8 17 . 7 20 . 5 20 . 7 22 . 7 22 . 2 27 . 2 ± 0 . 9 ± 2 . 1 ± 1 . 8 ± 2 . 1 ± 2 . 2 ± 1 . 8 ± 1 . 1 ± 0 . 40 . 1 % 25 . 2 24 . 7 18 . 7 16 . 5 15 . 2 16 . 8 19 . 3 25 . 5 ± 0 . 9 ± 1 . 3 ± 1 . 8 ± 1 . 0 ± 1 . 6 ± 0 . 7 ± 0 . 9 ± 0 . 80 . 5 % 25 . 2 22 . 7 22 . 5 17 . 8 13 . 5 13 . 0 15 . 7 25 . 2 ± 0 . 6 ± 1 . 1 ± 1 . 4 ± 2 . 3 ± 1 . 1 ± 0 . 9 ± 0 . 8 ± 0 . 81 % 24 . 3 21 . 8 23 . 8 18 . 3 14 . 5 14 . 8 13 . 2 22 . 2 ± 1 . 1 ± 1 . 1 ± 1 . 0 ± 1 . 7 ± 0 . 4 ± 1 . 0 ± 0 . 6 ± 1 . 3__________________________________________________________________________ table ii__________________________________________________________________________the effect of dpa on pupildiameter in normal albino rabbits__________________________________________________________________________concentration time ( hours ) __________________________________________________________________________ 0 0 . 5 1 . 5 3 5__________________________________________________________________________ pupil diameter mm ( x ± s . e . ) __________________________________________________________________________0 % 5 . 0 5 . 1 5 . 0 5 . 0 5 . 0 ± 0 . 1 ± 0 . 2 ± 0 . 1 ± 0 . 2 ± 0 . 10 . 01 % 4 . 7 5 . 6 5 . 2 4 . 7 4 . 7 ± 0 . 1 ± 0 . 3 ± 0 . 2 ± 0 . 1 ± 0 . 10 . 1 % 4 . 8 6 . 9 6 . 7 5 . 1 4 . 7 ± 0 . 1 ± 0 . 2 ± 0 . 2 ± 0 . 1 ± 0 . 10 . 5 % 5 . 0 7 . 2 6 . 9 5 . 2 5 . 0 ± 0 . 1 ± 0 . 5 ± 0 . 3 ± 0 . 2 ± 0 . 11 % 5 . 0 6 . 6 6 . 1 5 . 0 4 . 8 ± 0 . 1 ± 0 . 2 ± 0 . 1 ± 0 . 1 ± 0 . 1__________________________________________________________________________ when the preceding example is repeated , but this time , employing any one of the remaining compounds encompassed within formula i , substantially smilar results will be observed . pharameceutical compositions comprising any of the compounds of formula i in combination with a nontoxic pharmaceutically acceptable ophthalmological carrier therefor , suitable for ocular installation , is preferred for practicing the present invention . these include opthalmic solutions , ointments or any other equivalent ophthalmic vehicles . aqueous opthalmic solutions formulated in accordance with good pharmaceutical practices as set forth in chapter 83 of remington &# 39 ; s pharmaceutical sciences , fourteenth edition , mac publishing company , are preferred , although petrolatum based ointments may suffice . the ophthalmic solutions are naturally sterilized and preferably contain a bacteriological preservative to maintain sterility during storage and use . the quaternary ammonium bacteriostats such as benzalkonium chloride are satisfactory . antioxidants can also be employed if desirable , but in view of the fact that the compounds of formula i are highly stable toward degradation , antioxidants will seldom be necessary . by way of example , suitable antioxidants include sodium bisulfite , n - acetylcystene salts , sodium ascorbate and other water soluble opthalmologically acceptable antioxidants known in the pharmaceutical arts . ophthalmic solutions of any of the compounds of formula i may be adjusted with inert ingredients such as sodium chloride or boric acid to provide a solution which is comfortable for application to the eye . that is , adding ingredients to the basic opthalmological formulation for the purpose of achieving isotonicity with the eye are within the purview of the instant invention . ointments are prepared with conventional petralatum vehicles employing liquid petrolatum and white petrolatum in such proportions as to afford an ointment of desirable fluidity . the compounds of formula i and any opthalmological acceptable acid addition salt thereof may also be applied to the eye through the vehicle of a polymeric insert or soft contact lens . for the latter purpose , the polymeric hydrophilic hydrogels prepared from polymers of acrylic and methacrylic esters , modified collagens , cross - linked polyether gels , cross - linked polyvinyl alcohol , or cross - linked partially hydrolyzed polyvinylacetate as disclosed in u . s . pat . nos . 2 , 976 , 576 ; 3 , 220 , 960 and 3 , 419 , 006 may be employed . ocular inserts prepared from these or other polymeric materials which are insoluble in tear fluid but which may absorb tear fluid to form a swollen hydrogel as disclosed in u . s . pat . nos . 3 , 416 , 530 , 3 , 618 , 604 and 3 , 632 , 200 may also be employed . all such means of applying the compounds of formula i or any ophthalmologically pharmaceutically acceptable acid addition salt thereof are included within the present invention as are compositions adapted for such use . in practicing the process of the present invention for lowering intraocular pressure , an opthalmologically acceptable polymeric ocular insert placed and retained in contact with an eyeball is preferred wherein the compound of formula i diffuses from the insert at a rate sufficient to provide an effective intraocular pressure lowering dose over a period of 6 hours . ocular inserts , particularly preferred in the practice of the present invention , are conventionally prepared , for example , by soaking the polymeric insert or soft lens in an effective amount of a solution of the compound of formula i or an ophthalmologically acceptable acid addition salt thereof until equilibrium is established , which is generally within a period of one to five minutes . inserts prepared in this manner diffuse at a rate sufficient to provide a therapeutic dose to the eyeball over a period of six hours . from the foregoing description , one of ordinary skill in the art can easily ascertain the essential characteristics of this invention , and without departing from the spirit and scope thereof , can make verious changes and / or modifications to the invention for adapting it to various usages and contitions . accordingly , such changes and modifications are properly , equitably and intended to be , within the full range of equivalence of the following claims .	0
this disclosure is of a computer system comprised of a processor , memory coupled to the processor , a video camera , a screen and a computer program or application . the processor can be any kind of processor that will run the application , including cisc processors such as an x86 processor , or risc processors such as an arm processor . the memory can be any type of memory , including ram , rom , eeprom , magnetic memory such as floppy drives , hard disk drives , solid state drives , flash memory , and optical memory such as compact disks , digital versatile disks , and blu - ray disks . the video camera can be any kind of video camera capable of outputting a digital signal . specific resolutions and color sensitivity may vary depending on specific implementation purposes . the screen can be any kind of screen that is capable of displaying a video stream . the application is stored in the memory and is executed by the processor , inputting a real - time video stream from the video camera and outputting a video stream to the screen . the application does not rely on specific hardware , rather just on generic hardware requirements as specified above , such that the application can be conveyed by and executed from different memory types on different hardware that is compliant with the requirements . the application can be embodied in several ways . in this disclosure , there are exemplary embodiments of specific algorithms to build an interactive game where the bodies of a plural audience are used together as a unified control means , like a massive joystick . exemplary embodiments include algorithms both for crowd motion detection , and for statistical purposes which provide automatic measurements of audience participation ratio . exemplary embodiments of motion detection algorithms allow audiences to control applications by moving their arms and body sideways and / or vertically , the algorithms being able to recognize the directions left , right , up and down . in an exemplary embodiment of the present disclosure , the algorithms allow the crowd to control lane based games , such as catch and dodge or brick breaker . fig1 depicts an exemplary embodiment of this disclosure , wherein the sideways motion of human participants , and especially their arms , leads to the motion of a car between two alternate lanes a 1 and a 2 . fig2 depicts a game with sideways motion , suitable to be controlled by the methods and systems in this disclosure . all algorithms herein disclosed are shown as indexes . motion algorithms are divided into : a motion index to quantify the amount of motion of the crowd to be used in games with a continuous range of motion , such as brick - breaker - alike games ; a boolean motion index to trigger the alternative positions in lane - based games . both motion indexes are heuristic , adapting their values to the amount of motion captured by the camera . they work in the exact same way for a large crowd as for a single person . the motion index uses optical flow as the key to measure pixel velocities between two frames and calculates an average value for the entire image . for instance , a pyramidal lk optical flow , that has the advantage of being available in open source implementations like opencv , can be used . the motion index is , however , suited to use any algorithm within the optical flow family . a short memory of average optical flow vectors is used to calculate an histogram , and the motion index is obtained by measuring the rank of the actual average velocity , which essentially represents a value between 0 and 100 % according to the histogram shape . some filters are used to mitigate problems with outliers and to cull undesired areas like aisles in a film room . they are used to mask pixels out of optical flow average velocity calculation , and also to eliminate from the calculation high velocities that can represent a participant walking in front of the camera . thus image processing flux can be summarized in fig3 . fig3 depicts a method for calculating a motion index , with the following steps : capture of camera image in real - time ; first filtering , wherein masks are applied to the real - time image , for instance to remove sections of the image that are not to be processed by an optical flow algorithm ; optical flow algorithm application ; second filtering , wherein a vector filter is applied to the optical flow vectors , for instance to remove vectors which length is above a certain threshold ; an optical flow velocity histogram is kept for a certain period of acquisition , e . g . last 10 seconds , and updated with each iteration of the motion index ; a motion index is obtained . motion index calculation can take advantage of two different types of filters that can be applied before and after optical flow calculation , respectively . the first filtering level is calculated by removing pixels from velocity calculation , and the second level is applied to filter out vectors calculated through optical flow . motion index calculation does not require filtering ; filtering is performed to improve application accuracy in some scenarios . first filtering can be performed by two masks : adaptive differences and / or aisle remover . optical flow algorithms can be influenced by extreme lighting conditions , e . g ., weak light , heterogeneous lighting environment , and lateral lighting — weak lighting may increase gaussian noise in the image captured by the camera , decreasing optical flow precision ; heterogeneous and lateral lighting may cause two similar motions to be detected as having different intensity . a difference - based filter between several consecutive frames can be used to eliminate those pixels not showing differences in the gray scale above a predefined threshold . the likely timing for an interactive advertisement in an event is for it to be shown prior to or during an interval to the event . considering a space with seated places , such as a film room or public stands in an arena or court , there is a high probability that people will be walking towards and from their seats through aisles , hence it is important to eliminate these critical areas to minimize their effect on optical flow calculation , and potential consequences in application accuracy . this filter can be produced by applying polygons to exclude areas from optical flow calculation . second filtering is important in some scenarios . for instance , in a film room with a camera placed near the screen ( or projection room ) pointing to spectator places , participants &# 39 ; influence in optical flow average will vary according to their distance to the camera . even if the camera is hidden , there is always the possibility that someone will perceive its location and try to hack the interaction by obstructing the view to other participants , which may jeopardize the goal of the application . this danger can be minimized by elimination of optical flow vectors longer than a predefined threshold relative to image resolution . when people are playing a game like catch and dodge , they usually move in very precise moments with optical flow average velocity peaks alternating in their sign over time as people move left and right or up and down . fig4 is a typical profile for this type of game . the range of optical flow vectors can diverge according to the area that a player occupies in the captured image . this issue can be illustrated by a game scenario controlled by a single player and a setup with a camera capturing image from the center of a screen that is aimed to the seats or standing places in a event venue . if the player plays the game in the front seats , and also in the back seats , the player &# 39 ; s absolute velocities for both seat locations can be expressed by two histograms with distinct ranges like the ones in fig5 . spatial camera placement is a critical condition for effective interaction , and is dependent on the physical conditions of the space . a typical place for a camera is horizontally centered with a screen that is aimed at seats or standing places , either below or above the screen ; if the space is then symmetric from the perspective of the screen , optical flow will have the same approximate range for positive and for negative vectors . a centered placement is , however , not always possible , and sometimes the camera must be placed uncentered with the screen , e . g ., in a left or right side corner of the wall where the screen is placed against . in this situation , optical flow vectors suffer some distortion by virtue of the angle of capture : the range and absolute value of both positive and negative optical flow vectors can change significantly as the angle increases . for example , if the camera is placed on the right corner of a wall , vectors created by people moving left and right to play a game will be longer when they move left than it is when they move right , as illustrated in fig6 and by fig7 . the motion index integrates all the foregoing considerations and assumes the least parameters possible . the motion index differentiates both positive and negative velocities by keeping a short memory of optical flow average velocities . both histograms are then updated as a new captured image arrives and is used to calculate the rank of the actual average optical flow velocity . where u i is a positive velocity obtained in an instant ≦ t ( u i & gt ; 0 ), and where w i is a negative velocity obtained in an instant ≦ t ( w i & lt ; 0 ); the motion index uses the rank of the actual velocity expressed in percentage of a memory of positive and negative velocities ( v ) as : b is the number of scores below v t , if v t & gt ; 0 or number of scores above v t , if v t & lt ; 0 to illustrate the calculation of the motion index , one can assume fig8 as a representation of histograms for both positive and negative optical flow average velocities . when a new velocity is obtained , it is checked if it is positive or negative and the corresponding histogram is updated . assuming the velocity is positive with vt = 14 we will obtain an accumulated probability of approximately 0 . 8 and thus the motion index has a value of 80 . on the other end if we assume the velocity as negative with vt =− 26 , the accumulated probability is 50 and , therefore , the motion index is − 50 . despite positive and negative velocities having very different scales , the motion index produces values within − 100 and 100 which are adapted to the orientation of the camera . on cause of the motion index using short memory optical flow velocity histograms , its value is always adapting to the amount of motion captured by the camera , which makes it heuristic . the return of rank of vt in a memory set as a percentage of the data set also makes it parameter - less and confined to a same possible range . to make a two - dimensional ( 2d ) motion index it suffices to apply it to each component of an optical flow vector independently . the motion index will then be a two - dimensional vector with values ranging from − 100 to 100 . the above methods have been expressed as sensitive to a left and right sides from the perspective of a camera . equally , up and down can be used by the same methods . this can be of use in scenarios such as a sports arena with 2 levels for the public , or an event room with a stage wherein there is a general public section at the floor level and there are cabins at least one other superior level . in the latter case , the general public section can typically accommodate more spectators than the cabin section — still , by virtue of the motion index , the cabin section will be able to influence the application or game just as much as the general audience . in a practical , exemplary embodiment to this disclosure there is a public film room in a cinema , wherein a large screen is aimed at a public seating section . a camera is placed below the screen , and is connected to a computer wherein a processor and a memory are lodged to run and store applications , respectively . before the film begins , an application is run from the computer , that is displayed unto the screen and shows a representation of a man on a hoverboard seen from behind , similarly to fig2 , slightly fluctuating from left to right . a message appears on the screen which reads “ hold your arms up ”, followed by “ control the motion by swaying your harms ”. people on the public seating section sway their arms and thus influence the motion of the hoverboards . a person passing in front of the screen momentarily obstructs the camera , and the hoverboard stays still until the person is no longer obstructing the camera , since the application determines that the motion of the obstructing person is above a discarding threshold . the motion index has a continuous nature , allowing its use in measuring the actual amount of motion being captured by the camera in real time , and not just a subset thereof . it can be used by games requiring continuous motion to be played , like brick breaker type games . however , lane - based games , such as the one depicted in fig2 , require discrete values such as simple “ left ” or “ right ”, as people move to catch good items or to avoid obstacles . given that it includes orientation , the motion index can be used to calculate these boolean motions . to determine when to trigger a left or right motion , an absolute threshold for the motion index is specified , above which an order is given . for example , assuming a threshold of 70 %, if m ( v t , vpos n , vneg m )=− 89 , a left order is produced . for increased accuracy , the trigger can be the occurrence of a predefined number of consecutive values ( c ) above some absolute threshold for the motion index ( m 0 ), following the flow in fig9 . taking m as m ( v t , vpos n , vneg m ), for each new value of m that is superior to m0 with a sign ( i . e ., negative or positive ) equal to the previous value of m increments a counter . upon the counter reaching a parameter c , an order is given based on the negative or positive sign of the set of c number of m values with the same sign . this method avoids possible outliers coming from a lighting anomaly or noise that were not properly filtered by the masks previously specified . statistics for crowd participation can be of interest for advertising in situations that advertisements can be displayed , e . g . a cinema film room . in an exemplary embodiment of this disclosure , a crowd participation index provides a statistical measure to quantify this success , again by use of optical flow . the algorithm for a crowd participation index is carried out assuming that an interactive advertisement has at least an introduction phase for explaining the interaction , an interaction , and an end screen , all phases depicted in fig1 . in the introduction screen all pixels are sampled randomly over time and their correspondent optical flow set of values kept in memory . optical flow is filtered in the exact same way as for the motion index calculation with the exception of differences that are applied to select the pixels that will be used in the statistical comparison of optical flow vectors during introduction and interaction time . if the optical flow average value is significantly different , and the average is higher during interaction time , it is considered different . the index is given by the ratio of pixels with statistical higher average relative to all the pixels selected for the comparison . all pixels that are not being explicitly filtered out are trial candidates for optical flow comparison . pixels with differences in the color space are used as more likely candidates to have people moving . even if an audience is not interacting with the advertisement during introduction , people will be slightly moving their heads , arms and body , possibly creating differences in the color space . pixels are hence selected for statistical motion comparison by checking if they cross a specific threshold as specified for the adaptive differences mask . if they cross that threshold at least ( d ) times , they are selected for optical flow statistical comparison . several mathematical approaches can be used to compare optical flow during introduction and interaction times . two possibilities are : analysis of variance ( anova ), a technique often used to compare averages through their variability range . a single factor anova is applied for each pixel selected for optical flow vector average comparison . if they are statistically not equal and the average is higher during interaction time , the analyzed pixel is used for player counting ; simple comparison of percentiles ; for example — if percentile 50 of the absolute value of optical flow vectors during interaction time is higher than percentile 75 during introduction time , the analyzed pixel is used for player counting . the disclosed embodiments vie to describe certain aspects of this disclosure in detail . other aspects may be apparent to those skilled in the art that , whilst differing from the disclosed embodiments in detail , do not depart from this disclosure in spirit and scope . in a computer - implemented - method , a motion index is computed from vectors obtained through an optical flow algorithm , consisting of an histogram thereof . the motion index is used to determine maximum motion for an image or a part thereto , enabling the calculation of the proportion of motion in any point in time , relative to the maximum motion . thus , any motion can be attributed a relative strength proportional to the maximum , which has the virtue of allowing for consistent proportional interaction for audiences of all sizes . areas that are not relevant or are source of noise can be excluded from the motion index and the image capture , and out - of - boundaries motion can be discarded .	7
referring to the drawings , preferred embodiments of the present invention will be described hereunder . a tn type lcd was produced by pouring a nematic liquid crystal ( roche : trade name ro - tn - 653 ) into a liquid crystal cell arranged to have a base gap of 10 μm . the refraction anisotropy δn of the ro - tn - 653 liquid crystal was 0 . 136 and therefore δn · d was 1 . 36 . polarizer plates of different degree of polarization were combined with this lcd to provide various combinations of polarization axes of the negative type in which light was prevented from passing therethrough upon application of no voltage and white light was disposed at the rear side of the combination polaroid plates to visually test the conditions of occurrence of interference color of the light passed through the combination of polarizer plates , thereby obtaining the results as shown in the following table 1 : table 1______________________________________ extent ofused polarizer plates interference color______________________________________a ( 99 ) 2 plates x . sup . xb ( 95 ) 2 plates xc ( 80 ) 2 plates δa ( 99 ) and b ( 95 ) x . sup . xa ( 99 ) and c ( 80 ) δb ( 95 ) and c ( 80 ) δ______________________________________ in this table 1 , the numeral in () represents the degree of polarization , and therefore a ( 99 ), b ( 95 ) and c ( 80 ) represent a polaroid plate of the degree of polarization of 99 %, a polarizer plate of the degree of polarization of 95 %, and a polarizer plate of the degree of polarization of 80 %. in the column of the extent of interference color in the table 1 , the marks ××,× and δ represent the evaluations which were judged that the occuurence of interference color was very conspicuous , considerably conspicuous , and somewhat conspicuous , respectively . as seen from the table 1 , there is a tendency that the occurrence of interference color can be more suppressed in the case where the polarizer plate c having a low degree of polarization ( 80 %) is used . if such a polarizer plate of low degree of polarization is used , however , it is impossible to provide a complete black color upon application of no voltage to lower the contrast . particularly , in the case where such a display effect that a vivid color display appears with a completely black background , such a display can not be realized by using polarizer plates each having a low degree of polarization . accordingly , a black dichroism coloring matter was added to 10 % to the liquid crystal to test the extent of occurrence of interference color and the results as shown in the following table 2 were obtained : table 2______________________________________ extent ofused polarizer plates interference color______________________________________a ( 99 ) 2 plates xb ( 95 ) 2 plates δc ( 80 ) 2 plates oa ( 99 ) and b ( 95 ) δa ( 99 ) and c ( 80 ) ob ( 95 ) and c ( 80 ) o______________________________________ in the column of the &# 34 ; extent of interference color &# 34 ; in the table 2 , the mark o represents the evaluation which was judged that there was less occurrence of interference color , while the evaluation standard of the marks ××, × and δ is the same as in the table 1 . thus , even in the case where 1 % quantity of coloring matter is added in this manner , the effect of the coloring matter is not so conspicuous if a polarizer plate of a low degree of polarization below 80 % is used as one of the pair of polarizer plates . since as the quantity of addition of coloring matter is decreased the quantity of passed light is more increased to increase the brightness of display , the combination is preferable in which a coloring matter of about 1 . 5 % or less is added and a polarizer plate of the degree of polarization of 80 % or less is used as one of a pair of polarizer plates . referring to the single figure of drawing , embodiments of the present invention will be described next . a liquid crystal cell 1 having a base - plate gap of 10 μm and a nematic liquid crystal ( merck & amp ; co . : trade name zli - 1565 ) added 1 % black coloring matter ( mitsuitoatsu chemicals , inc . : trade name m - 307 ) was enclosed in the cell 1 . a first polarizer plate 2 of 80 % degree of polarization and a second polarizer 3 of 99 % degree of polarization were placed on the opposite side surfaces of the liquid crystal cell 1 with the respective polarization axes of the polarizer plates made registered to provide a negative , tn type lcd . the δn of this liquid crystal is 0 . 13 . a color filter 4 in which red and green colors are combined was disposed at the rear side of the liquid crystal cell , a light scattering plate 5 was disposed at the rear side of the filter 4 , and a transmissive display was realized by using radiation light by a tungsten lamp 6 , whereby a good black - red black - green color switch having a wide visual angle with no interference color could be obtained . the reference numeral 7 in the drawing designates a masking sheet . a nematic liquid crystal ( roche : trade name ro - tn - 653 ) added 1 % black coloring matter ( mitsuitoatsu chemicals , inc . : trade name m - 176 ) was enclosed in a liquid crystal cell having a base - plate gap of 10 μm . a first polarizer plate of 80 % degree of polarization and a second polarizer of 95 % degree of polarization were placed on the opposite side surfaces of the liquid crystal cell with the respective polarization axes of the polarizer plates made registered to provide a negative , tn type lcd . the δn of this liquid crystal is 0 . 134 . a green color filter was disposed at the rear side of the liquid crystal cell , and a transmissive display was realized by using radiation light by a fluorescent lamp , whereby a good black - green color switch having a wide visual angle could be obtained .	6
with reference to fig1 rigid integral body 10 includes mounting flange 11 , preload adjustment section 12 , teflon shell pilot section 13 , and cap pilot end 14 . circumferential seal groove 15 and outboard seal groove 16 together with hydraulic bore 17 and one or more cross passages 18 are provided in cylindrical pilot 13 . teflon shell 19 is provided with a relatively thin clamping wall 20 , relatively thick sealed ends 21 engaged by lip seals 22 , and shouldered reduced end extensions 23 which are press fit on both surfaces within rear shell retainer 24 and on body shell pilot 13 . the thicker end portions 21 are also provided with a light press fit on pilot surface 13 . rear shell retainer 24 at its inner diameter 25 is provided with a press fit on adjacent surface 26 which is slightly larger in diameter than pilot surface 13 , e . g . approximately 0 . 001 &# 34 ;, to accommodate assembly of retainer 24 over pilot surface 13 . stop ring 27 is in turn press fit on retainer 24 serving to engage the end of the workpiece 28 which , in the embodiment shown , comprises a thin walled cylinder liner . front shell retainer 29 likewise provides a press fit on adjacent extension 23 and is assembled to the end of arbor pilot section 13 by cap screws 30 . turning center 31 , press fit at 32 within pilot recess 33 , includes passage 34 providing access to axial bleeder 35 which , together with radial bleeder 36 , accommodates complete bleeding of air from all internal hydraulic passages and chambers . hydraulic fluid is displaced to actuate teflon shell 20 by probe 37 extending into bore 17 actuated by external control tooling engaging end 38 through an actuating stroke limited by cover surface 39 thus providing displacement of dowl rod 40 , sealed at 41 within bore 17 . compression spring 42 returns probe 37 upon release of actuating pressure to a release position of teflon shell 20 . dual adjusting screws 43 acting on plungers 44 communicating with cross passage 45 at intersections 46 with chambers 47 and with bore 17 through clearance around rod 40 as shown at 49 , typically in the order of 1 / 32 &# 34 ; in diameter , provide means when the unit is fully bled for varying the effective displacement of teflon shell 20 in reaching full engagement with the out - of - round internal surface of cylinder liner workpiece 29 thus providing an accurate means for initial regulating , and adjustment if and when required , in the pressurized holding force of the teflon shell under full stroke actuation of probe 37 . since it is highly desirable to hold the workpiece with sufficient torque to prevent slipping under tool loads , without causing deflection from its out - of - round condition incident to excessive pressures , accurate adjustment of the hydraulic displacement is a critical feature of the disclosed arbor . any leakage from the unit would of course objectionably decrease the teflon shell actuation displacement defeating such accurate adjustment . accordingly the provision of lip seals 22 on relatively rigid ring portions 21 of teflon shell 20 , and the supplemental seal provided by press fit of both surfaces of extensions 23 with the rear and front shell retainers , also serve as a critically important function in the disclosed embodiment . the relative rigidity of the heavier ring sections 21 also contribute to stabilizing the effective axis of rotation of the workpiece against displacement or vibration which would be incident to a uniform thin section . the arbor may be completely assembled prior to filling with hydraulic fluid , preferably accomplished in a horizontal attitude with one of the adjustment screws 43 and plunger removed and rotated to a vertical axis position . air is bled out through bleeders 35 and 36 changing the attitude of the arbor to provide rising passages from all hydraulic chambers and by repeatedly cycling the probe to eliminate all air bubbles . displacement provided by stroke of the probe is calculated to expand the teflon shell from a relaxed state in which the workpiece may be placed over the arbor , with a slip non - deflecting fit against stop 27 , to an expanded position for holding the workpiece . initial tryout of such displacement may be made with the adjustment screws 43 and plungers 44 in a mid position after all air bleeding has been completed . initial cycling of probe 37 may take place without the workpiece in position measuring the expanded diameter for preliminary setting through adjustment screws 43 . with the workpiece in place , further cycling and adjustment will provide an accurate setting of required sleeve displacement and minimum pressure for dependably holding the workpiece without deflection in order to achieve the desired result of finishing its exterior surface to an accurate free state cylindrical surface .	8
hereinafter , drones with wind guide parts according to preferred embodiments of the present invention will be described in detail . fig2 is a view schematically illustrating a drone with a wind guide part according to a first preferred embodiment of the present invention , and fig3 is view schematically illustrating an interior of a body of the drone with the wind guide part according to the first preferred embodiment of the present invention . referring to fig2 and 3 , the drone 50 with the wind guide part 300 according to the preferred embodiment of the present invention is intended to lift off or aviate using the flow of wind , and includes a body 100 , an inlet unit 200 , wind guide parts 300 , and connecting ducts 400 . the body 100 includes a first body 102 that has a space to accommodate therein the inlet unit 200 that will be described below , and a second body 104 that covers an open bottom of the first body 102 . the first and second bodies 102 and 104 may be integrally or separately formed . an interior of the first body 102 is partitioned into a first accommodation part 110 located at an upper position and a second accommodation part 120 located at a lower position by a partition wall 115 . a top of the first accommodation part 110 is opened to form an inlet part 102 a . the inlet unit 200 includes an inlet fan 210 , an inlet motor 220 , and a battery 230 . the inlet fan 210 and the inlet motor 220 are accommodated in the first accommodation part 110 , while the battery 230 is accommodated in the second accommodation part 120 . further , a plurality of supports 112 is formed in the inlet part 102 a of the first accommodation part 110 to support the inlet fan 210 and thereby prevent it from being removed . if the inlet motor 220 rotates the inlet fan 210 using the power of the battery 230 , outside air flows through a space between the supports 112 into the first accommodation part 110 , so that air flow , namely , wind is generated . the wind moves to the connecting ducts 400 that will be described below . by controlling the rotating speed of the inlet fan 210 and adjusting the amount of wind supplied to the wind guide parts 300 that will be described below , the body 100 may be moved up or down . the wind guide parts 300 may be radially arranged along an outer circumference of the body 100 to be spaced apart from each other . a plurality of wind guide parts , for example , four wind guide parts may be provided . the connecting ducts 400 connect the body 100 with the wind guide parts 300 to render wind supplied to the body 100 to be moved to the wind guide parts 300 . the wind guide parts 300 and the connecting ducts 400 will be described in detail with reference to fig4 . fig4 is view schematically illustrating the connecting duct of the drone with the wind guide part according to the first preferred embodiment of the present invention , and fig5 is view schematically illustrating the wind guide part included in the drone with the wind guide part according to the first preferred embodiment of the present invention . referring to fig4 and 5 , a plurality of connecting ducts 400 is provided to correspond to the number of the wind guide parts 300 , and extends in a longitudinal direction to connect the body 100 with the wind guide parts 300 . the connecting duct 400 defines therein a connecting path 410 to allow wind to flow in the longitudinal direction , and the connecting path 410 is open at both ends thereof , so that the wind introduced into the first accommodation part 110 of the body 100 flows through the connecting path 410 to the wind guide part 300 . to this end , an outlet part 102 b is formed at a junction between the body 100 and the connecting duct 400 to allow wind from the body 100 to be discharged to the connecting path 410 . the wind guide part 300 receives wind from the connecting duct 400 and then discharges the wind to a lower position , and includes a supply part 312 that is connected with the connecting duct 400 to be supplied with the wind , a discharge part 326 that discharges the wind supplied to the supply part 312 , and a wind passage 350 that is formed between the supply part 312 and the discharge part 326 to allow wind to flow therethrough . in detail , the wind guide part 300 is formed in a ring shape , and includes an outer circumferential part 310 that is provided on an outer circumference thereof , an inner circumferential part 320 that is provided on an inner circumference thereof , an upper side part 330 that is provided on an upper portion between the outer circumferential part 310 and the inner circumferential part 320 , and a lower side part 340 that is provided on a lower portion between the outer circumferential part 310 and the inner circumferential part 320 . further , the supply part 312 is formed through a junction between the outer circumferential part 310 and the connecting duct 400 to communicate with the connecting duct 400 , the discharge part 326 is formed on the inner circumferential part 320 to face the ground , and the wind passage 350 is provided in a space between the outer circumferential part 310 and the inner circumferential part 320 . here , the inner circumferential part 320 includes a first inner circumferential part 322 formed in a direction from the upper side part 330 to the lower side part 340 , and a second inner circumferential part 324 formed in a direction from the lower side part 340 to the upper side part 330 , and an upper portion of the second inner circumferential part 324 extends inside the first inner circumferential part 322 . further , the discharge part 326 is formed at a position where the first inner circumferential part 322 faces the second inner circumferential part 324 . as such , while the wind supplied through the connecting duct 400 to the wind guide part 300 flows to the discharge part 326 , the wind flow direction is changed towards the ground , and the body 100 has a lift force by the wind discharged towards the discharge part 326 . thus , the body 100 may vertically lift off or aviate using the flow of the wind . meanwhile , the second inner circumferential part 324 may be formed to be inclined towards the outer circumferential part 310 , thus allowing wind to be obliquely discharged from the discharge part 326 according to an inclination angle of the second inner circumferential part 324 . further , the inclination angle of the second inner circumferential part 324 is formed such that it is closer to the outer circumferential part 310 , as the second inner circumferential part approaches the supply part 312 . as a result , the wind discharged from the discharge part 326 is discharged to flare out from the body 100 according to the inclination angle of the second inner circumferential part 324 , thus allowing the body 100 to be more stably moved up and down . further , a lower end of the first inner circumferential part 322 may be formed to be closer to the second inner circumferential part 324 , so that the discharge part 326 located between the first inner circumferential part 322 and the second inner circumferential part 324 is formed to be narrower towards the lower end of the first inner circumferential part 322 . thus , the speed of the air passing through the discharge part 326 is gradually increased , so that the body 100 has a stronger lift force . furthermore , the connecting duct 400 or the wind guide part 300 may be formed to be tiltable . to this end , a tilting unit ( not shown ) may be provided between the body 100 and the connecting duct 400 , or between the connecting duct 400 and the wind guide part 300 . the tilting unit is intended to adjust an angle of the connecting duct 400 or the wind guide part 300 using the rotation of a motor , for example . since the tilting unit configured to tilt a wing , a propeller , or the like in an aircraft , a drone , or the like is generally known to those skilled in the art , a detailed description thereof will be omitted herein . as such , if the connecting duct 400 or the wind guide part 300 is tilted , it is possible to control the flying direction of the body 100 in all directions . further , a gravity sensor or the like may be provided in the body 100 to convert a gradient for a gravity direction into an electrical signal , and a gyro sensor , an acceleration sensor , a geomagnetic sensor , or the like may be further provided . various sensing signals detected by these sensors are transmitted to a control part ( not shown ) that is provided in the body 100 , and a control part outputs a control signal to control the tilting unit or the inlet motor 220 of the inlet unit 200 based on the sensing signal , thus controlling the flying or posture of the body 100 . further , the control part may receive a manipulation signal that is transmitted wirelessly from a controller ( not shown ), which will be described below , and may output a control signal to control the tilting unit or the inlet motor 220 of the inlet unit 200 , thus controlling the flying or posture of the body 100 . here , the controller is configured to be manipulated by a user himself and wirelessly transmit the manipulation signal to the control part . since such a controller adopts a general configuration for remotely or automatically controlling the drone 50 , a detailed description thereof will be omitted herein . in the embodiment of the present invention , the discharge part 326 is configured to be formed on the inner circumferential part 320 of the wind guide part 300 . however , without being limited to such a configuration , the discharge part 326 may be formed on the outer circumferential part 310 to face downwards , or formed on the lower side part 340 . hereinafter , an operation of the drone with the wind guide part according to the first preferred embodiment of the present invention will be described . fig6 is view schematically illustrating the operation of the drone with the wind guide part according to the first preferred embodiment of the present invention , and fig7 is view schematically illustrating the flow of wind moved by the wind guide part of the drone with the wind guide part according to the first preferred embodiment of the present invention . referring to the drawings , in order to operate the drone 50 according to the preferred embodiment of the present invention , a user manipulates a controller ( not shown ), and the controller transmits the manipulation signal to the control part ( not shown ) provided in the body 100 . then , the control part controls the inlet motor 220 of the inlet unit 200 , thus rotating the inlet fan 210 . then , while the air outside the body 100 flows into the body 100 , the air flow , namely , the wind is generated . after the wind passes through the inlet unit 200 , the wind is supplied through the supply part 312 of the wind guide part 300 to the wind passage 350 of the wind guide part 300 . further , the wind supplied to the wind passage 350 is discharged through the discharge part 326 to a lower portion of the wind guide part 300 . at this time , the body 100 has a lift force , so that flying is possible . fig8 is a view schematically illustrating a drone with a wind guide part according to a second preferred embodiment of the present invention . referring to fig8 , the drone with the wind guide part according to the second preferred embodiment of the present invention is different from the first embodiment in terms of the discharge part 366 of a wind guide part 355 . that is , the wind guide part 355 receives wind from the connecting duct 400 ( see fig7 ) and then discharges the wind to a lower portion . the wind guide part includes a supply part 360 a that is connected with the connecting duct 400 to be supplied with wind , a discharge part 366 that discharges the wind supplied to the supply part 360 a , and a wind passage 380 that is formed between the supply part 360 a and the discharge part 366 to allow the wind to flow therethrough . in detail , the wind guide part 355 is formed in a ring shape , and includes an outer circumferential part 360 that is provided on an outer circumference thereof , an inner circumferential part 370 that is provided on an inner circumference thereof , an upper side part ( not shown ) that is provided on an upper portion between the outer circumferential part 360 and the inner circumferential part 370 , and a lower side part ( not shown ) that is provided on a lower portion between the outer circumferential part 360 and the inner circumferential part 370 . further , the supply part 360 a is formed through a junction between the outer circumferential part 360 and the connecting duct 400 to communicate with the connecting duct 400 , and the wind passage 380 is provided in a space between the outer circumferential part 360 and the inner circumferential part 370 . here , at a location where the supply part 360 a of the outer circumferential part 360 is not formed , a first outer circumferential part 362 formed from the upper side part to the lower side part , and a second outer circumferential part 364 formed from the lower side part to the upper side part are included . an upper portion of the second outer circumferential part 364 extends inside the first outer circumferential part 362 . further , the discharge part 366 is formed at a position where the first outer circumferential part 362 faces the second outer circumferential part 364 . further , while the wind supplied through the connecting duct 400 to the wind guide part 355 flows to the discharge part 366 , the wind flow direction is changed towards the ground . fig9 is a view schematically illustrating a drone with a wind guide part according to a third preferred embodiment of the present invention . referring to fig9 , the drone 50 with the wind guide part 300 according to the third preferred embodiment of the present invention is different from the first embodiment in the number of inlet units 201 , 202 , 203 , and 204 . that is , a plurality of inlet units 201 , 202 , 203 , and 204 is provided to correspond to a plurality of wind guide parts 300 that are radially arranged along the outer circumference of the body 100 . for example , if the number of the wind guide parts 300 is four , four inlet units 201 , 202 , 203 , and 204 may be correspondingly provided to supply wind to the respective wind guide parts 300 . in this regard , the interior of the body 100 is provided with a plurality of independent spaces ( not shown ), for example , four independent spaces , and the inlet units 201 , 202 , 203 , and 204 are provided in the spaces , respectively . further , inlet parts 102 a - 1 , 102 a - 2 , 102 a - 3 and 102 a - 4 are formed in upper portions of the spaces , respectively . each wind guide part 300 is located outside the corresponding space to be spaced apart therefrom , and each connecting duct 400 is connected between each space and each wind guide part 300 . thus , for example , if four inlet units 201 , 202 , 203 , and 204 are driven , outside air flows through four inlet parts 102 a - 1 , 102 a - 2 , 102 a - 3 , and 102 a - 4 to four connecting ducts 400 , respectively , and subsequently , four wind guide parts 300 , respectively . as such , since the present invention has a plurality of inlet units 201 , 202 , 203 , and 204 to supply wind to a plurality of wind guide parts 300 , each wind guide part 300 has the effect of stably discharging stronger wind to a lower position . although a preferred embodiment of the present invention has been described for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	1
the various embodiments described herein use heat dissipation characteristics of tissue to determine injection depth and / or tissue type . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the various embodiments . it will be apparent , however , to one skilled in the art that the various embodiments may be practiced without some of these specific details . the following description and the accompanying drawings provide examples for the purposes of illustration only . however , these examples should not be construed in a limiting sense as they are merely intended to provide exemplary embodiments , rather than to provide an exhaustive list of all possible implementations . referring now to fig1 , device 10 is shown which comprises cylindrical needle 12 having a lumen therethrough with opening 14 at a distal end to access a desired area within the body . among other functions , needle 12 can be used to deliver a substance , extract a substance , or otherwise used to puncture tissue . examples of substances that may be delivered include drugs , pharmaceutical agents , fluids , proteins , polypeptides , gene therapy material , cell therapy material , and deoxyribonucleic acid (“ dna ”). the dimensions of needle 12 will vary depending on the application . for instance , needle 12 can be designed for use with an intracardiac catheter to access a patient &# 39 ; s atria or ventricles of the heart via a patient &# 39 ; s vascular system , for use with an intravascular catheter to access a patient &# 39 ; s vascular system , for percutaneous use ( e . g ., puncturing the skin ), and for generally accessing blood - filled cavities and vessels ( e . g ., blood volumes ). specifically , if needle 12 is to be used with an intracardiac catheter , the outer diameter of needle 12 is preferably between 0 . 065 inches ( 16 gage ) and 0 . 013 inches ( 29 gage ). in this regard , the gage sizes of hypodermic needle stock are relatively standard in the industry and refer to the outer diameter of the needle . the inner diameter will vary depending on the wall type . for intravascular catheter use , needle 12 will preferably have an outer diameter between 0 . 032 inches ( 21 gage ) and 0 . 010 inches ( 31 gage ). for percutaneous use , needle 12 can be any size suitable for a particular insertion location and the type of material to be injected or withdrawn . however , the most useful size range of needle 12 for percutaneous use would have an outer diameter between 0 . 134 inches ( 10 gage ) and 0 . 009 inches ( 32 gage ). despite the given size ranges for each application , it is contemplated that sizes outside of the given ranges can be used . in addition , device 10 includes heating element 16 coupled to an exterior portion of needle 12 . heating element 16 will have approximately the same diameter size constraints as needle 12 listed above for each application . this is due to the fact that a heating element which has an outer diameter substantially larger than the outer diameter of the needle could create problems when inserting and extracting device 10 . regarding the length of heating element 16 , it is preferred that the length be between 0 . 010 inches and 0 . 400 inches . however , lengths outside of this range could also be used . in various embodiments , heating element 16 comprises material whose electrical resistance changes in response to a change in temperature . specifically , heating element 16 is constructed with a controlled temperature / resistance relationship . in various embodiments , heating element 16 is constructed of tungsten or platinum wire or a thin metallic film . these materials have a resistance which increases as the temperature increases . however , heating element 16 may be constructed of other materials such as those used in thermistors and other devices that exhibit changes in electrical resistance in response to a change in temperature . device 10 additionally includes first electrically conductive lead 20 electrically coupled to a first end of heating element 16 and second electrically conductive lead 22 electrically coupled to a second end of heating element 16 to serve as an interface with anemometry circuitry . in other embodiments , an alternative anemometry circuitry interface could be used . although anemometry circuits are generally used to measure flow rates of fluids , the various embodiments disclosed herein use anemometry circuitry to measure heat dissipation ( e . g ., flow of thermal energy ) from heating element 16 . although the embodiment shown utilizes cylindrical needle 12 to mount heating element 16 , other embodiments contemplate other elongate members ( that may be non - cylindrical ) so long as they are suitable for insertion into a body . for example , the elongate member could be a thin rod ( with or without opening 14 and with or without a sharpened distal end ). furthermore , opening 14 , if present , could be disposed more proximally on needle 12 , which would allow for heating element 16 to be disposed distal to opening 14 . such a configuration would advantageously provide for heat dissipation measurement in situations in which tissue just distal of the desired injection depth provides a more reliable or larger signal change / reading . fig1 depicts heating element 16 as a wire . the wire should be large enough to conduct a sufficient amount of current but small enough to be effectively mounted on needle 12 . it is worth noting that in various embodiments , heating element 16 can comprise at least one of a wire , a film , and a thermistor material . in one embodiment , heating element 16 has a length that is approximately equal to or less than the known thickness of a targeted tissue ( accounting for the tissue penetration angle of device 10 ) whose heat dissipation characteristics are to be measured by device 10 . embodiments which include this feature are able to more discretely measure heat dissipation characteristics and detect differences in such characteristics than embodiments with heating elements 16 which are longer and , therefore , have no penetration depth at which heating element 16 is surrounded by only the targeted tissue . in the embodiment shown in fig1 , heating element 16 is shown having a coil portion 18 wrapped around needle 12 with covering 24 disposed over coil portion 18 . covering 24 is adhered to needle 12 or formed as an integral part of needle 12 . covering 24 protects heating element 16 and provides for a smooth transition with the surface of needle 12 to make insertion of needle 12 into tissue easier and less traumatic . covering 24 can be made of a non - conductive material to insulate the patient from electrical current flowing through coil portion 18 . moreover , the wire that forms coil portion 18 may also be coated with an electrical insulator . thus , either or both methods of providing electrical insulation described herein may be used . fig1 shows heating element 16 as a coiled wire . other wire configurations are also suitable . for example , heating element 16 can be formed by placing the center of the wire near the distal end of heating element 16 and winding each end 20 and 22 in opposite directions around needle 12 towards the proximal end of needle 12 . alternatively , the wire may be wound in a zigzag pattern , proximally and distally , back and forth in a desired area . alternatively , heating element 16 can be formed by mounting the wire within a groove or a plurality of grooves formed within the surface of needle 12 . in addition to wire configurations , heating element 16 can be formed by sputtering a thin film of metal over a masked insulator ( masked to lay down the desired heating element metal configuration ), removing the mask , attaching the conductors , and coating the remaining metal connections with an insulator ( e . g ., a dielectric material ). moreover , a photo - etching process , similar to that used in the microelectronics industry , could be used to remove metal from needle 12 in the desired configuration . heating element 16 can be mounted on needle 12 such that distance 26 ( from the distal end of opening 14 to the proximal end of heating element 16 ) is substantially equivalent to a desired injection depth . heating element 16 may be enclosed or mounted on or in a suitable assembly , syringe , or catheter to aid in the insertion , advancement , orientation , and delivery of device 10 to the desired position within the body prior to injection . in addition , the proximal end of device 10 may be provided with suitable electrical connections to external circuitry and / or instrumentation ( not shown ) as well as fluid connections to force the injectant through device 10 . common catheter assemblies provide such connections . in various embodiments , needle 12 can be comprised of material which is not electrically conductive ( e . g ., ceramic ) or material which is electrically conductive ( e . g ., stainless steel ). it is worth noting that ceramic needles advantageously increase response time and sensitivity of heating element 16 due to the reduced thermal mass and thermal conductivity of ceramic . however , electrically conductive materials have electrical connection advantages , which can simplify device design . for instance , in embodiments in which a portion of needle 12 is electrically conductive , heating element 16 can be connected to anemometry circuitry by ( i ) first electrically conductive lead 20 electrically coupled to a first end of heating element 16 and ( ii ) a conductive portion of needle 12 coupled to a second end of heating element 16 . if a high thermal mass needle ( e . g ., stainless steel ) is used , a thermal insulator can be disposed between heating element 16 and needle 12 to minimize any reduction in response time and sensitivity of heating element 16 caused by needle 12 . regardless of the construction and materials used to construct heating element 16 , device 10 can have more than just a single heating element 16 , as shown in fig1 . for instance , if a plurality of heating elements 16 are mounted on needle 12 and operated separately and / or in groups , multiple penetration depths / tissue types can be controlled / identified . in addition , a single penetration depth can be more effectively controlled with an embodiment which utilizes a plurality of heating elements 16 . turning now to fig2 , an embodiment of anemometry circuitry is shown . in the embodiment shown , the anemometry circuitry is configured to measure the heat dissipation characteristics of an environment in which heating element 16 is disposed . the anemometry circuitry is electrically coupled to heating element 16 shown in fig1 . specifically , a first end of heating element 16 is electrically coupled to first junction 42 of bridge circuit 28 , and a second end of heating element 16 is electrically coupled to node 41 of bridge circuit 28 . fig2 is a simplified representation of a temperature controlled hot wire or hot film anemometer system . although there are many ways to operate an anemometer system ( e . g ., constant current or constant voltage ), temperature controlled is preferred because the various embodiments are intended to be used within the body . control over the temperature of heating element 16 can advantageously avoid tissue damage caused by temperature . in addition , signal level changes in response to the heat dissipation characteristics of the environment in which heating element 16 is disposed will be maximized . the anemometry circuitry shown in fig2 includes balancing bridge circuit 28 , controlled amplifier 30 , and signal amplifier 32 . although other designs and configurations for the circuitry could be used , this simplified representation is included for ease of discussion . bridge circuit 28 is comprised of heating element 16 , a system controlled variable resistor 34 and two fixed resistors 36 and 38 . heating element 16 acts as a resistor within bridge circuit 28 . bottom node 41 of bridge 28 is connected to ground ( e . g . 0 volts ). thus , when a voltage is applied at top node 40 of bridge 28 , current will flow through heating element 16 , causing a dissipation of power . due to the material and construction of heating element 16 , the dissipated power is dissipated as heat . the heat will raise the temperature of heating element 16 such that the temperature change will cause a change in the resistance of heating element 16 . for the sake of simplicity , it is assumed that fixed resistors 36 and 38 have the same resistance value . although this is not required , this assumption makes explanation of the anemometry circuitry easier to understand . as heating element 16 increases in temperature , the resistance of heating element 16 also increases , causing the voltage at first junction 42 ( between heating element 16 and resistor 36 ) to increase . thus , if variable resistor 34 has a resistance value adjusted by the circuitry to be equal to that of heating element 16 , then the voltage at second junction 44 ( between fixed resistor 38 and variable resistor 34 ) will be the same as at first junction 42 . when the voltages are equivalent , bridge circuit 28 is understood to be “ balanced ”. thus , once variable resistor 34 has been adjusted to have a resistance value equal to that of heating element 16 , any changes to the resistance of heating element 16 ( e . g ., caused by changes in temperature ) will cause the voltage at junction 42 to change in the direction of and roughly in proportion to the temperature change of heating element 16 . thus , the voltage at first junction 42 would be either higher or lower than the voltage at second junction 44 . amplifier 30 is electrically coupled to bridge circuit 28 to sense the difference in voltage drop across heating element 16 and variable resistor 34 caused by the difference between the resistance of heating element 16 and the resistance of variable resistor 34 . amplifier 30 receives power , from positive vsupply and is also coupled to ground . amplifier 30 compares the voltages of positive input 46 and negative input 48 . if positive input 46 is a higher voltage than negative input 48 , the positive difference between input 46 and input 48 is amplified and output through line 50 . it is worth noting that no voltage higher than positive vsupply will be seen at output 50 . if negative input 48 is equal to or higher than positive input 46 , then the voltage present at output 50 will be a low positive value ( e . g ., too low to cause significant heating of heating element 16 ). amplifier 30 is able to compare the input voltages since positive input 46 is connected to second junction 44 , and negative input 48 is connected to first junction 42 . output 50 of amplifier 30 is connected to top node 40 of bridge circuit 28 . focusing now on the interaction between amplifier 30 and bridge circuit 28 , it is assumed that bridge circuit 28 is initially in a balanced condition . thus , the voltage applied to top node 40 of bridge circuit 28 by output 50 of amplifier 30 is low , and heating element 16 is not being heated . also , the resistance of heating element 16 is equal to that of variable resistor 34 . if the anemometry circuitry system raises the resistance of variable resistor 34 , the voltage at junction 44 will exceed the voltage at junction 42 . this , in turn , creates a positive voltage difference between positive input 46 and negative input 48 . this positive voltage difference causes output 50 to dramatically rise in voltage . output 50 is applied to top node 40 of bridge circuit 28 , raising the current through heating element 16 , which causes the power ( e . g ., heat ) dissipated by heating element 16 to increase dramatically . the increase in heat dissipated by heating element 16 results in an increase in the temperature of heating element 16 . when the temperature of heating element 16 nearly reaches the temperature at which the resistance of heating element 16 is the same as that of variable resistor 34 , the voltages at junctions 42 and 44 will be very close to equal . in addition , output 50 applied to top node 40 of bridge circuit 28 will begin to drop until an equilibrium is reached . upon reaching this equilibrium , heating element 16 will be heated to a temperature that correlates to a resistance that is very close to that of variable resistor 34 . with high amplification factors in amplifier 30 , this resistance difference can be made to be negligible . since the resistance / temperature relationship of heating element 16 is known and heating element 16 now has the same resistance as variable resistor 34 , the temperature of heating element 16 is also known . thus , this interaction allows the temperature of heating element 16 to be set by adjusting the value of variable resistor 34 so long as positive vsupply can supply enough voltage / current to top node 40 of bridge circuit 28 to sufficiently heat heating element 16 to the desired temperature . it is worth noting that the desired temperature is above ambient temperature of heating element 16 and that output 50 is at some intermediate voltage value between the maximum and minimum values for which amplifier 30 is configured when heating element 16 is heated above the ambient temperature . thus , output 50 is directly related to the heat transfer environment of heating element 16 . if that environment carries heat away from heating element 16 rapidly , then output 50 will be a higher value than if that environment carries heat away more slowly . it is expected that these changes in output 50 may be small . thus , signal amplifier 32 is employed to increase the size of the change to a level suitable for an associated instrument ( not shown ) to sample , process , and display the measurements in a suitable manner . signal amplifier 32 operates similarly to controlled amplifier 30 . however , signal amplifier 32 is supplied with negative vsupply , instead of power supply ground . thus , output 56 may vary between the values of positive vsupply and negative vsupply in response to the voltage difference of inputs 52 and 54 . if positive input 52 is a higher voltage than negative input 54 , then the positive difference between the two inputs is amplified , and the amplified voltage is presented at output 56 . if positive input 52 is a lower voltage than negative input 54 , then the negative difference between the two inputs is amplified , and the amplified negative voltage is presented at output 56 . it is worth noting that the amplification factor for negative and positive differences is the same . negative input 54 is connected to wiper 58 of system controlled potentiometer 60 . potentiometer 60 is also connected to positive vsupply and power supply ground such that , as wiper 58 is adjusted , the voltage at wiper 58 will vary between zero and the voltage of positive vsupply . assuming that heating element 16 is maintained at a higher than ambient temperature , amplifier 32 behaves in the following manner . since voltage output 50 is connected to positive input 52 of amplifier 32 , input 52 is at some intermediate positive voltage level . the anemometry circuitry may then adjust wiper 58 such that negative input 54 is at or nearly at the same voltage as input 52 . thus , voltage output 56 of amplifier 32 will be approximately zero . however , if heating element 16 is moved to an environment that transfers heat more rapidly , positive input 52 ( from output 50 ) will exceed negative input 54 ( from wiper 58 ), and output 56 of amplifier 32 will increase a multiple of the actual increase seen at input 52 due to an amplification factor of amplifier 32 . if heating element 16 is moved to an environment that transfers heat less rapidly , positive input 52 will be less than negative input 54 , and output 56 of amplifier 32 will have a negative value which is a multiple of the actual decrease seen at input 52 . although anemometry circuitry is generally used to measure the flow velocity of fluid or gas , or , where the dimensions of the flow conduit are known or constant , to calculate flow rates , various embodiments described herein use the detected differences in the heat dissipation characteristics of different body tissues to determine injection depth and / or tissue type . it is worth noting that the embodiments disclosed herein should not be limited to measuring the heat dissipation characteristics of tissues since there are other materials within the body which are not generally considered tissues but will still have measurable heat dissipation characteristics . for instance , spinal fluid and amniotic fluid are not considered tissues but could have their respective heat dissipation characteristics measured to determine injection depth or material type . focusing now on exemplary heat dissipation characteristics of different materials , atheroma is a degenerative accumulation of lipid - containing plaque on the innermost layer of a wall of an artery . for heat dissipation purposes , atheroma is generally a waxy substance with no blood flow . if device 10 were inserted into a layer of atheroma , heating element 16 would only dissipate a negligible amount of heat . similarly , fat tissue does not have much blood flow , and therefore , heating element 16 inserted into fat tissue would experience a low heat dissipation rate . however , the same heating element 16 inserted into muscle tissue , which has substantial blood flow , would experience a high heat dissipation rate , and if heating element 16 were inserted into a moving blood stream , the heat dissipation rate experienced by heating element 16 would be extremely high . fig3 - 6 demonstrate how device 10 with a single heating element 16 can be used to control the depth of penetration of needle 12 into the wall of a coronary artery to desired penetration depth 26 . it is assumed that device 10 is inside a suitable catheter ( not shown ) at the desired location , that the catheter is a relatively good thermal insulator , that heating element 16 is being driven at a temperature above blood temperature , and that the anemometry circuitry which drives heating element 16 is connected to heating element 16 and properly configured . fig6 shows a graph of voltage output 56 of amplifier 32 versus time . before t 1 , heating element 16 is inside the catheter ( not shown ). since the catheter is assumed to be a relatively good thermal insulator , the drive voltage or current required to keep heating element 16 at a stable temperature is low . thus , output 56 of amplifier 32 is very negative . at time t 1 , device 10 is rapidly moved out of the catheter and into blood stream 62 of the artery ( fig3 ). blood stream 62 carries away heat at an extremely high rate , which cools heating element 16 mounted on device 10 rapidly . thus , output 56 rises rapidly to a maximum value and remains at the maximum value until t 2 , when heating element 16 has almost reached the set temperature ( or resistance ) again . at t 3 , bridge circuit 28 reaches equilibrium with the new heat dissipation environment of blood stream 62 . the line segment between t 3 and t 4 represents the new equilibrium level . this line segment is shown as a straight line for simplicity , but in reality , this line segment would have oscillations due to changes in the velocity of blood stream 62 relative to heating element 16 during the cardiac cycle . the line segment between t 4 and t 5 represents the smooth continuous insertion of heating element 16 into artery wall 64 ( fig4 ). since artery wall 64 will be composed of atheroma , muscle tissue , connective tissue , and other surrounding tissues with low heat flow characteristics , artery wall 64 will be a better thermal insulator than blood stream 62 . thus , output 56 will change in a negative direction until heating element 16 is completely within artery wall 64 at t 5 . fig5 shows device 10 inserted into artery wall 64 to desired penetration depth 26 . as discussed above , the line segment between t 4 and t 5 is , shown as a straight line for simplicity , but in fact , the line segment will have the same cardiac cycle bumps as the line segment between t 3 and t 4 . however , as more of heating element 16 is inserted into artery wall 64 , the amplitude of these cardiac bumps will decrease until heating element 16 is no longer in blood stream 62 . one drawback of the single heating element design is that if needle 12 were inserted further into artery wall 64 , there would be little change in output 56 to alert the user of the change in position . however , if second heating element 17 were mounted just proximal to first heating element 16 ( fig7 ), then desired penetration depth 26 could be more easily determined . assuming heating elements 16 and 17 are constructed in the same manner , desired penetration depth 26 would be located when the greatest difference in outputs 56 of each of the respective heating elements was observed . if needle 12 were further inserted into artery wall 64 , output 56 of heating element 17 would decline toward the value of output 56 for heating element 16 . conversely , if needle 12 were withdrawn from artery wall 64 , then output 56 of heating element 16 would increase toward the output 56 of heating element 17 . thus , multiple heating elements allow for monitoring the depth of penetration of needle 12 within relatively close limits relative to any tissue interface where the two interfacing tissues have sufficient difference in heat dissipation characteristics and thickness relative to the length of heating elements 16 and 17 to be detectable . as shown in fig7 , multiple heating elements can be constructed within a single heating element assembly . for example , in the embodiment shown , heating element 16 and heating element 17 are both disposed in covering 24 . in addition , only three electrical leads are required since each heating element has a separate bridge circuit 28 ( not shown ) connecting the heating element to ground ( node 41 in fig2 ). thus , heating element 16 and heating element 17 share a lead to ground . in embodiments which use needle 12 as a conductive lead , needle 12 can be used as the ground connection for all heating elements . the embodiments disclosed herein can be operated by much more complex and sophisticated circuitry and instrumentation to filter , process , and detect the differences in the heat dissipation characteristics of different tissue types . for example , the temperature of heating element 16 could be stepped in increments small enough to avoid saturating amplifier 30 toward or away from body temperature , using the rate of equilibrium establishment to differentiate tissue types or boundaries in a more rapid manner . it is to be understood that even though numerous characteristics and advantages of various embodiments have been set forth in the foregoing description together with details of structure and function of the various embodiments , this disclosure is illustrative only . changes may be made in detail , especially matters of structure and management of parts , without departing from the scope of the various embodiments as expressed by the broad general meaning of the terms of the appended claims .	0
referring initially to fig1 , 8 and 9 , two types of vehicle mounts according to this invention are shown . as discussed above , mounts for supporting portable items such as radar detectors , toll road transponders , gps devices , cellular telephones , cameras , change holders , garage door openers , pdas , radios and other devices have been designed for attachment to different locations on motorcycles and other vehicles . for purposes of illustration , a handlebar mount 10 is depicted in fig1 and a stem mount 12 is shown in fig9 . it should be understood that the following discussion applies to any type of vehicle mount for motorcycles and other vehicles , and is not intended to be limited to the mounts 10 and 12 . each of the mounts 10 and 12 comprises a device mounting plate 14 , an upper coupler 16 , a lower coupler 18 , a shaft 20 connected between the upper and lower couplers 16 , 18 , and , a vehicle mounting element 22 . the term “ vehicle mounting element ” as used herein is meant to broadly refer to any structure that secures the mount 10 or 12 to the motorcycle or other vehicle . in the case of the handlebar mount 10 shown in fig1 , the vehicle mounting element 22 comprises an upper clamp section 24 and a lower clamp section 26 which extend around the handlebar of a motorcycle ( not shown ) and are connected to one another by one or more bolts 28 . the vehicle mounting element 22 of the stem mount 12 comprises a rod 30 having a radially outwardly extending upper end 32 and an outer surface 34 that mounts three o - rings 36 , 38 and 40 . additional structure of the vehicle mounting elements 22 is described below . for purposes of the present discussion , the terms “ upper ,” “ lower ,” “ top ” and “ bottom ” refer to the orientation of the mounts 10 and 12 as depicted in fig1 and 9 . with reference to fig1 - 3 , the handlebar mount 10 is described in more detail . the device mounting plate 14 is generally rectangular - shaped formed with a number of device bores 42 arranged in a pattern that permits coupling to a number of different portable devices of the type noted above . such devices may include mounting structure such as threaded studs ( not shown ) extending from the bottom of the device through one or more of the device bores 42 to receive nuts ( not shown ) for mounting the device onto the plate 14 . three through bores 44 , 46 and 48 are formed near one end of the plate 14 , as shown , and have a chamfer 50 at the top surface 52 of the plate 14 . as best seen in fig2 , three anti - rotation pins 54 , 56 and 58 are connected to the bottom surface 60 of the plate 14 and extend outwardly therefrom . the pins 54 - 58 generally align with respective through bores 44 - 48 . the pins 54 - 58 may be formed of a material having a hardness greater or less than that of the upper coupler 16 , for purposes to become apparent below . the upper coupler 16 comprises a body portion 62 having an upper planar surface 64 , an outer surface 66 and a beveled surface 68 extending between the planar surface 64 and outer surface 66 . two spaced arms 70 and 72 extend downwardly from the body portion 62 to receive the upper end of shaft 20 which is coupled thereto by a bolt 74 . a number of blind holes 78 , each defining a cavity , are formed in the body portion 62 . the blind holes 78 are circumferentially spaced from one another and radially spaced from an internally threaded bore 80 located at the center of the upper planar surface 64 . the blind holes 78 and threaded bore 80 extend from the upper planar surface 64 of the body portion 62 in a downward direction toward the arms 70 , 72 . the device mounting plate 14 and upper coupler 16 are connected to one another by a bolt 82 preferably having a head with a countersunk recess 84 shaped to fit an allen wrench ( not shown ). as best seen in fig2 and 4 - 7 , the device mounting plate 14 and upper coupler 16 are oriented relative to one another such that the planar surface 64 of the upper coupler 16 rests against the bottom surface 60 of the device mounting plate 14 , with the internally threaded bore 80 in the upper pivot placed in alignment with one of the through bores 44 , 46 or 48 of the device mounting plate 14 and one of the anti - rotation pins 54 , 56 or 58 seated within one of the blind holes 78 . the bolt 82 is inserted through whichever through bore 44 , 46 or 48 is placed in alignment with the internally threaded bore 80 in the upper coupler 16 , and then tightened down . the head of the bolt 82 is tapered to fit within the chamfer 50 of the through bores 44 - 48 so that it is flush with the upper surface 52 of the device mounting plate 14 . the purpose of providing multiple through bores 46 - 48 in the device mounting plate 14 is to permit variation of its position relative to the upper coupler 16 and the rest of the mount 10 or 12 . depending upon the configuration of a particular motorcycle or other vehicle , and / or the preferences of the rider , it may be necessary to shift the position of the device mounting plate 14 to avoid an obstruction or to place an item carried on the mount 10 in a more convenient location for the rider . any one of the through bores 44 , 46 or 48 may be aligned with the internally threaded bore 80 of the upper coupler 16 , such as the middle bore 46 as shown in fig5 or the bore 48 as depicted in fig6 . in addition to side - to - side adjustment of the position of the device mounting plate 14 relative to the upper coupler 16 , as illustrated in fig5 and 6 , the device mounting plate 14 may be oriented at an angle with respect to the upper coupler 16 as shown in fig7 . the term “ angle ” in this context refers to the relationship between the longitudinal axis 84 of the device mounting plate 14 and an axis 86 that bisects the internally threaded bore 80 of the upper coupler 16 in between the two arms 70 and 72 . as viewed in fig5 , the axes 84 and 86 are essentially coincident with one another . in fig6 , the device mounting plate 16 has been moved toward one side of the upper coupler 16 , e . g . with the through bore 44 in alignment with the internally threaded bore 80 , but no “ angle ” is formed between the axes 84 and 86 because they are substantially parallel to one another . in both fig5 and 6 , the same blind hole 78 in the upper coupler 16 receives the middle anti - rotation pin 56 ( fig5 ) or the anti - rotation pin 54 ( fig6 ) located on the device mounting plate 14 . the device mounting plate 14 may be turned or oriented at an angle relative to the upper coupler 16 by aligning one of the anti - rotation pins 54 - 58 with a different blind hole 78 such that the axes 84 and 86 form an angle relative to one another . in fig7 , the middle anti - rotation pin 56 is illustrated as being located within a different blind hole 78 than the one in which it is seated in fig5 . in any case , the beveled surface 68 provides clearance between the upper coupler 16 and the anti - rotation pins 54 , 56 or 58 regardless of which one of the pins 54 - 58 is seated within any one of the blind holes 78 . a generally similar mounting arrangement is provided between the lower coupler 18 and the vehicle mounting element 22 . referring to the embodiment illustrated in fig1 and 3 , the lower coupler 18 comprises a body portion 88 having a planar surface 90 and a beveled surface 92 . two spaced arms 94 and 96 extend downwardly from the body portion 88 to receive the lower end of shaft 20 which is coupled thereto by a bolt 98 . a number of blind holes 100 , each defining a cavity , are formed in the body portion 88 . the blind holes 100 are circumferentially spaced from one another and radially spaced from a through bore 102 that passes through the body portion 88 at the center of the planar surface 90 . the blind holes 100 extend from the planar surface 90 of the body portion 88 in a direction toward the arms 94 , 96 . as noted above , the vehicle mounting element 22 of the handlebar mount 10 depicted in fig1 includes upper and lower clamp sections 24 and 26 . referring to the embodiment shown in fig3 , the upper clamp section 24 is formed with a planar surface 104 that rests against the planar surface 90 of the lower coupler 18 when the vehicle mounting element 22 and lower coupler 18 are assembled . an internally threaded bore 106 is centered in the upper clamp section 24 , extending from its planar surface 104 toward the lower clamp section 26 , and an anti - rotation pin 108 extends outwardly from the planar surface 104 of upper clamp section 24 in a position radially spaced from the internally threaded bore 106 . when assembled , the through bore 102 in the lower coupler 18 aligns with the internally threaded bore 106 in the upper clamp section 24 and the anti - rotation pin 108 of the upper clamp section 24 seats within one of the blind holes 100 in the lower coupler 18 . depending upon which blind hole 100 receives the anti - rotation pin 108 , the lower coupler 18 can be positioned at different angles relative to the vehicle mounting element 22 . an alternative embodiment of the lower coupler 18 and vehicle mounting element 22 is illustrated in fig1 . the structure of lower coupler 18 and vehicle mounting element 22 is the same as that shown in fig3 , except the position of the anti - rotation pin 108 and blind holes 100 is reversed . specifically , in fig1 an anti - rotation pin 109 is mounted on the planar surface 90 of the lower coupler 18 and a number of blind holes 101 are formed in the planar surface 104 of the upper clamp section 24 of the vehicle mounting element 22 . the blind holes 101 are circumferentially spaced from one another and radially spaced from the threaded bore 106 at the center of upper clamp section 24 of vehicle mounting element 22 . as seen in fig1 , the planar surface 104 of the upper clamp section 24 is wider than that of the embodiment depicted in fig1 and 3 in order to provide space for the blind holes 101 . when assembled , the anti - rotation pin 109 of the lower coupler 18 is received within one of the blind holes 101 in the vehicle mounting element 22 . the same lower coupler 18 shown in fig1 and 3 is employed in the stem mount 12 illustrated in fig9 , but , as noted above , the vehicle mounting element 22 has a different construction than in the embodiment of fig1 . in the presently preferred embodiment , as best seen in fig8 , the upper end 32 of the rod 30 forming the vehicle mounting element 22 is formed with a planar surface 110 which rests against the planar surface 90 of the lower coupler 18 when assembled . an internally threaded bore 112 is formed in the rod 30 , centered on its planar surface 110 , and an anti - rotation pin 114 extends outwardly from the planar surface 110 of the rod 30 in a position radially spaced from the internally threaded bore 112 . when assembled , the through bore 102 in the lower coupler 18 aligns with the internally threaded bore 112 in the rod 30 and the anti - rotation pin 114 of the rod 30 seats within one of the blind holes 100 in the lower coupler 18 . a bolt 116 is inserted through the through bore 102 in the lower coupler 18 and into the internally threaded bore 112 of the rod 30 to connect the lower coupler 18 to the vehicle mounting element 22 . depending upon which blind hole 100 receives the anti - rotation pin 114 , the lower coupler 18 can be positioned at different angles relative to the vehicle mounting element 22 . it should be understood that the location of anti - rotation pin 114 and blind holes 100 may be reversed in the lower coupler 18 employed with stem mount 12 , as in the embodiment shown in fig1 . in particular , the anti - rotation pin 114 may be formed on the planar surface 90 or lower coupler 18 and the planar surface 110 of the vehicle mounting element 22 may be formed with blind holes 100 . referring now to fig1 - 14 , an alternative embodiment of the vehicle mount 120 of this invention is illustrated . the vehicle mount 120 includes a device mounting plate 122 , an upper coupler 124 , a lower coupler 126 and a vehicle mounting element 128 . the device mounting plate 122 is shown as circular in fig1 , but it could be square , rectangular or another shape , as desired . the device mounting plate 122 is formed with a number of device bores 130 , and three through bores 132 , 134 and 136 each having a chamfer 138 . in the presently preferred embodiment , a number of through holes 140 are formed in the device mounting plate 122 which are circumferentially spaced from one another and radially spaced from the center through bore 134 . the upper coupler 124 has a generally l - shaped body potion 142 formed with a base section 144 and a leg section 146 oriented perpendicularly to one another . the base section 144 has a planar surface 148 formed with a central , internally threaded bore 150 and an anti - rotation pin 152 which is spaced from the bore 150 . the leg section 146 is formed with an internally threaded bore 154 , and an anti - rotation pin 156 extends outwardly from the surface 158 of leg section 146 . the device mounting plate 122 and upper coupler 124 are connected to one another by a bolt 160 which may be inserted into any one of the through bores 132 - 136 and then threaded into the threaded bore 150 in the upper coupler 124 . the anti - rotation pin 152 seats within one of the through holes 140 in the device mounting plate 122 . the positioning of the upper coupler 124 relative to the three through bores 132 - 136 , and rotation of the device mounting plate 122 relative to the upper coupler 124 , is the same as that described above in connection with a discussion of the embodiment of fig1 - 7 . as best seen in fig1 , the mount 120 differs from mounts 10 and 12 in that the shaft 20 is eliminated and the upper and lower couplers 124 , 126 are directly connected to one another . in the presently preferred embodiment , the lower coupler 126 has a generally l - shaped body portion formed with a base section 162 and a leg section 164 oriented perpendicularly to one another . the base section 162 is formed with a bottom surface 166 which mounts an extension 168 having a circumferential recess 170 . the leg section 164 of lower coupler 126 has a through bore 172 and a planar surface 174 formed with a number of inwardly extending blind holes 176 . the upper and lower couplers 124 , 126 are connected to one another by placing their respective leg sections 146 and 164 together such that the threaded bore 150 in the upper coupler 124 aligns with the through bore 172 in the lower coupler 126 and the anti - rotation pin 156 of the upper coupler 124 extends into one of the blind holes 174 in the lower coupler 126 . a bolt 178 is inserted through the bore 172 in the lower coupler 126 and then into the threaded bore 154 in the upper coupler 124 where it is tightened down . the vehicle mounting element 128 of the mount 120 includes an upper portion 175 connected to a lower portion 177 by bolts 179 . in the presently preferred embodiment , the upper portion 175 of mount 120 is formed with a slot 181 defining a first clamping section 180 and a second clamping section 182 that may be partially separated from one another . referring to fig1 and 14 , a through bore 184 is formed in the upper portion 175 of mount 120 , partially in the first clamping section 180 and partially in the second clamping section 182 , which , when the first and second clamping sections 180 , 182 are moved apart , receives the extension 168 of the lower coupler 126 . the bottom surface 166 of the lower coupler 126 rests atop a planar surface 186 , collectively formed by the first and second clamping sections 180 , 182 , with the extension 168 seated in the through bore 184 . a cross bore 188 is formed in the upper portion 175 of the vehicle mounting element 128 , comprising an unthreaded portion in the first clamping section 180 and a threaded portion in the second clamping section 182 . a bolt 190 is inserted through the unthreaded portion of cross bore 188 in first clamping section 180 and then into the threaded portion of cross bore 188 in the second clamping section 182 . as seen in fig1 , the bolt 190 extends within the recess 170 formed in the extension 168 when positioned within the cross bore 188 . the bolt 190 is tightened down to draw the first and second clamping sections 180 , 182 toward one another to clamp the extension 168 between them in order to secure the lower coupler 126 within the vehicle mounting element 128 . additionally , the bolt 190 is captured within the recess 170 formed in the extension 168 of the lower coupler 126 when inserted into the cross bore 188 to further secure the lower coupler 126 and vehicle mounting element 128 together . since the recess 170 extends about the entire circumference of the extension 168 , the lower coupler 126 may be rotated to any position relative to the vehicle mounting element , or vice versa , while retaining alignment between the cross bore 188 and recess 170 . referring now to fig1 - 18 , a still further embodiment of a mount 200 according to this invention is illustrated . mount 200 is similar in some respects to the mount 120 depicted in fig1 - 14 and the same reference numbers are used in fig1 - 18 to denote common structure . as viewed in fig1 and 15 , the vehicle mounting element 128 and lower coupler 126 are the same in both embodiments . the mount 200 , however , includes a different upper coupler 202 , a modified device mounting plate 120 and the addition of a spacer 204 . the upper coupler 202 has a body portion 206 formed with a slot 208 extending along one side thereof defining a first clamping section 210 and a second clamping section 212 . a bore 214 extends into the body portion 206 of the upper coupler 202 and is partially formed in both the first and second clamping sections 210 , 212 . the body portion 206 is also formed with a cross bore 216 which intersects the bore 214 and is generally perpendicular thereto . the cross bore 216 includes an unthreaded portion formed in the first clamping section 210 and a threaded portion formed in the second clamping section 212 which align with one another in order to receive a threaded fastener such as a bolt 222 . the body potion 206 of upper coupler 202 is joined to a leg section 224 having an internally threaded bore 226 , a surface 228 and an anti - rotation pin 230 extending outwardly from the surface 228 . as seen in fig1 , the upper coupler 202 is connected to the lower couplers 126 by placing their respective leg sections 224 and 164 together such that the threaded bore 226 in the upper coupler 202 aligns with the through bore 172 in the lower coupler 126 and the anti - rotation pin 230 of the upper coupler 202 extends into one of the blind holes 174 in the lower coupler 126 . a bolt 178 is inserted through the bore 172 in the lower coupler 126 and then into the threaded bore 226 in the upper coupler 202 where it is tightened down . the spacer 204 comprises a body portion 232 formed with an extension 234 having a circumferentially extending recess 236 . an internally threaded bore 238 extends inwardly from the surface 240 of the body portion 232 , and a cavity 242 is radially spaced from the bore 238 . the device mounting plate 122 depicted in fig1 and 13 is modified in the mount 200 of the embodiment of fig1 - 18 by eliminating the through holes 140 and replacing them with a single anti - rotation pin 244 which extends outwardly from the bottom surface 246 of device mounting plate 122 . in order to connect the spacer 204 to the device mounting plate 122 , the anti - rotation pin 244 is inserted into the cavity 242 and then a bolt 160 is extended through the center through bore 134 in the device mounting plate 122 into the internally threaded bore 238 in the spacer 204 where it is tightened down . the spacer 204 , in turn , is connected to the upper coupler 202 by inserting the extension 234 of the spacer 204 into the bore 214 formed in the body portion 206 of the upper coupler 202 . the first and second clamping sections 210 , 212 in the upper coupler 202 are then urged toward one another by tightening the bolt 222 within the cross bore 216 thus securing the extension 234 of the spacer 204 between them . one advantage of the mount 200 illustrated in fig1 - 18 is that adjustment of the position of a device relative to a vehicle ( not shown ) is made easier by the joint connections between the lower coupler 126 and device mounting element 128 , and between the device mounting plate 122 and upper coupler 202 via the spacer 204 . the bolt 190 which urges the first and second clamping sections 180 , 182 of the device mounting element 128 toward one another may be loosened within cross bore 188 so that the extension 168 of the lower coupler 126 may be rotated within the bore 184 of the device mounting element 128 to any desired position . similarly , the bolt 222 which connects the spacer 204 and upper coupler 202 may be loosened to permit rotation of the spacer 204 and device mounting plate 122 relative to the upper coupler 202 . unlike the embodiment of the mount 120 shown in fig1 - 14 , there is no need to disassemble the spacer 204 or upper coupler 202 from the device mounting plate 122 in order to rotate it from one position to another . instead , a device carried on the device mounting plate 122 may be positioned , as desired , with a quick loosening and then tightening of the bolt 222 . threaded connections are employed in the mounts 10 , 12 , 120 and 200 of this invention to connect the device mounting plates 14 and 122 to respective upper couplers 16 , 124 or 202 , to connect the vehicle mounting elements 22 and 128 to respective lower couplers 18 and 126 , and , to connect the upper couplers 124 or 202 and lower coupler 126 to one another . while these threaded connections are generally effective to secure such components together , it has been found that vibration and jarring applied to the mounts 10 , 12 , 120 and / or 200 during operation of a motorcycle or other vehicle can loosen such connections over time and cause relative rotation between one or more of the threaded connections discussed above . this potential problem of relative rotation is addressed by the provision of the anti - rotation pins 54 , 56 , 58 or 244 located on the device mounting plate 14 or 122 , the anti - rotation pin 108 of vehicle mounting element 22 , the anti - rotation pin 114 on the rod 30 , the anti - rotation pin 109 on the lower coupler 18 , and , the anti - rotation pins 152 , 156 and 230 on the upper coupler 124 or 202 . these anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 and 244 seat within respective blind holes 78 , 100 , 101 , 176 , 242 or within through holes 140 , as discussed above , to resist disengagement of the components of the mounts 10 , 12 , 120 and 200 even in the event of loosening of a threaded connection between them . another important feature of the anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 and 244 relates to the performance of the mounts 10 , 12 , 120 and 200 during an accident or other occasion when a severe force is applied to the mounts 10 , 12 , 120 or 200 and / or to the vehicle on which they are mounted . in one presently preferred embodiment , each of the device mounting plates 14 and 122 , the upper couplers 16 , 124 and 202 , the lower couplers 18 and 126 , and , the vehicle mounting elements 22 and 128 are made of a relatively soft material such as aluminum . the anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 and 244 , on the other hand , may be formed of a material that is harder than aluminum , such as steel , or of material having less hardness than aluminum . for purposes of the present discussion , the term “ hardness ” refers to the property of a metal which gives it the ability to resist permanent deformation , e . g . being bent , broken or undergoing a change in shape , in response to the application of a load . the greater the hardness of a metal , the more resistant it is to deformation . while the anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 and 244 function to resist rotation of components during normal operation of the mounts 10 , 12 , 120 and 200 , as described above , in response to the application of a severe force to the mounts 10 , 12 , 120 , 200 or to the vehicle that carries them , shearing occurs at the point of connection of the anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 or 244 to respective components 14 , 16 , 18 , 22 , 122 , 124 , 126 and 204 . if the pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 and 244 are formed of a material having a hardness greater than that of the components 14 , 16 , 18 , 22 , 122 , 126 and 204 , then shearing occurs in between the blind holes or cavities 78 , 100 , 101 , 124 , 176 and 242 , or between the through holes 140 . alternatively , if the hardness of the components 14 , 16 , 18 , 22 , 122 , 126 and 204 exceeds that of the anti - rotation pins 54 - 58 , 108 , 109 , 114 , 152 , 156 , 230 or 244 then they will shear off in response to the application of a force . in either case , relative rotation between respective device mounting plates 14 , 122 and upper couplers 16 , 124 , or 202 , between the vehicle mounting elements 22 , 128 and the lower couplers 18 , 126 , or 202 , 126 , and , between the upper and lower couplers 124 , 126 , is permitted to the extent that the bolts that connect them together are loosened by such force . in essence , at least some rotation of such components provides “ give ” in the mounts 10 , 12 , 120 and 200 so that a portable device carried by the device mounting plates 14 and 122 does not become a projectile during an accident . by allowing some “ give ” in the components of mounts 10 , 12 , 120 and 200 during an accident , the force applied to the portable device tends to allow at least a limited rotation of such device rather than causing it to fly off of the mount 10 , 12 , 120 and 200 potentially causing injury to the rider or others . while the invention has been described with reference to a preferred embodiment , it should be understood by those skilled in the art that various changes may be made and equivalents substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . for example , the upper and lower pivots 16 , 18 shown in the figs . are of the type that permit rotation about the axis of the bolts 74 and 98 that mount the shaft 20 to such pivots 16 , 18 . it should be understood that other types of pivots may be employed , including ball - and - socket type pivots or others that permit motion about multiple axes . additionally , in the embodiment of fig1 - 18 , a separate spacer 204 is illustrated having an extension 234 which is connected between the device mounting plate 122 and the upper coupler 202 . however , it is contemplated that the extension 234 could be formed on the device mounting plate 122 and the spacer 204 eliminated . therefore the device mounting plate 122 is considered to “ have ” an extension either as a result of it being connected to a spacer 204 formed with such extension , or where an extension is integrally formed on or directly connected to the device mounting plate 122 itself . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims .	1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.