text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
fig1 shows the hand - held device 10 being hand - held by a user . in this implementation the hand - held device 10 is part of a system which supplies power , control and dielectric fluid ( which may also be a coolant ) via the support unit 14 . flexible umbilical 16 interconnects the hand - held device 10 and the support unit 14 so that the hand - held device can be positioned as desired . according to some exemplary implementations , a hand - held device 10 is shown in side elevational view in fig2 . according to some exemplary implementations , a side view is shown in fig3 . as shown in the figures , a hand - held device 10 may be positioned to remove a fastener 18 which extends through one or more frames . as further shown in the figures , fastener 18 and fastener collar 24 secure one or more frames . as will be clear to those skilled in the art , any variety of fasteners and associated components may be the object upon which some exemplary implementations of the disclosed device and method may operate . fig4 a , 4 b , 5 a , 5 b , 6 a , 6 b , and 6 c shows a longitudinal section through a hand - held device 10 according to exemplary implementations . the principle structural reference part of the hand - held device 10 is the base 26 . the base may be maneuvered by handle 28 , which is secured thereto . the handle 28 may be configured to be held in the hand of the workman . various configurations may be provided to provide hand - held operation of the device 10 . according to some exemplary implementations , the handle 28 may carry a switch 30 to activate components of the hand - held device 10 , as disclosed herein . according to some exemplary implementations , mounted on a distal end of the base 26 is a hood 32 . the hood 32 defines a workspace , within which erosion activity may occur . the hood 32 may be configured to seal against a portion of a workpiece , such as a frame , thereby enclosing the workspace such that the workspace includes access to at least a portion of a fastener 18 , a collar 24 , or another workpiece . the portion enclosed may be at least one of the shank of fastener 18 , the head of fastener 18 , and the collar 24 . according to some exemplary implementations , as the hood 32 engages the workpiece , the hood 32 may be configured to enclose the workspace so as to substantially isolate it from the environment outside the workspace . accordingly , substances within the workspace may be contained except through controlled inlets and outlets , as disclosed herein . for example , at least a portion of the hood 32 may be of a flexible or deformable material that adaptably interfaces with the surface 20 of the workpiece to create a seal at the interface . there may be provided a rigid structure for stabilizing the hand - held device 10 against a workpiece , such as at the surface 20 , as shown in the figures . channels may be provided for passage of dielectric fluid there through . according to some exemplary implementations , hand - held device 10 may include a ground electrode 38 and erosion electrode 66 . the erosion electrode 66 may be configured to controllably approach a portion of a workpiece to be eroded , such as a fastener 18 or a collar 24 . a variety of electrode shapes , geometries , and morphologies may be provided for the erosion electrode 66 . electrode morphologies may be selected according to desired usage ( i . e . erosion results and application specific variables ). according to other exemplary implementations , aspects of which are shown in fig5 a , 5 b , 6 a , 6 b , and 6 c , the erosion electrode 66 may be a hollow tubular structure . in some instances aspects of one exemplary implementation may fit properly into another exemplary implementation . the hollow tubular structure of an erosion electrode 66 may be symmetrical about an axis and configured to travel longitudinally along the axis , thereby eroding a ring - shaped portion of the workpiece . this shape is useful for separating the head flange of a fastener 18 from the shank of the fastener 18 ( as shown in fig5 a and 5b ) or for eroding the interface 22 between the shank of a fastener 18 and a collar 24 ( as shown in fig6 a , 6 b , and 6 c ). where erosion of the frame is not desired , such erosion may be minimized or avoided by providing a hollow tubular erosion electrode 66 having an outer diameter that is about equal to or less than the outer diameter of the shank of the fastener 18 or the inner diameter of the hole of the frame . according to some exemplary implementations , an erosion electrode 66 having a hollow tubular structure may be further configured to rotate about its axis of symmetry as it advances longitudinally along the axis . the rotation of the hollow tubular structure helps reduce issues associated with uneven wear of the erosion electrode 66 at its distal end . an uneven electrode results in correspondingly uneven workpiece erosion . this corresponding erosion causes the uneven portions of the erosion electrode 66 to remain uneven , because the gap distance between the erosion electrode 66 and the workpiece ( the spark gap ) at each point is equal . when the device is applied to the next fastener , the uneven erosion electrode 66 will be attenuated since the “ high ” portions of the erosion electrode 66 will contact first , but will not be completely eliminated for multiple cycles . a rotating electrode will recover sooner than a non - rotating electrode . as the hollow tubular structure is rotated as it advances , the orientation of the uneven surface of the erosion electrode 66 is altered with respect to the correspondingly uneven workpiece . the changing relative orientation causes portions of the erosion electrode 66 that may have disproportionately greater extension to be moved into other locations of which may result in increased erosion activity , whereby the continued wear of the erosion electrode 66 is in some circumstances at least partially self - correcting in terms of providing an even erosion electrode 66 and an evenly eroded workpiece . according to some exemplary implementations , the erosion electrode 66 may be moved by translational motion and rotational motion . according to some exemplary implementations , the translational motion of the erosion electrode 66 may simultaneously create rotational motion . for example , a lead screw may be rotated to advance the erosion electrode 66 and simultaneously rotate it about an axis . according to some exemplary implementations , translational and rotational motion of the erosion electrode 66 may be applied independently , such that rotation and translation may be simultaneously or separately provided . according to some exemplary implementations , an erosion electrode 66 may be a solid pin configured to penetrate a fastener 18 as shown in fig4 a and 4b . this shape is useful for providing a pilot hole in the fastener 18 for subsequent mechanical drilling . such pilot holes help control operation of a mechanical drill by providing a non - slip location . this shape electrode is also useful for eroding a central portion of a head of the fastener 18 to allow removal of the flange from the shank ( not shown ). the pilot hole may be of any shape and cross - section ( for example square or triangular ) and may be used to extract a threaded fastener where a previous rotating method has been damaged or otherwise rendered ineffective . according to some exemplary implementations , an erosion electrode 66 may include a plurality of pointed electrode tips ( not shown ). the electrodes tips may be distributed equidistant from an axis and configured to rotate about the axis as they advance longitudinally along the axis . the resulting erosion of the workpiece is ring - shaped , similar to that resulting from the operation of a hollow tubular structure . according to some exemplary implementations , separate plasma control systems 86 may be provided for each of the plurality of pointed electrode tips . structure such as brushes may be provided to allow each of the pointed electrode tips to be charged by the corresponding plasma control systems 86 as it rotates about the axis . a plurality of power sources reduce the cycle time by enabling multiple simultaneous material erosion locations . according to some exemplary implementations , an erosion electrode 66 may be configured to erode and reduce a nub , burr , raised portion , or protrusion 36 , such as an end of a fastener threaded through a frame 21 and extending from a surface 20 , as shown in fig1 a . an erosion electrode 66 may be configured to target the protrusion 36 to bring it closer to even with the surface 20 from which it extends , as shown in fig1 c . for example , the erosion electrode 66 may have a substantially flat tip facing the surface 20 from which the protrusion 36 extends , as shown in fig1 a . as the erosion electrode 66 advances toward the workpiece , the protrusion 36 is eroded , as shown in fig1 b and 11c . further , a ground electrode 38 may be provided to complete a circuit across the spark gap between the erosion electrode 66 and the protrusion 36 . the ground electrode 38 may be in contact with a portion of the protrusion 36 ( not shown ) or another portion of the workpiece that is in electrical conduction with the protrusion 36 , such as a frame 21 . according to some exemplary implementations , an erosion electrode 66 approaching an uneven workpiece , such as a protrusion 36 , may tend to experience its own erosion . in such a situation , the portion of the erosion electrode 66 that is eroded corresponds to the portion at which plasma events are occurring , which is generally the portion closest to the workpiece . in the case of eroding a protrusion 36 , the wear on the erosion electrode 66 would be uneven , rendering the erosion electrode 66 unable to evenly reduce the protrusion 36 level with the surface 20 from which it extends because the tip of the erosion electrode 66 facing the workpiece surface 20 would no longer be flat . to reduce uneven wear on the erosion electrode 66 , the position of the erosion electrode 66 relative to the protrusion 36 may be altered during the process such that the locations of plasma events are distributed across the erosion electrode 66 . for example , the erosion electrode 66 may be rotated as it advances toward the protrusion . according to some exemplary implementations , the erosion electrode 66 may be rotated about an axis that passes through a portion of the protrusion 36 but does not pass through the center of the erosion electrode 66 , as shown in fig1 a , 11 b , 11 c , and 11 d . the result is that any given exposed portion of the protrusion 36 is acted upon by different portions of the erosion electrode 66 during rotation of the erosion electrode 66 . for example , a right side of the erosion electrode 66 is shown aligned with the center of the protrusion 36 in fig1 a , and a left side of the erosion electrode 66 is shown aligned with the center of the protrusion 36 in fig1 b . according to some exemplary implementations , other types of rotation may be applied or combined to distribute wear on the erosion electrode 66 , such as rotation about a central axis of the erosion electrode 66 . according to some exemplary implementations , the erosion electrode 66 may be provided with a dielectric inlet 54 provided by one or multiple a channels within and extending along the erosion electrode 66 , as shown in fig1 a , 11 b , 11 c , and 11 d . such a configuration allows dielectric fluid to be provided directly to the location of plasma events in the spark gap . a dielectric outlet 34 may be provided in fluid communication with the workspace . according to some exemplary implementations , configurations shown in fig1 a , 11 b , 11 c , and 11 d and disclosed herein may be used to erode beyond the outer surface 20 of a workpiece ( not shown ). in such instances a countersink , recess , well , or divot will result . according to some exemplary implementations , components may be provided to effectuate the advancement and retraction of erosion electrode 66 relative to the base 26 or the workpiece . according to some exemplary implementations , a motor 60 may be provided to affect the position of the erosion electrode 66 relative to the base 26 or the workpiece . for example , the motor 60 may be a linear motor or any motor adapted to effect linear motion . for example , a stepper motor may be used for the motor 60 . when the hand - held device 10 is provided to a workpiece , the position of the erosion electrode 66 relative to the base 26 may correspond to the position of the erosion electrode 66 to the workpiece . according to some exemplary implementations , a ground electrode 38 may be configured to contact at least a portion of the workpiece that is electrically conductive with another portion of the workpiece that is eroded by the erosion electrode 66 . for example , where portions of the head , flange , or shank of fastener 18 are to be eroded , the ground electrode 38 may be configured to contact a portion of the fastener 18 , such that a dielectric breakdown between the erosion electrode 66 and the fastener 18 may be achieved . according to some exemplary implementations , a ground electrode 38 may be any conductive structure configured to complete an electrical circuit when placed in electrical conduction with an erosion electrode 66 . for example , a ground electrode 38 may act as a “ floating ground .” a ground electrode 38 may have an applied charge that is in contrast to the charge applied to the erosion electrode 66 , whether or not the ground electrode 38 provides a zero voltage reference point . alternatively , a ground electrode 38 may be connected to “ earth ground ,” such that any charge from the erosion electrode 66 is drawn to the ground electrode 38 . according to some exemplary implementations , a ground electrode 38 may be disposed central to and concentric with a tubular erosion electrode 66 , as shown in fig5 a , 5 b , 6 a , 6 b , and 6 c . according to some exemplary implementations , a ground electrode 38 may be a hollow tubular structure having an erosion electrode 66 disposed therein , as shown in fig4 a and 4b . where conduction of electricity through the frames is not desired or required , electrical conductivity through the frames may be avoided by maintaining the ground electrode 38 in contact with the workpiece that is being eroded . for example , electrical charge may travel through from the erosion electrode 66 through the dielectric fluid to the fastener 18 . from there , it may travel directly to the ground electrode 38 rather than through the frame . coatings provided on the fastener 18 , the collar 24 , or the frames and other factors at the interfaces between these components may further inhibit inter - component conductivity . thereby , electrical activity in the frame or other undesired portions may be avoided , as well as other associated collateral issues . according to some exemplary implementations , and as shown in fig5 a , 5 b , 6 a , 6 b , and 6 c , the ground electrode 38 may be disposed concentrically within a hollow tubular structure of an erosion electrode 66 and configured to contact a central portion of the fastener 18 concentric with the erosion activity effectuated by the erosion electrode 66 . according to some exemplary implementations , to maintain this concentricity , a guide structure 70 may be provided , as shown in fig9 . a guide tube 72 is provided and is of an insulating material to serve as a buffer between the ground electrode 38 and the erosion electrode 66 . insulating bearings 80 may be provided within openings 76 along the guide tube 72 . the bearings 80 maintain an insulating separation between the ground electrode 38 and the erosion electrode 66 and facilitate relative longitudinal motion between the ground electrode 38 and the erosion electrode 66 . this configuration may be provided so as to maintain fluid communication for the dielectric fluid flow across the guide structure 70 . according to some exemplary implementations , a dielectric inlet 54 and dielectric outlet 34 are provided in fluid communication with the workspace defined by the hood 32 . according to some exemplary implementations , dielectric fluid may be provided to the workspace or the gap between the erosion electrode 66 and the workpiece by a variety of structures and methods . for example , the dielectric inlet 54 may provide targeted , high - velocity flow of the dielectric fluid directed to the spark gap between the erosion electrode 66 and the workpiece . according to some exemplary implementations , a dielectric inlet 54 is configured to provide a dielectric fluid to the gap between the erosion electrode 66 and the workpiece . according to some exemplary implementations , the dielectric inlet 54 may provide dielectric fluid along at least a portion of the erosion electrode 66 such that the dielectric fluid is delivered directly to the location of plasma events occurring at the end of the erosion electrode 66 . for example , where the erosion electrode 66 is a hollow tubular structure , the dielectric inlet 54 may provide the dielectric fluid within the hollow tubular structure , such that the dielectric fluid is drawn through the spark gap to reach a dielectric outlet 34 located outside the hollow tubular structure . where the erosion electrode 66 is disposed within a hollow tubular structure , the dielectric inlet 54 may likewise provide the dielectric fluid within the hollow tubular structure to the spark gap . those of ordinary skill in the art will recognize that the coolant fluid may in some instances be the dielectric fluid . in other cases , a dielectric fluid and a coolant fluid may be provided in sequence . for example , a coolant fluid may be provided after an erosion process has been completed . according to some exemplary implementations , a dielectric outlet 34 may be provided and configured to evacuate the dielectric fluid and other debris from the workspace . the dielectric outlet 34 may evacuate the dielectric fluid and other debris through a directed channel of flow , such as where the spark gap is disposed between the dielectric inlet 54 and the dielectric outlet 34 . according to some exemplary implementations , the dielectric outlet 34 may evacuate the dielectric fluid generally from the workspace defined by the hood 32 , wherein turbulence within the workspace provides opportunities for the dielectric fluid and other debris to be removed through the dielectric outlet 34 . according to some exemplary implementations , the flow of dielectric fluid may be facilitated by at least one of an inlet pump 92 connected to the dielectric inlet 54 and a drain pump 84 connected to the dielectric outlet 34 , as shown in fig8 . the inlet pump 92 may increase the velocity with which the dielectric fluid travels through the spark gap by applying a high pressure to the dielectric inlet 54 . the drain pump 84 may further increase the velocity with which the dielectric fluid travels through the spark gap by applying a low pressure to the dielectric outlet 34 . according to some exemplary implementations , the combination of an inlet pump 92 and a drain pump 84 provide high speed flushing of the spark gap , resulting in faster evacuation of debris that may otherwise adversely affect the performance of the erosion electrode 66 . for example , pressure provided by the inlet pump 92 in the range of up to about 80 psi provides improved erosion performance . pressure below 80 psi were shown to increase the time required to achieved erosion targets ( cycle time ). for example , a pressure of 60 psi approximately doubled cycle times for some workpiece materials . pressure may be provided up to levels that allow a seal with the workpiece to be maintained under operator forces / pressures such that the dielectric fluid is substantially contained within the workspace enclosed by a hood 32 while a user operates the hand - held device 10 . according to some exemplary implementations , the dielectric fluid provides the channel through which plasma events occur . for example , a sufficient voltage difference across the spark gap between the erosion electrode 66 and the workpiece may cause breakdown of the dielectric fluid and electrical conduction through the plasma that is formed thereby . the dielectric fluid may be of de - ionized water , oil , or other appropriate substances that are generally non - conductive . according to some exemplary implementations , the dielectric outlet 34 may evacuate debris removed from the workpiece during operation of the hand - held device 10 . the presence of debris between the erosion electrode 66 and the workpiece may adversely affect the operation of the hand - held device 10 by altering the nature of the materials in the gap . because the workpiece debris may be generally conductive material , its presence in the dielectric fluid may alter the environment of the fluid as a dielectric . large enough debris may provide a conductive bridge across the gap that prevents breakdown of the dielectric fluid and plasma formation . thus , the dielectric fluid may be provided with high flow rate to facilitate flushing of the debris . according to some exemplary implementations , the dielectric fluid may provide cooling for the components involved in the operation of hand - held device 10 . for example , the high energy states of plasma events occurring in the gap between the erosion electrode 66 and the workpiece may tend to heat the electrodes and / or workpiece . however , the cooling effect provided by the dielectric fluid may maintain the electrodes and / or workpiece at a temperature that improves safety and efficiency to the user . for example , after operation of the hand - held device 10 , the electrodes and / or workpiece may be immediately operated upon by a user without the danger of residual high temperatures in the workpiece . according to some exemplary implementations , the dielectric inlet 54 and the dielectric outlet 34 may be parts of a closed loop system that recycles dielectric fluid and isolates workpiece debris , as shown in fig8 . for example , the dielectric inlet 54 may deliver the dielectric fluid from a dielectric supply tank 56 to the workspace ; the dielectric fluid and debris may be evacuated from the workspace through the dielectric outlet 34 to a debris extraction zone , where the debris may be separated from the dielectric fluid ; and the dielectric fluid is returned to the dielectric inlet 54 . if de - ionized water is used as a dielectric fluid , the system may include a subsystem that re - establishes the de - ionized character of the dielectric fluid . according to some exemplary implementations , the debris separation zone may be within the hand - held device 10 or outside the hand - held device 10 to provide a more compact hand - held portion . for example , the dielectric inlet 54 and the dielectric outlet 34 may connect to the umbilical 16 to provide fluid communication to and from the support unit 14 , where the debris separation zone may be located . the debris separation zone may include a filter , sediment deposition portion , or other features to separate the debris from the dielectric fluid . for example , in a sediment deposition , the debris - laden dielectric fluid may be provided to a tank with low flow rate , giving the debris — having higher density than the dielectric fluid — an opportunity to collect at the bottom of the tank . the dielectric fluid may be taken from the portion above the collected debris and recycled to the dielectric inlet 54 . according to some exemplary implementations , the flow of dielectric fluid to the workspace may be controlled so as to occur when an appropriate seal is formed at the interface of the hood 32 and the workpiece . for example , the flow of dielectric fluid may be activated by the switch 30 operated by a user or other events that correspond to a time when the hand - held device 10 is prepared to flow the dielectric fluid . according to some exemplary implementations , the application of the ground electrode 38 against the workpiece may enable the flow of dielectric fluid . for example , the ground electrode 38 may be mounted to a ground tube 40 in fluid connection with the workspace . the ground tube 40 may be slideably disposed within a valve block 42 , as shown in fig1 . in an unactuated position , the ground tube 40 rests against valve ball 48 , which is resiliently held against the valve block 42 by valve compression spring 52 , thereby restricting flow of the dielectric fluid from the dielectric inlet 54 . when the ground electrode 38 is pressed against the workpiece , the ground electrode 38 and the ground tube 40 cause the valve ball 48 to slide away from the valve block 42 , thereby permitting flow from the dielectric inlet 54 to the workspace . accordingly , when the ground electrode 38 is removed from the workpiece , the spring 52 causes the valve ball 48 to restrict flow of the dielectric fluid . further , the configuration may automatically limit flow of the dielectric fluid if the portion of the workpiece contacted by the ground electrode 38 is removed , such as if a shank of a fastener were to slip out of the workspace . thus , flow of the dielectric fluid may be automated based on the status of the ground electrode 38 . according to some exemplary implementations , devices and methods for providing visual observation of the workspace during operation of the hand - held device 10 are disclosed . according to some exemplary implementations , an image sensor 94 is provided at or near the workspace enclosed by the hood 32 . for example , the image sensor may include a charge - coupled device ( ccd ), a complementary metal - oxide - semiconductor ( cmos ), another active - pixel sensor , or another device configured to capture images such as digital images . the image sensor 94 is configured capture an image or series of images corresponding to the interface between the hand - held device 10 and the workpiece . for example , the image sensor 94 may capture images of a fastener 18 including a projected point of contact with at least one of the ground electrode 38 and the erosion electrode 66 . the image sensor 94 may be connected to an aiming display 96 configured to provide a display of the image captured by the image sensor 94 . for example , a portion of the aiming display may be known to correspond to a location at which the ground electrode 38 or the erosion electrode 66 would contact the workpiece . accordingly , a user may properly position and orient components of the hand - held device 10 relative to the workpiece based on the visualization provided by the image sensor 94 and aiming display 96 . according to some exemplary implementations , a power supply 86 may provide electrical power to the hand - held device 10 during operation . the power supply 86 may be located within the support unit 14 in connection with the hand - held device 10 , or the power supply 86 may be located onboard the hand - held device 10 . the power supply 86 may provide power for operation of the motor 60 , the image sensor 94 , the aiming display 96 , the inlet pump 92 , the drain pump 84 , the erosion electrode 66 , or any other components operable with electrical power . according to some exemplary implementations , methods of operating a hand - held device 10 and removing fasteners 18 are disclosed herein . in use , a user brings the hand - held device 10 to a workpiece . the workpiece may include at least one of a fastener 18 , a collar 24 , and a protrusion . for example , the hand - held device may be brought to the head of a fastener 18 , the shank of a fastener 18 , or a collar 24 . the relationships between the dielectric pressure ( near the end of the electrode ) (“ v ”), the size of the spark gap (“ d ”), and the erosion power (“ p ”) across time during an exemplary implementation of a startup process are represented in the chart of fig1 . according to some exemplary implementations , the user engages the hood 32 onto a portion of the workpiece to create and maintain a seal enclosing a workspace . the drain pump 84 may cause a negative or relatively lower pressure to be created in the workspace to facilitate engagement of the hood 32 onto the workpiece . the negative or relatively lower pressure may also facilitate introduction of the dielectric fluid from the dielectric inlet 54 . this operation is demonstrated starting at point 1 in fig1 . according to some exemplary implementations , the hand - held device 10 is centered onto the workpiece . the centering may correspond to the location of the erosion electrode 66 or the ground electrode 38 relative to the workpiece to be eroded . for example , location of the hand - held device may determine the targeted path that the erosion electrode 66 will travel . a user may use the view captured by the image sensor 94 and shown on the aiming display 96 to position the hand - held device 10 relative to the workpiece . according to some exemplary implementations , the erosion electrode 66 is brought into contact with the portion of the workpiece to be eroded ; the ground electrode 38 is brought into contact with a portion of the workpiece that is in electrical conduction with the portion to be eroded ( see point 2 in fig1 ). the hand - held device 10 then verifies that a closed circuit is provided by the pathway through the workpiece from the erosion electrode 66 to the ground electrode 38 ( see point 3 in fig1 ). this step verifies that the workpiece is conductive from the portion to be eroded to the portion contacted by the ground electrode 38 . this step also verifies that the ground electrode 38 is in contact with the workpiece . other methods are contemplated to verify that the ground electrode 38 is in contact with the workpiece , such as a detectable limit on the advancement of the ground electrode 38 as it contacts the workpiece , or actuating sensors at the interface between the device and the workpiece . according to some exemplary implementations , the position of the erosion electrode 66 while it is in contact with the workpiece may be recorded and utilized as a calibration position from which the depth of cutting may be calculated . for example , the difference between ( 1 ) the position of the erosion electrode while contacting the workpiece during a calibration step and ( 2 ) the position at any given time during an erosion process may indicate the approximate depth of cutting at that given time . according to some exemplary implementations , the erosion electrode 66 is retracted a distance from the workpiece after contacting the workpiece ( see point 4 of fig1 ). the distance of retraction may be at least about the distance anticipated for a plasma event to occur in a spark gap . according to some exemplary implementations , flow of dielectric fluid is commenced into and out of the sealed and enclosed workspace , particularly through the spark gap . the dielectric fluid may be provided as a result of pressure provided from inlet pump 92 . for example , pressure provided may result in a controllable flow rate . the flow may be initiated according to a variety of events , as disclosed herein . for example , flow may be automatically initiated by the provision of the ground electrode 38 to the workpiece , as disclosed herein . flow may be initiated following verification that the proper conditions for plasma events are provided , as disclosed herein . according to some exemplary implementations , the erosion electrode 66 is advanced along an axis toward the workpiece . a voltage difference across the erosion electrode 66 and the workpiece is established ( see point 5 of fig1 ). the spark gap is narrowed until the dielectric fluid breaks down and a plasma is formed across the spark gap . the flow of dielectric fluid may be constricted as the spark gap narrows ( see point 6 of fig1 ). the resultant plasma event causes erosion of the workpiece near the erosion electrode 66 ( see point 7 of fig1 ). according to some exemplary implementations , the flow and pressure of dielectric fluid is stabilized at a positive value , to prevent in ingress of air into the workspace ( see point 7 of fig1 ). according to some exemplary implementations , the erosion electrode 66 is recharged and advanced to create a series of plasma events , thereby eroding the workpiece until the desired cut shape is achieved . according to some exemplary implementations , the advancement of the erosion electrode 66 may be determined by its position relative to the base 26 . for example , the motor 60 may advance the erosion electrode 66 relative to the base 26 . the advancement may be constant , preprogrammed , or manually controlled . according to some exemplary implementations , maintenance of the gap between the erosion electrode 66 and the workpiece may be maintained to avoid shorting , facilitate dielectric breakdown , generate plasma events , and remove material from the workpiece . as needed , the erosion electrode 66 may also be retracted from the workpiece to maintain an appropriate spark gap size between the erosion electrode 66 and the workpiece . for example , if the erosion electrode 66 contacts the workpiece and shorts the electrical circuit , then the erosion electrode 66 may be retracted . according to some exemplary implementations , operation of the hand - held device 10 as shown in fig4 a may provide a pilot hole as shown in fig4 b . according to some exemplary implementations , operation of the hand - held device 10 as shown in fig5 a may facilitate separation of a flange of a fastener 18 from a shank of a fastener 18 , as shown in fig5 b by eroding the shape of a recess 23 . according to some exemplary implementations , operation of the hand - held device 10 as shown in fig6 a and 6b may facilitate separation of a shank of a fastener 18 from a collar 24 at the interface 22 , as shown in fig6 c . according to some exemplary implementations , operation of the hand - held device 10 as shown in fig1 a and 11b may result in reduced exposure of a protrusion , as shown in fig1 c according to some exemplary implementations , the hand - held device 10 may deactivate some components based on the conditions sensed . for example , the lack of dielectric fluid flow may be sensed and cause the system to stop until remedied . according to some exemplary implementations , the hand - held device 10 may deactivate some components when a programmed process is completed . when the operation is complete , the user stops actuation of the switch 30 and removes the device 10 from the proximity of the workpiece . according to some exemplary implementations , deactivation of switch 30 may cause systems and components that are not yet deactivated to become deactivated . according to some exemplary implementations , removal permits the ground tube 40 to move forward and causes the valve ball 48 to prohibit flow from the dielectric inlet 54 . according to some exemplary implementations , the components of devices disclosed herein may be provided in any combination to accomplish desired functionality . likewise , operations of methods disclosed may be provided in any sequence or combination to achieve results as disclosed herein . while the method and agent have been described in terms of what are presently considered to be the most practical and preferred exemplary implementations , it is to be understood that the disclosure need not be limited to the disclosed exemplary implementations . it is intended to cover various modifications and similar arrangements included within the spirit and scope of the claims , the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structures . the present disclosure includes any and all exemplary implementations of the following claims . it should also be understood that a variety of changes may be made without departing from the essence of the invention . such changes are also implicitly included in the description . they still fall within the scope of this invention . it should be understood that this disclosure is intended to yield a patent covering numerous aspects of the invention both independently and as an overall system and in both method and apparatus modes . further , each of the various elements of the invention and claims may also be achieved in a variety of manners . this disclosure should be understood to encompass each such variation , be it a variation of an exemplary implementation of any apparatus implementation , a method or process implementation , or even merely a variation of any element of these . particularly , it should be understood that as the disclosure relates to elements of the invention , the words for each element may be expressed by equivalent apparatus terms or method terms — even if only the function or result is the same . such equivalent , broader , or even more generic terms should be considered to be encompassed in the description of each element or action . such terms can be substituted where desired to make explicit the implicitly broad coverage to which this invention is entitled . it should be understood that all actions may be expressed as a means for taking that action or as an element which causes that action . similarly , each physical element disclosed should be understood to encompass a disclosure of the action which that physical element facilitates . any patents , publications , or other references mentioned in this application for patent are hereby incorporated by reference . in addition , as to each term used it should be understood that unless its utilization in this application is inconsistent with such interpretation , common dictionary definitions should be understood as incorporated for each term and all definitions , alternative terms , and synonyms such as contained in at least one of a standard technical dictionary recognized by artisans and the random house webster &# 39 ; s unabridged dictionary , latest edition are hereby incorporated by reference . finally , all referenced listed in the information disclosure statement or other information statement filed with the application are hereby appended and hereby incorporated by reference ; however , as to each of the above , to the extent that such information or statements incorporated by reference might be considered inconsistent with the patenting of this / these invention ( s ), such statements are expressly not to be considered as made by the applicant ( s ). in this regard it should be understood that for practical reasons and so as to avoid adding potentially hundreds of claims , the applicant has presented claims with initial dependencies only . support should be understood to exist to the degree required under new matter laws — including but not limited to united states patent law 35 usc 132 or other such laws — to permit the addition of any of the various dependencies or other elements presented under one independent claim or concept as dependencies or elements under any other independent claim or concept . to the extent that insubstantial substitutes are made , to the extent that the applicant did not in fact draft any claim so as to literally encompass any particular exemplary implementation , and to the extent otherwise applicable , the applicant should not be understood to have in any way intended to or actually relinquished such coverage as the applicant simply may not have been able to anticipate all eventualities ; one skilled in the art , should not be reasonably expected to have drafted a claim that would have literally encompassed such alternative exemplary implementations . further , the use of the transitional phrase “ comprising ” is used to maintain the “ open - end ” claims herein , according to traditional claim interpretation . thus , unless the context requires otherwise , it should be understood that the term “ compromise ” or variations such as “ comprises ” or “ comprising ”, are intended to imply the inclusion of a stated element or step or group of elements or steps but not the exclusion of any other element or step or group of elements or steps . such terms should be interpreted in their most expansive forms so as to afford the applicant the broadest coverage legally permissible . | 1 |
referring to fig1 a fuel cell stack assembly is generally referred to by the number 2 . the assembly 2 includes a fuel cell stack 4 with reactant gas manifolds 6a , 6b , 8a , 8b covering each of the four surfaces of the stack . manifolds 6a , 6b are the fuel ( i . e ., hydrogen ) inlet and outlet manifolds , respectively ; and manifolds 8a , 8b are the oxidant ( i . e ., air ) inlet and outlet manifolds , respectively . the manifolds are held in sealing relationship to the faces of the stack 4 by a plurality of bands 10 . details of the fuel cell stack 4 are best shown in fig2 . each stack 4 is comprised of a plurality of fuel cells 12 separated by either a single , flat , gas impervious separator plate 14 , or by a coolant holder assembly 15 , which includes a separator plate 14 &# 39 ; which is identical to the separator plates 14 . the gas impervious plates 14 , 14 &# 39 ; may be made by any known method and of any material which is compatible with and can withstand the operating environment within the cell . if the fuel cell electrolyte is phosphoric acid these plates are usually made from graphite . for example they may be made by molding , under pressure , a dry mixture of graphite powder and thermosetting resin , the molded part subsequently being cured and then heat treated to a temperature of at least 2000 ° c . to graphitize the resin . preferably the plate is no greater than 50 mils thick with 30 to 35 mils thick being most preferred . in this exemplary embodiment the plates 14 , 14 &# 39 ; are 33 mils thick , about 20 inches long , and about 20 inches wide . the basic fuel cell construction is the same as that shown in and described in commonly owned u . s . pat . no . 4 , 115 , 627 which is incorporated herein by reference . each cell 12 includes a thin electrolyte retaining matrix layer 16 having an anode electrode 18 disposed on one side thereof and a cathode electrode 20 disposed on the other side thereof . phosphoric acid is the electrolyte , and the matrix layer 16 between the anode and cathode electrodes is preferably a 5 mil thick layer of silicon carbide with a binder such as polytetrafluoroethylene , as described in commonly owned u . s . pat . no . 4 , 017 , 664 . the anode and cathode electrodes each comprise an 80 mil thick fibrous gas porous substrate 22 , 24 , respectively . the anode substrate 22 includes a flat surface 26 which faces the matrix layer 16 , and has a plurality of parallel ribs 28 on the opposite surface . on the flat surface 26 of the substrate is disposed a thin layer of catalyst ( not shown ). the catalyst layer preferably has a thickness on the order of only 2 to 5 mils . the ribs 28 define parallel grooves 30 therebetween which extend across the cell interconnecting the manifolds 6a , 6b . the inlet manifold 6a feeds a gaseous fuel such as hydrogen into the grooves 30 . unreacted hydrogen and reaction products exit from the other ends of the grooves 30 into the outlet manifold 6b . the cathode electrodes 20 are similar in construction to the anode electrodes 18 . thus , on the flat surface 32 of the cathode substrate 24 is a thin layer of catalyst ; and on the opposite side of the cathode substrate 24 are ribs which define grooves 34 for carrying the oxidant across the cells from the air inlet manifold 8a to the outlet manifold 8b in a direction perpendicular to the fuel flow across the anode electrodes 18 . cooling is provided by passing a coolant fluid through the stack 4 in heat transfer relationship to the cells 12 which generate heat during operation . for this purpose a plurality of coolant holder assemblies , such as the assembly 15 shown in the drawing , are disposed between certain pairs of consecutive cells 12 in the stack 4 . the number of coolant holder assemblies needed will depend on numerous factors relating to the desired maximum temperatures within the stack and the required uniformity of temperatures throughout the stack . in this embodiment the stack has about 270 cells and there is a coolant holder assembly after every fifth cell . each coolant holder assembly 15 comprises a gas impervious separator plate 14 &# 39 ; resin bonded at its surface 36 , to a gas porous , fibrous cooler holder layer 40 . the coolant is carried in tubes 42 disposed in channels 44 machined into the cooler holder layer 40 . the channels 44 are parallel to the grooves 30 in the anode electrode 18 . in this embodiment various pairs of tubes 42 are actually opposite ends of the same tube . a tube passes through the cell in one channel 44 , makes a u - turn in the space formed by the outlet manifold 6b , and returns through a different channel 44 in the cell to the inlet manifold 6a . the &# 34 ; returning &# 34 ; tube ends are interconnected by a horizontal coolant inlet header 48 . all the inlet headers 48 are interconnected by a vertical feed tube 50 ; and the outlet headers 46 are interconnected by a vertical return tube ( not shown ). fresh coolant enters the vertical feed tube 50 at a main inlet 54 and is distributed to the inlet headers 48 . the coolant then passes through the coolant tubes 42 and picks up heat from the cells 12 . the heated coolant passes from the tubes 42 , to the outlet headers 46 , to the vertical return tubes and leaves the stack 4 via a main outlet 56 . in accordance with the present invention , the edge portions 58 , 60 and 61 of the holder layers 40 and the electrode substrates 22 , 24 , respectively are significantly more dense ( preferably two to three times more dense ) than the central portion of each component located between these edges . ( the central portions of the substrates 22 , 24 are the ribbed portions ; and the central portion of the holder layer 40 is the portion opposite the ribs of the adjacent substrate .) yet , the composition of the edge portions is substantially the same as the composition of the central portion of each component , which eliminates problems associated with different rates of thermal expansion . during operation of the stack these edge portions are saturated with electrolyte and act in the same manner as the &# 34 ; wet seals &# 34 ; described in commonly owned u . s . pat . no . 3 , 867 , 206 . thus they prevent , for example , fuel which is traveling through the anode substrate from passing into the oxidant manifolds 8a , 8b , and oxidant which is traveling through the cathode substrates from passing into the fuel manifolds 6a , 6b . they differ basically from the wet seals of the &# 39 ; 206 patent in that the edge seals of the present invention do not include an impregnation of material for the purpose of reducing the pore size . as an exemplary embodiment of the process of the present invention , consider the fabrication of the electrode substrate 22 . the substrate 22 is made from a blend of chopped carbon fibers and thermosetting resin . a blend of 30 % phenolic resin and 70 % carbon fibers , by weight , is preferred . referring to fig3 to fabricate the substrate a dry blend of phenolic resin and carbon fibers is placed into a compartmented hopper 100 . the hopper includes three compartments : edge seal compartments 102 , 104 and central portion compartment 106 . the bottom opening of each compartment is covered by a screen . the screens 108 , 110 under the edge seal compartments 102 , 104 have a larger mesh size than the screen 112 covering the bottom of the compartment 106 . as a conveyor belt 114 moves under the hopper 100 ( in a direction perpendicular to the plane of the drawing ) the hopper is vibrated and the material passes through the screen onto the conveyor belt at a uniform , preselected rate which is determined by the belt speed , screen mesh size , material characteristics , hopper vibration mode , and other factors . to build up a greater thickness of material along the edges , the mesh sizes of the screens 108 , 110 are selected such that the powder falls from the compartments 102 , 104 at twice the rate as from the compartment 106 . the result is what is herein referred to as an intermediate product 116 , which , in this embodiment , is a powder comprising carbon fibers and uncured resin wherein the edge portions 118 , 120 have been built up to a thickness twice as great as the thickness of the central portion 122 . the intermediate product 116 is then simultaneously densified and cured by hot pressing between flat platens ( rollers may also be used ) to the desired thickness of the central portion at a temperature between 150 ° and 175 ° c . the press is set to exert 100 psi pressure over the central portion ; due to the additional thickness along the edge portions , they receive a pressure of about 3000 psi . the edge portions 118 , 120 will have the same thickness but twice the density of the central portion 116 . the compacted , cured material is then further heated in an oven in steps up to about 2100 ° c . to first carbonize and ultimately fully graphitize the part . the reactant grooves 30 ( fig2 ) may then be machined into the substrate and a catalyst layer applied to the opposite surface . an alternate process for fabricating a fully graphitized gas porous , resin bonded carbon fiber sheet is described with reference to fig4 . this particular embodiment will also be described in connection with fabricating an electrode substrate , although a cooler holder could just as well be made by this process , or the previously described process . in this embodiment we start with an intermediate product 200 which is a gas porous sheet of thermosetting resin bonded carbon fibers which has been heated to the point where the resin has melted and bonded the structure to the extent it can be handled upon cooling , but the resin has not thermoset . its thickness t is already the desired thickness of the finished substrate , and its porosity is already the porosity desired in the central portion 204 of the finished substrate . the intermediate product 200 has a pair of edge portions 206 , 208 which are parallel to each other and perpendicular to the plane of the drawing . these edge portions are built - up by disposing strips 210 , 212 along the top surfaces 214 , 216 of the edge portions . the edge portions and strips are oriented so as to be parallel to the reactant gas grooves which will be formed in the part later . a light dusting of the same phenolic resin used to form the strips and the intermediate product 200 is optionally ( but preferably ) applied beneath the strips along the surfaces 214 and 216 to facilitate bonding . in the next step the strips 210 , 212 are laminated to the intermediate product 200 by the simultaneous application of heat and pressure . the part is placed in a preheated press to which approximately 3000 psi pressure is applied to the strips 210 , 212 in the direction of the arrows 218 for a period of 2 - 5 minutes . by the use of suitable shim stock , no pressure is applied to the central portion 204 of the intermediate product . the temperature used during compression should be sufficiently high to thermoset or fully cure the resin but not high enough to decompose it ; and the pressure and temperature should be applied for sufficient time to rigidize the structure . the compressed part is then carbonized and fully graphitized as in the manner of the preceding process described with respect to fig3 . the resulting product is shown in fig5 wherein reactant gas grooves 202 have been machined into the part . to form the substrate into a finished electrode a thin layer of electrocatalyst is applied to the bottom surface 220 in the area of the central portion 204 . photomicrographs of a cross section of edge portions made according to the just described process indicate that a tightly formed network of uniform pores are present . the table below presents gas leakage test data for a 75 mil thick electrode substrate having edge seals made in accordance with the prior art ( as represented by u . s . pat . no . 3 , 867 , 206 ) and edge seals made in accordance with the immediately preceding process . in the prior art process , silicon carbide was used as the impregnating material . ______________________________________gas leakage test date prior art process of process present invention cen - cen - tral edge seal tral edge seal portion portion portion portion______________________________________open porosity 75 % 64 . 4 % 75 % 49 . 5 % mean pore size ( microns ) 35 8 . 3 35 7 . 680 % pore size range ( microns ) 28 - 43 1 . 5 - 36 . 6 28 - 43 3 . 7 - 18 . 0gas leakage rate ( lbs n . sub . 2 / hr / inch ) -- 5 . 0 × 10 . sup .- 5 -- 0 . 6 × 10 . sup .- 5______________________________________ a stack of fuel cells analogous to the stack shown in fig2 was used in the tests . the edge seals were saturated with phosphoric acid , the sealing medium , which is also the cell electrolyte . the tests were run with nitrogen , rather than hydrogen ; and gas leakage was measured in terms of the number of pounds of nitrogen escaping per hour per inch of seal length . note that the present invention resulted in a gas leakage rate almost an order of magnitude less than that of the prior art . in an effort to understand this change in leakage rate , mean pore size and the 80 % pore size range of the samples were measured . ( 80 % pore size range is the range of pore sizes wherein 10 % of the pore volume is the result of pores larger than those within the range , and 10 % of the pore volume is the result of pores smaller than those within the range .) from the data it became apparent that the reduction in leakage rate over the prior art is attributable to a reduction in the number and size of the larger pores . that is , a high end of the 80 % pore size range was reduced from 36 . 6 microns to 18 . 0 microns . note that the mean pore size hardly changed at all ( i . e ., it was reduced from 8 . 3 to 7 . 6 microns ). based on this data it is estimated that the edge seals , to be highly effective , should have a mean pore size no greater than about 10 microns and an 80 % pore size range having an upper limit of about 20 microns . it should be understood that the invention is not limited to the particular embodiments shown and described herein , but that various changes and modifications may be made without departing from the spirit and scope of this novel concept as defined by the following claims . | 8 |
the following describes an embodiment of present invention with reference to the appended drawings . the present invention , however , is not limited to the embodiment described below . schematic configuration of fuel cell device according to one embodiment of present invention first , with reference to fig1 , a description is made of a schematic configuration of a fuel cell device according to one embodiment of the present invention . fig1 is a schematic diagram showing the schematic configuration of the fuel cell device according to the one embodiment of the present invention . a fuel cell device 1 according to the one embodiment of the present invention includes , as shown in fig1 , a fuel cell main body 10 and a temperature control unit 20 . in fig1 , the fuel cell main body 10 is shown in the form of a sectional schematic diagram , and the temperature control unit 20 is shown in the form of a block diagram . the fuel cell main body 10 has an electrolyte membrane 101 , a fuel electrode 102 , an air electrode 103 as an oxidant electrode , a hydrogen generating member 104 , a heater 105 , a temperature sensor 106 , and a cover member 107 . furthermore , the fuel cell main body 10 has an mea ( membrane electrode assembly ; membrane electrode bonded body ) structure in which the fuel electrode 102 and the air electrode 103 are bonded to both sides of the electrolyte membrane 101 , respectively . on a fuel electrode 102 side , the hydrogen generating member 104 that supplies hydrogen as a fuel gas to the fuel electrode 102 is provided , and on an air electrode 103 side , an air flow passage 108 for supplying air as an oxidant gas to the air electrode 103 is formed . while this embodiment uses air as an oxidant gas , it is also possible to use , as an oxidant gas , a gas containing oxygen other than air . as a material of the electrolyte membrane 101 , a solid oxide electrolyte using , for example , stabilized yttria zirconium ( ysz ) can be used , and a solid polymer electrolyte such as , for example , nafion ( a registered trademark of e . i . du pont de nemours & amp ; co ., inc . ), a cationic conductive polymer , or an anionic conductive polymer can also be used . there is , however , no limitation thereto , and any material can be used as long as it satisfies characteristics of an electrolyte of a fuel cell such as to allow passage of hydrogen ions therethrough , to allow passage of oxygen ions therethrough , or to allow passage of hydroxide ions therethrough . in this embodiment , as the electrolyte membrane 101 , there is used an electrolyte that allows passage of oxygen ions or hydroxide ions therethrough , for example , a solid oxide electrolyte using stabilized yttria zirconium ( ysz ), so that water is generated on the fuel electrode 102 side at the time of electric power generation . in this case , by a chemical reaction using water thus generated on the fuel electrode 102 side at the time of electric power generation , hydrogen can be generated from the hydrogen generating member 104 . the electrolyte membrane 101 , when made of a solid oxide electrolyte , can be formed by an electrochemical vapor deposition method ( cvd - evd method ; chemical vapor deposition - electrochemical vapor deposition ) or the like and , when made of a solid polymer electrolyte , can be formed by a coating method or the like . each of the fuel electrode 102 and the air electrode 103 can be made up of , for example , a catalyst layer that comes in contact with the electrolyte membrane 101 and a diffusion electrode that is stacked on the catalyst layer . as the catalyst layer , for example , carbon black supporting platinum black or a platinum alloy can be used . furthermore , as a material of the diffusion electrode of the fuel electrode 102 , for example , carbon paper , a ni — fe based cermet , or a ni — ysz based cermet can be used . furthermore , as a material of the diffusion electrode of the air electrode 103 , for example , carbon paper , a la — mn — o based compound , or a la — co — ce based compound can be used . each of the fuel electrode 102 and the air electrode 103 can be formed by , for example , a vapor deposition method . as the hydrogen generating member 104 , a material that generates hydrogen by oxidation ( for example , fe or a mg alloy ) can be used , and this embodiment uses fe that generates hydrogen by oxidation . furthermore , the hydrogen generating member 104 may be such that it not only generates hydrogen but also can store ( absorb ) hydrogen . in a case where the hydrogen generating member 104 can store ( absorb ) hydrogen , after the hydrogen generating member 104 generates hydrogen from itself , a storage ( absorption ) operation is performed , and thus the hydrogen generating member 104 can be used repeatedly . as a material that can store hydrogen as a fuel , a hydrogen storing alloy using ni , fe , pd , v , mg , or the like as a base material can be used . an emission surface 104 a of the hydrogen generating member 104 , from which hydrogen is emitted , and a supply surface 102 a of the fuel electrode 102 , to which hydrogen is supplied , are opposed to each other and disposed parallel to and at a given distance from each other via a spacer such as beads . the emission surface 104 a of the hydrogen generating member 104 is configured such that hydrogen is emitted in a planar form therefrom and is uniformly supplied to the supply surface 102 a of the fuel electrode 102 . specifically , by the heater 105 disposed in contact with all the surfaces ( exclusive of the emission surface 104 a ) of the hydrogen generating member 104 , the hydrogen generating member 104 as a whole is evenly heated to an increased temperature , so that hydrogen can be emitted in a planar form from the emission surface 104 a . thus , the hydrogen generating member 104 can emit hydrogen from substantially the entire area of the emission surface 104 a thereof toward substantially the entire area of the supply surface 102 a of the fuel electrode 102 . furthermore , desirably , a hydrogen generation rate of the hydrogen generating member 104 is set to be substantially constant regardless of locations on the emission surface 104 a . specifically , a thermochemical equilibrium is utilized . by raising and lowering the temperature of the hydrogen generating member 104 , hydrogen can be generated in such a manner as to correspond to a deviation from an equilibrium state . based on this , using the heater 105 , the temperature of the hydrogen generating member 104 as a whole is made uniform , and thus hydrogen can be generated at a constant rate regardless of locations . furthermore , in a case where a chemical equilibrium is utilized , a hydrogen concentration at cell start - up in a space portion 111 between the fuel electrode 102 and the hydrogen generating member 104 is preset to be constant regardless of locations , and thus the hydrogen generation rate of the hydrogen generating member 104 can be set to be constant . this is attributable to a phenomenon below . when the hydrogen concentration at cell start - up is constant regardless of locations , constant electric power is generated from the electrode . that is , a hydrogen consumption also becomes constant regardless of locations . in this case , there occurs a deviation in chemical equilibrium due to hydrogen consumed , and from the hydrogen generating member 104 , hydrogen is newly generated in such a manner as to correspond to an amount of the deviation . since the hydrogen consumption is constant regardless of locations , the rate at which hydrogen is generated from the hydrogen generating member 104 also becomes constant regardless of locations . as a method for setting the hydrogen concentration at cell start - up to be constant regardless of locations , hydrogen could be encapsulated in advance in the space portion 111 between the fuel electrode 102 and the hydrogen generating member 104 . hydrogen thus encapsulated diffuses spontaneously , and thus a concentration thereof in the space portion 111 in which it is encapsulated becomes constant , so that the hydrogen concentration can be set to be constant regardless of locations . by setting the hydrogen generation rate of the hydrogen generating member 104 to be substantially constant regardless of locations on the emission surface 104 a as described above , it is possible to suppress an output drop due to variations in electromotive force , and thus increased fuel efficiency can be provided . while in this embodiment , the emission surface 104 a of the hydrogen generating member 104 , from which hydrogen is emitted , and the supply surface 102 a of the fuel electrode 102 , to which hydrogen is supplied , are disposed parallel to and at a given distance from each other , a configuration may also be adopted in which the emission surface 104 a of the hydrogen generating member 104 , from which hydrogen is emitted , and the supply surface 102 a of the fuel electrode 102 , to which hydrogen is supplied , are superposed on and in tight contact with each other . this configuration can achieve a simplified structure and a size reduction of the fuel cell device . furthermore , while this embodiment uses a configuration in which the hydrogen generating member 104 is incorporated in the fuel cell main body 10 ( cover member 107 ), a configuration may also be adopted in which the hydrogen generating member 104 is provided outside the fuel cell main body 10 and is connected to the fuel cell main body 10 by way of a flow passage . the cover member 107 is a container for covering constituent components of the fuel cell main body 10 other than the cover member 107 , and on the air electrode 103 side thereof , an air supply port 109 for supplying air to the air flow passage 108 and an air discharge port 110 for discharging excess air are provided . furthermore , similarly , also on the air electrode 103 side of the heater 105 , the air supply port 109 and the air discharge port 110 are provided . air passed through the air supply port 109 to the air flow passage 108 is dispersedly supplied to the entire body of the air electrode 103 . each of the air supply port 109 and the air discharge port 110 is provided with an unshown opening / closing valve by which each of the air supply port 109 and the air discharge port 110 can be brought to a shut - off state . the temperature sensor 106 is constituted by , for example , a thermocouple and is disposed closely to the hydrogen generating member 104 in order to detect the temperature of the hydrogen generating member 104 . the fuel cell main body 10 is configured to generate electric power by an electrochemical reaction caused by supplying hydrogen from the hydrogen generating member 104 to the fuel electrode 102 and by supplying air from the air flow passage 108 to the air electrode 103 . furthermore , in this electric power generation operation , iron ( fe ) forming the hydrogen generating member 104 is oxidized to turn into an iron oxide ( fe 3 o 4 ), so that the proportion of iron ( fe ) in the hydrogen generating member 104 is gradually decreased . an electric power generation operation will be described later in more detail . furthermore , the temperature control unit 20 will also be detailed later . a reduction control portion 30 is configured to reduce and regenerate the hydrogen generating member 104 when in a state where oxidation thereof has progressed along with the proceeding of an electric power generation operation of the fuel cell main body 10 . specifically , using hydrogen ( h 2 ) generated by electrolysis of water ( h 2 o ) performed in the fuel cell main body 10 , which is generated in an electric power generation operation of the fuel cell main body 10 , the reduction control portion 30 makes the hydrogen ( h 2 ) react with the hydrogen generating member 104 in an oxidized state ( the hydrogen generating member 104 in a state where the proportion of an iron oxide ( fe 3 o 4 ) therein has been increased ) so as to reduce the hydrogen generating member 104 in an oxidized state . next , with reference to fig2 , a description is made in detail of an electric power generation operation and a regeneration ( reduction ) operation performed in the fuel cell device 1 according to the one embodiment of the present invention . in fig2 , parts identical to those in fig1 are indicated by identical reference signs . fig2 ( a ) to 2 ( d ) are schematic views showing a flow of an electric power generation operation and a regeneration operation performed in the fuel cell device 1 according to the one embodiment of the present invention . in an initial state before an electric power generation operation , as shown in fig2 ( a ), the air supply port 109 and the air discharge port 110 are both closed , and hydrogen ( h 2 ) is encapsulated in the space potion 111 of the fuel cell main body 10 . after that , as shown in fig2 ( b ), the air supply port 109 and the air discharge port 110 are opened , so that air is supplied to the air electrode 103 via the air flow passage 108 . then , at the fuel electrode 102 , there occurs a reaction between the hydrogen ( h 2 ) encapsulated in the space portion 111 and oxygen ions ( o 2 − ) resulting from ionization at the air electrode 103 and having passed through the electrolyte membrane 101 , which is expressed by a chemical reaction formula ( 1 ) below , so that electrons ( e − ) are generated and accumulated . that is , in the fuel cell main body 10 , an electromotive force is generated to start an electric power generation operation . in the electric power generation operation , when an external load 40 is connected between the fuel electrode 102 and the air electrode 103 , the electrons ( e − ) accumulated at the fuel electrode 102 flow to the air electrode 103 via the external load 40 . this enables driving of the external load 40 . furthermore , in the electric power generation operation , as shown by the above chemical reaction formula ( 1 ), water ( h 2 o ) is generated at the fuel electrode 102 . the water ( h 2 o ) generated is supplied to the hydrogen generating member 104 ( fe ) via the space portion 111 , and in the hydrogen generating member 104 ( fe ), there occurs an oxidation reaction with the water ( h 2 o ) supplied , which is expressed by a chemical reaction formula ( 2 ) below , resulting in the generation of hydrogen ( h 2 ). the hydrogen ( h 2 ) generated is supplied to the fuel electrode 102 via the space portion 111 , and at the fuel electrode 102 , the hydrogen ( h 2 ) supplied is oxidized to cause electric power generation , so that water ( h 2 o ) is again generated . these cyclical processes are followed , and thus an electric power generation operation is continuously performed . in the above - described electric power generation operation , in the hydrogen generating member 104 , iron ( fe ) is oxidized to turn into an iron oxide ( fe 3 o 4 ), so that the proportion of iron ( fe ) in the hydrogen generating member 104 is gradually decreased . furthermore , from the state of the electric power generation operation shown in fig2 ( b ), as shown in fig2 ( c ), the air supply port 109 and the air discharge port 110 are closed , so that the supply of air to the air electrode 103 is halted , and thus the electric power generation operation can be halted . at this time , water ( h 2 o ) and hydrogen ( h 2 ) generated by the reactions expressed by the above chemical reaction formulae ( 1 ) and ( 2 ), respectively , remain in the space portion 111 . from the state where the electric power generation operation is halted shown in fig2 ( c ), as shown in fig2 ( d ), the reduction control portion 30 performs energization by applying a voltage between the fuel electrode 102 and the air electrode 103 in the fuel cell main body 10 . then , at the fuel electrode 102 , there occurs electrolysis with the water ( h 2 o ) remaining in the space portion 111 and electrons ( e − ) supplied by the energization , which is expressed by a chemical reaction formula ( 3 ) below , resulting in the generation of hydrogen ( h 2 ). the hydrogen ( h 2 ) generated at the fuel electrode 102 is supplied to the hydrogen generating member 104 via the space portion 111 , and in the hydrogen generating member 104 , there occurs a reduction reaction with the hydrogen ( h 2 ) supplied , which is expressed by a chemical reaction formula ( 4 ) below . by the reduction reaction , an iron oxide ( fe 3 o 4 ) in the hydrogen generating member 104 is reduced to turn into iron ( fe ), so that the proportion of iron ( fe ) in the hydrogen generating member 104 is gradually increased , and thus the hydrogen generating member 104 is regenerated . furthermore , in the regeneration operation , as shown by the above chemical reaction formula ( 4 ), water ( h 2 o ) is generated in the hydrogen generating member 104 . the water ( h 2 o ) generated is supplied to the fuel electrode 102 via the space portion 111 , and at the fuel electrode 102 , electrolysis of the water ( h 2 o ) supplied is performed , so that hydrogen ( h 2 ) is again generated . these cyclical processes are followed , and thus a regeneration operation is continuously performed . next , with reference to fig1 , 3 , and 4 , a description is made in detail of a control operation of the temperature control unit 20 , which is carried out when the above - described electric power generation operation is performed . fig3 is a flow chart showing one example of the control operation of the temperature control unit 20 , and fig4 is a diagram showing timing for halting heater energization . the temperature control unit 20 has a temperature monitoring portion 201 , a judging portion 202 , an auxiliary electric power source 203 , and a switching portion 204 . based on an output signal of the temperature sensor 106 , the temperature monitoring portion 201 creates temperature information regarding the hydrogen generating member 104 and sends the information created to the judging portion 202 . in a case where the temperature sensor 106 is constituted by a thermocouple , the temperature monitoring portion 201 includes an a / d convertor that converts a voltage value from the thermocouple into a digital signal . the judging portion 202 is constituted by , for example , a microcomputer and , based on the temperature information regarding the hydrogen generating member 104 sent from the temperature monitoring portion 201 , performs on / off control of the switching portion 204 . when the switching portion 204 is in an on state , the auxiliary electric power source 203 and the heater 105 become electrically connected to each other , and thus the heater 105 is energized . on the other hand , when the switching portion 204 is in an off state , the auxiliary electric power source 203 and the heater 105 are electrically shut off from each other , and thus the heater 105 is de - energized . there is no particular limitation on the type of the auxiliary electric power source 203 . in a case , however , where the fuel cell device 1 according to the one embodiment of the present invention has a long electric power generating life , the auxiliary electric power source 203 may be configured to be replaceable and rechargeable so that it also has a long life . when the temperature control unit 20 starts the control operation , the switching portion 204 is brought to the on state ( step s 10 ). after that , the judging portion 202 acquires temperature information regarding the hydrogen generating member 104 sent from the temperature monitoring portion 201 ( step s 20 ) and judges whether or not the hydrogen generating member 104 is at a temperature not less than a predetermined temperature tp ( step s 30 ). the judging portion 202 , therefore , is designed to include a storage section ( for example , a nonvolatile memory ) that stores a set value of the predetermined temperature tp . if it is judged that the hydrogen generating member 104 is at a temperature not less than the predetermined temperature tp ( yes at step s 30 ), the judging portion 202 brings the switching portion 204 to the off state ( step s 40 ), after which the operational flow goes to step s 20 . on the other hand , if it is judged that the hydrogen generating member 104 is not at a temperature not less than the predetermined temperature tp ( no at step s 30 ), the judging portion 202 brings the switching portion 204 to the on state ( step s 10 ), after which the operational flow goes to step s 20 . the above - described control is performed , and thus when , as shown in fig4 , the temperature of the hydrogen generating member 104 reaches the predetermined temperature tp , energization of the heater 105 is halted . in a case where the hydrogen generating member 104 is made of fe , the temperature tp is set to , for example , 100 ° c . this point in time is used as heater energization halting timing t 1 . thereafter , an oxidation reaction ( heat generation reaction ) expressed by the above chemical reaction formula ( 2 ) progresses to cause the hydrogen generating member 104 to generate heat by itself , and a temperature ta is reached at which hydrogen is generated in an amount sufficient for the fuel cell main body 10 to generate desired electric power . that is , the predetermined temperature tp has been set so that , after the heater energization is halted at the predetermined temperature tp , due to the self - heat generation by the hydrogen generating member 104 , the temperature of the hydrogen generating member 104 reaches the temperature ta at which hydrogen is generated in an amount sufficient for the fuel cell main body 10 to generate desired electric power . when , due to the self - heat generation , the temperature of the hydrogen generating member 104 further reaches a temperature ts , a steady state is reached where the temperature is no longer increased . when , for various reasons , the temperature of the hydrogen generating member 104 that has once reached the temperature ta falls below the predetermined temperature tp , energization of the heater 105 is restarted . by the above - described control , energization of the heater 105 for heating the hydrogen generating member 104 to an increased temperature can be reduced to a minimum possible level , and thus the fuel cell device 1 according to the one embodiment of the present invention can achieve energy saving and provide increased electricity use efficiency . furthermore , in a case where electric power generation should be accelerated , for example , in a case where it is requested to obtain desired electric power as soon as possible , the predetermined temperature tp may be set to a higher set value so that a time required for energizing the heater 105 can vary . the following describes a modified example of this embodiment . in this embodiment , as the electrolyte membrane 101 , a solid oxide electrolyte is used , so that water is generated on the fuel electrode 102 side at the time of electric power generation . according to this configuration , water is generated on a side on which the hydrogen generating member 104 is provided , which is advantageous in achieving a simplified structure and a size reduction of the device . on the other hand , it is also possible to use , as the electrolyte membrane 101 , a solid polymer electrolyte that allows passage of hydrogen ions therethrough as in the fuel cell disclosed in jp - a - 2009 - 99491 . in this case , however , water is generated on the air electrode 103 side at the time of electric power generation , and , therefore , there could be provided a flow passage for conveying water thus generated to the hydrogen generating member 104 . 1 fuel cell device according to one embodiment of the present invention | 7 |
other than in the operating examples , or where otherwise indicated , all numbers expressing quantities of ingredients and / or reaction conditions are to be understood as being modified in all instances by the term “ about ”. as used herein , the expression “ at least one ” means one or more and thus includes individual components as well as mixtures / combinations . “ cosmetically acceptable ” means that the item in question is compatible with any keratinous substrate . for example , “ cosmetically acceptable carrier ” means a carrier that is compatible with any keratinous substrate . a “ physiologically acceptable medium ” means a medium which is not toxic and can be applied to the skin , lips , hair , scalp , lashes , brows , nails or any other cutaneous region of the body . the composition of the instant disclosure may especially constitute a cosmetic or dermatological composition . the term “ free of monohydric c 1 - c 3 alcohols ” as used herein means containing less than 2 % c 1 - c 3 alcohols based on the total weight of the composition . monohydric c 1 - c 3 alcohols include methanol , ethanol , and propanol . the term “ anhydrous ” as used herein means containing less than about 1 . 0 % water , based on the total weight of the composition . the term “ stable ” as used herein means that no phase separation was observed . conversely , the term “ unstable ” as used herein means that phase separation was observed when samples were subjected to a centrifugation at 1000 rpm for 60 minutes . suitable silicone polyether elastomers for use in the present invention are those that display an increased compatibility with various organic ingredients and provide stable thickening effects due to the presence of polyoxypropylene groups such as those disclosed in u . s . pat . no . 8 , 110 , 630 and u . s . patent application publication 2010 / 0330011 , the entire contents of which are hereby incorporated by reference . commercially available silicone polyether elastomers are commonly sold in gel form since they come blended with a solvent , and are thus about 10 - 30 % by weight active , based on the total weight of the gel . examples thereof include , but are not limited to , those having the inci names dimethicone / bis - isobutyl ppg - 20 crosspolymer ( and ) isododecane , sold under the tradename dow corning el - 8050 id silicone organic elastomer blend ®; dimethicone / bis - isobutyl ppg - 20 crosspolymer ( and ) isodecyl neopentanoate sold under the tradename dow corning el - 8051 in silicone organic elastomer blend ®; dimethicone / bis - isobutyl ppg - 20 crosspolymer ( and ) isohexadecane sold under the tradename dow corning el - 8052 ih silicone organic elastomer blend ®. the amount of silicone polyether elastomer present in the composition of the present invention is typically from about 0 . 1 % to about 10 % by weight , more preferably from about 1 % to about 8 % by weight , and most preferably from about 2 % to about 5 % by weight , all weights based on the total active weight of the composition . hydrogenated plant oils are produced by hydrogenation of plant oils . hydrogenation , complete or partial , is a chemical process in which hydrogen is added to liquid fats or oils to turn them into a solid form . hydrogenation converts carbon - carbon double - bonds to carbon - carbon single bonds . iodine value is used to determine the degree of carbon - carbon double bonds in fats and oils . iodine value is expressed in grams of iodine for the amount of halogens linked with 100 g test sample . the higher the iodine value , the more carbon - carbon double bonds are present in the fat or oil . suitable hydrogenated plant oils have an iodine value typically up to about 16 , more preferably up to about 14 , and most preferably up to about 12 . suitable specific examples of hydrogenated plant oils for use in the present invention include , but are not limited to , hydrogenated jojoba oil , hydrogenated castor oil , hydrogenated palm oil , hydrogenated coconut oil , hydrogenated olive oil , myristyl esters , as well as combinations thereof . surprisingly , not all hydrogenated plant oils work in the composition of the present invention . one example thereof includes hydrogenated vegetable oil which has been found to undergo phase separation during centrifuge testing yielding an “ unstable ” composition . the amount of hydrogenated plant oil present in the composition of the present invention is typically from about 0 . 1 % to about 10 %, more preferably from about 0 . 1 % to about 6 %, and most preferably from about 0 . 1 % to about 4 % by weight , all weights based on the total active weight of the composition . polar solvents are lipophilic compounds having , at 25 ° c ., a solubility parameter δ d characteristic of dispersive interactions of greater than 16 and a solubility parameter δ p characteristic of polar interactions strictly greater than 0 . the solubility parameters δ d and δ p are defined according to the hansen classification . the definition and calculation of the solubility parameters in the hansen three - dimensional solubility space are described in the paper by c . m . hansen : “ the three dimensional solubility parameters ”, j . paint technol . 39 , 105 ( 1967 ). examples of polar solvents that may be included in the present invention include , but are not limited to , esters , triglycerides and ethers . hydrocarbon - based polar oils such as phytostearyl esters , such as phytostearyl oleate , phytostearyl isostearate and lauroyl / octyldodecyl / phytostearyl glutamate ( ajinomoto , eldew ps203 ), triglycerides consisting of fatty acid esters of glycerol , in particular the fatty acids of which may have chain lengths ranging from c4 to c36 , and especially from c18 to c36 , these oils possibly being linear or branched , and saturated or unsaturated ; these oils may especially be heptanoic or octanoic triglycerides , wheatgerm oil , sunflower oil , grapeseed oil , sesame seed oil , corn oil , apricot oil , castor oil , shea oil , avocado oil , olive oil , soybean oil , sweet almond oil , palm oil , rapeseed oil , cottonseed oil , hazelnut oil , macadamia oil , jojoba oil , alfalfa oil , poppy oil , pumpkin oil , marrow oil , blackcurrant oil , evening primrose oil , millet oil , barley oil , quinoa oil , rye oil , safflower oil , candlenut oil , passionflower oil or musk rose oil ; shea butter ; or alternatively caprylic / capric acid triglycerides , for instance those sold by the company stéarineries dubois or those sold under the names miglyol 810 ®, 812 ® and 818 ® by the company dynamit nobel ; synthetic ethers containing from 10 to 40 carbon atoms , such as dicaprylyl ether ; hydrocarbon - based esters such as cetostearyl octanoate , isopropyl alcohol esters , such as isopropyl myristate or isopropyl palmitate , ethyl palmitate , 2 - ethylhexyl palmitate , isopropyl stearate or isostearate , isostearyl isostearate , octyl stearate , diisopropyl adipate , heptanoates , and especially isostearyl heptanoate , alcohol or polyalcohol octanoates , decanoates or ricinoleates , for instance propylene glycol dioctanoate , cetyl octanoate , tridecyl octanoate , 2 - ethylhexyl 4 - diheptanoate and palmitate , alkyl benzoate , polyethylene glycol diheptanoate , propylene glycol 2 - diethyl hexanoate , and mixtures thereof , c12 to c15 alkyl benzoates , phenethyl benzoate , hexyl laurate , neopentanoic acid esters , for instance isodecyl neopentanoate , isotridecyl neopentanoate , isostearyl neopentanoate and 2 - octyldodecyl neopentanoate , isononanoic acid esters , for instance isononyl isononanoate , isotridecyl isononanoate and octyl isononanoate , oleyl erucate , isopropyl lauroyl sarcosinate , diisopropyl sebacate , isocetyl stearate , isodecyl neopentanoate , isostearyl behenate , and myristyl myristate ; fatty alcohols containing from 12 to 26 carbon atoms , for instance octyldodecanol , 2 - butyloctanol , 2 - hexyldecanol , 2 - undecylpentadecanol and oleyl alcohol ; higher c12 - c22 fatty acids , such as oleic acid , linoleic acid and linolenic acid , and mixtures thereof ; fatty acids containing from 12 to 26 carbon atoms , for instance oleic acid ; dialkyl carbonates , the two alkyl chains possibly being identical or different , such as dicaprylyl carbonate sold under the name cetiol cc ® by cognis . the amount of polar solvent present in the composition of the present invention is typically from about 10 % to about 50 %, more preferably from about 15 % to about 45 %, and most preferably from about 20 % to about 40 % by weight , all weights based on the total active weight of the composition . the composition may also contain one or more volatile hydrocarbon - based oils . for the purposes of the invention , the term “ volatile oil ” means an oil that is capable of evaporating on contact with the skin or the keratin fiber in less than one hour , at room temperature and atmospheric pressure . the volatile oil ( s ) of the invention are volatile cosmetic oils , which are liquid at room temperature , having a non - zero vapor pressure at room temperature and atmospheric pressure , ranging in particular from 0 . 13 pa to 40 000 pa ( 10 - 3 to 300 mmhg ), in particular ranging from 1 . 3 pa to 13 000 pa ( 0 . 01 to 100 mmhg ) and more particularly ranging from 1 . 3 pa to 1300 pa ( 0 . 01 to 10 mmhg ). as volatile hydrocarbon - based oils that may be used according to the invention , mention may be made especially of hydrocarbon - based oils containing from 8 to 16 carbon atoms , and especially branched c8 - c16 alkanes such as c8 - c16 isoalkanes of petroleum origin ( also known as isoparaffins ), for instance isododecane ( also known as 2 , 2 , 4 , 4 , 6 - pentamethylheptane ), isodecane , isohexadecane , and the alkanes obtained from fatty alcohols sold under the trade name isopar or permethyl , branched c8 - c16 esters , isohexyl neopentanoate , and mixtures thereof . the amount of volatile hydrocarbon - based oils which may be present in the composition of the present invention is typically up to about 20 %, more preferably up to about 15 %, and most preferably up to about 10 % by weight , all weights based on the total active weight of the composition . the organic uv - screening agents are chosen especially from cinnamic derivatives ; anthranilates ; salicylic derivatives ; dibenzoylmethane derivatives ; camphor derivatives ; benzophenone derivatives ; β , β - diphenylacrylate derivatives ; triazine derivatives ; benzotriazole derivatives ; benzalmalonate derivatives , especially those cited in patent u . s . pat . no . 5 , 624 , 663 ; benzimidazole derivatives ; imidazolines ; bis - benzoazolyl derivatives as described in patents ep669323 and u . s . pat . no . 2 , 463 , 264 ; p - aminobenzoic acid ( paba ) derivatives ; methylene bis ( hydroxyphenylbenzotriazole ) derivatives as described in applications u . s . pat . no . 5 , 237 , 071 , u . s . pat . no . 5 , 166 , 355 , gb2303549 , de19726184 and ep893119 ; benzoxazole derivatives as described in patent applications ep0832642 , ep1027883 , ep1300137 and de10162844 ; screening polymers and screening silicones such as those described especially in patent application wo 93 / 04665 ; dimers derived from α - alkylstyrene such as those described in patent application de 19855649 ; 4 , 4 - diarylbutadienes such as those described in patent applications ep0967200 , de19746654 , de19755649 , ep - a - 1008586 , ep1133980 and ep1133981 , merocyanine derivatives such as those described in patent applications wo04 / 006878 , wo05 / 058269 and wo06 / 032741 ; and mixtures thereof . as examples of complementary organic photoprotective agents , mention may be made of those denoted hereinbelow under their inci name : ethylhexyl methoxycinnamate sold in particular under the trade name “ parsol ® mcx ” by dsm nutritional products , isopropyl methoxycinnamate , isoamyl methoxycinnamate sold under the trade name “ neo heliopan ® e 1000 ” by symrise , dea methoxycinnamate , diisopropyl methylcinnamate , glyceryl ethylhexanoate dimethoxycinnamate . butyl methoxydibenzoylmethane sold especially under the trade name “ parsol ® 1789 ” by dsm , isopropyl dibenzoylmethane . paba , ethyl paba , ethyl dihydroxypropyl paba , ethylhexyl dimethyl paba sold in particular under the name “ escalol ™ 507 ” by isp , glyceryl paba , peg - 25 paba sold under the name “ uvinul ® p25 ” by basf . homosalate sold under the name “ eusolex ® hms ” by rona / em industries , ethylhexyl salicylate sold under the name “ neo heliopan ® os ” by symrise , dipropylene glycol salicylate sold under the name “ dipsal ™” by scher , tea salicylate sold under the name “ neo heliopan ® ts ” by symrise . octocrylene sold in particular under the trade name “ uvinul ® n539 ” by basf , etocrylene sold in particular under the trade name “ uvinul ® n35 ” by basf . benzophenone - 1 sold under the trade name “ uvinul ® 400 ” by basf , benzophenone - 2 sold under the trade name “ uvinul ® d50 ” by basf , benzophenone - 3 or oxybenzone sold under the trade name “ uvinul ® m40 ” by basf , benzophenone - 4 sold under the trade name “ uvinul ® ms40 ” by basf , benzophenone - 5 , benzophenone - 6 sold under the trade name “ helisorb ® 11 ” by norquay , benzophenone - 8 sold under the trade name “ spectra - sorb uv - 24 ” by american cyanamid , benzophenone - 9 sold under the trade name “ uvinul ® ds - 49 ” by basf , benzophenone - 12 , n - hexyl 2 -( 4 - diethylamino - 2 - hydroxybenzoyl ) benzoate sold under the trade name “ uvinul ® a +” or as a mixture with octyl methoxycinnamate under the trade name “ uvinul ® a + b ” by basf . 3 - benzylidene camphor manufactured under the name “ mexoryl ™ sd ” by chimex , 4 - methylbenzylidene camphor sold under the name “ eusolex ® 6300 ” by merck , benzylidene camphor sulfonic acid manufactured under the name “ mexoryl ™ sl ” by chimex , camphor benzalkonium methosulfate manufactured under the name “ mexoryl ™ so ” by chimex , terephthalylidene dicamphor sulfonic acid manufactured under the name “ mexoryl ™ sx ” by chimex , polyacrylamidomethyl benzylidene camphor manufactured under the name “ mexoryl ™ sw ” by chimex . phenylbenzimidazole sulfonic acid sold in particular under the trade name “ eusolex ® 232 ” by merck , disodium phenyl dibenzimidazole tetrasulfonate sold under the trade name “ neo heliopan ® ap ” by symrise . drometrizole trisiloxane sold under the name “ silatrizole ” by rhodia chimie , methylene bis - benzotriazolyl tetramethylbutyl - phenol sold in solid form under the trade name “ mixxim bb / 100 ” by fairmount chemical , or in micronized form as an aqueous dispersion under the trade name “ tinosorb m ” by ciba specialty chemicals . bis - ethylhexyloxyphenol methoxyphenyl triazine sold under the trade name “ tinosorb ® s ” by basf , ethylhexyl triazone sold in particular under the trade name “ uvinul ® t150 ” by basf , diethylhexyl butamido triazone sold under the trade name “ uvasorb ® heb ” by sigma 3v , 2 , 4 , 6 - tris ( dineopentyl 4 ′- aminobenzalmalonate ) s - triazine , 2 , 4 , 6 - tris ( diisobutyl 4 ′- aminobenzalmalonate )- s - triazine , 2 , 4 - bis ( dineopentyl 4 ′- aminobenzalmalonate )- 6 -( n - butyl 4 ′- aminobenzoate )- s - triazine , symmetrical triazine screening agents described in patent u . s . pat . no . 6 , 225 , 467 , patent application wo 2004 / 085412 ( see compounds 6 and 9 ) or the document “ symmetrical triazine derivatives ” ip . com journal , ip . com inc ., west henrietta , n . y ., us ( 20 sep . 2004 ), especially 2 , 4 , 6 - tris ( biphenyl )- 1 , 3 , 5 - triazines ( in particular 2 , 4 , 6 - tris ( biphenyl - 4 - yl )- 1 , 3 , 5 - triazine and 2 , 4 , 6 - tris ( terphenyl )- 1 , 3 , 5 - triazine , which is included in patent applications wo 06 / 035000 , wo 06 / 034982 , wo 06 / 034991 , wo 06 / 035007 , wo 2006 / 034992 and wo 2006 / 034985 ). menthyl anthranilate sold under the trade name “ neo heliopan ® ma ” by symrise . polyorganosiloxane containing benzalmalonate functions , for instance polysilicone - 15 , sold under the trade name “ parsol ® slx ” by dsm nutritional products . 2 , 4 - bis [ 5 -( 1 - dimethylpropyl ) benzoxazol - 2 - yl -( 4 - phenyl ) imino ]- 6 -( 2 - ethylhexyl ) imino - 1 , 3 , 5 - triazine sold under the name uvasorb ® k2a by sigma 3v , and mixtures thereof . ethylhexyl methoxycinnamate , ethylhexyl salicylate , homosalate , butyl methoxydibenzoylmethane , octocrylene , phenylbenzimidazole sulfonic acid , benzophenone - 3 , benzophenone - 4 , benzophenone - 5 , n - hexyl 2 -( 4 - diethylamino - 2 - hydroxybenzoyl ) benzoate , 4 - methylbenzylidene camphor , terephthalylidene dicamphor sulfonic acid , disodium phenyl dibenzimidazole tetrasulfonate , methylene bis - benzotriazolyl tetramethylbutylphenol , bis - ethylhexyloxyphenol methoxyphenyl triazine , ethylhexyl triazone , diethylhexyl butamido triazone , 2 , 4 , 6 - tris ( dineopentyl 4 ′- aminobenzalmalonate )- s - triazine , 2 , 4 , 6 - tris ( diisobutyl 4 ′- aminobenzalmalonate )- s - triazine , 2 , 4 - bis ( dineopentyl 4 ′- aminobenzalmalonate )- 6 -( n - butyl 4 ′- aminobenzoate )- s - triazine , 2 , 4 , 6 - tris ( biphenyl - 4 - yl )- 1 , 3 , 5 - triazine , 2 , 4 , 6 - tris ( terphenyl )- 1 , 3 , 5 - triazine , drometrizole trisiloxane , polysilicone - 15 , 1 , 1 - dicarboxy ( 2 , 2 ′- dimethylpropyl )- 4 , 4 - diphenylbutadiene , 2 , 4 - bis [ 5 - 1 ( dimethylpropyl ) benzoxazol - 2 - yl -( 4 - phenyl ) imino ]- 6 -( 2 - ethylhexyl ) imino - 1 , 3 , 5 - triazine , and mixtures thereof . the inorganic uv screening agents used in accordance with the present invention are metal oxide pigments . more preferentially the inorganic uv screening agents of the invention are metal oxide particles having a mean elementary particle size of less than or equal to 500 nm , more preferably of between 5 nm and 500 nm and more preferably still of between 10 nm and 100 nm , and preferably between 15 nm and 50 nm . they may be selected especially from titanium oxides , zinc oxides , iron oxides , zirconium oxides , cerium oxides or mixtures thereof . such coated or uncoated metal oxide pigments are described in particular in the patent application ep - a - 0 518 773 . commercial pigments that may be mentioned include the products sold by the companies kemira , tayca , merck and degussa . the coated pigments are pigments that have undergone one or more surface treatments of chemical , electronic , mechanochemical and / or mechanical nature with compounds such as amino acids , beeswax , fatty acids , fatty alcohols , anionic surfactants , lecithins , sodium , potassium , zinc , iron or aluminium salts of fatty acids , metal alkoxides ( of titanium or of aluminium ), polyethylene , silicones , proteins ( collagen , elastin ), alkanolamines , silicon oxides , metal oxides or sodium hexametaphosphate . the coated pigments are more particularly titanium oxides that have been coated : with silica and iron oxide , such as the product “ sunveil f ” from the company ikeda , with silica and alumina , such as the products “ microtitanium dioxide mt 500 sa ” and “ microtitanium dioxide mt 100 sa ” from the company tayca and “ tioveil ™” from the company tioxide , with alumina , such as the products “ tipaque tto - 55 ( b )” and “ tipaque tto - 55 ( a )” from the company ishihara and “ uvt 14 / 4 ” from the company kemira , with alumina and aluminium stearate , such as the products “ microtitanium dioxide mt 100 t , mt 100 tx , mt 100 z and mt - 01 ” from the company tayca , the products “ solaveil ™ ct - 10 w ” and “ solaveil ™ ct 100 ”, from the company uniqema and the product “ eusolex ® t - avo ” from the company merck , with silica , alumina and alginic acid , such as the product “ mt - 100 aq ” from the company tayca , with alumina and aluminium laurate , such as the product “ microtitanium dioxide mt 100 s ” from the company tayca , with iron oxide and iron stearate , such as the product “ microtitanium dioxide mt 100 f ” from the company tayca , with zinc oxide and zinc stearate , such as the product “ br 351 ” from the company tayca , with silica and alumina and treated with a silicone , such as the products “ microtitanium dioxide mt 600 sas ”, “ microtitanium dioxide mt 500 sas ” or “ microtitanium dioxide mt 100 sas ” from the company tayca , with silica , alumina and aluminium stearate and treated with a silicone , such as the product “ stt - 30 - ds ” from the company titan kogyo , with silica and treated with a silicone , such as the product “ uv - titan x 195 ” from the company kemira , with alumina and treated with a silicone , such as the products “ tipaque tto - 55 ( s )” from the company ishihara or “ uv titan m 262 ” from the company kemira , with triethanolamine , such as the product “ stt - 65 - s ” from the company titan kogyo , with stearic acid , such as the product “ tipaque tto - 55 ( c )” from the company ishihara , with sodium hexametaphosphate , such as the product “ microtitanium dioxide mt 150 w ” from the company tayca . tio2 treated with octyltrimethylsilane sold under the trade name “ t 805 ” by the company degussa silices , tio2 treated with a polydimethylsiloxane sold under the trade name “ 70250 cardre uf tio2s13 ” by the company cardre , anatase / rutile tio2 treated with a polydimethylhydrogenosiloxane sold under the trade name “ microtitanium dioxide usp grade hydrophobic ” by the company color techniques . the uncoated titanium oxide pigments are sold , for example , by the company tayca under the trade names “ microtitanium dioxide mt 500 b ” or “ microtitanium dioxide mt 600 b ”, by the company degussa under the name “ p 25 ”, by the company wackher under the name “ transparent titanium oxide pw ”, by the company miyoshi kasei under the name “ uftr ”, by the company tomen under the name “ its ” and by the company tioxide under the name “ tioveil ™ aq ”. those sold under the name “ nanogard ™ wcd 2025 ” by the company nanophase technologies . those sold under the name “ zinc oxide cs - 5 ” by the company toshibi ( zno coated with polymethylhydrogensiloxane ); those sold under the name “ nanogard ™ zinc oxide fn ” by the company nanophase technologies ( as a 40 % dispersion in finsolv ® tn , c12 - c15 alkyl benzoate ); those sold under the name “ daitopersion zn - 30 ” and “ daitopersion zn - 50 ” by the company daito ( dispersions in cyclopolymethylsiloxane / oxyethylenated polydimethylsiloxane , containing 30 % or 50 % of nanozinc oxides coated with silica and polymethylhydrogensiloxane ); those sold under the name “ nfd ultrafine zno ” by the company daikin ( zno coated with perfluoroalkyl phosphate and copolymer based on perfluoroalkylethyl as a dispersion in cyclopentasiloxane ); those sold under the name “ spd - z1 ” by the company shin - etsu ( zno coated with silicone - grafted acrylic polymer , dispersed in cyclodimethylsiloxane ); those sold under the name “ escalol ™ z100 ” by the company isp ( alumina - treated zno dispersed in an ethylhexyl methoxycinnamate / pvp - hexadecene copolymer / methicone mixture ); those sold under the name “ fuji zno - sms - 10 ” by the company fuji pigment ( zno coated with silica and polymethylsilsesquioxane ); those sold under the name “ nanox ® gel tn ” by the company elementis ( zno dispersed at a concentration of 55 % in c12 - c15 alkyl benzoate with hydroxystearic acid polycondensate ). the uncoated cerium oxide pigments may be for example those sold under the name “ colloidal cerium oxide ” by the company rhone - poulenc . the uncoated iron oxide pigments are sold , for example , by the company arnaud under the names “ nanogard ™ wcd 2002 ( fe 45b )”, “ nanogard ™ iron fe 45 bl aq ”, “ nanogard ™ fe 45r aq ” and “ nanogard ™ wcd 2006 ( fe 45r )” or by the company mitsubishi under the name “ ty - 220 ”. the coated iron oxide pigments are sold , for example , by the company arnaud under the names “ nanogard ™ wcd 2008 ( fe 45b fn )”, “ nanogard ™ wcd 2009 ( fe 45b 556 )”, “ nanogard ™ fe 45 bl 345 ” and “ nanogard ™ fe 45 bl ” or by the company basf under the name “ transparent iron oxide ”. mention may also be made of mixtures of metal oxides , especially of titanium dioxide and of cerium dioxide , including the silica - coated equal - weight mixture of titanium dioxide and of cerium dioxide , sold by the company ikeda under the name “ sunveil a ”, and also the alumina -, silica - and silicone - coated mixture of titanium dioxide and of zinc dioxide , such as the product “ m 261 ” sold by the company kemira , or the alumina -, silica - and glycerol - coated mixture of titanium dioxide and of zinc dioxide , such as the product “ m 211 ” sold by the company kemira . according to the invention , coated or uncoated titanium oxide pigments are particularly preferred . the sunscreen actives according to the invention are preferably present in the compositions according to the invention in an amount ranging from about 0 . 1 % to 40 % by weight , and in particular from about 3 % to 35 % by weight , and more particularly from about 5 % to 30 % by weight relative to the total weight of the composition . the inventors have found that the composition of the present invention , surprisingly , facilitates the incorporation of such a significant amount of sunscreen actives while yielding a storage stable product . a composition according to the invention may also comprise at least one water repellency agent . according to one preferred embodiment , the water repellency agent comprises an ester - terminated polyamide , preferably the compound whose inci name is ethylenediamine / stearyl dimer dilinoleate copolymer sold by the company croda under the name oleocraft ™ lp - 10 - pa -( mv ). the water repellency agent is preferably present in amounts ranging from 0 . 1 % to 10 %, more preferably from 1 % to 7 % and even more preferably from 3 % to 5 % relative to the total weight of the composition . a composition according to the invention may also comprise at least one filler . the fillers may be of mineral or organic origin , natural or synthetic in nature in order to provide oil absorption or optical effects . oil absorption fillers may impart a matte effect and non - greasy feeling onto the skin . optical effects fillers may impart a soft - focus / haze / blur effect to the skin , provide the skin with a more uniform appearance , reduce the appearance of skin imperfections or discoloration , or reduce the visibility of pores . mention may be made as examples of oil - absorbing fillers : mica , zea may ( corn ) starch , magnesium oxide , nylon - 12 , nylon - 66 , cellulose , polyethylene , talc , talc ( and ) methicone , talc ( and ) dimethicone , perlite , sodium silicate , pumice , ptfe , polymethyl methacrylate , oryza sativa ( rice ) starch , aluminum starch octenylsuccinate , potato starch modified , alumina , calcium sodium borosilicate , magnesium carbonate , hydrated silica , dimethicone / vinyl dimethicone crosspolymer , sodium carboxylmethyl starch . according to one preferred embodiment , the oil - absorbing filler comprises spherical microparticles of porous silica having a mean particle size from 0 . 5 to 20 μm whose inci name is silica sold by the company jcg catalysts and chemicals under the name spheron l - 1500 . according to another preferred embodiment , the oil absorbing filler comprises hydrophobic aerogel particles whose inci name is silica silylate sold by dow corning under the name vm - 2270 aerogel fine particles . mention may be made as examples of optical effects fillers : bismuth oxychloride , silica silylate , boron nitride , iron oxide , calcium carbonate , calcium sulfate ( and ) iron oxides , sodium potassium aluminum silicate . mention may be made as examples of fillers which provide both oil - absorbing and optical effects : silica , silica ( and ) methicone , silica ( and ) dimethicone , polysilicone - 22 , polysilicone - 8 , polysilicone - 11 , methyl metacrylate crosspolymer , polymethylsilsesquioxane , methylsilanol / silicate crosspolymer , vinyl dimethicone / methicone silsesquioxane crosspolymer , diphenyl dimethicone / vinyl diphenyl dimethicone silsesquioxane crosspolymer , and styrene / acrylates copolymer . the filler may be present in amounts ranging from about 0 . 1 % to 15 %, more preferably from about 0 . 5 % to 13 %, and even more preferably from about 1 % to 10 % by weight , all weights based on the total weight of the composition . according to one embodiment of the present invention , there is provided a composition containing : ( a ) from about 0 . 1 % to 10 %, preferably from about 1 % to 8 %, and most preferably from about 2 % to 5 %, of at least one silicone polyether elastomer ; ( b ) from about 0 . 01 % to 10 %, preferably from about 0 . 1 to 6 %, and most preferably from about 0 . 1 % to 4 %, of at least one hydrogenated plant oil having an iodine value not more than about 16 ; ( c ) from about 10 % to 50 %, preferably from about 15 % to 45 %, and most preferably from about 20 % to 40 %, of at least one polar solvent , other than ( b ); ( d ) from about 0 . 1 % to 40 %, preferably from about 3 % to 35 %, and most preferably from about 5 % to 30 %, of at least one sunscreen filter ; ( e ) optionally , from about 0 . 1 % to 10 %, preferably from about 1 % to 7 %, and most preferably from about 3 % to 5 %, of at least one water - repellency agent ; ( f ) optionally , from about 0 . 1 % to 15 %, preferably from about 0 . 5 % to 12 %, and most preferably from about 1 % to 9 %, of at least one filler ; and ( g ) up to about 20 % by weight , preferably up to about 15 % by weight , and most preferably up to about 10 % by weight of at least one volatile hydrocarbon - based oil , all weights being based on the total weight of the composition . according to another embodiment of the present invention , there is provided a method of making a composition involving : ( a ) providing from about 0 . 1 % to 10 %, preferably from about 1 % to 8 %, and most preferably from about 2 % to 5 %, of at least one silicone polyether elastomer ; ( b ) providing from about 0 . 01 % to 10 % preferably from about 0 . 1 to 6 %, and most preferably from about 0 . 1 % to 4 %, of at least one hydrogenated plant oil having an iodine value not more than about 16 ; ( c ) providing from about 10 % to 50 %, preferably from about 15 % to 45 %, and most preferably from about 20 % to 40 %, of at least one polar solvent , other than ( b ); providing ( d ) from about 0 . 1 % to 40 %, preferably from about 3 % to 35 %, and most preferably from about 5 % to 30 %, of at least one sunscreen filter ; ( e ) optionally , providing from about 0 . 1 % to 10 %, preferably from about 1 % to 7 %, and most preferably from about 3 % to 5 %, of at least one water - repellency agent ; ( f ) optionally , providing from about 0 . 1 % to 15 %, preferable from about 0 . 5 % to 13 %, and most preferably from about 1 % to 10 %, of at least one filler ; and ( g ) up to about 20 % by weight , preferably up to about 15 % by weight , and most preferably up to about 10 % by weight of at least one volatile hydrocarbon - based oil , all weights being based on the total weight of the composition ; and ( h ) combining ( a )-( g ) to form the composition . according to yet another embodiment of the present invention , there is provided a process for inhibiting uv radiation from coming in contact with a keratinous surface by applying the above - disclosed composition over top of the keratinous surface . examples of suitable keratinous surfaces include skin , hair and human nails . the following examples serve to illustrate the invention without however exhibiting a limiting character . in these examples the amounts of the composition ingredients are given as weight percentages relative to the total weight of the composition . in making each of the examples in tables 1 , 2 and 3 , the following procedure was used . the ingredients of phase a were combined in the main beaker , mixed , and heated until uniform . the contents of the main beaker were cooled and the ingredients of phase b were added to the main beaker and mixed until homogenous . the ingredients of phase c were added to the main beaker and mixed until homogenous . the contents of the main beaker were cooled to room temperature . phase d was added to the main beaker and mixed until fully incorporated and homogenous . samples were subjected to a centrifugation test as a predictor of stability . samples were centrifuged at 1000 rpm for 60 minutes . the emulsion is determined to be unstable if phase separation was observed . | 0 |
the nature , objectives , and advantages of the invention will become more apparent to those skilled in the art after considering the following detailed description in connection with the accompanying drawings . one aspect of the invention concerns a system for dispatching medical services , which may be embodied by various hardware components and interconnections . this system is illustrated , along with other related components , utilizing the exemplary operating environment 101 of fig1 . the operating environment 101 includes the patient &# 39 ; s home 100 , a call center 110 , clinician device 140 , on - site medical care devices 185 , the internet 200 , and various secondary components 130 - 137 . generally , the call center 110 receives and processes requests for in - home medical visits to patients . medical services are provided at the patient &# 39 ; s home 100 , which may be equipped with various devices for monitoring and reporting the patient &# 39 ; s condition , as shown below . the clinician utilizes the computer - based clinician device 140 to aid in conducting house calls , as explained in greater detail below . as further described below , the secondary components 130 - 137 include other related components such as remote diagnostic equipment , records storage , third parties , internet web sites , local hospitals , billing facilities , etc . in the environment 101 , employees or other agents of a “ mobile care entity ” screen and process incoming calls , dispatch clinicians , store records , process billings , and perform other services related to the providing of on - site medical care . the mobile care entity may comprise a corporation , non - profit group , partnership , sole proprietorship , or other suitable organization . central to the provision of in - home medical services (“ house calls ”) is the patient &# 39 ; s home 100 , workplace , relative &# 39 ; s home ( not the patient &# 39 ; s ), restaurant , mall , sporting event , or any other place where the patient desires to receive medical attention . for ease of reference , this place is referred to as the patient &# 39 ; s “ home ” 100 . however , the site 100 is not limited to the patient &# 39 ; s living quarters , although this may constitute an illustrative embodiment . although the invention contemplates clinicians making self - supported house calls without requiring any equipment at the patient &# 39 ; s home 100 , the mobile care entity may optionally pre - equip the home 100 with various electronics . for example , the patient &# 39 ; s home 100 may be equipped with a telephone 102 for use by the patient in placing calls to the call center 110 , and also for use by on - site clinicians . moreover , the patient &# 39 ; s home 100 may also include an internet capable communication device 104 , such as a personal computer , web - enabled phone , web - tv , etc . as explained below , the device 104 may serve the patient &# 39 ; s requests for medical attention , as well as by on - site clinicians &# 39 ; need to gather information , file reports , etc . the patient &# 39 ; s home 100 may also include an internet - capable medical device 106 , which comprises one or more machines capable of monitoring the patient &# 39 ; s medical condition and transmitting representative reports by the internet 200 , administering medication or other treatment pursuant to remotely transmitted commands , etc . as an example , the device 106 may comprise heart monitoring equipment , dialysis machinery , blood pressure monitoring equipment , respiratory equipment , etc . a custom device programmed to contact the mobile care entity may also be installed at the patient &# 39 ; s home 100 . in one embodiment , one or more of the telephone 102 , communication device 104 , medical device 106 are interconnected to one another other . the mobile care entity operates the call center 110 to receive requests for in - home patient visits . alternatively , the mobile care entity may hire a subcontractor to perform the services of the call center 110 . the call center 110 includes a telephone bank 112 , triage processing block 114 , clinician location block 116 , pre - scheduled appointment information block 120 , and wireless clinician paging system 118 . in one embodiment , one or more of the telephone 112 , triage processing block 114 , clinician location block 116 , appointment information block 120 , and paging system 118 are interconnected to one another . depending upon whether the blocks 114 - 120 are implemented with humans or computers , the telephone bank 112 may be implemented by traditional telephones ( used by humans ), or automated switching equipment ( compatible with computers ). the triage processing block 114 includes personnel and / or equipment trained or programmed to receive incoming calls , assess whether the reported medical condition is appropriate for treatment by mobile care entity &# 39 ; s clinicians . the mobile care facility may field some conditions appropriate for emergency room treatment , such as influenza , broken bones , non - life threatening abrasions , etc . the triage processing block 114 , however , refers life - threatening conditions to more appropriate ambulance , life - flight , or other critical care services . the clinician location block 116 includes personnel and / or equipment trained or programmed to identify appropriate clinicians and dispatch them to serve incoming requests . the clinician location block 116 may operate based on geographic proximity , time availability , and other considerations . once identified , the clinician is paged , called , or otherwise contacted by the wireless clinician paging system 118 , which includes personnel and / or equipment that is appropriately trained or programmed for this purpose . as described below , clinicians may be contacted via their clinician devices 140 . in one embodiment , the clinician location block 116 receives input from the clinician devices 140 as to the clinician &# 39 ; s current geographic location . the clinician location block 116 stores this information for reference at the time of dispatch . the pre - scheduled appointment information block 120 includes personnel and / or equipment trained or programmed to maintain schedules for the mobile care entity &# 39 ; s network of clinicians . thus , the block 120 may be implemented by scheduling software , physical calendars , or a combination . in addition to operating the call center 110 , the mobile care entity hires , contracts , or otherwise maintains a network of mobile clinicians that are available on a full - time , part - time , on - call , or other basis . the mobile care entity provides each clinician with access to a clinician device 140 and a selection of “ clinician tools ” for on - site patient diagnosis / treatment , billing , and record keeping . broadly , the clinician tools include a host of diagnostic and treatment devices , including the on - site medical care devices 185 along with the typical accoutrements of a family physician . as explained below , each of the medical care devices 185 includes a wireless ( as illustrated ) or non - wireless communications interface with the clinician device 140 . although the precise details may vary depending upon the application , the devices 185 may include the following items , which may be conveniently stored in a van or other means of transportation : electro cardiograph machine , pulse oximeter , laboratory analyzer , x - ray machine , and the like . the clinician tools also include other devices without any wireless interface , such as a stethoscope , tongue depressor , thermometers , blood pressure cuff , splints , casts , bandages , sutures , syringes , and other typical equipment of an emergency room , family physician , etc . furthermore , the clinician may arrive at the patient &# 39 ; s house equipped with a mini - pharmacy , constituted by a representative selection of most commonly prescribed drugs . the clinician &# 39 ; s tools may further include equipment for performing a broad range of diagnostic procedures and tests , including urinalysis , blood count / chemistry , cholesterol / triglyceride analysis , splinting fractures and broken bones , biopsies , suturing lacerations , constructing casts , pregnancy tests , visual acuity tests , draining abscesses , foreign body removal , pregnancy tests , and the like . as mentioned above , the clinician also arrives at the patient &# 39 ; s home 100 with a portable computer , represented by the clinician device 140 . the mobile care entity provides each clinician with access to a clinician device 140 . to save costs , clinicians with different working hours may share the same clinician device 140 . in one embodiment , each clinician device 140 includes , in one or more housings , a wireless interface 142 , mapping device 144 , medical records 146 , wireless interface 148 for diagnostic equipment , human interface 150 , and location device 152 , although other embodiments may omit one or more of these . in one embodiment , one or more of these components are interconnected with one another . in one embodiment , the wireless interface 142 comprises a digital cellular telephone capable of accessing the public internet 200 . as an alternative or additional feature , the interface 142 also include a system to receive pages and / or wireless telephone calls , such as paging messages from the wireless clinician paging system 118 . the location device 152 comprises self - locating device such as a global positioning system ( gps ) engine , long range navigation ( loran ) module , omnitracs system , radio frequency receiver , inertial navigation system , etc . the locating device 152 cooperates with mapping device 144 hardware and software to display maps to assist the clinician in reaching the patient &# 39 ; s home 100 . although the mapping device 144 may include mapping software , the clinician device 140 may utilize the interface . 142 to access mapping software available through the internet 200 or other remote site . the medical records 146 comprise a medical records database that is frequently synchronized with patient data contained in the medical record center 130 . the wireless interface 148 utilizes bluetooth technology , infrared , rf , spread spectrum , or other wireless interface to conduct data exchange between the clinician device 140 and wireless components of the on - site diagnostic equipment 185 . the clinician device 140 also includes a human interface 150 data entry , which may include a keyboard , digitizing pen , voice interface , mouse , touch - operated input device , a combination of the foregoing , or other appropriate device ( s ). as mentioned above , the system 101 also includes a number of secondary components 130 - 137 , with a variety of functions . these secondary components 130 - 137 as well as the patient &# 39 ; s home 100 , call center 110 , and clinician &# 39 ; s device 140 are selectively linked by an appropriate network such as the public internet 200 ( as shown ), intranet , wide area network , token ring , etc . the selective linking between these components corresponds to the nature of interaction between components , which is described in greater detail below . the secondary components 130 - 137 include a medical record center 130 , remote medical care devices 132 , web server 133 , third party vendors 131 , interested third party with access authorization 134 , medical information web site 135 , local hospital admissions 136 , and a billing entity 137 . each of these components has a different type and extent of information exchange with other parts of the system 101 , as shown below . additional secondary components may also be incorporated into the environment 101 , depending upon the particular needs of the application . the medical record center 130 comprises a server , workstation , mass storage device , or other appropriate facility to store medical records for patients of the mobile care entity . the medical record center 130 may be co - located with the call center 110 , for example . as one example , the medical record center 130 may provide access to stored medical records through an internet web site utilizing password checks , firewalls , encryption , or other suitable guarantees of patient security . this information , along with any other information to be shared , may be provided by the web server 133 . depending upon the implementation requirements , communications may be expedited by integrating the web server 133 with one or more other components such as the call center 110 , medical records center 130 , etc . the remote medical care devices 132 represent diagnostic and / or treatment equipment located remotely from the patient &# 39 ; s home . the devices 132 include computer or other electronic communication components for exchanging information with the on - site clinician and the clinician device 140 . despite their remote location from the patient , the devices 132 are therefore available to diagnose / treat the patient . as illustrated , communications between the remote devices 132 and the clinician device 140 is relayed by the internet 200 . the devices 132 may include equipment that is expensive , bulky , movement - sensitive , unique , or otherwise unsuitable for transportation to the patient &# 39 ; s home . some examples include a t c o 2 machine , end tidal capnometer , pulmonary function machine , and the like . the third party vendor 131 represents an entity such as a home health agency , durable medical equipment manufacturer , or health maintenance organization . the vendor 131 may have reason to communicate with the web server 1 . 33 , medical record center 130 , clinician ( via clinician device 140 ) or other clinical components for the purpose of fulfilling health care financing administration billing requirements , communicating medical info to the physician or receiving medical info , for example . the interested third party with access authorization 134 represents an entity such as a patient &# 39 ; s personal care physician , close friend , partner , or relative with a valid reason to access the medical records 130 to monitor the patient &# 39 ; s treatment . in the illustrated embodiment , the third party 134 may access the medical records 130 via the internet 200 . the medical information web site 135 represents various internet web sites with reference information that is helpful to mobile care clinicians . the clinicians may access these web sites during on - site patient visits , for example using the patient &# 39 ; s internet capable communication device 104 , or by using the wireless interface 142 feature of the clinician device 140 . clinicians may also access such web sites after patient visits , for the purpose of performing any follow - up research and diagnosis . although some content may be provided by the mobile care entity through its web server 133 , the web sites 135 are chiefly operated by independent content providers supplying reference and other medical information . the local hospital admissions 136 represents an admissions desk or other similar facility in a hospital . communications with the admissions 136 may be helpful , for example , to aid the on - site clinician in admitting the patient to a hospital . furthermore , hospital admissions 136 may have reason to communicate with the medical record center 130 , clinician ( via clinician device 140 ), and other clinical components for the purpose of medical records review , discharge planning or coordinating levels of service . the billing entity 137 represents an entity such as a contracted billing agency , in - house billing staff , automated billing service or software , etc . the entity 137 may have reason to communicate with the clinical and administrative components or the environment 101 for the purpose of generating health care financing administration compliant bills , reviewing utilization experience or analyzing trends . another aspect of the invention concerns a digital data processing apparatus , which may be used to implement the clinician device 140 and other components with data processing functions . this apparatus may be embodied by various hardware components and interconnections ;. one example is the digital data processing apparatus 200 of fig2 . the apparatus 200 includes a processor 202 , such as a microprocessor or other processing machine , coupled to a storage . 204 . in the present example , the storage 204 includes a fast - access storage 206 , as well as nonvolatile storage 208 . the fast - access storage 206 may comprise random access memory (“ ram ”), and may be used to store the programming instructions executed by the processor 202 . the nonvolatile storage 208 may comprise , for example , one or more magnetic data storage disks such as a “ hard drive ,” a tape drive , or any other suitable storage device . the apparatus 200 also includes an input / output 210 , such as a line , bus , cable , electromagnetic link , or other means for the processor 202 to exchange data with other hardware external to the apparatus 200 . despite the specific foregoing description , ordinarily skilled artisans ( having the benefit of this disclosure ) will recognize that the apparatus discussed above may be implemented in a machine of different construction , without departing from the scope of the invention . as a specific example , one of the components 206 , 208 may be eliminated ; furthermore , the storage 204 may be provided on - board the processor 202 , or even provided externally to the apparatus 200 . in contrast to the digital data storage apparatus discussed previously , a different embodiment of the invention uses logic circuitry instead of computer - executed instructions . depending upon the particular requirements of the application in the areas of speed , expense , tooling costs , and the like , this logic may be implemented by constructing an application - specific integrated circuit (“ asic ”) having thousands of tiny integrated transistors . such an asic may be implemented with cmos , ttl , vlsi , or another suitable construction . other alternatives include a digital signal processing chip (“ dsp ”), discrete circuitry ( such as resistors , capacitors , diodes , inductors , and transistors ), field programmable gate array (“ fpga ”), programmable logic array (“ pla ”), and the like . having described the structural features of the present invention , the method aspect of the present invention will now be described . although the present invention has broad applicability to medical care , the specifics of the structure that has been described is best suited for providing a network of mobile clinicians that individually conduct in - home patient visits enhanced by the use of portable computing and communications equipment , and the explanation that follows will emphasize such an application of the invention without any intended limitation . in the context of fig1 , such a method may be implemented by operating the clinician device 140 , call center 110 , medical record center 130 , or other components ( each as embodied by a digital data processing apparatus 200 ) to execute respective sequences of machine - readable instructions . in each case , these instructions may reside in various types of signal - bearing media . in this respect , one aspect of the present invention concerns a programmed product , comprising signal - bearing media tangibly embodying a program of machine - readable instructions executable by a digital data processor to perform a method of rendering mobile medical care as described below . as a specific example , this signal - bearing media may comprise , for example , ram ( not shown ) contained within the clinician device 140 , as represented by the fast - access storage 206 . alternatively , the instructions may be contained in another signal - bearing media , such as a magnetic data storage diskette 300 ( fig3 ), directly or indirectly accessible by the processor 202 . whether contained in the storage 206 , diskette 300 , or elsewhere , the instructions may be stored on a variety of machine - readable data storage media , such as direct access storage ( e . g ., a conventional “ hard drive ,” redundant array of inexpensive disks (“ raid ”), or another direct access storage device (“ dasd ”)), magnetic tape , electronic read - only memory ( e . g ., rom , eprom , or eeprom ), optical storage ( e . g ., cd - rom , worm , dvd , digital optical tape ), paper “ punch ” cards , or - other suitable signal - bearing media including transmission media such as digital and analog and communication links and wireless . in an illustrative embodiment of the invention , the machine - readable instructions may comprise software object code , compiled from a language such as “ c ,” etc . in contrast to the signal - bearing medium discussed above , the method aspect of the invention may be implemented using logic circuitry , without using a processor to execute instructions . logic circuitry may be implemented in the clinician device 140 , call center 110 , medical record center 130 , or other components , where the logic circuitry itself is configured to perform operations to implement the method of the invention . the logic circuitry may be implemented using many different types of circuitry , as discussed above . fig4 - 8 provide one illustrative , detailed example of the method aspect of the invention . for ease of explanation , but without any intended limitation , the examples of fig4 - 8 are described in the context of the hardware components and interconnections of fig1 , as described above . fig8 shows a mobile care setup sequence 800 , where use and operation of the mobile care environment 100 is initiated . the sequence 800 begins in step 802 , where the mobile care entity establishes its network of clinicians . the mobile care entity may construct this network by full - time or part - time hiring of clinicians , enrolling independent contractors , contracting with other agencies , or other suitable relationships . clinicians may include physicians , specialists such as dermatologist , x - ray technicians , nurses , nurse practitioners , physicians &# 39 ; assistants , paramedics , e . m . t . personnel , or other suitable medical care providers . in step 804 , the mobile care entity provides the clinicians with the clinician devices 140 , described above . each clinician has access to at least one of the clinician device 140 while on - duty ; clinicians may also have access to clinician devices 140 while on - call if the budget and number of clinician devices 140 permits . in step 806 , clinician devices 140 individually utilize their respective wireless interfaces 142 to self - initiate downloading of patient records from the medical record center 130 . to maintain current local records 146 , each clinician device 140 automatically repeats the synchronization step 806 whenever an appropriate criteria is met . this criteria may require a periodic , non - periodic , random , or other sufficiently frequent synchronization . the clinician devices 140 may be programmed to synchronize at the same or different times . synchronization helps the clinician devices 140 preserve the currency of their medical records 146 . however , if the number and size of medical records does not permit downloading of all data from the medical records center 130 , the synchronization 806 may be limited to certain patients ( such as those scheduled for future visits by clinicians associated to the particular device 140 ), medical records of prescribed recency / type , etc . as an alternative , the timing and extent of each clinician device &# 39 ; s synchronization may be manually controlled by a clinician . fig4 shows a patient call initiation sequence 400 . in the sequence 400 , a patient requests medical attention from the mobile care entity , and the call center 110 responds by selecting and dispatching a clinician from its network . the sequence 400 begins in step 402 , where the patient enters the mobile care facility &# 39 ; s web site ( supported by the web server 133 ). in this example , the patient initiates step 402 by using the internet capable communication device 104 . as an alternative , the patient may initiate the sequence 400 manually by using the telephone 102 to contact a call center telephone 112 , in which case the call processing and triage operations are performed manually by staff ( not shown ) at the call center 110 . for ease of explanation , the following description is limited to the embodiment where automated equipment at the call center 110 processes the patient &# 39 ; s call . upon receiving initial access by the patient in step 402 , the web server 133 queries the patient for name , password , or other indicia that identifies the patient as an existing customer of the mobile care entity . having identified the patient , the web server 133 proceeds to gather information from the patient as to his / her medical condition ( step 404 ). namely , the patient answers certain predetermined “ triage ” or screening ” questions , which may include a series of interactive inquiries based upon the appropriate triage algorithm . in one embodiment , the patient answers these inquiries by mouse - clicking on alternative choices , entering typed text , etc . next , the web server 133 forwards the patient &# 39 ; s triage answers to the triage processing block 114 ( step 406 ), which determines whether there is enough information to process the patient &# 39 ; s call ( step 408 ). if not , the triage processing block generates additional inquiries ( step 410 ) and returns to step 404 . when the triage processing block 114 determines that the patient has provided sufficient information to proceed ( step 408 ), the triage processing block 114 determines whether the patient &# 39 ; s condition presents a life - threatening situation ( step 412 ). in one embodiment , the triage processing block accesses medical information stored locally or via internet 200 in order to determine the outcome of the triage process . if the patient &# 39 ; s condition constitutes a life - threatening situation , the triage processing block 114 directs the web server 113 to display a message instructing the patient to obtain emergency ambulance services , for example by dialing “ 911 ” ( step 414 ). thus , the call center 110 refuses the patient &# 39 ; s call , since it is more appropriate for ambulance or other rapid deployment services rather than an on - site clinician visit . if the patient &# 39 ; s situation is not an emergency , step 412 leads to step 416 , where the triage processing block 114 retrieves the patient &# 39 ; s medical records . the medical records may be retrieved from a third party vendor 131 ( such as the patient &# 39 ; s primary care physician ), from the medical record center 130 , locally from the call center 110 , or another source . moreover , the records may be retrieved by hand , over the internet 200 , by facsimile machine , or other automated or manual means . next , in step 418 the triage processing block determines the appropriate clinician type and equipment required to treat the patient &# 39 ; s reported condition . as mentioned previously , clinicians may have qualifications of various levels , such as nurses , nurse practitioners , physicians , x - ray technicians , and the like . in one exemplary case , an appropriate clinician / device may be a nurse qualified to take blood ( clinician ) and a blood analyzer ( device ). in a different case , an appropriate clinician / device may be a physician ( clinician ) accompanied by an x - ray technician ( second clinician ) and x - ray machine ( device ). some examples of other clinician / device combinations include cardiologist , and impedance monitor , ultrasound machine and technologist , and other specialists . as one example , step 418 may be performed by utilizing a software module such as an expert system . after the triage processing block 114 identifies the appropriate type of clinician for the current patient ( step 418 ), the clinician location block 116 identifies ( step 420 ) and thereby selects a clinician in the mobile care entity &# 39 ; s network to satisfy the requirements of clinician type from step 418 . this may be performed by consulting a look - up table or other cross - referencing guide , for example . some exemplary considerations for step 420 include ( 1 ) the urgency of the patient &# 39 ; s request , ( 2 ) the geographical location of both patient and candidate clinician , ( 3 ) the clinician &# 39 ; s status as being on - duty busy , on - duty idle , on - call , off - duty but available , ( 4 ) the clinician &# 39 ; s pre - scheduled appointments available from the pre - scheduled appointment information block 120 , etc . step 420 may select multiple clinicians if required , such as an x - ray technician visit at one o &# 39 ; clock and then a physician follow - up visit at two o &# 39 ; clock . the wireless clinician paging system 118 then transmits a dispatch notification to the selected clinician , including forwarding of sufficient information to the clinician to initiate the house call ( step 422 ). this information identifies the patient &# 39 ; s name , the patient &# 39 ; s address and telephone number , the reported medical condition , and other information needed to initiate the house call . further information may include , for example , call center instructions resulting from patient triage / interview , information on the patient &# 39 ; s reported condition , call priority , proposed or promised arrival time , etc . this information may be conveyed to the clinician by various means , such as ( 1 ) the call center 110 transmitting a message to the internet 200 for subsequent retrieval by the clinician , wireless internet connection , ( 2 ) standard cellular telephone or paging system , ( 3 ) standard wireless paging system , ( 4 ) proprietary wireless system such as nextel , or ( 5 ) other suitable means . the on - call clinician receives this information at his / her clinician device 140 , via the wireless interface 142 . in step 424 , the triage processing block 114 responds to the patient &# 39 ; s initial call ( from step 402 ) by providing the patient with certain follow - up information , such as the name of any clinicians that have been dispatched , proposed arrival time , etc . the block 114 may convey this information to the patient by telephone 102 , e - mail , updating a confidential patient status area on the web site 133 , etc . furthermore , the triage processing block 114 may transmit e - mail or other suitable messages to other interested parties , or make such information available to parties with access authorization 134 . such parties may include , for example , the patient &# 39 ; s primary care physician , pre - registered friends / relatives , those with e - mail addresses entered by the patient during initial registration with the mobile care entity , insurance providers , etc . this completes the sequence 400 . fig5 shows an automatic call initiation sequence 500 . in the sequence 500 , automatic equipment installed at the patient &# 39 ; s home requests medical attention from the mobile care entity , and the call center 110 responds by selecting and dispatching one or more clinicians from its network . the steps are initiated in step 502 , where the internet capable medical device 106 transmits notification to the triage processing block 114 . this notification can take various forms , such as a periodic report , an emergency request automatically generated in response to a condition such as dangerously low blood pressure , manually generated emergency request such as the patient &# 39 ; s manual activation of a “ panic button ,” etc . in response to the notification of step 502 , the triage processing block 114 determines whether the notification contains sufficient information to begin the process of dispatching a clinician ( step 504 ). if not , the call center 110 initiates a request for additional information ( step 505 ). in one example , this request may occur manually , by call center staff placing a telephone call to the patient . in another example , the triage processing block 114 may submit a machine - initiated request for additional information , for example by querying the medical device 106 . when there is sufficient information to process the notification of step 502 , the triage processing block 114 determines whether the patient &# 39 ; s situation constitutes a life - threatening emergency . if so , the call center 110 directs the patient to obtain emergency medical care ( step 508 ), for example by dialing “ 911 .” if the notification of step 502 arose from the patient activating a panic button , step 508 may be satisfied by call center 110 staff contacting the patient by telephone 102 or calling an ambulance on behalf of the patient . on the other hand , if the notification of step 502 arose from the medical device 106 , step 508 may involve the triage processing block 114 returning an automated message to the medical device 106 or calling an ambulance on behalf of the patient . if the present situation does not constitute an emergency , the triage processing block 114 retrieves the patient &# 39 ; s medical record ( step 510 ). the medical records may be retrieved from a third party vendor 131 ( such as the patient &# 39 ; s primary care physician ), from the medical record center 130 , locally from the call center 110 , or another source . moreover , the records may be retrieved by hand , over the internet , by facsimile machine , or other automated or manual means . next , in step 512 the triage processing block 114 determines whether any response by an on - site clinician is required . this step is performed by evaluating the notification ( from step 502 ), any additional information ( from step 505 ), and the patient &# 39 ; s medical record ( from step 510 ). the evaluation of step 512 may be performed , for example , by using an expert system software module , or performing pre - programmed comparison with a list of various conditions for which clinician dispatch is required . if clinician dispatch is not needed , the patient is contacted and advised accordingly . namely , call center 110 staff may manually contact the patient , or the triage processing block 114 may automatically contact the patient by sending an appropriate message to the medical device 106 and / or the device 104 . on the other hand , if step 512 mandates clinician dispatch , the triage processing block 114 proceeds with step 516 . particularly , the block 114 determines the appropriate clinician type and equipment required to treat the patient &# 39 ; s reported condition , and then the clinician location block 116 identifies and thereby selects an on - call clinician in the mobile care entity &# 39 ; s network to satisfy these requirements . the wireless clinician paging system 118 then transmits a dispatch notification to the selected clinician , including forwarding of sufficient information to the clinician to initiate the house call ( step 518 ). in step 520 , the triage processing block 114 responds to the original notification of step 502 by providing the patient with certain follow - up information , such as the name of any clinician ( s ) scheduled to visit the patient and the proposed arrival time ( s ). this completes the sequence 500 . fig6 shows a clinician notification sequence 600 , where the clinician receives dispatch notification from the call center 110 and responds accordingly . the steps are initiated in step 602 , when the clinician device 140 receives the call center &# 39 ; s dispatch notification ( transmitted previously in steps 422 or 518 , as discussed above ). as mentioned above , this information identifies the patient , the reported medical condition , and other information needed to initiate the house call , and may include further information such as diagnosis / treatment instructions or allergy alerts resulting from patient triage / interview , information on the patient &# 39 ; s reported condition , call priority , proposed arrival time , etc . in response to the dispatch notification from step 602 , the mapping device 144 component of the clinician device 142 consults the location device . 152 to determine the clinician &# 39 ; s current location ( step 604 ). also in step 604 , the mapping device 144 prepares a map including the clinician &# 39 ; s present location ( from the device 152 ), the patient &# 39 ; s location ( from the call center &# 39 ; s dispatch notification ), and appropriate driving directions between these sites . next , in step 606 the clinician device 140 transmits a message reporting the location of the clinician device 140 . to aid the call center 110 in monitoring the clinician &# 39 ; s progress toward the patient &# 39 ; s home , location reporting messages may be repeatedly transmitted to the call center 110 in response to : ( 1 ) occurrence of a repeating time period , such as one minute , ( 2 ) call center queries , ( 3 ) significant changes in clinician location , or ( 4 ) another reason . after step 606 , the clinician device 140 retrieves the patient &# 39 ; s medical records . this is performed by operating the interface 142 to contact the medical record center 130 via the internet 200 , and retrieving the patient &# 39 ; s most updated medical records . also , the clinician device 140 updates any locally stored medical records 146 with the current information from the medical record center 130 . alternatively , rather than actively obtaining the patient &# 39 ; s medical records , the clinician device 140 may receive unsolicited transmission of the patient &# 39 ; s medical records by the call center 110 . after step 608 , the sequence 600 is complete and the clinician is ready to render on - site patient care upon arrival . fig7 shows the sequence for on - site patient diagnosis / treatment , as performed by the clinician . the sequence 700 begins in step 702 , when the clinician visits the patient &# 39 ; s home 100 after having been dispatched as discussed above . the clinician is accompanied by the clinician device 140 , on - site electronic medical care devices 185 , and other clinician tools as discussed above . in step 704 , the clinician examines the patient . the clinician selects and operates various of the clinician &# 39 ; s tools to conduct the examination . with traditional , manually - operated tools such as thermometers , blood pressure cuffs , and the like , use and feedback occurs in traditional fashion . the clinician may enter data from such manual examination into the clinician device 140 for inclusion into the patient &# 39 ; s medical record and / or analysis by diagnostic programs of the clinician device 140 . in contrast to traditional examination means , the clinician may perform more automated examination by coupling appropriate sensors between one or more on - site electronic medical care devices 185 ( such as a laboratory analyzer ) and the patient &# 39 ; s proximity , body , bodily fluids , or tissue , whereupon the device ( s ) 185 analyze the bodily component under scrutiny and provide a representative output . in one case , the output may comprise a human - readable output medical care devices 185 present directly to the clinician . in other cases , the output of one or more of the devices 185 may comprise a machine - readable output presented to the clinician device 140 ; in this embodiment , the clinician device 140 and device 185 communicate by the wireless link 148 , although other means may be used as well such as infrared link , cables , fiber optic lines , etc . if the output of the device 185 is machine - readable , then the clinician device 140 collects this output and responsively provides a table , graph , diagram , or other human - readable presentation by computer display , printing , etc . in addition to using on - site clinician tools , the clinician may also employ one or more remotely located medical care devices 132 . for this purpose , the clinician couples sensors between the clinician device 140 and the patient &# 39 ; s proximity , body , bodily fluids , or tissue . the sensors measure various physiological conditions and relay representative information in machine - readable form to the clinician device 140 . in turn , the clinician device 140 invokes the wireless interface 142 to further relay these measurements to the remote device ( s ) 132 , retrieve any resultant analysis from the remote devices , and locally present the results for the clinician in human - readable form . in step 706 , the clinician manually enters data from the patient &# 39 ; s examination , and also utilizes the clinician device 140 to store the output of the devices 185 / 132 , whether such output occurs in human or machine - readable form . furthermore , the clinician may direct the clinician device 140 to store any human - readable reports that it has prepared utilizing machine - readable output of the devices 185 . if desired , the clinician may direct the clinician device 140 to transmit results from the diagnosis ( including output from devices 185 ) to the call center 110 for immediate evaluation by another clinician , for inclusion in the patient &# 39 ; s medical record by call center personnel , etc . as shown in step 708 , the clinician may supplement his / her evaluation of the patient &# 39 ; s condition by utilizing the clinician device 140 and wireless interface 142 to access various medical information web sites 135 or other sources of information about drug interactions , symptoms , treatment strategies , etc . after step 708 , the clinician then diagnoses the patient ( step 710 ) and renders any on - site treatment ( step 712 ), if possible . the clinician may immediately prescribe and render medicine that s / he has brought along , as well as dispatch any available medical products , such as slings , casts , sutures , bandages , etc . as for medicine or products that are not immediately available , the clinician may choose to order them ( step 714 ) from a third party vendor 131 . advantageously , the order may be placed in immediately using the clinician device to contact the third party vendor 131 via the internet 200 . such products may include walkers , special beds , oxygen , leased medical equipment , and the like . next , in step 716 , the clinician prepares a record of the at - home patient visit by assembling the clinician &# 39 ; s notes , reports from the clinician device 140 , output from the equipment 185 / 132 , and the like . the clinician stores a machine - readable representation of this record , for example in the medical records 146 . at this time , or later , the clinician invokes the wireless interface 142 to transmit the machine - readable representation of the patient &# 39 ; s report to the medical record center 130 . having completed the patient &# 39 ; s visit , the clinician then performs various follow - up steps 718 . for instance , on behalf of the patient , the clinician may utilize the clinician device 140 to complete an on - line admission process to a local hospital 136 if the patient &# 39 ; s condition warrants . the clinician may also schedule one or more follow - up visits by manually contacting call center personnel , or by utilizing the clinician device 140 and wireless interface 142 to notify the pre - scheduled appointment information block 120 with follow - up information . in addition , the clinician device 140 may transmit an e - mail message to a friend , relative , personal care physician , or other pre - identified party after completion of the clinician &# 39 ; s at - home visit . this e - mail message , which may be transmitted automatically by the clinician device 140 or manually by the clinician , contains information reporting the patient &# 39 ; s examination , diagnosis , and treatment . at this time , the clinician may also receive , review , and respond to any e - mail messages that have been forwarded by the call center 110 from any interested third parties 134 . other possible follow - up action includes various billing matters , such as transmitting messages to invoke the billing entity 137 , sending completed health care financing administration records to a referring home health agency , etc . moreover , such billing operations may be performed automatically at the completion of the patient &# 39 ; s visit , or by the clinician &# 39 ; s use of the clinician device . finally , the clinician utilizes the clinician device 140 to notify the call center 110 that the visit is complete . while the foregoing disclosure shows a number of illustrative embodiments of the invention , it will be apparent to those skilled in the art that various changes and modifications can be made herein without departing from the scope of the invention as defined by the appended claims . furthermore , although elements of the invention may be described or claimed in the singular , the plural is contemplated unless limitation to the singular is explicitly stated . additionally , ordinarily skilled artisans will recognize that operational sequences must be set forth in some specific order for the purpose of explanation and claiming , but the present invention contemplates various changes beyond such specific order . | 6 |
the proposed quiet zone generation technique features injection of interferences at low power levels for cancellations . the interference mitigation technique consists of an auxiliary injection array with iterative processing to dynamically maintain a quiet zone over limited areas over which rx antenna apertures operating in full duplex while nearby tx apertures with strong rf leakage are in operation . in order to provide a working frame of reference , a glossary has been provided to define some terms used in the description and claims as a central resource for the reader . the glossary is intended to provide the reader with a general understanding of various terms as they are used in this disclosure , and is not intended to limit the scope of these terms . rather , the scope of the terms is intended to be construed with reference to this disclosure as a whole and with respect to the claims below . next , an overview is presented to provide a general understanding of the scope and meaning of the terms used herein . beam forming network — the term “ beam forming network ,” as used herein , is a standard term used in the fields of electronics , telecommunications , radar design , and signal processing to denote a network that combines signals from multiple antennae into a pattern that is more directional than each antenna by itself because of array factors . the beam forming network may be of electronic or mechanical design . the aim of a beam forming network is to create a steerable radio frequency signal beam , thus boosting gain , directionality , and signal strength . beam weight vectors — the term “ beam weight vectors ,” as used herein , is a term used in the field of electronics , telecommunications , radar design , and signal processing , to describe a process of altering a radio frequency signal by applying a certain value to the amplitude and phase , as well as giving identifiable qualities to the given signal . the beam weight vectors may be mechanical or electronic in design , and are aimed to provide information to a beam forming network for signal processing . cancellation beam weight vectors — the term “ cancellation beam weight vectors ,” or cancellation weight vectors ,” or cwv as an acronym , as used herein , is a term used in the field of electronics , telecommunications , radar design , and signal processing , is an alternative form of the term “ beam weight vectors .” more specifically , the term is used to denote the sum of the vector values of amplitude and phase changes to minimize a given radio frequency signal . the aim is to provide electronic information to a beam forming network for signal processing . cancellation technique — the term “ cancellation technique ,” or “ cancellation techniques ,” as used herein , is a term used in the fields of electronics , telecommunications , and signal processing to denote a process of using a series of antenna apertures to inject some radio frequency signals into a quiet zone in order to reduce self - jamming and external jamming effects on radar receive apertures by nearby transmission apertures . the aim of this technique is to allow full duplex systems to operate to full capacity by reducing or eliminating unwanted interference . cost optimization — the term “ cost optimization ,” or “ cost optimizing ,” as used herein , is a standard term used in the fields of electronics , mathematics , economics , signal processing , etc . to denote a process of finding the most cost - efficient element from a given set of alternatives . diagnostic probes — the term “ diagnostic probe ,” as used herein , is a standard term used in the field of electronics , to denote an antenna aperture used to acquire radio frequency information such as phase , amplitude and field strength , then relay that information to a processing unit for diagnostic analysis . specific to the present invention , the aim of the probes is to provide signal information so that the injected signals properly cancel out any unwanted interference . field - of - view — the term “ field - of - view ,” or fov as an acronym , as used herein , is a standard term in antenna design , to denote the maximum angle of transmission that a given antenna may broadcast a signal . jammer signal — the term “ jammer signal ,” or “ jamming signal ,” or “ jm ,” as used herein , is a standard term in electronics and telecommunications , to denote a source of radio frequency signals that produces undesired artifacts in a given radio frequency signal or signals , meaning the creation of interference , either externally propagated or self - created , and either intentional or unintentional . the aim of a jamming signal is to disrupt radio frequency transmissions when used in offensive manner . optimization processor — the term “ optimization processor ,” as used herein , is used to denote a central processing unit , be it mechanical or electronic , that is used to perform the cost optimization process . pickup array — the term “ pickup array ,” as used herein , is a term in the field of telecommunications , signal processing , and antenna design , is used to denote an antenna aperture used for the purpose of selecting and picking up undesired radio frequency jamming signals for processing . in the present invention , the aim of these pickup arrays is to identify and catalogue individual jamming signals so that the signal processor may cancel the jamming signal . quiet zone — the term “ quiet zone ,” as used herein , is a standard term in the field of telecommunications , satellite antenna design and signal processing , to describe an area that is relatively free of radio frequency signals as well as unwanted radio frequency interference . rx array — the term “ rx array ,” or “ reception array ,” or “ receiving array ,” as used herein , is a standard term in the field of antenna design , to denote an antenna aperture that is used for the purpose of receiving incoming radio frequency signals and converts it into usable information for a user . the aim is to receive radio frequency signals that have either been actively transmitted to the desired receive array or passively transmitted . rf leakage — the term “ rf leakage ,” or “ radio frequency leakage ,” as used herein , is a standard term in the field of telecommunications , electronics , and signal processing , to denote an issue where unwanted radio frequency signals are propagated in undesired directions as a result of use , and may possibly result in unwanted radio frequency interference in other receivers . self - interference — the term “ self - interference ,” as used herein , is a standard term in the field of telecommunications , satellite antenna design , and signal processing , to describe phenomena in full duplex communication systems where the receive aperture of the system receives unwanted radio frequency interference from its own transmission aperture either due to frequency use overlap , or cohabitation of multiple radio frequency functions due to the close proximity of system instruments . tx array — the term “ tx array ,” or “ transmission array ,” as used herein , is a standard term in the field of antenna design , to denote an antenna aperture that is used for the purpose of converting usable information into radio frequency signals , then broadcasts these outgoing radio frequency signals . the transmission array may be of dish design , or an array design . fig1 depicts the functional blocks of the injection for cancellation techniques 100 . one such a design features the following functions ; ( 1 ) an auxiliary tx ( injection ) array 110 , ( 2 ) diagnostic probes 121 , and ( 3 ) optimization processing 131 . an auxiliary tx array consists of an array of pickup sensors 111 to pick up m interferences in real time , ( 2 ) a beam forming network ( bfn ) 112 with a m - to - n distribution network , and ( 3 ) an array of n interference signal injectors 113 . the m - to - n bfn 112 feature electronic amplitude and phase weighting , or equivalent , for each of its inputs and outputs . the weightings are referred as cancellation beam weight vectors ( cwvs ) or simply beam weight vectors ( bwvs ). the interference signal injectors 113 include signal conditioning and amplifications mechanisms as well as rf radiating elements , and may have optional re - positioning capability for some radiating elements . for example , m = 1 and n = 10 . the diagnostic probes 121 are mostly located inside the targeted quiet zones 150 , over which rx apertures 161 of beneficial rf receivers 160 are located . the quiet zones 150 with limited areas are generated by dynamic injection of the interference signals through an auxiliary tx array 110 with injection elements 113 distributed nearby rx apertures 161 of beneficial receivers 160 . the pickup array 111 selects and picks up undesired jamming signals via its proximity to jamming sources or via its directional discriminations capability , picking - up strong jamming signals in far - field . the m picked - up jamming signals are fed to the bfn 112 , in which each jamming signal is individually replicated into n - injection channels and then weighted separately with flexible cwv controlled by the optimization processor 131 . in each of the n injection channels , there are m weighted replicated signals summed together as an injection channel signal for an individual interference injector 113 . these signals are conditioned and amplified , and then radiated by the injection array 113 to reach the quiet zones 150 . as results , the jammer field distributions in the quiet zones 150 are from the jamming sourced directly , and from the controlled radiations of the replicated jammer signals injected from the auxiliary array 110 . as a part of generating feedback signals , a network of diagnostic probes 121 is strategically distributed over the quiet zones . they function to continuously and dynamically measure the combined field distributions of the interfering signals . the optimization processor 131 converts measurements from individual probes to performance indexes , or “ cost functions ,” to accordingly generate ( a ) a total cost by summing all the cost functions for each iteration and ( b ) cost gradients with respect to the bwv . then it will calculate the new cwv for next updating in the bfn 112 . the iterative controls are through the generation of new cwv by an optimization processing using cost minimization algorithms based on the cost functions derived from currently measured data . the combined field distributions of the interfering signals comes from two sources ; the direct jammers and the injected ones by the auxiliary array which features dynamic amplitude and phase weightings on all element individually . the goal of the optimization process is to achieve “ destructive interference ” in the combined field distribution over the rx aperture by dynamically controlling the amplitude and phase weightings in the auxiliary tx array . real - time narrow - band controls of the auxiliary array radiations are through updating of amplitude and phase weighting , or in - phase / quadrature - phase ( vq ) weighting , of the auxiliary array elements . we may modify the techniques using tap - delay - line processing structure for wideband processing if needed . fig2 depicts one implementation method for the functional blocks of the injection for cancellation techniques 100 in fig1 . there are three major differences : 1 . an implementation of the functions of bfn 112 illustrated in the block 210 consisting of functions of rx bfn 212 r and those of tx bfn 212 t . 2 . the jammer radiation elements 213 illustrated with highlighted optional repositioning mechanisms 213 m , and the remaining electronic functions 213 e of signal conditioning and amplification functions . 3 . the optimization processor 231 controlling the updating of the bwvs in rx bfn , cwvs in tx bfns , and updating new positions of injection array elements . fig3 depicts one implementation method for the functional blocks of the injection for cancellation techniques 100 against self - jamming in fig1 , with one major difference : 1 . an implementation of pickup array 111 as two proximity elements 311 p 1 and p 2 to two tx apertures 371 , tx 1 and tx 2 , of the rf transmitters 370 . the interference signal injectors 113 , i . e ., injection elements , are distributed around the targeted quite zone 150 ; two of the injection elements 113 are distributed opposite to each other with respect to the targeted quite zone 150 and another two of the injection elements 113 are also distributed opposite to each other with respect to the targeted quite zone 150 . fig4 depicts another implementation method for the functional blocks of the injection for cancellation techniques 100 against self - jamming in fig1 . there is one major difference : 1 . an implementation of pickup array 111 as two pickup probes 411 at the outputs of the rf transmitters 470 before two tx apertures 471 , tx 1 and tx 2 , i . e . at the inputs of the two tx apertures 471 . the beam forming network ( bfn ) is coupled to multiple nodes at respective inputs of the two tx apertures 471 . the interference signal injectors 113 , i . e ., injection elements , are distributed around the targeted quite zone 150 ; two of the injection elements 113 are distributed opposite to each other with respect to the targeted quite zone 150 and another two of the injection elements 113 are also distributed opposite to each other with respect to the targeted quite zone 150 . fig5 depicts another implementation method for the functional blocks of the injection for cancellation techniques 100 against self - jamming in fig1 . there are two major differences : 1 . optimizations are via element repositioning of the injection radiation array elements 513 with only a . bnfs 512 with fixed bwvs b . optimization processor 531 controlling the repositioning mechanisms 513 2 . an implementation of pickup array 111 as two pickup probes 511 at the outputs of the rf transmitters 570 before two tx apertures 471 , txl and tx 2 . the injection radiation array elements 513 , i . e ., injection elements , are distributed around the targeted quite zone 150 ; two of the injection elements 513 are distributed opposite to each other with respect to the targeted quite zone 150 and another two of the injection elements 513 are also distributed opposite to each other with respect to the targeted quite zone 150 . fig6 depicts an implementation method for the functional blocks of the injection for cancellation techniques 100 against external jamming in fig2 . there are five major differences ; 1 . pickup array 611 with m - elements used for multiple jamming beams 680 tracking multiple ( jm ) power jammers 670 , respectively , 2 . each pickup beam is formed by a m - to - 1 rx bfn 612 r , and the m rx bfn 612 r are arranged in parallel . one of the rx bfn 612 r arranged in parallel has a port coupled to an element in the pickup array 611 and to a port of another one of the rx bfn 612 r . 3 . each pickup beam is also associated with a 1 - to - n tx bfn 612 t , and multiple 1 - to - n tx bfn 612 t are arranged in parallel . one of the 1 - to - n tx bfn 612 t may have a port coupled to a port of one of the rx bfn 612 r and another port coupled to a port of another one of the 1 - to - n tx bfn 612 t and to one of the n injection radiation elements 613 . 4 . there are n injection radiation elements 613 , 5 . optimizations are via multiple loops where : a . rx bfns 612 r are optimized by altering bwvs for best reception of individual jammers , or equivalent , b . tx bfns 612 t are optimized by altering cwvs and tx radiation element repositioning , with the aim of altering field distributions of jamming signals in quiet zones . fig7 depicts another implementation method for the functional blocks of the injection for cancellation techniques 100 against external jamming in fig2 . there are five major differences : 1 . high gain antennas 711 used for generating multiple ( jm ) pick - up beams 780 tracking multiple ( jm ) power jammers 770 , respectively , 2 . each high gain antenna capable of forming multiple beams over a limited field - of - view ( fov ) are driven by directional drivers 711 - d controlled by the optimization processor 731 , 3 . each pickup beam is associated with a 1 - to - n tx bfn 712 , 4 . there are n injection radiation elements 713 , and 5 . optimizations are via multiple loops : a . rx beams 760 , or pickup beams , are optimized by repositioning the high gain antennas 711 and their feeds , or equivalent , for best reception of individual jammers , b . by altering cwvs of tx bfns 712 and repositioning tx radiation elements 713 c . iteratively modifying field distributions of jamming signals in quiet zones 750 monitored continuously by diagnostic probes 721 ; d . all rx apertures 761 are “ covered ” by the quiet zones 750 fig8 depicts an implementation method for the functional blocks of the injection for cancellation techniques against self jamming in a handheld device 800 . the handheld device features multiple independent rf functions 871 + 872 , and 881 + 882 . the injection arrays 810 , 820 , each with a feed back loop , are to minimize undesired self jamming signals iteratively by dynamically updating the amplitudes and phases weightings , or equivalents , of individual elements in the injection arrays . there are potential rf leakages from rf system 1 872 transmission to a sensitive receiver of rf system 2 882 operating in same frequency channels . the leakages may be from a transmit antenna 871 of the rf system 1 872 via multiple propagation paths inside the handheld device to the receive antenna 881 or other parts of rf system 2 882 electromagnetically . the injection for cancellation circuits 810 iteratively alter the field distribution of injected interference signals making quiet zones over the small areas where rf system 2 881 + 882 are anchored . the weightings of all elements in an injection array 810 are the components of a “ cancel beam weighting vector ” or a cwv . the inputs to the injection arrays are from a pick up antenna 811 adjacent to rf system 1 antenna 871 which only pickups jamming rf 1 transmission signals . the feed back loop ( not shown ) to the injection arrays features a few diagnostic probes ( not shown ) over quiet zones for the rf 2 rx aperture 881 , and will be used to measure the strengths of combined interference signals . an optimization processor ( not shown ) in the feed back loop converts the measurements from each probes into performance indexes ; which are cost functions and must be positively definite . the summation of the cost functions is referred as the total cost of the current performance measure for the injection arrays . the to - be - updated cwvs of the next iteration for individual elements of the injection arrays are calculated based on the cost gradient by optimization algorithms minimizing the total cost iteratively . after the iterative results converge , the resulting cost at an optimized state will be reduced significantly . consequently , the internal strong leakage signals are minimized , creating quiet zone 881 + 882 within which the sensitive rx aperture 881 of the rf system 2 882 and itself 882 are resided . therefore rf system 2 will be well protected from “ rx front - ends saturations ” by the self - interferences . there are potential rf leakages from rf system 2 882 transmission to a sensitive receiver of rf system 1 872 operating in same frequency channels . the leakages may be from a transmit antenna 881 of the rf system 1 882 via multiple propagation paths inside the handheld device to the receive antenna 871 or other parts of rf system 1 872 electromagnetically . the injection for cancellation circuits 820 are to make quiet zones over the small areas where rf system 1 870 is anchored . | 6 |
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . fig1 shows a delivery unit 1 which is inserted into a tank 20 for a liquid . the delivery unit 1 has a housing 13 in which a distributor block 2 is situated . a pump 7 for delivering the liquid is fastened , as active component 3 of the delivery unit 1 , to the distributor block 2 . the pump 3 extracts liquid from the tank 20 at a suction point 23 , and supplies the liquid at a supply port 22 . the delivery unit 1 is inserted into a tank base 21 of the tank 20 . the distributor block 2 of the delivery unit 1 is surrounded by a clamping element 4 , the latter being in the form of a spring 8 and being manufactured from a wire 14 and having two prestressed sections 15 . the prestressed sections 15 ensure that the clamping element 4 exerts a force on the distributor block 2 and thus braces the distributor block 2 . fig2 shows the section a - a , already indicated in fig1 , through the delivery unit 1 shown in fig1 . here , too , it is possible to see the housing 13 with the distributor block 2 arranged therein , on which distributor block the pump 7 , as component 3 , is situated . also indicated at the pump 7 is a delivery direction 24 in which the liquid is delivered by the delivery unit 1 from the intake point 23 to the supply port 22 . also indicated is a duct 9 along which the liquid flows through the delivery unit 1 . it may be seen that a low - pressure region is formed upstream of the pump as viewed along the delivery direction 24 of the duct 9 , and a high - pressure region is formed downstream ( that is to say behind the pump 7 ) as viewed in the delivery direction 24 . owing to the pressure increase generated by the pump 7 , elevated liquid pressures prevail in the high - pressure region . it is also possible to see the described clamping element 4 , which is in the form of a spring 8 composed of wire 14 with prestressed sections 15 and which engages around the distributor block 2 at the outside . here , the distributor block 2 is formed with a main body 5 and with two legs 6 , wherein the left - hand leg 6 forms a low - pressure region of the duct 9 and is plugged onto the main body 5 by way of a plug - in connection , whereas the right - hand leg 6 forms a high - pressure region of the duct and is screwed to the main body 5 by way of a screw connection 11 . in addition to the pump 7 as component 3 , the illustration here also schematically shows two further components 3 in the upper region of the distributor block 2 , which further components may for example be a valve or a sensor . fig3 shows a motor vehicle 16 having an internal combustion engine 17 and having an exhaust - gas treatment device 18 with an scr catalytic converter 19 . a liquid additive for exhaust - gas purification may be supplied to the exhaust - gas treatment device 18 by way of an injector 25 , with liquid additive for exhaust - gas purification being supplied to the injector from a tank 20 , via a line 26 , by a delivery unit 1 . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention . | 8 |
carrier 100 is comprised by a u - shaped tube 101 having two major vertical struts 102 and 106 . vertical struts 102 and 106 have a number of holes 103 therethrough , extending longitudinally parallel with hitch 105 . seven holes 103 are illustrated on each of struts 102 and 106 , but the exact number , placement and orientation of holes 103 is not critical to the invention . preferably , an assortment of holes 103 will be provided sufficient to enable carrier 100 to adequately support a large number of articles including , but not limited to , bicycles , skis , snowboards , and other recreational and utilitarian devices . extending between vertical struts 102 and 106 on u - shaped tube 101 is horizontal strut 108 . horizontal strut 108 also has holes 109 therein , preferably similar to holes 103 . attached at the base of vertical struts 102 , 106 is rectangular base 110 , which is preferably formed from a single piece of tubing by forming four bends therein . base 110 has two three - sided channels 111 welded onto base 110 to mate with the ends of u - shaped tube 101 . in addition to channels 111 , another three - sided channel 113 attaches base 110 to z - strut 104 . through channels 111 and 113 , base 110 can be rigidly attached to u - shaped tube 101 , while still allowing removal therefrom for shipping purposes . as is known in the industry , shipping carriers place particular constraints upon the dimensions a package may take . by using channels 111 and 113 , base 110 may be laid flat with tube 101 during shipping and then may be assembled thereto in a more perpendicular manner during use as shown in fig1 and 2 . midway between vertical struts 102 and 106 is vertical z - shaped strut 104 . at the top of z - strut 104 , above horizontal strut 108 , is receiver 115 . receiver 115 may be permanently welded to z - strut 104 if desired . on top of receiver 115 is second receiver 112 which extends much further from z - strut 104 than receiver 115 . z - strut 104 will preferably be releasably attached to u - shaped tube 101 through three - sided channel 113 . once again , this allows z - strut 104 to be released from u - shaped tube 101 , so that z - strut 104 may be laid flat inside a package to conform to shipping constraints . while the particular shape of strut 104 is not critical , the combination of vertical support brace 107 and the z - shape of strut 104 provide substantial strength and resistance to fatiguing , while also providing a unique and aesthetically pleasing appearance . in addition , and as is best visible in fig2 vertical strut 106 is tilted slightly from vertical , approximately fifteen degrees from vertical . the slight tilt helps to support the load prior to strapping , while also moving the load closer to the hitch . since the amount of torque generated is calculated by the weight of the load multiplied by the distance of the load from the pivot point , bringing the load closer to the receiver hitch reduces the amount of torque generated at the hitch during vehicular movement over bumps and the like . furthermore , the slight angle helps to bring the end of base 110 distal from hitch 105 further off of the ground , to help prevent carrier 100 from dragging when a vehicle travels over a roadway with a sudden change in inclination . for the purposes of the present disclosure , this angle change is still within a range considered to be primarily vertical , which could be as great as forty - four degrees from vertical , and rods 142 - 158 discussed hereinbelow are still considered to be primarily horizontal . the combination of vertical struts 102 , 106 , z - strut 104 , horizontal strut 108 , rectangular base 110 and receiver 112 form the basic frame of carrier 100 , from which a number of variations of carrier configurations are possible . several additional components are added and moved around s about this basic framework , depending upon the cargo to be carried . by virtue of the basic frame being flat and the other components being removable and relatively two dimensional , carriers in accord with the present invention may be packaged for shipping , stocking and resale in a flat , compact package . at various locations along struts 102 , 104 , 106 , 108 , 110 eye bolts 114 are placed , to allow tie straps , bungee cords , ropes or similar retaining devices to be used to assist in retaining cargo . while eye bolts 114 are illustrated , they are not critical to the invention and other known attachment points or retaining methods may be used . while not absolutely critical to the invention , the basic materials used in the preferred embodiment are square steel tubes . these tubes offer low cost , low weight , ready machinability and high strength , while the square geometry prevents unwanted spinning or rotation between different sections of tubing . moreover , the flat surfaces of square tubing ensure ready placements and alignments that are not available with round tubing . for example , with round tubing , aligning holes through which a pin must pass can be vexing . when a designer elects to change materials , the attachment methods referred to throughout the specification will need to be adapted according to the characteristics of the new materials , as is known generally . as configured in fig1 rods 142 - 148 and rods 152 - 158 are inserted through holes 103 and retained therein by sliding keyhole brackets 160 . most preferably , rods 142 - 148 and 152 - 58 have a diameter larger than holes 103 , 109 , except at the end which passes through the holes . this may be best seen in fig3 and 4 , which illustrate rod 142 in greater detail . the increased diameter may be obtained by a number of methods , such as wrapping a majority of the rod with cushioning foam or by other coatings , such as a plastisol brand coating . as an alternative , a rod may be machined or produced to have different diameters at opposite ends . as a further alternative , holes 103 might be drilled with one side of strut 102 having a hole larger in diameter than the other side of strut 102 . in the preferred embodiment , plastisol brand coating 130 is used to cover the majority of rods 142 - 158 adjacent hole 103 and extending to an end of rod 142 opposite hole 103 . rod 142 is inserted through hole 103 until the plastisol brand coating 130 is pressed against hole 103 to retain rod 142 at a first side of hole 103 . then , sliding keyhole bracket 160 is slid downward to engage with rod 142 at necked down region 134 , thereby retaining the rod at the second side of hole 103 . the core of rod 142 will preferably consist of a rod of diameter equal to sections 132 and 136 , and will preferably be lathed , turned forged or otherwise formed down to a smaller diameter at necked down region 134 . subsequent to this machining , rod 142 will preferably be coated with one of the well - known anti - corrosive coatings , and then be coated with plastisol brand coating material 130 . as is partially visible in fig2 sliding keyhole bracket 160 is provided on the back side of both vertical strut 102 and vertical strut 106 . sliding keyhole bracket 170 , shown in fig7 and also partially visible in fig2 is provided on the back side of horizontal strut section 108 . the attachment between brackets 160 , 170 and u - tube 101 is not a rigid attachment , but rather a snug , but slidable interrelationship . more specifically and as best visible in fig8 brackets 160 , 170 have slots 166 machined therein through which rivet 180 or other similar fasteners may be attached . rivet 180 will stay within slot 166 , but will allow bracket 160 to slide longitudinally therein . to ensure a smoother sliding motion between bracket 160 and u - tube 101 , while still ensuring a solid mounting therebetween , additional anti - friction material such as nylon sleeve 184 and nylon washer 182 may be provided for around rivet 180 and between brackets 160 , 170 and u - tube 101 . in the preferred embodiment , only a few keyholes 163 are provided between adjacent rivet slots 166 , thereby ensuring a necessary relatively consistent spacing between keyholes 163 and u - tube 101 . as is best visible in fig5 - 7 , sliding keyhole brackets 160 , 170 are comprised of a number of these keyhole shaped openings 163 having a larger diameter opening 164 which is dimensioned to be approximately the same diameter as holes 103 , and a slightly narrower opening 162 . opening 162 is sized to allow necked down region 134 of rod 142 to fit therein , while not allowing either portion 132 or 136 to pass therethrough . by so dimensioning keyhole openings 163 , sliding keyhole brackets 160 , 170 may be initially aligned with larger diameter openings 164 aligned with holes 103 , 109 . rods 142 - 158 are then inserted through holes 103 , 109 and openings 164 . finally , sliding keyhole brackets 160 , 170 are slid so that narrow opening 162 slips between sections 132 and 136 , surrounding section 134 and retaining section 134 against motion along the longitudinal axis of rod 142 . once sliding keyhole brackets 160 , 170 are positioned to retain rods 142 - 158 in position , brackets 160 , 170 may be locked in place by inserting a lock through holes 168 , which mate with corresponding holes on u - tube 101 . rods 142 - 148 do not need to be inserted into exactly corresponding holes 103 as rods 152 - 158 are inserted into . as shown in fig1 rods 142 - 148 are inserted into holes 103 at the same heights as rods 152 - 158 . however , the particular holes 103 , 109 used will depend upon the particular cargo to be carried . additional cargo securement may be provided by attaching additional locking frames . a smaller square tube 120 is illustrated as inserted into receiver 112 in fig1 and 2 . this square tube 120 serves to enclose larger cargo supported from rods 142 - 158 , such as bicycles , thereby preventing removal therefrom . the actual length of tube 120 is not critical to the invention , and may us $ extend partially as illustrated or may , for example , extend down to base 110 . on an inner surface of tube 120 , an additional eye - bolt or d - ring is shown . the use of this particular anchor point offers unique advantage in preventing any rattling of tube 120 within receiver 112 during transport . tube 120 may alternatively be inserted into receiver 115 , particularly when the load to be carried is much smaller . hitch 105 is shown by illustration in fig2 to have an angled leading edge for insertion into a vehicle receiver . this was found to simplify installation therein , though the actual angle is not critical and in the preferred embodiment an angle of only five degrees is used . hitch receiver lock 400 , which in the preferred embodiment is integrally mounted to hitch 105 , is used to prevent relative motion between a hitch receiver and carriers such as carrier i 00 . a similar suitable lock is illustrated in co - pending application ser . no . 08 / 920 , 797 the contents and teachings which are incorporated completely herein by reference . hitch receiver lock 400 has a lever arm 410 which acts as a lever to multiply forces . arm 410 may be solid , tubular , u - shaped or other geometry . while material is not critical , ordinary mild steel or carbon steel has been found to work satisfactorily . extending through z - strut 104 is hand screw 420 , having threads 422 and a protruding tip which engages with clip 424 . at the end of arm 410 opposite hand - screw 420 is force tip 450 which is used to apply force to the vehicle receiver . between force tip 450 and hand screw 420 , but closer to force tip 450 , is retention strap 430 . arm 410 is pivotally mounted to retention strap 430 at pivot 452 , to allow hand screw 420 to move tip 450 closer to or further from hitch 105 , and multiply the force thereof by the difference in distance from tip 450 to strap 430 and strap 430 to screw 420 . in other words , if the retention strap 430 is twice as far from hand screw 420 as it is from force tip 450 , then the force on active edge 452 will be twice the force on hand screw 420 . by multiplying the force this way , it is relatively easy for a person to very securely clamp down and lock hitch 105 to a standard receiver . to accommodate larger receivers , arm 410 is preferably removable from strap 430 at pivot 452 . this is preferably accomplished by providing a bolt or other similar fastener at pivot 452 which may be removed . arm 410 may then be reinstalled upside - down from the view shown in fig2 so that tip 450 does not protrude towards hitch 105 at all beyond arm 410 . that way , a larger receiver can be accommodated . in addition , a bushing will preferably be bolted onto hitch 105 which is of larger size to more tightly fit within , for example , a two - inch receiver . in order to allow this simple reversal while still allowing hand screw 420 to both raise and lower arm 410 , clip 424 is provided and illustrated in much greater detail in fig9 . where clip 424 engages with hand screw 420 , hand screw 420 will preferably have a groove of slightly reduced diameter . clip 424 will be slotted and open to the end , and so may be slid about screw 420 at the location of the groove . in addition , clip 424 has several undulations which allow it to drive arm 410 upwards and downwards , while only being slid over one end and into arm 410 , so as to be easily removable therefrom . as an added benefit , lock 400 serves to act as a skid - plate , so that if carrier 100 should inadvertently come in contact with a road surface or obstacle , the lowest point is arm 410 . since arm 410 is a low - cost and readily replaceable component , the damage to carrier 100 will be minimal and easily repairable . in addition , receiver lock 400 serves to reinforce hitch 105 , thereby adding strength in an important region of carrier 100 . fig1 illustrates hitch 105 by cross - section taken along line 10 &# 39 ; in fig2 with the addition of a receiver size converter . visible therein is hitch 105 and core stiffener 220 . core stiffener 220 extends form adjacent the receiver end of hitch 105 to immediately adjacent hand screw 420 . stiffener 220 in the preferred embodiment may also be threaded or have a nut welded thereto through which hand screw 420 turns . the greatest forces on carrier 100 are generally found in the vicinity of hitch 105 , so the additional strength provided by stiffener 220 is generally desirable . certainly other tube sizes could be used for z - strut 104 , but in the preferred embodiment stiffener 220 provides the necessary strength while not increasing the weight of carrier 100 any more than necessary . by using a round tube for stiffener 220 , a problem of interference between weld seams in the stock materials is addressed . so long as the weld seam that might be found on the inside of hitch 105 does not line up with the contact between hitch 105 and the outer diameter of stiffener 220 , the weld seam will not interfere . furthermore , if the weld seam does interfere , a common drill bit or reamer can be used to open up space for stiffener 220 in an easy operation , where with square tubing the process of opening up the space would be much more complicated . where a nut is welded to stiffener 220 for threading with screw 420 , the nut should be aligned with the inside top of hitch 105 at the time of assembly , so that forces against the nut press the nut securely against hitch 105 . around hitch 105 is a size enlarging sleeve 205 , which is most preferably removably bolted to receiver 105 by flat head screw 210 and retained in place by nut 215 . should screw 210 rust to nut 215 and become unremovable therefrom , only screw 210 and nut 215 will need to be replaced , where if either receiver 105 or enlarging sleeve 205 were threaded , replacement of rusted components would be more difficult and expensive . sleeve 205 may only extend for a few inches longitudinally along hitch 105 , sufficient to properly fill available space within the larger receiver while still adding only minimal weight to carrier 100 . as will be readily understood from the easy hitch removal and self - supporting nature of carrier 100 , rather than having to separately remove all of the cargo , the entire carrier 100 may be used as a storage center , and be ready to transport for the next outing . this is a distinct advantage in the marketplace , since carriers typically detract from the aesthetic appearance of the vehicle and are desirably removed when not in use . most prior art carriers are not free standing and must be disassembled at least partially during removal or after removal for storage . the cargo must be removed . to prepare for the next outing the entire process must be reversed . carriers designed in accord with the present invention are simply slid off of the receiver hitch and stored , ready for re - use another time without any further disassembly or unpacking . particularly for those persons seeking leisure , this is a distinct advantage . while the foregoing details what are felt to be the preferred embodiments of the invention , no material limitations to the scope of the claimed invention are intended . further , features and design alternatives that would be obvious to one of ordinary skill in the art are considered to be incorporated herein . specific materials , different arrangements of basic components illustrated herein , special coatings and other such deviations are taught by the present disclosure and deemed included herewith , even where not specifically recited . known variations would be readily applied , by those of ordinary skill , to the present invention . the scope of the invention is set forth and particularly described in the claims hereinbelow . | 8 |
due to the need to play or need for distraction of many ring wearers , and due to the wear and tear that is associated with it , there is a need for a ring which downright invites to play , however , without being subject to undesirable signs of wear in the process . therefore , the present invention is based on the idea to provide a ring comprising two separate individual rings that are fitted into one another in such a way that one ring is positioned concentrically with respect to the other ring , so that both rings can be rotated relative to each other . to prevent the occurrence of undesirable friction between the two rings during such a rotation , there is at least one sliding ring inserted between the two rings , which serves as bearing surface for at least one of the two rings , so it can be rotated , with respect to the respective other ring , around it without the occurrence of signs of wear and tear . in particular , the ring according to the invention is a jewelry ring which comprises a first outer ring having an inner surface area , a second inner ring having an outer surface area , and at least one sliding ring which are arranged concentrically with respect to one another in such a way that the at least one sliding ring is located between the inner surface area of the first ring and the outer surface area of the second ring . by means of this concentric arrangement of the rings , it can be guaranteed that during a rotation , the second ring does not come into contact with the first ring , so that the signs of wear that usually result from the rotation can be avoided . in fact , the first ring slides along its inner surface area on the sliding ring , which due to the small coefficient of sliding friction between the at least one sliding ring and said first ring only results in microscopically small signs of wear . instead of only the first ring sliding on the at least one sliding ring , naturally , it is also possible that both the first ring and the second ring are arranged slidingly with respect to the at least one sliding ring , or that only the second ring can perform a sliding movement relative to the at least one sliding ring . larger signs of wear between the first and second rings are effectively avoided by arranging the first ring around the second ring in such a way that the inner surface area of the first ring is opposite and spaced apart by the at least one sliding ring from the outer surface area of the second ring . by this , it can be guaranteed that an appropriate ring gap between the inner surface area of the first ring and the outer surface area of the second ring is always present , which prevents a rubbing together of the two rings . indeed , the first ring also encloses the at least one sliding ring in such a way that a ring gap is created between the inner surface area of the first ring and the at least one sliding ring , but this ring gap is only about half the ring gap between the first and second rings , so that even in case of a tilting of the first and second rings they cannot come into contact with one another . in order to effectively avoid such a tilting and to improve the sliding process of the two rings with respect to each other , it can be advantageous , especially with wide rings , to insert more than only one sliding ring ( for example two , three , or even more sliding rings ) between the first and second rings , whereby an undesired tilting of the two rings is essentially avoided . in order to be able to tightly mount the at least one sliding ring on the outer surface area of the second ring , the at least one sliding ring has an inner circumference that is designed as a cylindrical clamping surface . if a cylindrical clamping surface is mentioned here , it means the inner circumference of the sliding ring , by means of which the at least one sliding ring clamps onto the outer surface area of the second ring due to its elastic properties , provided the inside diameter of the at least one sliding ring is slightly smaller than the diameter of the outer surface area of the second ring , onto which it is to be mounted . in order to have only small friction losses while sliding the inner surface area of the first ring on the at least one sliding ring , the at least one sliding ring has opposite the cylindrical clamping surface an outer circumference that , in cross - section , is designed as convexly curved sliding surface . besides the reduction of friction losses , this convexly curved form of the sliding surface of the at least one sliding ring additionally serves to secure the position of the first ring , which is explained in more detail later on in the present invention . to secure the position of the first and second rings , the at least one sliding ring further essentially has two planar wall sections which radially extend between the cylindrical clamping surface and the convexly curved sliding surface . in case of a large axial stress on the two rings , these two planar wall sections rest against a recess formed in the second ring and in particular the walls thereof . correspondingly , the inner surface area of the first ring also has at least one circular recess , into which the at least one sliding ring engages , so that a securing of the position in the axial direction is also guaranteed with regard to the first ring . in order to optimize the friction conditions between the first ring and the sliding ring , the at least one recess in the inner surface area of the first ring is designed as concave sliding ring depression , into which the convexly curved sliding ring surface of the at least one sliding ring at least partially engages and locks in place , so that the convex curvature of the sliding ring surface of the at least one sliding ring continues outside the sliding ring depression in the inner surface area of the first ring . in order to prevent that the at least one sliding ring comes off the outer surface area of the second ring or is removed in any other way while sliding the first ring onto the second ring during production of the jewelry ring , the at least one recess in the outer surface area of the second ring is designed as ring groove , into which the at least one sliding ring engages at least partially with its planar wall sections . consequently , the cylindrical clamping surface of the at least one sliding ring is at the base of the ring groove of the second ring and the convexly curved sliding surface protrudes from the ring groove and encloses the outer surface area of the second ring . in order to permanently guarantee these geometric relationships of the individual rings with respect to each other , the ring groove exhibits a radial depth dimension which is less than the radial thickness dimension of the at least one sliding ring , measured between the cylindrical clamping surface and the outermost point of the convexly curved sliding surface of the sliding ring . as explained in more detail later on , during production of the jewelry ring , the first ring is slid onto the second ring , however , in the process , the at least one sliding ring has to be slightly compressed in the radial direction until it can expand into the concave recess of the inner surface area of the first ring . in order to allow this radial compression of the at least one sliding ring , the ring groove exhibits a trapezoidal form that widens in the direction of the outer surface area of the second ring , resulting in the at least one sliding ring being able to expand sideways in it under radial stress . in particular , the trapezoidal form of the ring groove widens radially outward with respect to the planar wall sections of the sliding ring , so that said ring can expand with low strain in the ring groove . in order to keep friction losses between the at least one sliding ring and the first ring as small as possible , for the at least one sliding ring a material should be selected where the coefficient of sliding friction between the at least one sliding ring and the first ring is as small as possible . in particular , the coefficient of sliding friction should be less than 0 . 05 . such a low coefficient of sliding friction can in particular be guaranteed if the at least one sliding ring is made of teflon ® ( ptfe ). to make the at least one sliding ring out of teflon ® additionally entails the further advantageous effect that in this case , the jewelry ring according to the invention can also be subjected to aggressive environmental conditions , such as for example salt water , certain acids and bases , since , as a rule , teflon ® is resistant with regard to such an attack . a further advantage that making the sliding ring out of teflon ® entails is that teflon ® possesses a self - lubricating property , so that the sliding joint between the sliding ring and the first ring does not have to be lubricated . since , circumferentially , the at least one sliding ring radially protrudes from the outer surface area of the second ring with its convex sliding surface , so that the first ring has to be pressed onto it and thereby experiences a radial strain , both the first ring and the second ring should be made of a metal that is essentially insensitive to such stresses . in particular , it would be advantageous to make the first and / or second ring of a metal from the group of metals consisting of gold , silver , platinum , titanium , brass , and nirosta steel . in order to allow for the sliding into one another of the first and second rings without damaging the sliding ring in the process , at least one front end of the first ring , a radius is formed which extends at the transition of the inner surface area to the front end of the first ring . the conically widening phase - like radius serves to ride in such a way onto the projecting part of the at least one sliding ring over the outer surface area of the second ring while sliding the first ring onto the second ring that the sliding ring is radially compressed in order to facilitate the nesting of the two rings . in accordance with another aspect of the present invention , a method for the production of a jewelry ring comprising a first ring having an inner surface area , a second ring having an outer surface area , and at least one sliding ring is proposed . in order to be able to arrange these three individual components concentrically with respect to each other , so that the at least one sliding ring is located between the inner surface area of the first ring and the outer surface area of the second ring , first , the at least one sliding ring is mounted on the outer surface area of the second ring in order to be able to subsequently slide the first ring onto the second ring provided with the at least one sliding ring . since according to a preferred embodiment the at least one sliding ring is made of teflon ® ( ptfe ) and , consequently , can only be subjected to minor stretching , the at least one sliding ring is slit open in at least one place prior to mounting in order to thereby facilitate the mounting of it on the second ring . in order to guarantee a securing of the position between the first and second rings , prior to mounting of the at least one sliding ring , both in the inner surface area of the first ring and in the outer surface area of the second ring at least one circular recess each is formed , into each of which the at least one sliding ring partially engages . these recesses are therefore designed in such a way that the at least one sliding ring is essentially entirely circumferentially accommodated , so that axial movements of the two rings with respect to one another are essentially eliminated . as has become apparent from the previous explanations , the at least one sliding ring slightly protrudes with its external , circumferential convex sliding surface from the outer surface area of the second ring , which makes the sliding of the first ring onto the second ring more difficult . however , in order to neither damage the at least one sliding ring nor run the risk of pushing said ring out of the ring groove in the outer surface area of the second ring while sliding the first ring onto the second ring , prior to mounting the at least one sliding ring , the first ring is chamfered at least one front end in the area of its transition to the inner surface area in such a way that the radius formed circumferentially rides onto the at least one sliding ring while sliding the second and first rings into each other , so that said sliding ring is radially compressed . in the following , the present invention is explained in more detail with reference to two purely exemplary embodiments which are explained in more detail with reference to the following drawings . fig1 shows a cross - section of the upper half of a narrow ring according to the invention having a sliding ring ; and fig2 shows a cross - section of the upper half of a wide ring according to the invention having two sliding rings . in both figures , the same or similar components are labeled with identical reference numerals . the jewelry ring 1 depicted in cross - section in fig1 essentially comprises a first ring 2 , a second ring 3 , and a sliding ring 4 . first ring 2 , second ring 3 , and sliding ring 4 are arranged concentrically with respect to each other in such a way that first ring 2 circumferentially encloses second ring 3 and sliding ring 4 . sliding ring 4 , in turn , circumferentially encloses second ring 3 , so that sliding ring 4 is located between the inner surface area of first ring 2 and the outer surface area of second ring 3 . if viewed in cross - section , sliding ring 4 has a cylindrical clamping surface 7 which , in the fitted state , points toward the center of jewelry ring 1 . from clamping surface 7 , two essentially planar wall sections 9 radially extend outward , which are followed by a convexly curved sliding surface 8 , so that the sliding ring 4 has a virtually tunnel - shaped cross - section . to enable first ring 2 to slide on the convex sliding surface of sliding ring 4 with friction losses that are as small as possible , sliding ring 4 consists of a sliding material with only a very small coefficient of sliding friction with respect to first ring 2 , for which reason sliding ring 4 is preferably made of teflon ® ( ptfe ). the first ring 2 has in its inner surface area a circular recess which in the example shown here is designed as concavely curved sliding ring depression 6 . on its right front side 10 or in the transition area between the right front side 10 to the inner surface area of first ring 2 , first ring 2 has a circular , phased section 11 . in other words , the transition area between the right front side 10 and the inner surface area is chamfered , as indicated by the radius arrow ( r 0 , 2 ). the advantageous effect of this chamfered circular section 11 is explained in more detail later on in connection with the assembly of the ring . the second ring 3 also has a recess in its outer surface area which , however , is designed as trapezoidal ring groove 5 , the lateral wall areas of which radially widen outwards . both the first ring 2 and the second ring 3 are made of a metal such as for example silver , white or yellow gold ( 750 karat ), platinum , titanium , brass , or nirosta steel . preferably , both rings 2 , 3 are made of one and the same material , however , naturally special aesthetic effects may also occur if the two rings 2 , 3 are made of different materials . as can be seen in fig1 , the two rings 2 , 3 are hollow cylindrical bodies , the front surfaces of which , however , do not end flat but rather describe a wave form , which may lead to especially aesthetic effects if first ring 2 is rotated with respect to second ring 3 . sliding ring 4 is inserted between the two rings 2 , 3 , so that the two rings 2 , 3 do not rub against each other in case of a rotation . sliding ring 4 is wedged in the trapezoidal ring groove 5 in such a way that the clamping surface 7 of sliding ring 4 clamps against the ring groove base of ring groove 5 . the planar wall sections of sliding ring 4 extend in ring groove 5 , the wall areas of trapezoidal ring groove 5 departing radially outward from the planar wall sections 9 . sliding ring 4 protrudes with its exterior circumference in form of the convexly curved sliding surface 8 from ring groove 5 of second ring 3 and dips with a section of the convexly curved sliding surface 8 in the sliding ring depression 6 of the first ring . as can be seen from fig1 , a curved ring gap rs 1 extends between the convexly curved sliding surface 8 of sliding ring 4 and the sliding ring depression 6 , so that the first ring 2 can easily be rotated with respect to sliding ring 4 or second ring 3 . the measurements of rings 2 , 3 , 4 are dimensioned in such a way that a ring gap rs 2 also results between first ring 2 and second ring 3 , so that in case of a rotation , first ring 2 and second ring 3 cannot come into contact with one another . the dimensions of rings 2 , 3 , 4 are dimensioned in such a way that ring gap rs 1 is smaller than ring gap rs 2 . preferably , ring gap rs 1 has an inner width of 0 . 1 mm and ring gap rs 2 has an inner width of 0 . 2 mm . since sliding ring 4 is made of a relatively low stretch material , such as for example teflon ® ( ptfe ), for mounting , sliding ring 4 is slit open in at least one place , so that the sliding ring 4 can be bent up slightly in order to subsequently be fitted into the ring groove 5 . since the radial thickness dimension of sliding ring 4 is larger than the radial depth dimension of ring groove 5 , sliding ring 4 protrudes from ring groove 5 , so that during assembly of jewelry ring 1 , sliding ring 4 needs to be compressed in the radial direction to allow first ring 2 to be slid on . in order to facilitate such a compressing of sliding ring 4 in the radial direction , first ring 2 is provided with the circular radius 11 at the transition between the inner surface area and the right front end 10 described previously , so that during the sliding on of first ring 2 , radius 11 rides onto the convexly curved sliding surface 8 of sliding ring 4 in such a way that said sliding ring is radially compressed by means of the wedging action of radius 11 . since sliding ring 4 naturally has to give way in another direction during such a radial compression , the trapezoidal ring groove 5 widens linearly with respect to the planar wall sections 9 of sliding ring 4 , as is indicated by the angle symbol . that way , in case of radial compression , sliding ring 4 can give way sideways into these wedge - shaped areas , whereby first ring 2 can easily be slid onto second ring 3 that is provided with sliding ring 4 . in fig2 , a jewelry ring 1 is depicted that in its structural makeup essentially equals the jewelry ring 1 described with reference to fig1 . however , differing from fig1 , jewelry ring 1 depicted in fig2 has a larger width , for which reason two sliding rings 4 , that are spaced apart from each other , are inserted between first ring 2 and second ring 3 here , whereby a tilting of first ring 2 with respect to second ring 3 is to be avoided . since in the embodiment shown in fig2 , the positioning of the second sliding ring 4 is identical with respect to the formation of ring groove 5 and sliding ring depression 6 , at this point , it is simply referred to the explanations given previously . as an alternative to the wide jewelry ring depicted in fig2 , it would for example be possible to design first ring 2 with two parts in form of two narrower rings instead of providing one wide first ring , so that these two narrower rings can be rotated around the second ring independently of each other . | 0 |
the present invention resides in a car coaster for automobiles that absorbs condensed moisture from the outside of beverage containers which contain a cold beverage . throughout history , various societies and civilizations have endeavored to produce devices for the sole purpose of preventing the accumulation of adherent moisture associated with the use of liquids contained in moisture - bearing vessels , containers , etc . the accumulation of moisture on the outside of a container occurs when the liquid or beverage contained in the container is at a temperature lower than the dew point of the environment . currently , it is commonplace to see individuals struggle with coasters which do not adequately dispose of adherent moisture on beverage containers and which additionally cling to the bottom of said beverage containers . many common coasters in use today are characterized by a one layer construction of absorbent material composed of cork , wood , paper fiber or cotton , which when saturated with moisture no longer provide a moisture - proof , protective device . these types of coasters provide for a moisture - adhesive seal , which joins coasters to containers . embodiments of the car coasters of the present invention are hereinafter described with reference to the drawings in which identical or corresponding parts are indicated by the same reference characters or numbers through the several views . fig1 is a front perspective view of the car coaster ( 2 ) herein . car coaster ( 2 ) has a width ( 6 ) of 2 . 25 inches and a height ( 14 ) of 0 . 25 inch . car coaster ( 2 ) is constructed from a synthetic sponge ( 4 ) like material . preferably , the synthetic sponge ( 4 ) like material is constructed from a material marketed under the trade name of cello . another suitable or alternative material is marketed under the trade name spontex . other suitable synthetic sponges are constructed from polyurethane , cellulose , polyurethane / polyurea , polyvinyl alcohol and polyvinyl acetas . these types of sponges have densities of from about 0 . 50 g / in 3 to 1 . 60 g / in 3 in the dry state . they also have water absorption and wet wipe characteristics of from about 0 . 012 g / cm 2 sec to 0 . 19 g / cm 2 sec and from about 70 percent to about 90 percent respectively . the width of these synthetic sponges is from 2 inches to about 3 . 5 inches , with a height of from about ¼ inch to ¾ inch . the synthetic sponges herein have disc like characteristics with an upper surface area and a lower surface area wherein the upper surface area is constructed to receive a beverage container . in a preferred mode , the outside radius of the synthetic sponge is slightly larger than the inside radius of an automobile beverage container to provide bias , thus preventing the adhesive properties of condensed moisture on a beverage container from adhering to the synthetic sponge . fig2 is another view of the car coaster ( 2 ) shown in fig1 , except that the width ( 10 ) is 3 inches . fig3 is a front perspective view of the car coaster ( 2 ) shown in fig1 with the following exception : a layer of releasable adhesive ( 12 ) is contained on the bottom of car coaster ( 2 ). releasable adhesives ( 12 ) that are suitable for use herein include a contact , pressure sensitive , hightack adhesive such that when the car coaster ( 12 ) is placed in a cup holder the bottom of car coaster ( 12 ) will adhere to the cup holder . fig4 is substantially the same view as fig2 with the following exception : releasable adhesive layer ( 12 ) is attached to the bottom of synthetic sponge ( 4 ). the pressure sensitive adhesives herein are attached to the bottom surface of the synthetic sponges herein . the pressure sensitive adhesives can be constructed from strips , circular configurations or arc like configurations , which can form a variety of patterns on the bottom of the synthetic sponge . pressure sensitive adhesives that are suitable for use herein are random copolymers of isobutylene and paramethylstyrene and a tackfier , acrylic based isooctyl acrylate and acrylic based 2 - ethylhexyl acrylate as described in u . s . pat . no . 6 , 893 , 718b2 and u . s . pat . no . 6 , 861 , 139b2 the disclosures of which are incorporated by reference in their entirety herein . the above - identified pressure sensitive adhesives are manufactured by the 3m innovative properties company , located in saint paul , minn . fig5 is a front view of the car sponge ( 2 ) of fig4 which gives a better view of the relationship of the synthetic sponge ( 4 ) layer and the releasable adhesive ( 12 ) layer . obviously , many modifications and variations of the invention , as herein before set forth and claimed , may be made without departing from the spirit and scope thereof , and therefore , only such limitations should be imposed as are indicated in the appended claims . | 1 |
referring to fig1 , a portion of a vehicle ( pickup truck ) body , indicated generally at 20 , is shown . the body 20 includes a box 22 having a box bed 24 ( i . e ., the floor of the box 22 ), which can be seen located inboard of a wheel well opening 26 in a rear quarter panel 28 . the rear quarter panel 28 also includes a brake light opening 30 and a recess 32 within which a bumper ( not shown ) extends . the pickup body 20 has an endgate 34 mounted at the rearmost portion of the box 22 . referring now to fig1 - 5 , the endgate 34 is shown in both a vertical , closed position ( fig1 - 4 ) and a horizontal , fully open position ( fig5 ). the endgate 34 has an aft ( outer ) surface 36 and a forward ( inner ) surface 38 . a conventional latch assembly ( not shown ) may be employed to hold the endgate 34 in its closed position , and a conventional cable assembly ( not shown ) may be employed to hold the endgate 34 in its fully open position . the endgate 34 also includes a pair of hinges 40 ( only one shown ) pivotally connected to box side hinge structure 41 and defining a pivot axis 44 about which the endgate 34 pivots . when referring herein to two components being pivotally connected , this means that they are connected together but can pivot relative to one another . such an arrangement may be achieved , for example , when the components have aligned holes , with a rivet or bolt extending through the holes , thus holding the components together while allowing them to pivot about the rivet / bolt axis . a hinge arm 42 extends laterally from the hinge 40 and is pivotally fixed relative to the endgate 34 . the hinge arm 42 includes a crank attachment hole 46 for pivotally connecting to a crank mechanism 48 of an endgate counterbalance 50 . the crank mechanism 48 includes an l - shaped hinge pivot link 52 and an l - shaped crank pivot link 54 . the hinge pivot link 52 includes a first pivot hole 56 , through a first leg 60 , that pivotally connects to the crank attachment hole 46 and a second pivot hole 58 , through a second leg 62 , that pivotally connects to a first pivot hole 64 in a first leg 66 of the crank pivot link 54 . the crank pivot link 54 also includes a body pivot hole 68 located at an intersection of the first leg 66 and a second leg 70 . the body pivot hole 68 is used to pivotally mount the crank pivot link 54 to structure 72 , which is fixed relative to the body 20 . the second leg 70 includes a second hole 74 that pivotally connects to a first end 78 of an energy storage device 80 , which is also part of the endgate counterbalance 50 . the energy storage device 80 in the first embodiment is a gas strut , which includes a rod 82 . the first end 78 of the rod 82 is attached to the crank mechanism 48 with the rod 82 extending through box side structure 88 , and telescopically mounting in a gas cylinder 84 . the gas cylinder 84 is pivotally mounted to a mounting bracket 86 that mounts to vehicle structure under the box bed 24 . the crank mechanism 48 allows the gas strut 80 to extend forward in a generally horizontal orientation . thus , packaging concerns relating to a vertically mounted gas strut and tail lamp assembly ( not shown ) are avoided . moreover , in the case of a gas strut , this particular energy storage device 80 also provides a damping function while one is pivoting the endgate 34 . the operation of the endgate counterbalance 50 of fig1 - 5 will be discussed with reference to schematic fig6 - 8 . the phantom lines in fig6 - 8 extend between the various pivot points of the endgate counterbalance 50 . with the endgate 34 in its closed position ( fig6 ), the hinge arm 42 extends downward in a generally vertical direction . this position of the hinge arm 42 positions the links 52 , 54 of the crank mechanism 48 so that the gas strut ( energy storage device ) 80 is somewhat compressed . this compression produces a bias in the endgate opening direction . by having this bias , the endgate 34 preloads the latch assembly ( not shown ) that holds the endgate 34 closed , thus reducing the potential for squeak and rattle . moreover , during the last portion of the closing movement to the fully closed position , the endgate counterbalance , having this opening direction bias , will feel as if this last part of the motion is being damped , creating a desirable feel for the person closing the endgate 34 . as the endgate 34 begins to open , the hinge arm 42 will pivot the crank attachment hole 46 forward and upward , actuating the crank mechanism 48 such that the gas strut 80 moves toward its uncompressed position . the endgate 34 , then , will reach a cross - over position ( shown in fig7 ) where the endgate counterbalance 50 does not exert a bias in either the opening or closing direction . pivoting of the endgate 34 in either direction from this position will create a bias back toward this position . the cross - over position allows for greater ease in removal and installation of the endgate 34 from the body 20 since , when the endgate 34 is removed , the biases of the endgate counterbalance will tend to hold the hinge assemblies and locating features ( not shown ) in place . as the endgate 34 is rotated past the cross - over position toward the full open position ( shown in fig8 ), the hinge arm 42 will pivot into a generally horizontal position . this pivoting will cause the crank mechanism 48 to again compress the gas strut 80 , creating a bias in the endgate closing direction . thus , when one lifts up on the endgate 34 to close it , the endgate counterbalance 50 will assist by initially biasing the endgate toward the closed position . moreover , with the energy storage device 80 being a gas strut , the motion will be damped , creating a desirable feeling for the person moving the endgate 34 . fig9 illustrates a second embodiment . since this embodiment is similar to the first , similar element numbers will be used for similar elements , but employing 100 - series numbers . in this embodiment , the energy storage device 180 employed is a spring . while not providing all of the damping effect of a gas strut , it may reduce the cost of the overall endgate counterbalance 150 . in this embodiment , the hinge 140 still includes a hinge arm 142 that is pivotally connected to the first leg 160 of the hinge pivot link 152 . also , the second leg 162 of the pivot link 152 still pivotally connects to the first leg 166 of the crank pivot link 154 , which pivotally connects to structure 172 at the body pivot hole 168 . also , the second leg 170 of the crank pivot link 154 connects to a first end of the spring 180 . however , the l - shape of the crank pivot link 154 may be more of a closed angle to accommodate the connection of the forward end 186 of the spring 180 to vehicle structure ( not shown in fig9 ). the endgate counterbalance 150 still functions to provide for a cross - over position , thus allowing for the same functionality as the first embodiment . fig1 - 11 illustrate a third embodiment . since this embodiment is similar to the first , similar element numbers will be used for similar elements , but employing 200 - series numbers . in this embodiment , the energy storage device is a torque rod 280 extending horizontally under the box bed 224 . while not providing all of the damping effect of a gas strut , it has less sensitivity to temperature changes than the gas strut . the hinge 240 still includes the hinge arm 242 that is pivotally connected to the hinge pivot link 252 . also , the hinge pivot link 252 still pivotally connects to the first leg 266 of the crank pivot link 254 , which pivotally connects to structure 272 at the body pivot hole 268 . the second leg 270 of the crank pivot link 254 connects to the first end of the torque rod 280 . however , the torque rod 280 then extends through the center of the body pivot hole 268 before extending toward a second end ( not shown ) that is rotationally fixed to vehicle structure ( not shown ). the endgate counterbalance 250 still functions to provide for a cross - over position , thus allowing for the same functionality as the first and second embodiments . while certain embodiments of the present invention have been described in detail , those familiar with the art to which this invention relates will recognize various alternative designs and embodiments for practicing the invention as defined by the following claims . | 1 |
the present invention provides recombinantly produced pfs230 and fragments derived from the protein that are useful for inducing an immune response when injected into a human or other host animal . pfs230 and homologs in other plasmodium species can be used to block transmission of a number of parasites associated with malaria . four species of the genus plasmodium infect humans , p . vivax , p . ovale , p . malariae , and p . falciparum . in addition other plasmodium species infect other animals . for instance , p . gallinaceum is responsible for avian malaria . pfs230 is expressed by the parasite while it undergoes gametocytogenesis in the human host . this antigen has been identified on day 2 of gametocytogenesis and continues to be produced as the gametocyte is taken up by the mosquito in a blood meal and emerges from the erythrocyte in the mosquito midgut . once the parasite emerges from the erythrocyte , pfs230 is exposed on the surface of the parasite , and is thus in contact with the components of the bloodmeal including antibodies and complement . the 9 . 4 kb open reading frame of the nucleic acid encoding pfs230 predicts a protein with a molecular weight of 363 , 243 daltons . pfs230 exists in at least two forms , a 360 kda form that does not radiolabel with 125 i and a 125 i radiolabeled form isolated from surface labeled gametes . the labeled form when sized under reducing conditions migrates as a 310 , 000 molecular weight band . these results suggest that the full - length 360 kda protein is processed to a 310 kda protein that is expressed on the surface of the gamete . a prior art mab 1b3 has been reported to immunoprecipitate a 230 kda protein from radiolabeled surface proteins of newly formed gametes and zygotes . this monoclonal antibody was reported to recognize two proteins of 260 , 000 and 230 , 000 mr on western blots . quakyi , et al ., j . immunol . 139 : 4213 - 4217 ( 1987 ), which is incorporated herein by reference . evidence provided here shows that the protein encoded by the gene of the present invention is the same protein as that recognized by mab 1b3 . in particular , antisera raised against fusion proteins expressed from the nucleic acids of the invention recognized bands similar to those reported for pfs230 . the antisera also immunoprecipitates 125 i - labeled pfs230 and reacts with the surface of intact gametes as assayed by indirect immunofluorescence . seq . id . no . 2 is the deduced amino acid sequence of the 9 . 4 kb gene . the deduced amino acid sequence of pfs230 codes for a 363 kda polypeptide having five distinct characteristics : 1 ) consistent with pfs230 being a non - integral membrane protein ( kumar & amp ; wizel , mol . biochem . parasitol ., 53 : 113 - 120 ( 1992 )), there is a presumptive signal sequence at the amino - terminus , but no other predicted hydrophobic or transmembrane regions ; 2 ) starting at amino acid 280 , there are 25 contiguous e residues ; 3 ) beginning with amino acid 379 , a four amino acid ( e - e - v - g ) ( seq id no : 3 ) repeat is repeated tandemly 8 times followed by 4 copies of an eight amino acid ( e - e - v - g - e - e / g - e / v - g ) ( seq id no : 4 ) repeat ; 4 ) there are three regions of highly negative net charge , including amino acids 273 - 325 , which contain the 25 e residues , amino acids 1147 - 1205 , and amino acids 1604 - 1668 ; and 5 ) there are six copies of a seven cysteine motif with the consensus sequence . the pfs230 proteins of the invention may be recombinantly produced or may be purified from parasites isolated from infected host organisms . methods for purifying desired proteins are well known in the art and are not presented in detail here . for a review of standard techniques see , methods in enzymology , &# 34 ; guide to protein purification &# 34 ;, m . deutscher , ed . vol . 182 ( 1990 ), which is incorporated herein by reference . for instance , pfs230 or its homologs in other species can be purified using affinity chromatography , sds - page , and the like . another aspect of the present invention relates to the cloning and recombinant expression of pfs230 and its homologs . the recombinantly expressed polypeptides can be used in a number of ways . for instance , they can be used as transmission - blocking vaccines , as described below . the recombinantly produced proteins can also be used for raising antibodies or for t cell and b cell epitope mapping . in addition , oligonucleotides from the cloned genes can be used as probes to identify homologous polypeptides in other species . the invention relies on routine techniques in the field of recombinant genetics , well known to those of ordinary skill in the art . a basic text disclosing the general methods of use in this invention is sambrook et al ., molecular cloning , a laboratory manual , cold spring harbor publish ., cold spring harbor , n . y . 2nd ed . ( 1989 ), which is incorporated herein by reference . pfs230 was immunoaffinity purified using mab 1b3 as described in detail below . the isolated protein was then digested with trypsin . the tryptic peptides were separated by reverse phase hplc and three well resolved peptides were microsequenced . from this amino acid sequence degenerate oligonucleotide probes were used to screen a p . falciparum sexual stage cdna library . other methods for isolating genes encoding pfs230 and its homologs can also be used . for instance , the amino acid sequence of the n - terminus can be determined and degenerate oligonucleotide probes , designed to hybridize to the desired gene , are synthesized . amino acid sequencing is performed and oligonucleotide probes are synthesized according to standard techniques as described , for instance , in sambrook et al ., supra . oligonucleotide probes useful for identification of desired genes can also be prepared from conserved regions of related genes in other species . for instance , probes derived from a gene encoding pfs230 may be used to screen libraries for homologous genes from other parasites of interest . other methods include the detection of restriction fragment length polymorphisms ( rflp ) between wild type and mutant strains lacking a pfs230 polypeptide . amplification techniques , such as the polymerase chain reaction ( pcr ) can be used to amplify the desired nucleotide sequence . u . s . pat . nos . 4 , 683 , 195 and 4 , 683 , 202 describe this method . sequences amplified by pcr can be purified from agarose gels and cloned into an appropriate vector according to standard techniques . genomic or cdna libraries are prepared according to standard techniques as described , for instance , in sambrook , supra . to construct genomic libraries , large segments of genomic dna are generated by random fragmentation or restriction enzyme degradation and are ligated with vector dna to form concatemers that can be packaged into the appropriate vector . two kinds of vectors are commonly used for this purpose , bacteriophage lambda vectors and plasmids . to prepare cdna , mrna from the parasite of interest is first isolated . eukaryotic mrna has at its 3 &# 39 ; end a string of adenine nucleotide residues known as the poly - a tail . short chains of oligo d - t nucleotides are then hybridized with the poly - a tails and serve as a primer for the enzyme , reverse transcriptase . this enzyme uses rna as a template to synthesize a complementary dna ( cdna ) strand . a second dna strand is then synthesized using the first cdna strand as a template . linkers are added to the double - stranded cdna for insertion into a plasmid or phage vector for propagation in e . coli . identification of clones in either genomic or cdna libraries harboring the desired nucleic acid segments is performed by either nucleic acid hybridization or immunological detection of the encoded protein , if an expression vector is used . the bacterial colonies are then replica plated on solid support , such as nitrocellulose filters . the cells are lysed and probed with either oligonucleotide probes described above or with antibodies to the desired protein . standard transfection methods are used to produce prokaryotic , mammalian , yeast or insect cell lines which express large quantities of the pfs230 polypeptide , which is then purified using standard techniques . see , e . g ., colley et al ., j . biol . chem . 264 : 17619 - 17622 , 1989 ; and guide to protein purification , supra . the nucleotide sequences used to transfect the host cells can be modified to yield the pfs230 polypeptide or fragments thereof , with a variety of desired properties . for example , the polypeptides can vary from the naturally - occuring sequence at the primary structure level by amino acid , insertions , substitutions , deletions , and the like . these modifications can be used in a number of combinations to produce the final modified protein chain . the amino acid sequence variants can be prepared with various objectives in mind , including facilitating purification and preparation of the recombinant polypeptide . the modified polypeptides are also useful for modifying plasma half life , improving therapeutic efficacy , and lessening the severity or occurrence of side effects during therapeutic use . the amino acid sequence variants are usually predetermined variants not found in nature but exhibit the same immunogenic activity as naturally occurring pfs230 . for instance , immunogenically active fragments comprising about 6 to about 300 amino acids are typically used . shorter fragments comprising bout 100 to about 200 amino acids , preferably about 130 to about 160 , may also be used . for use as vaccines , immunologically active fragments are typically preferred so long as at least one epitope capable of eliciting transmission blocking antibodies remains . preferred polypeptide fragments of the invention include those comprising one or more of the six copies of the seven - cysteine motif noted above . other modifications include the addition of a membrane anchoring sequence to the expressed protein . such modifications allow the protein to be expressed on cell surfaces and thereby improve immunogenicity . in general , modifications of the sequences encoding the homologous polypeptides may be readily accomplished by a variety of well - known techniques , such as site - directed mutagenesis ( see , gillman and smith , gene 8 : 81 - 97 , 1979 ) and roberts , s . et al ., nature 328 : 731 - 734 , 1987 ). one of ordinary skill will appreciate that the effect of many mutations is difficult to predict . thus , most modifications are evaluated by routine screening in a suitable assay for the desired characteristic . for instance , the effect of various modifications on the ability of the polypeptide to elicit transmission blocking can be easily determined using the mosquito feeding assays , described in quakyi et al ., supra . in addition , changes in the immunological character of the polypeptide can be detected by an appropriate competitive binding assay . modifications of other properties such as redox or thermal stability , hydrophobicity , susceptibility to proteolysis , or the tendency to aggregate are all assayed according to standard techniques . the particular procedure used to introduce the genetic material into the host cell for expression of the pfs230 polypeptide is not particularly critical . any of the well known procedures for introducing foreign nucleotide sequences into host cells may be used . these include the use of calcium phosphate transfection , spheroplasts , electroporation , liposomes , microinjection , plasmid vectors , viral vectors and any of the other well known methods for introducing cloned genomic dna , cdna , synthetic dna or other foreign genetic material into a host cell ( see sambrook et al ., supra ). it is only necessary that the particular procedure utilized be capable of successfully introducing at least one gene into the host cell which is capable of expressing the gene . the particular vector used to transport the genetic information into the cell is also not particularly critical . any of the conventional vectors used for expression of recombinant proteins in prokaryotic and eukaryotic cells may be used . expression vectors for mammalian cells typically contain regulatory elements from eukaryotic viruses . sv40 vectors include psvt7 and pmt2 . vectors derived from bovine papilloma virus include pbv - 1mtha , and vectors derived from epstein bar virus include phebo , and p205 . other exemplary vectors include pre4 , pmsg , pav009 / a + , pmt010 / a + , pmamneo - 5 , bacculovirus pdsve , and any other vector allowing expression of proteins under the direction of the sv - 40 early promoter , sv - 40 later promoter , metallothionein promoter , murine mammary tumor virus promoter , rous sarcoma virus promoter , polyhedrin promoter , cytomegalovirus promoter , or other promoters shown effective for expression in eukaryotic cells . the expression vector typically contains a transcription unit or expression cassette that contains all the elements required for the expression of the pfs230 polypeptide dna in the host cells . a typical expression cassette contains a promoter operably linked to the dna sequence encoding a pfs230 polypeptide and signals required for efficient polyadenylation of the transcript . the term &# 34 ; operably linked &# 34 ; as used herein refers to linkage of a promoter upstream from a dna sequence such that the promoter mediates transcription of the dna sequence . the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting . as is known in the art , however , some variation in this distance can be accommodated without loss of promoter function . the dna sequence encoding the pfs230 polypeptide will typically be linked to a cleavable signal peptide sequence to promote secretion of the encoded protein by the transformed cell . additional elements of the cassette may include selectable markers , enhancers and , if genomic dna is used as the structural gene , introns with functional splice donor and acceptor sites . enhancer elements can stimulate transcription up to 1 , 000 fold from linked homologous or heterologous promoters . enhancers are active when placed downstream from the transcription initiation site . many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues . for example , the sv40 early gene enhancer is suitable for many cell types . other enhancer / promoter combinations that are suitable for the present invention include those derived from polyoma virus , human or murine cytomegalovirus , the long term repeat from various retroviruses such as murine leukemia virus , murine or rous sarcoma virus and hiv . see , enhancers and eukaryotic expression , cold spring harbor pres , cold spring harbor , n . y . 1983 , which is incorporated herein by reference . in addition to a promoter sequence , the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination . the termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes . if the mrna encoded by the structural gene is to be efficiently translated , polyadenylation sequences are also commonly added to the vector construct . two distinct sequence elements are required for accurate and efficient polyadenylation : gu or u rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides , aauaaa , located 11 - 30 nucleotides upstream . termination and polyadenylation signals that are suitable for the present invention include those derived from sv40 , or a partial genomic copy of a gene already resident on the expression vector . efficient expression and secretion in yeast is conveniently obtained using expression vectors based on those disclosed in barr et al ., j . biol . chem . 263 : 16471 - 16478 , 1988 , or u . s . pat . no . 4 , 546 , 082 , which are incorporated herein by reference . in these vectors the desired sequences are linked to sequences encoding the yeast α - factor pheromone secretory signal / leader sequence . suitable promoters to use include the adh2 / gapdh hybrid promoter as described in cousens et al ., gene 61 : 265 - 275 ( 1987 ), which is incorporated herein by reference . yeast cell lines suitable for the present invention include bj 2168 ( berkeley yeast stock center ) as well as other commonly available lines . any of a number of other well known cells and cell lines can be used to express the polypeptides of the invention . for instance , prokaryotic cells such as e . coli can be used . eukaryotic cells include , chinese hamster ovary ( cho ) cells , cos cells , mouse l cells , mouse a9 cells , baby hamster kidney cells , c127 cells , pc8 cells , and insect cells . following the growth of the recombinant cells and expression of the pfs230 polypeptide , the culture medium is harvested for purification of the secreted protein . the media are typically clarified by centrifugation or filtration to remove cells and cell debris and the proteins are concentrated by adsorption to any suitable resin or by use of ammonium sulfate fractionation , polyethylene glycol precipitation , or by ultrafiltration . other routine means known in the art may be equally suitable . further purification of the pfs230 polypeptide can be accomplished by standard techniques , for example , affinity chromatography , ion exchange chromatography , sizing chromatography , his 6 tagging and ni - agarose chromatography ( as described in dobeli et al . mol . and biochem . parasit . 41 : 259 - 268 ( 1990 )), or other protein purification techniques to obtain homogeneity . the purified proteins are then used to produce pharmaceutical compositions , as described below . a further aspect of the invention includes antibodies against pfs230 or its homologous polypeptides . the antibodies are useful for blocking transmission of parasites . thus , antibodies can be used as therapeutic agents to block transmission . the multitude of techniques available to those skilled in the art for production and manipulation of various immunoglobulin molecules can be readily applied to block transmission . as used herein , the term &# 34 ; immunoglobulin &# 34 ; refers to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes . the recognized immunoglobulin genes include the kappa , lambda , alpha , gamma , delta , epsilon and mu constant region genes , as well as the myriad immunoglobulin variable region genes . immunoglobulins may exist in a variety of forms besides antibodies , including for example , fv , fab , and f ( ab ) 2 , as well as in single chains . for a general review of immunoglobulin structure and function see , fundamental immunology , 2d ed ., w . e . paul ed ., ravens press , new york , ( 1989 ) which is incorporated herein by reference . monoclonal antibodies which bind pfs230 can be produced by a variety of means . the production of non - human monoclonal antibodies , e . g ., murine , lagomorpha , equine , etc ., is well known and may be accomplished by , for example , immunizing the animal with a preparation containing pfs230 . antibody - producing cells obtained from the immunized animals are immortalized and screened , or screened first for the production antibodies which bind pfs230 and then immortalized . for a discussion of general procedures of monoclonal antibody production see harlow and lane , antibodies , a laboratory manual cold spring harbor publications , new york ( 1988 ), which is incorporated herein by reference . it may be desirable to transfer the antigen binding regions of the non - human antibodies , e . g ., the f ( ab &# 39 ;) 2 or hypervariable regions , to human constant regions ( fc ) or framework regions by recombinant dna techniques to produce substantially human molecules . such methods are generally known in the art and are described in , for example , u . s . pat . no . 4 , 816 , 397 , ep publications 173 , 494 and 239 , 400 , which are incorporated herein by reference . alternatively , one may isolate dna sequences which encode a human monoclonal antibody or portions thereof that specifically bind to pfs230 by screening a dna library from human b cells according to the general protocol outlined by huse et al ., science 246 : 1275 - 1281 ( 1989 ), incorporated herein by reference , and then cloning and amplifying the sequences which encode the antibody ( or binding fragment ) of the desired specificity . the pfs230 polypeptides of the present invention are also useful as prophylactics , or vaccines , for blocking transmission of malaria or other diseases caused by parasites . compositions containing the polypeptides are administered to a subject , giving rise to an anti - pfs230 polypeptide immune response . the pfs230 polypeptide - specific antibodies then block transmission of the parasite from the subject to the arthropod vector , preventing the parasite from completing its life cycle . an amount of prophylactic composition sufficient to result in blocking of transmission is defined to be an &# 34 ; immunologically effective dose .&# 34 ; the isolated nucleic acid sequence coding for pfs230 or its homologous polypeptides can also be used to transform viruses which transfect host cells in the susceptible organism . live attenuated viruses , such as vaccinia or adenovirus , are convenient alternatives for vaccines because they are inexpensive to produce and are easily transported and administered . vaccinia vectors and methods useful in immunization protocols are described in , e . g ., u . s . pat . no . 4 , 722 , 848 , incorporated herein by reference . suitable viruses for use in the present invention include , but are not limited to , pox viruses , such as , canarypox and cowpox viruses , and vaccinia viruses , alpha viruses , adenoviruses , and other animal viruses . the recombinant viruses can be produced by methods well known in the art : for example , using homologous recombination or ligating two plasmids together . a recombinant canarypox or cowpox virus can be made , for example , by inserting the gene encoding the pfs230 , immunologically active segment of pfs230 or other homologous polypeptide into a plasmid so that it is flanked with viral sequences on both sides . the gene is then inserted into the virus genome through homologous recombination . the recombinant virus of the present invention can be used to induce anti - pfs230 polypeptide antibodies in mammals , such as mice or humans . in addition , the recombinant virus can be used to produce the pfs230 polypeptides by infecting host cells which in turn express the polypeptide . the present invention also relates to host cells infected with the recombinant virus of the present invention . the host cells of the present invention are preferably eukaryotic , such as yeast cells , or mammalian , such as bsc - 1 cells . host cells infected with the recombinant virus express the pfs230 polypeptides on their cell surfaces . in addition , membrane extracts of the infected cells induce transmission blocking antibodies when used to inoculate or boost previously inoculated mammals . in the case of vaccinia virus ( for example , strain wr ), the sequence encoding the pfs230 polypeptides can be inserted into the viral genome by a number of methods including homologous recombination using a transfer vector , ptkgpt - ofis as described in kaslow et al ., science 252 : 1310 - 1313 , 1991 , which is incorporated herein by reference . the pfs230 polypeptides , or recombinant viruses of the present invention can be used in pharmaceutical and vaccine compositions that are useful for administration to mammals , particularly humans , to block transmission of a variety of infectious diseases . the compositions are suitable for single administrations or a series of administrations . when given as a series , inoculations subsequent to the initial administration are given to boost the immune response and are typically referred to as booster inoculations . suitable formulations are found in remington &# 39 ; s pharmaceutical sciences , mack publishing company , philadelphia , pa ., 17th ed . ( 1985 ), which is incorporated herein by reference . the pharmaceutical compositions of the invention are intended for parenteral or oral administration . preferably , the pharmaceutical compositions are administered parenterally , e . g ., subcutaneously , intradermally , or intramuscularly . thus , the invention provides compositions for parenteral administration that comprise a solution of the agents described above dissolved or suspended in an acceptable carrier , preferably an aqueous carrier . a variety of aqueous carriers may be used , e . g ., water , buffered water , 0 . 4 % saline , 0 . 3 % glycine , hyaluronic acid and the like . these compositions may be sterilized by conventional , well known sterilization techniques , or may be sterile filtered . the resulting aqueous solutions may be packaged for use as is , or lyophilized , the lyophilized preparation being combined with a sterile solution prior to administration . the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions , such as ph adjusting and buffering agents , tonicity adjusting agents , wetting agents and the like , for example , sodium acetate , sodium lactate , sodium chloride , potassium chloride , calcium chloride , sorbitan monolaurate , triethanolamine oleate , etc . for solid compositions , conventional nontoxic solid carriers may be used which include , for example , pharmaceutical grades of mannitol , lactose , starch , magnesium stearate , sodium saccharin , talcum , cellulose , glucose , sucrose , magnesium carbonate , and the like . for oral administration , a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients , such as those carriers previously listed , and generally 10 - 95 % of active ingredient and more preferably at a concentration of 25 %- 75 %. in therapeutic applications , pfs230 polypeptides or viruses of the invention are administered to a patient in an amount sufficient to prevent parasite development in the arthropod and thus block transmission of the disease . an amount adequate to accomplish this is defined as a &# 34 ; therapeutically effective dose .&# 34 ; amounts effective for this use will depend on , e . g ., the particular polypeptide or virus , the manner of administration , the weight and general state of health of the patient , and the judgment of the prescribing physician . the vaccines of the invention contain as an active ingredient an immunogenically effective amount of the pfs230 polypeptides or recombinant virus as described herein . useful carriers are well known in the art , and include , e . g ., thyroglobulin , albumins such as human serum albumin , tetanus toxoid , polyamino acids such as poly ( d - lysine : d - glutamic acid ), influenza , hepatitis b virus core protein , hepatitis b virus recombinant vaccine and the like . the vaccines can also contain a physiologically tolerable ( acceptable ) diluent such as water , phosphate buffered saline , or saline , and further typically include an adjuvant . adjuvants such as incomplete freund &# 39 ; s adjuvant , aluminum phosphate , aluminum hydroxide , or alum are materials well known in the art . in addition , the compositions can be administered in slow release particles as described in langer , science 249 : 1527 - 1533 ( 1990 ). vaccine compositions containing the polypeptides or viruses of the invention are administered to a patient to elicit a transmission - blocking immune response against the antigen and thus prevent spread of the disease through the arthropod vector . such an amount is defined as an &# 34 ; immunogenically effective dose .&# 34 ; in this use , the precise amounts again depend on the patient &# 39 ; s state of health and weight , the mode of administration , and the nature of the formulation , but generally range for the initial immunization ( that is for therapeutic or prophylactic administration ) from about 1 . 0 μg to about 1 mg of peptide for a 70 kg patient , followed by boosting dosages of from about 1 . 0 μg to about 100 μg of peptide pursuant to a boosting regimen over weeks to months . the following examples are offered by way of illustration , not by way of limitation . pfs230 was immunoaffinity purified using monoclonal 1b3 ( mab 1b3 ) ( quakyi , et al ., j . immunol ., 139 : 4213 - 4217 ( 1987 )). it was electroeluted from mab 1b3 - resin prepared as described in williamson , et al ., anal . biochem ., 206 : 359 - 362 ( 1992 ), reduced and alkylated , run in one lane of a 4 % gel and then transferred electrophoretically to nitrocellulose . the band corresponding to pfs230 was excised then digested in situ with trypsin . the tryptic peptides were separated by reverse phase hplc and three well resolved peptides were microsequenced . from this amino acid sequence degenerate oligonucleotide probes were designed utilizing p . falciparum codon bias and used to screen a p . falciparum sexual stage cdna library prepared according to standard techniques . fig1 shows the results of the samples from each of the purification steps which were size - fractionated on a 4 - 20 % sds - polyacrylamide gel and stained with coomassie blue . the lanes in gel are as follows : gamete / zygote extract before 1b3 - sepharose resin ( lane 1 ), proteins that did not bind to the 1b3 - sepharose resin ( lane 2 ), molecular weight standards ( amersham ) ( lane 3 ) and protein electroeluted from 1b3 - sepharose resin ( lane 4 ). the molecular weight ( mr × 10 3 ) is indicated on the left and the position of pfs230 is indicated on the right . oligonucleotide probes from each of the three tryptic peptides hybridized to a 4 . 4 kb insert of an isolated clone . sequencing revealed open reading frames at both the 5 &# 39 ; and 3 &# 39 ; ends of the 4 . 4 kb clone , therefore synthetic oligonucleotides probes corresponding to the ends were used to rescreen the library and obtain overlapping clones that extend the sequence . this process was continued until cdna clones covering the entire 9 . 4 kb open reading frame were isolated . the deduced amino acid sequence of the 9 . 4 kb gene ( seq . id . no . 2 ) contains all 3 tryptic peptides that were microsequenced . the pfs230 rna transcript is 12 . 5 kb and sexual stage - specific as shown in the northern analysis of p . falciparum rna in fig2 . equal amounts of rna were run in each lane ( 1 ) asexual , ( 2 ) gametocytes ( stage 2 & amp ; 3 ), and ( 3 ) zygotes / gametes ( 5 hours post emergence ). the blot was probed with the random - prime labeled 4 . 4 kb insert described above . the message is most abundant in gametocytes . with a long exposure of the northern a faint band can be seen in rna from 5 hour zygotes but there is no band with asexual rna . oligonucleotide probes from the extreme 5 &# 39 ; and 3 &# 39 ; ends of the orf hybridize to what appears to be the same transcript . the 9 . 4 kb open reading frame predicts a protein with a molecular weight of 363 , 243 kda , this is larger than the 260 , 000 and 230 , 000 mr reported for the proteins mab 1b3 recognizes by western blot . only the 230 , 000 band was shown to be radiolabeled when live gametes were surface - labeled with 125 i . since mab 1b3 does not react with reduced pfs230 it has been difficult to obtain an accurate molecular weight of the protein . quakyi , et al ., supra . prior art estimates of the size of the protein have been made with molecular weight standards having molecular weights less than 200 kda . to more accurately determine the molecular weight , radiolabeled pfs230 from surface labeled gametes was carefully sized under reducing conditions using molecular weight markers ranging from 100 , 000 to 500 , 000 . reduced 125 i labeled pfs230 migrated as a 310 , 000 molecular weight band ( fig3 ). to confirm that the cloned gene was indeed pfs230 , antibodies to a 2 . 0 - 2 . 2 kb section of the gene expressed in e . coli as fusions with maltose - binding protein ( rpfs230 / mbp - a e - b , described below ) were used to assay a western blot of triton x - 100 extracted p . falciparum gametes / zygotes . fig4 a and 4b show western blots of triton x - 100 extracted 125 i - surface - labeled gametes reacted with a 1 : 5 , 000 dilution of mpb antisera ( lane 1 ), rpfs230 / mbp - a antisera ( lane 2 ), and rpfs230 / mbp - b antisera ( lane 3 ). also shown is an autoradiograph of rpfs230 / mbp - b ( lane 4 ). when the extract was size - fractionated under nonreducing conditions the rpfs230 / mbp - a and - b antisera recognized bands of 325 , 000 kda and 275 , 000 kda , and under reducing conditions bands of 360 , 000 kda and 310 , 000 kda ( fig4 a and 4b , respectively . neither preimmune sera nor antisera to mbp alone reacted with any specific bands . the lower bands , under both reducing and nonreducing conditions comigrated with 125 i labeled pfs230 ( fig4 a and 4b ). this suggests that only the lower band was exposed on the surface of the gamete . possibly , the 360 , 000 protein is processed to a 310 , 000 form as it is moved to the surface of the gamete . to determine whether the rpfs230 / mbp antisera recognized the native ( nondenatured ) surface form of pfs230 , the antisera was used to immunoprecipitate radiolabeled pfs230 from a triton x - 100 extract of surface - labeled p . falciparum gametes / zygotes ( fig5 ). proteins immunoprecipitated by the following antibodies or antisera were loaded on the gel : mab 1b3 ( lane 1 ), rpfs230 / mbp a antisera ( lane 2 ), rpfs230 / mbp - b ( lane 3 ) and mbp antisera ( lane 4 ). the antibodies and antisera were incubated with a triton x - 100 extract of 125 - i surface labeled gametes and precipitated with protein a - sepharose as described above . the precipitated material was run out on a 4 - 20 % acrylamide gel . the radiolabeled bands were visualized by autoradiography . fig5 shows that 125 i - labeled pfs230 was precipitated by rpfs230 / mbp 1b antisera and monoclonal 1b3 but not mbp antisera . finally , an indirect immunofluorescence assay of intact gametes / zygotes was used to show that rpfs230 / mbp - a and b antisera recognized the surface of live gametes / zygotes ( fig6 a and 7a ). fig6 b and 7b , respectively , are the corresponding bright field image . fig8 a shows the results of the same experiment with mbp antisera . fig8 b is the corresponding bright field image . pfs230 open reading frame was pcr - amplified using a sense primer with a 5 &# 39 ; sma i site encoding amino acids 439 - 444 for rpfs230 / mbp - a or amino acids 2398 - 2405 for rpfs230 / mbp - b , and an antisense primer with a 3 &# 39 ; stop codon followed by a sal i site encoding amino acid 1127 - 1135 for rpfs230 / mbp - a or nucleotides 9607 - 9624 in the 3 &# 39 ; untranslated region for rpfs230 / mbp - b . gel - purified pcr products were ligated into stu i / sma i cut pih - 902 expression vector ( gift of paul riggs , new england biolabs ). iptg - induced rpfs230 - maltose binding protein fusion was purified from an extract of e . coli ( dh10b strain , brl ) on amylose resin and use to immumize nih outbred mice according to the method of rawlings , et al ., j . biol . chem ., 267 : 3976 - 3982 ( 1992 ). although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 4 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 9636 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( genomic )( ix ) feature :( a ) name / key : cds ( b ) location : 149 .. 9556 ( xi ) sequence description : seq id no : 1 : tattttttttattttttttatttttttatttttttattatttttatttttttattttttt60tatttttttatttttatatttttatattttttttcttctaccattcttttatccttcttg120atcgtatatttttcttttcttttaataaatgaagaaaattataacgctgaag172metlyslysileilethrleulys15aatctattcctcattatcctggtatacatatttagcgagaaaaaagac220asnleupheleuileileleuvaltyrilepheserglulyslysasp101520ctgcgttgtaatgtgataaagggaaataatattaaggatgatgaagat268leuargcysasnvalilelysglyasnasnilelysaspaspgluasp25303540aagagattccacttattttattattcccacaacctttttaagacaccc316lysargphehisleuphetyrtyrserhisasnleuphelysthrpro455055gaaacaaaagaaaagaagaataaaaaggagtgcttttataaaaatggt364gluthrlysglulyslysasnlyslysglucysphetyrlysasngly606570ggtatttataatttatctaaagaaataaggatgagaaaggatacatcc412glyiletyrasnleuserlysgluileargmetarglysaspthrser758085gtaaaaataaaacaaagaacatgtccctttcataaagaaggaagttca460vallysilelysglnargthrcysprophehislysgluglyserser9095100tttgaaatgggttcaaagaatattacatgtttttatcctatcgtaggg508pheglumetglyserlysasnilethrcysphetyrproilevalgly105110115120aagaaggaaaggaaaacactggacacaattattataaaaaagaatgta556lyslysgluarglysthrleuaspthrileileilelyslysasnval125130135acaaatgatcatgttgttagtagtgatatgcattccaatgtacaagaa604thrasnasphisvalvalserseraspmethisserasnvalglnglu140145150aaaaatatgatattaataagaaatatagataaagaaaataaaaatgat652lysasnmetileleuileargasnileasplysgluasnlysasnasp155160165atacaaaatgttgaggaaaaaatacaaagggatacatacgaaaataaa700ileglnasnvalgluglulysileglnargaspthrtyrgluasnlys170175180gattatgaaagtgatgatacacttatagaatggtttgatgataataca748asptyrgluseraspaspthrleuileglutrppheaspaspasnthr185190195200aatgaagaaaactttttactaacttttttaaaaaggtgcttgatgaaa796asnglugluasnpheleuleuthrpheleulysargcysleumetlys205210215atattttcttcacccaaaagaaaaaaaactgtagtacaaaaaaaacat844ilepheserserprolysarglyslysthrvalvalglnlyslyshis220225230aagtctaatttttttataaacagttcgttgaaatatatatatatgtat892lysserasnphepheileasnserserleulystyriletyrmettyr235240245ttaaccccctcggatagctttaacctagtacgtcgaaacagaaatttg940leuthrproseraspserpheasnleuvalargargasnargasnleu250255260gatgaggaagacatgtcgcccagggataattttgtaatagatgatgag988aspglugluaspmetserproargaspasnphevalileaspaspglu265270275280gaagaagaggaggaggaagaagaagaggaagaggaagaagaggaagaa1036gluglugluglugluglugluglugluglugluglugluglugluglu285290295gaagaagaagaggaggaggaagaatatgatgattatgtttatgaagaa1084gluglugluglugluglugluglutyraspasptyrvaltyrgluglu300305310agtggggatgaaacagaagaacaattacaagaggaacatcaggaagaa1132serglyaspgluthrglugluglnleuglnglugluhisglngluglu315320325gtaggtgctgaatcttcagaagaaagttttaatgatgaggatgaagat1180valglyalagluserserglugluserpheasnaspgluaspgluasp330335340tctgtagaagcacgggatggagatatgataagagttgacgaatattat1228servalglualaargaspglyaspmetileargvalaspglutyrtyr345350355360gaagaccaagatggtgatacttatgatagtacaataaaaaatgaagat1276gluaspglnaspglyaspthrtyraspserthrilelysasngluasp365370375gtagatgaagaggtaggtgaagaggtaggtgaagaggtaggtgaagag1324valaspglugluvalglyglugluvalglyglugluvalglygluglu380385390gtaggtgaagaggtaggtgaagaggtaggtgaagaggtaggtgaagag1372valglyglugluvalglyglugluvalglyglugluvalglygluglu395400405gtaggtgaagaggtaggtgaagaagaaggtgaagaggtaggtgaaggg1420valglyglugluvalglygluglugluglyglugluvalglyglugly410415420gtaggtgaagaggtaggtgaagaagaaggtgaagaggtaggtgaagaa1468valglyglugluvalglygluglugluglyglugluvalglygluglu425430435440gaaggtgaatatgtagatgaaaaagaaaggcaaggtgaaatatatcca1516gluglyglutyrvalaspglulysgluargglnglygluiletyrpro445450455tttggtgatgaagaagaaaaagatgaaggtggagaaagttttacctat1564pheglyaspglugluglulysaspgluglyglygluserphethrtyr460465470gaaaagagcgaggttgataaaacagatttgtttaaatttatagaaggg1612glulyssergluvalasplysthraspleuphelyspheileglugly475480485ggtgaaggagatgatgtatataaagtggatggttccaaagttttatta1660glygluglyaspaspvaltyrlysvalaspglyserlysvalleuleu490495500gatgatgatacaattagtagagtatctaaaaaacatactgcacgagat1708aspaspaspthrileserargvalserlyslyshisthralaargasp505510515520ggtgaatatggtgaatatggtgaagctgtcgaagatggagaaaatgtt1756glyglutyrglyglutyrglyglualavalgluaspglygluasnval525530535ataaaaataattagaagtgtgttacaaagtggtgcattaccaagtgta1804ilelysileileargservalleuglnserglyalaleuproserval540545550ggtgttgatgagttagataaaatcgatttgtcatatgaaacaacagaa1852glyvalaspgluleuasplysileaspleusertyrgluthrthrglu555560565agtggagatactgctgtatccgaagattcatatgataaatatgcatct1900serglyaspthralavalsergluaspsertyrasplystyralaser570575580aataatacaaataaagaatacgtttgtgattttacagatcaattaaaa1948asnasnthrasnlysglutyrvalcysaspphethraspglnleulys585590595600ccaacagaaagtggtcctaaagtaaaaaaatgtgaagtaaaagttaat1996prothrgluserglyprolysvallyslyscysgluvallysvalasn605610615gagccattaataaaagtaaaaataatatgtccattaaaaggttctgta2044gluproleuilelysvallysileilecysproleulysglyserval620625630gaaaaattatatgataatatagaatatgtacctaaaaaaagcccatat2092glulysleutyraspasnileglutyrvalprolyslysserprotyr635640645gttgttttaacaaaagaggaaactaaactaaaggaaaaacttctctcg2140valvalleuthrlysglugluthrlysleulysglulysleuleuser650655660aaacttatttatggtttattaatatctccgacggttaacgaaaaggag2188lysleuiletyrglyleuleuileserprothrvalasnglulysglu665670675680aataattttaaagaaggtgttattgaatttactcttccccctgtggta2236asnasnphelysgluglyvalilegluphethrleuproprovalval685690695cacaaggcaacagtgttttattttatatgtgataattcaaaaacagaa2284hislysalathrvalphetyrpheilecysaspasnserlysthrglu700705710gatgataacaaaaaaggaaatagagggattgtagaagtgtatgtagaa2332aspaspasnlyslysglyasnargglyilevalgluvaltyrvalglu715720725ccatatggtaataaaattaatggatgtgctttcttggatgaagatgaa2380protyrglyasnlysileasnglycysalapheleuaspgluaspglu730735740gaagaagaaaaatatggtaatcaaattgaagaagatgaacataatgag2428glugluglulystyrglyasnglnileglugluaspgluhisasnglu745750755760aagataaaaatgaaaacattctttacccagaatatatataaaaaaaat2476lysilelysmetlysthrphephethrglnasniletyrlyslysasn765770775aatatatatccatgttatatgaaattatatagcggagatataggtggt2524asniletyrprocystyrmetlysleutyrserglyaspileglygly780785790attctatttcctaagaatataaaatcaacaacgtgttttgaagagatg2572ileleupheprolysasnilelysserthrthrcysphegluglumet795800805ataccttataataaagaaataaaatggaataaagaaaataaaagttta2620ileprotyrasnlysgluilelystrpasnlysgluasnlysserleu810815820ggtaacttagttaataattctgtagtatataataaagagatgaatgca2668glyasnleuvalasnasnservalvaltyrasnlysglumetasnala825830835840aaatattttaatgttcagtatgttcacattcctacaagttataaagat2716lystyrpheasnvalglntyrvalhisileprothrsertyrlysasp845850855acattaaatttattttgtagtattatattaaaagaagaggaaagtaat2764thrleuasnleuphecysserileileleulysgluglugluserasn860865870ttaatttctacttcttatttagtatatgtaagtattaatgaagaatta2812leuileserthrsertyrleuvaltyrvalserileasnglugluleu875880885aatttttcacttttcgatttttatgaatcatttgtacctataaaaaaa2860asnpheserleupheaspphetyrgluserphevalproilelyslys890895900accatacaagtagctcaaaagaatgtaaataataaagaacatgattat2908thrileglnvalalaglnlysasnvalasnasnlysgluhisasptyr905910915920acatgtgattttaccgataaattagataaaacggttccttctactgct2956thrcysaspphethrasplysleuasplysthrvalproserthrala925930935aatgggaagaaattatttatatgtagaaagcatttaaaagaatttgat3004asnglylyslysleupheilecysarglyshisleulysglupheasp940945950acatttaccttaaaatgtaatgttaataaaacacaatatccaaatatc3052thrphethrleulyscysasnvalasnlysthrglntyrproasnile955960965gagatatttcctaaaacattaaaagataaaaaggaagtattaaaatta3100gluilepheprolysthrleulysasplyslysgluvalleulysleu970975980gatcttgatatacaatatcaaatgtttagtaaattttttaaattcaat3148aspleuaspileglntyrglnmetpheserlysphephelyspheasn9859909951000acacagaatgcaaagtatttaaatttatatccatattatttaattttt3196thrglnasnalalystyrleuasnleutyrprotyrtyrleuilephe100510101015ccatttaatcatataggaaaaaaagaattaaaaaataatcctacatat3244propheasnhisileglylyslysgluleulysasnasnprothrtyr102010251030aaaaatcataaagatgtgaaatattttgagcaatcatctgtattatct3292lysasnhislysaspvallystyrphegluglnserservalleuser103510401045cccttatcttccgcagacagtttagggaaattattaaattttttagat3340proleuserseralaaspserleuglylysleuleuasnpheleuasp105010551060actcaagagacggtatgtcttacggaaaagataagatatttaaattta3388thrglngluthrvalcysleuthrglulysileargtyrleuasnleu1065107010751080agtatcaatgagttaggatctgataataatacattttctgtaacattt3436serileasngluleuglyseraspasnasnthrpheservalthrphe108510901095caggttccaccatatatagatattaaggaacctttttattttatgttt3484glnvalproprotyrileaspilelysgluprophetyrphemetphe110011051110ggttgtaataataataaaggtgaagggaatatcggaattgttgaatta3532glycysasnasnasnlysglygluglyasnileglyilevalgluleu111511201125ttaatatctaagcaagaagaaaagattaaaggatgtaatttccatgaa3580leuileserlysglngluglulysilelysglycysasnphehisglu113011351140tctaaattagattatttcaatgaaaacatttctagtgatacacatgaa3628serlysleuasptyrpheasngluasnileserseraspthrhisglu1145115011551160tgtacattgcatgcatatgaaaatgatataattggatttaattgttta3676cysthrleuhisalatyrgluasnaspileileglypheasncysleu116511701175gaaactactcatcctaatgaggttgaggttgaagttgaagatgctgaa3724gluthrthrhisproasngluvalgluvalgluvalgluaspalaglu118011851190atatatcttcaacctgagaattgttttaataatgtatataaaggattg3772iletyrleuglnprogluasncyspheasnasnvaltyrlysglyleu119512001205aattctgttgatattactactatattaaaaaatgcacaaacatataat3820asnservalaspilethrthrileleulysasnalaglnthrtyrasn121012151220ataaataataagaaaacacctacctttttaaaaattccaccatataat3868ileasnasnlyslysthrprothrpheleulysileproprotyrasn1225123012351240ttattagaagatgtcgaaattagttgccaatgtactattaaacaagtt3916leuleugluaspvalgluilesercysglncysthrilelysglnval124512501255gttaaaaaaataaaagttattataaccaaaaatgatacagtattatta3964vallyslysilelysvalileilethrlysasnaspthrvalleuleu126012651270aaaagagaagtgcaatctgagtctacattagatgataaaatatataaa4012lysarggluvalglnsergluserthrleuaspasplysiletyrlys127512801285tgtgaacatgaaaattttattaatccaagagtaaataaaacatttgat4060cysgluhisgluasnpheileasnproargvalasnlysthrpheasp129012951300gaaaatgtagaatatacatgtaatataaaaatagagaatttctttaat4108gluasnvalglutyrthrcysasnilelysilegluasnphepheasn1305131013151320tatattcaaatattttgtccagccaaagatcttggtatttataaaaat4156tyrileglnilephecysproalalysaspleuglyiletyrlysasn132513301335atacaaatgtattatgatattgtaaaaccaacaagagtaccacaattt4204ileglnmettyrtyraspilevallysprothrargvalproglnphe134013451350aaaaaatttaataatgaagaattacataaattaattcctaattcagaa4252lyslyspheasnasnglugluleuhislysleuileproasnserglu135513601365atgttacataaaacaaaagaaatgttaattttatataatgaagaaaaa4300metleuhislysthrlysglumetleuileleutyrasngluglulys137013751380gtggatctattacatttttatgtattcttaccaatatatataaaagac4348valaspleuleuhisphetyrvalpheleuproiletyrilelysasp1385139013951400atatatgaattcaatatagtatgtgataattcaaaaacaatgtggaaa4396iletyrglupheasnilevalcysaspasnserlysthrmettrplys140514101415aatcaattaggaggaaaagttatatatcatattactgtttcaaaaaga4444asnglnleuglyglylysvaliletyrhisilethrvalserlysarg142014251430gagcagaaagtaaaaggttgttcatttgataatgaacatgcacatatg4492gluglnlysvallysglycysserpheaspasngluhisalahismet143514401445tttagttataataaaactaatgtaaaaaattgtattatagatgctaaa4540phesertyrasnlysthrasnvallysasncysileileaspalalys145014551460cctaaagatttgataggtttcgtttgtccctctggtaccttaaaatta4588prolysaspleuileglyphevalcysproserglythrleulysleu1465147014751480acaaattgttttaaagatgcaatagtacatacaaatttaacaaatatt4636thrasncysphelysaspalailevalhisthrasnleuthrasnile148514901495aatggtatactttatttaaaaaataatttggctaactttacatataaa4684asnglyileleutyrleulysasnasnleualaasnphethrtyrlys150015051510catcaatttaattatatggaaataccagctttaatggataatgatata4732hisglnpheasntyrmetgluileproalaleumetaspasnaspile151515201525tcatttaaatgtatatgtgttgatttaaaaaaaaaaaaatataatgtc4780serphelyscysilecysvalaspleulyslyslyslystyrasnval153015351540aaatcaccattaggacctaaagttttacgtgctctttataaaaaatta4828lysserproleuglyprolysvalleuargalaleutyrlyslysleu1545155015551560aatataaaatttgataattatgttactggcactgatcaaaataaatat4876asnilelyspheaspasntyrvalthrglythraspglnasnlystyr156515701575cttatgacatatatggatttacatttatctcataaacgtaattattta4924leumetthrtyrmetaspleuhisleuserhislysargasntyrleu158015851590aaggaattatttcatgatttaggtaaaaaaaaaccagcagatacagat4972lysgluleuphehisaspleuglylyslyslysproalaaspthrasp159516001605gctaaccctgaatctattatcgaatctttaagtattaatgaatctaat5020alaasnprogluserileilegluserleuserileasngluserasn161016151620gaatctggaccttttccaaccggggatgtagatgcagaacatttaata5068gluserglypropheprothrglyaspvalaspalagluhisleuile1625163016351640ttagaaggatatgatacatgggaaagtttatatgatgaacaattagaa5116leugluglytyraspthrtrpgluserleutyraspgluglnleuglu164516501655gaagttatatataatgatattgaatctttagaattaaaagatattgaa5164gluvaliletyrasnaspilegluserleugluleulysaspileglu166016651670caatatgttttacaagttaatttaaaagctccaaaattaatgatgtct5212glntyrvalleuglnvalasnleulysalaprolysleumetmetser167516801685gctcaaattcataataatagacatgtatgtgatttctcaaaaaataat5260alaglnilehisasnasnarghisvalcysasppheserlysasnasn169016951700ttaattgtaccagaatcattaaaaaaaaaagaagagcttggtggtaat5308leuilevalprogluserleulyslyslysglugluleuglyglyasn1705171017151720ccagtaaatattcattgttatgcattattaaaacctttagatacatta5356provalasnilehiscystyralaleuleulysproleuaspthrleu172517301735tatgtaaaatgtcctacatcaaaagataattatgaagctgctaaagta5404tyrvallyscysprothrserlysaspasntyrglualaalalysval174017451750aacatatctgaaaacgacaatgaatatgagttacaagttatatcatta5452asnilesergluasnaspasnglutyrgluleuglnvalileserleu175517601765atcgaaaaaagatttcataattttgagacgttagaatcgaagaaacct5500ileglulysargphehisasnphegluthrleugluserlyslyspro177017751780ggaaatggagatgtagtagtacataatggtgttgtagatactggacct5548glyasnglyaspvalvalvalhisasnglyvalvalaspthrglypro1785179017951800gtattagataacagtacatttgaaaaatattttaaaaatataaaaata5596valleuaspasnserthrpheglulystyrphelysasnilelysile180518101815aaaccagataaattttttgagaaagttataaatgaatatgatgatact5644lysproasplysphepheglulysvalileasnglutyraspaspthr182018251830gaagaagaaaaagatttagaaagtatattacctggggctattgttagt5692glugluglulysaspleugluserileleuproglyalailevalser183518401845cctatgaaagttttaaaaaaaaaggatccttttacatcatatgctgct5740prometlysvalleulyslyslysaspprophethrsertyralaala185018551860tttgttgttccaccaattgttcccaaagatttacattttaaagtagaa5788phevalvalproproilevalprolysaspleuhisphelysvalglu1865187018751880tgtaataatacagaatataaagatgaaaatcaatatataagtggatat5836cysasnasnthrglutyrlysaspgluasnglntyrileserglytyr188518901895aatggtataatacatattgatatatcaaatagtaataggaaaattaat5884asnglyileilehisileaspileserasnserasnarglysileasn190019051910ggatgtgatttctctacgaacaatagttctattttaacatccagtgta5932glycysasppheserthrasnasnserserileleuthrserserval191519201925aaattagtaaatggagaaactaaaaattgtgaaataaatataaataat5980lysleuvalasnglygluthrlysasncysgluileasnileasnasn193019351940aatgaagtatttggtatcatatgtgataatgaaacaaatttagatcca6028asngluvalpheglyileilecysaspasngluthrasnleuasppro1945195019551960gaaaaatgttttcatgaaatatatagtaaagataataaaactgtaaaa6076glulyscysphehisgluiletyrserlysaspasnlysthrvallys196519701975aaatttcgtgaagttatacctaatatagatatattctcattacataat6124lysphearggluvalileproasnileaspilepheserleuhisasn198019851990tctaataagaaaaaagttgcatatgctaaagtacctttagattatatt6172serasnlyslyslysvalalatyralalysvalproleuasptyrile199520002005aataaattattattttcttgttcatgtaaaacatcacatactaataca6220asnlysleuleuphesercyssercyslysthrserhisthrasnthr201020152020ataggtaccatgaaagttactctaaataaagatgaaaaagaagaagaa6268ileglythrmetlysvalthrleuasnlysaspglulysglugluglu2025203020352040gattttaaaacagctcaaggtattaaacataataatgtacatttatgt6316aspphelysthralaglnglyilelyshisasnasnvalhisleucys204520502055aatttctttgataatcctgaattaacatttgataataataaaatagtt6364asnphepheaspasnprogluleuthrpheaspasnasnlysileval206020652070ttatgtaaaatcgatgcagaactgttctcagaagtaattatacaatta6412leucyslysileaspalagluleuphesergluvalileileglnleu207520802085ccaatatttggaacaaagaatgtagaagaaggagtacaaaatgaagaa6460proilepheglythrlysasnvalglugluglyvalglnasngluglu209020952100tataaaaaattttcattaaaaccatcattagtttttgatgataacaat6508tyrlyslyspheserleulysproserleuvalpheaspaspasnasn2105211021152120aatgatattaaagttataggaaaagaaaaaaatgaagtatctattagt6556asnaspilelysvalileglylysglulysasngluvalserileser212521302135ttagctttgaaaggggtttatggaaatcgaatttttacttttgataaa6604leualaleulysglyvaltyrglyasnargilephethrpheasplys214021452150aatggaaaaaaaggagaaggaattagtttttttatacctccaataaaa6652asnglylyslysglygluglyileserphepheileproproilelys215521602165caagatacagatttaaaatttataattaatgaaacaatagataattca6700glnaspthraspleulyspheileileasngluthrileaspasnser217021752180aatattaaacaaagaggattaatatatatttttgttaggaaaaatgta6748asnilelysglnargglyleuiletyrilephevalarglysasnval2185219021952200tcagaaaattcatttaaattatgtgatttcacaacaggttcgacttca6796sergluasnserphelysleucysaspphethrthrglyserthrser220522102215ttaatggaattaaatagtcaagtaaaagaaaaaaagtgcactgttaaa6844leumetgluleuasnserglnvallysglulyslyscysthrvallys222022252230attaaaaaaggagatatttttggattgaaatgtcctaaaggttttgct6892ilelyslysglyaspilepheglyleulyscysprolysglypheala223522402245atatttccacaagcatgttttagtaatgttttattagaatattataaa6940ilepheproglnalacyspheserasnvalleuleuglutyrtyrlys225022552260agtgattatgaagatagtgaacatattaattattatattcataaagat6988serasptyrgluaspsergluhisileasntyrtyrilehislysasp2265227022752280aaaaaatataatttaaaacctaaagatgttattgaattaatggatgaa7036lyslystyrasnleulysprolysaspvalilegluleumetaspglu228522902295aattttagagaattacaaaatatacaacaatatacaggaatatcaaat7084asnphearggluleuglnasnileglnglntyrthrglyileserasn230023052310attacagatgtgttacatttcaaaaattttaatttaggtaatctacca7132ilethraspvalleuhisphelysasnpheasnleuglyasnleupro231523202325ttaaattttaaaaatcattattctacagcatatgctaaagtaccagat7180leuasnphelysasnhistyrserthralatyralalysvalproasp233023352340acctttaattctattattaacttctcatgtaattgttataatccagaa7228thrpheasnserileileasnphesercysasncystyrasnproglu2345235023552360aaacatgtatatggtactatgcaagttgagtctgataatcgaaatttt7276lyshisvaltyrglythrmetglnvalgluseraspasnargasnphe236523702375gataatattaaaaaaaatgaaaatgttataaaaaatttccttttacct7324aspasnilelyslysasngluasnvalilelysasnpheleuleupro238023852390aatatagaaaaatatgcactactattagatgatgaagaaagacaaaaa7372asnileglulystyralaleuleuleuaspaspglugluargglnlys239524002405aaaataaaacaacaacaagaagaagaacaacaagaacaaatattaaaa7420lysilelysglnglnglngluglugluglnglngluglnileleulys241024152420gatcaagatgatagattaagcagacatgatgattataataaaaatcat7468aspglnaspaspargleuserarghisaspasptyrasnlysasnhis2425243024352440acatatatactatatgattcaaatgaacatatatgtgattatgaaaaa7516thrtyrileleutyraspserasngluhisilecysasptyrglulys244524502455aatgaatcactcatatcaacattacctaatgatacaaaaaaaatacaa7564asngluserleuileserthrleuproasnaspthrlyslysilegln246024652470aaaagtatctgtaaaattaatgcaaaagcattagatgttgttacaatt7612lysserilecyslysileasnalalysalaleuaspvalvalthrile247524802485aaatgtcctcatacaaaaaattttacgcctaaagattattttcctaat7660lyscysprohisthrlysasnphethrprolysasptyrpheproasn249024952500tcttcattaataactaatgataaaaaaattgtgattacttttgataag7708serserleuilethrasnasplyslysilevalilethrpheasplys2505251025152520aaaaattttgttacttatatagatcctacaaaaaaaacattttctttg7756lysasnphevalthrtyrileaspprothrlyslysthrpheserleu252525302535aaagatatatatatacaaagtttttatggtgtttctcttgatcatctt7804lysaspiletyrileglnserphetyrglyvalserleuasphisleu254025452550aatcaaataaaaaaaatacatgaagaatgggatgatgtacatttattt7852asnglnilelyslysilehisgluglutrpaspaspvalhisleuphe255525602565tatcctcctcataatgtattacataatgttgtacttaataatcatata7900tyrproprohisasnvalleuhisasnvalvalleuasnasnhisile257025752580gtcaacttatcatctgcattagaaggagtcttatttatgaaatcaaaa7948valasnleuserseralaleugluglyvalleuphemetlysserlys2585259025952600gttactggagatgaaacagctacaaaaaaaaacactacactaccaact7996valthrglyaspgluthralathrlyslysasnthrthrleuprothr260526102615gatggtgtatcaagtattttaattccaccatatgtaaaggaagatata8044aspglyvalserserileleuileproprotyrvallysgluaspile262026252630acatttcatcttttttgtgggaaatctacaacaaaaaaaccaaacaaa8092thrphehisleuphecysglylysserthrthrlyslysproasnlys263526402645aagaacacatctcttgcacttattcatatacatatatcatcaaacaga8140lysasnthrserleualaleuilehisilehisileserserasnarg265026552660aatattattcatggatgtgatttcttatatttagaaaatcaaacaaat8188asnileilehisglycysasppheleutyrleugluasnglnthrasn2665267026752680gatgctattagtaataataataataattcatattctatatttacacat8236aspalaileserasnasnasnasnasnsertyrserilephethrhis268526902695aataaaaatacagagaataatctaatatgtgatatatctttaattcca8284asnlysasnthrgluasnasnleuilecysaspileserleuilepro270027052710aaaactgttataggaattaaatgtcctaataaaaaattaaatccacaa8332lysthrvalileglyilelyscysproasnlyslysleuasnprogln271527202725acatgttttgatgaagtgtattatgttaaacaagaagatgtaccttcg8380thrcyspheaspgluvaltyrtyrvallysglngluaspvalproser273027352740aaaactataacagctgataaatataatacatttagtaaagacaaaata8428lysthrilethralaasplystyrasnthrpheserlysasplysile2745275027552760ggaaatatattaaaaaatgcaatctctattaataatccagatgaaaag8476glyasnileleulysasnalaileserileasnasnproaspglulys276527702775gataatacatatacttatttaatattaccagaaaaatttgaagaagaa8524aspasnthrtyrthrtyrleuileleuproglulyspheglugluglu278027852790ttaatcgataccaaaaaagttttagcttgtacatgtgataataaatat8572leuileaspthrlyslysvalleualacysthrcysaspasnlystyr279528002805ataatacatatgaaaatagaaaaaagtacaatggataaaataaaaata8620ileilehismetlysileglulysserthrmetasplysilelysile281028152820gatgaaaaaaaaacaattggtaaagatatatgtaaatatgatgttact8668aspglulyslysthrileglylysaspilecyslystyraspvalthr2825283028352840actaaagttgctacttgtgaaattattgatacaattgattcgtctgta8716thrlysvalalathrcysgluileileaspthrileaspserserval284528502855ttaaaagaacatcatacagtacattattctattacattatcaagatgg8764leulysgluhishisthrvalhistyrserilethrleuserargtrp286028652870gataaacttattattaaatatccaacaaatgagaaaacacatttcgaa8812asplysleuileilelystyrprothrasnglulysthrhispheglu287528802885aatttttttgttaatccttttaatttaaaagataaagttttatataat8860asnphephevalasnpropheasnleulysasplysvalleutyrasn289028952900tataataaaccaataaatatagaacatatcttaccaggagccattaca8908tyrasnlysproileasnilegluhisileleuproglyalailethr2905291029152920acagatatatatgataccagaacaaaaattaaacaatatatattaaga8956thraspiletyraspthrargthrlysilelysglntyrileleuarg292529302935attccaccatatgtacataaagatatacatttctcattagaatttaac9004ileproprotyrvalhislysaspilehispheserleuglupheasn294029452950aatagcctaagtttaacaaaacaaaatcaaaatattatttatggaaat9052asnserleuserleuthrlysglnasnglnasnileiletyrglyasn295529602965gtagccaaaatttttattcatataaatcaaggatataaagaaattcat9100valalalysilepheilehisileasnglnglytyrlysgluilehis297029752980ggatgtgatttcacaggaaaatattcccatttatttacatattcaaaa9148glycysaspphethrglylystyrserhisleuphethrtyrserlys2985299029953000aaacctttaccaaatgatgatgatatatgtaatgtaactataggtaat9196lysproleuproasnaspaspaspilecysasnvalthrileglyasn300530103015aatacattctcaggttttgcatgcttaagccattttgaattaaaacca9244asnthrpheserglyphealacysleuserhisphegluleulyspro302030253030aataactgcttctcatctgtttatgattataatgaagccaataaagtt9292asnasncyspheserservaltyrasptyrasnglualaasnlysval303530403045aaaaaattattcgatctatccacaaaagtagaattagaccatatcaaa9340lyslysleupheaspleuserthrlysvalgluleuasphisilelys305030553060caaaatacttcaggatatacactatcatatattatttttaataaagaa9388glnasnthrserglytyrthrleusertyrileilepheasnlysglu3065307030753080tccacaaaacttaaattctcatgtacatgctcatccaactattcaaat9436serthrlysleulysphesercysthrcysserserasntyrserasn308530903095tatactatacgaatcacatttgatcctaattatataatcccagaacct9484tyrthrileargilethrpheaspproasntyrileileproglupro310031053110caatcaagagccatcattaaatatgtagatctgcaagataaaaatttt9532glnserargalaileilelystyrvalaspleuglnasplysasnphe311531203125gcaaaatacttgagaaagctttaaatcgtaaataattaatcaaacatatat9583alalystyrleuarglysleu31303135ataatcaaaaggataatatattagaacacacatatatatgtaaaaaaaaaaaa9636 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 3135 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : protein ( xi ) sequence description : seq id no : 2 : metlyslysileilethrleulysasnleupheleuileileleuval151015tyrilepheserglulyslysaspleuargcysasnvalilelysgly202530asnasnilelysaspaspgluasplysargphehisleuphetyrtyr354045serhisasnleuphelysthrprogluthrlysglulyslysasnlys505560lysglucysphetyrlysasnglyglyiletyrasnleuserlysglu65707580ileargmetarglysaspthrservallysilelysglnargthrcys859095prophehislysgluglyserserpheglumetglyserlysasnile100105110thrcysphetyrproilevalglylyslysgluarglysthrleuasp115120125thrileileilelyslysasnvalthrasnasphisvalvalserser130135140aspmethisserasnvalglnglulysasnmetileleuileargasn145150155160ileasplysgluasnlysasnaspileglnasnvalgluglulysile165170175glnargaspthrtyrgluasnlysasptyrgluseraspaspthrleu180185190ileglutrppheaspaspasnthrasnglugluasnpheleuleuthr195200205pheleulysargcysleumetlysilepheserserprolysarglys210215220lysthrvalvalglnlyslyshislysserasnphepheileasnser225230235240serleulystyriletyrmettyrleuthrproseraspserpheasn245250255leuvalargargasnargasnleuaspglugluaspmetserproarg260265270aspasnphevalileaspaspglugluglugluglugluglugluglu275280285gluglugluglugluglugluglugluglugluglugluglugluglu290295300tyraspasptyrvaltyrglugluserglyaspgluthrgluglugln305310315320leuglnglugluhisglnglugluvalglyalaglusersergluglu325330335serpheasnaspgluaspgluaspservalglualaargaspglyasp340345350metileargvalaspglutyrtyrgluaspglnaspglyaspthrtyr355360365aspserthrilelysasngluaspvalaspglugluvalglygluglu370375380valglyglugluvalglyglugluvalglyglugluvalglygluglu385390395400valglyglugluvalglyglugluvalglyglugluvalglygluglu405410415gluglyglugluvalglygluglyvalglyglugluvalglygluglu420425430gluglyglugluvalglygluglugluglyglutyrvalaspglulys435440445gluargglnglygluiletyrpropheglyaspglugluglulysasp450455460gluglyglygluserphethrtyrglulyssergluvalasplysthr465470475480aspleuphelyspheilegluglyglygluglyaspaspvaltyrlys485490495valaspglyserlysvalleuleuaspaspaspthrileserargval500505510serlyslyshisthralaargaspglyglutyrglyglutyrglyglu515520525alavalgluaspglygluasnvalilelysileileargservalleu530535540glnserglyalaleuproservalglyvalaspgluleuasplysile545550555560aspleusertyrgluthrthrgluserglyaspthralavalserglu565570575aspsertyrasplystyralaserasnasnthrasnlysglutyrval580585590cysaspphethraspglnleulysprothrgluserglyprolysval595600605lyslyscysgluvallysvalasngluproleuilelysvallysile610615620ilecysproleulysglyservalglulysleutyraspasnileglu625630635640tyrvalprolyslysserprotyrvalvalleuthrlysglugluthr645650655lysleulysglulysleuleuserlysleuiletyrglyleuleuile660665670serprothrvalasnglulysgluasnasnphelysgluglyvalile675680685gluphethrleuproprovalvalhislysalathrvalphetyrphe690695700ilecysaspasnserlysthrgluaspaspasnlyslysglyasnarg705710715720glyilevalgluvaltyrvalgluprotyrglyasnlysileasngly725730735cysalapheleuaspgluaspgluglugluglulystyrglyasngln740745750ileglugluaspgluhisasnglulysilelysmetlysthrphephe755760765thrglnasniletyrlyslysasnasniletyrprocystyrmetlys770775780leutyrserglyaspileglyglyileleupheprolysasnilelys785790795800serthrthrcysphegluglumetileprotyrasnlysgluilelys805810815trpasnlysgluasnlysserleuglyasnleuvalasnasnserval820825830valtyrasnlysglumetasnalalystyrpheasnvalglntyrval835840845hisileprothrsertyrlysaspthrleuasnleuphecysserile850855860ileleulysgluglugluserasnleuileserthrsertyrleuval865870875880tyrvalserileasnglugluleuasnpheserleupheaspphetyr885890895gluserphevalproilelyslysthrileglnvalalaglnlysasn900905910valasnasnlysgluhisasptyrthrcysaspphethrasplysleu915920925asplysthrvalproserthralaasnglylyslysleupheilecys930935940arglyshisleulysglupheaspthrphethrleulyscysasnval945950955960asnlysthrglntyrproasnilegluilepheprolysthrleulys965970975asplyslysgluvalleulysleuaspleuaspileglntyrglnmet980985990pheserlysphephelyspheasnthrglnasnalalystyrleuasn99510001005leutyrprotyrtyrleuilephepropheasnhisileglylyslys101010151020gluleulysasnasnprothrtyrlysasnhislysaspvallystyr1025103010351040phegluglnserservalleuserproleuserseralaaspserleu104510501055glylysleuleuasnpheleuaspthrglngluthrvalcysleuthr106010651070glulysileargtyrleuasnleuserileasngluleuglyserasp107510801085asnasnthrpheservalthrpheglnvalproprotyrileaspile109010951100lysgluprophetyrphemetpheglycysasnasnasnlysglyglu1105111011151120glyasnileglyilevalgluleuleuileserlysglngluglulys112511301135ilelysglycysasnphehisgluserlysleuasptyrpheasnglu114011451150asnileserseraspthrhisglucysthrleuhisalatyrgluasn115511601165aspileileglypheasncysleugluthrthrhisproasngluval117011751180gluvalgluvalgluaspalagluiletyrleuglnprogluasncys1185119011951200pheasnasnvaltyrlysglyleuasnservalaspilethrthrile120512101215leulysasnalaglnthrtyrasnileasnasnlyslysthrprothr122012251230pheleulysileproprotyrasnleuleugluaspvalgluileser123512401245cysglncysthrilelysglnvalvallyslysilelysvalileile125012551260thrlysasnaspthrvalleuleulysarggluvalglnsergluser1265127012751280thrleuaspasplysiletyrlyscysgluhisgluasnpheileasn128512901295proargvalasnlysthrpheaspgluasnvalglutyrthrcysasn130013051310ilelysilegluasnphepheasntyrileglnilephecysproala131513201325lysaspleuglyiletyrlysasnileglnmettyrtyraspileval133013351340lysprothrargvalproglnphelyslyspheasnasnglugluleu1345135013551360hislysleuileproasnserglumetleuhislysthrlysglumet136513701375leuileleutyrasngluglulysvalaspleuleuhisphetyrval138013851390pheleuproiletyrilelysaspiletyrglupheasnilevalcys139514001405aspasnserlysthrmettrplysasnglnleuglyglylysvalile141014151420tyrhisilethrvalserlysarggluglnlysvallysglycysser1425143014351440pheaspasngluhisalahismetphesertyrasnlysthrasnval144514501455lysasncysileileaspalalysprolysaspleuileglypheval146014651470cysproserglythrleulysleuthrasncysphelysaspalaile147514801485valhisthrasnleuthrasnileasnglyileleutyrleulysasn149014951500asnleualaasnphethrtyrlyshisglnpheasntyrmetgluile1505151015151520proalaleumetaspasnaspileserphelyscysilecysvalasp152515301535leulyslyslyslystyrasnvallysserproleuglyprolysval154015451550leuargalaleutyrlyslysleuasnilelyspheaspasntyrval155515601565thrglythraspglnasnlystyrleumetthrtyrmetaspleuhis157015751580leuserhislysargasntyrleulysgluleuphehisaspleugly1585159015951600lyslyslysproalaaspthraspalaasnprogluserileileglu160516101615serleuserileasngluserasngluserglypropheprothrgly162016251630aspvalaspalagluhisleuileleugluglytyraspthrtrpglu163516401645serleutyraspgluglnleuglugluvaliletyrasnaspileglu165016551660serleugluleulysaspilegluglntyrvalleuglnvalasnleu1665167016751680lysalaprolysleumetmetseralaglnilehisasnasnarghis168516901695valcysasppheserlysasnasnleuilevalprogluserleulys170017051710lyslysglugluleuglyglyasnprovalasnilehiscystyrala171517201725leuleulysproleuaspthrleutyrvallyscysprothrserlys173017351740aspasntyrglualaalalysvalasnilesergluasnaspasnglu1745175017551760tyrgluleuglnvalileserleuileglulysargphehisasnphe176517701775gluthrleugluserlyslysproglyasnglyaspvalvalvalhis178017851790asnglyvalvalaspthrglyprovalleuaspasnserthrpheglu179518001805lystyrphelysasnilelysilelysproasplysphepheglulys181018151820valileasnglutyraspaspthrglugluglulysaspleugluser1825183018351840ileleuproglyalailevalserprometlysvalleulyslyslys184518501855aspprophethrsertyralaalaphevalvalproproilevalpro186018651870lysaspleuhisphelysvalglucysasnasnthrglutyrlysasp187518801885gluasnglntyrileserglytyrasnglyileilehisileaspile189018951900serasnserasnarglysileasnglycysasppheserthrasnasn1905191019151920serserileleuthrserservallysleuvalasnglygluthrlys192519301935asncysgluileasnileasnasnasngluvalpheglyileilecys194019451950aspasngluthrasnleuaspproglulyscysphehisgluiletyr195519601965serlysaspasnlysthrvallyslysphearggluvalileproasn197019751980ileaspilepheserleuhisasnserasnlyslyslysvalalatyr1985199019952000alalysvalproleuasptyrileasnlysleuleuphesercysser200520102015cyslysthrserhisthrasnthrileglythrmetlysvalthrleu202020252030asnlysaspglulysgluglugluaspphelysthralaglnglyile203520402045lyshisasnasnvalhisleucysasnphepheaspasnprogluleu205020552060thrpheaspasnasnlysilevalleucyslysileaspalagluleu2065207020752080phesergluvalileileglnleuproilepheglythrlysasnval208520902095glugluglyvalglnasngluglutyrlyslyspheserleulyspro210021052110serleuvalpheaspaspasnasnasnaspilelysvalileglylys211521202125glulysasngluvalserileserleualaleulysglyvaltyrgly213021352140asnargilephethrpheasplysasnglylyslysglygluglyile2145215021552160serphepheileproproilelysglnaspthraspleulyspheile216521702175ileasngluthrileaspasnserasnilelysglnargglyleuile218021852190tyrilephevalarglysasnvalsergluasnserphelysleucys219522002205aspphethrthrglyserthrserleumetgluleuasnserglnval221022152220lysglulyslyscysthrvallysilelyslysglyaspilephegly2225223022352240leulyscysprolysglyphealailepheproglnalacyspheser224522502255asnvalleuleuglutyrtyrlysserasptyrgluaspsergluhis226022652270ileasntyrtyrilehislysasplyslystyrasnleulysprolys227522802285aspvalilegluleumetaspgluasnphearggluleuglnasnile229022952300glnglntyrthrglyileserasnilethraspvalleuhisphelys2305231023152320asnpheasnleuglyasnleuproleuasnphelysasnhistyrser232523302335thralatyralalysvalproaspthrpheasnserileileasnphe234023452350sercysasncystyrasnproglulyshisvaltyrglythrmetgln235523602365valgluseraspasnargasnpheaspasnilelyslysasngluasn237023752380valilelysasnpheleuleuproasnileglulystyralaleuleu2385239023952400leuaspaspglugluargglnlyslysilelysglnglnglngluglu240524102415gluglnglngluglnileleulysaspglnaspaspargleuserarg242024252430hisaspasptyrasnlysasnhisthrtyrileleutyraspserasn243524402445gluhisilecysasptyrglulysasngluserleuileserthrleu245024552460proasnaspthrlyslysileglnlysserilecyslysileasnala2465247024752480lysalaleuaspvalvalthrilelyscysprohisthrlysasnphe248524902495thrprolysasptyrpheproasnserserleuilethrasnasplys250025052510lysilevalilethrpheasplyslysasnphevalthrtyrileasp251525202525prothrlyslysthrpheserleulysaspiletyrileglnserphe253025352540tyrglyvalserleuasphisleuasnglnilelyslysilehisglu2545255025552560glutrpaspaspvalhisleuphetyrproprohisasnvalleuhis256525702575asnvalvalleuasnasnhisilevalasnleuserseralaleuglu258025852590glyvalleuphemetlysserlysvalthrglyaspgluthralathr259526002605lyslysasnthrthrleuprothraspglyvalserserileleuile261026152620proprotyrvallysgluaspilethrphehisleuphecysglylys2625263026352640serthrthrlyslysproasnlyslysasnthrserleualaleuile264526502655hisilehisileserserasnargasnileilehisglycysaspphe266026652670leutyrleugluasnglnthrasnaspalaileserasnasnasnasn267526802685asnsertyrserilephethrhisasnlysasnthrgluasnasnleu269026952700ilecysaspileserleuileprolysthrvalileglyilelyscys2705271027152720proasnlyslysleuasnproglnthrcyspheaspgluvaltyrtyr272527302735vallysglngluaspvalproserlysthrilethralaasplystyr274027452750asnthrpheserlysasplysileglyasnileleulysasnalaile275527602765serileasnasnproaspglulysaspasnthrtyrthrtyrleuile277027752780leuproglulysphegluglugluleuileaspthrlyslysvalleu2785279027952800alacysthrcysaspasnlystyrileilehismetlysileglulys280528102815serthrmetasplysilelysileaspglulyslysthrileglylys282028252830aspilecyslystyraspvalthrthrlysvalalathrcysgluile283528402845ileaspthrileaspserservalleulysgluhishisthrvalhis285028552860tyrserilethrleuserargtrpasplysleuileilelystyrpro2865287028752880thrasnglulysthrhisphegluasnphephevalasnpropheasn288528902895leulysasplysvalleutyrasntyrasnlysproileasnileglu290029052910hisileleuproglyalailethrthraspiletyraspthrargthr291529202925lysilelysglntyrileleuargileproprotyrvalhislysasp293029352940ilehispheserleuglupheasnasnserleuserleuthrlysgln2945295029552960asnglnasnileiletyrglyasnvalalalysilepheilehisile296529702975asnglnglytyrlysgluilehisglycysaspphethrglylystyr298029852990serhisleuphethrtyrserlyslysproleuproasnaspaspasp299530003005ilecysasnvalthrileglyasnasnthrpheserglyphealacys301030153020leuserhisphegluleulysproasnasncyspheserservaltyr3025303030353040asptyrasnglualaasnlysvallyslysleupheaspleuserthr304530503055lysvalgluleuasphisilelysglnasnthrserglytyrthrleu306030653070sertyrileilepheasnlysgluserthrlysleulysphesercys307530803085thrcysserserasntyrserasntyrthrileargilethrpheasp309030953100proasntyrileileprogluproglnserargalaileilelystyr3105311031153120valaspleuglnasplysasnphealalystyrleuarglysleu312531303135 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 4 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( xi ) sequence description : seq id no : 3 : glugluvalgly ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 8 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( ix ) feature :( a ) name / key : modified - site ( b ) location : 6 ( d ) other information : / product =&# 34 ; other &# 34 ;/ note =&# 34 ; xaa = glu or gly &# 34 ;( ix ) feature :( a ) name / key : modified - site ( b ) location : 7 ( d ) other information : / product =&# 34 ; other &# 34 ;/ note =&# 34 ; xaa = glu or val &# 34 ;( xi ) sequence description : seq id no : 4 : glugluvalglygluxaaxaagly15__________________________________________________________________________ | 0 |
referring to fig1 a , 1 b and 1 c , there is shown an example of the electric field distribution for the te 10 - mode in a rectangular waveguide . the waveguide cavity 10 has a width dimension , a ; a height dimension , b ; and a length , l as shown in fig1 a . fig1 b shows the electric field distribution e at a particular moment in time , in the cavity 10 for te 10 - mode of the electromagnetic wave , e shown in fig1 c . referring now to fig2 , the accelerator is shown in cross section as a ct arc source 12 application . a rectangular wave - guide cavity 14 has an electron emitter 16 placed on the bottom face 18 , which corresponds to the width dimension , a , of the rectangular waveguide . for an electric field distribution as shown in fig1 b , the electrons emitted from the source are accelerated across the guide , along the path corresponding to the height dimension , b , to the opposing , or upper face , 20 of the cavity 14 . during the negative half wave of the electric field , as in fig1 c for 1 / λ = 0 . 5 1 , no electrons are emitted . it is possible to achieve electron energies of around 150 kev over a path of one to two centimeters in height . the accelerated electrons are then used to generate x - rays in the conventional manner by interacting with a solid target , 22 . the waveguide 14 is essentially an rf cavity . rf frequencies in the cavity may be several ghz . the low frequency cutoff , λ c , is determined by the geometry of the cavity ( see fig1 a ). also , the resonance frequency , λ r , is determined by the geometry of the cavity and integers m , n , and q . for te 10 mode , m = 1 , n = 0 , and the frequency is determined only by the width dimension , a . for a = 10 cm the cutoff frequency , λ c , would be 1 . 5 ghz . a resonant cavity with a cross sectional dimension on the order of 10 cm could be readily integrated in existing ct and other medical x - ray imaging systems . for an electron beam current of 1 ampere and an accelerating voltage on the order of 150 kv , the supplied microwave power must be at least 150 kw , or 150 kv * 1 a . a microwave generator providing ghz - microwave frequencies and mega watt power is state of the art and known in the areas of telecommunications and accelerator technology . a klystron is just such an example . a klystron may be used for microwave - generated electric fields in the waveguide structure in accordance with the present invention to generate x - rays . the microwave power , the waveguide dimensions , and the phase of the electromagnetic wave all determine the energy of the electrons impinging on the target . according to the present invention , there is no need for static high - voltage to accelerate the electron beam . therefore , static high - voltage stability is no longer a concern and the need for costly and bulky high voltage insulator used in prior art arc sources is eliminated . fig3 is a prior art arc source 30 having a field emission cathode 32 that directs electrons onto a target . a water - filled cooling chamber 34 cools the source , and a solid high voltage insulator 36 must be incorporated to maintain high voltage . referring again to fig2 , no high voltage insulator is required . microwaves are coupled into the waveguide . in the waveguide , it is possible to generate oscillations of various configurations , namely standing or traveling waves , by appropriately tuning and terminating the resonant cavity structure . the electron emitter 16 may be a field emission array ( fea ) that is electrically gated . the electron beam is generated only in the area where the gate is open . therefore , the location of the focal spot along the arc can be controlled electrically through the control of the electron beam . the energy of the electrons striking the target 22 depends on several factors . the phase of the electromagnetic wave relative to the time that an electron leaves the emitter is one factor that will affect the energy . the energy is also affected by the location of the emitted electron with respect to the spatial amplitude of the electromagnetic wave . in addition , the power of the microwaves affects the energy of the electrons . at least these three factors are used to generate electron beams with different average energies . the ability to alter , or vary , the average energies is of particular interest for specialized imaging techniques . a significant advantage is the fact that strong electric fields , greater than 10 kv / mm , can be sustained in resonant cavities without the need for solid insulation . electron energies on the order of up to 200 kev can be reached in a space as small as about 20 mm in length with an rf frequency on the order of 12 ghz . therefore , designs are not limited by the need for bulky and expensive high voltage insulators . fig4 is an example of an application in a stationary ct apparatus 40 . a subject 42 remains stationary while the arc source 44 of the present invention generates x - rays . the arc source is moved along the subject 42 and an image is generated by combining image slices into one complete image . it should be noted that the dimensions shown in fig4 are for example purposes only . fig5 is another application for the accelerator of the present invention . a multi - slotted waveguide 50 is used to collimate the x - rays and create a larger coverage area for the x - ray beam . such an extended coverage is needed in volume ct applications so that the time it takes to create the images and the hospital &# 39 ; s ability to diagnose problems is reduced . fig5 shows three slots 52 , 54 , 56 for example purposes only . one skilled in the art is capable of modifying the slot dimensions and the number of slots without departing from the scope of the invention . the electron source 58 may be a field - emitter electron source . in yet another application , the rf electron beam accelerator 62 , shown in fig6 , is used in a rotating x - ray tube 60 . the anode target 63 rotates about an axis 64 and the x - ray beam 66 is generated by an electrode beam 68 from emitter 69 striking the anode target 63 . the accelerator 62 is coupled to a klystron , not shown by way of waveguide 65 . still another application , shown in fig7 , the rf electron beam accelerator 72 is used to boost the energy of an electron beam 74 as it exits a cathode or e - gun source 76 and is directed to a target 78 . the source 76 can be operated below 10 kv , and the rf cavity 72 boosts the electron beam energy up to 100 to 200 kv . the invention covers all alternatives , modifications , and equivalents , as may be included within the spirit and scope of the appended claims . | 7 |
fig1 shows an oil sand deposit referred to as a reservoir , with reference always being made to a rectangular unit 1 of length 1 , width w and height h when making specific observations . the length 1 may , for example , measure up to some 500 m , the width w may measure 60 to 100 m and the height h may measure approximately 20 to 100 m . it should be taken into consideration that , starting from the earth surface e , an ‘ overburden ’ of thickness s up to 500 m may be provided . fig1 shows an apparatus for the inductive heating of the reservoir detail 1 . this may be formed by a long , i . e . measuring several hundred meters to 1 . 5 km , conductor loop 10 to 20 laid in the ground , the outgoing conductor 10 and the return conductor 20 being guided beside one another , i . e . at the same depth , and being interconnected at the end via a member 15 inside or outside the reservoir . at the start , the conductors 10 and 20 are guided down vertically or at a flat angle and may be supplied with electric power by a hf generator 60 that may be housed in an external housing . in fig1 the conductors 10 and 20 extend beside one another to the same depth . however , they may also be guided above one another . a feed pipe 1020 is illustrated beneath the conductor loop 10 / 20 , i . e . on the base of the reservoir unit 1 , via which feed pipe the liquefied bitumen or heavy oil can be transported . typical distances between the outgoing and return conductors 10 , 20 are 5 to 60 m with an outer diameter of the conductors of 10 to 50 cm ( 0 . 1 to 0 . 5 m ). the electric double conductor line 10 , 20 from fig1 having the aforementioned typical dimensions comprises a series inductance per unit length of 1 . 0 to 2 . 7 μh / m . the shunt capacitance per unit length is only 10 to 100 pf / m with the dimensions given , in such a way that the capacitive cross - flows can initially be disregarded . in this instance wave effects should be avoided . the wave velocity is given by the capacitance and inductance per unit length of the conductor apparatus . the characteristic frequency of the apparatus is conditional on the loop length and the wave velocity along the apparatus of the double conductor line 10 , 20 . the loop length should therefore be kept short enough that no interfering wave effects are produced . it can be seen that the simulated density distribution of power loss decreases radially in a plane perpendicular to the conductors , as is the case with current feed in antiphase to the upper and lower conductors . for an inductively introduced heating power of 1 kw per meter of double conductor line , a current amplitude of approximately 350 a for low - resistance reservoirs having specific resistances of 30 ω · m , and of approximately 950 a for high - resistive reservoirs having specific resistances of 500 ω · m is required at 50 khz . the current amplitude necessary for 1 kw / m decreases quadratically with the excitation frequency , i . e . at 100 khz the current amplitudes fall to ¼ of the values above . with a mean current amplitude of 500 a at 50 khz and a typical inductance per unit length of 2 μh / m , the inductive voltage drop is approximately 300 v / m . an electric and thermal configuration of a reactive power - compensated multifilament inductor will be described hereinafter in detail . the previous , unpublished german patent application de 10 2007 040 605 already discloses the basic principle of compensation , over portions , of a coaxial line with distributed capacitances . the following is based on the description of the previous application relating to this aspect : a specific example of a configuration of a capacitively compensated multifilament conductor is presented as follows : two conductor groups have , together , for example a copper cross - section of 1200 mm 2 . this cross - section is divided into 2790 individual solid wires each having a diameter of 0 . 74 mm . each of the wires has insulation made of teflon with a wall thickness of slightly more than 0 . 25 mm and is brought to the doubled resonance length of 2 × 20 . 9 m = 41 . 8 . the wires are arranged in the longitudinal direction , offset relative to the resonance length in accordance with fig4 , described in greater detail below . the cross - section of the conductor apparatus resembles a hexagonal grid and is reproduced in fig5 . in this instance the cross - sectional plane is pressed in such a way that the wires are brought to a mutual distance of 0 . 5 mm . the redundant insulation fills the spaces in the hexagonal grid . the two conductor groups have a capacitance per unit length of 115 . 4 nf / m with an alternate arrangement of the wires on the rings in accordance with fig5 . with the resonance length of 20 . 9 m , the conductor is capacitively compensated at 20 khz . the ohmic resistance is thus 30 μ / m , also at 20 khz . with an alternating current amplitude of 825 a ( peak ), an inductive heating power of 3 kw / m ( rms ) can be inserted in a reservoir having a specific resistance of 555 ωm if the outgoing and return conductors have a distance of 106 m and this configuration is periodically continued . in this instance the ohmic losses in the conductor averaged over a resonance length add up to 15 . 1 w / m ( rms ). depending on the underlying thermal model of the reservoir zrs , t = 200 ° c . constant at 0 . 5 m or 2 . 5 m distance from the conductor , these lead to a heating of the conductor of 230 - 250 ° c ., with no additional liquid cooling being necessary . in this instance the insulation must withstand a voltage of 3 . 6 kv . for teflon , electric strengths of 20 - 36 kv / mm are given , i . e . approximately one third of the electric strength is required with an insulation thickness of 0 . 5 mm . in accordance with the schematic view shown in fig2 it is provided for the line inductance l to be compensated over portions by discrete or continuous series capacitances c . this is shown in a simplified manner in fig2 . an equivalent schematic view of a conductor circuit operated by an alternating current source 25 and having a complex resistor 26 is shown , in which in each case inductors l i and capacitors c i are provided over portions . the line is thus compensated over portions . the latter type of compensation is known from the prior art in systems for inductive energy transfer to systems moved in a translatory manner . in the present context specific advantages are therefore posed . a characteristic of compensation integrated into the line is that the frequency of the hf line generator must be matched to the resonance frequency of the current loop . this means that the double conductor line 10 , 20 of fig1 can expediently only be operated at this frequency for inductive heating , i . e . with high current amplitudes . the key advantage of the latter approach lies in that an addition of the inductive voltages along the line is prevented . if , in the example above , i . e . 500a , 2 μh / m , 50 khz and 300 v / m , a capacitor c i is , for example , inserted in each case every 10 m in the outgoing and return conductors of 1 μif capacitance , this apparatus may be operated resonantly at 50 khz . the inductive and corresponding capacitive accumulated voltages occurring are therefore limited to 3 kv . if the distance between adjacent capacitors c i is reduced , the capacitances must increase in a manner that is inversely proportional to the distance ( with a requirement of the electric strength of the capacitors that is proportional to the distance ) in order to obtain the same resonance frequency . fig3 shows an advantageous embodiment of capacitors integrated into the line having a respective capacitance c . the capacitance is formed by cylindrical capacitors c i between a tubular outer electrode 32 of a first portion and a tubular inner electrode 34 of a second portion , between which a dielectric 33 is arranged . accordingly , the adjacent capacitor is formed between subsequent portions . in addition to high electric strength , high thermal stability is also required for the dielectric of the capacitor c since the conductor is arranged in an inductively heated reservoir 100 that may reach a temperature of , for example , 250 ° c . and the resistive losses in the conductors 10 , 20 may lead to further heating of the electrodes . the requirements of the dielectric 33 are satisfied by a large number of capacitor ceramics . in practice , for example , the groups of aluminum silicates , i . e . porcelains , exhibit thermal stabilities of several hundred degrees centigrade and electric dielectric strengths of & gt ; 20 kv / mm with permittivity values of 6 . upper cylindrical capacitors can therefore be formed with the necessary capacitance and may , for example , be between 1 and 2 m long . if the length should be shorter , a plurality of coaxial electrodes can be nested inside one another in accordance with the principle illustrated with reference to fig2 to 4 . other conventional capacitor designs may also be integrated in the line , provided they exhibit the necessary electric strength and thermal stability . the radial formation of the conductor apparatus that is illustrated with reference to the cross - sectional views is used for this purpose . fig4 shows the main schematic view of two capacitively coupled filament groups 100 and 200 in the longitudinal direction . it can be seen that individual wire portions of predetermined length are periodically repeated and that a second structure 200 with individual wire portions is arranged in a first structure 100 , each being of the same length and the first group of wire portions overlapping with the second group of wire portions over a predetermined distance . a resonance length r l is thus defined , which signifies the capacitive coupling of the filament groups in the longitudinal direction . in fig5 the entire inductor arrangement is already surrounded by insulation 150 . insulation against the surrounding earth is necessary in order to prevent resistive currents through the earth between the adjacent portions , in particular in the region of the capacitors . the insulation also prevents the resistive current flow between the outgoing and return conductors . however , the requirements of the insulation with regard to electric strength are reduced in comparison with the uncompensated line from & gt ; 100 kv to slightly more than 3 kv in the example above and are therefore satisfied by a large number of insulating materials . the insulation must permanently withstand higher temperatures , similarly to the dielectric of the capacitors , ceramic insulating materials again being suitable . in this instance the thickness of the insulation layer must not be too low since otherwise capacitive leakage currents could flow into the surrounding earth . greater insulating material thicknesses , for example 2 mm , are sufficient in the above embodiment . sectional views of a corresponding apparatus with 36 filaments that in turn consist of two filament groups are shown in fig5 , 9 , 10 and 12 . in this instance fig5 in particular illustrates the structure and combination of the nested apparatus formed of 36 filaments . more specifically , in this instance the filament conductors of the first group are denoted by reference numerals 101 to 118 and the filament conductors of the second group are denoted by reference numerals 201 to 218 . in the structure in accordance with a hexagonal - type arrangement a central region 150 in the centre of the conductor is free . overall , predetermined insulations are thus produced in accordance with the intensity structure . fig6 shows a cross - section of a 2 - group , 60 - filament apparatus that in turn has a hexagonal structure . in this instance the conductors 401 to 430 ( hatched to the left ) belong to the first group of filament conductors and the conductors 501 to 530 ( hatched to the right ) belong to the second group of filament conductors . the conductor groups are embedded in an insulating medium . the specific structure of the conductor groups produces individual conductors in each case that are connected in groups via a high intensity electric field and are each connected to other conductors via a low field , which can be confirmed by model calculations . with the hexagonal structure according to fig5 and 6 , the central region 150 is field - free . this region 150 may be used to insert coolants or else to insert mechanical reinforcements with the aim of increasing tensile strength . for example , permanently inserted or removable artificial fiber cables or else removable steel cables can be used for this purpose . this matter is discussed further in greater detail hereinafter . the graph according to fig7 shows , in each case on a logarithmic scale , the number n of individual wires on the abscissa and the series capacitance in μf / m on the ordinate . graphs 71 to 74 are shown for different conductor cross - sections : 71 for a cross - section of 600 mm 2 , 72 for a cross - section of 1200 mm 2 , 73 for a cross - section of 2400 mm 2 and 74 for a cross - section of 4800 mm 2 . the individual graphs 71 to 72 extend parallel with the same monotonic increase : as expected the litz wire capacitance increases exponentially with the number of wires , but linearly with the cross - section . it can be derived from fig7 that the capacitive compensation can be adjusted , on the one hand , as a function of the number of conductors and , on the other hand , as a function of the total cross - section . in this instance a geometry of the conductors according to fig4 and 5 was based on identical teflon insulation in each case . with a predetermined cross - sectional surface , the necessary number of stranded conductors can thus be determined . the graph illustrated in fig8 shows the dependency on frequency of the ohmic resistance for different wire diameters . the frequency is plotted on the abscissa in hz and the resistance per unit of length r is plotted on the ordinate in ω / m , the logarithmic scale being selected in turn for both coordinates . graphs 81 to 84 are shown as parameters for different wire diameters : 81 for a diameter of 0 . 5 mm , 82 for a diameter of 1 mm , 83 for a diameter of 2 mm and 84 for a diameter of 5 mm . graphs 81 to 84 extend , in the starting region , parallel to the abscissa and then rise monotonically with substantially the same increase : as expected the resistance increases exponentially , on the one hand , with frequency and , on the other hand , with wire diameter . in this instance a temperature of 260 ° c . is assumed during current feed . in particular , the influence of the skin effect , at the given temperature , can be seen from the curve in graphs 81 to 84 in fig8 . graphs 81 to 84 show that the ohmic resistance is initially substantially constant in the range up to different limiting frequencies between 10 3 and 10 5 hz , the resistance being inversely proportional to the wire diameter , and also that resistance increases with frequency . six hexagonal conductor bundles 91 to 96 are arranged about a central void 97 in fig9 . in contrast , six approximately cake slice - shaped conductor bundles 91 ′ to 96 ′ are arranged as segments about a central void 97 ′ in fig1 . the empty spaces 97 and 97 ′ contain possible means for receiving cooling devices or mechanical reinforcement devices . corresponding means are not shown in detail in fig9 and 10 . fig1 shows that it is advantageous , with a principle arrangement in accordance with fig1 with segment - shaped members formed of individual conductors , for the individual conductors to be twisted in the longitudinal direction of the entire cable . lines from , for example , c to d are therefore produced on the periphery of the conductor and these indicate the azimuthal twisting of the individual conductors . in this instance there is a field distribution in the left - hand quadrant in the interface that corresponds to the arrows shown . fig1 shows a plastics material pipe 120 , in which an apparatus comprising stranded conductors is inserted . the pipe 120 may , for example , consist of plastics material , an annular gap 121 being formed in the pipe 120 , in which gap the insulator having the hexagonal conductor structures 122 is inserted . in this instance there is basically a central conductor - free region 123 , in which aids required for the intended use of the described conductors may be inserted . in particular , an apparatus of this type with the conductor - free centre 123 makes it possible to use stranded wires instead of woven or transposed wires without having to forego the reduction in additional ohmic losses caused by the proximity effect . comparatively simple production is thus made possible . the relevant boundary conditions should be observed for the intended use of the conductor assemblies described in detail , in particular with reference to fig4 , 5 and 9 to 12 , for heating oil sand reservoirs and extending over several hundred meters . in particular , considerable tensile stresses that may lie within a range of several tens of tonnes should be expected when laying the inductor . the compensated conductor , weakened by interruptions according to fig4 , may therefore be overburdened to such an extent that the electric strength of the dielectric is reduced . mechanical reinforcements are provided for this purpose , in particular in the form of steel cables . furthermore , active cooling may be required . in the apparatus according to fig1 , the outer plastics material pipe 120 is used , in particular , to keep the bore hole open as well as to protect the inductor during installation and operation of the system comprising the apparatus for the inductive heating of the oil sand deposits . the tensile stress on the inductor when it is drawn in is thus reduced as a result of a decrease in friction . the liquid for cooling an annular gap 120 may be arranged inside the plastics material pipe 120 , particularly in the apparatus according to fig1 . in this case the liquid produces a good level of thermal contact relative to the plastics material pipe 120 and , moreover , relative to the reservoir , at least passive cooling of the inductor being necessary in turn . for example , with an ambient temperature of the reservoir of , for example , 200 ° c ., the ohmic losses in the indictor of approximately 20 w / m are dissipated by the heat conduction without the temperature in the inductor exceeding 250 ° c ., which is the critical value for teflon insulation . the apparatus according to fig1 also offers the possibility of cooling in opposite directions . in this instance the central void 97 is used for one direction of the flowing liquid and the annular space 121 inside the plastics material pipe 120 is used for the other direction of the flowing liquid . in fig1 , in each case represented by a line , the frequency in khz is plotted on the abscissa and the inductor flow in amps is plotted on the ordinate . the dependency of the inductor flow on frequency is illustrated , different heating powers being given as parameters : 1 kw / m for graph 131 , 3 kw / m for graph 132 , 5 kw / m for graph 133 and 10 kw / m for graph 134 . the individual graphs 131 to 134 each have an approximately hyperbolic curve . this means that the current feed to the inductor becomes more heavily dependent on frequency as the heating power increases , provided there are constant power losses in the reservoir . in this respect the currents and / or frequencies required for defined heating powers can be read with reference to graphs 131 to 134 . the assemblies described in detail with reference to the figures and comprising the capacitively compensated multifilament conductors make it possible to achieve effective inductive heating of oil sands or other heavy oil deposits . calculations and tests have found that effective heating of the reservoir is achieved , whereby the viscosity of the bitumen or heavy oil embedded in the sand is reduced and therefore sufficient flowability of the previously highly viscous raw material is obtained . | 7 |
the following embodiment of the present invention is constructed on the assumption of achieving color correction by the combination of an lb filter with a cc filter . prior to the description of the embodiment , preliminary items about the color correction will be described hereinafter . between the light - ray intensity ( i 1 , i 2 ) of the operational two wavelengths ( λ1 , λ2 ) from a black body radiation and the photographic color temperature ( tx ) kelvin determined by the two - wavelength intensity in blackbody radiation . here , is given , wherein c is constant . also , there is known to be represented in actual known measuring apparatus , for photographic color it is difficult to measure the light - ray intensity of one wave length only . actually the output in of the measuring apparatus is as follows : wherein sn is the spectral sensitivity or response of the measuring apparatus . also , the wavelength λn corresponding to the measuring apparatus is given as follows . the above - described relation is applied to the light - ray intensity ib of the blue region in the light source and the lightray intensity ir of the red region to give the following mb . this mb is called b - r ratio . ## equ1 ## sb ; is the spectral sensitivity of a light measuring circuit in the blue region ; sr ; is the spectral sensitivity of a light measuring circuit in the red region . likewise , the following mg is given even in the light - ray intensity ir of the red region in the light source and the light - ray intensity ig of the green region . this mg is called a g - r ratio . ## equ2 ## sg ; is the spectral sensitivity of a light measuring circuit of green region . in the case of correction by the combination of the lb filter and the cc filter , is given according to the value mf corresponding to the color temperature of the film of various types , the b - r ratio , mb , and the g - r ratio , mg , above - mentioned . here , the lb , which is called the light balancing factor , shows the difference between the b - r ratio conformed to the film used and the b - r ratio of the measured illuminating light source . also , the above - described cc is called color compensating factor , who shows the difference between the g - r ratio conformed to the film used and the g - r ratio through the correction of the corrected illuminating light source according to the lb factor . as described hereinabove , a person who performs the measurement can use the color filter such as an lb filter , and cc filter , conformed to the lb factor and the cc factor to perform a photographing operation of a color balance , which conforms to the film or image recording member used . fig1 is an analog circuit diagram of a photographic color meter showing a first embodiment of the present invention . a circuit ( 1 ) is composed of a filter ( fo ) for allowing only the light ray of the blue region from among the incident light rays to pass therethrough , a light receiving element ( pdo ), a diode ( do ) for logarithmic compression and an operation amplifier ( oao ). the circuit ( 1 ) comprises a light measuring circuit for the blue region , which output a voltage ( vb ), wherein the intensity of the incident light of the blue region from among the incident light rays has been logarithmically compressed . a circuit ( 2 ) is composed of a filter ( f2 ) for allowing only a light ray of the red region to pass therethrough , a light receiving element ( pd2 ), an operation amplifier ( oa2 ) and a diode ( d2 ) for logarithmic compression . the circuit comprises a light measuring circuit for the red region , which outputs a voltage ( vr ), wherein the intensity of the incident light of the red region from among the incident light rays has been logarithmically compressed . a circuit ( 3 ) is composed of a filter ( f4 ) for allowing only a light ray of the green region to pass therethrough a light receiving element ( pd4 ), a diode ( d4 ) for logarithm compression , and an operation amplifier ( oa4 ). the circuit ( 3 ) comprises a light measuring circuit for the green region , which output a voltage ( vg ), wherein the intensity of the incident light of the green region from among the incident light rays has been logarithmically compressed . reference character ( eo ) is a constant - voltage source which outputs a voltage ( v 1b ) corresponding to ( k 1b ) in the equation ( 1 - 1 ). reference character ( e2 ) is a constant - voltage source , which outputs a voltage ( v 1 g ) corresponding to the k 1 g of an equation ( 1 - 2 ). a circuit ( 40 ), which is composed of resistors ( ro ) through ( r10 ) and an operation amplifier ( oa 6 ), comprises a subtracting circuit , wherein the resistors ( ro ), ( r2 ), ( r4 ) are equal in resistance value , and the resistors ( r6 ), ( r8 ), ( r10 ) are equal in resistance value . a circuit ( 42 ) composed of resistors ( r12 ) through ( r22 ) and an operation amplifier ( oa8 ) is a subtracting circuit , wherein the resistors ( r12 ), ( r14 ) and ( r16 ) are equal in resistance value and the resistors ( r18 ), ( r20 ) and ( r22 ) are equal in resistance value . a circuit ( 50 ), which is composed of resistors ( r24 ), ( r26 ) and an operation amplifier ( oa10 ), comprises an inversion amplifying circuit , wherein the ratio r26 / r24 of the resistors ( r24 ), ( r26 ) corresponds to the 1 /| k 2b | of the equation ( 1 - 1 ). a circuit ( 52 ), which is composed of resistors ( r28 ) and ( r30 ) and an operation amplifier ( oa12 ), comprises an inversion amplifying circuit , wherein the ratio r30 / r28 of the resistors ( 28 ), ( 30 ) corresponds to the 1 /| k 2g | of the equation ( 1 - 2 ). ( k 2b , k 2g & lt ; 0 ) a circuit ( 60 ), which is composed of operation amplifiers ( oa14 ), ( oa16 ), transistors ( bto ), ( bt2 ), ( bt4 ), a resistor ( r32 ), a constant - voltage source ( e4 ), and a diode ( d6 ), comprises an inverse - number operation circuit for calculating the operation of a circuit ( 62 ), which is composed of operation amplifiers ( oa18 ), ( oa20 ), transistors ( bt10 ), ( bt12 ), ( bt14 ), a resistor ( r34 ), a constant - voltage source ( e6 ) and a diode ( d8 ), comprises an inverse - number operation circuit for calculating the operation of a circuit , which is composed of a constant - voltage source ( e8 ), an operation amplifier ( oa22 ), transistors ( bt6 ), ( bt8 ) and a light - emitting diode ( ldo ), comprises a warning circuit for indicating that the photographic color temperature tb based on the output of the light measuring circuit ( 1 ) and ( 2 ) cannot be determined . a circuit , which is composed of a constant - voltage ( e10 ), an operation amplifier ( oa24 ), transistors ( bt16 ), ( bt18 ) and a light - emitting diode ( ld2 ), comprises a warning circuit indicating that the photographic color temperature tg based on the output of the light measuring circuits ( 2 ) and ( 3 ) cannot be determined . a variable - voltage source ( e12 ) outputs a voltage ( vmf ) corresponding to the mf ( mrd ) of the equation ( 4 ), which corresponds to the color temperature of a manually determined film . a circuit ( 7 ), which is composed of resistors ( r36 ) through ( r42 ) and an operation amplifier ( oa26 ), comprises a subtracting circuit for calculating the lb factor . resistors ( r36 ), ( r38 ) are equal in resistance value and resistors ( r40 ), ( r42 ) are equal in resistance value . a circuit ( 8 ), which is composed of resistors ( r44 ) through ( r50 ) and an operation amplifier ( oa28 ), comprises a subtracting circuit for calculating the cc factor . resistors ( r44 ), ( r46 ) are equal in resistance value , and resistors ( r48 ), ( r50 ) are equal in resistance value . reference character ( mo ) is a meter for displaying the tb ( kelvin ) shown in the equation ( 5 ). reference character ( m2 ) is a meter for displaying the tg ( kelvin ) shown in the equation ( 6 ). reference character ( m4 ) is a meter for displaying the lb factor shown in the equation ( 2 ). reference character ( m6 ) is a meter for displaying the cc factor shown in the equation ( 3 ). the operation of the circuit of fig1 will be described hereinafter . assume that the intensity of each of the light rays which become incident to light receiving elements ( pdo ), ( pd2 ) and ( pd4 ) is ib , ir or ig , and the voltage vb , vr , vg corresponding to 1nib , 1nir and 1nig are outputted from the light measuring circuits ( 1 ), ( 2 ), ( 3 ). the outputs of the light measuring circuit ( 1 ), ( 2 ) and the voltage v 1 b corresponding to the k 1b from the constant - voltage source ( eo ) are inputted to the subtracting circuit ( 40 ). the voltage ( v6 ) of is outputted from the subtracting circuit ( 40 ). the voltage ( v6 ) corresponds to on the other hand , the output of the light measuring circuit ( 2 ), ( 3 ) and the voltage v 1g corresponding to the k 1g from the constant - voltage source ( e2 ) are inputted to the subtracting circuit ( 42 ). the voltage ( v8 ) of is outputted from the subtracting circuit ( 40 ). the voltage ( v8 ) corresponds to the output voltage ( v6 ) from the subtracting circuit ( 40 ) is inputted to the inversion amplifying circuit ( 50 ). the output voltage vmb of the inversion amplifying circuit ( 50 ) is given as follows . ## equ3 ## as on the other hand , the output voltage v8 from the subtracting circuit ( 42 ) is inputted to the inversion amplifying circuit ( 52 ). the output voltage vmg of the inversion amplifying circuit ( 52 ) is given as follows . ## equ4 ## as the output vmb of the inversion amplifying circuit ( 50 ) is inputted to the inverse - number operation circuit ( 60 ). in the inverse - number operation circuit ( 60 ), a voltage - current converting circuit , which is composed of the operation amplifier ( oa14 ), the transistor ( bto ) and the resistor ( b32 ), converts the input voltage vmb into the current imb proportional to the input voltage . the current imb becomes the collector current of the transistor ( bt2 ) for the current mirror use and is inputted to the logarithmic compression circuit composed of the diode ( d6 ), the constant - voltage source ( e4 ) and the operation amplifier ( oa16 ). accordingly , assume that the output voltage of the constant - voltage source ( e4 ) is v2 , and the output v4 of the operation amplifier ( oa16 ) is given as follows . ## equ5 ## wherein β1 and β2 are constants . the output v4 of the operation amplifier ( oa16 ) is logarithmically expanded into current by the transistor ( bt4 ). assume that the collector current of the transistor ( bt4 ) is itb , and ## equ6 ## wherein β3 and β4 are constants , are given . through the proper selection of the output voltage v2 of the constant - voltage source ( e4 ) the itb becomes a value corresponding to to give the photographic color temperature determined by the b - r ratio . the photographic color temperature tbk ( kelvin ) is displayed by the meter ( mo ). the collector current itg of the transistor ( bt14 ) becomes according to the input vmg and the output ( v10 ) of the constant - voltage source ( e6 ) from an inverse - number operation circuit ( 62 ), which is the same in construction as the inverse - number operation circuit ( 60 ). the current value of the transistor collector ( bt14 ) becomes a value corresponding to the photographic color temperature tgk ( kelvin ) determined by the g - r ratio is given from the inverse - number operation circuit ( 62 ), and is displayed by the meter ( m2 ). when the output vmb of the inversion amplifying circuit ( 50 ) is larger than the output voltage ( v14 ) of the constant - voltage source ( e8 ), the output of the operation amplifier ( oa22 ) becomes &# 34 ; high &# 34 ; to render the transistor ( bt5 ) nonconductive and , then , the inverse - number operation circuit ( 60 ) and the meter ( mo ) becomes inoperative . at this time , transistor ( bt8 ) becomes conductive to light the light - emitting diode ( ldo ) to provide the warning . the reason why the warning is given is that if the photographic color temperature obtained from the measured b - r ratio becomes o k or lower it renders the definition impossible to be made as the color temperature . similarly , if the photographic color temperature given from the measured g - r ratio becomes o k or lower by the constant - voltage source ( e10 ), the operation amplifier ( oa24 ), the transistor ( bt16 ), ( bt18 ) and the light - emitting diode ( ld2 ), thereby render the inverse - number operation circuit ( 62 ) and the meter ( m2 ) inoperative to cause the light - emitting diode ( ld2 ) to give a warning . the subtracting circuit ( 7 ) inputs the output voltage vmf from the constant - voltage source ( e12 ) and the output vmb of the inversion amplifier ( 50 ) to output the voltage of the vmf corresponds to the mfmrd ( mrd ) corresponding to the color temperature of a film shown in the equation ( 4 ), the vmb corresponds to the mbmrd ( mrd ), and the vlb corresponds to the lb factor shown in the equation ( 2 ) and is displayed by the meter ( m4 ). the vmb , and the vmg from the inversion amplifying circuit ( 52 ) are inputted to the subtracting circuit ( 8 ) and the voltage of is outputted from the subtracting circuit ( 8 ). as the vmg corresponds to the cc factor shown in the equation ( 3 ), the voltage vcc being displayed by the meter ( m6 ). in this embodiment , a circuit is provided to give a warning when the outputs vmg , vmg of the inversion amplifiers ( 50 ), ( 52 ) have become v14 , v16 or more , respectively . in addition , a circuit may be added to give a warning likewise even when a light source wherein the photographic color temperature becomes infinite has been measured . the warning is given when the outputs of the inversion amplifiers ( 50 ), ( 52 ) have become a given value or lower . the warning circuit is required to be the same in construction as the warning circuit of fig1 . fig2 is an appearance view of a color meter to which the present invention has been applied . the construction and function of the color meter of fig2 will be described hereinafter . reference numeral ( 12 ) is a light receiving unit with three filters and light receiving elements disposed therein . reference character ( ss ) is a slide switch for setting a film type . when the switch ( ss ) is placed in a position b , the b type ( color temperature 3 , 200 k in a tungsten type ) is set , while , when the switch ( ss ) is placed in a position a , the a type ( color temperature 3 , 400 k in a tungsten type ) is set . when the switch ss is placed in a position d , the d type ( color temperature 5 , 500 k in a daylight type ) is set . also , when the switch ss is located in a position v , the color temperature of a film to be set becomes variable . reference character ( fs ) is a button to be depressed when the film type is required to be changed . when the button ( fs ) is depressed , the display unit ( 22 ) displays film and k , which show a film - set operation . data corresponding to the position of the slide switch ( ss ) is read to display the color temperature on the display unit ( 24 ), and the display unit ( 26 ) displays a set film type b , a , d or v , which stands for variable . also , when the film type is variable , depression of up button ( us ) or a down button ( ds ) simultaneously with the button ( fs ) and the color temperature of the film to be set at a given time period changes during the depression of the two buttons thereby to display the set value on the display unit ( 24 ). when the up button ( us ) is in its depressed position the set color temperature increases . when the down button ( ds ) is in its depressed position , the set color temperature decreases . once the up button or the down button is released , the momentary color temperature display is fixed and the value of the display is stored as a color temperature set - value of the film . the color temperature to be set has a top limit and a bottom limit . when the value has reached the limit , the set value and the display value remain unchanged even if the buttons ( us ) and ( ds ) are , respectively , in depressed positions . even if only the buttons ( us ) and ( ds ) have been depressed , the set value and the display value remain unchanged . reference character ( ls ) is a button , which is depressed when the lb factor is required to be given . when the button ( ls ) is depressed , &# 34 ; lb &# 34 ; of the display unit ( 22 ) is displayed . and when a measured value is maintained , the value of the lb factor is displayed by the display unit ( 24 ). also , when the measured value is not maintained , nothing is displayed on the display unit ( 24 ). when a measuring button ( ms ) is depressed to read the measured value , the lb factor according to the value is displayed on the display unit ( 24 ). reference character ( cs ) is a button , which is depressed when the cc factor is required to be given . when the button ( cs ) is depressed , &# 34 ; cc &# 34 ; is displayed on the display unit ( 22 ). when the measured value is read in as in the ( ls ) button , the cc factor is displayed on the display unit ( 24 ). when the measured value is not maintained , nothing is displayed on the display unit ( 24 ) before the measuring button ( ms ) is depressed and the measured value is read in . reference character ( ks ) is a button , which is depressed when the photographic color temperature determined from the b - r ratio is required to be given . when the button ( ks ) is depressed , k is displayed on the display unit ( 22 ). when the measured value is maintained as in the ( ls ) and ( cs ), the photographic color temperature is displayed on the display unit ( 24 ). when the measured value is not maintained , nothing is displayed on the display unit . a film type , which is kept set if any button is depressed , is displayed on the display unit ( 26 ). when the measuring button ( ms ) is depressed , the measuring operation is performed except in a film type setting mode . while the button ( ms ) is depressed , the measuring operation is repeated to display the lb factor , the cc factor or the photographic color temperature parameter according to the new measured value . when the ( fs ) button is depressed and the mode for setting the film type is provided , no measuring operation is performed even if the measurement button ( ms ) is depressed . also , when the light source brightness to be measured becomes a given value or lower , the calculated data is not reliable , so that the display unit ( 24 ) flashes and displays the calculated data . when the calculated data has reached a top limit or bottom limit in the case of the photographic color temperature , the display unit ( 24 ) flashes and displays the top limit value or the bottom limit value . also , when the button actions are performed , the entire display performs the same displaying operation for a given time period ( when the flashing operation is performed , the flashing operation continues ) and stops the displaying operation after a given time period . the circuit construction accommodated in the color meter of fig3 will be described hereinafter . reference number ( 300 ) is one chip of a micro - computer , what is called as a μ - com , wherein the circuit is composed of , for example , c - mosfet of which the consumption power is less . power to the circuit ( 300 ) is normally fed from a power supply cell ( e20 ). within the μ - com ( 300 ), there are provided ram ( 302 ), accumulator ( acc ) ( 304 ), carry flag ( cy ) ( 306 ), logical operation circuit ( alu ) ( 308 ), address counter ( ad . cou .) ( 310 ), rom ( 312 ), frequency divider ( div ) ( 314 ), clock generator ( 316 ), input ports ( ip1 ) through ( ip3 ), and output ports ( op1 ) through ( op6 ). in addition , there are various circuit blocks , which will be omitted in description , since the circuit blocks have no direct relation to the present invention . within the ram ( 302 ), there are registers with various labels thereon and the functions of these registers will be described hereinafter . reference character mtc is a register , which counts the time required from the button - action completion of the display off . reference character mrd is a register , which sets the color temperature parameter data of a set film type , for instance , in this embodiment , mf - 10 6 / tfmrd is set . fixed data at a type b is shown by k4 , a fixed data at a type a is shown by k5 , and a fixed data at a type d is shown by k6 . in the mdd , a displaying data is set on the display unit ( 24 ), and the data for blank display ( no display ) is shown by k3 . also , the data corresponding to the top limit from the display limit values of the color temperature is shown by k1 and the data corresponding to the bottom limit is shown by k2 . reference character mdm is a register , which sets the discrimination result of the operation mode . within the register mdm , 8 is set in a film type setting mode , 4 is set in a lb factor calculation mode , 2 is set in a cc factor calculation mode , and 1 is set in a color temperature calculation mode . reference character mfl is a register wherein 1 is provided when all the measured data are read in and 0 is provided when all the measured data are not read in . reference character mrn is a register , wherein a signal is inputted for switching to input one of the outputs ( vmb , vmg and vg ) from an analog circuit ( 10 ) into an a - d converting circuit ( 20 ), and the vmb is inputted at 4 , the vmg is inputted at 2 , and the vg is inputted at 1 . reference character mgf is a register , wherein 1 is provided when the measuring operation is performed through depression of the measuring button ( ms ) and 0 is provided when the measuring operation is not performed . reference character mfj is a register , wherein 1 is provided in a case where the display is required to flash to give a warning when the level of the vg is a given value or less ( when incident light quantity is less ) and 0 is provided in a case where the warning is not required . reference character mfc is a register , wherein 1 exists when the blank display is required to be performed in the flashing display and 0 exists when the data display is required to be performed . reference character mra is a register , wherein the data α from an input port ( ip1 ) is read in such a manner that 8 is provided when the set film type is b , 4 when it is a , 2 when it is d and 1 when it is variable . reference character mud is a register , where 2 is provided when the down button ( ds ) is in its depressed position , 1 is provided when the up button ( us ) is in its depressed position and 0 is provided when both buttons are not in the depressed position . reference character mju is a register , wherein 1 is provided when the calculated color temperature has exceeded a limit and 0 is provided when it has not exceeded the limit . reference character msj is a register , wherein the data , by the button action , from an input port ( ip2 ) is read in . reference character # w is a register , wherein the a - d converting data from an input port ( ip3 ) is read in . reference character # x is a register , wherein the data of the register # w is a data corresponding to mb , the data is set . reference character # y is a register , wherein when the data of the register # w is data corresponding to mg , the data is set . reference character # z is a register , wherein when the data of the register # w is data corresponding to vg , the data is set . strobe signals are normally outputted from the output ports op1 to scan switches ( fs ), ( ls ), ( cs ), ( ks ), ( us ), ( ds ), ( bss ), ( ass ), ( dss ) and ( vss ). in addition , the 1 chip μ - com executes the instruction from a specified address ( 0 address ) of the rom ( 312 ) when the input of a switch has been provided at an inoperative condition ( the condition of cend ) or a one - second - lapsed signal from the frequency divider ( 314 ) has been provided . a transistor ( bt20 ) is a transistor , which controls the feeding to the analog circuit ( 10 ) and the a - d converter ( 20 ) by a signal , through an inverter ( in ), from the μ - com ( 300 ). reference numeral ( 10 ) is an analog circuit composed of the light - measuring circuit ( 1 ), ( 2 ), ( 3 ), the constant - voltage sources ( eo ), ( e2 ), the subtracting circuits ( 40 ), ( 42 ) and the inversion amplifiers ( 50 ), ( 52 ). the vmb , vmg from the inversion amplifiers ( 50 ), ( 52 ) and the vg from the light measuring circuit ( 3 ) are outputted from the analog circuit ( 10 ). reference characters fet ( fto ), ( ft2 ) and ( ft3 ) are analog switches . the data within the mrn register is outputted from the output port ( op3 ) of the μ - com ( 300 ). when 4 has been outputted from the μ - com 1300 , the fet ( fto ) becomes conductive to input the vmb to the a - d converter ( 20 ). when 2 has been outputted , the fet ( ft2 ) becomes conductive to input the vmg . also , when 1 has been outputted , the fet ( ft4 ) becomes conductive to input the vg . the vg is used to determine whether the incident light is a given value or more . reference numeral ( 20 ) is an a - d converter , which is actuated by a signal from the output port ( op3 ) of the μ - com ( 300 ). the a - d conversion results are read into the μ - com ( 300 ) from the input port ( ip3 ). reference numeral ( 22 ) corresponds to the display unit ( 22 ) of fig2 reference numeral ( 24 ) corresponds to the display unit ( 24 ) of fig2 and reference numeral ( 26 ) corresponds to the display unit ( 26 ) of fig2 the display units being composed of , for example , liquid crystal . reference numeral ( msw ) is a switch , which is closed when the light measuring button ( ms ) of fig2 has been depressed . reference character ( fsw ) is a switch , which is closed when the film type setting button ( fs ) of fig2 has been depressed . reference character ( lsw ) is a switch , which is closed when the lb calculating button ( ls ) of fig2 has been depressed . reference character ( csw ) is a switch , which is closed when the cc calculating button ( cs ) of fig2 has been depressed . reference character ( ksw ) is a switch , which is closed when the button for the calculating color temperature ( ks ) of fig2 has been depressed . reference character ( usw ) is a switch to be closed through the depression of the button ( us ), which is depressed to increase the set color temperature of a film of fig2 . reference character ( dsw ) is a switch to be closed through the depression of the button ( ds ), which is depressed to decrease the set color temperature of a film of fig2 . reference character ( bss ) is a switch , which is closed when the slide switch ( ss ) of fig2 is located in a position b . reference character ( ass ) is a switch , which is closed when the slide switch ( ss ) of fig2 is located in a position a . reference character ( dss ) is a switch which is closed when the slide switch ( ss ) of fig2 is located in a position d . reference character ( vss ) is a switch , which is closed when the slide switch ( ss ) of fig2 is located in a position of v . the operation of the μ - com ( 300 ) shown in fig3 will be described hereinafter with reference to the flow charts of fig4 - 1 through fig4 - 4 . fig4 - 1 and fig4 - 2 mainly show the flow charts of the measurement , calculation and display operations with respect to the μ - com ( 300 ), fig4 - 3 mainly shows the flow chart of the button detecting and the data setting operation , and fig4 - 4 shows the flow chart of the display operation in a case where the button operation is not performed . when the input from the button or one - second signal from the frequency divider ( 314 ) has been provided , the μ - com ( 300 ) starts its operation from the instruction within the specific address of the rom ( 312 ). at a step # 2 , the decision is performed as to whether the operation is started by the one - second signal or by the signal from the button . in the case of the one - second signal , the step moves to a step # 81 of fig4 - 4 . when it is not the one - second signal , the data from the input port ( ip2 ) is read into the register msj inside the ram ( 302 ) to detect which button is depressed at a step # 3 . then , at a step # 4 , a detection is performed as to whether or not the switch ( msw ) is closed according to the contents of the register msj wherein the button signal within the ram ( 302 ) has been read in . when the button is not in its depressed position , the step moves to the step # 51 of fig4 - 3 , while , when the button is in its depressed position , the step moves to a step # 5 . at the step # 5 , detection is made as to the contents of the register mdm . when mdm = 8 that is , the film type setting mode , the cend is provided to stop the operation . namely , in the film type setting mode , the measuring operation is not performed . once detection is made that the mode is not in the film type setting mode at step # 5 , a signal &# 34 ; high &# 34 ; is inputted to the inverter ( in ) from the output port ( op3 ) at the step # 6 to render the transistor ( bt20 ) conductive thereby to start the feeding operation to the analog circuit ( 10 ) and the a - d converter ( 20 ). and 1 is set in the register mgf to indicate that the measuring operation is performed at a step # 7 to put the register mfl into o , in which register 1 is provided when three measured values have been read in , since the measured value are not read in . also , 4 is set , in the register mrn for specifying the data to be read in , to specify the data mb to be read - in at first . at a step # 8 , decision is made as to whether the register mfl is 1 or 0 . when the three measured data have not been read in yet through closure of the measuring switch ( ms ), the step moves to the step # 21 , since the register mfl is 0 . a blank displaying data k3 is set in the register mdd to decide the registers mra , mdm so that the set film type is displayed on the display unit ( 26 ) and the set calculation mode is displayed on the display unit ( 22 ) and the step moves to a step # 24 . when the three measured data are arranged , at a step # 8 , with the measuring switch ( ms ) being closed , or when the measured data are arranged after the button deciding action to be later described according to fig4 - 3 , the step moves to a step # 9 to decide the contents of the register mdm to decide the calculation mode . when the register mdm is 1 , the step moves to a mode ( a step # 10 ) wherein the photographic color temperature determined by the b - r ratio mb is calculated , thereby to perform the operation of then , at a step # 11 , a decision is made as to whether or not the calculated data exceeds a display limit value . when the calculated data does not exceed it , the displaying data corresponding to the calculated data is set in the register mdd . and o is set in the register mju so that the flash display is not performed and the step moves to a step # 24 . when it has been decided that the calculated data exceeds the display limit at the step # 11 , a top limit data k1 or a bottom limit k2 is set in the register mdd at the step # 14 or the step # 15 to set 1 in the register mju so that the flash display may be performed thereby to move to the step # 24 . when the content of the register mdm is 2 at the step # 9 , the cc calculation is performed . the operation of is performed at the step # 17 to set the displaying data in the register mdd thereby to move to the step # 24 . when the content of the register mdm is 4 at the step # 9 , the mode is a lb calculation mode . at the step # 19 , the operation of is performed to set the displaying data in the register mdd thereby to move to the step # 24 . at the step # 24 , the register mgf is decided to judge whether or not the light is being measured . when the light is not being measured , the step goes to the step # 26 , while , when the light is being measured , an a - d conversion starting signal is outputted , at the step # 25 , from the output port ( op3 ). time required from the step # 6 to the step # 25 is longer than the time required for the analog circuit ( 10 ) to be stabilized . at the step # 26 , decision is made as to whether or not the register mfj is 1 when the output level of the light measuring circuit is located at a given value or less at the steps # 42 through # 45 to be described later . when the mfj is not 1 , decision is made as to whether or not the register mju is 1 . when the register mju is not 1 , the step goes to the step # 32 to perform the displaying operation according to the data of the mdd . when the register mfj or mju is 1 , decision is made as to whether or not the register mfc is 1 at the step # 28 . also , when the register mfc is 1 , the blank displaying data k3 is set in the register mdd to render the mfc zero . at the step # 32 , the blank is displayed on the display unit ( 24 ). also , when the register mfc is not 1 at the step # 28 , 1 is set in the mfc , at the step # 32 , to display the contents of the register mdd on the display unit ( 24 ). namely , when mfj and mju are 1 , the operations of the steps # 26 through # 36 display the calculated data and the blank alternately on the display unit ( 24 ) every time the step is past , whereby the flashing display is performed . at the step # 33 , decision is made as to whether or not the measuring operation is being performed again . when the measuring operation is not being performed , i . e ., when the operation has been performed through depression of a button except for the measuring button , the register mtc for timer , which causes the displaying operation to be continued for a given time period , is reset at the step # 38 to stop the operation . when it is decided that the measuring operation is being performed at the step # 33 , the a - d converted data is read into the register # w from the input port ( ip3 ) to decide whether or not the measuring switch ( msw ) is closed or not . when the measuring switch ( msw ) is not closed , the step goes to the step # 36 to render the register mgf zero . the feeding transistor ( bt20 ) to the analog circuit is turned off thereby to move to the step # 38 . once it is decided that the measuring switch ( msw ) is closed at the step # 35 , the step # 35 goes to the step # 39 to decide the contents of the register mrn . when the content of the register mrn is 4 , the input voltage to the a - d transducer ( 20 ) is vmb to set the data , read into the register # w , in the register # x . when the mrn is 2 , the a - d converted data which corresponds to the mg is set in the # y register . also , when the mrn is 1 , the a - d converted data which corresponds to the output vg of the light measuring circuit ( 3 ) of fig1 is set in the # z register to decide whether or not the data is at a given value or less . when the incident light quantity is at a given level or less , the calculated data is not reliable and this is performed to warn against it . when the incident light quantity is at a given value or less , 1 is set in the register mfj while , when it is at a given value or more , o is set . the mfj is used to decide as to whether or not the display is made to be flashed at the step # 26 and at the step # 87 to be described later . the time required from the step # 25 to the step # 34 is longer than the time required for the a - d conversion . at the step # 46 , the bit of 1 in the register mrn is shifted by one bit onto the lower unit side . namely , 4 is put to 2 and 2 is put to 1 , and when it is 1 , 1 is provided in the carry ( 306 ). at the step # 47 , decision is made as to whether or not the 1 is in the carry ( 306 ), and when 1 is not in the carry , the step goes to the step # 50 to output the content of the mrn to the output port ( op2 ) thereby to return to the step # 8 . when 1 is provided in the carry ( 306 ) at the step # 47 , three data are adapted to be read in . thus , 1 is set in the register mfl and 4 is set in the register mrn thereby to move to the step # 50 . while the measuring button ( ms ) is in its depressed position , the three data are repeatedly read in in order through the action when the measuring button ( ms ) is depressed . the operation and display are performed , in accordance with the set calculation mode , on the base of these data . once the measuring button ( ms ) is released , the action moves to the time counting operation for continuing the displaying operation . then , the operation in a case where the buttons except for the measuring button have been acted will be described hereinafter with reference to fig4 - 3 . the data read - in in the register msj at the step # 3 are decided at the steps # 51 , # 54 , # 57 and # 60 . in the k calculation , 1 is set in the register mdm to display the k on the display unit ( 22 ). in the cc calculation mode , 2 is set in the mdm to display the cc on the display unit ( 22 ). in the lb calculation mode , 4 is set in the mdm to display the lb . in the film type setting mode , 8 is set in the mdm to display the film thereby to move to the step # 63 . at the step # 63 , the content of the register mdm is decided . when the mdm # 8 is established , the mode is the calculation mode , and the step goes to the step # 8 . when the reading - in operation of the measured value has been completed , the operation and display are performed in accordance with the set calculation mode to stop the action thereby to move to the counting operation of a given time period . also , when reading - in operation of the measured value has not been performed , the displaying operation is performed on the display unit ( 26 ) by the step # 21 or lower to stop the operation . when the mdm = 8 is established at the step # 63 , the step moves to the step of the film type setting mode of the step # 64 or lower . at the step # 64 , the data α corresponding to the condition of the switches ( bss ), ( ass ), ( vss ) from the input port ( ip1 ) is read in to set in the register mra . then , decision is made as to whether or not the content of the register mra is 1 . when the content is not 1 , the step moves to the step # 68 , since the type of b , a or d is required to be set . when the content is 1 , the step moves to the step # 75 , since the film setting color temperature is variable . at the step # 68 , the content of the register mra is decided . in the mra = 8 , a data k4 ( data of mrd unit ) corresponding to the film of the b type is set in the register mrd to display b on the display unit ( 26 ) thereby to move to the step # 10 . when the data k5 ( mrd ) corresponding to the film of the a type is set in the register mrd , when mra = 4 is established at the step # 68 , to display a on the display unit ( 26 ), thereby to move to the step # 10 . when the mra = 2 is established at the step # 68 , a data k6 ( mrd ) corresponding to the film of a d type is set in the mrd to display the d , thereby to move to the step # 10 . when the set color temperature of the film is variable , the step moves from the step # 67 to the step # 75 . at this time , in a case where the content of the register mud is decided and the mud = 0 is established , both the up button and the down button are not in their depressed positions . thus , the step moves to the step # 80 to display the v on the display unit ( 26 ) thereby to move to the step # 10 . when the mud = 1 is established , the content of the mrd is compared with the value of the bottom limit . when the content of the mrd has reached to the bottom limit , the step goes to the step # 80 . when the content has not reached to the bottom limit , 1 is subtracted from the content of the register mrd to move to the step # 80 . when the mud = 2 is established at the step # 75 , the content of the mrd is compared with the value of the top limit at the step # 78 . when the content thereof has reached to the top limit , the step moves to the step # 80 . when the content thereof has not reached to the top limit , 1 is added to the content of the mrd thereby to go to the step # 80 . when the step returns to the step # 10 from the step # 70 , # 72 , # 74 or # 80 , the operation of is calculated according to the mf set in the register mrd to perform the displaying operation thereby to stop the operation . in a case where the film button ( fsw ) and the up button ( usw ) or the down button ( dsw ) are in depressed positions under the inoperative ( cend ) condition , the operation is performed again to change the set value . namely , while the button is in its depressed position , the set value is varied according to a given time period . fig4 - 4 is a flow chart , which is related to an operation of continuing the display for a given time period after the completion of the operation of the buttn action . when one - second signal is provided from the frequency divider ( 314 ) in the condition of the cend , the μ - com ( 300 ) starts its operation thereby to move to the step # 81 , and 1 is added to the register mtc for timer use to decide whether or not the overflowing operation has been performed . when the overflowing operation has been performed , the blank displaying data k3 is set in the displaying data register mdd , with the register mfl showing the reading - in completion of the measured value being 0 , and the registers mfj , mju showing the execution of the flash display being 0 , to turn off the display units ( 22 ), ( 26 ) to output the data k3 of the mdd , so that the cend condition is provided . thereafter , no display is provided on the display unit unless the button action is operated . when no overflow exists at the step # 82 , decision is made as to whether or not the flash display is performed at the steps # 87 and # 88 . when no flash display is performed , the step goes to the step # 94 to continue the display . when it has been decided that the flash display is performed at the steps # 87 , # 88 , decision is made as to whether or not 1 is provided in the register mfc at the step # 89 . when 1 is provided in the register , 0 is set in the mfc to set the blank display data in the mdd thereby to move to the step # 94 . when the mfc has 0 , 1 is set in the mfc to set the displaying data in the mdd thereby to move to the step # 94 . accordingly , after the operation related to the button action has been completed , the display is continued for a given time period , and when the flashing operation for warning is required , the flashing operation is performed at an one - second period . in the above - described embodiment , the b - r ratio and the g - r ratio are given to perform the operation . according to the present invention , it is not an object to provide the b - r ratio and the g - r ratio as in the conventional color meter , but it is an object to provide the light balancing factor and the color compensating factor . thus , it is not restricted to only the embodiment wherein the operation through the b - r ratio and the g - r ratio is performed . namely , the light balancing factor is a value , which is determined when the light intensity of the blue region , the light intensity of the red region and the color temperature of the film are given . the color compensating factor is a value , which is determined when the respective light intensity of blue , green , red and the color temperature of the film are given . thus , the value can be optional as the intermediate calculation process so that the b - r ratio and the g - r ratio are not necessarily given . in the above description , it was a precondition to use the lb filter and the cc filter each having the following operation . namely , the lb filter functions to compensate for the difference between the entire inclination of the characteristic curve of the color balance of a light source and that of the film . the cc filter functions to compensate for the local difference between the light source and film in the characteristic curve has been corrected . the color meter is used to select the respective proper correcting strength about each of the lb filter and the cc filter . however , the color correction is not restricted to the combination between the lb filter and the cc filter as described hereinabove . in addition to the above method , there is a method comprising the steps of using a cc filter having the local correcting function in the green region to perform the correcting operation ( in this case , the lb filter is not used ) for the green region only and using a second cc filter having the local correcting function in the blue region to perform the correcting operation for the blue region only thereby to correct the difference between the characteristic curve of the color balance ranging from the red to the blue of the light source and that of the film . in this case , the b - r ratio ( mb ) and the g - r ratio ( mg ) are used for representation , and cc1 and cc2 defined by respectively become indexes ( they are both color compensating factors ) for the local correction of the green region and for the local correction of the blue region . accordingly , as in the above embodiment , the present invention may be constructed not only to display the combination of the light balancing factor ( lb ) with the color compensating factor ( cc ), but also to display the combination of the color compensating factor ( cc1 ) and the color compensating factor ( cc2 ). this can be realized through the light modification of the above embodiment . as apparent from the definition of the cc1 and cc2 , the color compensating factor ( cc1 ) is a value , which is determined when the respective light intensity of the green and blue regions and the color temperature of the film are given . on the other hand , the color compensating factor ( cc2 ) is a value , which can be determined when the respective light intensity of the blue and red regions and the color temperature of the film are given . thus , the b - r ratio ( mb ) and the g - r ratio ( mg ) are not required to be given as in the above embodiment , and the intermediate calculation process is optional . as described hereinabove , the present invention proposes , as a novel color meter , an appliance , which can directly display the light balancing factor or the color compensating factor with respect to the conventional color meter , which is known as the appliance which measures and displays the b - r ratio and the g - r ratio . according to the present invention , the determination of the color correcting filter can be made more quickly and easily than before , thus resulting in greater convenience for the photographing operation . although the present invention has been described and illustrated in detail , it is to be clearly understood that the same is applied by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of the present invention being limited only by the terms of the appended claims . | 6 |
this invention relates to a spherical biocatalyst , which consists of an immobilized , biologically active material and of an ionotropic , gellike matrix and to a process of producing the same . biocatalysts of the kind described first hereinbefore are known from the publication by vorlop and klein in enzyme technology , third rotenburg fermentation symposium 1982 , sept . 22 to 24 , 1982 , springer - verlag , 1983 , pages 219 to 235 . for instance , it has been stated in the publication that biocatalysts can be produced which are 0 . 1 to 4 millimeters in diameter and have good mechanical properties and consist of a cross - linked alginate matrix and of microorganisms ( yeasts , bacteria ). to produce the known biocatalysts , the alginates are dissolved in water and the aqueous solution is subsequently treated at an elevated temperature in an autoclave . microorganisms are dispersed in the alginate solution and the resulting dispersion is dripped into a calcium chloride solution , in which the droplets remain for 30 to 60 minutes so that they are cured . finally , the biocatalyst is separated and washed . it is also known from the publication that the biopolymers pectin , carrageenan and chitosan may be used as a matrix . cells and enzymes rather than microorganisms can be immobilized as biologically active material in the matrix . the known biocatalysts have been found to rise in the fermentation reactor and to form a coherent layer in the upper portion of the reactor because the catalyst beads have approximately the same density as the solution which is contained in the fermentation reactor and the solutes of which are to be reacted under the influence of the catalyst . the rise of the known biocatalysts will be particularly disadvantageous if the catalysts are used in a fermentation reactor which is operated to maintain a moving bed or fluidized bed . for this reason it is an object of the invention to provide a biocatalyst which has a higher density than water and which ensures an undisturbed operation of a fermentation process proceeding in a fluidized bed . the biocatalyst should also have a high resistance to abrasion and it should be possible to produce the biocatalyst under sterile conditions . another object of the invention is to propose a process of producing the biocatalyst . the object underlying the invention is surprisingly accomplished in that the matrix contains tio 2 having a particle diameter from 0 . 1 to 1 micrometer . it has been found that the catalyst resists abrasion even in continuous operation and in a moist state has a specific gravity from 1 . 1 to 1 . 4 grams per milliliter . the tio 2 has a large surface area having a tio 2 content from 5 to 30 % by weight and a high content of ion - active valences . the biocatalyst in accordance with the invention will have particularly desirable properties if the tio 2 particles are surface - doped with al 2 o 3 and / or alo ( oh ). to dope the tio 2 particles they are sprayed with a 0 . 1 - to 2 - molar solution of an aluminum salt and are subsequently treated at 150 ° to 500 ° c . 10 to 50 grams of the aluminum salts , calculated as al 2 o 3 , are used per kg of tio 2 . the heat treatment results in a hydrolysis of the aluminum salt so that al 2 o 3 and / or alo ( oh ) is formed , which is firmly anchored on the surface of the tio 2 particles . particularly alcl 3 is used as an aluminum salt . it has been found that particularly the tio 2 particles which are doped with al 2 o 3 and / or alo ( oh ) have on their surface free valences , which bond to the macromolecules of the matrix to form a highly stable solution . a further feature of the invention resides in that enzymes , microorganisms or cells are used as a biologically active material and that the matrix consists of biopolymers , such as alginates , pectins , carrageenan or chitosan . it has been found that the biocatalyst in accordance with the invention will have good mechanical properties , a sufficiently high density and a high activity if the above - mentioned substances are used . within the scope of the invention the biocatalyst has a particle diameter from 0 . 05 to 5 mm . catalyst particles which are 0 . 5 to 5 mm in diameter are desirably employed for fermentation reactions which involve a formation or supply of gas . catalyst particles which are 0 . 05 to 0 . 5 mm in diameter are preferred for fermentation reactions which do not involve a formation or supply of gas . the object underlying the invention is also accomplished by the provision of a process of producing the biocatalyst , in which an aqueous solution of the substance for forming the matrix is mixed with 7 to 35 % by weight tio 2 , 0 . 1 to 20 % by weight biologically active material are admixed to the resulting mixture , the resulting dispersion is degassed under a pressure from 800 to 10 millibars and the degased dispersion is dripped from a nozzle into a precipitating bath . particularly as a result of the degassing of the dispersion in the process in accordance with the invention , the biocatalyst has the desired specific gravity . all process steps are carried out at a temperature from 15 ° to 40 ° c . and sterile conditions can be maintained . the precipitating bath for biocatalysts having a matrix consisting of biopolymers , such as alginate , pectin or carrageenan consist of aqueous solutions of divalent or trivalent cations , particularly ca 2 + or al 3 + . chitosan - containing catalysts are precipitated by means of an aqueous solution which contains multivalent anions , particularly polyphosphates . within the scope of the invention the solution of the substance for forming the matrix contains 70 to 99 % by weight water . this will ensure a uniform admixing of the tio 2 particles . within the scope of the invention it will be particularly desirable to cause the droplets emerging from the nozzle to fall freely through a gas space having a length from 0 . 2 to 2 meters and containing an inert gas or air , whereafter the droplets enter the precipitating bath . that measure will have the result that the droplets emerging from the nozzle have an almost spherical shape , which will not substantially change as they impinge on the precipitating bath . within the scope of the invention it will also be particularly desirable to introduce reactive vapors , such as acetaldehyde , into the gas space so that said vapors will effect a surface - hardening of the catalyst beads . temperatures up to 121 ° c . may be provided in the gas space because the residence time of the catalyst beads in the gas space is short and they are not inactivated by relatively high temperatures . finally , within the scope of the invention the droplets which have emerged from the nozzle may remain in the precipitating bath for 0 . 1 to 24 hours . a cross - linking between the substance for forming the matrix and the multivalent ions contained in the precipitating bath is effected during that time . that cross - linking imparts to the droplets a strong structure . the hard catalyst spheres can be stored for several months and can desirably be used in a fluidized bed reactor . the catalyst spheres may optionally be activated with oxygen before they are used . the subject matter of the invention will subsequently be explained more in detail with reference to an illustrative embodiment . 1635 kg twice - distilled water are mixed with 3 . 5 grams penicillin k so that an infection of the catalyst with extraneous germs will be inhibited for a long time . 300 kg of the yeast saccharomyces cerevisiae having a solids content of 30 % by weight are subsequently dispersed in the resulting mixture . 600 kg tio 2 which has been treated with an aluminum salt and contains 2 % by weight al 2 o 3 , are then dispersed in the resulting mixture . a solution consisting of 1000 kg twice - distilled water , 60 kg sodium alginate , 360 g oleic acid , 180 g ergosterol and 2 liters of an emulsifying agent based on fatty acid are dispersed in the resulting suspension . throughout the life of the catalyst , particularly while it is at rest , the oleic acid and the ergosterol act as a growth substrate . the catalyst mixture is subsequently degassed in a vacuum vessel at 800 to 10 millibars and is slowly stirred as it is degassed . the degassed catalyst mixture is conveyed by means of compressed air or inert gas under a pressure of about 3 bars into a nozzle carrier , which is provided with a large number of capillary nozzles , each of which has an inside diameter of 0 . 8 mm . air or inert gas flows around the capillary nozzles in an axial direction , from top to bottom , in the direction in which the droplets emerge , so that droplets having a defined size will be torn from the nozzles . the droplets fall through a gas space , which contains air and has a length of 500 mm , and then impinge on the precipitating bath , which consists of twice - distilled water and 2 % by weight cacl 2 . the precipitating bath has a height of 1000 mm and a spherical shape is assumed by the catalyst beads as they pass through the gas space and through the precipitating bath . the catalyst beads are withdrawn from the bottom of the precipitating bath and placed into a container , in which they are agitated for 12 hours in a solution consisting of twice - distilled water and 2 % by weight cacl 2 . the catalyst beads are subsequently filled into barrels and are stored therein at 4 ° c . in a solution of 1 % by weight cacl 2 . they can be stored for several months without an activity loss of the biocatalyst . 5000 liters of moist catalyst beads which are 2 . 5 mm in diameter and have a bulk density of 0 . 7 kg / l are obtained from the catalyst mixture . the biocatalyst is used for the fermantation of glucose - containing substrates in the production of ethanol . before the fermentation begins , the biocatalyst is activated with a 5 % by weight glucose with an addition of air for 5 days . as a result , the yeast cells grow under the surface of the sphere in a dense growth zone of about 100 micrometers . the biocatalyst has a life of about 8 months in continuous operation . | 2 |
turning now to fig1 a lapping process utilizes a bottom plate 12 that contains a plurality of grooves 14 for transporting slurry ( not shown ). one or more carriers 22 are placed on , and is supported by , the bottom plate 12 . each carrier 22 contains at least one wafer - containing hole 24 . the wafer - containing hole 24 is slightly larger in diameter that the wafer which will be placed therein , typically between 0 . 5 mm and 2 millimeters . the wafer containing holes 24 then have wafers 28 placed in them , with the wafers also being supported by the bottom plate 12 . the wafers 28 have a beveled edge 26 that helps reduce mechanical fractures and chips on the edge of the wafer . the wafers 28 are also thicker than the carriers 22 , such that the top and bottom surfaces of the wafers 28 can be removed by the lapping process , without having to lap the surface of the carriers 22 . by providing carriers 22 that are thinner than the target thickness of the wafers 28 at the completion of the lapping cycle , the lapping cycle time can be reduced . a top plate 16 is then lowered onto the top surface of the wafers 28 . the top plate 16 also contains a plurality of grooves 18 for transporting slurry . slurry is fed into the grooves 18 through a series of slurry holes 20 that project through the top surface of the top plate 16 and connect with the grooves 18 . slurry is introduced into the lap cycle by providing slurry to the top of the slurry holes 20 and letting gravity and motion pull the slurry down through the slurry hole 20 , into the grooves 18 . the slurry then contacts the wafers 28 , and is then carried out of the machine through the grooves 14 . this slurry provides abrasives to assist in the removal of the wafer surfaces , and can also contain surfactants , cleaning agents , rust inhibitors and the like as required . the top plate 16 is typically lowered onto the top surface of the wafers 28 by a pneumatic cylinder ( not shown ). at the start of the lap cycle , the top plate 16 is held against the surface of the wafers 28 under a low pressure controlled by the pneumatic cylinder . this is done to allow any rough anomalies on the surfaces of the wafers 28 to be gently lapped off , and to allow the process to develop momentum . after a prescribed time , the pressure exerted on the surface of the wafers 28 by the top plate 16 is gradually increased at a controlled rate by the pneumatic cylinder to help improve the lapping removal rate . some lapping machines control the final amount of pressure exerted on the wafers 28 , while others simply let the weight of the top plate 16 provide the pressure , whatever that may be . in any case , a significant increase in pressure is realized during lap cycle . typically , the top plate 16 and the bottom plate 12 rotate in opposite directions . the periphery of the carriers 22 contain gear teeth ( not shown ), and interact with a center gear 48 as shown in fig3 and an annular gear ( not shown ). the center gear 48 drives the carriers 22 and causes them to remain in the proper position on the bottom plate 12 , and to rotate around the center axis of the lap machine . the carriers 22 rotate around the center axis of the machine , and also rotate around the center of the carrier 22 itself . this rotation , combined with the spacing between the wafer 28 and the wafer - containing hole 24 , allows the wafer to rotate freely within the carrier , and move across the surfaces of the top plate 16 and bottom plate 12 both radially and axially . this unrestricted movement results in a very flat workpiece with highly parallel surfaces . fig2 demonstrates a situation wherein a wafer 28 is not properly seated in the wafer - containing hole 24 . improper seating can occur due to improper placement of the wafer 28 into the wafer - containing hole 24 . alternatively , during the start of a lap cycle when the pressure exerted on the wafers 28 by the top plate 16 is light , a wafer 28 can float out of the wafer - containing hole 24 . this floating can be caused due to clogging of the slurry grooves 14 of the bottom plate 12 . in such an instance , the slurry cannot flow in the grooves , and therefore causes a buildup of slurry between the bottom plate 12 and the wafer 28 , illustrated as 29 . in any case , when a wafer 28 is not seated properly in the wafer - containing hole 24 , it gets trapped between the carrier 22 and the top plate 16 . when this occurs , a distinct audible noise is generated , and the lap machine is stopped and the wafer 28 is seated into the wafer - containing hole 24 . turning now to fig3 a lap machine 30 contains a spray shield 40 that surrounds the lapping process . access to the carriers 22 for placing and removing wafers 28 is provided through the shield door 42 . when the shield door 42 is opened , access is provided to the carriers 22 , plates 12 and 16 , and wafers 28 . however , the shield door 42 is electronically connected to a control panel 32 , which prohibits commencement of the lap cycle when the shield door 42 is opened . since the operator is shielded from the distinct audible noise generated when a wafer is not properly seated , a sound transmitter 36 , such as a microphone , is placed within the confines of the spray shield 40 . in one preferred embodiment , the sound transmitter 36 is mounted on a support beam 44 which is typically used for supporting the top plate 16 and the pneumatic cylinder used to raise and lower the top plate 16 . in an alternative embodiment , the sound transmitter 36 can be placed on the center gear 48 . in yet another embodiment , the sound transmitter 36 can be mounted on the inside of the spray shield 40 . the sound generated by the commencement of the lapping process is transmitted from the sound transmitter 36 to a receiver 34 . the receiver 34 can be located in any convenient place outside the confines of the spray shield 40 , so long as the operator can hear the sound transmissions and can react accordingly in the event the distinct audible noise associated with a crash is detected . in the embodiment shown , the receiver 34 is located directly above the lap controller 32 , but is in no way limited to this placement . in the event the distinct audible noise associated with a crash is detected , the operator can press one of the emergency stop buttons , designated 38 . the wafer improperly seated can be reseated , and then the lap cycle restarted . the sound transmitted through the sound transmitter 36 can optionally be enhanced through the use of amplifier ( not shown ). the amplifier can be used to boost the entire frequency range of sound produced by the lapping cycle , or can selectively be used to focus on specific frequency ranges associated with a crash . it is also conceivable and within the scope of the invention to electronically translate the signal processed in the amplifier , and provide the signal to the lap controller 32 , thereby automatically stopping the lap cycle when the electronic signal associated with the noise generated during a crash is detected . although the disclosed invention herein specifically details detection of a wafer improperly seated in a carrier , it encompasses the use of sound to detect other lap problems such as a broken wafer , or a contaminant scratching the wafers , for example . as such , while several embodiments of the present invention have been shown and described , it is to be understood that many changes and modifications may be made thereunto without departing from the spirit and scope of the invention as defined in the appended claims . | 1 |
an improved switch apparatus 2 in accordance with the disclosed and claimed concept is depicted generally in fig1 and 2 in an open position . the switch apparatus 2 is connectable with a dc circuit 4 which is schematically depicted in fig1 and which can be of either polarity while still being interruptible by the switch apparatus 2 . as can be understood from fig1 and 2 , the switch apparatus 2 includes a line conductor 8 and further includes a load conductor 12 that is depicted in broken lines in fig1 and 2 for clarity of illustration . the line and load conductors 8 and 12 are , by themselves , electrically separated but are electrically connectable together to close the dc circuit 4 , as will be set forth in greater detail below . as such , the line and load conductors 8 and 12 can be said to together form a conduction element of the switch apparatus 2 . it is understood that the expressions “ line ” and “ load ” in the context of the line and load conductors 8 and 12 or elsewhere are intended merely for purposes of illustration and description and are not intended to be limiting . as such , the line conductor 8 can be connected with either a line or a load , and the load conductor 12 can likewise be connected with either a line or a load without departing from the present concept . the switch apparatus 2 further includes a pair of first contacts 16 a and 16 b ( collectively herein referred to with the numeral 16 ) and a pair of second contacts 20 a and 20 b ( collectively referred to herein with the numeral 20 ) that are situated on the line and load conductors 8 and 12 . more particularly , the first contact 16 a and the second contact 20 a are both situated on and electrically connected with the line conductor 8 , and the first contact 16 b and the second contact 20 b are situated on and electrically connected with the load conductor 12 . as will be set forth in greater detail below , the first contacts 16 are electrically connectable together , and the second contacts 20 are electrically connectable together in parallel with the first contacts 16 . it is also noted that more than two pairs of contacts can be provided , as necessary , to increase the interruption capability of the switch apparatus 2 . the switch apparatus 2 further includes a shaft 24 that is pivotable about a pivot axis 28 , and also includes a first conductor apparatus 32 and a second conductor apparatus 36 that are situated on the shaft 24 . the first and second conductor apparatuses 32 and 36 are each elongated and extend radially from the shaft 24 . the first and second conductor apparatuses 32 and 36 are electrically in parallel with one another when connected together with the pairs of first and second contacts 16 and 20 . moreover , the first and second conductor apparatuses 32 and 36 can be said to be physically oriented parallel with one another and to extend generally in a common plane 38 that extends through the pivot axis 28 . the first conductor apparatus 32 in the depicted exemplary embodiment comprises two conductors , i . e ., a pair of first conductors 40 and 41 . the second conductor apparatus 36 in the depicted exemplary embodiment likewise comprises two conductors , i . e ., a pair of second conductors 44 and 45 . depending upon the rotational position of the shaft 24 about the pivot axis 28 , the first conductors 40 and 41 may be electrically connected at opposite ends thereof with the first contact 16 . further depending upon the rotational position of the shaft 24 about the pivot axis 28 , the second conductors 44 and 45 may be electrically connected at opposite ends thereof with the second contact 20 . as will be set forth in greater detail below , the first and second contacts 16 and 20 and the first and second conductors 40 , 41 , 44 and 45 are together arranged such that the second contacts 20 are electrically connectable together only if the first contacts 16 are electrically connected together . however , the first contacts 16 are electrically connectable together even if the second contacts 20 are electrically disconnected . the switch apparatus 2 can further be said to include a support 46 upon which the line and load conductors 8 and 12 , the pairs of first and second contacts 16 and 20 , the shaft 24 , and the first and second conductor apparatuses 32 and 36 are disposed . although not expressly depicted herein , it is understood that the switch apparatus 2 is intended to further be disposed within an enclosure or to have an enclosure mounted on the support 46 in order to electrically isolate the aforementioned components that are situated on the support 46 from exposure to the environment . the switch apparatus 2 further and advantageously includes an arc extinction apparatus 48 that is situated on the support 46 and that is positioned generally in the vicinity of the first contacts 16 . the arc extinction apparatus 48 can be said to include two magnetic field elements 52 a and 52 b ( collectively referred to herein with the numeral 52 ) which each generate a magnetic field 56 a and 56 b , respectively , ( collectively referred to herein with the numeral 56 ) that are parallel to one another and parallel with the pivot axis 28 . as will be set forth in greater detail below , the north poles of the magnetic field elements 56 point in the same direction . in the depicted exemplary embodiment , the magnetic field element 52 a includes an outboard magnet 60 a and an inboard magnet 64 a that are situated at alternate sides of the first contact 16 a and which have north poles 68 a and 72 a , respectively , that are oriented in the same direction . likewise , the magnetic field element 52 b includes an outboard magnet 60 b and an inboard magnet 64 b that are situated at alternate sides of the first contact 16 b and which have north poles 68 b and 72 b , respectively , that are oriented in the same direction , which is the same direction as that in which the north poles 68 a and 72 a are oriented . the switch apparatus 2 is schematically depicted in fig3 a - 3d as being movable between a first position that is depicted generally in fig3 a , a second position that is depicted generally in fig3 b , a third position that is depicted generally in fig3 c , and a fourth position that is depicted generally in fig3 d . upon rotation of the shaft 24 in the counter - clockwise direction from the perspective of fig3 a - 3d , the switch apparatus 2 is sequentially movable from the first position ( fig3 a ) to the second position ( fig3 b ) to the third position ( fig3 c ) and to the fourth position ( fig3 d ). it is likewise understood that if the shaft 24 is pivoted in the clockwise direction from the perspective of fig3 a - 3d , the switch apparatus 2 is sequentially movable from the fourth position ( fig3 d ), to the third position ( fig3 c ), to the second position ( fig3 b ), and to the first position ( fig3 a ). fig3 d is intended to depict the shaft 24 and the first and second conductor apparatuses 32 and 36 as being in the same position as is depicted generally in fig1 and 2 , i . e ., the fourth position of the switch apparatus 2 , which is an open position . in such position , the line and load conductors 8 and 12 are electrically disconnected from one another since the first conductor apparatus 32 is disconnected from the first contacts 16 and the second conductor apparatus 36 is disconnected from the second contacts 20 . as will be understood from the following description , the first , second , and third positions of the switch apparatus 2 correspond with a closed position of the switch apparatus 2 . when the shaft 24 is in the first position of fig3 a , the first contacts 16 are electrically connected together via the first conductor apparatus 32 , and the second contacts 20 are electrically connected together via the second conductor apparatus 36 , with the second contacts 20 being electrically connected in parallel with the first contacts 16 . by providing both the first contacts 16 and the second contacts 20 electrically in parallel , the switch apparatus 2 can possess a relatively higher current carrying capability than would be generally possible with only the first contacts 16 or the second contacts 20 . when the shaft 24 is rotated in the counter - clockwise direction from the first position of fig3 a toward the second position of fig3 b , the second pair of contacts 20 become electrically disconnected ( fig3 b ) while the first pair of contacts 16 remain electrically and physically connected together . that is , upon rotation of the shaft 24 from the first position of the switch apparatus 2 , as is depicted generally in fig3 a , to the second position of the switch apparatus 2 , as is depicted generally in fig3 b , the second contacts 20 become electrically disconnected . however , the first contacts 16 remain electrically and physically connected together in the second position since the first conductor apparatus 32 remains electrically connected with the first contacts 16 . this is because the first contacts 16 are relatively taller in the vertical direction from the perspective of fig3 a - 3d than the second contacts 20 . that is , and as can be seen in fig3 d , the first contacts 16 can be said to be of a relatively taller dimension 78 in a direction extending away from the conduction element , and the second contacts 20 can be said to be of a relatively shorter dimension 82 in the direction extending away from the conduction element . upon further rotation of the shaft 24 in the counter - clockwise direction from the second position of fig3 b to the third position of fig3 c , the pair of first conductors 40 and 41 become physically disconnected from the pair of first contacts ( fig3 c ). however , fig3 c also depicts the pair of first conductors 40 and 41 being in sufficiently close physical proximity to the first contacts 16 that a pair of arcs 80 a and 80 b ( collectively referred to herein with the numeral 80 ) are formed at a pair of air gaps 76 a and 76 b , respectively , ( collectively referred to herein with the numeral 76 ) which are disposed between the first contacts 16 and the first conductors 40 and 41 , in which situation a certain level of dc current flows through the switch apparatus 2 . as will be set forth in greater detail below , however , the arcs 80 are desirably extinguished by the arc extinction apparatus 48 . nevertheless , the mere possibility of current flow through the switch 2 in the third position of the switch apparatus 2 ( fig3 c ) causes the third position of the switch apparatus 2 to be considered a closed position . since the first and second conductor apparatuses 32 and 36 are oriented parallel with one another in a common plane along the common axis 38 , a rotation of the shaft 24 in the counter - clockwise direction with respect to fig3 a - 3d will result in the second contacts 20 being electrically disconnected from the second conductor apparatus 36 ( fig3 b ) prior to the first contacts 16 being physically disconnected from the first conductor apparatus 32 ( fig3 c ). since in the second position of fig3 b the first contacts 16 remain electrically connected together , and since the second contacts 20 had been electrically connected together in parallel with the first contacts 16 , electrical arcs generally do not form at air gaps between the second contacts 20 and the second conductor apparatus 36 . it is understood that other configurations of contacts and conductors can be employed without departing from the present concept . for example , if the first and second conductor apparatuses did not both lie in a common plane , the pairs of contacts that might be employed may be of the same height but at different positions to cause one pair of contacts to be connected at a different rotational position of the shaft than the connection of another pair of contacts . other variations will be apparent to one of ordinary skill in the art within the scope of the disclosed and claimed concept . as can be understood from the foregoing , therefore , upon rotation of the shaft 24 from the first position of fig3 a and the second position of fig3 b , no arcs are formed between the second contacts 20 and the second conductor apparatus 36 when they become physically and electrically disconnected . this is because the first contacts 16 remain electrically connected together at the point when the second contacts 20 become electrically disconnected . however , when moving from the second position of fig3 b to the third position of fig3 c , at which point the first conductor apparatus 32 becomes physically disconnected from the first contacts 16 , the arcs 80 are formed at the air gaps 76 . the arc extinction apparatus 48 is thus advantageously provided to rapidly extinguish the arcs 80 at the air gaps 76 when the switch apparatus 2 is moved from its second position to its third position . the arc extinction apparatus 48 rapidly extinguishes the arcs 80 via the application of lorentz forces to the arcs 80 . the first conductor apparatus 32 is depicted in fig4 as being in the third position with respect to the first contacts 16 and as having dc of a first polarity being connected between the line and load conductors 8 and 12 . in this regard , the direction of the current flow through the first conductor apparatus 32 is indicated generally with the numeral 84 , and the direction of the current flow at the air gaps 76 as a result of the arcs 80 is depicted at the numerals 88 a and 88 b ( collectively referred to herein with the numeral 88 ) at the air gaps 76 a and 76 b , respectively . when the dc of the first polarity is applied , as is depicted generally in fig4 , the action of the magnetic fields 56 a and 56 b on the arcs 80 a and 80 b results in the application of lorentz forces 90 a and 90 b ( collectively referred to herein with the numeral 90 ) on the arcs 80 a and 80 b , respectively , according to the well understood right hand rule . as can be understood from fig4 , the lorentz force 90 a causes the arc 80 a to be pushed in a direction generally away from the pivot axis 28 , whereas the lorentz force 90 b causes the arc 80 b to be pushed in a direction generally toward the pivot axis 28 . while it is understood that the pushing of the arc 80 b toward the pivot axis 28 would typically cause the arc 80 b to become shortened and thereby reinforced and strengthened , it can be understood that the extinction of either the arc 80 a or the arc 80 b will result in the extinction of both arcs 80 . as such , the lorentz force 90 a applied to the arc 80 a , which is in a direction generally away from the pivot axis 28 , causes both arcs 80 to be extinguished very rapidly . fig5 depicts an instance wherein dc of an opposite polarity ( i . e ., opposite that of fig4 ) is applied to the switch apparatus 2 in the third position . the direction of the current flow in the first conductor apparatus 32 is indicated generally at the numeral 92 , and the direction of the current flow at the air gaps 76 a and 76 b is represented generally at the numerals 94 a and 94 b ( collectively referred to herein at the numeral 94 ) and which take the form of electrical arcs 96 a and 96 b ( collectively referred to herein at the numeral 96 ). the magnetic fields 56 cause lorentz forces 98 a and 98 b ( collectively referred to herein at the numeral 98 ) to act on the arcs 96 in directions generally opposite those of the lorentz forces 90 a and 90 b , respectively . that is , whereas the lorentz force 90 a caused the arc 80 a to move in a direction generally away from the pivot axis 28 , the lorentz force 98 a causes the arc 96 a to move in a direction generally toward the pivot axis 28 . likewise , the lorentz force 98 b acting on the arc 96 b causes the arc 96 b to move in a direction generally away from the pivot axis 28 , which is an opposite direction from that of fig4 . the arc 96 b is expected to be extinguished prior to the extinction of the arc 96 a since the arc 96 b is being pushed by the lorentz force 98 b in a direction generally away from the pivot axis 28 and , as before , the extinction of either arc 96 will result in the extinction of both arcs 96 . it thus can be seen that the magnetic field elements 52 applied to the first contacts 16 results in rapid extinction of the arcs 80 and 96 regardless of the polarity of the dc applied to the switch apparatus 2 . by causing the first contacts 16 to remain electrically connected together via the first conductor apparatus 32 subsequent to the second contacts 20 becoming electrically disconnected from the second conductor apparatus 36 , the arcs 80 and 96 advantageously occur only at the first contacts 16 and not at the second contacts 20 , with the advantageous result that the arc extinction apparatus 48 need provide only the magnetic field elements 52 in the vicinity of the first contacts 16 . this reduces costs by avoiding the need for such additional magnetic field elements to be placed in the vicinity of the second contacts 20 . the switch apparatus 2 thus advantageously is configured to interrupt high current levels of dc of either polarity at an acceptably low cost . while specific embodiments of the invention have been described in detail , it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure . accordingly , the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of invention which is to be given the full breadth of the claims appended and any and all equivalents thereof . | 7 |
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . in the following description and in the figures , like elements are identified with like reference numerals . the use of “ or ” indicates a non - exclusive alternative without limitation unless otherwise noted . the use of “ including ” means “ including , but not limited to ,” unless otherwise noted . several versions of the door stabilizer bracket of the invention are shown to advantage in fig1 - 5 . fig1 shows a doors stabilizer bracket 10 of the invention with a bracket body 12 , and three hinge interface plates 14 . each of the hinge interface plates 14 connect to a different door 16 specifically , each of the hinge interface plates 14 interface with a position on the door 16 which has been prepared for attachment of hinges to hold the door onto the door frame . these are designated as hinge attachment locations 18 . the door stabilizer bracket 10 of the invention can be made of a number of different materials such as metal and plastic , but a metal such as steel or aluminum is preferred . the door stabilizer brackets can take a number of configurations , as shown by the figures . the hinge interface plates 14 are shaped to fit into standard hinge attachment locations 18 on a standard household door . the hinge interface plates 14 are configured so that when a door is attached to them , the three doors that can be attached are pointed at different angles to allow access to both sides of each of the doors by a painter . when attached to the door stabilizer bracket 10 of the invention , the three doors can be placed in an upright position while they are being painted , and can be left in an upright position as the paint dries . although the door stabilizer bracket 10 may be utilized to hold three doors , it is also an option for the user to utilize two door stabilizer brackets in order to hold those three doors , or one stabilizer to hold two doors . fig2 shows an alternate form of door stabilizer bracket , which is formed generally by a t shaped bracket body . shown in fig2 is the door stabilizer bracket 10 of the invention attached to doors 16 using screws 20 . shown in fig2 are three hinged interface plates 14 . fig3 shows an alternate configuration bracket body 12 of the invention . in this configuration of the door stabilizer bracket 10 , the bracket body 12 is generally u shaped , with hinge interface plates positioned on each of the three sides of the u shaped bracket body 12 . the hinge interfaced plates 14 are shown attached to doors 16 by screws 20 . the configuration shown in fig4 is a five sided bracket , with a five sided bracket body 12 , with three hinge interface plates 14 , attached to the hinge attachment location 18 of three doors 16 , the doors are attached by one screw 20 . fig5 shows a version of the door stabilizer bracket 10 which is generally three sided , with a generally triangular shaped body with three hinge interfaced plates 14 which attach to doors 16 by one or more screws 20 . while there is shown and described the present preferred embodiment of the invention , it is to be distinctly understood that this invention is not limited thereto , but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the invention as defined by the following claims . | 1 |
while this invention is susceptible of embodiment in many different forms , there is shown in the drawings and will be described in details herein one specific embodiment , with the understanding that the present disclosure is to be considered as an example of the principles of the invention and is not intended to limit the invention to the embodiment illustrated and described . referring firstly to fig1 , the basic components of the preferred universal retrofit kit 20 are illustrated therein . the preferred retrofit kit comprises a pair of limit switches 24 , 26 mounted to a switch post 28 . a wiring system is provided and is generally labelled as 30 . a pair of light modules 32 are provided for attachment to the front end and to the rear end of a vehicle . illuminated monitoring switches 34 are optional . these switches 34 are optionally provided for mounting inside the vehicle for monitoring the operation of the light modules 32 . the switch post 28 has an enlarged base 36 for bonding to the firewall of a vehicle , as it will be explained later . the limit switches 24 , 26 are mounted to the switch post 28 by means of tube clamps 38 . the clamps 38 are mounted to the switch post 28 with a sliding fit tolerance or tension , such that the limit switches 24 , 26 can be adjusted along and around the switch post 28 by a force of approximately 5 lbs . the wiring system 30 comprises several series of single - wire connectors 40 such that portions of this wiring system can be threaded , one connector at the time , into a relatively small hole through the firewall of the vehicle , or alongside existing conduits or cables extending outside the passenger compartment of the vehicle . each light module 32 is made of coloured light emitting diodes ( leds ) 50 mounted side by side in a sealed housing 52 . these diodes 50 are arranged in sets of three , aligned behind a clear lens 54 . each set of diodes 50 , contains a red diode , an amber diode and a green diode . for convenience , the word diodes and lights are used interchangeably herein to refer to the light emitting diodes 50 . it will be understood from the following description , that the red light indicates a braking condition , the amber light indicates a coasting condition , where the operator of the vehicle does not apply pressure on neither the brake pedal nor the accelerator pedal , and the green light indicates an accelerating or constant speed condition , where the accelerator pedal is depressed at least a small amount . there are also provided on the housing 52 of each light module 32 , a series of tabs 56 affixed to the housing 52 by means of respective hinges 58 . each tab 56 preferably has on its surface , an adhesive tape , a mounting hole , or other means of attachment of the tab to a vehicle . the hinges 58 are adjustable to mount each light module 32 to any of several preferred locations on a vehicle . the hinges 58 have a tight fit tolerance in their moving parts so as to retain an initial adjustment thereof on a vehicle under normal driving conditions . the housing 52 of each light module preferably has a length of about 6 – 10 inches , a thickness of about ⅜ to ¾ inch , and a depth of ¾ to 1½ inches . it preferably has a sleek design and a moderate bow shape with the ends pointing toward the rear side thereof , as illustrated in fig1 . each housing 52 is preferably made of a plastic material that is somewhat malleable and that has shape - retention memory , such that it can be bent to some degrees lengthwise and crosswise to match various curvatures on the vehicle on which it is mounted . referring now to fig2 and 3 , the switch post 28 is preferably affixed to the firewall 60 of a vehicle , between the brake pedal 62 and the accelerator pedal 64 , under or immediately below the dashboard 66 of the vehicle . one of the light modules 32 is preferably mounted at any convenient location on the front end of a vehicle 70 such that it can be easily seen by approaching traffic and pedestrians . the other light module 32 is preferably affixed to another highly visible location on the rear end of the vehicle . one advantage of having the signalling light module 32 on the front end of a vehicle is that it indicates to pedestrians at an intersection for example , the running condition of an approaching vehicle . these pedestrians can readily detect the intentions of the driver in that vehicle , and decide whether or not they should walk in the front of it . one advantage of the rear light module 32 is to provide a driver in a following vehicle with the ability to predict a deceleration by compression of the engine , and an eventual braking of the vehicle ahead of him . referring now to fig4 , 5 and 6 , the mounting of the limit switches 24 , 26 and of the switch post 28 will be explained in greater details . the limit switches are of the type having a normally open contact , a normally closed contact and a respective wand 72 extending at least about 3½ to 4 inches from the axis of the switch post 28 . one example of such limit switches is a model z , general purpose basic switch , available from omron ™ canada inc . a company having its head offices in scarborough , ontario , canada . the switch post 28 with the limit switches 24 , 26 mounted thereto is held between the brake pedal and the accelerator pedal of the vehicle at a location that is high enough so not to interfere with the foot movement of the driver , and where the wands 72 of the limit switches 24 , 26 are respectively in contact with the arm 62 of the brake pedal and with arm 64 of the accelerator pedal . the location of the base 36 of the switch post 28 is then marked on the firewall 60 of the vehicle . then , the carpet 74 of the firewall 60 is cut out and the metal of the firewall 60 is exposed over an area 76 corresponding to the location of the base 36 of the switch post . using a resinous bonding compound 78 , often referred to as plastic metal or plumber putty , the base 36 of the switch post is bonded to the bare metal of the firewall 76 . a typical shear strength of the preferred bonding compound is 3 , 000 psi . an example of such a bonding compound 78 is marketed under the name cold weld ™, by permatex ™, inc ., a company having its head offices in solon , ohio , usa . a sufficient amount of an appropriate bonding compound 78 is preferably included in the preferred vehicle signalling retrofit kit , such that it is readily available to the purchaser of the preferred retrofit kit . in order to ensure a strong bond between the base 36 of the switch post and the firewall , the base 36 has a hollow shape and several radial holes 80 near the rim of the base . a sufficient amount of bonding compound 78 should be used to partly fill the hollow shape of the base 36 and to flow out through these holes 80 . the switch post 28 is then held in place for a few minutes until the bonding compound starts to take hold . a preferred material of construction for the switch post 28 is a nominal ½ inch copper tubing and the preferred material of construction for the base 36 is a tubing reducer coupling having a nominal size of ½ inch to ¾ inch . it will be appreciated that the switch post 28 , and the base 36 can be manufactured from materials other than copper , depending upon the preference of the manufacturer . when the bonding compound has set or hardened to hold the switch post 28 in place , such as after a period of 15 – 30 minutes or so , the limit switches 24 , 26 can be adjusted to their final positions . the adjustment of both switches is done by moving them along the switch post 28 until their wands 72 touch the arms 62 , 64 of the brake and accelerator pedals respectively , and the normally open contact in each switch is closed . the switches are further moved slightly toward the arms 62 , 64 of the pedals such that a pre - travel of approximately 1 / 16 to ⅛ of an inch is required in each pedal to change the state of the switches . it will be appreciated that the stress on the switch post 28 is maximum at the initial position of the switches 24 , 26 as described above . the force on the wands 72 of the switches is a fraction of one pound . therefore , the force required to hold the limit switches in place along the switch post 28 and the overall stress on the switch post 28 is negligible as compared to the holding strength of the bonding compound specified above . the sturdiness of this installation is believe to be sufficient to last the life of the vehicle . in order to further simplify the work required to install the preferred retrofit kit , the wiring of the switches 24 , 26 is preferably done before bonding the switch post in place and adjusting the position of the switches . in fact , the connection of the wiring system 30 to the limit switches 24 , 26 is preferably effected at the factory before the packaging of the retrofit kit and its distribution to retail outlets . these connections have been omitted in fig1 , 2 , 4 and 5 to maintain the clarity of these drawings . the wiring of the switches 24 , 26 and of the light modules 32 is illustrated in fig7 . the wiring system 30 is preferably connected directly to the battery 90 of the vehicle . the wiring system 30 preferably comprises a fuse 92 and an on - off switch 94 . the power is firstly supplied to the common terminal of the brake pedal switch 24 . the initial pre - tensioning of the wand 72 of the brake pedal switch 24 as described before , closes the normally open contact of that switch 24 to transmit power to the common terminal of the accelerator pedal switch 26 . when the wand 72 of the brake pedal switch 24 is released from its tensioned position , the power is cut off to the accelerator pedal switch 26 and is applied to the normally closed terminal of the brake pedal switch 24 , thereby energizing the red diodes , labelled as “ r ” on the diagram of fig7 . it will be appreciated from the above description that the red diodes have precedence over the other lights . during all non - braking conditions , power is available to the accelerator switch 26 , to light up either the amber “ a ” or the green “ g ” diodes , of which the respective wiring is labelled by the same letters , or coded with the same colours . when the accelerator pedal is at rest , the normally open contact of the accelerator pedal switch 26 is closed , thereby energizing the amber “ a ” diodes in the light modules 32 . when the accelerator pedal is depressed , the green “ g ” diodes are lit up . the wiring system 30 comprises several series of single - wire connectors 40 to facilitate the threading of the wiring through relatively small openings out of the passenger compartment of the vehicle . one series of connectors 96 is preferably provided for connection to the illuminated monitoring switches 34 . another series of connectors 98 is preferably provided for connection to a third light module mounted on a trailer towed behind the vehicle for example . one or more extensions 100 are provided for connection of the light modules 32 to the switches 24 , 26 . the connectors in each series 40 are preferably coloured or colour coded according to the colours of the diodes energized therefrom , with the ground connectors 102 left unmarked or coloured white . the coloured diodes 50 in each light module 32 are typically 3 volt leds . each diode 50 is connected to the wiring system in series with a 470 ohm resistor 104 . the vehicle signalization retrofit kit described above does not tap into the existing wiring system of an automobile and is easily adjusted to various configurations of brake pedals , accelerator pedals and various vehicle interiors . furthermore , the vehicle signalization retrofit kit according to the present invention operates equally well when the vehicle is travelling in a cruise controlled mode . in the cruise controlled mode , the accelerator pedal still moves as if it was operated by the foot of the driver . this movement is detected by the accelerator limit switch 26 to operate the light modules accordingly . as to other manner of usage and operation of the retrofit kit of present invention , the same should be apparent from the above description and accompanying drawings , and accordingly further discussion relative to the manner of usage and operation of the invention would be considered repetitious and is not provided . while one embodiment of the present invention has been illustrated and described herein above , it will be appreciated by those skilled in the art that various modifications , alternate constructions and equivalents may be employed without departing from the true spirit and scope of the invention . therefore , the above description and the illustrations should not be construed as limiting the scope of the invention which is defined by the appended claims . | 1 |
while the invention is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the invention to the specific form disclosed , but , on the contrary , the invention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention as defined in the claims . as shown in fig1 the present invention is a construction module 10 for building walls and other structures . the invented module 10 is in the general form of a generally right rectangular parallelepiped having a first side face 12 , a second side face 14 , a first end face 16 , and second end face 18 , a top face 20 , and a bottom face 22 . the top faces 20 of the module 10 includes at least one latitudinal groove 24 extending perpendicular to the side faces 12 , 14 across the top face 20 and parallel to the end faces 16 , 18 . the bottom face 22 of the module 10 includes at least one matching latitudinal tang 26 extending perpendicular to the side faces 12 , 14 across the bottom face 22 and parallel to the end faces 16 , 18 . the tang 26 of a first module 10 is able to be received into the groove 24 of a second module 10 ′, as shown in fig6 & amp ; 7 , thereby interfittingly locking plural modules together . the preferred embodiment has two tangs 26 and two grooves 24 located so that adjacent modules 10 , 10 ′ can either be stacked vertically , one on top of one another , or stacked in a staggered portion so that in a module having two tangs 26 , 26 ′, a first tang 26 would be received into a groove 24 of a first module 10 ′, and the second tang 26 ′ would be able to be received into the groove 24 ′ of a second module 10 ″. such stacking is shown in fig6 . the top face 20 further comprises at least one longitudinal inner shoulder 28 extending slightly inwards from one of the side faces . the bottom face 22 further comprises at least one longitudinal outer shoulder 30 , said outer shoulder 30 preferably extending from the side face inward . the inner shoulder 28 receives and interfits with outer shoulder 30 of an adjacent module . thereby interfittingly locking plural modules together , as shown in fig7 & amp ; 8 . it is preferred that the top face 20 comprise two longitudinal inner shoulders 28 and the bottom face 22 comprises a complement of two longitudinal outer shoulders 30 . when plural modules are so stacked , the tangs 26 and grooves 24 and shoulders 28 , 30 cooperate to inhibit all sliding movement of the modules , either latitudinally or longitudinally . such interfitting attachments can be further secured through the use of a bonding means applied to the joints between the grooves and tangs and between the inner shoulders and outer shoulders . additionally , a relief 32 may exist in the inner or outer shoulder and within the ends themselves ( relief 34 ) thereby allowing a quantity of bonding means to be applied to the surface thereby increasing the strength of the bonds . suitable bonding means can be any appropriate material from sealants to adhesives , to mortar , so long as the bonding means is appropriate for holding plural modules together . it is preferred that said bonding means will have elastic properties thereby allowing the structure built to withstand some movement and changes due to environmental conditions . such a bonding material would also preferably allow for lateral thermal expansion and contraction and provide highly survivable flexibility under natural and extraordinary stresses . transfer of load carried by such structure is done by space - to - space contact of accurately cast surfaces , and distribution by the elastic nature of the bonding means . such a wall would also have features of being water resistant . the construction module 10 also preferably comprises a center channel 36 vertically through the center of the module 10 extending from top face 20 to bottom face 22 . stacked modules will have aligned center channels 36 . this center channel can be used for many purposes , including the insertion of attachment means for attaching modules together or modules to a footer or other means ; for inclusion of an insulating material ; for receipt of a bonding means , such as concrete ; or for other purposes . as shown in fig3 and 5 , each of the end faces 16 , 18 , preferably also comprise vertical troughs 38 extending within the end face 16 , 18 from the bottom face 22 to the top face 20 . the troughs 38 of adjacent module ends jointly form end channels 40 extending vertically , as shown in fig6 a . when adjacent modules are stacked in a staggered position , the end channels 40 alternatingly align with the center channels 36 to form joint channels 42 extending vertically through the pieces . an example of this is shown in fig6 b . the side faces 12 , 14 may further comprise horizontal conduits 44 or vertical conduits 48 extending to said side face . these conduits can be for receiving wiring , plumbing or other materials . also envisioned is the receipt of an insert , into the conduit . this insert would allow a material such as drywall to be affixed to the stacked modules by a screw extending , for instance , through the drywall and into the insert . these inserts will be rigidly affixed into said conduits , either through dovetailing , friction or through an adhesive or other bonding means . the conduits 44 , 48 and inserts may be made of a dovetailed type of shape so that the inserts slide into the conduits . still referring to fig9 a conduit cavity 52 may be found along any of the conduits 44 , 48 , this cavity 52 extending into the module 10 . such a cavity 52 would allow receipt of a joint box , for instance . this cavity may extend through the module 10 and into one of the center 36 , end 40 , or joint 42 channels . such an arrangement allows for wiring and plumbing to be properly and easily extended along the faces of the modules without requiring said wiring , plumbing or other apparatuses to project outwards from the surface of the modules . also envisioned is a sluice or horizontal relief 62 running though the top 20 of the module 10 , thereby allowing apparatuses such as plumbing or wiring to be laid along the top surfaces of the modules . also envisioned , as shown in fig1 , is the inclusion of joist relief notches 54 extending generally downward from the intersection of the top face 20 and either of the sides . these joist relief notches 54 are for the receipt of standard construction joist members ( not shown ). such means would allow the joist members to be attached to a foundation without necessitating the need of some kind of additional joist hanger . as shown in fig1 , the center channel 36 further comprises an attachment ledge 56 at the top of the center channel 36 for cooperation with an attachment means 58 . examples of such attachment means 58 , as shown in fig1 , 13 a , 13 b , would include reinforced bar or rebar , and the combination of anchor spanners , anchor nuts and anchor bolts . such attachment means 58 could be used to rigidly affix modules together . for instance , an anchor bolt 64 could be formed into concrete footer 70 , extending vertically therefrom . the modules could be arranged so that this anchor bolt extends upward through the center channel 36 . an anchor spanner 66 would then be inserted over the top of this anchor bolt 64 , said anchor bolt 64 extending through said anchor spanner 66 . an anchor nut 68 could be attached to the anchor bolt 64 and tightened down , holding the anchor spanner 66 against the attachment ledge 56 at the top of the center channel , thereby fixedly holding the construction module 10 against the footer 70 . this process could be repeated for all such modules attached to the concrete footer . modules stacked or staggered above said first row of modules could be affixed to one another through use of rebar clamp 72 as shown in fig1 a , or other means . such attachment could be by extending the rebar clamp 72 through one of the joint channels 42 and attaching it . the anchor bolts are preferably threaded . the reinforcing bars are preferably one - half inch round . the anchor spanners are preferably twelve gauge steel . the invented modules can be cast or formed of a variety of materials , for instance , concrete or concrete aggregates such as sand , gravel , styrofoam beads , inert wastes , etc . ; composite materials such as silicates , carbonates or other inert particles with binders ; mixtures of natural organic / mineral compounds and fixed with heat and / or chemical processing ; mixtures of wastes rendered inert by processes , encapsulating or fixing with heat and / or chemical processing or binders ; or , steel , composite or other types of reinforcement cast into blocks . as shown in fig1 a , 10 b and 10 c the side faces 12 ( and 14 ) may comprise textures or decorations , for instance they might be formed to look like logs ( fig1 a ) for a mock log cabin construction , designs ( fig1 b , fig1 c ) or coated with different types of coatings ( not shown ). because the invention might be used for a wide variety of applications , not limited to retaining walls , building walls , columns , foundations , etc ., assembly of the invented construction modules into such a structure is done through first establishing a level foundation having embedded vertically extended anchor bolts or other attachments means . a first course of modules would then be set upon this foundation with a bonding means applied between the foundation and the modules and between adjacent modules thereby forming a solid initial wall . horizontal reinforcing bars could be laid into the horizontal sluice located in the top face of the modules . anchor spanners and anchor nuts would then be attached to each of the anchor bolts and tightened down so that the anchor spanners fixedly contact the top faces of the modules , capturing the horizontal reinforcing bars , and fixedly holding the modules onto the footer . reinforcing bar latches could be installed at appropriate locations to retain and secure the horizontal reinforcing bars as well . bonding means could then be applied at the top of the first course of modules and a mixed course of modules could be applied to the first course , repeating the above procedures throughout the course of the modules in a staggered fashion . while there is shown and described the present preferred embodiment of the invention , it is to be distinctly understood that this invention is not limited thereto , but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the invention as defined by the following claims . | 4 |
the present invention overcomes the disadvantages of prior art ski boots , and provides a ski boot whose flexional properties of the calf with respect to the shell base include an elastic - return or spring - back property . additionally , in order to accomplish a principal aim of the invention , which is to provide a ski boot in a simple and efficient manner by utilizing modern plastic materials as the means for controlling the angular flexion of the calf , as well as its return and / or spring - back elastic means , additional adjustment means for adjusting these elastic - return characteristics may be provided . the ski boot , according to one preferred embodiment of the invention , has a rear insertion capability which comprises a rigid shell base essentially surrounding the foot provided with a sole . the upper portion of the zone surrounding the heel and the malleoli is provided with at least one pivot axis on which a relatively rigid calf surrounding the bottom of the leg of the skier is journalled . in this embodiment , the calf itself is composed of at least one rear portion or spoiler serving as a support for the bottom of the leg , and at least one front portion or cuff assuring the closure of the boot . the boot is characterized in that the shell base comprises , respectively , on each side of the malleoli , a vertical extension in the form of a deformable elastic blade extending approximately parallel to the axis of the calf from the zone surrounding the heel . the calf contains a second pivot axis with the shell base provided at one point , situtated above the first pivot axis , along the length of the extension . nevertheless , the invention is not limited to boots in which insertion of the foot occurs from the rear , and it is possible to apply the invention to ski boots of the front - insertion type . another aim of the invention is to obtain flexional characteristics of the calf to provide a good shock - absorption capacity of the flexional forces sustained with a sufficient elastic return for small forces while providing a good lateral security to the leg . these aims are achieved with the boot according to the invention by virtue of its particular structure . in effect , it is the vertically extending lateral extensions extending upwardly from the rigid shell base which assure flexional control , as well as the elastic return , while the calf , and more particularly the spoiler journalled on the shell , which , by virtue of its shape , envelopes the leg in a tubular fashion , and assures the necessary lateral rigidity and security for the bottom of the leg of the skier . finally , another aim of the invention is to provide &# 34 ; rear insertion &# 34 ; boots whose cuff cooperates with the top of the shell base in the approximate zone of the instep to resist permanent deformation which occurs at the lower edge of the front portion of the calf after repeated periods of use . furthermore , this cooperation zone between the shell base and the lower edge of the calf is determinative in establishing of the rigidity of the calf , whose curve of values increases sharply . it is with a view towards modifying the characteristics of the rigidity curve of the calf that the construction according to the invention has also been developed . additionally , the great advantage of this type of construction resides in the fact that the lateral extensions are formed directly during the same molding step as the shell base , whose unique material assures both lightness and good mechanical characteristics linked with simplicity of production . various embodiments of the boot according to the invention can be provided . thus , depending on the possibilities of adjustment that one wishes to obtain for a finer modulation of the flexional characteristics and elastic - return qualities , the lateral extensions in the form of elastic blades will be connected to the front portion of the calf , called the cuff , at a distance which is more or less raised above the journal axis of the calf on the shell base . it is likewise possible , according to this concept , to provide an attachment apparatus for attaching the calf to the extensions which varies the distance of the upper pivot axis from the lower first pivot axis along the height of the calf such that , depending upon the level of the skier &# 39 ; s abilities , the flexional conditions of the boot can be adjusted to suit the skier &# 39 ; s needs . according to another embodiment , a different manner of varying the flexional and elastic - return characteristics is provided by providing at least one of the lateral elastic blades with an oblong slot which serves effectively to diminish the cross - section of the beam constituted by the elastic blade . in another embodiment , the boot according to the invention is provided with a latching means between the elastic blades and the cuff which is removable or retractable to allow for the possibility of totally eliminating the return and / or flexion of the calf provided by the blades . as a result of this , the calf is connected to the shell base only at its lower first pivot axis . one thus obtains good angular deflection in the longitudinal perpendicular plane of the boot , which facilitates walking . it is also possible to provide an alternative embodiment for a ski boot having insertion through the front . in this case , the lateral extensions still originate at the shell base and extend upwardly substantially the length of the calf , but the calf in this embodiment comprises a single , relatively rigid element surrounding the bottom of the leg of the skier . the calf is connected at its upper portion to the lateral elastic blades by known assembly means , while the calf can be opened to the foot when the boot is to be put on . referring to the embodiment illustrated in fig1 and 2 , ski boot 1 comprises a shell base 2 made of rigid plastic material on which a calf 3 surrounding the bottom of the leg of the skier is journalled . this calf itself comprises a front calf portion 3 &# 39 ;, called a cuff , and a rear portion 3 &# 34 ;, called a spoiler . in the case of the embodiment described , the cuff and spoiler 3 &# 39 ;, 3 &# 34 ; are simultaneously journalled on the same pivot axis 5 , situated approximately in the zone of the shell base adjacent to the malleoli of the skier . furthermore , shell base 2 entirely encases the front of the foot up to the zone of the instep , as well as in the zone of the heel . the base is generally slipper - shaped , which advantageously facilitates putting on the boot through the rear . quite obviously , tightening and locking means of the cuff and of the spoiler may be provided on the calf ; these means not being shown for purposes of clarity . according to one of the principal characteristics of the boot according to the invention , the shell base 2 comprises , on both sides of the malleole zone and above the pivot axis 5 , an extension originating from the shell base , which extends above the zone of the malleoli , in the form of two lateral blades 4 and 4 &# 39 ; positioned substantially parallel to the longitudinal median plane of the boot . the two lateral blades 4 and 4 &# 39 ; are substantially of the same thickness as the walls of the shell base , and extend upwardly along the general axis of the calf 3 of the boot 1 . the lateral elastic blades 4 and 4 &# 39 ;, which extend up to a height which is approximately equal to that of the calf , are equivalent to beams anchored at one of their ends , i . e ., at their bases 41 , 41 &# 39 ;. these blades can be provided at their bottom or base 41 , 41 &# 39 ;, with a width which is greater than along the rest of the blade , which leads to a modification of the original flexional characteristics . in the case of fig1 and 2 , a ski boot according to the invention has been shown which is provided with lateral elastic blades 4 , 4 &# 39 ; whose edges are each parallel . at the upper portion or top 42 , 42 &# 39 ; of the lateral blades 4 , 4 &# 39 ;, second attachment points 6 , 6 &# 39 ; of the shell base 2 with the calf 3 are provided . these attachment points 6 , 6 &# 39 ; are provided by known assembly means such as rivets , clips , screws , etc . this second attachment point , which is an essential aspect according to the invention , assures the cooperation of the calf with the lateral blades during the various phases of active use of the boot . as shown in fig2 when the skier exerts a frontwardly - directed flexion in the direction shown by arrow 7 in dashed lines , cuff 3 &# 39 ; flexes frontwardly ( along the position shown in dotted lines 31 &# 39 ;), and causes the same frontward force to be exerted on lateral blades 4 , 4 &# 39 ;. the blades flex as shown in the advanced position in dashed lines 43 at their upper ends 42 , 42 &# 39 ;. the flexional force shown by arrow 8 to which the blades 4 , 4 &# 39 ; are subjected is applied to the linkage points 6 , 6 &# 39 ;, and acts , as a result , on the blades , as a force applied to the end of a cantilevered beam . however , as soon as the flexional force stops being applied to cuff 3 &# 39 ;, force is no longer applied to the lateral extension blades 4 , 4 &# 39 ;. by virtue of the elasticity of the plastic material itself of which the blades are made , as well as by virtue of their connection with respect to the direction of the flexional forces , the forces are approximately contained in the same plane as the blades . the blades thus act as beams of rectangular cross - section positioned such that one thus obtains a quadratic moment of inertia which is relatively substantial for the mass which the beams represent , and consequently , one thus obtains a very low deformation under flexion , and thus better elastic resistance ( greater rigidity ). it follows likewise that one achieves an excellent elastic return of the lateral blades 4 , 4 &# 39 ;, and consequently of the calf assembly 3 . another advantage of this type of construction according to the convention is obtained by virtue of the fact that the inventive apparatus makes it possible to compensate for the eventual permanent deformation of the bottom 32 &# 39 ; of the cuff 3 &# 39 ; which occurs when the cuff slides and rests against the top of the shell base 2 during repeated flexions . this ablility to compensate is made possible by virtue of the fact that the shell base 2 has an upper edge running along the top of the zone of the instep , which forms on each side of the foot a sort of cut - out 21 , 21 &# 39 ; having a &# 34 ; v &# 34 ; shape . this cut - out 21 allows , within acceptable human physiological limits , for the frontward angular deflection of the lateral elastic blades 4 , 4 &# 39 ; during flexional movements of the leg of the skier . fig3 illustrates an alternative ski boot 10 according to the invention , where only the shell base 2 and calf 3 have been shown , so as to not complicate the drawing . in this embodiment , lateral elastic blades 14 , 14 &# 39 ; ( only blade 14 will be mentioned , since the boot is shown in side view ) beginning at shell base 2 are cut by an oblong slot 142 defining , as a result , two tie beams 141 and 143 . the principle of operation is similar to that which has been previously described for fig1 and 2 . in this embodiment , blade 14 , which is still connected to cuff 3 &# 39 ; by attachment means 6 , which are known in themselves , differs from that which has been previously described by the structure of the blade 14 , whose flexional characteristics are fundamentally modified . the quadratic moment of inertia of the two tie beams 141 and 143 becomes less substantial , which allows for greater deformation . this makes it possible to employ materials having greater natural rigidity for the shell base 2 ( and consequently the vertical extensions ), while making it possible to preserve good elastic - return properties . fig4 illustrates a variant of the boot shown in fig3 . in this embodiment , the lateral elastic blade 24 of boot 20 comprises , between the non - parallel edges , on oblong slot 245 having the general shape of a parallelogram . furthermore , the lateral elastic blade comprises a base 241 of greater width than its head 242 , situated at a height substantially equal to that of the calf 3 of the boot 20 , while the slot 245 extends from the base 241 until the zone of the attachment point or pivot axis 6 . according to a complementary aspect of the invention , it is possible to vary the flexional characteristics of the lateral blade 24 , whose interior edges are spaced by virtue of a cursor 9 , which can be moved along the length of the slot 245 , as indicated by double arrow 11 . the operation of boot 20 remains similar to that of the boots previously described , besides having the supplemental possibility of modulating the flexion of the calf , depending upon the position occupied by cursor 9 in slot 245 . so as to maintain the selected position of the cursor , even when the boot is subjected to strong mechanical forces due to the irregularities of the terrain , the cursor may be provided with stop means or a rack in the slot itself provided with corresponding means such as teeth , serrated or embossed rollers , etc ., known in themselves , which have not been shown so as not to detract from the clarity of fig4 . fig5 and 6 illustrate another embodiment of a boot 30 according to the invention where the lateral elastic blade 34 is connected to cuff 3 &# 39 ; at its upper portion 342 by a releasable latching apparatus . by way of example , this apparatus can comprise a latch 12 journalled on an axis 13 positioned at the upper portion of the cuff 3 &# 39 ; at the height of the upper linkage point 16 . the latch is adapted to be secured to an attachment nipple attached to the lateral extension blade 34 . this attachment nipple 16 is constituted , in the case shown in the figure , by a flat - head rivet 17 , and extends to the exterior of the wall of cuff 3 &# 39 ; across an arcuate slot 15 , having its center of rotation on journal axis 5 of calf 3 . slot 15 has a length such that it allows for the angular deflection of the calf 3 , as a result of the walking gait when latch 12 is unhooked from the attachment nipple 16 , as shown by fine dashed lines 18 . boot 30 is thus provided with a first position of use , known as the &# 34 ; ski position &# 34 ;, with calf 3 having good flexional properties and good elastic - return properties , and a second use position , known as the &# 34 ; walking position &# 34 ;, with calf 3 being free to pivot around journal axis 5 . of course , it is possible to adapt this type of construction to the slotted lateral blade structure disclosed above , with or without a flexion - control cursor . fig7 , and 9 shown an embodiment of boot 40 according to the invention in which lateral elastic blade 33 extends substantially over the length of the calf , and comprises a slot provided substantially over its entire height . however , contrary to the embodiments described above , the upper point of linkage between the blade 44 and cuff 3 &# 39 ; is no longer at a fixed , predetermined position , but can , by virtue of an adjustable linkage apparatus 26 , assure attachment at different points between the lower or first pivot axis 5 and the uppermost pivot axis . it is adapted such that , from a purely mechanical point of view , it is possible to vary the position of the point of application of the force on the cantilevered beam at one of its ends . consequently , a variation of the flexional properties occurs , depending upon the position of the adjustable attachment apparatus 26 along the slot 441 of the blade 44 . depending upon the degree of flexion of the calf sought by the skier , the position of the adjustable attachment apparatus 26 along the calf 3 can be varied by means of plugs 19 . the plugs are adapted to have protrusions be embedded in recesses 22 provided for this purpose on the internal surface of the wall of cuff 3 &# 39 ; ( fig8 and 9 ). plugs 19 extend beyond the guide surface 23 which functions as a slide for the attachment apparatus . slide 23 has the shape of a rounded tail ( fig8 ) fitting within the hollow space within slot 441 having a corresponding cross - section , such that the device cannot leave the slot . to change the position of the attachment device 26 , the skier spaces the lateral elastic blades 44 from the wall of cuff 3 &# 39 ;, which makes plugs 19 leave their recesses 22 , and the skier slides the apparatus 26 ( along the direction of the double arrow 25 of fig9 ) to the height selected along blades 44 to make plugs 19 face the new recesses 22 situated higher or lower than the original position occupied by the attachment apparatus . the release of the lateral blades 44 towards the wall of the cuff 3 &# 39 ;, makes the plugs 19 penetrate the recesses 22 selected , thereby providing a new degree of flexibility to the calf . the invention is not limited only to the embodiments described above . thus , without going beyond the scope of the invention , it is possible to adapt the structural principles of the lateral elastic blades to ski boots having calves which are higher or lower , depending upon the tendencies and the requirements , as well as the skiing technique of the market in which it is to be used . fig1 illustrates another possible embodiment of a ski boot according to the invention . in this case , boot 50 is of the front - insertion type , wherein the lateral elastic blades 54 , 54 &# 39 ; likewise beginning at shell base 27 allow for the boot to be put on from the front , by virtue of an opening between the two convering portions 27 and 27 &# 39 ; at the top of the foot . the rear of the shell base is cut away around the zone at the front of the malleoli and the heel . in this zone , lateral blades 54 and 54 &# 39 ; extend upwardly along the general axis of calf 28 of the boot . calf 28 is made of a single element surrounding the bottom of the leg , and is connected to the shell base 27 by pivot axis 29 and to the upper portion 542 of the lateral elastic blades 54 and 54 &# 39 ;, forming an integral portion of the shell base by virtue of attachment means 33 and 33 &# 39 ;. the operation of such boot remains similar to that of the rear - insertion boot previously described . in effect , when calf 28 is closed in the position of use by virtue of locking means 31 schematically illustrated in the figure , the compact shell - calf assembly thus formed exhibits the functional properties previously described . furthermore , it is likewise possible to vary certain functional characteristics by the intercombination of various aspects of the embodiments described above . it is , furthermore , possible to provide slots and lateral elastic cams having edges which may or may not be parallel , and by using shell base materials , and cursors which are very different , depending upon the needs and / or industrial technological necessities . | 0 |
the following description illustrates the manner in which the principles of the present invention are applied , but is not to be construed as in any sense limiting the scope of the invention . more specifically , a calibration device 10 made according to the present invention is illustrated in fig1 . the calibration device 10 comprises a hollow cylindrical body 2 adapted to contain an electrolyte solution 3 in contact with a first electrode 4 ; means 5 for sealing the body 2 at the top thereof ; means for sealing the body 2 at the bottom which include a threaded fitting 6 , an ion - exchange membrane 7 , and an o - ring 8 ; a nut 9 threaded onto the fitting 6 ; a porous membrane 11 ; a second electrode 12 formed of a metallic mesh disposed between and in physicl contact with the ion - exchange membrane 7 and the porous membrane 11 ; a flow - through mixing chamber 13 ; a first inlet tubing 14 to receive a stream of inert ccarrier gas ; a second outlet tubing 15 to remove the stream of gas ; a terminal connection 16 covered with electrical insulation 17 for the first electrode 4 ; and a terminal connection 18 covered with electrical insulation 19 for the second electrode 12 . a direct electrical current source connected to terminals 16 and 18 , and a means for supplying the stream of inert carrier gas to the inlet tubing 14 are not shown in fig1 but are well known in the art . the electrolyte solution 3 is generally a solution of an inorganic compound which , when electrolyzed , forms an oxidizing or reducing gas . for example , chlorine is beneficially generated by electrolyzing an aqueous solution of sodium chloride or hydrochloric acid . the first electrode 4 is preferably a platinum wire , and the second electrode 12 is preferably a substantially flat platinum - mesh or screen . the ion - exchange membrane 7 can be formed from any known ion - exchange membrane material , depending on the requirements of the calibration device 10 . preferably , if a cation - exchange membrane is desired , the membrane 7 is beneficially made from a material having a polytetrafluoroethylene backbone and perfluorinated two - carbon sulfonated sidechains , such as that marketed by e . i . du pont de nemours and company , inc ., under the tradename &# 34 ; nafion &# 34 ;. if an anion - exchange membrane is desired , the membrane 7 is beneficially made from a styrene - divinylbenzene copolymer having quaternary - ammonium sidechains . the porous membrane 11 is prefereably fabricated from a polytetrafluoroethylene resin . the remaining structural elements of the device 10 can be constructed of any known structural material which will also provide electrical insulation for the electrochemical circuit . for example , a plastic material such as chlorinated polyvinylchloride may beneficially be used . to complete the calibration device 10 , a source of direct current is connected to the first and second electrodes 4 through 12 through the connections 16 and 18 , respectively . the current may be measured by known means such as an ammeter , a microammeter , or a resistor in parallel combination with a voltmeter such as a ten - thousand ohm resistor in parallel with a hickok lx - 303 digital voltmeter . the source of direct current may be any well - known means such as a battery or an alternating power source which has been stepped down with a direct current transformer or rectifier , and may include feedback circuitry to insure current regulation when used in the calibration device 10 . although not absolutely required , a chart recorder may be used to provide a permanent record and the direct current measuring mean may be adapted to read out in the concentration of the gaseous mixture formed . in general , a membrane is selected which will permit the transfer of the ion from which the oxidizing or reducing gas is generated . the choice of an ion - exchange membrane 7 depends upon the chemical species being generated by the device 10 . if a halogen is to be generated , an anion - exchange membrane is chosen , to permit a flow of negative halide ions from the electrolyte 3 through the membrane 7 to the second electrode 12 . if hydrogen is to be generated , a cation - exchange membrane is used , to permit a flow of positive hydronium ions from the electrolyte 3 through the membrane 7 to the second electrode 12 . in addition , the membrane 7 substantially separates the electrolyte 3 from the second electrode 12 , while permitting a small amount of solution to be carried with the ion of interest to the electrode 12 , and also acts as a reverse ion barrier for ions which would poison the electrolyte 3 or electrode 4 is permitted to be transported into the cell . generally , the porous membrane 11 does not control the rate of release of the gas from the cell . preferably , the average pore diameter of the porous membrane 11 is between about 50 microns and about 100 microns , and more preferably about 75 microns which is about one thousand times the molecular size of the most common gases of interest such as hydrogen and chlorine . however , as described in more detail hereinafter , it has been found that the porous membrane is a necessary element for the proper functioning of electrode 12 . although the porous membrane 11 is not rate - controlling , it does provide , to a minor degree , the added function of regularizing the rate of diffusion similar to many flow control devices such as surge chambers , thereby further smoothing the flow of the electrolytically - generated gas out of the thin film of liquid around electrode 12 into the stream of inert carrier gas . as previously disclosed , the ion - exchange membrane 7 , the second electrode 12 , and the porous membrane 11 are in physical contact forming a sandwich structure . it has been found that this structure has a direct and substantial bearing on the accuracy and sensitivity of device 10 . if the membranes 7 and 11 are not positioned close together a large layer of solution will form around the second electrode 12 during operation of device 10 in which gas bubbles will form and be released as erratic bursts . moreover , the gas pressure build - up that occurs in a large layer of solution around the second electrode 12 during operation causes solution to be forced through the porous diffusion membrane 11 into the mixing chamber 13 which further decreases the sensitivity and accuracy of device 10 . thus , it has been found that the void volume not occupied by the second electrode 12 between the ion - exchange membrane 7 and the porous membrane 11 should be minimized to the point that gas bubbles will not form in and be released as erratic bursts from the liquid layer around the second electrode 12 during operation of device 10 . in this regard , it has been found that a void volume of about ten microliters per square centimeter of the membranes 7 and 11 sandwiched together is the maximum volume which can be used without a substantial loss of accuracy and sensitivity in device 10 . of course , squeezing the membranes 7 and 11 closer together over the second electrode 12 will further decrease the void volume and increase the accuracy and sensitivity of the device 10 . this void volume can , if physically possible , be reduced until there is only a molecular layer of solution around the second electrode 12 without detrimentally affecting the function of device 10 . a particularly preferred use of the calibration device 10 is for preparing standard gas samples containing trace concentrations of chlorine in air , as the inert carrier gas . for this purpose an anion - exchange membrane is required . the preferred material for forming the anion - exchange membrane is a styrenedivinylbenzene copolymer having quaternary - ammonium sidechains . the electrolyte solution 3 is preferably an aqueous solution of sodium chloride or hydrochloric acid . upon passage of a current through the device 10 , chlorine gas is generated at the second electrode 12 from a thin film of solution at the surface of the anion - exchange membrane 7 . this type of electrolytic generation is inherently smooth and approaches theoretical output since it eliminates the need for large ballast volumes of electrolyte and chlorine gas , and high carrier gas flow rates which would be required if the chlorine were released in bursts or bubbles directly from the electrolyte . this improvement is achieved because of the use of the porous membrane 11 which minimizes the thickness of the liquid layer around electrode 12 sufficiently to prevent the formation of gas bubbles . during use of device 10 , air as the carrier gas flows into the chamber 13 through inlet 14 and across the surface of the membrane 11 , where it entrains and mixes with the chlorine generated at the second electrode 12 , thereby forming a mixture of chlorine and air . the direct current flowing through the electrodes 4 and 12 is accurately measured by known methods and the rate at which chlorine is generated is readily calculated from the known electrochemical stoichiometric equivalence . the rate of air flow can be likewise accurately controlled and measured , for example , which an accurate gas pump and flowmeter . from the known rate of air flow and the known rate of chlorine generation , the concentration of chlorine in the air leaving the device 10 through the outlet 15 can be calculated with a high degree of accuracy , thereby providing a useful gas standard for calibrating other instruments or for use where very accurate known concentrations of a desired gas is required . the present invention will now be further illustrated by means of the following examples . the calibration device 10 was constructed with an anion - exchange membrane 11 made from a styrene - divinylbenzene copolymer with quaternary - ammonium sidechains to generate chlorine at a known , constant , and controlled rate from an electrolyte solution 3 consisting of a saturated aqueous solution of sodium chloride , while maintaining an air flow rate through the device 10 of one liter per minute . current from a constant - current power source was passed through the electrolytic cell and measured with a microammeter . the data obtained are shown in table i below . table i______________________________________ chlorine concentrationcurrent ( parts per million by volume )( microamperes ) theoretical actual - produced______________________________________33 0 . 23 0 . 2069 0 . 48 0 . 5088 0 . 61 0 . 60191 1 . 32 1 . 35344 2 . 37 2 . 35______________________________________ while certain representative embodiments and details have been shown for the purpose of illustrating this invention , it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention . | 2 |
fig1 is an overview of a processor system 10 according to the present invention . processor system 10 , in one preferred embodiment , comprises two microprocessors , and several special purpose chips on a processor board , however other configurations are possible , such as including several circuits shown on one chip or providing several chips for individual functions . processor system 10 is shown in fig1 with two microprocessors 12 ( 0 , 1 ), a maintenance and diagnostic chip ( mdc ) 14 , a processor interface chip ( pic ) 16 , a memory interface chip ( mic ) 20 , a main memory 22 , a secondary cache 30 . other components which are not shown may be included . several busses interconnecting components are also provided . a processor bus ( pbus ) 18 couples pic 16 and the microprocessors 12 ( 0 , 1 ); a maintenance bus ( mbus ) 24 couples mdc 14 to pic 16 and mic 20 and carries diagnostic commands and data to and from mdc 14 ; an internal bus ( ibus ) 26 couples pic 16 to mdc 14 and mic 20 ; and a secondary cache bus 28 couples microprocessors 12 ( 0 , 1 ) to secondary cache 30 . for reliability , several busses use information lines and check lines , where the information lines carry the independent signals for which the bus exists ( such as data , instructions , addresses , control signals , etc . ), and the check lines carry check signals which are a function of the values on the information lines and a check function such as check sum , parity , or other error - correcting code ( ecc ) functions . for example , ibus 26 comprises , in part , 32 signal lines and four parity lines , where each of the parity lines carries an even parity check of eight of the 32 information signal lines . in fig1 some busses are not shown with check lines separated from information lines . microprocessors 12 can operate in a &# 34 ; complete master &# 34 ; mode , where one microprocessor controls the information lines and the check lines of both pbus 18 and sc bus 28 , or they can operate in a &# 34 ; lock - step &# 34 ; or a &# 34 ; partial master &# 34 ;, mode where each microprocessor 12 controls on bus of pbus 18 and sc bus 28 . for reliability , both microprocessors 12 read the busses and execute the same instructions , but only one , the master of a bus , drives the information lines of the bus , while the other microprocessor 12 monitors the information lines and compares the values on those lines with what it would have driven on those lines ( its &# 34 ; potential &# 34 ; output ) if it were the master for that bus . if the non - master microprocessor disagrees with what is on the information lines of the bus , it triggers an &# 34 ; output miscompare &# 34 ; fault , which is explained in connection with fig2 . for further reliability , the master of a bus does not drive the bus check lines , the non - master does . this way , if the microprocessors are operating normally , but get out of step with each other , other devices on the bus will notice the error , as the check lines will not likely be correct . fig1 shows one microprocessor , 12 ( 0 ), as being the master of sc bus 28 and is labelled &# 34 ; sc master &# 34 ; ( secondary cache master ), while the other microprocessor , 12 ( 1 ), is the master of pbus 18 , and is labelled &# 34 ; si master &# 34 ; ( system interface master -- pbus 18 is the &# 34 ; system interface &# 34 ; in this case ). thus , when operating in lock - step , sc master 12 ( 0 ) drives the information lines of sc bus 28 ( address / data / ecc ) and monitors the check lines of sc bus 28 ( adr / cnt parity -- address and control line parity ), while si master 12 ( 1 ) drives the check lines and monitors the information lines of sc bus 28 . conversely , si master 12 ( 1 ) drives the information lines of pbus 18 ( address / data ) and monitors the check lines of pbus 18 ( ecc / parity ), while sc master 12 ( 0 ) drives the check lines and monitors the information lines of pbus 18 . in some embodiments , one microprocessor might be both the sc master and the si master , in other words , a &# 34 ; complete master &# 34 ; with the other microprocessor is a &# 34 ; complete listener &# 34 ;, duplicating the operation of the complete master , but not driving any lines except possibly its fault line , which it does not share with the complete master . while the ecc lines of sc bus 28 are actually check lines , they are grouped with the information lines . this is because the ecc lines are used by secondary cache 30 to do error checking there , and if all the lines into secondary cache 30 come from the same microprocessor , the secondary cache can run faster without worrying about slight variations in timing which might occur between the two microprocessors 12 ( 0 , 1 ), thus causing the address and data to arrive at the secondary cache offset in time with the ecc signals . such timing variations might be caused by process variations in creating the microprocessors . in a preferred embodiment , microprocessors 12 ( 0 , 1 ) are r4400 microprocessors manufactured by the mti division of silicon graphics , inc . in addition to the busses ( ibus , pbus , sc bus , mbus ), other signal lines exist between various components . an error signal line from pic 16 to mdc 14 carries a ce / uce error signal which indicates that the pic has encountered a correctable or uncorrectable error on the pbus . if check values on the check lines of the pbus do not correctly reflect the check function for the information values on the information lines of the pbus , then the pic asserts the ce / uce error signal . three lines , fault *, reset *, and modein are provided between each microprocessor 12 and the mdc . the fault * line is driven low by the microprocessor when it detects a fault . the reset * and modein lines are driven by the mdc 14 . the reset * signal is an active low signal which holds the microprocessor in a reset state when the signal is low , and the modein signal controls a mode of the microprocessor . where the reset * signal is being asserted ( held low by mdc the modein signal controls the meaning of signals on the fault * line . fig2 shows the interaction of the fault *, reset *, and modein signals in more detail . fig2 is a timing chart , which is divided into periods labelled a - k , which are not equal spans of time , but which differentiate different periods of activity on these signal lines . these periods are briefly described in table 1 . a si master and / or sc master asserts their fault , line , which is detected by the mdc . c mdc continues to assert both reset * signals ( i . e ., holding the reset * lines low ) and asserts both modein signals ( by driving the modein lines high ), in which state the fault * lines of each microprocessor indicate ( by going low ) whether that microprocessor believes an output miscompare was the first fault to trigger the fault . d mdc continues to assert both reset * signals and drives both modein lines high , in which state the fault * lines of each microprocessor indicate ( by going low ) whether that microprocessor believes an input fault occurred . e mdc releases the reset * signal for the si master only , at which point the si master becomes a complete master of sc bus 28 , pbus 18 , and the check lines for both busses . mdc reasserts the reset * signal for the si master and deasserts the reset * signal for the sc master , at which point the sc master becomes a complete master . at the end of this period , mdc reasserts the reset * signal for the sc master . g mdc deasserts the reset * signal for both microprocessors , and they both run as partial masters . at the end of this period , mdc reasserts both reset * signals . h mdc deasserts the reset * signal for the si master , and holds ( continues to assert ) the reset * signal for the sc master . in this period , the si master is a complete master . i mdc reasserts the reset * signal for the si master and deasserts the reset * signal for the sc master . in this period , the sc master is a complete master . j mdc reasserts both reset * signals for some finite time period . k mdc deasserts both reset * signals , and the microprocessors come up as partial masters . the timing chart ( period a ) begins with either the sc master ( shown as 12 ( 0 ) in fig1 ) or the si master ( shown as 12 ( 1 ) in fig1 ) detecting a fault , and asserting its fault * line by driving it low . this signal is picked up by mdc 14 . for some errors , such as where the pic drives pbus 18 with incorrect parity , both microprocessors 12 might assert their separate fault lines . for other errors , only one microprocessor 12 might detect the error . in any case , when a fault occurs , mdc 14 must quickly determine the state of microprocessors 12 . the state of microprocessors 12 is the values of its internal registers and flags . for complete diagnostics , mdc 14 must also obtain the contents of the primary caches of each microprocessor 12 and the contents of the shared secondary cache 30 ( see fig . where microprocessors are used in which instructions and data are cached separately , the primary caches include a primary instruction cache and a primary data cache . once the mdc receives the fault * signal , the mdc asserts the reset * line of both microprocessors ( period b ). when the reset * signal is asserted , the microprocessor goes into a state where all of its outputs are tri - state outputs except the fault * line . this allows other lock - step microprocessors to completely control the busses without interference . microprocessors 12 contain internal logic in which a bit can be set and remembered after a reset . this bit indicates whether microprocessor 12 is an si master or an sc master when in the partial master mode . each time microprocessor 12 is reset and the reset is held for at least some predetermined amount of time , the master mode of the microprocessor toggles between the complete master mode and the partial master mode . in addition to holding microprocessors 12 in a reset state , the mdc also sends a hold signal over mbus 24 to preserve the state of the devices coupled to ibus 26 . while in a reset mode , logic within microprocessor 12 provides further fault indications on the fault * line which depend on the state of the modein line ( periods b , c ). when the modein line is low , the fault * line is low ( logical 0 ) if an output miscompare first triggered the fault which resulted in the initial fault * pulse . as explained above , an output miscompare fault is expected from one microprocessor when a line being driven by the other microprocessor is being driven to a value different than the one microprocessor &# 39 ; s potential output . unless the output logic is faulty , a microprocessor cannot logically detect an output miscompare on the lines it is driving . since each microprocessor 12 is a master for some lines , the output miscompare indications will indicate the likely lines on which the miscompare occurred , on either sc bus 28 or pbus 18 . the fault * line will be driven low ( logical 0 ) by the microprocessor detecting the error if an output miscompare was detected . next , in period c , the input fault history bit from each microprocessor 12 is read from the fault * lines . when the mdc , which keeps the reset * lines low , drives the modein lines high , microprocessors 12 output an input fault history bit on their fault * lines , driving the lines low to indicate an input fault . the input fault history bit does not indicate that the input fault was the first fault to occur , but just that an input fault did occur at some time since the input fault bit was reset . after the fault is detected by the mdc , the mdc loads diagnostic code into memory 22 at the boot location for the microprocessors . the boot location is the first instruction location read by the microprocessor upon reset ( although , as explained later , this address might be relocated to a physical memory location by boot address relocator 194 ). once the diagnostic code is loaded , the reset * signal is deasserted on microprocessor 12 ( 1 ) ( the si master in a partial master mode ), and it runs as a complete master , as explained above . the diagnostic code causes microprocessor 12 ( 1 ) to dump its state and the contents of its primary cache ( period e ). the diagnostic code is usually written such that the primary cache is not used while running this code , so that it can be read without being destroyed first . since the reset * line on microprocessor 12 ( 0 ) is still asserted , the output lines of that microprocessor are tri - stated . this allows microprocessor 12 ( 1 ) to run the diagnostic code which causes it to make the dump without interference by microprocessor 12 ( 0 ). the dumped data can then be picked up by the pic and passed to mic 20 to store in memory 22 for later analysis . of course , given that a fault has occurred , either of the microprocessors 12 might not behave properly and might interfere with the collection of diagnostic data . at the end of period e , the reset * line on microprocessor 12 ( 1 ) is again asserted . starting in period f , the reset * line for microprocessor 12 ( 0 ) is deasserted and it begins to run diagnostic code to dump its state and primary cache . once both microprocessors 12 have dumped their state and primary caches , secondary cache 30 needs to be dumped . since mdc 14 does not connect directly to sc bus 28 , secondary cache 30 must be dumped through one of the microprocessors 12 . mdc 14 could connect directly to sc bus 28 for this purpose , but connecting another device to sc bus 28 would slow its response time , so mdc 14 reads secondary cache 30 via a microprocessor 12 . until the problem causing the fault is diagnosed , it is unknown which microprocessor 12 is faulty , if either , so secondary cache 30 is read out using both microprocessors operating in lock - step , and then using each microprocessor separately , to provide three copies of the secondary cache for the analysis . if an output miscompare occurs while secondary cache 30 is being read out of the lock - stepped microprocessors 12 ( 0 , 1 ), it is ignored . since each microprocessor 12 is set to come up in a partial master mode when its reset line is released , secondary cache 30 is first read in the lock - step ( two partial masters ) mode ( period g ). note that in order for the sc master to be a partial master , the sc master must have been reset for some finite time between periods f and g , as is shown in fig2 . in period g , both microprocessors 12 run the same code which instructs them to dump the contents of secondary cache 30 to pic 16 , which passes it to mic 20 for storage in memory 22 . if an output miscompare occurs during this dump , a fault * line might be asserted , but it is ignored by the mdc ( although it may be noted and logged by the mdc ). of course , the diagnostic code is usually written such that the secondary cache is not used while running this code . in period h , microprocessor 12 ( 1 ), as a complete master , dumps the contents of secondary cache 30 , and in period i , microprocessor 12 ( 0 ), as a complete master , dumps the contents of secondary cache 30 . period j illustrates the finite time period which is required for the reset line to toggle the partial / complete master mode in microprocessor 12 ( 0 ). once the states and the primary caches of each microprocessor 12 and secondary cache 30 have been dumped , mdc 14 can proceed to analyze the dump , or could cold - reset microprocessors 12 by deasserting the reset * lines ( period k ). fig3 shows pic 16 in greater detail . the pic contains many elements not shown , and is roughly divided into a pbus interface section 180 , an ibus interface section 182 , a request pipeline 195 , a prefetch queue 196 , and an interrupt filter 198 . pbus interface section 180 contains logic for reading data from pbus 18 and for outputting data from several other components of pic 16 onto pbus 18 . the components of pbus interface section 180 shown in fig3 are a multi - bit input driver 202 coupled to pbus 18 , a pbus input register 250 coupled to input driver 202 , a prefetch queue monitor 254 coupled between a command path output by input register 250 and prefetch queue 196 , a pbus output multiplexer 246 with a select input received from a multiplexer controller 256 and an output coupled to a pbus output register 248 , which in turn is coupled to an input of a multi - bit output driver 252 . the output of register 250 is split into a command path and a write data path , with the commands going to prefetch queue monitor 254 and request pipeline 195 , and the write data going to a write buffer 208 of request pipeline 195 . ibus interface section 182 contains logic for reading data from ibus 26 and for outputting data from several other components of pic 16 onto ibus 26 . the components of ibus interface section 182 shown in fig3 are a second multi - bit input driver 242 connected to ibus 26 , an ibus input register 244 coupled to input driver 242 , an ibus output multiplexer 210 with a select input received from a second multiplexer controller 212 and an output connected to a boot address relocator 194 , which outputs to an ibus output register 240 , which is in turn connected to an input of a second multi - bit output driver 214 . the output of register 244 is split into two outputs , with one output for interrupts going to interrupt filter 198 and the other output for memory read responses going to prefetch queue 196 . request pipeline 195 will now be described in further detail with reference to fig3 . following the description of request pipeline 195 , prefetch queue 196 is described with reference to fig4 and interrupt filter 198 is described with reference to fig7 . request pipeline 195 comprises a pipeline tail register ptail ( dmi ) 204 ( 1 ), a pipeline head register phead ( dmo ) 204 ( 2 ), a pipeline controller 206 , and a write buffer 208 . write buffer 208 includes a full / empty flag 209 for indicating whether the write buffer is full or empty . pipeline controller 206 also maintains a register ( not shown ) indicating how full or empty write buffer 208 is , as well as a programmable threshold ( also not shown ) which can be compared to the register for deciding whether to send the incoming write request to ibus 26 or to wait for write buffer 208 to fill further . the command portion of a microprocessor request , such as an indication that the request is a memory read request and an indication of the address to be read , is either stored in the pipeline tail , the pipeline head , or is passed directly to multiplexer 210 and onto ibus 26 . in some cases , a memory read request might not reach the request pipeline , but will be routed to the prefetch queue 196 . this occurs when the data to be read by the microprocessor is already present in the prefetch queue . this condition is detected by comparing the address portion of the read request with the address tags stored for the buffers of the prefetch queue 196 . if the read request does enter request pipeline 195 , however , it can be passed directly through request pipeline 195 , or stored in either ptail or phead . if both ptail and phead are empty and ibus 26 is free , the read request passes directly to multiplexer 210 . if ibus 26 is busy , the read request is placed in phead and pipeline controller 206 returns a request acceptance to the microprocessor over pbus 18 , so that the microprocessor call continue . if phead is occupied , the read request is placed in ptail , and moved along to phead when phead is free ; again , pipeline controller 206 returns a request acceptance to the microprocessor . if ptail is also occupied , then the read request is held in input register 250 , and pipeline controller does not send back a request acceptance . until pipeline controller 206 sends back a request acceptance ( when the read request is finally loaded into ptail or phead , or sent to ibus 26 ), the microprocessor avoids using pbus 18 to send more requests . write requests are placed in ptail 204 ( 1 ) and the write data is collected off pbus 18 into write buffer 208 . when write buffer 208 is full , full / empty flag 209 is set to &# 34 ; full &# 34 ;. when the threshold amount of data is loaded into write buffer 208 , pipeline controller 206 moves the write request from ptail to phead . if ibus 26 is available , the write request then moves there , and when the write request and accompanying data is sent over the bus , the full / empty flag is set to &# 34 ; empty &# 34 ;. in the embodiment shown in fig3 only one write request can be in the request pipeline at one time , but other embodiments , with different constraints as to bus performance and allocated chip area might have multiple write buffers or more than two pipeline stages 204 . in order to avoid sending obsolete data to the microprocessor , prefetch queue monitor 254 monitors the write requests , and signals prefetch queue 196 to invalidate any data the prefetch queue may have already retrieved from the memory locations which are to be written by the write requests . a dotted line connecting pipeline control 206 and multiplexer controller 212 is used to indicate that pipeline controller 206 signals to multiplexer controller 212 which , if any , output of request pipeline 195 is to be output onto ibus 26 . because ibus 26 is only accessed when a write request and its write data are complete in pic 16 , ibus 26 is used more efficiently . several bus cycles of pbus 18 are needed to get all the write data , so ibus 26 is not used until write buffer 208 is at least filled to the programmable threshold stored in pipeline controller 206 . fig4 shows prefetch queue 196 in greater detail . prefetch queue 196 comprises a control state machine 312 , a most recently used register ( mru ) 310 , and two buffers ( pfq0 , pfq1 ) 226 ( 0 , 1 ). mru 310 points to the most recently used buffer 226 . each buffer includes storage for eight data words and associated parity bits , an address tag register 302 , a validity flag 304 , a hard abort flag 306 , and an uncorrectable memory error ( ucme ) flag 308 . control state machine 312 is coupled to ibus 26 and pbus 18 through bus interface registers , and is coupled to read and write the storage areas and various flags of each buffer 226 . control state machine 312 also receives signals from prefetch queue monitor 254 which are used to provide prefetched data to pbus 18 and to invalidate data which has been written after being read into a buffer 226 . control state machine 312 includes an output over which memory read requests are made via multiplexer 210 . prefetch queue 196 operates as follows . for non - prefetch operations , pfq0 is used as an ibus buffer . for prefetch operations , control state machine 312 is made aware of a read address of a read request , either through monitor 254 or from the data coming from ibus 26 . control state machine 312 then makes a request for the data from the addresses following the block which was actually requested , or makes a single request over ibus 26 for twice as much data as was requested in the read request . the block of data which as actually requested is sent along to the microprocessor over pbus 18 , and the other half is stored in a prefetch queue buffer 226 until requested . suppose mru 310 indicated that pfq1 was most recently used , and that both validity flags 304 ( 0 , 1 ) were reset . when a read request is sent to pic 16 , the read request cannot filled by the prefetch queue , so the request is put on ibus 26 by request pipeline 195 . a typical read request asks for eight words , but to fill the prefetch queue , the request on ibus 26 asks for sixteen words . if the sixteen word request would cross a dram ( dynamic random access memory ) page boundary , the request is sent out as two eight - word requests . when the 16 words are returned , eight are sent on to fill the request , and the other eight words are stored in pfq0 ( the oldest buffer ). mru 310 is toggled to point to pfq1 , tag register 302 ( 0 ) is updated with the address of the latter eight words stored in pfq0 , and validity flag 304 ( 0 ) is set . if , during the read of the first eight words , a hard abort error or ucme occurred , an indication of that condition is passed on to the microprocessor . however , if the error occurred in the latter eight words , the indication is not passed on to the microprocessor until the microprocessor actually requests the data which causes the error . if a hard abort is caused by reading the latter eight words , the hard abort flag 306 ( 0 ) is set , and if an ucme occurred reading the latter eight words , ucme flag 308 ( 0 ) is set . when pfq monitor 254 indicates that a read request was issued for an address matching one of the tag registers 302 ( 0 , 1 ), that request is filled from the prefetch queue , and the buffer 226 which filled the request is marked invalid by resetting its validity flag 304 . anytime there is an invalid buffer 226 , another eight words could be fetched , so that prefetch queue 196 is rarely a bottleneck for data flow . when a write request is sent to request pipeline 195 , pfq monitor 254 supplies the write address to control state machine 312 , which compares it to tag registers 302 ( 0 , 1 ). if the write address matches either tag register , control state machine 312 resets the validity flag 304 for the buffer 226 associated with the matching tag register . fig5 shows boot address relocator 194 in greater detail . in fig5 boot address relocator 194 comprises a boot exception vector indicator register ( bev pic ) 218 for storing a bit indicating whether or not boot address relocation is to be done , two - bit boot address register 220 , six two - input multiplexers 402 ( 1 .. 6 ), an and gate 400 and an exclusive or ( xor ) gate 404 . an address comprises 32 bits and four bits of parity , one parity bit for each byte ( 8 bits ) of address . the parity bits are even parity , so that dmo -- r -- pb [ 3 ] is an xor of dmo -- r [ 31 : 24 ], dmo -- r -- pb [ 2 ] is an xor of dmo -- r [ 23 : 16 ], and so on . register 220 and bev -- pic 218 can be set in a number of ways , such as being controllable by mdc 14 . one way mdc 14 inserts values into registers is by inserting the desired values into scan data and running a scan on the registers , reading out their current content while inserting new content . boot address relocator 194 has a bus input , a bus output , and an input to indicate whether the content of the bus is an address which will be placed on ibus 26 . if the content of the bus is not an address which will be placed on ibus 26 , the data is passed through boot address relocator without modification . and gate 400 has two inputs , one from bev -- pic 218 and the other from an input which indicates if the input is an address for ibus 26 . if both are true , then and gate 400 outputs a logical 1 ( select = 1 ) to the select inputs of multiplexers 402 ( 1 .. 6 ), which causes the relocation of the address on the bus . otherwise , if and gate 400 outputs a logical 0 ( select = 0 ), the data on the bus passes through boot address relocator 194 unchanged . table 2 shows the logic of the multiplexers and its effect on the bits of the address lines . table 2______________________________________boot relocation addressingline ( s ) select = 0 select = 1______________________________________31 : 24 dmo . sub .-- a [ 31 : 24 ] 023 : 22 dmo . sub .-- r [ 23 : 22 ] 021 dmo . sub .-- r [ 21 ] boot . sub .-- adr [ 1 ] 20 : 17 dmo . sub .-- r [ 20 : 17 ] 016 dmo . sub .-- r [ 16 ] boot . sub .-- adr [ 0 ] 15 : 08 dmo . sub .-- r [ 15 : 08 ] dmo . sub .-- r [ 15 : 08 ] 07 : 00 dmo . sub .-- r [ 07 : 00 ] dmo . sub .-- r [ 07 : 00 ] parity 3 xor ( dmo . sub .-- r [ 31 : 24 ]) 0parity 2 xor ( dmo . sub .-- r [ 23 : 16 ]) xor ( dmo . sub .-- r [ 21 : 16 ]) parity 1 xor ( dmo . sub .-- r [ 15 : 08 ]) xor ( dmo . sub .-- r [ 15 : 08 ]) parity 0 xor ( dmo . sub .-- r [ 07 : 00 ]) xor ( dmo . sub .-- r [ 07 : 00 ]) ______________________________________ fig6 shows a memory map of 32 - bit addresses from 0 × 00000000 to 0 × ffffffff which illustrates the effect of boot address relocation . in one embodiment of a processor system , the operating system expects physical memory at the low addresses starting at 0 × 00000000 , and spanning 32 , 64 , 128 , or 256 megabytes ( mb ). however , microprocessor 12 expects to find boot code at 0 × 1fc00000 . both these needs can be met by either using a memory of at least 508 mb to span the space from 0 × 00000000 to 0 × 1fc00000 , or by adding a small memory at 0 × 1fc00000 which contains code including a jump to a location in the physical memory . while microprocessor 12 is running , it can perform virtual memory address translations with its internal translation look - aside buffer ( tlb ), but following a reset it has not yet configured itself for virtual memory operations . the boot code assists in this setup , so it must be located in , or relocated to , an address where microprocessor 12 expects it . four sections of physical address space ( labelled 00 , 01 , 10 , and 11 ) are available for boot code . since these sections are all located within the first 4 mb of memory , they are all located in the installed physical memory of the embodiment discussed above . boot address relocator 194 relocates addresses to one of these four sections , where the particular one of the four sections is determined by the contents of the boot address register 220 , which is labelled as boot -- adr [ 1 : 0 ]. fig5 shows multiplexer 402 ( 3 ) in a dotted outline to indicate that it is not really needed since bits 20 : 17 are all zeroes in a boot address in the above example anyway . in this case , multiplexer 402 ( 3 ) can be eliminated to save chip real estate . fig7 shows the details of interrupt filter 198 , which includes an interrupt image register 452 , a third priority level interrupt register 460 , a third priority level interrupt mask 462 , a second priority level interrupt register 464 , a second priority level interrupt mask 466 , a multi - line comparator 470 , an output driver 480 , and an input driver 482 . fig7 also shows an interrupt register 450 within microprocessor 12 . an interrupt input path is shown , where an interrupt propagates from ibus 26 , and in order , through register 460 , mask 462 , register 464 , mask 466 , and onto internal bus 490 . five lines of internal bus 490 are provided to interrupt image register 452 , which has a five - line output to comparator 470 . a comparator output of comparator 470 is coupled to an output enable of driver 480 . the input to driver 480 is internal bus 490 . the output of driver 482 is provided to the registers and masks , while the input of driver 482 and the output of driver 480 are coupled to pbus 18 through pbus interface section 180 ( not shown ; see fig3 ). interrupt register 450 of microprocessor 12 is coupled to the pbus as well . in operation , interrupts from ibus 26 are filtered so that the only interrupts which reach microprocessor 12 are interrupts which would alter the contents of interrupt register 450 , however , microprocessor 12 is free to query or change any interrupt register or mask in interrupt filter 198 . fig8 shows registers 460 , 464 in more detail . although not shown , masks 462 , 466 contain a bit for each interrupt of registers 460 , 464 , respectively . interrupts received over ibus 26 are stored in register 460 according to their interrupt number . for some interrupts , a value is passed along with the interrupt number and this value is stored along with an indication of the setting of the interrupt , which is either in a set state or in a reset state ( i . e ., a cleared interrupt ). these incoming interrupts are masked and prioritized according to a priority scheme , such as that shown in fig8 . the priority of an interrupt is determined by its interrupt number and by its priority grouping . for example , among the grouping of interrupts int -- io [ 19 : 10 ], int -- io [ 19 ] has the highest priority . therefore , if int -- io [ 19 ] and lower priority interrupts are set by incoming interrupt events over ibus 26 , only the int -- io [ 19 ] interrupt will be passed on to trigger the int -- a [ 15 ] interrupt at the next priority level . the number &# 34 ; 19 &# 34 ; might also be stored in int -- a [ 15 ] so that the number of the interrupt within the priority group causing the int -- a [ 15 ] interrupt can be readily determined . when int -- io [ 19 ] is cleared , then the next highest priority interrupt would propagate up to int -- a [ 15 ]. the mask registers contain flags for each interrupt , and if the mask bit is set , that interrupt is not sent on to the next level . therefore , if the mask bit for int -- io [ 19 ] is set , an int -- io [ 19 ] interrupt would not be passed on to int -- a [ 15 ] even though it is the highest priority interrupt . likewise , interrupts are prioritized at the second level , which reduces the interrupts to five at the first level . however , even with this narrowing of the number of different interrupts , the frequency of interrupts is not necessarily reduced , since an interrupt will often propagate all the way up to the first priority level . to reduce the amount of traffic on the pbus for updating interrupt register 450 , interrupt image register 452 maintains a copy of what should be in interrupt register 450 . interrupt image register 452 is updated by the output of mask 466 onto internal bus 490 , and the pre - update contents of interrupt image register 452 are compared with the contents of internal bus 490 by comparator 470 . if the contents of internal bus 490 change the contents of interrupt image register 452 , then the contents of internal bus 490 are output to the pbus , otherwise , nothing is output to the pbus . in this way , interrupt register 450 and interrupt image register 452 are reflections of each other , except for any delay in updating interrupt register 450 . of course , if microprocessor 12 modifies interrupt register 450 internally , it should also update interrupt image register 452 . the complete interrupt data need not be sent each time to microprocessor 12 , since microprocessor 12 , when necessary to its operation , can access the registers and masks of interrupt filter 198 . the invention has now been described . the above description is illustrative and not restrictive . many variations of the invention will become apparent to those of skill in the art upon review of this disclosure . the scope of the invention should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the appended claims along with their full scope of equivalents . | 6 |
reference is now made to the drawings wherein like reference characters denote like or similar parts throughout the various figures . referring then to fig1 a , 1 b , 2 and 3 , each computer 10 , 12 , 13 , 14 , 15 in the collection possesses a physical means 24 to communicate one to another as illustrated in fig1 a . the physical means of communication may be reorganized to produce a logical means to communicate 25 one to another as illustrated in fig1 b . in an internet embodiment , fig1 a would consist of computers physically connected via local area networks , routers and the internet . in fig1 b the network would consist of computers logically connected via internet protocol (“ ip ”) addresses . a preferred embodiment is directed to the logical configuration of a computer network , irrespective of the particular physical means of communication between computers in the network . a typical embodiment of the invention in a quadrilateral configuration is illustrated in fig2 . the logical middle 10 of the collection possesses a logical means to communicate 25 to four neighbor computers 12 , 13 , 14 , 15 that comprise a concentric square . each computer in the collection possesses a logical means to communicate 25 to four neighbors . the concentric square consisting of four computers 12 , 13 , 14 , 15 is in turn logically connected with the concentric square consisting of eight computers 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 . the collection of computers ends at the collection edge 30 . referring to fig3 a , the logical means to communicate 25 is defined by a neighbor relationship . each computer possesses links to four neighbors . fig3 a illustrates each computer &# 39 ; s “ neighbors ” as “ neighbor0 ” 40 , “ neighbor1 ” 41 , “ neighbor2 ” 42 , and “ neighbor3 ” 43 . neighbor 1 41 is clockwise from neighbor 0 40 , neighbor 2 42 is clockwise from neighbor 1 41 , and neighbor 3 43 is clockwise from neighbor 2 42 . referring to fig3 a and 3b , the neighbor 0 s 40 of four computers 12 , 13 , 14 , 15 point to the logical center 10 of the collection . the neighbor 2 s 42 of these computers 12 , 13 , 14 , 15 point to four more computers 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 and so on . the neighbor 2 42 to neighbors 40 configuration of the computers emanating from the logical center 10 of the collection may be considered radials 26 . the radials 26 pass through the computers at the vertices of the concentric quadrilaterals . the neighbor 0 s 40 of computers on a radial point toward the logical middle of the collection of computers . the neighbor 2 s 42 of computers on a radial point toward the collection edge 30 . the neighbor 1 41 of every computer on a radial 26 point to a line of neighbor 2 42 to neighbor 0 40 relationships which form indirect radials 27 . the neighbor 0 s 40 of computers on an indirect radial 27 point toward a radial 26 . the neighbor 2 s 42 of computers on an indirect radial 27 point toward the collection edge 30 . generally , the neighbor relationships are used for logically organizing the computers , while the radials 26 and indirect radials are used for disseminating information throughout the collection of computers . a typical embodiment of the invention in a hexagonal configuration is illustrated in fig4 . as will be appreciated by persons of ordinary skill in the art , the hexagonal configuration possesses six radials 26 emanating from the logical center 10 of the collection , while indirect radials 27 generally emanate from a neighbor 2 ( out of a total of six neighbors ) of every computer on a radial 26 . although the invention is described in connection with a quadrilateral or hexagonal configuration , configurations with any even plurality of sides are possible in accordance with the invention . three dimension configurations are also possible . the more sides in the configuration , the more states exist in managing the collection of computers and the faster the broadcast and search of the entire collection may be performed . in any event , it will be recognized that , among other things , the orientation of the indirect radial depends on the particular configuration . the creation of one embodiment of the invention is shown in fig5 a , 5 b , 5 c , 6 , 7 a and 7 b . the embodiment creates a logical organization in which each and every computer in the collection appears to be at the top of a hierarchy formed by concentric polygons . for purposes of describing the invention , the logical middle 10 of the collection of computers corresponds to the geometrical center , while the top computer 11 in the hierarchy represents a location at which a search or broadcast originates . as a result , the top computer 11 , at any given time , changes based on which computer in the overall hierarchy is acting as a source of a broadcast , search , or other dissemination of information throughout the network or a portion thereof . fig5 a illustrates a hierarchy emanating from the top computer 11 in the hierarchy through a collection of computers 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 organized into concentric squares . in the example illustrated by fig5 a , the top computer 11 in the hierarchy is also the logical middle 10 of the collection of computers . in the case of the quadrilateral configuration , the number of computers in the concentric squares increases by four from concentric square to concentric square . the first square surrounding the top computer 11 in the hierarchy contains four computers 12 , 13 , 14 , 15 . the next concentric square contains eight computers 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 . the next concentric square contains twelve computers , and so on . fig5 b illustrates a hierarchy emanating from the top computer 11 in the hierarchy through a collection of computers 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 organized into concentric squares . in the example illustrated by fig5 b , the top computer 11 in the hierarchy is not the logical middle 10 of the collection of computers . the number of computers in the concentric squares increases by four from concentric square to concentric square . the first square surrounding the top computer 11 in the hierarchy contains four computers 12 , 13 , 14 , 15 . the next concentric square contains eight computers 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 . the next concentric square ( not fully shown ) contains twelve computers , and so on . fig5 c illustrates a hierarchy emanating from the top computer 11 in the hierarchy through a collection of computers 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 organized into concentric squares . in the example illustrated by fig5 c , the top computer 11 in the hierarchy resides on the collection edge 30 . the number of computers in the concentric squares increases by four from concentric square to concentric square except computers residing on the collection edge 30 which do not possess a complete square of neighbors . in this case , therefore , the first square surrounding the top computer 11 in the hierarchy contains two computers 12 , 13 . the next concentric square contains five computers 16 , 17 , 18 , 19 , 20 . the next concentric square ( not fully shown ) contains six computers . the next concentric square contains nine computers , and so on . one - to - many message broadcast may efficiently be performed by the collection of computers as each computer passes the broadcast to either one or two more computers in the next concentric polygon . fig6 illustrates the rapid increase in number of computers reached with the addition of each concentric polygon . referring again to fig5 a illustrates how a broadcast operation may use this configuration to relay a message from the top of the hierarchy out through the concentric squares of computers . the message is initially passed from the top computer 11 in the hierarchy to the four computers in the surrounding concentric square 12 , 13 , 14 , 15 . in the example illustrated by fig5 a , the top computer 11 in the hierarchy is also the logical middle 10 of the collection of computers . the message is then passed by the computers at the four corners of the square 12 , 13 , 14 , 15 to the eight computers in the surrounding concentric square 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 . the message is then passed to the computers in the next concentric square and so on . referring again to fig5 b illustrates how a broadcast operation may use this configuration to relay a message from the top of the hierarchy out through the concentric squares of computers . the message is initially passed from the top computer 11 in the hierarchy to the four computers in the surrounding concentric square 12 , 13 , 14 , 15 . in the example illustrated by fig5 b , the top computer 11 in the hierarchy is not the logical middle 10 of the collection of computers . the message is then passed by the computers at the four corners of the square 12 , 13 , 14 , 15 to the eight computers in the surrounding concentric square 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 . the message is then passed to the computers in the next concentric square and so on . referring again to fig5 c illustrates how a broadcast operation may use this configuration to relay a message from the top of the hierarchy out through the concentric squares of computers . in the example illustrated by fig5 c , the top computer 11 in the hierarchy resides on the collection edge 30 . computers residing on the collection edge 30 do not possess a complete square of neighbors . the message is initially passed from the top computer 11 in the hierarchy to the two computers 12 , 13 in the 15 surrounding but incomplete concentric square . the message is then passed to the five computers 12 , 13 , 14 , 15 , 16 in the surrounding but incomplete concentric square . the message is then passed to the computers in the next surrounding but incomplete concentric square and so on . as can be seen in both fig5 b and 5c , there is a possibility that one or more computers will be orphaned ( e . g ., computer 17 in fig5 c ), at least with respect to a message that does not originate from a top computer 11 at the logical middle 10 of the collection of computers . the existence of such orphaned computers , however , does not create a problem in most applications . preferably , although not necessarily , a broadcast will originate from a top computer 11 that is at the logical middle of the collection of computers . thus , the broadcast will reach all of the computers in the collection . on the other hand , messages that originate from a top computer 11 that is not at the logical middle 10 frequently do not need to reach all of the computers in the collection . for example , a search for a specified file or application normally does not have to be exhaustive because there is often sufficient redundancy in a computer network to locate a subject of a search without querying every computer in the network . a search of content residing on computers in the collection may be performed if the message passed through the hierarchy contains search parameters and the network address of the requesting computer . the message will radiate through the hierarchy causing each computer in the collection to search its local content . when a computer being searched finds a match to the searched content , that computer contacts the network address of the requesting computer and identifies the network address where the content is located . a computer in the collection of computers may be located by a name or other identifying ‘ characteristic if the message passed through the hierarchy contains the name or other identifying characteristic and the network address of the requesting computer . the message will radiate through the hierarchy causing each computer in the collection to compare the name or other identifying characteristic to its own name or other identifying characteristic . the collection of computers must begin with a single computer which will be the initial logical middle 10 of the collection of computers . the next four additions to the collection of computers will constitute the neighbor 0 40 , neighbor 1 41 , neighbor 2 42 , and neighbor 3 43 neighbors of the logical middle 10 of the collection of computers . in order to become part of the collection of computers , a computer must first find another computer which is part of the collection of computers . a computer can find to the collection of computers using several techniques including but not limited to : ( a ) trying to attach to a known list of available computers in the collection of computers . ( b ) trying to attach to a computer from a list of computers with which this computer has previously communicated . ( c ) seeking a computer connected to the collection of computers by broadcasting queries to network addresses created from an algorithm such as a random number generator . fig7 a illustrates following a radial 26 from the found computer 28 to the collection edge 30 to attach a new computer 32 . fig7 b illustrates following an indirect radial 27 from the found computer 28 to the collection edge 30 to attach a new computer 32 . when a new computer 32 locates a computer belonging to the collection of computers , the found computer 28 ( see fig7 a ) will reside either on a radial 26 or indirect radial 27 ( fig7 b ). the neighbor 2 42 of the found computer 28 will point toward the collection edge 30 . by following the found computer &# 39 ; s 28 neighbor &# 39 ; s neighbor 2 s 42 one after another , the collection edge 30 may be located . the new computer 32 is attached to the collection of computers at the collection edge 30 . the collection of computers may be searched more rapidly if it maintains itself as a symmetrical compact shape such as that illustrated in fig8 a rather than a collection of long thin strings as illustrated in fig8 b . for example , a message can be broadcast to all 25 members of the collection of computers illustrated in fig8 a within three hops from the logical middle 10 of the collection of computers . however a message requires fourteen hops to be fully broadcast to the members of the collection of computers illustrated in fig8 b . to maintain symmetrical compactness of the collected computers , each computer in the collection follows a goal seeking behavior illustrated in fig9 a to 9h and generally defined as : ( a ) orbit counter clockwise at the same level of concentric polygon until another computer is encountered ; ( b ) decay inward until another computer is encountered . the result of the above two rules applied by each computer in the collection will result in the creation of a logical network in the shape of a near perfect quadrilateral ( or other polygon , depending on the configuration ). in the preferred embodiment , each unit follows the goal seeking behavior illustrated in fig9 a to 9l through the logic of a state machine . a state machine is a logical mechanism that defines the existence of a plurality of physical or logical states of being and the occurrences necessary to change the mechanism from one state of being to another . for purposes of clarity , neighbor 0 40 may be referred to as no . similarly neighbor 1 41 may be referred to as n 1 , neighbor 2 42 may be referred to as n 2 , and neighbor 3 43 as n 3 . in some states , both the existence of a neighbor and existence of a neighbor &# 39 ; s neighbor determine the state . in such instances , for clarity , the neighbor 0 of neighbor 0 is referred to as n 00 . similarly the neighbor 2 of neighbor 1 is referred to as n 12 . fig9 a to 9d illustrate the state diagram of the goal seeking behavior of an individual computer relative to the collection of computers of which it is a part . in particular , fig9 a to 9d exemplify the possible state transitions at least for a quadrilateral configuration . these states , however , relate only to the logical organization of the computers with respect to the logical middle 10 and not to the identity or location , at any particular time , of the top computer 11 . for example , each computer in the collection of computers may exist in one of the following states based on the existence and state of its neighbor units and its proximity to a radial 26 . state 1 ( illustrated in fig9 f )— the computer is searching for a found computer 28 in the collection of computers . three strategies are used : ( a ) search a pre existing list of network addresses of computers known to belong to the collection of computers . ( b ) search a cache of network addresses of computer with which the searching unit communicated when previously connected to the collection of computers . use a brute force search of all possible network addresses of computers . in an embodiment using internet addresses , the search will be made by generating random 32 - bit numbers corresponding to internet protocol ( ip ) addresses and excluding the ranges of non routable ip addresses . the searching computer confirms location of a computer in the collection of computers by executing a handshake protocol consisting of the following exchange : ( b ) queried unit —“ yes i am , no i am not , or i don &# 39 ; t understand .” when the searching computer locates the collection of computers , its state becomes state 2 . state 2 ( illustrated in fig9 c )— the computer has located the collection of computers and is attempting to locate the collection edge 30 . the computer follows the neighbor 2 42 neighbor links of the found computer 28 to locate the next closest computer to the collection edge 30 . the computer will continue to follow the neighbor 2 42 neighbor links of successive neighbors until a neighbor is found with no neighbor 2 42 link . a neighbor without a neighbor 2 42 link resides on the collection edge 30 . state 3 ( illustrated in fig9 h )— the computer is located on the collection edge 30 and on a radial 26 . since the computer is located on the collection edge 30 , the computer &# 39 ; s neighbor 2 42 does not exist . furthermore , as illustrated in fig9 h the neighbor 01 position is vacant . at the first opportunity , the computer will move into the neighbor 01 position thereby moving closer to the logical middle 10 of the collection of computers . state 4 ( illustrated in fig9 i )— the computer is located on the collection edge 30 and therefore the computer &# 39 ; s neighbor 2 42 does not exist . the computer is not located on the radial , but is touching it . the computer &# 39 ; s neighbor 1 41 does not exist . at the first opportunity the computer will move into the neighbor 01 position thereby moving closer to the logical middle 10 of the collection of computers . state 5 ( illustrated in fig9 j )— the computer is located on an indirect radial 27 . neighbor 1 41 does not exist . neighbor 2 42 does not exist , and the neighbor 01 position is filled . at the first opportunity the computer will move onto the indirect radial 27 behind the neighbor 01 position thereby moving closer to the logical middle 10 of the collection of computers . state 6 ( illustrated in fig9 k )— the computer is located on an indirect radial 27 . neighbor 1 41 does not exist . neighbor 2 42 does not exist . the neighbor 01 position is vacant . at the first opportunity the computer will move into the neighbor 01 position . state 7 ( illustrated in fig9 l )— the computer is located on an indirect radial 27 , but its neighbor 1 41 is a radial 26 . neighbor 2 42 does not exist . at the first opportunity the computer will move onto the radial 26 behind the neighbor 01 position . state 8 ( illustrated in fig9 m )— the computer is located on an indirect radial 27 . the n 12 position is vacant . at the first opportunity the computer will move into the n 12 position . state 9 ( illustrated in fig9 n )— the computer is located on an indirect radial 27 . neighbor 1 41 exists and neighbor 1 41 is on a radial 26 . this is a stable state . no movement is possible without other neighbors moving first . state 10 ( illustrated in fig9 o )— the computer is located on a radial 26 . either neighbor 1 41 or neighbor 2 42 exist preventing movement . this is a stable state . no movement is possible without other neighbors moving first . state 11 ( illustrated in fig9 p )— the computer is located on an indirect radial 27 . either neighbor 2 42 or n 12 exist preventing movement . one neighbor must exist to prevent movement . this is a stable state . no movement is possible without other neighbors moving first . state 12 ( illustrated in fig9 q )— the computer is located on a radial 26 . neighbor 0 40 is vacant . either neighbor 1 41 or neighbor 3 43 exist so there is a way to link to the neighbors of the missing neighbor 0 40 . at the first opportunity , the computer will move into the vacant neighbor 0 40 position . state 13 ( illustrated in fig9 r )— the computer is located on an indirect radial . 27 but is touching a radial 26 . neighbor 0 40 is vacant . either neighbor 1 41 or neighbor 3 43 exist so there is a way to link to the neighbors of the missing neighbor 0 40 . at the first opportunity , the computer will move into the vacant neighbor 0 40 position . state 14 ( illustrated in fig9 s )— the computer is located on an indirect radial 27 . neighbor 0 40 is vacant . either neighbor 1 41 or neighbor 3 43 exist so there is a way to link to the neighbors of the missing neighbor 0 40 . at the first opportunity , the computer will move into the vacant neighbor 0 40 position . state 15 ( illustrated in fig9 t )— the computer is located on an indirect radial 27 . neighbor 0 40 exists . neighbor 1 41 is vacant . neighbor 2 42 is vacant . neighbor 01 is vacant . at the first opportunity , the computer will move into the vacant neighbor 01 position . after entering one of the stable states , each computer will compare its available network bandwidth with that of its neighbor 0 40 . if the computer &# 39 ; s available network bandwidth is greater than that of its neighbor 0 40 , the computer and its neighbor 0 40 will swap places in the collection of computers . the effect of the computers swapping places is that , the collection of computers becomes sorted by available network bandwidth . the computers with the greatest amount of available network bandwidth will be closest to the logical middle 10 of the collection of computers . the collection of computers can rebuild the connections necessary for broadcast and searching in the event a computer in the collection becomes disabled by a hacking attack or ceases functioning due to technical or network problems . fig1 a illustrates the collection of computers following the disabling of several computers . the disabled computers 29 are unable to pass along broadcast messages and must therefore be replaced . fig1 b through fig1 c illustrate the process by which the remaining computers in the collection reorganize the remaining computers . once the disabled computers have been removed from the interior of the collection of computers , the reorganization will continue to rebuild the symmetrical compactness illustrated in fig9 f to 9o . each computer in the collection of computers functions as an autonomous unit asynchronously related to its neighbors . in order to synchronize the movements of computers to different positions in the collection , it is necessary to prevent race conditions or ambiguous situations which could occur should a computer make a decision based on the states of its neighbors and move its position at the same time the neighbor &# 39 ; s states are changing . for this reason a computer in the collection will lock its neighbors from making any moves until it : the lock has a timeout to prevent a never ending lock should the locking computer be disabled in some way before releasing the lock . in some cases it may be desirable to limit message broadcast or content searches to a subset of the collection of computers . in that case , the broadcast or search may be limited by specifying the number of concentric rings to search relative to the computer requesting the broadcast or search . if all computers in the collection of computers do comprehensive message broadcasts or content searches , the communications means logically connecting the computers may become congested . any computer in the collection of computers can view the sum total of the communications traffic between all computers . should the communications traffic begin to approach to capacity of the logical communications channel a means of reducing the traffic must be considered . the following technique is “ fair ” to each user of the collection of computers , rewards efficient use , and penalizes overused . before each broadcast or search is initiated , each and every computer in the collection of computers will perform the following before performing a broadcast or search : ( b ) if the utilization is below a predetermined desired threshold , proceed with the broadcast or search , otherwise , ( d ) if the time since the last search is less than a predetermined amount , insert a predetermined delay in front of the request for broadcast or search which is related to the amount the communications channel bandwidth utilization exceed the predetermined desired threshold . the above algorithm will assure that broadcast and search performance will degrade gracefully under heavy use of the collection of computers . if the collections of computers large enough and search demands frequent enough to fill the logical communication channel bandwidth , a more efficient use of bandwidth is possible by defining a subset of the collection of computers to perform a caching function . the computers chosen to perform the caching function are those with faster network connections . fig1 illustrates the preferred embodiment of the caching organization . in fig1 the caching computers 33 are organized into a collection of computers similar to the collection of non - caching computers shown in fig2 . each caching computer 33 is the logical middle of a collection of computers . as such , the caching computers 33 and the underlying collections of computers represent a hierarchy within a hierarchy or , in an alternative way of looking at it , a simple type of three dimensional configuration . each caching computer 33 caches the content index and name or other identifying characteristic of each computer in the collection of computers which surround the caching computer 33 . each caching computer 33 is also a member of the collection of caching computers . the collection of caching computers self organizes itself so that the computer with the most available network bandwidth resides at the logical middle 10 of the collection of caching computers . each caching computer in the collection of caching computers compares its available network bandwidth with the network bandwidth of its neighbor nearer the logical middle of the collection of caching computers . if the caching computer possesses more available network bandwidth than its neighbor , the computer and its neighbor swap positions in the collection of caching computers . each caching computer in the collection continuously performs the compare and swap operation , such that the collection of caching computer is always sorted with the computer having the most available network bandwidth located at the logical middle of the collection of caching computer and each concentric polygon contains computers with successively less available network bandwidth . a caching computer is added to the collection of caching computers in much the same way as a computer is added to the collection of computers as described in self organizing a hierarchy and illustrated in fig9 a to 9t . a new caching computer can find the collection of caching computers using several techniques including but not limited to : ( a ) trying to attach to a known list of available caching computers in the collection of caching computers . ( b ) trying to attach to a caching computer from a list of caching computers with which this computer has previously communicated . ( c ) seeking a computer connected to the collection of caching computers by broadcasting queries to network addresses created from an algorithm such as a random number generator . when a new caching computer locates a computer belonging to the collection of caching computers the found caching computer will reside either on a radial 26 or an indirect radial 27 . the tail 41 of the found caching computer 28 will point toward the collection edge 30 . by following the found caching computer &# 39 ; s 28 neighbor &# 39 ; s tail to head one after another , the collection edge 30 may be located . the new caching computer is attached to the collection of caching computers at the edge 30 . to maintain symmetrical compactness of the collected computers , each computer in the collection follows a goal seeking behavior as illustrated in fig9 a to 9t : ( a ) orbit counter clockwise at the same level of concentric polygon until another computer is encountered ; ( b ) decay inward until another computer is encountered . a newly added caching computer will have a large amount of available network bandwidth , and as such will swap positions with its neighbors until it reaches the logical middle of the collection of caching computers . preferably , a newly added computer will be designated as a caching computer based on whether the newly added computer possesses an available amount of bandwidth greater than some threshold . newly added computers that do not possess an amount of bandwidth over the threshold are added as non - caching computers . in a caching system , a new computer 32 locates the collection of computers and then follows the head to toe links until it reaches the logical middle 10 of its collection of computers . the logical middle will be a caching computer that also belongs to the collection of caching computers . the new computer 32 will follow the head to toe links of the collection of caching computers until it reaches the logical middle of the collection of caching computers . the new computer 32 will provide the caching computer with its network address , the index of its content , and its name or other identifying characteristics . the new computer 32 will then follow a radial 26 of the collection of non - caching computers attached to the logical middle of the collection of caching computers . the new computer 32 will attach itself to the edge 30 of the collection of computers and begin the self - organizing logic to seek a position . due to the bandwidth availability comparison logic , the computer at the logical middle of the collected caching computers will always be the caching computer with the most available bandwidth . new non - caching computers will always be added to the collection of non - caching computers attached to this caching computer . as more non - caching computers are added to the caching computer with the most available bandwidth , it will eventually have less available bandwidth than another caching computer in the collection of caching computers and be replaced at the middle of the collection of caching computers by a computer with more bandwidth available . in the above fashion , the collection of caching computers will always maintain an optimally balanced distribution of non - cached computers attached to each caching computer . from time to time , a caching computer will poll each of the computers in its collection of non - caching computers . when a computer that is a member of a collection of computers headed by a caching computer becomes unavailable or unusable through some sort of failure , the caching computer will remove the unavailable computers cached content index , name , and other identifying characteristics . from time to time , a caching computer will fail to respond to communications from non - caching computers in its collection of computers . the caching computer will be replaced by one of the non - caching computers in its collection of computers using the algorithms illustrated in fig9 a to 9t . should there be no more non - caching computers available in the disabled caching computers collection of computers , the collection of caching computers will fill in the void using the logic illustrated in fig9 a to 9t . the invention embodies a feature by which a computer compares its version of software that controls the collection of computers to that of the neighbor 40 , 41 , 42 , 43 with which it is preparing to communicate . if the computer requesting the communication possesses a more recent version of the software that controls the collection of computers , then that version of software is transferred to the neighbor 40 , 41 , 42 , 43 . if the neighbor 40 , 41 , 42 , 43 to which communications is being requested posses a more recent version of the software that controls the collection of computers , then the more recent version of the software is transferred from the neighbor 40 , 41 , 42 , 43 to the computer requesting the communications . in this fashion , a software update applied to any computer in the collection of computers will propagate through the collection of computers at about the same rate as a message broadcast . it is possible using the auto - update mechanism described above to distribute executable programs to all computers in the collection of computers . it is possible using the auto - update mechanism described above to distribute executable programs to a subset of all the computers in the collection of computers by limiting the distribution to computers within a fixed number of concentric polygons of the computer initiating the distribution . the computers receiving executable programs using the auto - update mechanism may be commanded to perform certain operations using the executable programs distributed using the auto - update mechanism including executing the programs to perform a calculation or other operation and returning a result to the computer initiating the distribution of the executable program . one embodiment of the invention provides for the one to many broadcast of streaming media . streaming media include but are not limited to web radio and corporate webcasts . current broadcast technology requires the originator posses a large server 44 and high speed network connection necessary to open the required channel to each and every destination 45 as illustrated in fig1 . therefore a doubling of destinations requires a doubling of the originator &# 39 ; s network bandwidth . the invention offers an efficient means to broadcast streaming media by sharing the necessary bandwidth and computing power with each destination computer 45 . fig1 illustrates the streaming media possible with the collection of computers created by the invention . ( a ) the originator &# 39 ; s network bandwidth need only be as large as that necessary for a single stream of the media . ( b ) the number of destinations may be increased irrespective of the bandwidth of the originator &# 39 ; s network connection . ( c ) the number of destinations may be increased virtually without limit . a web radio station is an existing example of streaming media . with current technology , a user with a media player program contacts the station &# 39 ; s web page , provides the user &# 39 ; s network address , and requests to be connected to the station &# 39 ; s streaming media server . the media server opens a connection and begins sending the media information to the user &# 39 ; s media player at the user &# 39 ; s network address . the media information is virtually the same as that sent to every other user . when using one embodiment of the invention , a user with a media player program and a program implementing the invention contacts the station &# 39 ; s web page , provides the user &# 39 ; s network address , and requests to be connected to the station &# 39 ; s streaming media server 44 . the station streaming media server is using a version of the invention . the media server directs the new user to the logical middle of the collection of computers 10 . the new user &# 39 ; s computer 32 follows the protocol described in fig9 a to 9t to attach to the collection of computers . upon attachment to the collection of computers , the new computer 32 will begin receiving the streaming media from the neighbor to which its head is attached . when yet another computer is attached to the new computer 32 , the new computer 32 will forward the streaming media to the added computer . when a computer in the collection of computers used to broadcast streaming media disconnects or otherwise becomes unavailable , the invention replaces the unavailable computer in the collection of computers using the protocol illustrated in fig1 a to 10c . each computer in the collection of computers requires an available outbound network bandwidth the same as the inbound network bandwidth of the streaming media . the exceptions are computers which reside on radials 26 which require twice the available outbound bandwidth as inbound bandwidth . ( a ) the ability to broadcast a message from any computer in a collection of computers to broadcast to the balance of the collection by distributing the computing power and communications bandwidth required by the broadcast to the collection of computers . ( b ) the ability of any computer in a collection of computers to search for content in a collection of computer by distributing the computing power and communication bandwidth required by the search to the collection of computers . ( c ) the ability of any computer in a collection of computers to search for another computer in the collection of computers by a name or other identifying characteristic by distributing the computing power and communication bandwidth required by the search to the collection of computers . ( d ) the ability to self organize computers into a collection of computers such that the computing power and communication bandwidth of the collection may be used to broadcast from one computer to the balance of computers in the collection ; such that the computing power and communication bandwidth of the collection may be used to search for content existing on the collection of computers ; and such that the computing power and communication bandwidth of the collection may be used to locate a computer in the collection by name or other identifying characteristic . ( e ) the ability to self organize computers which possess transient network addresses into a collection of computers such that the computing power and communication bandwidth of the collection may be used to broadcast from one computer to the balance of computers in the collection ; such that the computing power and communication bandwidth of the collection may be used to search for content existing on the collection of computers ; and such that the computing power and communication bandwidth of the collection may be used to locate a computer in the collection by name or other identifying characteristic . ( f ) the ability of an organized collection of computers to self repair itself after some computers become inoperative to an attack or technical malfunction . although a preferred embodiment of the method and apparatus of the present invention has been illustrated in the accompanying drawings and described in the foregoing detailed description , it is understood that the invention is not limited to the embodiment disclosed , but is capable of numerous rearrangements , modifications , and substitutions without departing from the spirit of the invention as set forth and defined by the following claims . | 7 |
now the present invention will be clarified in detail by embodiments thereof . fig4 shows a 4 - phase drive ccd for explaining an embodiment of the present invention , wherein a potential pattern 13 , shown in fig4 ( a ) is formed by dc bias voltages 12 applied to drivers 11 . the bottom of each potential well is formed as a staircase shape descending in the charge transfer direction by means of said bias voltages . a broken - lined potential pattern 13 &# 39 ; indicates a state in which the phase of transfer pulse is shifted by 180 °. the potential pattern of the descending staircase shape as shown in fig4 ( a ) is also achievable in a 2 - phase or 1 - phase drive ccd . the present invention is naturally applicable also to such ccd , through the following description will be concentrated on a 4 - phase drive ccd . the potential pattern of the above - explained pattern essentially required for charge transfer , can be modified into a state shown in fig4 ( b ) in the state of charge accumulation by applying suitable voltages to the transfer electrodes . fig4 ( c ) shows the probability distribution of charge capture in such state . the above - explained ccd is combined with a color filter 15 having an element layout as shown in fig5 wherein each color filter element is displaced by a half pitch in the vertical direction with respect to the electrodes . the illustrated set of filter elements are repeatedly provided in the horizontal and vertical directions , and the numerals 16 , 17 , 18 and 19 represent color filter elements respectively transmitting red ( r ), green ( g ), blue ( b ) and magenta ( ma ) component while the numeral 20 represents an opaque element and a light - shield layer provided at the channel stopper . as will be seen from fig5 the color filter is so structured as to position two different color filter elements on each cell composed of four electrodes φ1 , φ2 , φ3 and φ4 . in fig5 the corresponding electrodes belonging to different cells are represented by prime marks , such as φ1 , φ1 &# 39 ; and φ1 &# 34 ;. when a potential pattern as shown in fig4 ( b ) is formed on the above - explained color imaging device , the potential well for example under the electrode φ2 in the n - th column 23 accumulates the signal charge corresponding to the light component transmitted by the red color filter element 16 , and , as will be understood from the probability distribution of charge capture shown in fig4 ( c ), a signal charge generated by the light component transmitted by the green color filter elements 17 positioned above and below said element 16 , thus giving rise to a mixed color component . let us now represent the charge corresponding to a pure color component transmitted by a color filter element and accumulated in the potential well thereunder by lower case letters r , g , b , ma or opaque , and the leak rate of mixed color component by a coefficient α . thus the charge accumulated in the potential well under the electrode φ2 in the n - th column is given by : similarly the charge in the potential well under the electrode φ4 in the n - th column is given by : the charge in the potential well under the electrode φ2 &# 39 ; in the n - th column is given by : the charge in the potential well under the electrode φ4 &# 39 ; in the n - th column is given by : the charge in the potential well under the electrode φ2 in the ( n + 1 )- th column 24 is given by : the charge in the potential well under the electrode φ4 in the ( n + 1 )- th column is given by : the charge in the potential well under the electrode φ2 &# 39 ; in the ( n + 1 )- th column is given by : the charge in the potential well under the electrode φ4 &# 39 ; in the ( n + 1 )- th column is given by : after the charge accumulation in the foregoing manner in the charge accumulation mode , the transfer pulse voltages applied to the electrodes are changed to modify the potential pattern from the state shown in fig4 ( b ) to the descending staircase pattern 13 &# 39 ; in fig4 ( a ) for signal reading in the signal transfer mode . in this state the charge r &# 39 ; accumulated in the potential well under the electrode φ2 in the n - th column and the charge g &# 39 ; under the electrode φ4 in the same column are united and accumulated in a potential well newly formed under the electrode φ4 . also the charge ma &# 39 ; accumulated in the potential well under the electrode φ2 in the ( n + 1 )- th column and the charge g &# 39 ; under the electrode φ4 in the same column are united and accumulated in a potential well formed under the electrode φ4 . consequently a horizontal line 21 composed of the electrodes φ1 , φ2 , φ3 and φ4 provides the signals r &# 39 ;+ g &# 39 ; and ma &# 39 ;+ g &# 39 ; alternately , while another horizontal line 22 composed of the electrodes φ1 &# 39 ;, φ2 &# 39 ;, φ3 &# 39 ; and φ4 &# 39 ; provides the signals b &# 39 ;+ g &# 39 ; and opaque &# 39 ;+ g &# 39 ; alternately . in the interlaced drive the transfer pulse voltages are so changed as to obtain a potential pattern 13 shown in fig4 ( a ). thus a horizontal line 21 &# 39 ; composed of the electrodes φ3 , φ4 , φ1 &# 39 ; and φ2 &# 39 ; provides the signals b &# 39 ;+ g &# 39 ; and opaque &# 39 ;+ g &# 39 ; alternately , while another horizontal line 22 &# 39 ; composed of the electrodes φ3 &# 39 ;, φ4 &# 39 ;, φ1 &# 34 ; and φ2 &# 34 ; provides the signals r &# 39 ;+ g &# 39 ; and ma &# 39 ;+ g &# 39 ; alternately . fig6 shows a block diagram of a control circuit for obtaining color signals from the output signals provided in the above - explained manner by the color imaging device . in fig6 there are shown a signal generator 35 for generating electrode drive signals φ1 - φ4 ; a switching circuit 36 for supplying said drive signals φ1 - φ4 from the signal generator 35 , with or without dc bias voltages 37 , to the color imaging device 25 suitably in the transfer or accumulation mode in response to a mode signal m ; a delay line 26 for delaying the signals by one horizontal scanning time and obtaining the luminance signal y , red component signal r and blue component signal b through the vertical correlation of the signals ; and the color imaging device 25 composed , as already explained in relation to fig5 of a mosaic color filter and a ccd . the output signal from the device 25 is introduced to an adder 27 , the delay line 26 and input terminals a , b of a switching circuit 28 , and the output signal from said delay line 26 is introduced to said adder 27 and input terminals b , c of said switching circuit 28 . the signal obtained from the adder 27 for the n - th column is given by the foregoing equations ( 1 ) to ( 4 ), and , by representing the signal level with uppercase letters corresponding to each signal charge , can be expressed as : which is also usable as the luminance signal y since ma = r + b . from the foregoing result it will be understood that the effect of color mixing is not significant as the luminance signal ( r + 2g + b ) is merely multiplied by a coefficient ( 1 + 2α ). also the presence of luminance signal for each clock pulse suggests the possibility of obtaining a sufficiently high resolving power even with a ccd having a relatively limited number or pixels in the horizontal direction . output terminals e , f of the switching circuit 28 are simultaneously connected respectively to the input terminals a , c for a horizontal scanning time 1h , and to the input terminals b , d for a next horizontal scanning time the fh in fig6 represents the horizontal scanning frequency . said output terminals e , f are respectively connected to the plus and minus input terminals of a subtracter 29 , which therefore provides alternate signals ( r &# 39 ;+ g &# 39 ;)-( b &# 39 ;- g &# 39 ;)= r - b and ( ma &# 39 ;+ g &# 39 ;)- ( opaque &# 39 ;+ g &# 39 ;)= ma . the switching circuit 28 functions to avoid the formation of inverted signals b - r or - ma . as will be understood from the foregoing explanation , the mixed color components are completely excluded in the subtraction process . the output signal from said subtracter 29 is supplied to an adder 31 , a 1 - bit delay line 30 for delaying the signal by a time corresponding to an adjacent cell , and a subtracter 32 , and the output signal from said delay line 30 is supplied to said adder 31 and subtracter 32 . in this manner the adder 31 provides the red component signal r , and the subtracter 32 alternately provides positive and negative blue component signals which are rectified by a product detector 33 to obtain the blue component signal b . the signals y , r and b thus obtained are supplied to a processor 34 composed of low - pass filters , r - compensating circuit , matrix circuit and color encoder to obtain an ntsc color video signal . the color layout shown in fig5 as the repeating unit in the horizontal and vertical directions can be modified in various manners , some of which are shown in fig7 a to 7f . the layout shown in fig7 a is obtained by simply repeating the basic layout of fig5 in both directions . however an improvement on certain properties is achievable by checkerboard arrangement of the green elements g . the layouts shown in fig7 b , 7c and 7d are variations of that shown in fig7 a and are capable of providing color signals by certain modifications in the signal processing shown in fig6 . these layouts shown in fig7 a to 7d are all practically acceptable though they mutually differ to some extent with respect to the preparation of color filter , image resolving power , degree of moire pattern generation etc . fig7 e shows a layout in which the vertical resolving is improved by modified arrangement of red elements in the vertical direction . also fig7 f shows a color filter layout capable of reducing image jitter at the image edge portion . furthermore fig8 a to 8f show color filter layouts utilizing the combinations of pure colors and complementary colors for improving the sensitivity , with corresponding characteristics to those shown in fig7 a to 7f . also fig9 a to 9f show color filter layouts allowing easier preparation of the color filter . in ccd as explained in the foregoing , the electrodes φ1 , φ2 , φ3 and φ4 have mostly been prepared with polysilicon having considerably poor transmittance to blue light component , leading to the insufficient sensitivity of the color camera utilizing such ccd . such insufficient blue sensitivity can be improved by replacing a part or all of said electrodes with transparent electrodes , for example preparing the electrodes φ2 and φ4 with sno 2 transparent electrodes . in such case the equations ( 1 ) to ( 8 ) become more complex , but the elimination of mixed color components can still be achieved in the process for separating color signals . also loss in blue sensitivity can be prevented by combining a 1 - phase drive frame - transfer ccd with a filter of a particular color element layout . such 1 - phase drive ccd has a cross - sectional structure as shown in fig1 , wherein a p - type silicon substrate 100 is provided with donor and acceptor ions 101 , 102 doped in the illustrated patterns to achieve a staircase potential pattern as shown in fig4 ( a ) by 1 - phase drive , and is further provided with a silicon insulating layer 103 and polysilicon electrodes 104 . thus , in such ccd , each cell is half covered by a polysilicon electrode 104 but the remaining half 105 ( hereinafter called transparent area ) is not covered by polysilicon . although the detailed function of said ccd will be omitted in the present description , the potential pattern is formed as a descending staircase shape as shown by 13 , 13 &# 39 ; in fig4 ( a ) in the charge transfer mode and as a well shape 14 in the charge accumulation mode . because of the considerably different spectral transmissions between the polysilicon electrode area and the transparent area , the color layouts shown in fig7 b , 7c and 7d are no longer applicable and have to that shown in fig7 a or the variations thereof as shown in fig1 a and 11b , all of which have linearly arranged green elements in the horizontal direction . the color filter is so positioned that the blue elements b are present on the transparent areas 105 and the green elements g are present on the polysilicon electrodes 104 thereby achieving an efficient photoelectric conversion since the polysilicon electrode 104 has considerable transmittance to the green light component and the blue component need not be transmitted by the polysilicon layer . in this manner a color imaging apparatus with improved blue sensitivity can be obtained by employing the above - mentioned ccd and color filter in combination as the imaging device 25 shown in fig5 . in this case , however , the ccd is controlled by 1 - phase drive instead of 4 - phase drive . as the color filter elements are displacedly positioned with respect to the imaging cells as already explained in relation to fig5 the green filter elements g partly cover the transparent areas of ccd . for this reason the equations ( 1 ) to ( 8 ) assume more complex form , but the mixed color components are again eliminated in the process of separating color signals . the foregoing second embodiment of the present invention is applicable , as explained above , also to a frame - transfer ccd the surface of which is partly covered by polysilicon electrodes and partly occupied by transparent areas , and allows to provide a solid - state color imaging apparatus of significantly improved sensitivity as the blue filter elements can be positioned outside the polysilicon electrodes of poor transmittance to the blue light component . in the conventional three - chip color imaging apparatus , the white clipping has been easily achieved even when the imaging devices are saturated because of the use of three solid - state imaging devices for green , red and blue with matched sensitivity . however , with the recent development of ccd provided with a color filter utilizing the combination of pure color elements and complementary color elements , the white clipping becomes difficult because of the difference in saturation light levels of the cells caused by the different color filter elements . as an example , the aforementioned embodiment can be combined with a color filter as shown in fig1 a or 12b wherein r stands for red element , g for green , b for blue , o for opaque , cy for cyan , w for white , ye for yellow and ma for magenta . the color components transmitted by such filter elements are processed by the circuit shown in fig6 to obtain the luminance signal y and color component signals r , b by signal delay in the delay line for a horizontal scanning time and by signal correlation in the vertical direction . in such processing the luminance signal is obtained from each row as : and the red signal r and blue signal b are obtained , as the sum and difference between the adjacent bits , from a signal obtained by subtraction of said 1h - delayed signal . now let us consider the dynamic ranges of the signals y , r and b in relation to fig1 a and 13b , showing the ccd output signals through a color filter as shown in fig1 in response to white light , when the components r , g and b respectively represent 25 % in the luminance signal y = r + 2g + b . fig1 a shows the ccd output level in the ordinate , in which the level &# 34 ; 1 &# 34 ; indicates the saturation level of the photosensitive cell , as a function of relative incident light amount in the abscissa . also fig1 b shows the output signals obtained from the signals ( m + g ), ( r + g ), ( b + g ) and g shown in fig1 a through the processing system shown in fig6 according to the following processes : thus , as shown in fig1 a , the incident light amount corresponding to the output saturation level becomes different according to the corresponding color filter element . consequently , as shown in fig1 b , it becomes no longer possible to obtain correct y , r and b signals above an incident light amount x at which the photosensitive cells corresponding to filter elements ma and g become saturated . the solid - state color imaging apparatus is generally used , in normal operation , for example in the order of 1 / 8 of the saturation level of photosensitive cells , and an incident light corresponding to the saturation level is regarded as a strong white light and is usually white clipped in the signal processing system . however , in a single - chip imaging apparatus , the coded output signals y , r and b show the behavior as shown in fig1 b , resulting in a decrease in the output levels of signals r and b above an incident light amount at which the photosensitive cells corresponding to ( ma + g ) become saturated . consequently said signals r and b are not white clipped , so that the color difference signals ( r - y ) and ( b - y ) do not reach zero , thus leading to a non - white image when the ccd is saturated . the above - mentioned drawback can be prevented by another embodiment of the present invention shown in a block diagram in fig1 , wherein the same components as in fig6 are represented by same numerals . in fig1 there are shown a signal generator 35 for generating electrode drive signals φ1 - φ4 ; a switching circuit 36 for supplying said drive signals φ1 - φ4 from the signal generator 35 , with or without dc bias voltages 37 , to the color imaging device 25 suitably in the transfer or accumulation mode in response to a mode signal m ; a delay line 26 for delaying the signals by one horizontal scanning time and obtaining the luminance signal y , red component signal r and blue components signal b through the vertical correlation of the signals ; and the color imaging device 25 composed , as already explained , of a mosaic color filter and a ccd . the output signal from the device 25 is introduced to an adder 27 , the delay line 26 and input terminals a , d of a switching circuit 28 , and the output signal from said delay line 26 is introduced to said adder 27 and input terminals b , c of said switching circuit 28 . the signal obtained from the adder 27 is expressed , by representing the signal level with uppercase letters , as follows for the n - th column : which is also usable as the luminance signal y since ma = r + b . from the foregoing result it will be understood that the effect of color mixing is not significant as the luminance signal ( r + 2g + b ) is merely multiplied by a coefficient ( 1 + α ). also the presence of luminance signal for each clock pulse suggests the possibility of obtaining a sufficiently high resolving power even with a ccd having a relatively limited number of pixels in the horizontal direction . output terminals e , f of the switching circuit 28 are simultaneously connected respectively to the input terminals a , c for a horizontal scanning time 1h , and to the input terminals b , d for a next horizontal scanning time . the fh in fig1 represents the horizontal scanning frequency . said output terminals e , f are respectively connected to the plus and minus input terminals of a subtracter 29 , which therefore provides alternate signals ( r &# 39 ;+ g &# 39 ;)-( b &# 39 ;- g &# 39 ;)= r - b and ( ma &# 39 ;+ g &# 39 ;)-( opaque &# 39 ;+ g &# 39 ;)= ma . the switching circuit 28 functions to avoid the formation of inverted signals b - r or - ma . as will be understood from the foregoing explanation , the mixed color components are completely excluded in the subtraction process . the output signal from said subtracter 29 is supplied to an adder 31 , a 1 - bit delay line 30 for delaying the signal by a time corresponding to an adjacent cell , and a subtracter 32 , and the output signal from said delay line 30 is supplied to said adder 31 and subtracter 32 . in this manner the adder 31 provides the red component signal r , and the subtracter 32 alternately provides positive and negative blue component signals which are rectified by a product detector 33 to obtain the bule component signal b . also there are shown a clamp circuit 38 for clamping the output signal from the color imaging device 25 ; a clipping circuit 38 for clipping thus clamped signals exceeding a certain level ; a pulse generator 39 ; adders 41 , 42 , 43 for adding the output of a pulse generator 40 to the respective output signals of the adder 27 or 31 of the detector 33 to obtain the signals y , r and b ; and a processor 34 composed of a white clipping circuit , a low - pass filter , a r - correcting circuit , a matrix circuit , a color - encoding circuit etc . for converting said signals y , r and b into the ntsc color video signal . the function of the above - explained embodiment is as follows . the signals obtained from the color imaging device 25 is delayed for a 1h time by the delay line 26 and is added with the output signal thereof in the adder 27 to obtain the signal y . also the color component signals r and b are obtained by subtraction in the subtracter 29 . simultaneously the signal from the color imaging device 25 is clamped by the clamping circuit 38 , and is clipped , in the clipping circuit 39 , by a voltage selected slightly lower than the saturation level . the obtained clip signal is converted , by the pulse generator 40 , into a clip pulse including the correction for 1 - bit delay , which is added to the luminance signal y and color component signals r , b in the adders 41 , 42 , 43 for achieving the white clipping by a corresponding circuit in the processor 34 . consequently the signals y , r and b are corrected to a same level in the processor to provide a white image with satisfactory white balance . now there will be explained another embodiment of the present invention in which the luminance signal itself is utilized as the input signal to the clipping circuit for determining the saturation of the photosensitive cells as shown in fig1 , in which the same components as in fig1 are represented by same numerals . in fig1 there are shown a clamp circuit 38 for clamping the output of the adder 27 ; a clipping circuit 39 for clipping the output signal of said clamp circuit 38 at a clip level a or a &# 39 ; shown in fig1 b ; adders 44 , 45 for adding the output signal of said clip circuit 39 respectively to the output signals of the adder 31 and the product detector 33 , the output signals of said adders 44 , 45 and of the adder 27 being supplied to the processor 34 for obtaining the ntsc color signal in the aforementioned manner . as mentioned above , the clip level may be selected at the point a in fig1 b or at the point a ; corresponding to the saturation level of the signal ( ma + g ). in the former case the clipping may not take place if the component ( g + o ) is small in the addition of ( ma + g )+( g + o ) after the 1h delay line 26 . on the other hand , in the latter case , the clipping may take place at an indicate light amount x &# 39 ; to result in a slightly increased saturation point . however , the white balance is almost assured in either case . in this manner the foregoing embodiment is advantageous in realizing desirable white clipping when the imaging device is saturated . this advantage is naturally further enhanced in a ccd having suitable measures against saturation or blooming . the solid - state color imaging apparatus in the foregoing embodiments allows to eliminate the drawback of color mixing by combining a mosaic color filter with a frame - transfer ccd , but is still associated with a drawback of providing false color signals under certain conditions . in the following there will therefore be explained an embodiment capable of formation of false signal in a particular color component in response to an input image having a low spatial frequency in the vertical direction . fig1 shows the same color element layout as in fig5 but each filter element and the corresponding output from potential well is numbered for the ease of explanation and the opaque portion 20 is omitted for clarity . thus , in a particular image field , a scanning line ( 1 ) provides the signals : consequently the signal r obtained through the circuit shown in fig6 corresponding to the scan line ( 2 ), is represented by : similarly the signal r obtained corresponding to the next scan line ( 3 ) is represented by : in the succeeding field , because of the interlaced drive , the signal r corresponding to the scan line ( 2 &# 39 ;) becomes : in the following explained are the positive and negative coefficients multiplied on the original output signals from filter element for obtaining the signal r out . fig1 a shows the coefficients to be multiplied on the cell output signals for calculating the output signal r out corresponding to the scan line ( 2 ). similarly the coefficients for the scan line ( 2 &# 39 ;) in the interlaced drive assume the state shown in fig1 b , and those corresponding to the scan line ( 3 ) or ( 3 &# 39 ;) assume the state shown in fig1 c or 17d , respectively . as shown in these figures said coefficients are positive in the cells in two upper rows and negative in the cells in two lower rows in the scanning of line ( 2 ) or ( 2 &# 39 ;), and are negative in the cells in two lower rows and positive in the cells in two lower rows for the scan line ( 3 ) or ( 3 &# 39 ;). the use of such vertically asymmetric coefficients to be multiplied on the cell output signals in the calculation of the color signal leads to the formation of significantly marked false color signals in case the input image is provided with a luminance gradient in the vertical direction . such false color signals , being generated by the first - order gradient of luminance , are scarcely cancelled by the optical low - pass filter , and not cancelled either by the use of an electrical low - pass filter as said signals are uniform in the scanning direction . the state of such false color signals is schematically shown in fig1 , wherein fig1 a represents an uncolored input image with a higher luminance in the upper left area and a lower luminance in the lower right area , the hatching lines being provided it indicate the luminance by the number of said lines . also fig1 b shows the signal r out obtained by signal processing circuit shown in fig6 . in response to such uncolored input image showing a higher luminance in the upper part and a lower luminance in the lower part , the color signal r out is calculated , according to the coefficients shown in fig1 a and 17b , by subtracting the output signals b and g of the lower luminance area from the output signals g , r and ma in the higher luminance area , thus leading to a value higher , eventually more than double , than the correct r out signal . also the coefficients shown in fig1 c and 17d give rise to the subtraction of a component generated by luminance gradient from the correct value of r out signal , thus leading eventually to a zero or negative r out signal value . because of the situation explained in the foregoing , the r out signal obtained from the uncolored input image shown in fig1 a becomes excessively higher and lower than the correct level for every two scan lines as shown in fig1 b , so that the image becomes irregular for every two scan lines . such false color signals are easily noticeable as they are generated in the low spatial frequency portion of the image . such drawback is resolved in the present embodiment by adding the initially obtained color signals after a delay for a horizontal scanning time , whereby the overall image quality is improved without loss in the resolving power . this embodiment is shown in fig1 , in which the same components as in fig6 are represented by same numerals , and the following explanation will be limited to those different from the circuit shown in fig6 . in fig1 there are shown a 1h delay line 46 for delaying the output signal from the adder 31 ; and an adder 47 for adding the output signal of said delay line 46 to the output signal from the adder 31 and supplying thus obtained signal r to the processor 34 . because of the presence of such additional circuit , the coefficients for calculating the signal r out corresponding to the scan line ( 3 ) in fig1 become equal to the average of those shown in fig1 a and 17b , thus assuming a vertically symmetrical form as shown in fig2 a . similarly said coefficients for the succeeding scan line assume the form shown in fig2 b . as the result , the irregular pattern as shown in fig1 b becomes no longer existant . strictly speaking the r out signal loses the resolving power in the vertical direction by the above - explained process , but the color component signal does not require a high resolving power . in addition the luminance signal is not at all affected by the above - explained process . consequently the final image quality is improved by the elimination of said false color signals . although the foregoing explanation has been limited to a color component signal , it is desirable , in a general color element layout , to apply the aforementioned process to both color signals , and is in practice possible to extend the above - explained principle to both color signals . in case of employing a color filter as shown in fig2 a , which is obtained by interchanging the blue and red elements in the layout shown in fig5 it is desirable to insert the delay line into the blue signal b . also in case of employing a color filter as shown in fig2 b , 21c , or 21d , it is desirable to insert the delay lines to both blue and red signals . also in consideration of the foregoing , the luminance signal and color signals can be similarly obtained from other circuits than that shown in fig1 . fig2 shows still another embodiment of the present invention , wherein there are shown a signal generator 48 for generating electrode drive signals sφ1 - sφ4 ; a switching circuit 49 for supplying said drive signals sφ1 - sφ4 from said signal generator 48 , with or without dc bias voltages 50 , to the color imaging device 51 suitably in the transfer or accumulation mode in response to a mode signal m ; a solid - state color imaging device 51 composed , as already explained , of a mosaic color filter and a ccd as shown in fig5 ; and a delay line 52 for delaying the signals by one horizontal scanning time and obtaining the luminance signal y , red component signal r and blue component signal b through the vertical correlation of the signals . the output signal from the device 51 is introduced to an adder 52 , the delay line 53 and a subtracter 56 , and the output signal from said delay line 53 is introduced to said adder 52 , a delay line 55 and an amplifier 56 . also the output signal from said subtracter 54 is supplied to an inverter 57 and switching circuits 58 , 59 , which are automatically changed over for every scan line and of which output signals are supplied through low - pass filters 60 , 61 to a processing circuit 62 of the same structure as the processor 34 shown in fig5 to provide the ntsc color signals . the function of the above - explained embodiment is as follows . the output signal from the color imaging device 51 is added , after delay by the delay line 53 , to the undelayed signal in the adder 52 to provide the input luminance signal for the processing circuit 62 . the output signal from said delay line 53 is also supplied again to the delay line 55 to provide a two - line delayed signal . the one - line delayed output from the color imaging device 51 is doubly amplified by the amplifier 56 , and introduced , together with the undelayed signal and the two - line delayed signal , to the subtracter 54 . the output signal therefrom is partly supplied through the inverter 57 to the switching circuits , 58 , 59 which are changed over according to the scan position and the cell position under scanning , whereby the switching circuit 58 provides signals ( r + b ), ( r - b ), ( r + b ), ( r - b ), . . . in succession which are converted into the signal r through the low - pass filter 60 , while the switching circuit 59 provides signals ( b + r ), ( b - r ), ( b + r ), . . . in succession which are converted into the signal b through the low - pass filter 61 . the y , r and b signals obtained in this manner are supplied to the processing circuit 62 to obtain the ntsc color signals . said low - pass filters 60 , 61 may be composed of 1 - bit delay circuit and addre as shown in fig1 or may be of any other structure capable of sufficiently reducing the high - frequency components . | 7 |
referring first to fig1 of the drawing , the schematic circuit diagram illustrates a typical attenuator network of the bridged h type . thus , it includes two legs of permanent , fixed resistors 10 , usually of 300 ohms each . each leg includes two such resistors connected together in series . the legs of the pad are shown with input terminals 12 and output terminals 14 for connection to telephone line circuitry , as will be understood . as mentioned previously , attenuator networks are required to be provided in a wide range of resistance values . accordingly it is a conventional practice to associate with the permanent , fixed resistors 10 , a plug - in component , commonly referred to as an attenuator pad 16 ( fig2 and 3 ), which includes series and shunt resistors of various values which , when combined with the permanent resistors , provides the desired attenuation values . thus , in fig1 the attenuator pad includes the series resistors 18 and 20 , one associated with each leg and each arranged for connection in parallel across one of the two permanent resistors 10 of the leg . the attenuator pad also includes a shunt resistor 22 arranged for connection across the legs between the pairs of permanent resistors . the resistance values of the series and shunt resistors are selected for association with the permanent resistors to provide the desired magnitude of attenuation , as previously mentioned . thus , for example , if the attenuator network includes 300 ohm permanent resistors and it is desired that the attenuation be 3 . 0 db , the series resistors 18 and 20 are chosen to have a resistance of 128 . 8 ohms each and the shunt resistor 22 is chosen to have a resistance value of 1 , 454 ohms . as will be understood , various other values for the series and shunt resistors are selected to provide an attenuation range of , for example , from 0 - 35 db in 0 . 2 db increments . a typical attenuator pad , commonly identified as an eighty - nine type resistor , is contained in a cylindrical metal housing measuring about 13 / 8 inch in diameter and about 13 / 4 inches long and provided at one end with a multiple prong male socket base , of the familiar vacuum tube base type , for removable reception in a correspondingly apertured female socket . two of the male prongs are enlarged in diameter to properly orient the multiple male prongs for correct circuit connections . in this regard , therefore , it will be apparent that installation of the attenuator pad involves sufficient time to rotate the pad to align the prongs with the corresponding female socket . moreover , the installation of one such conventional pad requires a space of 7 . 2 square inches . in accordance with the present invention , on the other hand , the attenuator pad 16 is miniaturized to a volume about 1 / 30 the volume of the aforementioned container of a conventional attenuator pad , requiring about 1 / 15 the space for installation . moreover , it may be installed in its associated supporting connector 24 in either of two positions of 180 ° degree rotation , thereby insuring proper installation in a minimum of time . fig2 illustrates a plurality of attenuator pads 16 of this invention mounted on a conventional elongated electrical connector 24 . as a typical illustration , the body of the connector is 7 / 16 inch wide , 1 / 4 inch thick and of any desired length . projecting tabs 26 extend longitudinally from the opposite ends of the body and are apertured to receive mounting screws by which the body may be secured to a supporting structure , preferably the main frame of a telephone central office system . the external dimensions of the casing 28 of the attenuator pad 16 is 1 / 2 inch wide , 1 / 4 inch thick and 1 / 2 inch long . referring now primarily to fig3 of the drawing , the attenuator pad of this invention includes a printed circuit board or other form of substrate 30 of electrically non - conductive material . in relation to the foregoing exemplified dimensions of the casing , the substrate is 3 / 8 inch wide , 1 / 16 inch thick and 3 / 4 inch long . thus , when it is inserted into the casing , about 1 / 3 of an inch of it projects therefrom . the substrate is provided with a plurality of pairs of spaced electrical conductors 32 and 34 deposited on at least one of its sides . in the preferred embodiment illustrated , and best shown in fig4 and 5 , the conductors are aligned on opposite sides of the substrate . thus , on the side illustrated in fig4 there are 3 spaced conductors 32 . each extends inwardly from the outer end of the substrate and provides electrical engagement with a corresponding resilient electrical conductor component of the connector 24 . the inner ends of the two outer conductors 32 communicate with spaced openings 36 formed through the substrate . the center conductor 32 is connected to an extension 32 &# 39 ; which communicates through opening 38 in the substrate with a circular conductor portion 32 &# 34 ; surrounding the opening on the opposite side of the substrate ( fig5 ). on the side of the substrate illustrated in fig5 there is also deposited a plurality of spaced electrical conductors 34 on the outer portion of the substrate . each conductor is aligned with one of the conductors 32 on the opposite side of the substrate ( fig4 ) and provides electrical engagement with a corresponding resilient electrical conductor component of the connector 24 . the inner ends of the two outer conductors 34 are extended to spaced openings 40 formed through the substrate . the center conductor 34 is connected to an extension 34 &# 39 ; which communicates through opening 42 in the substrate with a circular conductor portion 34 &# 34 ; surrounding the opening on the opposite side of the substrate ( fig4 ). electrical resistance means interconnects the ends of the deposited electrical conductors 32 and 34 of each pair . although the resistance means may be provided by the well known deposition techniques of applying suitably resistive material directly on a substrate , the preferred arrangement illustrated utilizes a conventional resistor element having electric leads projecting from its opposite ends for insertion in the pairs of spaced openings in the substrate and soldering or other form of attachment to the end of the corresponding deposited electrical conductors . as illustrated , there are three pairs of deposited electrical conductors on the substrate and three associated resistors . two of the resistors are the series resistors 18 and 20 illustrated in fig1 and these are connected in series with the two outer pairs of conductors 32 and 34 on opposite faces of the substrate . the third resistor is the shunt resistor 22 illustrated in fig1 and it is connected in series with the center pair of conductors 32 and 34 on opposite sides of the substrate at the spaced openings 38 and 42 . in the preferred embodiment illustrated , the resistors and supporting portion of the substrate are encased in electrically non - conductive potting material 44 , such as epoxy resin , or other suitable electrically non - conductive material . for this purpose it is also preferred that an electrically non - conductive , hollow case 28 to be provided to contain the potting material ( fig3 ). the case is closed at one end by a wall 46 , while the opposite end is open to receive the resistor mounting portion of the printed circuit board and the potting material . the lateral sides of the closure wall preferably project from the corresponding side walls of the case to provide finger gripping shoulders 48 by which to facilitate removal of the pad from the connector 24 . fig3 of the drawing also illustrates the construction of a conventional terminal connector 24 . the body , also shown in fig2 is of electrically non - conductive material , preferably of molded synthetic resin formed with an internal cavity along its length and confining therein a plurality of longitudinally spaced , opposed pairs of resilient electrical conductors 50 and 52 . the resilient portions of the conductors of each pair confined within the body are arranged to receive removably between them the portion of the substrate projecting from the case 28 , with each aligned pair of deposited electrical conductors 32 and 34 on said projecting portion of the substrate in electrical engagement with the associated resilient conductors . in this respect , the portions of the deposited electrical conductors on the substrate constitute electrical contacts of the attenuator pad . it is to be noted that the portion of the substrate 30 projecting from the case 28 is in the form of a flat blade . thus , by arranging the resistors 18 , 20 and 22 in the symmetrical pattern illustrated in fig5 the pad may be installed in the connector 24 in either of its 180 ° positions of rotation without affecting the circuitry . this materially reduces the time factor involved in installation and replacement of attenuator pads . the portions of the resilient conductors 50 and 52 extending from the connector body 24 serve as electrical connections for the permanent resistors 10 and input and output terminals 12 and 14 illustrated in fig1 . thus , the connector body may be mounted directly on the main frame of telephone central equipment , thereby eliminating the necessity of equipment bays , the extremely large volume of wires extending to and from them , and the corresponding cost of labor involved conventionally in the continual replacement of such wires . fig6 - 9 illustrates an attenuator network assembly embodying the features of this invention . thus , a base plate 60 of electrically non - conductive material supports a plurality of terminal block strips 62 also of electrically non - conductive material . the strips are arranged in a stack , extending perpendicularly from the base plate , and are provided with laterally spaced , registering openings for the reception of tie rods 64 which also extend through registering openings in the base plate . an exposed , threaded end portion of each rod thus receives a nut 66 , by which to secure the stacked blocks and base plate together . each terminal block is provided with a plurality of laterally spaced notches 68 ( fig6 ) each arranged to receive an electrically conductive terminal 70 . each terminal is provided intermediate its ends with a notch 72 extending upward from its lower side . the length of the notch is dimensioned to correspond to the width of the terminal block and the depth of the notch is selected to provide the body of the terminal immediately above it with a dimension corresponding to the depth of the notch 68 in the terminal block . accordingly , when the terminal is positioned within the notch , the upper edge of the terminal lies in the same plane as the upper surface of the block . the lower surface of each terminal block rests in abutment with the upper surface of the terminal block immediately below it in the stacked assembly . accordingly , the terminals 70 are secured in position and restrained from displacement . one end of each electrically conductive terminal is provided with means for the connection of an electrical conductor wire . in the embodiment illustrated , the terminal end portion 74 of each terminal is designed for a solder connection , as is well known . the opposite end of each terminal is provided with means for the connection of the opposite ends of the wires of the legs formed of the permanent , fixed resistors . in the embodiment illustrated , these ends are designed for a wire wrap , and are herein identified as the input terminals 12 and output terminals 14 . supported at the upper ends of the stack of blocks 62 by means of the tie rods 64 , is a u - shaped support plate 76 . the intermediate portion of the plate overlies the stack of blocks , and the spaced end sections 76 &# 39 ; project laterally therefrom to support the connector 24 . registering openings in the end sections and the projecting tabs 26 of the connector 24 receive anchor screws 78 for securing the connector 24 in position extending between the end sections , with the electrical conductors 50 and 52 projecting downward alongside the stack of terminal blocks . the permanent , fixed resistors 10 are soldered or otherwise secured to appropriate one of the conductors 50 and 52 . being of miniature size , they are located conveniently between and adjacent the outer sides of the conductors 50 and 52 , as illustrated . the four fixed resistors 10 are associated with three adjacent pairs of the electrical conductors 50 and 52 . the input terminals 12 are connected to the outer terminals 50 through electrical wires 12 &# 39 ;, and the output terminals 14 are connected to the outer terminals 52 through the flexible wires 14 &# 39 ;. the opposite ends 74 of the electric terminals 70 projecting from the opposite side of the stack of terminal blocks thus may be connected to associated telephone line circuitry . fig6 and 9 illustrate the assembly of a single attenuator network and the associated attenuator pad 16 . it will be understood that a large number of such assemblies may be provided on a single unit . for example , 200 terminals may be arranged on a stacked terminal block assembly measuring about 24 square inches , to provide 50 attenuator network assemblies . the base plate 60 may conveniently be secured to the main frame of telephone central office equipment . in this manner the conventional equipment bays may be eliminated , together with the multitude of wires leading to and from them . from the foregoing it will be appreciated that the present invention provides a telephone line attenuator network assembly and pad of economical construction and of such miniaturized size as to reduce significantly the space requirements , wire , maintenance and other substantial cost factors associated with telephone central operations . in this regard , it has been found that the attenuator pad of the dimensions previously mentioned reduces the floor space requirements by a factor of at least about 15 , as compared with conventional attenuator pads of the dimensions also mentioned hereinbefore . further , the attenuator pad of this invention correspondingly reduces the inventory storage space , as will be apparent , and significantly reduces the capital expenditure for such inventory since the cost of the attenuator pads of this invention is significantly lower than those utilized heretofore . it will be apparent to those skilled in the art that various changes may be made in the size , shape , type , number and arrangement of parts described hereinbefore , without departing from the spirit of this invention . | 7 |
the following definitions are provided to facilitate understanding of certain terms used herein and are not meant to limit the scope of the present disclosure . “ amino acid ” or “ residues ” refers to any of the twenty naturally occurring amino acids as well as any modified amino acid sequences . modifications may include natural processes such as posttranslational processing , or may include chemical modifications which are known in the art . modifications include but are not limited to : phosphorylation , ubiquitination , acetylation , amidation , glycosylation , covalent attachment of flavin , adp - ribosylation , cross - linking , iodination , methylation , and alike . amino acid residue characterization can be found in numerous citations , for example stryer , 1995 , biochemistry , throughout the text and 17 - 44 . “ expression ” refers to transcription and translation occurring within a host cell . the level of expression of a dna molecule in a host cell may be determined on the basis of either the amount or corresponding mrna that is present within the cell or the amount of dna molecule encoded protein produced by the host cell ( sambrook et al ., 1989 , molecular cloning : a laboratory manual , 18 . 1 - 18 . 88 ). “ genetically engineered ” refers to any recombinant dna or rna method used to create a host cell that expresses a target protein at elevated levels , at lowered levels , or in a mutated form . typically , the host cell has been transfected , transformed , or transduced with a recombinant polynucleotide molecule , and thereby been altered so as to cause the cell to alter expression of the desired protein . methods for genetically engineering host cells are well known in the art . ( see current protocols in molecular biology , ausubel et al ., eds . ( wiley & amp ; sons , new york , 1988 , and quarterly updates )). genetically engineering techniques include but are not limited to expression vectors , targeted homologous recombination and gene activation ( see , for example u . s . pat . no . 5 , 272 , 071 to chappel ) and trans activation by engineered transcription factors ( see segal et al ., 1999 , proc natl acad sci usa 96 ( 6 ): 2758 - 63 ). “ hybridization ” refers to the pairing of complementary polynucleotides during an annealing process . the strength of hybridization between two polynucleotide molecules is impacted by the homology between the two molecules , stringency of the conditions involved , and melting temperatures of the formed hybrid and the g : c ratio within the polynucleotide . for purposes of the present invention stringency hybridization conditions refers to the temperature , ionic strength , solvents , etc , under which hybridization between polynucleotides occurs . “ identity ” refers to a comparison between pairs of nucleic acid or amino acid molecules . methods for determining sequence identity are known in the art . for example , computer programs have been developed to perform the comparison , such as the gap program ( wisconsin sequence analysis package , version 8 for unix , genetics computer group , university research park , madison wis . ), that uses the algorithm of smith and waterman ( 1981 ) adv appl math 2 : 482 - 489 . “ isolating ” refers to a process for separating a nucleic acid or polypeptides from at least one contaminant with which it is normally associated . in preferred embodiments , isolating refers to separating a nucleic acid or polypeptide from at least 50 % of the contaminants with which it is normally associated , and more preferably from at least 75 % of the contaminants with which it is normally associated . the term “ nucleic acid ” refers to a linear sequence of nucleotides . the nucleotides are either a linear sequence of polyribonucleotides or polydeoxyribonucleotides , or a mixture of both . examples of nucleic acid in the context of the present invention include — single and double stranded dna , single and double stranded rna , and hybrid molecules that have mixtures of single and double stranded dna and rna . further , the nucleic acids of the present invention may have one or more modified nucleotides . the term “ pcr ” or “ polymerase chain reaction ” refers to the process to amplify nucleic acids as described in u . s . pat . nos . 4 , 683 , 105 and 4 , 683 , 202 , both owned by roche molecular . “ host cell ” refers to cells containing a target nucleic acid molecule , for example a heterologous nucleic acid molecule such as a plasmid or other low molecular weight nucleic acid , in which case the host cell is typically suitable for replicating the nucleic acid molecule of interest . examples of suitable host cells useful in the present invention include , bacteria , algae , and yeast , specific examples of such cells include , e . coli dh5α cells , as well as various other bacterial cell sources , for example the e . coli strains : dh10b cells , xl1blue cells , xl2blue cells , top10 cells , hb101 cells , and dh12s cells , yeast host cells from the genera including saccharomyces , pichia , and kluveromyces and green alga , for example chlamydomonas reinhardtii . “ hybridization ” refers to the pairing of complementary polynucleotides during an annealing period . the strength of hybridization between two polynucleotides molecules is impacted by the homology between the two molecules , stringent conditions involved , the melting temperature of the formed hybrid and the g : c ratio within the polynucleotides . high stringency conditions include , for example , 42 ° c ., 6 × ssc , 0 . 1 % sds for 2 hours . “ nucleic acid ” or “ na ” refers to both a deoxyribonucleic acid and a ribonucleic acid . as used herein , “ nucleic acid sequence ” refers to the order or sequence of deoxyribonucleotides or ribonucleotides along a strand . they may be natural or artificial sequences , and in particular genomic dna ( gdna ), complementary dna ( cdna ), messenger rna ( mrna ), transfer rna ( trna ), ribosomal rna ( rrna ), hybrid sequences or synthetic or semisynthetic sequences , oligonucleotides which are modified or otherwise . these nucleic acids may be of human , animal , plant , bacterial or viral origin and the like . they may be obtained by any technique known to persons skilled in the art , and in particular by the screening of libraries , by chemical synthesis or by mixed methods including the chemical or enzymatic modification of sequences obtained by the screening of libraries . they may be chemically modified , e . g . they may be pseudonucleic acids ( pna ), oligonucleotides modified by various chemical bonds ( for example phosphorothioate or methyl phosphonate ), or alternatively oligonucleotides which are functionalized , e . g . which are coupled with one or more molecules having distinct characteristic properties . in the case of deoxyribonucleic acids , they may be single - or double - stranded , as well as short oligonucleotides or longer sequences . in particular , the nucleic acids advantageously consist of plasmids , vectors , episomes , expression cassettes and the like . these deoxyribonucleic acids may carry genes of therapeutic interest , sequences for regulating transcription or replication , anti - sense sequences which are modified or otherwise , regions for binding to other cellular components , and the like . “ oxygen resistant ” refers to any measurable decrease in oxygen sensitivity in a hydrogenase as compared to a hydrogenase having a reference oxygen sensitivity , for example , as compared to a wild type hydrogenase from which an oxygen - resistant hydrogenase enzyme has been made . “ oxygen sensitive ” refers to the wild type or reference oxygen sensitivity found in a native hydrogenase . “ protein ,” “ peptide ,” and “ polypeptide ” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers . green algae , e . g ., chlamydomonas reinhardtii , cultured under anaerobic conditions synthesize an enzyme known as iron - hydrogenase ([ fe ]- hydrogenase ). as shown in fig1 a , several representative [ fe ]- hydrogenase enzymes are aligned showing general sequence identity for the family of proteins . generally , overall sequence identity for [ fe ]- hydrogenase family members is usually at least 45 % and sequence identity for the h 2 - channel between family members is at least 66 %. in general , [ fe ]- hydrogenase enzymes characteristically possess a catalytic site consisting of a bimetallic center containing two fe atoms ( 2fe - center ), bridged by cysteinyl sulfur to an electron relay [ 4fe4s ] center ( 4fe - center ). the iron atoms of the catalytic 2fe - center are joined together by a combination of organic , sulfur , and carbon monoxide ligands . the chemistry of the [ fe ]- hydrogenase catalytic core is reactive with respect to hydrogen , typically possessing very high hydrogen - production rates . however , this same catalytic core is also highly sensitive to inactivation by oxygen . as a protective measure against inactivation by oxygen or other like molecules , the catalytic core is typically buried deep within the protein , where access to the core is limited . as a result , interface of the hydrogenase catalytic site with surface surroundings is principally limited to a single channel , termed the h 2 - channel , that directs diffusion of synthesized hydrogen from the enzyme interior to the external environment . the h 2 - channel is also the primary access route of oxygen to the metallo - catalytic site within hydrogenase enzyme . reverse diffusion of the oxygen from the surface of the enzyme into the h 2 - channel and on to the active site , allows oxygen to bind to the 2fe - center , inactivating the enzyme . under normal physiologic conditions this represents a fairly normal inhibitory response for the hydrogenase enzyme , however , under the artificial conditions of expressing bulk amounts of h 2 , this is a fairly major limitation . the present invention provides for the modification of the h 2 - channel to reduce oxygen diffusion from the external environment to the enzyme &# 39 ; s catalytic core . the present invention provides modifications to the h 2 - channel that act as oxygen filters , preventing or reducing the diffusion of oxygen to the catalytic site within the hydrogenase enzyme . these modifications are at the same time insufficient to limit the ability of h 2 to diffuse out of the enzyme through the h 2 - channel . several mechanisms for the reduction of oxygen diffusion to the active site within the hydrogenase enzyme are provided , including targeted replacement of residues that line the h 2 - channel with bulkier residues , so as to shield the 2fe - center and / or reduce the diameter of the h 2 - channel . in particular , the residues that line the h 2 - channel are replaced with bulkier , hydrophobic residues , for example tryptophan or phenylalanine , so as to shield the 2fe - center , as well as to reduce the size or volume of the catalytic site - h 2 - channel interface . in addition , modifications to residues on the channel interior that approach and define the channel - solvent boundary ( see portion 4 of fig3 ). in a preferred embodiment of the invention , a process for designing and engineering oxygen - resistant iron - hydrogenases has been developed . the engineering scheme targets the structure and or environment of the h 2 - channel within the target hydrogenase , which is altered to be more selective in allowing the outward diffusion of hydrogen while simultaneously filtering our surface oxygen . note that size - limited diffusion has been successfully used to generate filters for commercial use in the separation of gases , including the separation of hydrogen from oxygen . menoff t . m ., ( 2000 ) proc . hydrogen program review . the present invention provides host cells for the expression of nucleic acid molecules for encoding an oxygen - resistant iron - hydrogenase , for example , c . reinhardtii that expresses an oxygen - resistant hyda1 or cyanobacteria that also expresses an oxygen - resistant hyda1 . example oxygen - resistant hydrogenases designed and engineered by the method of the present invention include v240w , a78w , a244w , a248w , g86w , and l93w . these oxygen - resistant hydrogenase enzymes have the same primary structure as hyda1 with the exception that a at residue 78 is replaced with w . note that other residues besides w , including synthetic and derivatized amino acids , are envisioned for substitution into the h 2 - channel , as long as they limit o 2 diffusion through the channel and allow h 2 diffusion out of the channel . in addition , the invention provides for the bulk photoproduction of h 2 using the transformed host cells of the invention . identification of the residues that form the h 2 - channel of a [ fe ]- hydrogenase the iron - hydrogenase family of enzymes is a group of enzymes expressed in algae for metabolism of hydrogen . iron - hydrogenase family members have been shown to have three distinct motifs that contain highly conserved residues , including a series of identifiable cysteine residues . vignais et al ., ( 2001 ) fems micro . rev . 25 : 455 - 501 . in particular , motif 1 has the amino acid sequence pmftsccpxw , motif 2 has an amino acid sequence mpcxxkxxexxr and motif 3 has an amino acid sequence of fxexmacxgxcv . these three motifs have been identified in all iron - hydrogenase family members to date . the cysteine residues have been shown to either ligate the catalytic [ 4fe - 4s ] center , or bridge the [ 4fe - 4s ] to the [ 2fe - 2s ] center , and there presence within the primary structure of the enzyme is highly conserved . one of the most studied iron - hydrogenase enzymes is cpi , having its primary , secondary and tertiary structures determined . peters et al ., ( 1998 ) science 282 : 1853 - 1858 . in preferred embodiments , cpi or other like known iron - hydrogenase enzymes , can be used in the design and engineering of oxygen - resistant hydrogenases ( see below and fig1 a for potential iron - hydrogenase enzymes ). to identify the h 2 - channel within a target hydrogenase , i . e ., a polypeptide containing motifs 1 - 3 above , the primary sequence of the target hydrogenase must be compared to the primary sequence of a known hydrogenase . once the two sequences have been aligned a level of identity is determined ( see fig1 a and 2 ). stothard p ., ( 2000 ) biotechniques 28 ( 6 ) 1102 ( hereby incorporated by reference in its entirety ). for purposes of the present invention an overall identity of approximately 40 %- 45 % or better should be found for the target hydrogenase . further , an analysis of the target polypeptide &# 39 ; s primary sequence is performed to predict the sequences that share homology with the h 2 - channel forming regions of other known iron - hydrogenases ( similar patterns of residues that have been shown previously to form hydrophobic cavities ). montet et al ., ( 1997 ) nat . struc . biol . 4 : 523 - 526 . it should be noted that because the h 2 - channel is a conserved domain within all hydrogenases , other non - iron hydrogenase sequences can be used to identify the target hydrogenase h 2 - channel . there should be at least 40 %- 45 % identity between the known and unknown sequence between the h 2 - channel sequences of the know and unknown hydrogenases . once the region within the target polypeptide for the h 2 - channel has been located , the channel is modeled into a three - dimensional structure showing the orientation of residues in relation to the channel and active site . guex et al ., ( 1997 ) electrophoresis 18 : 2714 - 2723 . ( see below ) in some embodiments , the analysis is extended to identify the residues corresponding to the active site within the target hydrogenase . note that the active site of the target or unknown hydrogenase should share at least 90 % homology for motifs 1 - 3 , and in preferred embodiments shown complete identity with motifs 1 - 3 ( see above ). the combination of primary and tertiary structures of the target hydrogenase are compared to evaluate the identification of candidate regions for the final verification of the hydrogen - channel . as noted above , the present invention provides a model for generating a theoretical structure of a target h 2 - channel within a target hydrogenase enzyme . in one embodiment , the theoretical structure is generated by homology modeling ( see above ) to the solved structure of other known [ fe ]- hydrogenases , for example cpi . ( see fig1 a ). in some embodiments , the homology modeling is limited to the known hydrogenase active site and h 2 - channel , and in other embodiments the homology modeling can be limited to the known hydrogenase h 2 - channel sub - domains . a percent homology of the known hydrogenase ( both identity and similarity ) can be used to determined residue identity and similarity for the entire enzyme , the active site , the h 2 - channel and the h 2 - channel sub - domains ( see overhead arrows in fig2 and see discussion in previous section above ). as such , the present invention provides a known hydrogenase based homology model that gives a reliable approximation of the target hydrogenase structure and h 2 - channel environment . in a preferred embodiment , the known hydrogenase is cpi and the target hydrogenase is hyda1 . homology modeling can be performed using swiss - model software as described in guex et al . guex et al ( 1997 ) electrophoresis 18 : 2714 - 2723 . note , however , that other like programs can be used in this aspect , as is known in the art , e . g ., modeller program designed by marti - renom et al ., ( 2000 ) ann . rev . biophy , biomol . struct . 29 : 291 - 325 ; esypred3d designed by lambert c . et al ., ( 2002 ) bioinformatics 18 ( 9 ): 1250 - 1256 . typically , the homology modeling identifies the residues that project into the h 2 - channel interior of the target hydrogenase . the channel environment is often composed of smaller hydrophobic residues , e . g ., glycine , alanine , valine , but can contain phenylalanine and other like residues . for example , the h 2 - channel of hyda1 contains mostly small hydrophobic residues with the exception of the larger phenylalanines at positions 252 and 355 ( see fig2 , black dotted residues ). a secondary structure is determined from the active site to the enzyme surface using the modeled structure above , and distances between side chain atoms of identified residues opposed to each other are determined . guex et al ., supra an approximate average diameter of the channel over the distance from the catalytic site ( fe 2 - atom to the h - cluster [ 2fe - 2s ]- center ) to the protein surface is determined ( see fig3 , 1 - 4 ) ( typically by using the distances between the side chain atoms of opposed residues within the channel ). in silico mutagenesis is performed on the identified hydrogenase h 2 - channel structure to identify possible residues that can be modified to reduce the h 2 - channel diameter . mutagenesis criteria preferably involve conservative mutation of specific residues , selection of the lowest energy rotomer and energy minimization of the resulting structure using gromos . van gunsteren , w . f . et al ., ( 1996 ) biomolecular simulation , the gromos96 manual and user guide . vdf hochschulverlag ethz . once an energy minimized structure is obtained , the dimensions of the target in silico mutagenized hydrogenase channel is determined . in preferred embodiments , one or more locations along the h 2 - channel is designed via conservative mutation to be smaller in diameter than a corresponding non - mutated h 2 - channel , typically this reduction is to a channel size of between approximately 5 . 0 and 2 . 4 å in diameter , and preferably between 3 . 5 and 2 . 5 å , a diameter that either limits or eliminates the ability of oxygen to diffuse through the modified h 2 - channel . note that the h 2 - channel is in constant flux , as such diameter measurements are averages and not meant to be held to a static standard . note that in embodiments of the present invention , more than one residue can be in silico mutated to design an optimum oxygen - resistant hydrogenase . in an alternative embodiment , design of oxygen - resistant hydrogenase enzymes is provided by determining what substitutions / modifications of residues within the identified h 2 - channel of a target [ fe ]- hydrogenase can be performed to reduce the volume of the h 2 - channel . volume considerations include a reduction in the flow of gasses , i . e ., o 2 , through the channel in accordance with stokes einstein equation and fick &# 39 ; s law . designed oxygen - resistant hydrogenases , having a reduced diameter h 2 - channel , are genetically engineered and transformed into target host cells , for example , into c . reinhardtii , and tested for hydrogenase activity in the presence of o 2 via a modified clark electrode or other known assay ( s ). in preferred embodiments , the oxygen - resistant hydrogenase is generated via site - directed mutagenesis . for example , to generate hyda1 mutants , the hyda1 gene of pa1exble can be mutagenized in vitro using the quick change xl site - directed mutagenesis kit ( stratagene ). host cells that have incorporated the designed enzymes ( having reduced oxygen sensitivity ) can be used to photoproduce h 2 in an oxygen containing environment . note that these host cells can also be treated with mrna interference to repress the expression of native hydrogenases , while continuing to allow expression of the inventive engineered hydrogenase ( s ). in one embodiment , the in silico designed oxygen - resistant hydrogenase enzymes can be further analyzed for changed or reduced oxygen diffusion within their h 2 - channel by applying smd via the namd program . kale l . et al ., ( 1999 ) computational physics 151 : 283 ; isralewitz b ., ( 2001 ) curr . opin . struc . biol . 11 : 224 . smd analysis , therefore , provides confirmation and additional baseline data as to the efficiency of the channel modifications and their effects on o 2 diffusion within the proposed oxygen - resistant hydrogenase . oxygen - resistant hydrogenase enzymes of the invention include all proteins that can be constructed from the in silico mutagenesis methods discussed above . for example , any polypeptide having a predicted reduction in hydrogen - channel diameter or volume , as determined by the methods of the invention , is envisioned to be within the scope of the present invention . in addition , oxygen - resistant hydrogenase enzymes of the invention include isolated polypeptides having an amino acid sequence as shown in fig2 ( cr hyda1 ), and having one or more substitutions at residues v240 , a78 , a244 , a248 , g86 , and l93 ( note that substitution by tryptophan and other like amino acids is envisioned , including synthetic or derivatized amino acids ) ( also included are substitutions shown in tables 1 and 2 ). the invention includes variants and derivatives of these oxygen - resistant [ fe ]- hydrogenase enzymes , including fragments , having substantial identity to these amino acid sequences , and that retain both hydrogenase activity and enhanced tolerance to oxygen ( see example 3 for assays to determine hydrogenase activity in the presence of oxygen ). in a preferred embodiment , the oxygen - resistant hydrogenase enzyme is hyda1v240w . derivatives of the oxygen - resistant hydrogenases include , for example , oxygen - resistant hyda1 enzymes modified by covalent or aggregative conjugation with other chemical moieties , such as lipids , acetyl groups , glycosyl groups , and the like . oxygen - resistant hydrogenase enzymes of the present invention can be fused to heterologous polypeptides to facilitate purification . many available heterologous peptides allow selective binding of the fusion protein to a binding partner , for example , 6 - his , thioredoxin , hemaglutinin , gst , and the like . polypeptide fragments of the modified oxygen - resistant hydrogenase h 2 - channel polypeptide ( that include the relevant residue modification ) can be used to generate specific anti - oxygen - resistant hydrogenase antibodies ( monoclonal or polyclonal ). generated antibodies can be used to selectively identify expression of oxygen - resistant hydrogenases or in other known molecular and / or biochemical techniques , for example , in immunoprecipitation or western blotting . variant oxygen - resistant hydrogenase enzymes include fusion proteins formed of a oxygen - resistant hydrogenase and a heterologous polypeptide . preferred heterologous polypeptides include those that facilitate purification , stability or secretion . the invention also provides polynucleotide molecules encoding the oxygen - resistant polypeptides of the invention . the polynucleotide molecules of the invention can be cdna , chemically synthesized dna , dna amplified by pcr , rna or combinations thereof . the present invention also provides vectors containing the polynucleotide molecules of the invention , as well as host cells transformed with such vectors . any of the polynucleotide molecules of the invention may be contained in a vector , which generally includes a selectable marker , and an origin of replication , for propogation in a host . the vectors also include suitable transcriptional or translational regulatory sequences , such as those derived from algae operably linked to the oxygen - resistant hydrogenase polynucleotide molecule . examples of such regulatory sequences include transcriptional promoters , operators , enhances , and mrna binding sites . nucleotide sequences are operably linked when the regulatory sequence functionally relates to the dna encoding the target protein . thus , a promoter nucleotide sequence is operably linked to a oxygen - resistant hydrogenase dna sequence if the promoter nucleotide sequence directs the transcription of the oxygen - resistant hydrogenase sequence . selection of suitable vectors for the cloning of oxygen - resistant hydrogenase polynucleotides of the invention will depend on the host cell in which the vector will be transformed / expressed . for example , the plasmid plam91 - 1 ( see fig8 ) was used to create a 980 bp hyda1 psti promoter fragment cloned into a unique psti site of plam91 - 1 , creating the hyda1 promoter - hyda1 cdna fusion construct , pa1ax . the ble r cassette of psp108 confers bleomycin resistance in transformed c . reinhardtii , and was inserted into the tfi1 site of pa1ax , creating pa1axble ( see fig9 ). this was particularly useful in the construction of expression oxygen - resistant [ fe ]- hydrogenase vectors for use in green algae . suitable host cells for expression of target polypeptides of the invention include green algae , for example c . reinhardtii cells and cyanobacteria , both of which utilize water in growth , which is also a substrate for the hydrogenase enzymes . typically , green algae cells are transformed by a glass bead method as is known in the art . cells exhibiting the target selectable marker , for example resistance to bleomycin , are picked and patched onto fresh tap + ble plates and re - patched an additional 2 - 3 times to ensure the isolation of stable integrates . green algal cultures that express oxygen - resistant hydrogenase of the invention may be used to photoproduce h 2 in the presence of oxygen . in one embodiment of the invention , the transformed cells are grown in a photobioreactor photoautotrophically , photoheterotrophically in tap , or other like growth media to a concentration of 5 - 50 μg / ml chlorophyll , and h 2 harvested . note that in some embodiments , the cells are grown under selective pressure that ensures that the cells maintain the oxygen - resistant hydrogenase , for example in bleomycin , where the construct used to transform the host cell confers the selective pressure . in another embodiment , the oxygen - resistant hydrogenase of the invention may be transformed into target algae , under the control of the endogenous hyda1 promoter , for nighttime enzyme generation and daytime h 2 - production . see boichenko et al ., ( 2003 ) photoconversion of solar energy , molecular to global photosynthesis : in press . it is envisioned that the proceeding discussion on the design , engineering , and construction of oxygen - resistant hydrogenases , as well as the subsequent transformation of host cells with the designed hydrogenases , can be expanded to any iron hydrogenase known or identified in the future having the characteristics for iron hydrogenase enzymes discussed herein . having generally described the invention , the same will be more readily understood by reference to the following examples , which are provided by way of illustration and are not intended as limiting . computer modeling of hydrogenase h 2 - channel for design of oxygen - resistant hydrogenase enzymes to facilitate the design and engineering of mutant oxygen - resistant hyda1 enzymes , a theoretical structure of hyda1 was generated by homology modeling to the solved x - ray structure of clostridium pasteuraianum [ fe ]- hydrogenase , cpi ( fig1 b ). the theoretical model was generated by homology modeling using swiss - model software as described by guex et al . guex et al ., ( 1997 ) electrophoresis 18 : 2714 - 2723 . the resulting hyda1 model was subjected to several rounds of energy minimization using gromos . an alignment of the hyda1 and cpi amino acid sequences show they share a high degree of homology ( 45 % identity , 58 % similarity ) within the essential domains , i . e ., active site and h 2 - channel , that comprise the core region of [ fe ]- hydrogenases ( see fig2 ). stothard p ., ( 2000 ) biotechniques 28 ( 6 ) 1102 . note that the degree of conservation increases for h 2 - channel sub - domains , where the two proteins share 62 % identity and 92 % similarity ( fig2 , overhead arrows ). this high level of sequence identity / similarity shows that the cpi - based hyda1 homology model provides a reasonable approximation of the hyda1 structure and the h 2 - channel environment . the detailed study of the hyda1h 2 - channel structure was performed , at least partly , to identify residues that project into the h 2 - channel interior . in general , the channel environment was primarily composed of smaller hydrophobic residues , e . g ., glycine , alanine , valine , with the exception of the larger phenylalanines at positions 252 and 355 ( fig2 , black dotted residues ). the secondary structure of the h 2 - channel was organized into two α - helices and two β - sheets , which extend from the active site to the enzyme surface . the distance between side chain atoms of residues that oppose each other were measured to approximate the average channel diameter over the distance from the catalytic site ( fe 2 - atom of the h - cluster [ 2fe - 2s ]- center ) to the protein surface ( 1 to 4 , fig3 ). the channel measured 3 . 85 to 7 . 44 å in diameter over a distance of 24 to 27 å , making the channel diameter greater than the effective diameters of both h 2 ( 2 . 8 å ) and o 2 ( 3 . 5 å ). as a result , the predicted size of the hyda1 h 2 - channel is sufficient to function in h2 diffusion from the active site to the surface , but it is also large enough to allow for the inward diffusion of the inhibitor o 2 . these results suggest that engineering o 2 tolerance into hyda1 might be accomplished by altering the residues that line the interior of the channel so as to reduce the diameter of the channel and thereby limit o 2 diffusion to the active site . the potential to reduce the diameter of the channel via residue substitution was initially tested in silico by mutating the h 2 - channel of the hyda1 model . the mutagenesis criteria involved conservative mutation , i . e ., hydrophobic → hydrophobic , of specific residues , selection of the lowest energy rotomer , and energy minimization of the resulting structure using gromos . once an energy - minimized structure was obtained , the dimensions of its channel was determined . several of the channel residues proved to be unameanable to mutation and were left unchanged , i . e ., i82 , l89 , f252 and f355 , i . e ., the guex program determined that changes at these locations would provide only minimal ( non - significant ) change to the h 2 - channel diameter / volume . however , promising mutants were generated from alteration of several residues that were spaced over the entire length of the channel ( see fig2 and table 1 ). substantial reductions of channel diameter were obtained by mutating residues a78 and v240 ( proximal to active site ); a244 , a248 and g86 ( mid - channel ); and l93 ( protein - solvent boundary , distal to active site ) to bulkier amino acids ( table 1 and fig3 ). the individual mutations listed in table 1 caused reductions in diameter that ranged from 0 . 5 to 1 . 90 å ( table 2 ). the hyda1 mutant that combined the a248i and l93f mutations located at the channel - solvent boundary ( fig3 , zone 4 ) showed an average decrease in size from 5 . 21 to 3 . 34 å , less than the effective diameter of o 2 ( 3 . 5 å ). when the mutations listed in table 2 were combined into a single hyda1 mutant , the average overall channel diameter was reduced from an average 5 . 71 to an average of 4 . 31 å ( table 2 ), noting however that there are several locations along the h 2 - channel with reductions in the diameter at or near the average diameter of o 2 . the above results indicate that modeling of the hyda1 structure has revealed a hydrophobic channel extending from the active site to the enzyme surface . this channel would appear to be conserved in other [ fe ]- hydrogenases . the channel &# 39 ; s secondary structure is mainly α - helical , which suggests that the channel domain is fairly rigid . perhaps the rigidity of the channel structure helps to prevent its collapse during folding . volbeda et al ., ( 2002 ) int . j . hyd . energy 27 : 1449 - 1461 . rigidity would also be expected to contribute to conformational stability of the channel in the folded protein , and a static model should give reasonable approximations of shape and size . our measurements of the hyda1 channel demonstrate that it is sufficient in diameter not only to allow for diffusion of the product h 2 but also the larger - sized inhibitors o 2 and co . since enzyme inhibition occurs quickly ( minutes ), following exposure of o 2 ( happe et al ., ( 1994 ) eur . j . biochem . 222 : 769 - 774 ), the channel would not appear to be highly restrictive to inhibitor diffusion , which is in agreement with our analysis . this data illustrates the utility of the present invention for engineering o 2 - resistant , [ fe ]- hydrogenase by manipulation of residues within the conserved h 2 channel . this modeling approach can be used in enzymes that have one channel or multiple channels to reduce inhibitor access to an enzyme active site . c . reinhardtii can be transformed with hyda1 h 2 - channel mutants to test the ability of the predicted hyda1h 2 - channel mutants for limiting o 2 inhibition , an algal hyda1 expression system was created using the hyda1 endogenous promoter . from the modeling discussed in example 1 , the v240w mutation was selected for further examination . in vivo expression of the v240w mutant was performed and further testing of the mutant for o 2 resistance hydrogenase activity performed . note that the v240w mutation is predicted to cause a constriction of the channel near the active site ( see fig4 ). in addition , the tryptophan projects over the fe 2 - atom , partially shielding it from the channel domain . the chlamydomonas reinhardtii strain cc849 ( cw10 , mt -) was used as the wild type parent strain throughout the remainder of this example . growth of liquid cultures were performed photoheterotrophically in tap medium ( harris e , ( 1989 ) the chlamydomonas source book , academic press , new york ) with a continuous stream of 5 % co 2 under cool - white fluorescent light ( 150 μe / m − 2 / s − 1 par ). growth on solid medium was performed on tap agar plates ( tap medium with 1 . 4 % w / v agar ). note that when selection of bleomycin resistance was performed , solid tap medium was supplemented with 10 μg / ml zeocin ( invitrogen ). a plasmid construct plam91 - 1 , containing the hyda1 cdna and 3 ′- terminator regions cloned into the ecori - xhoi sites of pbluescript sk , was used to generate an algal hyda1 expression construct . a 980 bp hyda1 psti promoter fragment was cloned into the unique psti site of lam91 - 1 , creating the hyda1 promoter - hyda1 cdna fusion construct , pa1ex . the ble r cassette of psp108 that confers bleomycin resistance in transformed c . reinhardtii ( stevens et al ., ( 1996 ) mol gen genet . 251 : 23 - 30 ) was inserted into the tfii site of pa1ex , creating pa1exble . site - directed mutagenesis was performed on hyda1 to generate hyda1 mutants for expression in c . reinhardtii . the hyda1 gene pa1exble was mutagenized in vitro using the quick change xl site - directed mutagenesis kit of stratagene . oligonucleotides ( integrated dna technologies ) used for mutagenesis were designed based on the kit requirements . mutant pa1exble constructs were sequenced to confirm the presence of individual mutations . the hyda1 mutant , v240w , contains a valine to tryptophan substitution at amino acid position 240 of the mature protein . c . reinhardtii cells were next transformed by the glass bead method as is known in the art ( see also harris e ) using 10 μg of linearized pa1exblev240w dna . following transformation , cells were cultured overnight in 2 ml of tap medium to allow for cell recovery and phenotypic expression of ble r . transformed cells were harvested by centrifugation ( 2000 × g , 5 minutes ), resuspended in 1 . 5 ml tap soft agar ( tap with 0 . 8 % w / v agar ) and spread onto tap + ble agar plates . plates were incubated in the light for a period of 1 - 2 weeks and ble r colonies picked . resistant colonies were patched onto fresh tap + ble plates , and re - patched an additional 2 - 3 times to ensure the isolation of stable integrates . to ensure that the hyda1 cdna genomic insert having the v240w mutation was present in the transformed c . reinhardtii , pcr and sequencing was performed on ble r transformants . total genomic dna was isolated from individual ble r transformants using the plant genomic kit ( qiagen ). a total of 0 . 5 to 1 . 0 μg of purified genomic dna was digested with either saci or ecori and used as template in a pcr reaction consisting of the hyda1 internal primers ( 5 ′- cacgctgtttggcatcgacctgaccatcatg - 3 ′ and 5 ′- gccacggccacgcggaatgtgatgccgcccc - 3 ′), 1 unit kod hotstart polymerase ( novagen ), 10 mm mgso4 , 25 mm of each dntp , 2 % dmso ( v / v ), and water to a total volume of 50 μl . the presence of a hyda1 cdna genomic insert results in an additional 780 bp hyda1 cdna product together with the 1120 bp hyda1 genomic product . pcr reactions were run on 1 × tae agarose gels ( 1 . 25 % agarose w / v ), stained with ethidium bromide , and photographed ( not shown ). the 780 bp band , corresponding to the hyda1 cdna insert , was purified and sequenced to confirm the presence of v240w mutation . two ble r c . reinhardtii clones , mt18 and mt28 , were shown to possess the hyda1v240w construct ( see fig5 ). green alga , c . reinhardtii , transformed with oxygen - resistant hydrogenases are effective in the bulk production of h 2 the o 2 - sensitivity of [ fe ]- hydrogenase activity in strains mt18 and mt28 carrying the hyda1v240w mutation was tested in either whole cells or whole cell extracts of anaerobically induced cultures . hydrogenase activities were measured as h 2 gas photoproduction by whole cells as previously described . ghirardi et al ., ( 1997 ) app . biochem . biotech . 63 - 65 : 141 - 151 ; flynn et al ., ( 2002 ) int . j . hyd energy 27 : 1421 - 1430 . briefly , cells were grown photoheterotrophically in tap to a concentration of 15 - 20 μg / ml chlorophyll , harvested and resuspended at 200 μg / ml chlorophyll in phosphate induction buffer . ghirardi et al . clark electrode measurement of o2 - resistant hydrogenase activity was performed by adjusting the o 2 concentration in the electrode chamber to a set level between 0 % and 4 %. once the o 2 level had stabilized , a stream of ar gas was passed over the chamber to maintain a constant o2 concentration . a 0 . 2 ml sample of induced cell suspension was injected into the chamber , and the cells kept in the dark for a two minute period . light dependent h 2 - photoproduction activity was then induced by illumination . in addition , to measure hydrogenase activity directly , reduced methyl viologen ( mv ) was used as an artificial electron donor for h 2 production by solubilizing whole cells as previously described . flynn et al . tolerance to o 2 was measured by incubating 1 ml of induced cells in a dark , sealed glass bottle and injecting o 2 to achieve a final atmosphere of 1 to 4 % ( v / v ). samples were incubated for two minutes then purged with ar gas for five minutes . a 1 ml mixture of reduced mv and triton x - 100 in a phosphate buffer was added , samples were mixed for three to five minutes , and 0 . 1 ml of 100 mm reduced na - dithionite injected to start the reaction . the reaction mixtures were incubated for 30 minutes at room temperature with stirring , and reactions were stopped by the addition of 0 . 1 ml 20 % trichloroacetic acid ( tca ). the hydrogen content of a 0 . 2 ml headspace sample was measured by gas chromatograph . three separate headspace samples were assayed , and the values were averaged to attain final hydrogen - production rates . as shown in table 3 , all three strains , cc849 , mt18 , and mt28 , exhibited similar levels of hydrogenase activity ( rate of h 2 photoproduction ) under completely anaerobic conditions . note that as has been shown in previous studies ( ghirardi et al , supra ; flynn et al , supra ), pretreatment of induced wild type cells with o 2 is sufficient to cause a significant decline in h2 production rate ( fig6 , white bars ). when induced wild - type cells were pre - treated with o2 at a concentration of 1 . 7 to 3 . 5 %, the h2 photoproduction rate declined by 90 to 100 % respectively . however , the exposure of mt18 or mt28 induced cells to similar o2 treatments showed h2 photoproduction activity had significant resistance to inactivation . after exposure to 1 . 7 to 2 . 2 % o 2 concentrations , the h 2 photoproduction rates remained 3 . 8 to 7 fold higher in mt18 , and 3 . 2 to 13 fold higher in mt28 compared to activities in wild - type cells under identical conditions ( see fig6 ). at 3 . 5 % o 2 treatment , the h2 photoproduction rates in both mt18 and mt 28 were low , but detectable , whereas residual activity in wild - type cells was undetectable ( fig6 ). the light - induced production of hydrogen by whole cells is a metabolic process and depends on many electron transfer steps . zhang et al ., ( 2000 ) trends biotech . 18 ( 12 ): 506 - 511 ; melis et al ., ( 2001 ) plant physiol . 127 : 740 - 748 ; melis et al ., ( 2000 ) plant physiol . 122 : 127 - 135 . a more direct measurement of hydrogenase activity can be accomplished in solubilized whole cells using reduced mv ( mv red ) as electron donor for h2 gas production by hydrogenase in the dark . under completely anaerobic conditions , the mv red → h 2 reaction rates were similar in value for either induced wild - type or mutant cells ( see table 4 ). as shown in fig7 , a two - minute exposure of induced wild - type to various o 2 concentrations caused hydrogenase activity to decline . after exposure of o 2 concentrations of 1 % to 4 % hydrogenase activities in wild - type cells decreased to between 10 and 1 . 5 % respectively ( fig7 ), similar to the results shown in fig6 . in comparison , both mt16 and mt28 containing the hyda1v240w construct exhibited significant levels of o 2 resistant hydrogenase activity ( see fig7 ). exposure of mt18 to o 2 at 1 % to 4 % concentration caused hydrogenase activities to decline by 76 % to 96 %, whereas mt28 activities declined only 12 % to 76 % ( fig7 ). as a result , mt18 hydrogenase activities were 2 - to 3 - fold higher , and mt28 activities 8 - to 15 - fold higher than activities in wild - type cells after exposure to similar o 2 treatments . this example illustrated the utility of modeling residue substitutions within the h 2 - channel to constrict the channel from o 2 passage to the [ 2fe - 2s ]- center . in particular , the example illustrated that substitution of tryptophan for valine at position 240 of hyda1 caused an increase tolerance to o 2 in the mutant hydrogenase . the difference in the structure change made to hyda1v240w and the effects of that change are similar to the observed differences in structure and o 2 - resistance of h 2 - sensing [ nife ]- hydrogenases compared to catalytic [ nife ]- hydrogenases . volbeda et al ., ( 2002 ) int . j . hyd . energy 27 : 1449 - 1461 ; bernhard et al ., ( 2001 ) 276 : 15592 - 15597 . active - site proximal channel residues of o 2 - resistant , h 2 - sensing [ nife ]- hydrogenases contain the bulky , hydrophobic amino acids isoleucine and phenylalanine . identical positions in the o 2 - sensitive , catalytic [ nife ]- hydrogenases encode the smaller - sized residues valine and leucine respectively . the difference in amino acid composition is suggested to result in the shielding of the [ nife ]- cluster and constriction of the channel . volbeda supra and bernhard supra . the invention has been described with reference to specific examples . these examples are not meant to limit the invention in any way . it is understood for purposes of this disclosure , that various changes and modifications may be made to the invention that are well within the scope of the invention . numerous other changes may be made which will readily suggest themselves to those skilled in the art and which are encompassed in the spirit of the invention disclosed herein and as defined in the appended claims . this specification contains numerous citations to patents and publications . each is hereby incorporated by reference in their entirety for all purposes . | 2 |
the present invention is concerned with light emitting devices and to a manner of non - contact pumping of light emitters by non - radiative energy transfer . the present invention is further concerned with light emitting devices including semiconductor nanocrystals . a “ noncontact ” approach to carrier injection into ncs has now been developed using förster - type non - radiative energy transfer ( et ) from a proximally situated primary light source such as an epitaxial quantum well ( qw ). since et relies on coulomb interactions rather than a direct wavefunction overlap , it is not significantly inhibited by any nc capping layer , and can potentially allow for an efficient energy flow from such a qw to ncs . in an optimal device , the qw can be pumped electrically in the same way a common qw light emitting diode is pumped . however , in the initial experiments , pulsed optical excitation was intentionally used in order to study the dynamics of et as well as the dynamics of other competing processes such as carrier recombination in the qw . non - radiative energy transfer ( also called förster - type or resonant energy transfer ) is a process in which excitation energy is transferred from a donor to an acceptor as a result of near - field dipole - dipole interaction . the process can be highly efficient at short distances between the donor and acceptor and falls off very rapidly with increasing donor - acceptor separation . non - radiative energy transfer also requires spectral overlap of the donor emission with the acceptor absorption , but does not involve the emission of a photon by the primary light source . as used herein , the term “ nanocrystal ” refers to particles less than about 150 angstroms in the shortest axis , and preferably from about 10 to about 150 angstroms . also , within a particularly selected semiconductor nanocrystal , the semiconductor nanocrystals are substantially monodisperse , i . e ., the particles have substantially identical size and shape . the semiconductor nanocrystals are generally members of a crystalline population having a narrow size distribution . in preferred embodiments , the semiconductor nanocrystals are characterized by a size distribution in rms of less than about 10 percent . the shape of the semiconductor nanocrystals can be a sphere , a rod , a disk and the like . in one embodiment , the semiconductor nanocrystals include a core of a binary semiconductor material , e . g ., a core of the formula mx , where m can be cadmium , zinc , mercury , aluminum , lead , tin , gallium , indium , thallium , magnesium , calcium , strontium , barium , copper , and mixtures or alloys thereof and x is sulfur , selenium , tellurium , nitrogen , phosphorus , arsenic , antimony or mixtures thereof . in another embodiment , the semiconductor nanocrystals include a core of a ternary semiconductor material , e . g ., a core of the formula m 1 m 2 x , where m 1 and m 2 can be cadmium , zinc , mercury , aluminum , lead , tin , gallium , indium , thallium , magnesium , calcium , strontium , barium , copper , and mixtures or alloys thereof and x is sulfur , selenium , tellurium , nitrogen , phosphorus , arsenic , antimony or mixtures thereof . in another embodiment , the semiconductor nanocrystals include a core of a quaternary semiconductor material , e . g ., a core of the formula m 1 m 2 m 3 x , where m 1 , m 2 and m 3 can be cadmium , zinc , mercury , aluminum , lead , tin , gallium , indium , thallium , magnesium , calcium , strontium , barium , copper , and mixtures or alloys thereof and x is sulfur , selenium , tellurium , nitrogen , phosphorus , arsenic , antimony or mixtures thereof . examples include cadmium sulfide ( cds ), cadmium selenide ( cdse ), cadmium telluride ( cdte ), zinc sulfide ( zns ), zinc selenide ( znse ), zinc telluride ( znte ), mercury sulfide ( hgs ), mercury selenide ( hgse ), mercury telluride ( hgte ), aluminum nitride ( aln ), aluminum sulfide ( als ), aluminum phosphide ( alp ), aluminum arsenide ( alas ), aluminum antimonide ( alsb ), lead sulfide ( pbs ), lead selenide ( pbse ), lead telluride ( pbte ), gallium arsenide ( gaas ), gallium nitride ( gan ), gallium phosphide ( gap ), gallium antimonide ( gasb ), indium arsenide ( inas ), indium nitride ( inn ), indium phosphide ( inp ), indium antimonide ( insb ), thallium arsenide ( tlas ), thallium nitride ( tin ), thallium phosphide ( tip ), thallium antimonide ( tlsb ), zinc cadmium selenide ( zncdse ), indium gallium nitride ( ingan ), indium gallium arsenide ( ingaas ), indium gallium phosphide ( ingap ), aluminum indium nitride ( alinn ), indium aluminum phosphide ( inalp ), indium aluminum arsenide ( inalas ), aluminum gallium arsenide ( algaas ), aluminum gallium phosphide ( algap ), aluminum indium gallium arsenide ( alingaas ), aluminum indium gallium nitride ( alingan ) and the like , mixtures of such materials , or any other semiconductor or similar materials . the preferred semiconductor nanocrystals are from the group of zns , znse , znte , cds , cdse , cdte , pbs , pbse and pbte . additionally , the core of semiconductor material can have an overcoating on the surface of the core . the overcoating can also be a semiconductor material , such an overcoating having a composition different than the composition of the core . the overcoat on the surface of the semiconductor nanocrystals can include materials selected from among group ii - vi compounds , group ii - v compounds , group iii - vi compounds , group ill - v compounds , group iv - vi compounds , group i - iii - vi compounds , group ii - iv - v compounds , and group ii - iv - vi compounds . examples include cadmium sulfide ( cds ), cadmium selenide ( cdse ), cadmium telluride ( cdte ), zinc sulfide ( zns ), zinc selenide ( znse ), zinc telluride ( znte ), mercury sulfide ( hgs ), mercury selenide ( hgse ), mercury telluride ( hgte ), aluminum nitride ( aln ), aluminum phosphide ( alp ), aluminum arsenide ( alas ), aluminum antimonide ( alsb ), gallium arsenide ( gaas ), gallium nitride ( gan ), gallium phosphide ( gap ), gallium antimonide ( gasb ), indium arsenide ( inas ), indium nitride ( inn ), indium phosphide ( inp ), indium antimonide ( insb ), thallium arsenide ( tlas ), thallium nitride ( tin ), thallium phosphide ( tip ), thallium antimonide ( tlsb ), lead sulfide ( pbs ), lead selenide ( pbse ), lead telluride ( pbte ), zinc cadmium selenide ( zncdse ), indium gallium nitride ( ingan ), indium gallium arsenide ( ingaas ), indium gallium phosphide ( ingap ), aluminum indium nitride ( alinn ), indium aluminum phosphide ( inalp ), indium aluminum arsenide ( inalas ), aluminum gallium arsenide ( algaas ), aluminum gallium phosphide ( algap ), aluminum indium gallium arsenide ( alingaas ), aluminum indium gallium nitride ( alingan ) and the like , mixtures of such materials , or any other semiconductor or similar materials . the overcoating upon the core material can include a single shell or can include multiple shells for selective tuning of the properties . the multiple shells can be of differing materials . the semiconductor nanocrystals can be dispersed within a suitable host material . the host matrix may be any material in which the semiconductor nanocrystals may be dispersed in a configuration in which they may be illuminated by the primary light source . some examples of host matrix materials are polymers such as polystyrene , polyimide , or epoxy , as well as silica glasses , titania glasses , silica sol - gels or titania sol - gels . for the non - radiative energy transfer contemplated by the present invention , the semiconductor nanocrystals are situated within a close proximity of the primary light source , a distance generally less than about 15 nanometers ( nm ), preferably from about 1 to about 10 nm . in another aspect of the invention , the light emitting material can be any material , e . g ., an organic light emitting molecule or organic light emitting polymer having fluorescent properties , including , but not limited to , molecules such as an aluminum quinolinol complex ( generally abbreviated alq 3 ) or derivative thereof , benzoxazole materials , and benzothiazole materials , or polymers such as substituted and unsubstituted forms of conjugated polymers such as poly ( p - phenylene vinylene ), poly ( silyl - phenylene vinylene ), poly ( thienylene vinylene ), poly ( naphthalene vinylene ), poly ( quinoline vinylene ), poly ( pyridine vinylene ), poly ( fluorene ), poly ( thiophene ), derivatives thereof and the like . in a device of the present invention , a light source can include a primary light source and semiconductor nanocrystals as secondary phosphors . the semiconductor nanocrystals can convert the entire or part of the primary emission ( from the primary light source ) to emission having a wavelength output from the semiconductor nanocrystals . in the present invention , the conversion process relies on non - radiative ( resonant ) energy transfer , which is efficient for the small separation between the primary light source ( donor ) and the semiconductor nanocrystals or secondary phosphors ( acceptors ). the primary light source can be a semiconductor light emitting diode ( led ), a laser diode ( ld ), an organic light emitting diode ( oled ) or may be other types of semiconductor nanocrystals . the primary light source can be either electrically pumped , optically pumped or both . the semiconductor nanocrystals or secondary phosphors can be either mono - disperse in size for narrow band ( single pure color ) emission or polydisperse in size for multicolor or white light emission . by mono - disperse is generally meant that the semiconductor nanocrystals are characterized by a size distribution in root mean square ( rms ) deviation in diameter of less than about 10 percent . the semiconductor nanocrystals or secondary phosphors can either emit in the spontaneous emission regime or in the stimulated emission regime as a laser . an exemplary device is schematically depicted in fig1 . it consists of an ingan qw 10 on top of which was assembled a close - packed monolayer 14 of highly monodisperse cdse / zns core / shell ncs using the langmuir - blodgett ( lb ) technique . the ncs are synthesized as described in dabbousi et al ., j . phys . chem ., 101 , 9463 - 9475 ( 1997 ) and are comprised of a cdse core ( radius r = 1 . 9 nm ) overcoated with a shell of zns ( about 0 . 6 nm thickness ), followed by a final layer of the organic molecules of trioctylphosphine ( top ) and trioctylphosphine oxide ( topo ). either colloidal nanocrystals or nanocrystals epitaxially grown on a substrate can be used in the present invention . fig2 shows the emission of the qw 22 spectrally overlaps with the absorption 24 of the ncs . for cdse ncs with 1 . 9 nm radius , the emission wavelength 20 is around 575 nm . these ncs show efficient emission centered near 575 nm and a structured absorption spectrum with the lowest is absorption maximum at about 560 nm . qw samples were grown on sapphire substrates by metal - organic chemical vapor deposition by the process described by koleske et al ., appl . phys . lett ., 81 , 1940 - 1942 ( 2002 ). the qw samples consist of a 20 nm gan nucleation layer , a 3 μm gan bottom barrier and a 3 nm ingan qw that is either terminated with a 3 nm gan top barrier ( capped qw ) or remains uncapped ( uncapped qw ). the concentration of indium in the qws was 5 - 10 %, which corresponds to an emission wavelength 22 about 400 nm ( fig2 ). this wavelength is in the range of strong nc absorption , which provides strong coupling of qw excitations to the absorption dipole of ncs and should allow efficient et . to study et dynamics , the temporal evolution of pl in the qw and the ncs was monitored using a time correlated single - photon counting system that provides about 30 ps time resolution . the hybrid qw / nc structures were excited at 266 nm by 200 fs pulses of the frequency tripled output of an amplified ti : sapphire laser . the emission from either the qw or the ncs was selected using a monochromator . the dynamics measured for qw / nc hybrid structures were compared with those in isolated qws and isolated nc monolayers assembled on glass substrates . all measurements were performed at room temperature . the interactions between the qw and the nc monolayer can be described in terms of a resonant förster - type et ( similar to that used by basko et al ., eur . phys . j . b , 8 , 353 - 362 ( 1999 ) to describe et between a qw and a layer of organic molecules ). the et rate per qw carrier is strongly dependent on whether electrons and holes are free or bound by coulomb interactions into excitons . in the case of excitons , the et rate is independent of the density of qw excitations ( n eh ), while in the free - carrier case , the et rate is proportional to n eh ( see supplementary information below ). to experimentally distinguish between these two cases , the excitation density dependence of pl in an isolated qw at t = 0 ps ( fig3 ) was measured . it was observed that at low pump powers this dependence was quadratic , and it saturated at high excitation densities . the quadratic growth of pl was characteristic of free - carrier bimolecular recombination , indicating that the electron - hole ( e - h ) interactions in these qw samples were not sufficiently strong to produce bound exciton states at room temperature . the pl dynamics in the qw ( inset in fig3 ) were also monitored and it was observed that the pl decay was exponential and was characterized by a time constant range of 0 . 6 - 1 ns that was independent of pump power . this result indicates that the decay of photoexcited carriers is dominated not by radiative recombination ( characterized by the density - dependent time constant τ ∝ 1 / n eh ) but by trapping at defects , as is typically observed for ingan qws at room temperature . after establishing that qw excitations were unbound electron - hole ( e - h ) pairs , the et rate , γ et , per qw carrier could be analyzed using the following expression ( see supplementary information below ): γ et = 8 π 2 3 ɛ 2 μ nc 2 μ qw 2 n nc n eh n nc ( ℏ ω qw ) 1 d 4 ℏ 2 2 mk b t ∫ 0 ∞ κ 3 exp ( - 2 κ - ℏ 2 κ 2 2 mk b td 2 ) ⅆ κ , ( 1 ) in which ε is the dielectric constant , μ nc and μ qw are the transition dipole moments for the nc and the qw , respectively , n nc is the surface density of ncs , n nc ({ overscore ( h )} ω qw ) is the nc density of states at the qw emission energy , d is the separation between the centres of the qw and the nc monolayer , m is the sum of electron and hole masses in the qw , and t is the temperature . assuming that the length of nc passivating molecules is 1 . 1 nm , values for d of 8 . 1 and 5 . 1 nm were obtained for capped and uncapped qws , respectively , which further results in transfer rates of 1 . 05 ns − 1 ( capped qw ) and 5 . 8 ns − 1 ( uncapped qw ) at a qw carrier density of 1 . 8 × 10 13 cm − 2 . these estimated et rates are sufficiently high to compete with carrier decay rates ( about 1 ns − 1 ) measured experimentally for the qw samples . to directly measure the qw - to - nc et rates , comparative , time - resolved pl studies were performed for hybrid qw / nc structures and isolated qws . it was observed that the presence of the nc layer adjacent to the qw significantly altered the qw pl dynamics ( see fig4 ( a )). namely , the qw pl decay became faster in the presence of ncs , indicating an additional relaxation channel for qw excitations , which is most likely due to qw - to - nc et . this nc - induced change in qw dynamics became more pronounced with increasing carrier density ( e . g ., compare traces shown by solid and dashed lines in fig4 ( a )). to quantify this increase , in fig4 ( b ) the additional initial decay rate δγ = γ qw w / nc − γ q w / o nc was plotted as a function of n eh for structures based on uncapped ( squares ) and capped ( circles ) qws . it was observed that in both cases the δγ growth was linear with n eh , but absolute values of δγ were approximately 4 . 4 times greater for the uncapped qws compared to qws with a top barrier . both of these observations are consistent with the fact that the additional decay rate δγ is due to qw - to - nc et . förster modelling [ eq . ( 1 )] predicts that for the free - carrier case the et rate should increase linearly with n eh , which is exactly the dependence observed experimentally . furthermore , the increase in the transfer rate in the case of the uncapped qw is consistent with its strong dependence on the et distance ( γ et ˜ d − 4 ). from the geometrical parameters of the present system it is estimated that the d dependence should result in a 5 . 5 increased et rate , which agrees well with the factor of 4 . 4 observed experimentally . further evidence for efficient qw - to - nc et is provided by the analysis of the pl from the nc layer . the et - induced outflow of carriers from the qw should result in a corresponding increase in the emission of the ncs . in the present experimental configuration , however , optical pumping directly generates carriers not only in the qw but also in the ncs . therefore , in order to extract the et - induced increase in the nc pl , a side - by - side comparison of pl data was performed for hybrid qw / nc structures and an nc lb monolayer assembled on a glass slide . one such set of data plotted as temporally integrated nc pl intensity vs . pump fluence is displayed in fig4 ( c ). to account for the difference in the nc packing densities for lb films assembled on the qw and the glass slide , a constant scaling factor was introduced which allows matching of pl intensities detected from qw / nc and glass / nc samples at low pump powers , for which et from the qw is negligible . the data indicate that at low pump fluences , both types of samples show a similar pl pump dependence . however , two traces show distinctly different behavior at higher pump fluences , for which et starts to play a significant role ( see fig4 ( b )). while emission from the isolated nc layer saturates at about 20 μj / cm 2 , the nc pl in the hybrid structure shows a steady growth until about 80 μj / cm 2 . as a result of this delayed saturation , the maximum nc pl intensity achievable with the qw / nc structure is 4 times greater than the pl for the nc monolayer on the glass slide . all of these results indicate a strong additional carrier inflow into ncs as a result of et from the qw . fig5 ( a ) displays the schematics of et along with other relaxation processes in the hybrid qw / nc structures studied in this work . following photoexcitation , carrier thermalization , and cooling , the thermal distribution of free electrons and holes is established in the qw . qw carriers can decay either radiatively ( time constant τ rr ) or nonradiatively τ nr ), or experience et ( τ et ) into a nc . carriers generated in the nc via resonant qw - to - nc et have significant access energies as measured with respect to the nc band - gap . extremely fast intraband relaxation in ncs ( sub - ps time scales ) rapidly removes carriers from resonance with the qw transition and prevents backtransfer . in well - passivated ncs , relaxed e - h pairs recombine primarily radiatively with a time constant of about 20 ns , emitting a photon with an energy that is determined by the nc size . the efficiency of nonradiative qw - to - nc et ( η et ) can be estimated from the expression : η et = τ r ( τ et + τ r ) − 1 , in which τ r =( 1 / τ rr + 1 / τ nr ) − 1 is the relaxation time of qw excitations due to both radiative and nonradiative process . the experimental results for the uncapped sample indicate that τ r ≈ 0 . 6 ns and τ et ≈ 0 . 5 ns ( for n eh = 1 . 8 × 10 13 cm − 2 ), which yields η et as high as 55 %. it is believed that that nearly 100 % efficiencies can be achieved by improving the quality of the qws ( to reduce nonradiative losses ) and / or by optimizing the geometry of the nc - qw structure ( by using , e . g ., shorter nc surface passivation molecules ). it is interesting that despite the additional step in the et process , the pl qy of the hybrid qw / nc device ( qy qw / nc ) can be greater than the original qy of the qw ( qy qw ). qy qw / nc can be estimated from the expression qy qw / nc = qy nc ( 1 + τ et / τ r ) − 1 , where qy nc is the pl qy of the ncs . this expression indicates that if τ et & lt ;& lt ; τ r the quantum efficiency of the hybrid structure approaches that of ncs . this conclusion further means that even the use of ingan qws with poor room temperature qys can produce highly efficient hybrid devices . it is illustrative to compare the efficiency of et measured here with that expected for radiative et ( η ret ). the latter process is used in the traditional colour - conversion scheme and is based on the emission of a photon from a qw followed by absorption / re - emission steps in the phosphor material ( e . g ., ncs or other phosphors such as organic dyes ). for a close - packed nc monolayer , η ret can be estimated from the ratio of the nc absorption cross section to its geometrical cross section , which yields η ret & lt ; 0 . 3 %. this value is at least two orders of magnitude smaller than the efficiencies measured experimentally , indicating that the use of nonradiative et can significantly improve the performance of color - conversion devices . in addition to applications as efficient color converters , ncs have been considered promising building blocks for color - selectable optical gain media in lasing applications . one complication associated with lasing applications of ncs is the requirement for extremely fast pumping that competes with non - radiative auger recombination leading to very short ( picosecond ) optical gain lifetimes . so far optical amplification and lasing in ncs has been achieved using optical excitation with short laser pulses . estimations show that the “ et pumping ” scheme studied here provides carrier inflow that can in principle compete with nonradiative losses induced by auger recombination . the et rate of about 2 ns − 1 measured for the uncapped qw sample for n eh = 1 . 8 × 10 13 cm − 2 results in the qw - to - nc carrier flux of about 3 . 6 × 10 22 cm − 2 s − 1 . for the ncs of 1 . 9 nm radius as described here , the auger recombination time is about 50 ps , which corresponds to a non - radiative carrier loss of 4 × 10 22 cm − 2 s − 1 for a close - packed monolayer . the latter value is comparable to the carrier inflow rate provided by et from the qw , indicating the feasibility of lasing in the et pumping regime . while only optically pumped devices have been studied , it should be possible to realize the et pumping scheme in the regime of electrical injection by combining ncs 56 with an electrically driven gainn qw . the design of the qw emitter in the “ et color - converter ” ( see fig5 ( b )) can be similar to that used in conventional gainn light emitting diodes , in which the qw 50 is sandwiched between n and p doped gan barriers 52 and 54 with attached metal contacts . these preliminary studies indicate that fabrication of high mobility ( about 200 cm 2 v − 1 s − 1 ), thin ( 2 - 3 nm ), n - doped gan layers that can be used as top qw barriers ( adjacent to ncs ) in electrically powered devices can be constructed . the direct comparison of pl dynamics in ncs assembled on glass slides and n - doped gan layers ( up to 2 × 10 19 cm − 3 doping level ) do not show any noticeable quenching of nc emission in the presence of a proximal doped semiconductor . furthermore , the doping of the barriers is not expected to induce additional carrier losses in the qw . all of these considerations strongly indicate the feasibility of high - efficiency , electrically driven , hybrid nc / qw devices . fig6 shows a device with an injection layer 60 including colloidal nanocrystals embedded in a semiconductor material 62 . various size of the semiconductor nanocrystals 62 , 64 and 66 yield differing colors of light output . the approach to calculating the energy transfer ( et ) rate , γ et , between a semiconductor quantum well ( qw ) and a monolayer of semiconductor nanocrystals ( ncs ) is conceptually similar to that used by basko et al . to describe et between the qw and a layer of organic molecules . the förster process transfers an electron - hole ( e - h ) excitation from the qw to the nc via electrostatic interactions that we describe in the dipolar approximation . the transition rate is calculated using the fermi golden rule , in which the summation is performed over the final states in the nc monolayer and the qw initial states weighted using the thermal distribution function . the two cases that correspond to two different types of excitations in the qw : coulombically bound e - h pairs ( excitons ) and free electrons and holes are distinguished between as follows . first , et in the excitonic regime : the qw exciton envelope function is presented as a product of the functions that describe the centre - of - mass ( cm ) motion and the relative ( rel ) motion : ψ ( r e , r h ) = ψ cm ( r cm ) ψ rel ( r rel ) , with ψ cm ( r cm ) ∝ ⅇ ⅈ kr cm and ψ rel ( r ) ∝ ⅇ - r a b , where k is the centre - of - mass momentum and α b is the exciton bohr radius . to calculate the förster transfer rate , the boltzman distribution of qw excitons is assumed , which yields : γ et exc = 16 π 3 ɛ 2 μ nc 2 μ qw 2 n nc 1 a b 2 n nc ( ℏ ω qw ) 1 d 4 ℏ 2 2 mk b t ∫ 0 ∞ κ 3 ⅇ - 2 κ - ℏ 2 κ 2 2 mk b td 2 ⅆ κ , ( 1 ) where ε is the effective dielectric constant ( see below ), μ nc and μ qw are the transition dipole moments for the ncs and the qw , respectively , n nc is the surface density of ncs , n nc ({ overscore ( h )} ω qw ) is the nc density of states at the qw emission energy , d is the separation between the centres of the qw and the nc monolayer , m is the sum of electron and hole masses in the qw , and t is the temperature . second , et in the free - carrier regime : in the free - carrier case , qw electrons and holes are described by plane waves and follow the same procedure as the one described above to calculate the et rate . at sufficiently high temperatures , which correspond to a nondegenerate electron / hole gas , it is found that : γ et e - h = 8 π 2 3 ɛ 2 μ nc 2 μ qw 2 n nc n eh n nc ( ℏ ω qw ) 1 d 4 ℏ 2 2 mk b t ∫ 0 ∞ κ 3 ⅇ - 2 κ - ℏ 2 κ 2 2 mk b td 2 ⅆ κ , ( 2 ) the important difference between eqs . ( 1 ) and ( 2 ) is that in the excitonic case the et rate is independent of n eh , whereas in the free - carrier case it is proportional to n eh . from photoluminescence ( pl ) studies of isolated qws , it was concluded that the qw excitations at room temperature can be described in terms of free ( unbound ) e - h pairs . using eq . ( 2 ), et rates of 1 . 05 ns − 1 ( capped qw ) and 5 . 8 ns − 1 ( uncapped qw ) were obtained for the following set of parameters : ε = 3 . 6 [ the value of the effective dielectric constant is obtained by averaging the high frequency dielectric constant of gan ( ε = 6 . 2 ) and the dielectric constant of air ( ε = 1 )], μ nc = 25 debye ( as in crooker et al ., “ spectrally resolved dynamics of energy transfer in quantum - dot assemblies : towards engineered energy flows in artificial materials ”, phys . rev . lett . 89 , 186802 ( 2002 )), μ qw = 14 debye ( as in lawaetz , “ valence - band parameters in cubic semiconductors ”, phys . rev . b 4 , 3460 ( 1971 )) n nc = 2 × 10 12 cm − 2 ( determined for a close - packed monolayer of ncs with r total = 3 . 6 nm ), n eh = 1 . 8 × 10 13 cm − 2 , n nc ({ overscore ( h )} ω qw )= 17 . 3 ev − 1 ( determined from the measured nc absorption spectra ), m e = 0 . 2 m 0 , m h = 0 . 8 m 0 , t = 293 k , d = 5 . 1 nm ( uncapped qw ) and d = 8 . 1 nm ( capped qw ). although the present invention has been described with reference to specific details , it is not intended that such details should be regarded as limitations upon the scope of the invention , except as and to the extent that they are included in the accompanying claims . | 1 |
in order to provide a clear and consistent understanding of the specification and claims , including the scope to be given such terms , the following definitions are provided . any terms that are not specifically defined in this or other sections of this patent application have the ordinary meaning they would have when used by one of skill in the art to which this invention applies at the time of the invention . as used herein , all temperatures are in degrees celsius (° c . ), unless otherwise specified . as used herein , human trabecular meshwork or htm cells include all cells of the trabecular meshwork [ tm ]. it may include all cells that play an active role in the intraocular fluid outflow or exit pathway , including but not limited to those from the juxtacanalicular and corneoscleral region of the trabecular meshwork of the eye as well as schlemm &# 39 ; s canal cells . as used herein , the choices of cell sources of htm cells can be various including but not limited to htm cells from cell lines , primary htm cells isolated from tissues , htm cells derived from stem cells ( e . g ., embryonic stem cells , adult stem cells , induced pluripotent stem cells ), and genetically engineered cells . choices of htm cells may include epithelial cells , epidermal cells , endothelial cells , smooth muscle cells , stromal cells , neural cells , stem cells , but are not necessarily limited to the htm cell types listed herein . as used herein , primary htm cells are cells derived from living tissue . as used herein , intraocular fluid , may also mean aqueous humor ; and intraocular fluid pathway or intraocular outflow pathway or intraocular exit pathway may also mean aqueous humor pathway or aqueous outflow pathway or aqueous humor outflow . these terms will be used interchangeably herein . as used herein , human means any mammal including but not limited to humans , and animals , e . g ., rhesus monkeys , other monkeys , sheep , pigs , rabbits , rats , and mice . as used herein , substrate means a material subjected to micro - and / or nanofabrication for example su - 8 or any material including but not limited to polymeric , ceramic , metallic , semiconductor , composite material . as used herein , scaffold , 3 - dimensional ( 3 - d ) micro - and nanostructured scaffold , or su - 8 scaffold may mean a micro - or nanopatterned material , micro - or nanofabricated material , micro - or nanoporous materials , or their hybrid for example a porous su - 8 scaffold or any material which responds to appropriate fabrication and htm biocompatible coating techniques known to those skilled in the art by achieving desired properties of supporting desired 3 - d htm cell and schlemm &# 39 ; s canal [ sc ] cell growth and attachment , which may include macroporous , flexible , free - standing , synthetic or natural biomaterial scaffolds and their hybrids . the scaffold may include a biocompatible , epoxy - based , negative tone photoresist that can be micro - or nanopatterned into custom designed micro - and / or nanostructures using photolithography , for example su - 8 . it may include a material that has previously been used as a cell culture substrate , but not necessarily for 3 - d htm cell culture , including but not limited to polystyrene , polyester , polypropylene , polycarbonate , polyamide , polyethers , polyimide , polymethylmethacrylate ( pmma ), polydimethylsiloxane ( pdms ), hydrogels , inorganic materials . it may include any scaffold material that may be reproducibly fabricated into micro - or nano structures with over a wide range of thicknesses , produce high aspect - ratio structures without collapsing , and can be transparent , allowing for easy monitoring of htm and sc cell growth and behavior , for example su - 8 . the scaffolds may be formed by manipulation with predetermined pore and beam width and sizes . the pore sizes and beam widths may be uniform . the scaffolds may include a micro - or nanofibrous material that is fabricated or synthesized using electrospinning , self - assembly or phase separation . the 3 - d micro - and nanostructured scaffolds may be used alone or combined with htm biocompatible coating for a choice of 3 - d htm cell proliferation , including but not limited to those used herein for example epithelial cells , endothelial cells , smooth muscle cells , stromal cells , neural cells , and stem cells . as used herein , micro - or nanoporous materials used alone or in hybrid combinations may mean microfabricated membranes , filters , permeable films , micro - or nanofluidic devices including but not limited to su - 8 , track - etched membranes , mixed cellulose membranes , polystyrene membranes , poly ( l - lactic acid ) membranes , poly ( lactic - co - glycolic acid ) membranes , polycaprolactone membranes , polyimide membranes , polyamide membranes , polyethersulfone membranes , polyethersulfone membranes , poly ( vinylidene fluoride ) membranes , silk fibroin membranes , hydrogel membranes ( e . g ., alginate , chitosan , gelatin , collagen , hyaluronic acid , or composite ), nanocrystalline silicon membranes , alumina membranes , nanofibrous membranes , and composite membranes . as used herein , photolithography may include the process used to design and pattern a biocompatible 3 - d micro - or nanostructured scaffolds on a photoresist ( for example su 8 ) and a variety of microfabrication processes including but not limited to microembossing processes , dip - pen nanolithography , colloidal lithography , electron beam lithography , nanoimprint lithography to achieve an optimal 3 - d htm in vitro cellular structure . it means any controllable method to fabricate tissue scaffolds with a well - defined 3 - d architecture that can be used to better elucidate the effect of structure parameters such as pore geometry and pore size on htm cell and sc cell growth in 3 - d scaffolds . as used herein , coating on a 3 - d micro - or nanostructured scaffold means any biomacromolecule or synthetic coating on a 3 - d micro - or nanostructured scaffold that may support any htm or sc cell growth and proliferation for several hours , days , months or years into a functional trabecular meshwork [ tm ], for example , a confluent htm / sc cell meshwork - like construct . it may include , but is not limited to gelatin , poly - l - lysine , laminin , collagen or other molecules known to those skilled in the art . as used herein , beam width means the grid spacing between two adjacent pores . as used herein , beam height means the thickness of the 3 - d micro - and nanostructured scaffold . as used herein , an artificial trabecular meshwork ( artificial tm ) is an in vitro 3 - d htm cell system model in which htm and / or sc cells grow on a 3 - d micro - or nanostructured scaffold to recreate a functional trabecular meshwork [ tm ], for example , a confluent htm / sc cell meshwork - like construct . as used herein , a perfusion chamber is any construction housing that provides a feasible way to combine the elements in this invention in a controlled environment in perfusion experiments as shown in fig2 . it may include but is not limited to a scaffold holder construct ( fig2 a - b ; 202 ) supporting an in vitro 3 - d htm cell system model with pre - defined , well - controlled , uniform pore size , shape and beam width ; an integrated pressure transducer and / or flow sensor ( fig2 c ; 206 ) for sensing the transmembrane pressure ( and / or flow ) under constant flow ( or pressure ) conditions at a predetermined flow ( or pressure ) rate , for a predetermined time period , at a constant temperature ; a construction for investigation and recording of outflow physiology . as used herein , a scaffold holder is a filter holder , array of filter holders , or a microtiter plate that secures the artificial trabecular meshwork in the perfusion chamber and allows performing the perfusion experiments in a high throughput fashion ( fig2 ). as used herein , cytoskeleton includes but is not limited to f - actin , and other cytoskeletal proteins . as used herein , a 3 - d htm structure may include but is not limited to htm cell interaction , enhanced htm cellular interactions , htm cell - cell and cell - ecm , cell secreted extracellular material , and htm cell processes . as used herein , transmembrane may include a 3 - d micro and nanostructured scaffold structure as constructed in this invention with or without a seeded cell culture , which may have been cultured over several hours or days and cells may have proliferated on a 3 - d micro and nanostructured scaffold with several layers of tm / sc cells . cell adhesions between htm cells provide dynamic , bidirectional links between the extracellular matrix and the cytoskeleton . as used herein , lat - b , unless otherwise specified , includes but is not limited to lat - b and other well - documented or novel , innovative htm therapeutic agent , which may prevent , cure , or ameliorate an outflow system - related disease . it may include but is not limited to drugs , for example , lat - b or a novel agent that may cause a minor or marked drop in perfusion pressure or intraocular pressure or improve aqueous flow or improve intraocular exit pathway channels and lower intraocular pressure therein . as used herein , intraocular pressure ( iop ) means the pressure caused by the fluid inside the eye that helps maintain an eye . there is some diurnal and seasonal variation to control the iop within the correct physiological range necessary to maintain the anatomical conditions suitable for optimal refraction and thus vision . the present invention overcomes the drawbacks in the prior art that make current human trabecular meshwork ( htm ) outflow facility studies unsuitable for a uniform , well - defined , controllable , low cost , high throughput 3 - d htm screening and to provide a novel therapeutic device that can regulate iop . the following features serve the great need for a bioengineered , functional , in vitro 3 - d htm model for a screening procedure , for example , glaucoma drug screening . a model according to the present invention would advance the understanding of the htm and provide a platform for future low - cost , less invasive , novel studies related to the eye , leading to drug discovery and effective treatment of diseases of eye , for example , glaucoma . this invention overcomes a screening drawback which is over a century old : in conventional in - vitro systems , cells are grown on flat glass , tissue culture plastics , or commercially - available filters , only allowing monolayer or single cell layer growth of htm cells . in this invention , the construction of a micro - and / or nanopatterned 3 - d micro - and nanostructured scaffold allows for multiple htm cell layers to form ( fig5 c ), much like those observed in the in - vivo environment . the present invention , therefore , serves a valuable , century old need for a multicellular transmembrane screening option . in addition , it allows development of 3 - d co - culture system that will further simulate the human outflow pathways . interestingly , the diameter of the beams revealed in previous sem work ( polansky et al ., ophthalmology . 1984 june ; 91 ( 6 ): 580 - 95 ) of the intricate in vivo microenvironment of the htm complex meshwork match the micropatterned width of beams ( fig3 b ; w ) that make up the 8 - 15 μm and in a preferred embodiment 10 - 12 μm pores ( fig3 a ; 301 ) used in this in vitro work in this invention , which might explain why this 3 - d micro - and nanostructured scaffold structure shows good htm cell adhesion and proliferation . the pore size range with corresponding width of beams of the present invention are features for an optimal artificial tm . this invention recreates an in vitro structure ( fig3 a , 3b , 3c , 9 ), for the seeded cells to use as a “ guide ” ( fig1 ) while mimicking the in vivo htm morphology , in which the pore sizes and width of beams are created via the intricate adhesions of various types of interacting cells of the htm and their secreted extracellular matrix . such a model as in this present invention would advance the understanding of the htm and provide a platform for future low - cost , less invasive , novel studies related to the eye , for example leading to innovative drug research and discovery ( fig1 , 16 ). scaffolds with a well - defined 3 - d architecture can be used to screen the effect of structure parameters such as pore geometry and pore size on htm cell growth in 3 - d micro - and nanostructured scaffolds , under controlled conditions ( fig8 - 16 ). a perfusion chamber to provide controlled conditions was created in the present invention as shown in fig2 . also , models based on the current invention may be adapted to provide an artificial trabecular meshwork ( fig6 and 7 ) that a physician might use to insert to replace the defective trabecular meshwork of a patient , inside or outside the eye of a patient in addition to prescribing eye drops for eye diseases such as glaucoma . a perfusion chamber to provide controlled conditions was created in the present invention as shown in fig2 to provide such controlled conditions as temperature and flow rate , while allowing for variables in pore size and width of beam of scaffold along with other micro - or nanopatterning to be compared . the concept in this invention is incorporated into a high - throughput system set up , allowing for arrays of artificial htm in experimental screening efforts ( fig2 ). the artificial htm of the present invention allows for high throughput screening , which in turn , enables restriction of the use of live animal eye research and decreases the need for live or deceased natural eye donors . a major point of novelty of the present invention is in the micro - and nanostructure of the 3 - d micro - and nanostructured scaffold . a micropatterned 3 - d micro - and nanostructured scaffold scaffold having a well - defined 3 - d architecture ( fig3 , 5 & amp ; 9 ) ( that can be used to better elucidate the effect of structure parameters on htm cell growth and proliferation ) was constructed using photolithography for uniform pore geometry and optimized pore and beam size , as illustrated in fig4 . the material used to create the scaffold may be variable , although su - 8 was chosen as an ideal substrate to fabricate porous 3 - d micro - and nanostructured scaffold . a hybrid material may also provide a scaffold , as long as it results in a suitable , functional artificial htm , as per the concept of this invention . the novel microstructure of the scaffold in this invention could vary the range of the pore size . the range of pore size found to be ideal herein was 10 - 12 μm , while 1 - 7 μm resulted in inferior results and above 14 μm exhibited suboptimal results . for this invention , a microstructure pore size range of 10 - 12 μm is optimal to create a functional artificial htm . the resulting micropatterned 3 - d micro - and nanostructured scaffold ( fig9 ) constructed via the process discussed herein ( fig4 ) resulted in a 3 - d square pore of uniform size , as illustrated in fig3 . a nanopatterned 3 - d micro - and nanostructured scaffold may be constructed using the same concept ( fig3 a , 3b , 3c ). conditions for optimal htm cell growth on the micropatterned 3 - d micro - and nanostructured scaffold were enhanced by coating the scaffold with a htm biocompatible coating optimal for htm cells as shown in fig5 a . conditions for optimal htm cell growth were experimented with and the best conditions selected herein were those suitable for the specifications listed herein . these are only examples of optimal conditions , and the invention is not limited by these , but instead , incorporates all feasible conditions . in a preferred embodiment , incorporating the primary features of the present invention , a flow system apparatus for the controlled flow pressure measurement was constructed as shown in fig2 . it can be integrated easily to enable low - cost high throughput assays within an addressable 3 - d environment ( fig1 & amp ; 2 ), which is attractive for use in understanding of outflow physiology , drug screening and other therapeutic screenings . 1 . the flow system apparatus ( fig2 ) incorporating the principles and features of this invention is contained within a controlled environment , which herein comprises of a stand - alone perfusion chamber , with a cell growth medium entry system ( fig2 c ; 204 ) and a screening agent ( for example a glaucoma drug ) entry system ( fig2 c ; 204 ) as shown in fig2 c . the system allows for the screening agent to be added to the perfusate at a pre - determined concentration for a pre - determined number of hours . this 3 - d structure of the bioengineered in vitro htm cell system in the present invention allows for the htm cells to behave in a “ physiological manner ” mimicking preferred in vivo conditions in a controlled environment . 2 . includes an integrated pressure transducer ( fig2 c ; 206 ), an integrated pressure sensing system while maintaining a constant flow rate and a pressure measurement system at different flow rates for calculation of the outflow facility of the bioengineered htm . 3 . includes the bioengineered htm , a micropatterned , htm biocompatible coated 3 - d micro - and nanostructured scaffold with htm cells providing flow resistance ( fig5 c ) or without htm cells ( fig5 a ) providing no significant resistance to flow . the construction of a scaffold holder is shown in fig2 a and 2 b . this artificial htm is set up in the scaffold insert ( fig2 a ; 202 ). 4 . includes the bio - compatible scaffold holder array construction ( fig2 a , 2 b , 2 c ) as shown in fig2 . the 3 - d micro - and nanostructured scaffold with or without htm cells were secured in the scaffold holder inside the perfusion chamber . lid 201 , scaffold insert 202 , effluent well 203 . 5 . this flow system allowed for simultaneous control of the flow and measurement of the transmembrane pressure , permitting the exploration of the outflow characteristics of the in vitro htm model . pressure measurements at different flow rates allowed for calculation of the outflow facility of the bioengineered htm . transmembrane pressure ( p ) was plotted as a function of flow rate ( f ) and the linear regression gave rise to the slope which was the value of change of transmembrane pressure ( δp )/ the change of flow rate ( δf ) ( fig8 ). 6 . since the outflow facility could be determined by δf / δp , the outflow facility was given by the inverse of the slope . 7 . fourteen days prior to perfusion measurements , htm cells ( for example 4 × 10 5 cell / scaffold ) were seeded on htm biocompatible coated scaffolds ( for example su - 8 ) having a pre - determined pore size range . the seeding density and cell source may vary ( fig1 ). 8 . at day 14 , samples were placed in the perfusion chamber and were perfused in the apical - to - basal direction ( for example at 2 , 10 and 40 μm / min ) for several hours ( for example , 24 hrs ), respectively , with perfusion media ( for example , comprising dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) containing 0 . 1 % gentamicin ). the temperature was kept constant ( for example , at 34 ° c .). back pressures were continuously monitored with a pressure transducer and recorded . 9 . for the treatment with a screening agent ( for example , lat - b ), once a stable baseline pressure was reached through perfusion of media and hank &# 39 ; s balance salt solution ( hbss ) as described above , samples were then perfused with the screening agent ( for example 20 1 - 1 m lat - b in hbss at the same constant flow and temperature ( for example for 4 hrs ) fig1 ). 10 . after detecting the effect of the screening agent the cells can be perfused again with media to ensure that outflow facility reverts to prior values . 11 . follow up cell characterization studies may be conducted as desired with standard techniques well known to those of skill in the art . for this invention , samples were fixed and stained for sem and confocal image analysis as described herein ( fig1 - 15 ). all chemicals were purchased from sigma - aldrich unless otherwise specified . primary htm cells , isolated from the juxtacanalicular and corneoscleral region of the human eye , were either purchased from sciencell research laboratories ( carlsbad , calif .) or cultured from donor tissue from corneal transplant rims . htm cells were cultured in improved mem ( cellgro , manassas , va .) with 10 % fetal bovine serum ( sciencell research laboratories , carlsbad , calif .). a “ physiologic ” bypass of the outflow pathways would be expected to reduce iop while maintaining the functionality of the tm and not relying on the control of the fibrotic response induced by current glaucoma surgery . for practical reasons , this bypass of the outflow pathways can be moved outside of the eye , making implantation of the device easy for eye surgeons who are trained to insert seton devices . however , implantation will require additional training as the aqueous humor will need to be directed into the sc to re - establish the physiologic flow of aqueous humor . a device suitable for implantation in humans ( fig7 ) or other mammals can be constructed of , for example , either polypropylene ( inflexible ) or medical grade silicone ( flexible ). the device can be roughly circular or ovoid ( similar to a glaucoma seton device ) and can have fixation holes anteriorly for suturing to the sclera and at the sides for growth of fibrous tissue over time ( and thus additional fixation ). the total height will be between 0 . 5 and 2 mm while the area will be 150 - 300 mm 2 ( this is an area calculation assuming that filtration area occupies ˜ 50 % of the total device area . this would provide ˜ 115 mm 2 for filtration which is roughly similar to the area of the human tm facing the anterior chamber ). although backflow will not be prevented , filters below and above the cell bi - layers will prevent htm cells from potentially moving back into the eye and sc cells flowing out ( fig6 , 607 ). devices will be tested ex - vivo for determination of resistance to flow without and with cells loaded . thin polyimide ( 100 - 300 μm diameter ) perforated ( outflow ) and silastic ( inflow ) tubes will direct fluid in and out of the central portion of the device . the inflow tube will be placed in the anterior chamber as for a regular glaucoma seton tube . the outflow tubes will be inserted in the sc after 360 degree cannulation using an iscience or other similar catheter . the device will remain in place for the duration of the patient &# 39 ; s life or can be easily replaced if it malfunctions or for other reasons . in one aspect of the current invention , the bioengineering of the substrate comprises optimizing the property of the substrate to yield a trabecular meshwork ( tm ) that mimics the physiological function of tm found in vivo . in one aspect , this substrate property comprises at least one of composition and geometry of scaffolds . in another embodiment , the 3 - d scaffolds are porous . in yet further embodiments the substrate comprises of a material including but not limited to a porous membrane or filter , a photodefinable material , a track - etched membrane or filter , a nano fibrous material or su 8 . in another aspect , the geometry of 3 - d micro - and nanostructured scaffolds of the invention exhibit a grid spacing of approximately between 0 . 1 and 20 microns . in another aspect , the pore size of the 3 - d micro - and nanostructured scaffolds is approximately between 0 . 1 and 20 microns . an embodiment of the invention provides for the method of bioengineering a trabecular meshwork [ tm ] that are derived from the 3 - d micro - and nanostructured scaffolds of the current invention . given their interesting similarity to the beam width and height structure observed in sem of in vivo trabecular meshwork , the 3 - d micro - and nanostructured scaffolds of the current invention can be modified for both high - throughput screening and therapy . in one embodiment , the optimizing a property that mimics the physiological function of the tm found in vivo is by favoring the culturing of htm cells on the 3 - d micro - and nanostructured scaffolds . in further modifications of the invention , the culturing step comprises optimizing a cell seeding density , wherein the cell seeding density is at least 1 × 10 4 cells / cm 2 . the technology of cell seeding is well known to those of skill in the art . various types of htm cells may be suitable for the purposes of this invention , appreciated by those of skill in the art . in a further embodiment , the culturing step comprises at least 7 days of culturing of seeded cells yielding at least one sheet of cultured cells , whereby forming a human trabecular meshwork system [ tm ]. in a yet further embodiment , the cultured cells are characterized to assess their similarity to in vivo htm cells by standard assessing cell morphology techniques known to those of skill in the art . the cultured cells in this invention exhibit a spindle shape and express at least one of alpha - smooth muscle actin , myocilin and alpha b - crystalline . one aspect of the present invention comprises further treating the bioengineered tm with at least one anti - glaucoma agent ; and investigating an outflow facility of the cultured cells . another aspect comprises an investigating step comprising using a pressure sensing system , wherein the pressure sensing system is integrated with a perfusion chamber or the pressure sensing system is a stand - alone perfusion chamber . in one aspect of the invention the pore size ranges from 0 . 1 microns to 8 microns , 8 microns to 14 microns and 14 microns to 30 microns , and more preferably approximately 7 , 12 and 15 μm and most preferably for htm cell size of current invention approximately 10 microns to 12 microns . an htm with a pore size range of 5 - over 15 μm an htm with an optimum pore size range of 10 - 12 μm in one aspect of the invention the three dimensional porous trabecular meshwork that mimics the in vivo tm having beam widths approximately ranging from 0 . 1 microns to 20 microns and more preferably approximately 3 . 4 ± 0 . 1 μm , 7 . 3 ± 0 . 1 μm and 5 . 2 ± 0 . 1 μm . an htm with a seeding density of 4 × 10 4 cells / cm 2 an htm with a seeding density of at least 2 × 10 4 cells / cm 2 and preferably 4 × 10 4 cells / cm 2 in another aspect of the present invention , an htm is constructed with a 14 day htm cell culture . the htm cell culture in this invention is facilitated by pore size , beam width and beam height . in a preferred embodiment the beam width and height is about 0 . 1 μm to about 20 μm . in a further embodiment the beam width and height is about 3 . 4 ± 0 . 1 μm , 7 . 3 ± 0 . 1 μm and 5 . 2 ± 0 . 1 μm ( p & lt ; 0 . 05 ). in one embodiment method for a high - throughput screening artificial htm screening comprises achieving the optimal 3 - d thickness of the artificial htm of at least around 20 microns to mimic the structure and function of an in vivo tm . in another aspect of the present invention a method for a high - throughput artificial htm screening system comprising maintaining said constant flow rate through a said pressure transducer from about 0 . 1 μl / min to about 15 μl / min to study the effect of experimental agents on the htm aqueous flow facility . in a further embodiment , comprising maintaining said constant flow rate through a said pressure transducer at about 15 μl / min to about 30 μl / min ; and in a yet further embodiment maintaining said constant flow rate through a said pressure transducer at about 30 μl / min to about 60 μl / min to study the effect of experimental agents on the htm aqueous flow facility . 1 . primary human trabecular meshwork ( htm ) cells were purchased ( from sciencell research laboratories , carlsbad , calif . ); or isolated from the juxtacanalicular and corneoscleral region of donor human eye tissue . 2 . the htm cells were plated in flasks , glass coverslips , and micropatterned 3 - d micro - and nanostructured scaffolds coated with htm biocompatible agents such as poly - l - lysine , gelatin etc ., and cell proliferation compared ; the htm biocompatible coating which provided the optimal htm cell proliferation was selected . 2 . a . the htm cells were plated in poly - l - lysine - coated 75 cm 2 cell culture flasks ( 2 μg poly - l - lysine / cm 2 ) and cultured in improved mem ( cellgro , manassas , va .) with 10 % fetal bovine serum ( sciencell research laboratories , carlsbad , calif .). or 2 . b . the htm cells were plated in gelatin - coated ( 75 cm 2 cell culture flasks ( 1 % sterile gelatin solution ) and cultured in improved mem ( cellgro , manassas , va .) with 10 % fetal bovine serum ( sciencell research laboratories , carlsbad , calif .). 4 . cells were maintained at 37 ° c . in a humidified atmosphere with 5 % carbon dioxide until 80 %- 90 % confluence . 5 . cells were trypsinized using 0 . 25 % trypsin / 0 . 5 mm ethylenediaminetetraacetic acid ( edta ). 7 . after comparing the poly - l - lysine coating to gelatin for htm cell attachment and growth , the htm cells were sub cultured on gelatin - coated 75 cm 2 cell culture flasks . gelatin - coating provided superior results than poly - l - lysine , but other htm biocompatible coatings on the chosen micropatterned 3 - d micro - and nanostructured scaffold may be tested with htm cells and selected if superior desired cell attachment and proliferation results are observed . 8 . all studies were conducted using cells before the 5th passage , for the htm cells purchased herein . however , other choices of htm cells may perform favorably under more passages . similar methods were used to derive the htm cells used for cell seeding in fig1 ; 109 , and fig5 b . choices of htm cells may include epithelial cells , epidermal cells , endothelial cells , smooth muscle cells , stromal cells , neural cells , stem cells , but are not necessarily limited to the htm cell types listed herein . to produce the scaffolds with varying dimensions of micro - and / or nanostructures , using standard photolithography techniques shown in fig4 , a 3 - d micro - and nanostructured scaffold with an architecture ( fig3 a ; 3 b ; 3 c ; 9 ) very similar to the specific features of the tm observed in vivo . 1 . a silicon wafer ( fig4 ; 402 ) was cleaned using piranha ( 3 : 1 h 2 so 4 : h 2 o 2 ). 4 . a release layer ( fig4 ; 401 ) was then spun on the wafer at 3000 rpm using a spin coater . in this example , omniccoat ™ treatment was used on previously cleaned silica wafer for the release layer ( fig4 a ; 401 ). 5 . baked on a hot plate at 200 ° c . for 1 min . 6 . a substrate ( in this example su - 8 2010 ) was applied by spin - coating to a final thickness of approximately 20 μm , ( fig4 b ; 403 ). 10 . a micro - or nanostructure with desired pore size , beam width , beam height and other factors were selected for the mask ( fig4 c ; 404 ). the substrate was exposed through a mask containing the desired patterns ( fig4 c ). 12 . the micro - and nanostructure was baked at 95 ° c . for 10 min . 14 . placed in propylene glycol methyl ether acetate ( pgmea ) developer overnight . the immersion of the micro - and nanostructure in pgmea enabled the development and release of the 3 - d micro - and nanostructured scaffolds from the wafer coated with release layer . 15 . the released porous 3 - d micro - and nanostructured scaffolds were then removed from the pgmea solution ( fig4 d ). 16 . the porous 3 - d micro - and nanostructured scaffolds were created by cutting into disks that fit in a 24 - well plate or microtiter plate for htm cell growth , sterilized by soaking in 70 % ethanol for 30 min , and reinforced by an autoclaved aluminum tape ring ( fig4 e ). it will be understood that the invention has been described by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention . 1 . su - 8 3 - d micro - and nanostructured scaffolds were coated by soaking for 30 minutes in a htm biocompatible coating agent ( for example poly - l - lysine or gelatin ) to promote htm cell attachment . 2 . coated su - 8 3 - d micro - and nanostructured scaffolds were removed and allowed to air - dry overnight in a sterile environment like a sterile tissue culture hood . 3 . su - 8 3 - d micro - and nanostructured scaffolds were allowed to rest at the bottom of a 24 - well plate while preventing direct contact between 3 - d micro - and nanostructured scaffold and the bottom of the 24 - well plate . for the present invention , a structure was designed and constructed for preventing direct contact between 3 - d micro - and nanostructured scaffold and the bottom of a cell culture plate . aluminum tape rings were cut , autoclaved and placed around the borders of the previously sterilized scaffolds . these tape rings allowed the 3 - d micro - and nanostructured scaffolds to rest at the bottom of a culture plate while preventing direct contact between 3 - d micro - and nanostructured scaffold and the bottom of the plates ; this tape ring feature designed and constructed for the present invention also facilitates manipulation without handling cell - seeded scaffolds directly . however , differently designed and constructed structures may achieve the same desired features . 4 . htm cells were seeded on the htm biocompatible coated su - 8 3 - d micro - and nanostructured scaffolds at various cell densities ( for example 1 - 2 × 10 4 , 3 - 4 × 10 4 and 5 - 10 × 10 4 cells / well ) ( fig1 ). 5 . cell growth on the su - 8 3 - d micro - and nanostructured scaffolds was monitored every 48 hours for 14 days ( fig1 ). a nikon inverted ts - 100 f microscope ( micro video instruments , avon , mass .) may be used . characterizing htm and sc cell morphology using sem , immunochemistry and confocal microscopy techniques , which are standard techniques well known to those of skill in the art ( for htm cells : polansky et al ., ophthalmology . 1984 june ; 91 ( 6 ): 580 - 95 ; for sc cells : perkumas et al ., exp eye res . 2012 march ; 96 ( 1 ): 82 - 7 . doi : 10 . 1016 / j . exer . 2011 . 12 . 017 . epub 2011 dec . 22 ). a perfusion chamber system using an artificial trabecular meshwork ( tm ) in a high throughput system setup within a controlled environment using a “ multi - channel artificial tm perfusion array ” ( fig2 ). 1 . set up a disposable cell - culture insert with a porous 3 - d micro - and nanostructured scaffold , with or without a seeded cell culture ( fig2 ; 202 ). 2 . set up a re - usable or single - use effluent wells bottom structure ( fig2 ; 203 ). 3 . set up a re - usable fixed lid structure with desired number of fluidic inlets top structure ( fig2 ; 201 ). 4 . set up a scaffold holder construction comprising of at least a bottom structure , a top structure , a disposable cell - culture inserts , wherein connection to cell - culture inserts may be through o - ring compression seals ( fig2 a - b ). 5 . set up pumps such as syringe pumps for introducing at least one media or media in combination with at least one experimental agent through multiple fluidic inlets ( fig2 c ; 204 ). 6 . set up pressure transducers and flow monitors ( fig2 c ; 206 ). 8 . set up a multi - channel artificial tm array monitoring system comprising of the scaffold holder construction connected through multiple channel inlets ( fig2 c ; 207 ) to at least the pumps such as syringe pumps , the pressure transducers , the flow monitors , and a temperature control monitor , in a housing maintaining a constant temperature ( fig2 c ). an example of a high throughput screening artificial tm system setup ( fig2 c ) may include the following in a system setup with a 6 - channel perfusion array for artificial tm . the system would include a disposable cell - culture insert with su - 8 porous substrate ( fig2 a ; 202 ); a re - usable effluent wells ( bottom ) ( fig2 a ; 203 ) and fixed lid with fluidic inlets ( top ) ( fig2 a ; 201 ); connection to cell - culture inserts is through o - ring compression seals . the 6 - channel artificial tm array would be supported within a housing comprising of a scaffold holder that is connected to pressure , flow ( fig2 c ; 206 ) and temperature instruments that would measure and monitor the flow rate , pressure and temperature of the fluids and effluents entering and exiting the perfusion array for artificial tm . fig6 showing a cross - sectional view of a human trabecular meshwork device derived from inventive concept herein . the human trabecular meshwork device as shown in fig7 with cell support ( fig7 ) and bottom “ cap ” ( fig7 ; 702 ) in place . upper lid is shown ( fig7 ). one inlet and two outlet tubings are shown ( fig7 ; 704 , 705 ). the thickness of the assembled device is designed to be between 0 . 7 and 2 mm and a perfusion area of approximately 115 mm 2 . the ophthalmologist may perform a surgical incision at the limbus , raise the conjunctiva to expose the sclera and place the device on the sclera a few millimeters back from the limbus ( typically 8 - 10 mm ). the surgeon may then secure the device with non - absorbable sutures to the sclera to prevent movement . he will then insert the inflow tube through a limbal stab incision into the anterior chamber . he will then dissect above the schlemm &# 39 ; s canal to identify the canal . he will insert either a suture or a catheter into the canal and feed it into the canal until he reaches a point 180 degrees away . it is preferable to use a fiberoptic catheter for this maneuver as this allows constant feedback on the tip position . the surgeon would then inject viscoelastic material in the canal to facilitate insertion of the outflow tube . the maneuver will be repeated with the other outflow tube . following insertion of the outflow tubes the surgeon will reinforce as needed the overlying tissues and will close the incision with sutures . alternatively , the doctor may insert other configurations of the artificial tm inside the eye to replace the tm after it has been removed using methods known to those skilled in the art . either way , the artificial tm device proposed here and shown in fig7 may have potential as a routine first - line therapy for treatment of open - angle glaucoma and other types of glaucoma , even before eye drops are used but can also be used in conjunction with eye - drops . fig1 is a process flow diagram that shows various iterations and variations in the work - flow to generate an artificial trabecular meshwork . in this example , it is essential that the choice of cells could determine the resultant artificial htm function , which can be measured in this invention concept . the 3 - d micro - and nanostructured scaffold &# 39 ; s pre - determined structure at micro - and / or nanoscale as per the concept of this invention would guide the seeded cells . the pore size and width of beams would be essential for an artificial trabecular meshwork to form . the present invention suggests the range . choices of source of cells are various including but not limited to cell lines , primary cells ( fig1 ; 104 ) isolated from eye tissues ( fig1 ; 100 ), cells derived from stem cells ( fig1 ; 106 ), bioengineered or genetically engineered cells ( fig1 ; 105 ). after harvesting , tm cells and / or sc cells ( fig1 ; 107 , 108 ) will be seeded ( fig1 ; 109 ) onto 3 - d micro - and nanostructured scaffolds ( fig1 ; 110 ) and cultured ( fig1 ; 111 ) to recreate artificial trabecular meshwork ( fig1 ; 112 ). the artificial tm will be incorporated into a flow chamber , an assembled micro - titer plate or a medical device , respectively , which can be used for understanding outflow physiology ( fig1 ; 113 ), high throughput therapeutics screening ( fig1 ; 114 ) and developing therapeutic devices ( fig1 ; 115 ). follow up experiments might include small rna interference studies of genetically modified cell source artificial htm or studies of stem cell originated artificial htm or studies of an artificial htm originated from cells donated by individual patients . for the purposes of success of this invention of an artificial htm , cell characterization studies as follow up can show that the artificial htm behaves like the natural htm . characterizing human trabecular meshwork ( htm ) cell morphology ( fig1 - 16 ) by ( i ) using scanning electron microscopy ( sem ) ( fig1 - 12 ) and ( ii ) using immunocytochemistry and confocal imaging ( fig1 - 14 ). see fig1 for a glaucoma drug screening results through the artificial htm . bioengineering pore size ( fig3 a ; l 1 & amp ; l 2 ) and beam width and height ( fig3 b ; h & amp ; w ) as described herein , the present invention involves a bioengineered htm construction to better recapitulate the perforated sheet - like structure and outflow characteristics of htm . in one aspect of the invention , freestanding , microporous 3 - d micro - and nanostructured scaffolds were fabricated containing an array of pores . in another embodiment , these scaffolds were fabricated containing beam widths and heights forming the walls of the pores , in which these beam widths and heights facilitated direction of the seeded htm cells to send out cellular processes . fig5 c shows a cross - sectional illustrated view of such a beam height and width forming the walls of a pore , and providing a support element for a htm cell process extension ( fig5 c ; 505 ). in one embodiment , the pore size ranges from 0 . 1 microns to 8 microns , 8 microns to 14 microns and 14 microns to 30 microns , and more preferably approximately 7 , 12 and 15 μm and most preferably for htm cell size of current invention approximately 10 microns to 12 microns ( fig3 a : l 1 & amp ; l 2 ). in another embodiment for facilitating the formation of the three dimensional porous trabecular meshwork that mimics the in vivo tm with beam widths approximately ranging from 0 . 1 microns to 20 microns and more preferably approximately 3 . 4 ± 0 . 1 μm , 7 . 3 ± 0 . 1 μm and 5 . 2 ± 0 . 1 μm ( p & lt ; 0 . 05 ) ( fig3 b : w & amp ; h ), respectively . we chose these pore sizes for this invention because they are close to the size of a single htm cells of our present invention &# 39 ; s cell source . one preferred embodiment is that the pore size selected to fabricate the 3 - d micro - and nanostructured scaffold , are smaller than the size of the htm cell size selected to seed the 3 - d micro - and nanostructured scaffold , since a preliminary study in this invention showed it was difficult for htm cells to grow into a confluent layer on microstructures with pore size larger than that of the cell since cells were unable to expand over or fully populate the pores ( data not shown ). in another preferred embodiment , the pore size , width and height ( fig3 a ; l 1 & amp ; l 2 and 3 b : h & amp ; w ) respectively , conferred the ability on the select htm seeded cells to form cell processes capable of interacting with neighboring cell processes and forming a three - dimensional porous meshwork of at least a single layer of htm cells with an approximate thickness of 20 microns . it will be appreciated from the results of this invention to those of skill of the art that should the htm cell source and their resultant cell sizes be slightly different from the current htm cell size the preferred pore size and beam and width dimension might be slightly different . in one aspect of the invention , a scaffold holder was constructed comprising of a housing wherein there is a first element including a microtiter plate designed as an insert to hold the 3 - d micro - and nanostructured scaffolds ( fig2 a ; 202 ); a second element including a bottom array designed to collect effluents ( fig2 a ; 203 ); and a third element including a top plate designed to allow entry of perfusion media in a sealed manner ( fig2 a ; 201 ). for the present invention , in a preferred embodiment , this scaffold holder is set up to hold a microtiter multi - well plate for high - throughput screening format . in yet further aspects of the present invention , such a scaffold holder in a perfusion chamber maintained at a constant temperature and flow rate , will have the ability to maintain a constant flow rate for htm cells at 0 . 1 - 15 μl / min and 15 - 30 μl / min and 30 - 60 μl / min or more than 60 μl / min to study the effect on the htm in the present invention during screening . in another aspect of the present invention , this scaffold holder is located within a sealed perfusion chamber providing a tool for studying in a controlled environment for temperature and pressure flows ( fig2 c ; 206 ) the htm set up in the scaffold holder arrays . in yet another aspect of this invention , this scaffold holder is connected to a pressure transducer within a perfusion chamber , allowing for flow and measurements of a constant flow rate of perfusion media , in a controlled temperature , through the 3 - d micro - and nanopatterned scaffolds with or without htm cellular cultures . those of skill of the art will appreciate the numerous parameters such a construction provide for a controlled environment and pressure flow rate to demonstrate how closely the htm 3 - d micro - and nanostructured scaffold mimics an in vivo htm and allows for screening studies and therapy comparisons . the final product may be a two - component system . a fixed component which will involve the pumping and sensing mechanisms and a disposable component which will include the carrier on which the htm cells and sc cells grow and are then perfused . because of the common practice of using multi - well plates in cell culture , we will design the disposable porous substrate component to fit in off - the - shelf 24 - well plates . this will greatly simplify the phase of growing htm cells prior to using them for flow facility measurement experiments . the carrier containing confluent htm cells will then be placed in a non - disposable re - sterilizable 6 - well chamber ( fig2 c ; 207 ). the connection to the pumping system and pressure sensor package ( fig2 c ; 204 , 206 ) will be through an o - ring compression seal . medium will be injected into each of the wells using 2 programmable multi - channel pumps . each pump will be used to control flow in 3 wells so that experiments can be run in triplicate to ensure validity of the results . an additional pair of programmable pumps will connect to the system to allow injection of medium containing pharmaceutical agent of interest at the appropriate concentration . perfusion will be performed at a constant flow rate that will be feedback - controlled using pressure data . initially through flow will be adjusted to obtain an average pressure of ˜ 5 mmhg in each three - well group controlled by one pump ( fig2 c ; 204 ). individual pressure sensors for each well will ensure that excessively low or high pressures caused by accidental leakage or air obstruction respectively can be detected . after the system stabilizes for at least 2 hours , medium containing the agent of choice can be injected in the wells using the second set of pumps ( fig2 c ; 204 ). again flow will be adjusted to maintain an average iop 5 mmhg and the system allowed to reach steady - state . at that point flow will be increased to obtain an average iop of approximately 15 mmhg and after reaching steady state again flow rates will be recorded . the difference in flow rates divided by the pressure in each well will be used to calculate flow facility in each individual well . flow with basic media will allow washout of the agent and test reversibility of effect . a design , construction and characterization of an artificial human trabecular meshwork ( htm ) primary htm cells , isolated from the juxtacanalicular and corneoscleral region of human eye , were purchased from sciencell research laboratories ( carlsbad , calif .). the htm cells were initially plated in poly - l - lysine - coated 75 cm 2 cell culture flasks ( 2 μg poly - l - lysine / cm 2 ) and cultured in improved mem ( cellgro , manassas , va .) with 10 % fetal bovine serum ( sciencell research laboratories , carlsbad , calif .). fresh culture medium was supplied every 48 hours . cells were maintained at 37 ° c . in a humidified atmosphere with 5 % carbon dioxide until 80 %- 90 % confluence at which point cells were trypsinized using 0 . 25 % trypsin / 0 . 5 mm edta and subcultured . after comparing the poly - l - lysine coating to gelatin for htm cell growth , the following htm cells were subcultured on gelatin - coated 75 cm 2 cell culture flasks . all studies were conducted using cells before the 5th passage . su - 8 2010 ( microchem corp ., newton , mass .) was used to develop free - standing porous microstructures that served as 3 - d micro - and nanostructured scaffolds for htm cell culture . su - 8 3 - d micro - and nanostructured scaffolds with varying dimensions of microstructures were fabricated using standard photolithography techniques ( fig4 ). first , a silicon wafer was cleaned using piranha ( 3 : 1 h 2 so 4 : h 2 o 2 ) ( h 2 so 4 was purchased from transene company , danvers , mass . and h 2 o 2 from puritian products , bethlehem , pa . ), rinsed with deionized water and then dried with nitrogen . a release layer of omnicoat ( microchem , boston , mass .) was then spun on the wafer at 3000 rpm using a spin coater ( brewer science , rolla , mo . ), and baked on a hot plate at 200 ° c . for 1 min . su - 8 2010 ( microchem ) was applied by spin - coating to a final thickness of approximately 20 μm , then baked at 95 ° c . for 10 min , and cooled to room temperature . the resist was exposed through a mask containing the desired patterns using a 150 mj / cm 2 dose on an evg 640 1 - line contact aligner ( ev group , albany , n . y .). finally , the substrate was baked at 95 ° c . for 10 min , cooled to room temperature and placed in pgmea developer ( microchem ) overnight . the immersion of the substrate in pgmea enabled the development and release of the su - 8 3 - d micro - and nanostructured scaffolds . the released su - 8 porous scaffolds were then removed from the pgmea solution and sterilized by soaking in 70 % ethanol for 30 min . su - 8 3 - d micro - and nanostructured scaffolds were coated with poly - l - lysine or gelatin to promote htm cell attachment . by soaking in 10 mg / ml poly - l - lysine or 1 % sterile gelatin solution for 30 min , after which these htm biocompatible coated scaffolds were removed and allowed to air - dry in a sterile tissue culture hood overnight . aluminum tape rings were cut , autoclaved and placed around the borders of these previously sterilized htm scaffolds . this allows these sterilized , htm biocompatible coated , su - 8 3 - d micro - and nanostructured scaffolds to rest at the bottom of a 24 - well plate while preventing direct contact between these scaffolds and the bottom of the plate ; the ring also facilitates manipulation without handling cell - seeded scaffolds directly . htm cells were seeded on these scaffolds at various cell densities ( 1 × 10 4 , 2 × 10 4 , 4 × 10 4 and 5 × 10 4 cells / cm 2 ). cell growth was monitored by a nikon inverted ts - 100 f microscope ( micro video instruments , avon , mass .) every 48 hours for 14 days . cells were characterized using standard procedures for sem , immunocytochemistry and confocal imaging , well known to those of skill in the art . a flow system apparatus for the controlled flow pressure measurement was constructed as shown in fig2 c was contained in a perfusion chamber housing comprised of at least a perfusion chamber with an integrated pressure transducer ( fig2 c ; 206 ), the sterilized , htm biocompatible coated , su - 8 3 - d micro - and nanostructured scaffold with or without htm cells placed within a cell - culture insert ( fig2 a ; 202 ) and were secured in the scaffold holder , comprising at least a bottom element adapted for effluent ( fig2 a ; 203 ), a top element adapted for media entry ( fig2 a ; 201 ) inside the perfusion chamber ( fig2 c ). this flow system allowed for simultaneous control of the flow and measurement of the transmembrane pressure , permitting the exploration of the outflow characteristics of the in vitro htm model . fourteen days prior to perfusion measurements , 4 × 10 5 cell / cm 2 htm cells were seeded on these sterilized , htm biocompatible coated , su - 8 3 - d micro and nanostructured scaffolds . at day 14 , samples were placed in the perfusion chamber ( fig2 c ; 207 ) and were perfused at 2 , 10 and 40 μm / min in the apical - to - basal direction for 24 hrs , respectively , with perfusion media comprising dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ) containing 0 . 1 % gentamicin . the temperature was kept constant at 34 ° c . within the perfusion chamber housing ( fig2 c ; 207 ). back pressures were continuously monitored with a pressure transducer ( fig2 c ; 206 ) and recorded . for the treatment with lat - b , once a stable baseline pressure was reached through perfusion of media and hbss as described above , samples were then perfused with 20 μm lat - b in hank &# 39 ; s balance salt solution ( hbss ) at the same constant flow and temperature for 4 hrs . samples were fixed and stained for sem and confocal image analysis as described above . to better recapitulate the perforated sheet - like structure and outflow characteristics of htm , we fabricated freestanding , microporous membranes of su - 8 3 - d micro - and nanostructured scaffolds . these scaffolds contain arrays of square pores 7 , 12 and 15 μm ( fig3 a ; l 1 & amp ; l 2 ), with beam widths of 3 . 4 ± 0 . 1 μm , 7 . 3 ± 0 . 1 μm and 5 . 2 ± 0 . 1 μm ( fig3 b ; w ), respectively . we chose these pore sizes because they are close to the size of a single htm cells . our preliminary study showed that it was difficult for htm cells to grow into a confluent layer on microstructures to with pore size larger than that of the cell since cells were unable to expand over or fully populate the pores ( data not shown ). the thickness of these free - standing 3 - d micro - and nanostructured scaffolds was measured to be 20 μm through sem analysis . sem and light microscopy were used to evaluate the effects of biomacromolecular htm biocompatible coating , initial cell seeding density , pore size of 3 - d micro - and nanostructured scaffold , and culture period on htm cell attachment and growth on these scaffolds . to recapitulate the functional morphology of htm , we expected the sterilized , htm biocompatible coated , su - 8 3 - d micro - and nanostructured scaffold - based culture system to provide the most cell coverage , enhancing htm cell growth to form confluent perforated meshwork with laminar layers . initial screening of htm biocompatible coating factors ( gelatin vs . poly - l - lysine ) demonstrated that 3 - d micro - and nanopatterned su - 8 scaffolds coated with gelatin showed greater cell attachment and higher percentage of confluence after culturing for 10 days , and thus all scaffolds used in our work were htm biocompatible coated with 1 % gelatin prior to cell seeding . the effect of initial cell seeding density ( 1 × 10 4 , 2 × 10 4 , 4 × 10 4 and 5 × 10 4 cells / cm 2 ) on htm cell attachment and growth on all su - 8 scaffolds was evaluated through sem observation . when the cell seeding density was lower than 4 × 10 4 cells / cm 2 , it exhibited poor cell attachment and low cell growth . the results demonstrated that 4 × 10 4 cells / cm 2 was the lowest initial cell seeding density that allowed confluent cell layer formation . the cell seeding density greater than 4 × 10 4 cells / cm 2 showed no improvement in cell layer formation ( data not shown ). therefore 4 × 10 4 cells / cm 2 seeding density was used for construction of the in vitro htm model . the effect of pore size ( 7 , 12 and 15 μm ) ( fig3 a ; l 1 & amp ; l 2 ) of su - 8 scaffolds on htm cell growth was compared . by day 7 , cells grown on the 7 μm su - 8 scaffolds exhibited less cell coverage ( fig1 d ). htm cells grown on 12 - μm su - 8 scaffolds fully covered the pore spaces ( fig1 e ) and began secreting their fibrillar , mesh - like extra - cellular matrix ( ecm ) evenly throughout the scaffold and between the cells . cells grown on 15 μm su - 8 scaffolds showed larger non - cell covered areas ( fig1 f ). the effect of pore size on htm cell attachment and growth was even more pronounced at the low cell density ( 1 × 10 4 cells / cm 2 ) where the 12 - μm su - scaffold provides the best cell coverage among all three pore sizes ( compared in fig1 a - f ). additionally , observation under light microscopy showed that fewer cells attached to these two scaffolds compared to the 12 - μm su - 8 scaffolds ( data not shown ). the effect of culture period of htm cell growth on 12 - μm su - 8 scaffolds was further evaluated . compared to 7 days of cultivation , cells grown for 14 days achieved full coverage ( fig1 ). in order to further assess whether the extended culture period could enhance cell layer formation , htm cells on su - 8 scaffolds were allowed to grown for 21 days . no apparent difference was noted through sem and light microscopy observation ( data not shown ). additionally , htm cells grown on the 12 - μm su - 8 3 - d micro - and nanostructured scaffolds exhibited a spindle - shaped appearance , representative characteristics of htm cells , while presenting characteristic microvillus projections and overlapping cell processes . the results demonstrated that , sterilized , gelatin - htm biocompatible coated , 12 - μm su - 8 micro - and nanostructured scaffolds could provide the most favorable scaffolds , enhancing htm cell growth and confluent meshwork formation ( fig1 - 14 ). after we demonstrated the feasibility of constructing an in vitro htm model system by culturing 4 × 10 4 cells / cm 2 cells on sterilized , gelatin - htm biocompatible coated 12 - μm su - 8 3 - d micro - and nanostructured scaffolds for 14 days , we confirmed htm - specific gene expression in the bioengineered htm using immunocytochemistry analysis followed by confocal imaging . confocal images showed that these htm cells grown on su - 8 scaffolds expressed α - sma ( fig1 a ), myocilin and αb - crystallin ( fig1 b ), suggesting that these cells maintained an htm - like expression pattern . additionally , f - actin staining characterized the cytoskeleton as containing partially elongated stress fibers , which also appeared to be aligned . three - dimensional confocal reconstruction by z - stacking of f - actin demonstrated that htm cells grew on top of the su - 8 3 - d micro - and nanostructured scaffolds as dense multilayers , forming a 3 - d meshwork approximately 20 μm thick ( fig1 b - c ). additionally , cells that constitute the primary ( basal ) layer sent thin fibrous processes into these su - 8 micro - and nanostructured scaffolds ( fig1 b - c ; 301 ). the fact that htm cells grown on gelatin - coated 12 μm su - 8 scaffolds maintained htm cell phenotype promoted us to further evaluate the outflow facility of the bioengineered htm using a flow system apparatus as shown in fig2 . the construct of htm cells cultured on these htm biocompatible coated , su - 8 3 - d micro - and nanostructured scaffolds for 14 days was incorporated into a stand - alone perfusion chamber , where the pressure across the tissue construct was measured using an integrated pressure sensing system while maintaining a constant flow rate ( 40 μl / min ). htm cells provided flow resistance , raising the transmembrane pressure to 8 ± 1 mmhg , while su - 8 scaffolds alone ( without htm cells ) had no significant resistance to flow ( transmembrane pressure of 0 . 3 ± 0 . 5 mm hg ). pressure measurements at different flow rates ( 2 , 10 and 40 μl / min ) allowed for calculation of the outflow facility of the bioengineered htm . transmembrane pressure ( p ) was plotted as a function of flow rate ( f ) and the linear regression gave rise the slope which was the value of change of transmembrane pressure ( δp )/ the change of flow rate ( δf ) ( fig8 ). since the outflow facility could be determined by δf / δp , the outflow facility was given by the inverse of the slope , and was found to be 4 . 7 μl / min / mmhg ( 4 . 2 - 5 . 1 μl / min / mmhg with 95 % confidence ). to further verify that our system allows htm cells to behave in a “ physiological manner ”, lat - b was added to the perfusate at a concentration of 2 μm for 4 hours . the mechanism of action of lat b is reversible disruption of the dynamic process of actin filament maintenance , which affects the cytoskeleton of cells through net actin depolymerization . this agent decreased the resistance to flow by 92 ± 6 % ( fig1 , n = 8 , p & lt ; 0 . 05 ). furthermore , lat - b appeared to increase the outflow facility of our system by inducing shrinkage of htm cells and disruption of secreted ecm . sem images ( fig1 a - f ) showed that htm cells changed their morphology dramatically from elongated spindle - shape appearance to square - like shape after lat - b treatment ( fig1 c ). additionally , thick fibrillose bundles of circular appearance were seen throughout the entire scaffold under sem . confocal images showed that elongated actin fibers were disturbed and became punctate actin bundles after lat - b perfusion , suggesting the critical role of actin filaments in maintaining htm morphology and outflow physiology . confocal z - stack analysis revealed that after lat - b treatment the 3 - d structure of the bioengineered htm collapsed , with many cells falling into the pores of the scaffold . in this study , the feasibility of using htm biocompatible coated , porous su - 8 3 - d micro - and nanopatterned scaffolds to coax htm cells into functional trabecular meshwork has been demonstrated herein ( fig9 - 16 ). an in vitro htm model system has been constructed in this invention . it includes the biomacromolecule htm compatible coated su - 8 3 - d micro - and nanopatterned scaffold for htm cells growing into a confluent meshwork - like construct and a perfusion chamber with an integrated pressure transducer for sensing the transmembrane pressure under constant flow . it offers a new avenue for understanding the htm physiology at molecular and cellular level ; testing pharmacological agents that affect iop and trabecular outflow facility in humans ; and contributes to the 3 - d micro - and nanopatterned design and construction of a medical device comprising of therapeutic inserts to manipulate iop by repairing a defective trabecular outflow facility . although the invention has been shown and described with respect to a certain preferred embodiment or embodiments , certain equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings . in particular regard to the various functions performed by the above described components , the terms ( including a reference to a “ means ”) used to describe such components are intended to correspond , unless otherwise indicated , to any component which performs the specified function of the described component ( i . e ., that is functionally equivalent ), even though not structurally equivalent to the disclosed structure which performs the function in the herein illustrated exemplary embodiments of the invention . in addition , while a particular feature of the invention may have been disclosed with respect to only one of several embodiments , such feature may be combined with one or more features of the other embodiments as may be desired and advantageous for any given or particular application . further , where a component , step , or feature is described singularly using “ a ” or “ an ”, etc ., there may be one or more of such component ( plurality ), steps or features included within the scope of the invention . tamm , e . r ., the trabecular meshwork outflow pathways : structural and functional aspects . exp eye res , 2009 . 88 ( 4 ): p . 648 - 55 . tektas , o . y . and e . lutjen - drecoll , structural changes of the trabecular meshwork in different kinds of glaucoma . exp eye res , 2009 . 88 ( 4 ): p . 769 - 75 . overby , d . r ., w . d . stamer , and m . johnson , the changing paradigm of outflow resistance generation : towards synergistic models of the jct and inner wall endothelium . exp eye res , 2009 . 88 ( 4 ): p . 656 - 70 . johnson , m ., ‘ what controls aqueous humour outflow resistance ?’. exp eye res , 2006 . 82 ( 4 ): p . 545 - 57 . heijil a ., leske m . g ., bengtsson b ., hyman l ., hussein m . reduction of intraocular pressure and glaucoma progression : results from the early manifest glaucoma trial . arch ophthalmol , 2002 . 120 ( 10 ): 1268 - 79 peterson , j . a ., et al ., effect of latrunculin - b on outflow facility in monkeys . exp eye res , 2000 . 70 ( 3 ): p . 307 - 13 . ethier c . r ., a . t . read , and d . w . chan , effects of latrunculin - b on outflow facility and trabecular meshwork structure in human eyes . invest ophthalmol vis sci , 2006 . 47 ( 5 ): p . 1991 - 8 . tian b ., geiger b ., epstein d . l ., kaufman p . l . cytoskeletal involvement in the regulation of aqueous humor outflow . invest ophthalmol vis sci , 2000 . 41 ( 3 ): p . 619 - 23 . spector i ., shochet n . r ., kashman y ., groweiss a . latrunculins : novel marine toxins that disrupt microfilament organization in culture cells . science , 1983 ; 216 ( 4584 ): 493 - 5 mckee , c . t ., et al ., the effect of biophysical attributes of the ocular trabecular meshwork associated with glaucoma on the cell response to therapeutic agents . biomaterials , 2011 . 32 ( 9 ): p . 2417 - 23 . vaajanen , a ., h . vapaatalo , and o . oksala . a modified in vitro method for aqueous humor outflow studies in enucleated porcine eyes . j ocul pharmacol ther , 2007 . 23 ( 2 ): p . 124 - 31 . russell , p ., et al . response of human trabecular meshwork cells to topographic cues on the nanoscale level . invest ophthalmol vis sci , 2008 . 49 ( 2 ): p . 629 - 635 . schlunck , g ., et al ., substrate rigidity modulates cell matrix interactions and protein expression in human trabecular meshwork cells . invest ophthalmol vis sci , 2008 . 49 ( 1 ): p . 262 - 9 . fautsch , m . p ., et al ., primary trabecular meshwork cells incubated in human aqueous humor differ from cells incubated in serum supplements . invest ophthalmol vis sci 2005 . 46 ( 8 ): p . 2848 - 56 . koga , t ., et al ., rho - associated protein kinase inhibitor , y - 27632 , induces alterations in adhesion , contraction and motility in cultured human trabecular meshwork cells . exp eye res , 2006 . 82 ( 3 ): p . 362 - 70 . bahler , c . k ., et al ., prostaglandins increase trabecular meshwork outflow facility in cultured human anterior segments . am j ophthalmol , 2008 . 145 ( 1 ): p . 114 - 9 . bahler , c . k ., et al ., trabecular bypass stents decrease intraocular pressure in cultured human anterior segments . am j ophthalmol , 2004 . 138 ( 6 ): p . 988 - 94 . [ 18 ] bogdanov , a . l . and peredkov , s . s ., use of su - 8 photoresist for very high aspect ratio x - ray lithography . microelectronic engineering , 2000 ; 53 : 493 - 496 . [ 19 ] liu , c ., recent developments in polymermems . adv mater , 2007 ; 19 : 3783 - 3790 . mata a ., fleischman a . j ., roy s ., fabrication of multi - layer su - 8 microstructure . j . micromech . microeng . 2006 ; 16 : 276 - 84 mataa a ., kima e . j ., boehma c . a ., fleischmana a . j ., muschlera g . f ., roya s . a three - dimensional scaffold with precise micro - architecture and surface micro - textures . biomaterials , 2009 . 30 ( 27 ): p . 4610 - 17 perkin t . w ., alvarado j . a ., polansky j . r ., stilwell l ., maglio m . and juster r . trabecular meshwork cells grown on filters . invest ophthalmol vis sci , 1988 . 29 ( 12 ): 1836 - 1846 freddo t . f ., patterson m . m ., scott d . r ., and epstein d . l . influence of mercurial sulfhydryl agents on aqueous outflow pathways in enucleated eyes . invest ophthalmol vis sci , 1984 . 25 : 278 - 285 w . h . spencer , j . alvarado , and t . l . hayes . scanning electron microscopy of human ocular tissues : trabecular meshwork . invest ophthalmol vis sci , 1968 . 7 ( 6 ): 651 - 662 johnson , d . h . trabecular meshwork and uveoscleral outflow models . j glaucoma 2005 ; 14 : 308 - 310 clayton t . mckee , joshua a . wood , nihar m . shah , marion e . fischer , christopher m . reilly , christopher j . murphy , paul russell , the effect of biophysical attributes of the ocular trabecular meshwork associated with glaucoma on the cell response to therapeutic agents . biomaterials , 2011 . 32 ( 9 ): 2417 - 2423 . sara m . thomasy , joshua a . wood , philip h . kass , christopher j . murphy , paul russell . substratum stiffness and latrunculin b regulate matrix gene and protein expression in human trabecular meshwork cells . invest ophthalmol vis sci . 2012 . 53 ( 2 ): 952 - 958 . julie a . last , tingrui pan , yuzhe ding , christopher m . reilly , kate keller , ted s . acott , michael p . fautsch , christopher j . murphy , paul russell . elastic modulus determination of normal and glaucomatous human trabecular meshwork . invest ophthalmol vis sci . 2011 april ; 52 ( 5 ): 2147 - 2152 . joshua a . wood , clayton t . mckee , sara m . thomasy , marion e . fischer , nihar m . shah , christopher j . murphy , paul russell . substratum compliance regulates human trabecular meshwork cell behaviors and response to latrunculin b invest ophthalmol vis sci . 2011 . 52 ( 13 ): 9298 - 9303 . | 2 |
bioparticles have been discovered which provide effective and generally complementary mechanisms for reducing the free concentration and biological effects of a broad range of toxins including drugs . recent advances in particle science engineering combined with developing molecular medicine have been found to provide highly effective therapeutic strategies aimed at effectively treating a wide variety of toxic poisonings , including drug poisonings . previously , applications for particle technology were limited by the size of available particles . for example , particles available for use had been too large to be effectively used with living organisms . with a reduction in size of available particles to less than 100 nm , or even as small as typical molecular dimensions ( 1 - 5 nm ), the invention has created bioparticles having nanoparticle sizes which are small enough to effectively interact with living organisms . it is noted that molecules may be less than 1 nm in diameter or larger than 5 nm in diameter . for example , proteins which are polymers or macromolecules can be 5 nm or larger in diameter . as used herein , the term nanoparticles refer to particles having sizes less than approximately 100 nm . these bioparticles can act to bind with targeted drugs and other toxic substances and / or to quickly degrade these drugs and toxins into largely inactive reaction products . the invention can have valuable applications for a wide variety of uses such as drug detoxification ( e . g ., drug overdose ), military ( e . g ., toxic warfare agents ), industrial ( e . g ., manufacturing processes ), environmental ( chemical spill clean up ), as well as many other purposes . drug poisonings may be treated by bioparticles which can use any or all of the following mechanisms : 1 ) partitioning a targeted drug onto the bioparticles by exploiting differences in physicochemical properties and / or using molecular templating to adsorb the drug onto functionalized surfaces of bioparticles ; 2 ) biotransforming a targeted drug into an inactive metabolite ( s ). for example , an enzyme , such as a human purified and genetically cloned high activity enzyme , may be incorporated into a bioparticle to provide biotransformation effects on a targeted drug or toxin , or 3 ) preferably , providing a bioparticle which combines both approaches ( 1 ) and ( 2 ). these above methods are not limited to oral or intravenous use , but could also be employed to remove toxins from biological surfaces such as skin or non - biological surfaces such as metal , wood or plastic . moreover , the above methods can be used to detoxify a broad range of toxins . the invention allows the synthesis of bioparticles that can directly reduce the free drug concentration in the blood , either by exclusively partitioning it inside the bioparticle , or more preferably , by partitioning and biotransforming the drug into an inactive metabolite within the bioparticle and ultimately promoting excretion from the body . with this approach , the principles of lipid partitioning and / or adsorption ( via molecular templating ) may act in a highly synergistic manner with those of biotransformation to provide drug detoxification systems with complementary detoxification mechanisms to provide added effectiveness . thus , by providing a very high local concentration of toxic drug ( substrate ), partitioning and / or adsorption can dramatically increase the rate of enzymatic degradation depending upon the km of the enzyme and its enzymatic efficiency in the bioparticle . nanoparticles ( such as those shown in fig1 ) have been created for treating a broad range of toxins . for example , “ soft particles ” such as microemulsions with nanoscale oil cores and “ soft / hard ” particles with hydrophobic cores for lipophilic drugs and various shells each permit relatively selective drug penetration . “ templated particles ” allow for toxins to be selectively fitted into pores in their surface generally with 1 or 2 point binding of the toxin to the nanoparticle . the above nanoparticle types can preferably also include an attached enzyme for even more rapid degradation of the target drug and / or toxin . soft / hard particles are ones consisting of a core composed of a liquid or a ( softer ) polymeric organic material surrounded by or encapsulated in a shell composed of an inorganic or ( harder ) polymeric organic material . the example of a liquid encapsulated in a shell of metal oxide or metal carbonate can be prepared by making a solution of the metal oxide precursor in an oil and exposing droplets of the solution to water or carbonate ion , respectively . this could be accomplished in aerosol or microemulsion apparatus . the example of a liquid encapsulated in a shell of organic polymer can be prepared by making a microemulsion stabilized by surfactant having reactive vinyl functionality , followed by initiating polymerization of the surfactant molecules around the surface of individual oil droplets in the system . the example of a ( soft ) polymeric organic core encapsulated in a ( hard ) polymeric shell can be prepared by dispersing a polymer gel in a solution of organic monomer precursor to a highly crosslinked or crystalline polymer , followed by initiation of polymerization of the dissolved monomer . templated particles are ones consisting of material , either as the core or shell component , that incorporates molecularly - sized and shaped pores into its structure . these materials can be prepared by including in the synthesis mixture suitably derivatized molecules or mimics ( the templates ) of the chemicals ( in this application the toxins ) of interest to be captured by the bioparticles . after the particles are formed and collected , the templating species are removed from the particles by dialysis or pyrolysis , leaving the desired pores as selective sites in which toxic molecules to be removed can be trapped . examples are various metal oxides or solid organic polymers that have pores templated for neural amines , aromatic compounds or terpenes . a shell containing pores can provide significant improve the effectiveness of nanoparticle - mediated drug detoxification . there are a number of potential design benefits of encapsulating either a hydrophilic or a hydrophobic environment with a solid shell containing nanopores . first , it could act to stabilize a nanoemulsion injected into the blood to prevent a dilutional effect on emulsion function . second , it could act as a highly selective molecular filter by allowing only molecules of certain physical dimensions access to the bioparticle interior . therefore , bioparticles could be targeted against at toxic molecules with molecular weights ( mws ) at or below the selected cutoff points of molecular size . third , by “ trapping ” locally high concentrations of coenzymes and cofactors important to cyp activity such as oxidoreductase ( mw = 75 , 000 ) and cytochrome b5 ( mw = 17 , 500 ) within the bioparticle interior and preventing their escape , a bioparticle with a shell incorporating nanopores would potentially enhance ( or at least help preserve ) optimal p450 enzymatic activity . the reconstitution of p450 enzymes , especially the cyp 3a4 fraction , may be technically challenging with regards to preserving its catalytic activity , especially in blood . inclusion of a shell can greatly aid this process . fourth , a bioparticle shell with nanopores could prevent proteolytic degradation of cyp fractions while in the blood ( i . e ., armor the enzymes ). it will allow ingress of smaller sized toxic drug molecules and easy egress of more water - soluble metabolites , but exclude those molecules greater than the pore size cutoff . in contrast , cyp fractions incorporated into soft bioparticles may not only be susceptible to degradation in blood , but their local concentrations of cofactors and coenzymes may not be preserved ( see the second point given above ). fifth , a solid shell with nanopores could be designed to provide a biodegradable platform where the functional activity of the bioparticle is determined by the blood half - life of biodegradable shell . that is , once the job of biotransformation is complete , the biodegradable particle can slowly disintegrate and releases the cyp fractions into the blood where they are degraded . sixth , design of the shell and its surface characteristics ( e . g ., ionicity , lipophilicity ) may be critical to prevent ( or minimize ) uptake into rbcs or the reticuloendothelial system ( res ), or eliminate the risk of hemolysis . the goal of bioparticle design is to keep the bioparticles within the vascular compartment . seventh , if the shell of the nanobioparticle is sized small enough to be directly excreted via the kidney , it may be possible to directly sequester a highly lipophilic drug within the bioparticle via partitioning and / or adsorption , or to attach it to even smaller sized nanoparticles by adsorption onto its surface . in a manner similar to what is observed clinically when the fab antibody digibind ® is used to treat digoxin toxicity , if the size of the “ nanoparticulobody ” ( a bioparticle acting functionally like an antibody ) is less than a 50 , 000 - 60 , 000 mw molecule , it may be directly excreted from the body by the kidneys , particularly if its surface has a neutral or positive charge . using molecular templating , highly selective adsorption of various molecules ( and members among their chemical class ) can be achieved . in this scenario , the p450 element of the bioparticle would not be needed . in essence , the nanoparticle is accomplishing phase i and ii biotransformation without the actual need for enzyme modification . that is , it renders the toxic drug molecule more polar by complexing it to a nanoparticle , which in turn allows excretion from the body . this type of adsorption would be highly selective and would most likely be applicable only to those molecules ( or class of drugs sharing a common chemical moiety ) it was originally designed for . in contrast , if a lipid partitioning system could be incorporated into a bioparticle , while keeping its size less than 50 - 60 kda , it would be useful for most lipophilic drugs . one approach for preparing such nanoparticles entails using the template - synthesis method . in this method , the pores in a microporous membrane or other solid are used as templates to prepare the nanoparticle . the membranes employed contain cylindrical pores with monodisperse diameters . the pore diameter can be controlled at will over a range from iess than 1 nm to as large as tens of micrometers . a correspondingly large range of nanoparticle sizes can be prepared . the template method is very versatile . it has been used to prepare nanoparticles composed of metals , semiconductors , other inorganic materials , carbons , etc . nearly any method used to prepare bulk materials can be adapted to allow for synthesis of nanoparticles within the pores of a microporous template membrane . significantly , a hollow tubular nanostructures can be obtained . membranes that have been used to prepare nanoparticles via the template method are shown in fig3 . these are microporous aluminas prepared electrochemically from aluminum metal . the upper set of micrographs shows an in - house prepared membrane of this type . in this case the pores are approximately 60 nm in diameter . the lower micrograph in fig3 shows a commercially - available membrane of this type . in this case the pores are 200 nm in diameter . these micrographs illustrate the important point discussed above that the pore diameter in such membranes ( and correspondingly the diameter of the nanoparticle obtained ) can be controlled at will . for these microporous alumina template membranes , the pore diameter is varied by varying the potential used during the electrochemical formation of the membrane . toxins can be adsorbed onto specialized nanoparticles to achieve drug detoxification . nanoemulsions have been synthesized for acutely reducing the free concentration of potentially toxic molecules . fig2 shows the effect of pluronic ® l - 44 micelles and microemulsions in reducing the concentration of the drug amitriptyline . a micelle may be defined as a colloidal aggregate of amphipathic ( surfactant ) molecules , which occurs at a well - defined concentration known as the critical micelle concentration . the typical number of aggregated molecules in a micelle ( aggregation number ) is from approximately 50 to 100 . poloxamer , or pluronic ® gels are made from selected forms of polyoxyethylene - polyoxypropylene copolymers in concentrations ranging from 15 to 50 weight %. poloxamers generally are white , waxy , free - flowing granules that are practically odorless and tasteless . aqueous solutions of poloxamers are stable in the presence of acids , alkalis and metal ions . commonly used poloxamers include the 124 ( l - 44 grade ) used above as well as 188 ( f - 68 grade ), 237 ( f - 87 grade ), 338 ( f - 108 grade ) and 407 ( f - 127 grade ) types , which are freely soluble in water . the trade name “ pluronic ®” is used in the us by basf corp ., of mount olive , n . j ., for pharmaceutical and industrial grade poloxamers . in the example shown in fig2 , a nanoemulsion was produced using pluronic ® l - 44 ( micelles ) with or without addition of ethylbutyrate ester . ethylbutyrate ester was added at a low ( me - i ) and high ( me - ii ) concentration . as seen in fig2 , the emulsion effectively sequestered significant quantities of amitriptyline , a tricyclic antidepressant agent with potential cardiotoxic effects , when compared to the saline control shown . the system labeled “ micelles ” did not possess the oil core of ethylbutyrate ester which was possessed by both me - 1 and me - ii . by comparing the micelles system to me - 1 and me - 2 , it can be seen that the oil core significantly increased the amount of amitripyline adsorbed , the higher oil concentration ( me - ii ) adsorbing significantly more amitripyline than the lower oil concentration ( me - i ). drugs that may be amenable to this type of detoxification are not limited to tricyclic antidepressant agents such as amitriptyline , but may include drugs and toxins from all drug classes that have an affinity for , tend to combine with , or are capable of dissolving in lipids ( lipophilic drugs ). many types of oils , surfactants , and cosurfactants may be used to produce bioparticles based on nanoemulsion technology . the bioparticle composition can be varied depending on the goal of the therapy and the specific properties of the target toxin . for example , a particle system prepared for intravenous use would , be preferably varied in composition compared to a similar system prepared for skin or metal decontamination . another type of bioparticle that can be used to detoxify drugs can be prepared using the template - synthesis method . template - synthesized nanoparticles can be either hollow nanotubules or solid nanoparticles and they can remove the toxic substance by either adsorption on their surfaces or extraction into the hollow part of the nanotubule . such template - synthesized nanoparticles can be composed of a wide variety of materials including metals , polymers . semiconductors , other inorganic materials , carbons , etc . the size of these nanoparticles ( both the diameter and the length ) can be controlled at will from the nm regime to the micrometer regime . one embodiment of this technology is to use the template method to prepare hollow cylindrical silica nanoparticles . these nanoparticles are preferably prepared by using sol - gel template synthesis of silica within the pores of a microporous alumina template membrane . the silica tubules in this case were prepared using tetraethylorthosilicate as the starting material ; however , other precursors are available for preparing silica via the sol - gel method . sol - gel silica nanotubules of this type have been prepared in the pores of various microporous alumina template of the type shown in fig3 . it has been shown that both the inside and outside diameters and the length of the silica nanostructures can be controlled by varying the diameter of the pores and the thickness of the template used . the tubular silica nanostructures prepared in this way can be derivatized both on their outside and inside surfaces with chemical and / or biochemical reagents . one approach for doing this is to use well - known silane chemistry . hundreds of silanes are available commercially , so this is a very versatile route for chemically and biochemically derivatizing these silica nanostructures . this is important because such derivatization allows these nanotubules to extract or adsorb specific chemical reagents and allows them to catalyze specific biochemical reactions . in addition because the inside and outside of the tubules can be derivatized with different reagents , the inside and outside chemistry / biochemistry can be different . this is important because , for example , it might be desirable to have the interior of the nanotubules hydrophobic so that they will extract specific molecules but the outside hydrophilic so that the nanotubules can be dispersed in an aqueous - based medium ( e . g . blood ). two embodiments of this concept are discussed herein . the first embodiment derivatizes the inside surfaces of the silica nanocylinders with a hydrophobic 18 carbon alkyl silane . in this case the outside surface is left underivatized so that the outside surface retains the hydrophilic character of silica . the second case entails derivatizing both the inside and outside surfaces with trimethoxybutyl aldehyde to introduce the aldehyde functionality to the surfaces . this aldehyde functionality can then be reacted with terminal amino sites on a protein molecule to covalently attach the protein to the nanotubules . attachment of the protein glucose oxidase ( god ) can be performed in this way . many other proteins have been attached using this general method . accordingly , it is a versatile way to attach proteins to the surfaces of these nanotubules . scanning electron micrographs of an alumina template membrane having a plurality of open pores which can be filled with silica nanotubes are shown in fig3 ( a )- 3 ( c ). fig3 ( a ) shows a surface image of an alumina template membrane demonstrating a high packing density of pores , the pores having diameters of approximately 60 nm . fig3 ( b ) shows a cross sectional image of the template membrane shown in fig3 ( a ) while fig3 ( c ) shows a perspective view of the template membrane . although 60 nm nominal pore diameters are shown , pore diameters of the template membrane can be readily controlled . in an embodiment of the invention , a long chain alkyl carbon ( such as c 18 ) is added to silica nanotubes positioned within a template membrane for the purpose of adsorbing a target molecule . it is noted that the field of protein and enzyme attachment to particles , otherwise referred to prolifically in the literature as “ enzyme immobilization ”, is a mature science , and that the methodologies described in this portion of the application are similar to ones described earlier but that the selection of which enzymes used and the overall particle composition is unique . the 18 - carbon alkyl ( c 18 ) silane was chosen because this renders the insides of the nanotubules hydrophobic . the nanotubules with the c 18 groups inside can then be used to extract hydrophobic molecules from a contacting solution phase . again , in this case the outsides of the nanotubules remain hydrophilic silica and this allows these tubules to be dispersed into solutions containing polar solvents . the most obvious example is water , but the same principle applies for other polar solvents . obviously , the outside could also be derivatized with the hydrophobic silane and such tubules could then be dispersed into solutions containing nonpolar solvents . other alkyl silanes could be used to tune the extraction selectivity of the derivatized nanotubules . examples include using shorter chain ( e . g . c 8 ) alkyl silanes to make the tubules less hydrophobic on the inside , using aromatic silanes , using silanes with specific chemical functionalities ( e . g ., acidic or basic ), etc . the hydrophobic c 18 silane - containing tubules were used to extract a hydrophobic target molecule ( 7 , 8 - benzoqunoline or bq ) from a dilute aqueous solution . extraction was accomplished in two ways . in the first method the hydrophobic nanotubules were left embedded within the pores of the template membrane , and a piece of the membrane was simply immersed into and then removed from the solution of the target molecule . removing the membrane also accomplished the removal of the target molecule bq sequestered inside . in the second method , the nanotubuies were liberated from the template membrane , by dissolving the membrane in phosphoric acid solution . the liberated tubules were then collected by filtration . the tubules were then dispersed into a solution of the target molecule . the solution was then filtered to remove the tubules as well as the target molecule bq sequestered inside . fig4 shows an example of the second method , dispersion of the liberated nanotubules . this figure shows first the uv absorption spectrum of a solution that was 1 × 10 − 5 m 7 , 8 benzoquinoline solution ( bq ). to this solution was first added silica nanotubules that did not contain the hydrophobic c 18 silane inside . ( 10 mg of tubules added per 100 ml of solution .) the solution was then filtered to remove these tubules and the solution spectrum was remeasured . note that there is essentially no change in the bq absorbance . this experiment showed that silica tubules that were hydrophilic on the inside did not extract the hydrophobic bq . an identical quantity of the c 18 derivatized tubules was then added to the solution . the solution was then filtered to remove the tubules and the spectrum was remeasured . as indicated by the lower absorbance , these tubules extracted 82 % of the bq from the solution . fig5 shows analogous data after addition of a second 10 mg of tubules per 100 ml of solution . after the second extraction 92 % of the bq was removed from the solution . in another embodiment of the invention , reactive molecules such as enzymes can be incorporated into nanoparticles to improve the drug detoxification ability of the nanoparticles . although enzymes are described herein , incorporation of any molecule capable of generating a chemical reaction or aiding in the rate of a chemical reaction with a target molecule can also be incorporated in nanoparticles to produce enhanced detoxification results . this approach detoxifies substances and surfaces by using nanoparticles as a platform to incorporate molecules such as enzymes for catalyzing the conversion of toxic substances into inactive substances ( or for generating chemical reactions with toxic substances ). protein ( i . e ., enzyme ) attachment to sio 2 nanotubules was achieved using 2 steps . a tubule wall was functionalized with an aldehyde - terminated silane . a protein was then coupled to the aldehyde through primary amino sites on the protein . the enzyme used , glucose oxidase ( god ), was the first protein tested . god effectively catalyzes the oxidation of glucose to glucono - 1 , 5 - lactone . in the presence of glucono - 1 , 5 - lactone , electrons shuttle to o 2 , creating hydrogen peroxide . in the presence of peroxidase ( pod ), hydrogen peroxide oxidizes o - dianisidine from a colorless to red form , which then can be assayed by monitoring its absorbance ( see fig6 ). for preliminary experiments performed , an intact alumina template membrane with the sio 2 / god nanotubules in the pores was utilized . the absorbance of a solution of glucose , o - dianisidine and pod immersed in a “ blank membrane ” ( without nanotube incorporation of god ) was determined to establish a baseline absorbance . al 2 o 3 / sio 2 / god membranes were then immersed into the glucose solution . the time dependent changes in the absorbance ( concentration ) of glucose ( assayed indirectly via oxidation of o - dianisidine ) were determined . the results are depicted in fig6 . based on the absorbance spectra shown , it is apparent that god incorporated into pores of the nanotubules converted much of the glucose in the solution to glucono - 1 , 5 - lactone upon immersion of the membrane ( at approximately 140 seconds ). as shown in fig6 , at approximately 400 seconds the membrane was removed from the solution . no further oxidation of glucose is observed because in removing the membrane the god incorporated inside is removed . the nanotubes are important because they are new morphologies of particulate material . they are also important , being newly available , for evaluation and use in biomedical applications either by themselves or modified as described in this application . however , the nanotube is not the only shape carrier / core particle that can be derivatized as is described in this application . many other shapes are useful , such as derivatized polyhedral - shaped porous ( templated or not ) nanoparticles . based on this observation , it was concluded that enzymes incorporated into nanoparticles can be used to degrade drugs . the linkage of enzymes to the inner surface of pores , can be achieved without losing the enzyme &# 39 ; s reactivity . although nanotubes having inner cavities for enzyme attachment was used , any shaped particle , whether tubular or not , having pores adapted for this purpose can have enzymes inside the pores . thus , any nanoparticles having pores , whether the pores are tubular or any other shape may be used with the invention . an identical approach ( i . e ., linking a cytochrome p - 450 ( cyp ) enzyme system ) to the inner surface of a nanoparticle ) can also be used to efficiently reduce the free concentration of lipophilic agents in human plasma and blood by a biotransformation dominated mechanism . analogous experiments have been done with nanotubules that were liberated from the template membrane , and substantially identical results were obtained . in this case the god was on both the inner and outer surfaces of the membrane . this is an advantage of the hollow nanotubule approach . having available inner and outer surfaces increases the surface area available for biocatalysis . as before , it might also be advantageous to separately derivatize the inner and outer surfaces . for example , the inner surface could be derivatized with a specific dye and the outer surface could be derivatized with a specific enzyme or other protein . in a second set of tubules , a second specific dye could be attached to the inside and a second specific protein to the outside . this could be continued for n tubules that contain specific dyes and specific proteins on the insides and outsides . the dye could then be used to identify the tubules . for example , green tubules could contain protein # 1 , blue tubules could contain protein # 2 , etc . in this way , in a mixture of tubules one could identify which tubules are catalyzing which biochemical process . hollow and solid nanoparticles can also be used for removal of lipophilic toxins . for example , nanoparticles , whether hollow or solid , having substantially polyhedral or spherical morphologies can be used for this purpose . studies were performed to establish whether the benzene ring moiety of the prototypical amide local anesthetic , bupivacaine , possessed sufficient electron enrichment to enable π - π electron bonding to an electron deficient molecular moiety attached to a solid nanoparticle . specifically , when a mimic of bupivacaine was mixed with the dinitrobenzamide moiety , a number of changes in spectral values occurred . specifically , the uv - vis diffuse shoulder from 280 - 320 nm moved to a diffuse shoulder from 340 - 400 nm . complexation of the pi - pi type between bupivacaine and its mimics , and several electron deficient aromatics , including a dinitrobenzamide ( designed for convenient subsequent attachment to nanoparticles ), has been proven using proton nmr spectrometry . tables 1 and 2 show the chemical shift values observed for test systems relevant to this application . this data is consistent with the ranges published ( dust , 1992 ) for other π complexed electron deficient and electron rich benzene rings . thus , the dinitrobenzamide moiety can be attached to carrier nanoparticles during synthesis for use treating local anesthetic detoxification primarily by π - π complexation which can take place on solid or soft / hard nanoparticles , and with or without two - point binding or templated cores or shells . further experiments were performed to determine the effectiveness of various emulsions to reduce the free concentration and toxic effects of other drugs . as shown in fig7 - 9 , the cardiotoxic effects of bupivacaine , a local anesthetic , were significantly reduced using a macroemulsion of intralipid . fig7 shows a macroemulsion of intralipid . intralipid attenuates bupivacaine - induced sodium current ( i ns ) in guinea pig ventricular myocytes . panel a shows examples of current traces in response to depolarization to − 20 mv from a holding potential of − 100 mv during interventions shown near cach records . panel b shows the change in current peaking as a function of time . horizontal bars above panel b denote the duration of drug administration . panel c summarizes the effect of bupivacaine ( 5 , 10 and 20 μm ) and intralipid ( 1 . 5 %) on i ns . all data was normalized to a control current . bars represent the mean ± sem of 5 - 7 myocytes . fig8 shows concentration - dependent in vitro attenuation of bupivacaine ( 1 μm ). bupivacaine induces qrs prolongation in guinea pig isolated hearts , paced at 200 beats per minute ( bpm ) as shown in fig8 . fig8 shows the mean ± sem of 4 experiments ( p & lt ; 0 . 05 ). as shown in fig8 , increasing intralipid concentations reduce qrs prolongation caused by bupivacaine 1 %. fig9 shows the attenuation of in - vivo cardiotoxic effects of bupivacaine in isofluanc - anesthetized rates . specifically , the effect of an iv bolus of bupivacaine ( 8 mg / kg over 10 scc ) on the qrs interval is shown . compared to time matched controls , intralipid ( 3 ml / kg / min over 2 min ) more rapidly attenuated bupivacaine induced prolongation of the qrs interval . two additional experiments were also carried out , both yielding similar results . therefore , compared to available methods , bioparticles which may be produced using the invention have numerous advantages over current methods for treating drug toxicity . advantages from the invention are enhanced through use of complementary approaches including lipid partitioning , adsorption and xenobiotic biotransformation . bioparticles using lipid partitioning and / or drug biotransformation produced using the invention not only scavenge most toxic drugs that are more lipophilic ( active drug state normally ) but also offer broader substrate usage . for example , various soft bioparticles can effectively reduce the free blood concentration of all virtually lipophilic drugs . moreover , appropriately chosen enzymes incorporated into bioparticles can further improve the bioparticle &# 39 ; s therapeutic performance and applicability by adding metabolization effects applicable to a broad range of drugs . if desired , the feature of chemical selectivity inherent in immunotoxicotherapy can be incorporated into bioparticles by using the processes of molecular templating and / or adsorption onto functionalized surfaces . using bioparticles , large lipid - water partition coefficients for highly lipid soluble substances such as amiodarone indicate that the free concentration of this antiarrhythmic agent can be effectively reduced by using a concentration of soft bioparticles in the bloodstream that should not be detrimental to cell function ( approximately 1 . 5 % maximum ). a bioparticle having a large lipid - water partition coefficient ( e . g . 10 , 000 ), where the lipid component of the bioparticle is either liquid solid core , or lipophilic molecular entities attached to the surface of an inorganic core can bind a large fraction of highly lipophilic drugs . thus , a drug &# 39 ; s free blood concentration can be effectively reduced in a small volume of soft bioparticles . in a preferred embodiment of the invention , bioparticles containing p450 cytochrome components such as a cyp 3a4 fraction are used to not only offer broad substrate detoxification , but also to produce rapid elimination of toxins from the blood . cyp3a4 and cyp2d6 hepatic microsomal fractions of the p450 system can biotransform approximately 55 % and 25 %, respectively , of virtually all xenobiotics [ benet l z , kroetz d l and sheiner l b , pharmacokinetics in goodman and gilman &# 39 ; s , pharmacological basis of therapeutics ( 1996 ) eds hardman jg and limbird le , 9th edition , mcgraw hill , pp 3 - 27 .] cytochrome results in an enhanced drug elimination rate by either increasing the quantity or quality of enzyme ( e . g ., selecting high activity enzyme systems using genetic polymorphisms or molecular cloning ) and / or optimizing the environment of the enzyme ( substrate concentration , cofactor levels , hydrophilicity for optimal enzyme functioning ). bioparticles can provide partitioning and a biotransformation to take advantage of the potential synergistic actions which can result from initially partitioning a drug at high local concentrations in an environment containing high concentrations of an enzyme . this synergy can dramatically increase the efficiency of the substrate degradation if the toxic drug concentration occurs well below the km value . for example , partitioning a toxic drug from the bloodstream into the lipid environment of a bioparticle containing a genetically engineered p450 enzyme designed for super high efficiency ( e . g ., supersomes ) should not only effectively and promptly reduce the free blood concentration of xenobiotics in the blood but also concentrate the toxic drug in an area adjacent to the active enzyme . this can promote extremely efficient catalysis and degradation of target molecules . the beneficial effects of bioparticles formed using the invention are expected to be greatly enhanced by concentrating a large enzyme mass , such as genetically engineering p450 fractions selected for super high activity within the biocompatible particle . preferably , the bioparticle should have a large internal surface area whose efficiency of catalyzing its substrate to its metabolite is marked augmented by the concentrating effect of the soft bioparticle component ( e . g ., exposes the enzyme to a high concentration of its substrate ). in addition to its substrate concentrating effect , another advantage gained by incorporating a lipid matrix within the bioparticle is that this structure may dramatically increase the intrinsic biocatalytic efficiency of an enzyme . salt - immobilized hydrolytic and co - factor requiring enzymes ( lyophilizates of enzyme in a salt matrix ) in organic solvents have been shown to have 100 - 3000 times more activity than that observed in aqueous mediums ( u . s . pat . no . 5 , 449 , 613 to dordick , et al .). this technology applied to cyp fractions located within bioparticles can produce extremely efficient biocatalytical tools for drug detoxification , particularly when preferred high efficiently molecular cloned supersomes are used . numerous products can be produced from the invention including those composed of multiple types of nanoparticles for in - vivo detoxification of drugs and toxins from humans or animals . for example , nanoparticles can be synthesized for attenuating acute cardiotoxic effects of tricyclic antidepressant drugs ( e . g ., amitriptyline ). however , the invention is not limited only to tricyclic antidepressants , but encompasses all drug classes that may cause toxicity . in addition , biological toxins ( e . g ., snake and insect envenomation ) may also be detoxified using the invention . this can ensure human and animal safety and welfare . furthermore , endogenous toxins produced during organ dysfunction or failure ( e . g ., hepatic or renal failure ) may also be removable using the invention to create “ circulating hepatocytes ” or “ circulation nephons .” another potential product which can be produced from the invention is a product for detoxification of poison warfare agents that are used for military purposes ( e . g ., nerve gas ). it is noted that warfare agents may be solids , liquids or gases . warfare agents can cause massive intoxification of substances such as acetylcholine or tissue necrosis from direct toxicity ( e . g ., mustard gases ). rapid and simultaneous removal of both the warfare agent and molecules causing injury may prove to be effective therapy to mitigate the dangers of these weapons of mass destruction . for example , bioparticles produced using the invention could be used intravenously to reduce the concentration of both the toxin ( e . g ., sarin ) and acetylcholine . alternatively , the invention can be used for skin or metal decontamination for other types of toxic warfare agents such as mustard gas . | 0 |
fig1 shows a simple embodiment of the invention in order to explain the basic principle . two coils 1 and 2 , which each consist of one winding 7 , are disposed on a printed circuit board 8 for generating a dipole 24 . each winding 7 is disposed on the printed circuit board 8 in the form of a strip conductor 9 , and is loaded with current via connections 25 . the windings 7 form rectangular windows 16 with rounded edges , wherein the long sides 17 of the windows 16 are oriented along an imaginary axis 10 . the axis 10 is the optical axis when the multipole coils are used in the field of particle optics . the printed circuit board 8 is made from a flexible material and rolled into a cylinder which is hollow inside , such that the two coils 1 , 2 concentrically enclose the axis 10 . fig2 shows a sectional view of one embodiment , in which the printed circuit board 8 is rolled in several printed circuit board layers 11 , 12 , 13 , 14 . these multipole coils 1 , 2 , 3 , 4 form a quadrupole 31 , since four coils 1 , 2 , 3 , 4 are concentrically disposed about an imaginary axis 10 ( optical axis ). the section in a plane 19 perpendicular to the axis 10 thereby shows the cut strip conductors 9 , which extend perpendicularly to the axis 10 . this illustrates that the strip conductors 9 of the windings 7 of the different printed circuit board layers 11 , 12 , 13 , 14 are precisely stacked in a radial direction . this is particularly important to obtain an exact coil geometry and thereby exact fields when the multipole coils 1 , 2 , 3 , 4 are intended for correcting aberrations in particle optics . gluing can secure exact positioning . in this representation , one can clearly see how reduced the construction height of a multipole coil of this type is , in particular , in a region of the four layers of circuit board 11 , 12 , 13 , 14 , wherein a large number of multipole coils can be configured within this constructional height e . g . a hexapole , octupole or twelve pole . if one compares this to conventional wound coils ( for examples as seen in the figure in nanos , page 27 , op . cit . ), then the constructional size difference is quite clear as is the resulting changed geometry . in this manner , much purer multipole fields can be more easily produced . fig3 shows a perspective view of a printed circuit board 8 rolled into several layers 11 , 12 , 13 , 14 . this example shows the design of the strip conductors 9 as windings 7 in a spiral arrangement 15 . only one spiral arrangement 15 is shown as an example . they are , in fact , superposed like the windings 7 of fig2 . the strip conductors 9 of the spiral arrangement 15 of the different printed circuit board layers 11 , 12 , 13 , 14 can be connected by through - connections 23 , such that all windings 7 of one coil are interconnected . the coils that belong to a multipole element are correspondingly interconnected again to alternately generate one south pole and one north pole of the respective magnetic fields . a rolled printed circuit board 8 of this type may thereby also contain coils 1 , 2 , 3 , 4 , 5 , 6 etc . of several multipoles . the supply lines 34 guided on the edges may serve for interconnecting the coils of one multipole or also for current loading of one or more multipoles at the connections 25 . also shown are the rectangular windows 16 formed by the windings 7 . fig4 shows a section through a printed circuit board 8 with strip conductors 9 . the strip conductors 9 are thereby mounted to the front side 20 of the printed circuit board 8 and covered by an insulating layer 22 . strip conductors 9 may accordingly also be disposed on the rear side 21 of the printed circuit board 8 . this is advantageous in that twice as many windings 7 or spiral arrangements 15 of windings 7 can be formed as there are printed circuit board layers 11 , 12 , 13 , 14 . in this case , the insulating layer 22 is required for electrically separating the strip conductors 9 . during winding of the printed circuit board 8 , a glue layer is additionally provided on the full surface , which secures the positions of the coils and thereby also improves dissipation of heat . for this reason , a connection without air gaps is advantageous . fig5 shows a section through a dipole 24 , in which the printed circuit board 8 is not shown . this figure shows that each coil 1 and 2 extends over an area of 120 °, which is utilized to generate a very pure dipole field . in this view , the strip conductors 9 are cut in a plane 19 perpendicular to the axis 10 , and the winding centers 18 are illustrated which , in simple windings 7 like this , extend in the center of the strip conductors 9 . rolling of the printed circuit board 8 ( not shown ) provides the strip conductors 9 with the illustrated circular arc shape , which is also advantageous for generating fields , which shall act with optimum precision on the area of the axis 10 . fig6 shows a similar section in a plane 19 perpendicular to the axis 10 , with two dipoles 24 and 24 ′ disposed on different printed circuit board layers 11 , 12 . only the strip conductors 9 of the windings 7 of the coils 1 and 2 of the respective dipoles 24 and 24 ′ are thereby illustrated but not the printed circuit board 8 with its layers 11 and 12 . it is rolled in two layers in correspondence with fig2 and 3 . this shows how the dipoles 24 and 24 ′ can be superposed through two printed circuit board layers 11 , 12 , thereby providing an arrangement which cannot be produced using conventional wound coils . the coils 1 and 2 of the respective dipoles 24 and 24 ′ can naturally also be designed as spiral arrangements 15 in order to reinforce the generated magnetic forces . it is thereby also possible to provide more than two printed circuit board layers 11 , 12 to ensure that the number of windings 7 of the two dipoles 24 and 24 ′ can be further increased . fig7 shows one example of a coil arrangement 1 , 2 , of a dipole 24 or 24 ′, wherein the windings 7 are spirally arranged 15 , and wherein the coils 1 and 2 are formed from windings 7 , 15 on the front side 20 of a printed circuit board , shown in the upper area of fig7 , and additional windings 7 , 15 on the rear side 21 of the printed circuit board , shown in the lower area of fig7 . the printed circuit board 8 is not shown either . only the strip conductors 9 mounted to the printed circuit board 8 of the front side 20 are shown in the upper part of the figure and the strip conductors 9 of the rear side 21 of the printed circuit board 8 are shown in the lower part of the figure . the through - connections 23 are connected to each other at a and b to produce an electric connection 35 between a and b in the upper part of the drawing , which is symbolically shown with dashed lines and corresponds to the connection via the windings 7 of the spiral arrangements 15 , shown in the lower part of the figure . the printed circuit board 8 is rolled in correspondence with fig1 . the dipole 24 or 24 ′ must then only be loaded with current via the connections 25 to produce a current flow , as indicated by arrows 33 and 33 ′. in this fashion , two coils 1 , 2 are available which generate reverse - poled magnetic fields . fig8 shows one example of a coil arrangement with coils 1 , 2 , 3 , and 4 , which form a quadrupole 31 . the view corresponds to the above - described , wherein the interconnection is correspondingly varied , such that the connections 35 shown in the upper part exist only between the coils 1 and 2 and the coils 3 and 4 via the corresponding windings 7 on the rear side 21 of the printed circuit board , and the windings 7 of the front side 20 of the printed circuit board are connected directly between the coils 2 and 3 . in this fashion , the coils 1 , 2 , 3 and 4 are also interconnected in the quadrupole 31 , which results in that the north and south poles of the magnetic fields alternate . the printed circuit board 8 is naturally also rolled in this case , such that the coils 1 , 2 , 3 , 4 concentrically enclose the axis 10 . this view also shows that the spiral arrangement 15 has more windings 7 on the front side 20 of the printed circuit board 8 than the spiral arrangement 15 on the rear side 21 of the printed circuit board 8 . in consequence thereof , the outer spiral arrangements 15 have more windings 7 than the inner when the printed circuit board 8 is rolled in such a fashion that its rear side 21 faces to the inside and its front side 20 faces to the outside . the dash - dotted lines show that the winding centers 18 of each spiral arrangement 15 are in the center of the windings 7 , which form the respective spiral arrangements 15 . these winding centers 18 must be arranged in such a fashion that they all coincide with the radii in a plane 19 perpendicular to the axis 10 . this applies not only for the front side 20 and the rear side 21 of a printed circuit board 8 but also for several printed circuit board layers 11 , 12 , 13 , 14 etc . fig9 shows another example of a coil arrangement of a hexapole 32 with six coils 1 , 2 , 3 , 4 , 5 , 6 . the windings 7 are thereby also shown as spiral arrangements 15 on the front side 20 of the printed circuit board 8 ( top ) and the rear side 21 of the printed circuit board 8 ( below ), wherein the printed circuit board 8 itself is not shown . the double arrows also indicate that the electric connections 35 between a and b , c and d , e and f of the windings 7 of the front side 20 are realized via the windings 7 on the rear side 21 by providing through - connections at points a , b , c , d , e and f . otherwise , the above - described applies . fig1 shows an arrangement of the inventive multipole coils 1 , 2 , 3 , 4 , 5 , 6 in a lens 26 which is designed as a magnetic lens . the enumeration of six coils is naturally only an example . any number of multipole elements may be disposed , as mentioned above , even a combination of several multipole elements . they are preferably arranged below the magnetic gap 28 formed by the pole shoes 37 , in the beam passage opening 27 of the lens 26 . the housing of the lens 26 is shown in sectional view , such that the windings 38 , which are also shown in sectional view , can be seen in the sectional view of the iron circuit 39 . the behavior of the electron beam 36 , which is influenced by the lens 26 , is also shown . since the inventive multipole coils 1 , 2 , 3 , 4 , 5 , 6 require very little installation space , they may either be disposed directly in the beam passage opening 27 of the lens 26 without impairing the electron beam 36 , or if more space is required , a recess may be provided in the beam passage opening 27 for inserting the printed circuit board 8 including multipoles . fig1 shows such a recess 29 in an arbitrary particle - optical component , e . g . a steel tube 30 . a recess 29 of this type may be disposed on the outer side ( as shown ) or on the inner side of the beam passage opening 27 in correspondence to the lens 26 of fig1 . the printed circuit board layers 11 , 12 , 13 etc . may thereby be easily inserted into any recess 29 . the recess 29 need not be designed in such a fashion that the rolled printed circuit board 8 can be mounted by sliding it on . the drawings naturally only symbolically show a few embodiments . many variations are feasible . the windings 7 could also be disposed in circles or ovals . the rectangular shapes could also have a different position , or much more complex arrangements could be provided by disposing many multipole coils 1 , 2 , 3 , 4 , 5 , 6 in many printed conductor board layers 11 , 12 , 13 , 14 which are used to correct a plurality of aberrations in particle optics . depending on the purpose of use , the different coils must , of course , be correspondingly interconnected , wherein even separate control of individual coils would be feasible or also an interconnection of several multipole coils , possibly also by introducing further electric or electronic components . the drawing is only designed to give an exemplary idea of the invention . 1 , 2 , 3 , 4 , 5 , 6 multipole coils or coils 35 connection via windings on the rear side of the printed circuit board | 7 |
according to fig1 , a clip connection 1 , with the help of which a first component 2 can be fastened without tools to a second component 3 in a joining direction 4 indicated by an arrow , comprises a plug - in pin 5 that is arranged fixed on the first component 2 and a sleeve 6 that is arranged fixed on the second component 3 . according to the fig1 and 2 , a longitudinal centre axis 7 of the plug - in pin 5 runs parallel to the joining direction 4 . the plug - in pin 5 comprises a conical longitudinal section 8 proximally with respect to the first component 2 , which tapers with increasing distance from the first component 2 or in the joining direction 4 . according to the fig1 and 3 , a longitudinal centre axis 9 of the sleeve 6 runs parallel to the joining direction 4 . furthermore , the sleeve 6 comprises multiple radially resilient spring elements 10 , which axially project from the sleeve 6 . in the plugged state of fig1 , the spring elements 10 support themselves with their free ends 11 , which are arranged distally from the sleeve 6 , on the conical longitudinal section 8 of the plug - in pin 5 in such a manner that they lie against the same under radial preload . through the conicity of the conical longitudinal section 8 , the sleeve 6 is thereby driven in the joining direction 4 relative to the plug - in pin 5 . as reaction thereto , the plug - in pin 5 is driven against the joining direction 4 relative to the sleeve 6 . according to fig1 to 3 , the clip connection 1 additionally comprises multiple radially resilient engagement hooks 12 , which in the plugged - in state are engaged with at least one engagement contour 13 that is complementary to the former . here , the engagement lugs 14 of the engagement hooks 12 radially engage behind said engagement contour 13 in such a manner that the engagement hooks 12 via their engagement lugs 14 support themselves opposite to the joining direction 4 on the engagement contour 13 . through the axial preload between sleeve 6 and plug - in pin 5 , the engagement hooks 12 are axially preloaded for lying against the engagement contour 13 . accordingly , the clip connection 1 in the plugged state is axially free of play . in the embodiment shown in the fig1 to 4 , the engagement hooks 12 are arranged on the plug - in pin 5 distally from the first component 2 . in particular , the engagement hooks 12 are integrally moulded on the plug - in pin 5 . the respective engagement contour 13 in this case is integrally moulded on the sleeve 6 . in principle , an embodiment is also conceivable in which the engagement contour 13 is formed on the second component 3 . the plug - in pin 5 can thus be plugged into the sleeve 6 in the joining direction 4 with the engagement hooks 12 up front . in the process , the engagement hooks 12 penetrate an interior enclosed by the sleeve 6 . in the shown example of the fig1 to 4 , the plug - in pin 5 comprises a cylindrical longitudinal section 15 , from the free face end 16 of which the engagement hooks 12 project , and which axially adjoins the conical longitudinal section 8 . the free face end 16 of the cylindrical longitudinal section 15 faces away from the conical longitudinal section 8 . according to fig1 , the sleeve 6 can now comprise in its interior at least one axial stop 17 which is indicated by an interrupted line . the axial stop 17 in this case radially projects towards the inside between two engagement hooks 12 which are adjacent in the circumferential direction . preferentially , exactly two engagement hooks 12 are provided which are arranged diametrically opposite one another . the respective axial stop 17 now radially projects into the gap between the two engagement hooks 12 . because of this , the axial stop 17 can axially interact with the face end 16 in order to limit a plug - in depth for the plug - in pin 5 to a predetermined value . here , the respective axial stop 17 and the face end 16 are matched to one another so that in the plugged state shown in fig1 , in which the engagement hooks 12 with their engagement lugs 14 axially lie against the respective engagement contour 13 , an axial distance 18 between the respective axial stop 17 and the face end 16 is present . in this way , a tolerable over - plugging of the plug - in pin 5 into the sleeve 6 is made possible . in the embodiment shown in the fig1 to 4 , a common engagement contour 13 is provided for all engagement hooks 12 , which is formed by an axial face end 19 of the sleeve 6 facing away from the spring elements 10 . furthermore , the sleeve 6 , with this embodiment , can comprise in its interior guide grooves which are not noticeable here for axially guiding the engagement hooks 12 during the plug - in operation . the guide grooves in this case are orientated parallel to the longitudinal centre axis 9 of the sleeve 6 . the engagement hooks 12 radially engage in the guide grooves , as a result of which a slot and key guide is formed . in the embodiment shown in the fig5 and 6 , the engagement hooks 12 are arranged on the sleeve 6 , in particular integrally moulded thereon . the respective engagement contour 13 in this case is arranged on the plug - in pin 5 or on the first component 2 . here , too , exactly two engagement hooks 12 are provided which are located diametrically opposite one another . the associated engagement contour 13 in the example is formed on a support 20 in each case , from which the plug - in pin 5 originates and which in this case forms an integral part of the first component 2 . in this embodiment , the engagement hooks 12 are arranged on the sleeve 6 radially outside , while extending parallel to the joining direction 4 . in the embodiment shown in the fig5 and 6 , the free ends 11 of the spring elements 10 and the free ends of the engagement hooks 12 carrying the engagement lugs 14 are orientated in the same direction , namely in each case in the joining direction 4 . in contrast with this , it is provided in the embodiment shown in the fig1 to 4 that the free ends of the engagement hooks 12 are orientated opposite to the free ends 11 of the spring elements 10 . while the free ends of the engagement hooks 12 extend in the joining direction 4 , the free ends 11 of the spring elements 10 extend opposite to the joining direction 4 . with the embodiment shown in the fig5 and 6 , the interaction of the spring elements 10 with the conical longitudinal section 8 also results in an elimination of the axial play between the plug - in pin 5 and sleeve 6 , so that this clip connection 1 is also axially free of play . in the case of the embodiment shown in the fig1 to 6 , the spring elements 10 are arranged on the spring 6 distributed in the circumferential direction , wherein they axially project from the sleeve 6 in each case and are separated from one another in the circumferential direction by axial slots 21 . furthermore , the free ends 11 of the spring elements 11 are radially chamfered on the inside in order to form a chamfered insertion region 22 of the sleeve 6 . this insertion region 22 simplifies inserting the plug - in pin 5 into the sleeve 6 during the plug - in operation . according to the fig1 and 2 , a locking element 23 can be provided which prevents or at least impedes a radial disconnecting of the engagement hook 12 from the respective engagement contour 13 . in the example indicated in fig1 , the locking element 23 is a separate element subsequently inserted into the sleeve 6 , which impedes the radial movability of the engagement hooks 12 . this locking element 23 in this case is inserted into the sleeve 6 on the face end 19 facing away from the spring elements 10 . in contrast with this , another embodiment is indicated in fig2 , in the case of which such a locking element 23 is adjustably arranged on the plug - in pin 5 . here , an unlocking state and a locking state of the locking element 23 are indicated by a continuous line and an interrupted line respectively . in the unlocking state , a detent 24 of the locking element 23 lies for example against the face end 16 of the cylindrical section 15 . in the locking state , the detent 24 by contrast is adjusted as far as into the region of the engagement lugs 14 . adjusting the detent 24 can be effected for example by means of a rod 25 , which extends through a central opening 26 of the plug - in pin 5 , so that the locking element 23 following the insertion of the plug - in pin 5 into the sleeve 6 and following the engagement of the engagement hooks 12 with the respective engagement contour in the joining direction 4 can be transferred into a locked position . as is indicated in the fig4 to 6 , the respective plug - in pin 5 is practically moulded integrally on the first component 2 . in particular , the first component 2 is a one - piece injection moulded part produced from plastic . similar applies also to the respective sleeve 6 which is preferably integrally moulded on the second component 3 . the second component 3 is preferably also an injection moulded part produced in one piece , preferentially from plastic . the fig4 to 6 show an assembly 27 , which comprises at least the first component 2 and the second component 3 . here , the first component 2 and the second component 3 are connected to one another with the help of at least one clip connection 1 of the type mentioned above . in the examples of fig4 to 6 , three clip connections 1 are provided in each case in order to fasten the two components 2 , 3 to one another . the one component is purely exemplarily a suction module 28 , which in a suction module housing 29 comprises a flap arrangement , of which a flap shaft 30 is noticeable only in fig6 . by turning the flap shaft 30 , multiple flaps for controlling fresh air ducts are adjusted within the module housing 29 . in the example shown in fig4 , the suction module 28 forms the second component 3 which comprises the sleeves 6 . in contrast with this , fig5 and 6 show an example in the case of which the suction module 28 forms the first component 2 , which comprises the plug - in pins 5 . on the module housing 29 , a support 20 is formed for each clip connection 1 , which in the region of fig5 and 6 in each case comprises a plug - in pin 5 with conical longitudinal section 8 . in the example of fig4 , by contrast , the sleeve 6 is arranged on the support 20 , while the spring elements 10 are located distally from the support 20 . the other component in the present example is an actuating device 33 , which comprises for example a pressure capsule 31 . on an actuating device housing 32 , the plug - in pins 5 ( fig4 ) or the sleeves 6 ( fig5 and 6 ) are arranged in each case depending on embodiment . in the example of fig4 , the actuating device thus forms the first component 2 while in the example of fig5 and 6 it forms the first component 3 . accordingly , in the embodiment shown in fig4 , seemingly kinematically reversed with respect to the embodiment shown in the fig5 and 6 , the sleeves 6 are arranged on the suction module housing 29 and the plug - in pins 5 on the actuating device housing 32 . accordingly , the actuating device 33 in the example of fig4 forms the first component 2 , while the second component 3 is formed by the suction module 28 . with the help of the clip connections 1 , the two components 2 , 3 , i . e . actuating device 33 and suction module 28 , can be fastened to one another without tools , wherein in addition any play in the joining direction 4 can be additionally eliminated . | 5 |
65 is a key measurement line pair , one for “ no ” and one for “ yes ” for indicating the incorrect or the correct depth gauge depending upon the depth that the depth gauge is able to be inserted into a lock and whether or not it strikes or slides under a lock wafer in it &# 39 ; s rest position . 70 b is a back side of the modified key blank . 80 is a wafer slot for positioning at the inner wafers of a lock . 85 is the active key side for the inner wafers of the lock . 90 is a wafer slot for positioning at the outer wafers of the lock . 95 is the active key side for the outer wafers of the lock . 100 is a slot or depression milled into the modified key blank for accepting the release and insertion tool 10 and depth tools 50 . 140 are holes added to the modified key blank . the holes are placed there to assist in the use in gauging the spacing from one wafer position to the next wafer position while the user is moving the key from one wafer position to the next wafer to be read . for this tool demonstration it &# 39 ; s assumed that the wafer lock being measured has seven wafer positions and four possible depths . to use the tool , the user would first place the insertion / release tool ( 10 ) into the slot ( 100 ) on the modified key ( 70 a ), this will allow the modified key to enter the keyway completely without trapping the wafers in the wafer trap ( 80 ). with the modified key ( 70 a ) fully seated in the lock the wafer trap ( 80 ) will be aligned with the seventh wafer in the lock . once the modified key ( 70 a ) has been placed fully within the keyway , the insertion / release tool ( 10 ) is removed allowing the wafer ( 120 ) in position seven to drop into the wafer trap ( 80 ) to its resting position . the # 4 depth slide ( 45 ) is then fully inserted into the slot ( 100 ) of the modified key ( 70 a ). this motion will cause the measurement line ( 60 ) to align with either the yes or the no ( 65 ) on the modified keyblank ( 70 a ). if , the measurement line ( 60 ) aligns with the yes ( 65 ), the depth for the wafer in position seven is a four depth . the # 4 depth slide ( 45 ) would then be removed and the insertion / release tool ( 10 ) would be inserted to lift the wafer out of the wafer trap ( 80 ) and allow the modified key ( 70 a ) to be moved outward using the holes ( 140 ) in the key as a guide to measure the distance to the next wafer position to be measured . once in position the insertion / release tool ( 10 ) is removed trapping the next wafer to be measured . if , the measurement line ( 60 ) aligns with the no ( 65 ), the # 4 depth slide ( 45 ) is removed and the # 3 depth slide ( 35 ) would be inserted in the slot ( 100 ) of the modified key ( 70 a ). if the measurement line ( 60 ) aligned with a yes ( 65 ) the depth for the wafer is position seven would be a three depth . the # 3 depth slide ( 45 ) would then be removed and the insertion / release tool ( 10 ) would be inserted to lift the wafer out of the wafer trap ( 80 ) and allow the modified key ( 70 a ) to be moved outward using the holes ( 140 ) in the key as a guide to measure the distance to the next wafer position to be measured . once in position the insertion / release tool ( 10 ) is removed trapping the next wafer to be measured . if , the measurement line ( 60 ) aligns with the no ( 65 ), the # 4 depth slide ( 45 ) is removed and the # 3 depth slide ( 35 ) would be inserted in the slot ( 100 ) of the modified key ( 70 a ). if the measurement line ( 60 ) aligned with a no ( 65 ) again the # 3 depth slide ( 35 ) would be removed and the # 2 depth slide would be inserted in the slot ( 100 ) of the modified key ( 70 a ). if the measurement line ( 60 ) of the # 2 depth slide aligned with a yes ( 65 ) the depth for the wafer is position seven would be a two depth . the # 2 depth slide ( 45 ) would then be removed and the insertion / release tool ( 10 ) would be inserted to lift the wafer out of the wafer trap ( 80 ) and allow the modified key ( 70 a ) to be moved outward using the holes ( 140 ) in the key as a guide to measure the distance to the next wafer position to be measured . once in position the insertion / release tool ( 10 ) is removed trapping the next wafer to be measured . if , the measurement line ( 60 ) aligns with the no ( 65 ), the # 4 depth slide ( 45 ) is removed and the # 3 depth slide ( 35 ) would be inserted in the slot ( 100 ) of the modified key ( 70 a ). if the measurement line ( 60 ) aligned with a no ( 65 ) again the # 3 depth slide ( 35 ) would be removed and the # 2 depth slide would be inserted in the slot ( 100 ) of the modified key ( 70 a ). if the measurement line ( 60 ) of the # 2 depth slide aligned with a no ( 65 ) again , then the depth for wafer position seven is a one depth . the # 2 depth slide ( 45 ) would then be removed and the insertion / release tool ( 10 ) would be inserted to lift the wafer out of the wafer trap ( 80 ) and allow the modified key ( 70 a ) to be moved outward using the holes ( 140 ) in the key as a guide to measure the distance to the next wafer position to be measured . once in position the insertion / release tool ( 10 ) is removed trapping the next wafer to be measured . the procedure described above would be repeated for wafer positions seven through four . for wafer positions three through one of the lock they are measured using the modified key ( 70 b ). the wafer trap ( 90 ) is designed to align with wafer position three when the modified key ( 70 b ) is fully inserted . the procedure for determining the depths for positions three through one is the same as described above with the exception of using side b of the modified key ( 70 b ) instead of side a of the modified key ( 70 a ). once the depths for each of the seven wafer positions has been recorded , a keyblank can be cut to the recorded depths to operate the lock . note : all the wafer positions can be read from side a of the modified key ( 70 a ), however using side b of the modified key ( 70 b ) will increase the accuracy of the tool by allowing the modified key to be inserted further into the lock when using the depth gauges on the wafers closer to the face of the lock . | 8 |
fig1 shows a pair of transducer pads 10 , 11 and an emg electrode assembly 12 . pads 10 , 11 and emg assembly are connected to a data logger ( not shown ) via detachable plug in cables 13 , 14 . transducer pads are positioned on the back of a person being monitored as described with reference to fig2 a and 2b . the transducer pads 10 , 11 are attached to the skin in any suitable manner such as via adhesive tape . each transducer pad 10 , 11 incorporates one or more accelerometers . preferably angular changes of lumbar spine orientation are measured by use of four accelerometers , two of which are placed at the upper lumbar spine and other two , at the lower lumbar spine . if one accelerometer is used in each transducer pad it should be mounted such that it is located centrally over the spine . each transducer pad 10 , 11 may be at least 10 cm wide and may include a gyroscope to provide rotational data . emg electrode assembly 12 includes a plurality of emg electrodes 15 - 19 . electrodes 16 , 17 are adapted to measure muscle activity on the left side of the person &# 39 ; s back and electrodes 18 , 19 are adapted to measure muscle activity on the right side of the person &# 39 ; s back . electrode 15 is a reference electrode for each circuit associated with emg electrodes 16 - 18 . referring to fig2 a use of the monitoring apparatus requires locating of landmarks on the lower back to ensure reliable readings . the landmarks may be located using the following procedure : 1 . the subject should be instructed to stand upright but relaxed ; 2 . if hair on the lumbar region of the subject has not been clipped , hair clippers may be used to remove excessive hair from the region ; 3 . an alcohol wipe may be used to clean the skin in the region thoroughly ( to remove any oil on the skin ); 4 . the psis ( posterior superior iliac spine ) should be located and marked on the left and right sides such that each is the size of an olive ; 5 . a small horizontal line should be drawn across the middle of each psis ‘ olive ’; 6 . the two horizontal marks should be joined with one extended horizontal line ( line “ a ”) stretching across the spine ; 7 . after confirming that the subject is in their starting position , a distance of 150 mm up from line “ a ” should be measured with a soft measuring tape pressed against the subjects skin , gently following skin contours , and marked with a small horizontal line ( line “ b ”); 8 . two less prominent lines ‘ c ’ and ‘ d ’ should be marked . line “ d ” should be 10 mm down from line “ a ” and line “ c ” should be 10 mm up from line “ b ”. 9 . the subject should be instructed to stand with feet shoulder width apart and the distance between the lines “ a ” and “ b ” verified ; 10 . the subject should be instructed to bend forward to their marker , keeping their knees straight . 11 . the subject should be instructed to return to their starting position . 12 . adhesive sheets should be placed as follows : ( a ) an adhesive sheet should be prepared by removing the backing ; ( b ) the subject should be instructed to bend forward to their marker . when the patient is in this position , the adhesive sheet should be placed such that it &# 39 ; s top edge aligns with line “ a ” ( see fig2 a ). the subject should be instructed to return to their starting position ; ( c ) when the subject is upright , the second adhesive sheet should be prepared and placed such that its bottom edge aligns with line “ b ”. the apparatus of the present invention should be accurately fixed to the back of the person being monitored to minimize reading errors . referring to fig2 b care should be taken in fixing the transducer pads and emg electrode assembly . fixation preferably should adhere to the following precautions : 1 . care should be taken not to rotate the accelerometers in relation to each other . if the coil in between them is twisted , it &# 39 ; s readings may become unstable . 2 . accelerometer two should be placed lightly on the centre of the spine , with its bottom edge aligned with line “ b ”. it should be pressed just hard enough to ensure it stays in position . 3 . accelerometer one should be placed lightly on the centre of the spine , with its top edge aligned with line “ a ”. it should be pressed just hard enough to ensure it stays in position . 4 . the subject should be instructed to bend forward to their marker and hold . whilst the patient is in this position , placement of both accelerometers may be verified . if okay , each accelerometer board should be pressed down firmly to ensure good adhesion . the subject should be instructed to return to their starting position . 5 . the subject should be instructed to bend forward to their marker slowly , and return to their starting position . when this is occurring , placement and adhesion of the accelerometer pads should be verified . the diagram shown in fig3 a includes accelerometer 30 , low pass ( averaging ) filter 31 and analog to digital ( a to d ) converter 32 . accelerometer 30 preferably includes a 3d or 3 axes accelerometer such as a kionix kxm52 . alternatively , accelerometer 30 may comprise a pair of 2d accelerometers such as a device type adxlz10e . each transducer pad 10 , 11 may include an accelerometer such as accelerometer 30 . each accelerometer 30 provides outputs that are proportional to acceleration being applied to its respective axes . as gravity provides a constant acceleration of 9 . 8 m / s2 directly downward , a stable point of reference can be used to determine inclination . by using a minimum of 3 axes , a 3 dimensional vector pointing in the direction of acceleration may be generated . by using two accelerometers , one in each transducer pad , the angle between the accelerometers may be calculated using appropriate software . low pass filter 31 provides an averaging function for the accelerometer signal by removing sudden changes in acceleration which may cause aliasing errors . a to d converter 32 provides a digital representation of the accelerometer signal suitable for processing via a digital processor . the diagram shown in fig3 b includes gyroscope 33 , low pass ( averaging ) filter 34 and a to d converter 32 . gyroscope 33 preferably includes a device type adxrs300 . the emg diagram shown in fig4 includes input amplifier 40 , filter 41 , precision rectifier 42 , low pass ( averaging ) filter 43 and a to d converter 44 . amplifier 40 includes a plurality of inputs for receiving signals from emg electrodes 15 - 19 . amplifier 40 includes highly sensitive inputs for amplifying the very small signals produced from electrodes 15 - 19 . low pass filter 43 removes unwanted portions of the frequency spectrum . filter 41 may include a band pass filter . a to d converter 44 provides a digital representation of the emg signal suitable for processing via a digital processor . the flexion diagram shown in fig5 includes oscillator 50 , resistor 51 , amplifier 52 , precision rectifier 53 , low pass ( averaging ) filter 54 and a to d converter 55 . oscillator 50 provides an ac excitation voltage for a flexion sensor 56 such as a helical coil of wire . the coil of wire forms an inductor . many variables affect the value of the inductance such as coil length . by stretching and contracting the coil the inductance is varied . the impedance of the coil is proportional to inductance according to the formula : oscillator 50 should be stable in amplitude and frequency . resistor 51 may be arranged to form with the flexion sensor 56 , a voltage divider . as the value of resistor 51 is constant , the input voltage to amplifier 52 is controlled entirely by the changing impedance of the flexion sensor 56 . low pass filter 54 is an averaging filter and is used to remove sudden changes in the impedance of the flexion sensor 56 . a to d converter 55 provides a digital representation of the flexion impedance signal suitable for processing via a digital processor . the diagram shown in fig6 a to 6 d includes accelerometer package 30 a . accelerometer package 30 a may be a device type kxm52 - l20 or equivalent . the output of each channel ( x , y , z axes ) of accelerometer 30 a is connected to a respective low pass filter 31 a , 31 b , 31 c . the output of each filter 31 a , 31 b , 31 c is connected to a respective input of a to d converter 32 a . a to d converter 32 a may be a device type ds2450s . the diagram also includes a gyroscope circuit 33 a including an angular rate sensor such as a device type adxrs300 . the gyroscope circuit 33 a provides orientation reference data for calculating changes in body position . the output of gyroscope circuit 33 a is connected via low pass filter 34 a to an input of a to d converter 32 a . the output of a to d converter 32 a is in a digital format and is connected to a digital processing circuit ( not shown ) such as a microprocessor . the digital output may be connected to a pc via a suitable interface . the emg circuit shown in fig7 a to 7 d includes input amplifiers 40 a and 40 b . each input amplifier 40 a , 40 b receives an input from a respective pair of electrodes 15 - 16 and 15 - 17 associated with emg electrode assembly 12 . the output of input amplifier 40 a passes via low pass and high pass filters 43 a , 41 a to rectifier and integrator 42 a . the output of rectifier and integrator 42 a is applied to one input of a to d converter 44 a . the output of input amplifier 40 b passes via a similar low pass and high pass filter and rectifier and integrator and is applied to a respective input of a to d converter 44 a . the output of a to d converter 44 a is in a digital format and is connected to a digital processing circuit as described above . a second emg circuit similar to that shown in fig7 a - 7 d is used to interface pairs of electrodes 15 - 18 and 15 - 19 associated with emg electrode assembly 12 to the digital processing circuit . the flexion circuit shown in fig8 a to 8 d includes crystal controlled oscillator 50 a . the output of oscillator 50 a is applied to respective inputs ( in 1 - in 3 ) of flexion channels 81 , 82 , 83 . flexion channel 81 includes a resistive divider comprising resistors r 6 , r 49 . one arm of the divider is connected to a channel of a flexion coil ( not shown ). an output of the divider is connected to amplifier 52 a . the output of amplifier 52 a is connected via rectifier circuit 53 a to low pass filter 54 a . the output of filter 54 a is connected to one input of a to d converter 55 a . flexion channels 82 , 83 are configured similarly to flexion channel 81 and will not be described in detail . the outputs of flexion channels 82 , 83 are connected to respective inputs of a to d converter 55 a . the output of a to d converter 55 a is in a digital format and is connected to a digital processing circuit as described above . digital data from the accelerometer , emg and flexion circuits is processed in the digital domain via a digital processing engine such as a suitably programmed microprocessor or the like . the microprocessor may be included with the data logger or it may be located remotely from the data logger . data may be processed in real time to provide real time feedback to the person being monitored . the feedback may include a measure or evaluation of risk of back strain and / or injury based on the data collected during a predetermined time frame ( s ). alternatively , the data may be processed offline to provide an assessment of activities logged during a preceding time frame ( s ) such as a day &# 39 ; s activities with respect of risk of back strain and / or injury . the digital processing engine may be programmed with suitable software for evaluating risk of back strain and / or injury . the software may determine risk components associated with data provided by the accelerometer , emg , flexion and other circuits as appropriate . the risk components may be combined in accordance with risk assessment principles to provide a cumulative measure of risk of back strain and / or injury . the risk components may be combined in a specific algorithm to give a risk score that is accumulated per unit of time , such as per second , for an entire time that a monitoring device is worn by a person . the accumulated or aggregate score may be matched to the wearer &# 39 ; s personalized preset thresholds . when the aggregate or accumulated score reaches personalized risk thresholds , biofeedback ( vibrational , visual and / or auditory ) may be triggered . there may be more than one theme of biofeedback . for example , feedback may be based on an hourly aggregate score and on a further aggregate score calculated over a shorter time frame such as a sliding five minute window . the different themes have regard to the fact that risk of injury may arise from a variety of contributing events including events associated with a short burst or bursts of relatively intensive activity as well as events associated with longer periods of less intensive activity that present significant risk when accumulated over a period such as an hour or more . flow charts illustrating examples of software for processing data from the accelerometer , emg and flexion circuits are shown in fig9 to 17 . the software may be adapted for calculating a cumulative score indicative of risk of back strain and / or injury . cum 1 t = period of time in seconds of the 1 st cumulative feedback window . cum 1 #= number of data samples in the 1 st cumulative feedback cum 1 s = result of data scores for the period cum 1 t cum 2 t = period of time in seconds of the 2 nd cumulative feedback window . number of data samples in the 1 st cumulative feedback window . eg . for 60 minutes window at sample rate of 20 hz . cum 2 s = result of data scores for the period cum 2 t max - if = maximum range of movement to date in the lateral flexion plane max - rot = maximum range of movement to date in the flexion / extension plane note : this diagram is repeated for each muscle group being measured . vib lft = level of vibration for the lateral flexion plane at time t . vib ft = level of vibration for the flexion / extension plane at time t . vib udt = level of vibration for the vertical plane at time t . cum 1 t = period of time in seconds of the 1st cumulative feedback window . cum 1 #= number of data samples in the 1st cumulative feedback window . eg . for 5 minutes window at sample rate of 20 hz . cum 1 s = result of data scores for the period cum 1 t cum 2 t = period of time in seconds of the 2 nd cumulative feedback window . cum 2 #= number of data samples in the 1 st cumulative feedback window . eg . for 60 minutes window at sample rate of 20 hz . cum 2 s = result of data scores for the period cum 2 t the software processes raw data received from the accelerometer , emg and flexion circuits shown in fig6 to 8 . the software also processes data from a gyroscope circuit as well as profile data associated with the person being monitored . the profile data may allow calculation of parameters and risk thresholds to be tailored to personal habits and factors that may have a bearing on risk of back strain and / or injury such as age , sex , weight , height , family history , fitness level , occupation etc . profile data may be obtained by means of a questionnaire or the like . a sample questionnaire for this purpose is set out in fig1 . finally , it is to be understood that various alterations , modifications and / or additions may be introduced into the constructions and arrangements of parts previously described without departing from the spirit or ambit of the invention . | 0 |
a self - contained vacuum saw , shown in its full embodiment in fig1 is presented . the self - contained vacuum saw is a modification of the standard circular saws currently being used in the building and construction trades . such a standard circular saw has a body 1 that contains an electric motor 2 , a saw handle 3 , a circular saw blade 4 , and a lower saw platform 5 . the lower saw platform 5 is pivotably connected to the saw body and has an inner side near the motor and an outer side outside the saw blade . the circular saw of the preferred embodiment has an electric motor and is powered through the saw cord 6 . these well - known elements of the standard circular saw are best shown in fig1 through 3 . as shown schematically in fig2 , the electric motor 2 turns a blade drive shaft or armature 7 that in turn is connected to the saw blade 4 . the electric motor in the instant device also turns a drive shaft vacuum extension 7 ′ ( the same armature ) which is connected to a vacuum impeller 8 . the vacuum impeller 8 is surrounded by a vacuum impeller housing 9 . the vacuum impeller and housing is best shown in fig5 . the impeller 8 has a vacuum impeller main housing 9 attached to the saw body 1 and a vacuum impeller outer housing 9 ′. the outer housing 9 ′ is removably attached to the permanently attached main housing 9 . the vacuum housing ( 9 and 9 ′) contains a vacuum housing exhaust port 10 . this exhaust port 10 is adapted to receive the dust and debris pulled into the vacuum housing by the impeller . this material is then discharged through the exhaust port 10 . attached to the outer portion of the exhaust port 10 is a metal exhaust port tube 10 ′. attached to the exhaust tube 10 ′ is a vacuum bag 11 . the type of vacuum bag 11 used on this particular device must be tighter than the normal bags on the market . the bags could be disposable for fine dust accumulated such as in drywall cutting or washable for coarser work such as cutting materials like wood . particular types of bags utilized to catch and collect fine debris such as that produced in drywall cutting are in common use in the industry and are well known in the art . turning now to fig2 and 3 , the saw blade chamber is shown . the saw blade chamber creates an essentially sealed chamber around the saw blade . the upper blade housing of the saw blade chamber comprises a semi - circular saw blade outer enclosure plate 12 ( fig1 ). the upper blade chamber includes a semi - circular inner enclosure plate 12 ′. a saw blade chamber shoulder 13 connects outer 12 and inner 12 ′ blade plates . the outer plate 12 is clear , as best shown in fig1 . this clear outer plate 12 allows the workmen to see the blade and to trace the path of the blade as the cut is being made . the upper blade housing surrounds the upper portion of the blade 4 . attached to the circular shoulder 13 of the saw blade chamber is a plurality of vacuum tubes 14 . these vacuum tubes are connected between the blade chamber and the vacuum housing . the preferred embodiment shown herein has four hoses 14 that must be strategically positioned to allow for the most efficient collection of dust and debris . after much experimentation , it has been found that a single hose simply introduced at one part of the saw blade chamber is inefficient and would not be effective in gathering the amount of dust and debris accumulated during a saw cut . in one embodiment of this device , the front two hoses 14 ′ vacuum up most of the dust . however , these front hoses 14 ′ must be strategically placed . in the preferred embodiment herein , the front two vacuum hoses 14 ′ are located at approximately two o &# 39 ; clock and three o &# 39 ; clock on a twelve o &# 39 ; clock dial on the circumference of the shoulder 13 , with reference being had to fig4 . on fig4 , if one places the twelve o &# 39 ; clock high position on the saw blade chamber at the apex 27 of the semi - circle , the front two vacuum hoses 14 ′ would be located at the two o &# 39 ; clock and three o &# 39 ; clock position . other hoses should also be attached to the saw blade chamber . in one embodiment , as best shown in fig4 , two additional vacuum tubes 14 would be located at the ten o &# 39 ; clock and nine o &# 39 ; clock position . it has also been found that moving the nine o &# 39 ; clock vacuum hose to an alternate position , as shown in drawing fig7 and 8 would be a beneficial placement of the vacuum hoses . this alternate placement of the nine o &# 39 ; clock vacuum hose will be described later in this specification . in order to complete the saw blade chamber , a lower saw blade bellows 15 is attached to the bottom part of the saw blade chamber as best shown in fig4 . the upper blade housing and lower bellows create the blade chamber . the bellows 15 is an accordion - style flexible and bendable bellows as shown in the drawing figures . the bellows 15 needs to be flexible and bendable in order for , the adjustable saw blade to be maneuverable within the saw blade chamber to adjust for angles and depths of cut . a lower bellows attaching bracket 16 , as shown in fig4 , may be attached to the lower part of the bellows in order for the entire bellows unit 15 to be attached to the saw lower platform 5 . suitable screw holes are provided in the lower bellows bracket 16 . corresponding holes are found in the saw lower platform 5 . another variation of the placement of the vacuum hoses 14 of this device is shown in fig7 and 8 . in this variation , the lower chamber created by bellows 15 is divided into two chambers 17 and 18 . a larger , front chamber 17 , as best shown in fig7 and 8 , has three vacuum tubes attached . a second , smaller , rear bellows chamber 18 has one vacuum tube , in this embodiment 19 , to collect the dust and debris from the back end of the saw blade . a small , flexible separation wall 20 separates front 17 and rear 18 bellows chambers . this upper part of this separation wall 20 is connected to the saw blade chamber but is not connected to the lower saw platform 5 . a small space between the lower part of the separation wall 20 and the lower saw platform 5 allows any remaining debris not already pulled up by the front hoses to be pulled into the rear bellows chambers 18 and discharged by the rear bellows chamber vacuum tube 19 . once the bellows are attached to the upper part of the saw blade chamber , the saw blade is almost completely enclosed . ( due to the fact that the saw blade must move and may not always be completely flush against the work piece , the chamber is not always one hundred percent sealed . however , the chamber does provide a virtual seal for the saw blade .) the saw blade chamber is created by the upper semi - circular saw blade shoulder 13 , the outer plate 12 , the inner plate 12 ′, the bellows 15 and the lower saw platform 5 . in combination , these elements create a saw blade chamber . when the blade 4 is turned by the electric motor and cuts the work piece , the dust and debris created is pulled up into the vacuum tubes 14 and 14 ′ by the impeller and is deposited in the vacuum bag 11 . this process is best shown in the schematic drawing fig2 and by the diagram shown in fig6 . in fig2 and 6 , the arrows show the direction of airflow and the direction of travel of the dust and debris . as shown in fig6 , the dust and debris created by the blade is vacuumed into vacuum housing 9 in the direction of the arrows . each of the vacuum tubes 14 and 14 ′ have their outlets at approximately , or as near as possible , to the center of the impeller 8 . it has been shown through much experimentation that the introduction of the outlet end of the vacuum tubes near the center of the impeller is preferred . as the dust and debris is vacuumed by the impeller into the vacuum housing 9 the dust and debris is discharged through exhaust port 10 and into the vacuum bag 11 . the vacuum bag is detachably attached to the device so that it may be emptied as necessary . another refinement to this device is illustrated in fig1 . each circular saw blade has a lower blade guard 24 . this lower blade guard 24 rotates as the blade moves through the material to be cut and must be pushed out of the way before the blade encages the working piece . normally , this is done by means of a lever on the side of the lower blade guard . however , since the outer side of the blade 4 is now fully contained within the saw blade chamber , an alternate means of rotating the lower blade guard 24 is required . this is accomplished using a lower blade guard rod 25 that is contained within the blade chamber . the rod has a first end connected to the blade guard 24 as shown in drawing fig1 . this lower blade guard rod 25 is also attached at a second end to lower blade guard lever handle 26 , which is positioned on the outside of the saw blade chamber . by pulling handle 26 , lower blade guard 24 may be rotated so that the saw may be placed on the work piece for cutting . one important modification of the standard circular saw is shown in fig9 and 10 . fig9 shows the standard construction of this circular saw , including the vacuum impeller housing 9 , the vacuum tubes 14 and 14 ′, the saw blade chamber and the bellows 15 . this modification to the standard circular requires that the lower base 5 pivot point 21 be changed . in normal operation and production , the lower saw platform 5 pivots by manipulating the lower base adjusting handle 22 . this base - adjusting handle ( or bolt ) 22 is loosened to allow the lower base platform 5 to pivot for angle cuts . normally , the lower saw platform 5 pivots at pivot point 21 . however , as a modification of the standard saw pivot point , a circular saw of this alternate embodiment may pivot at outer pivot point 23 as best shown schematically in fig1 . when the saw lower platform 5 pivots at the modified outer pivot point 23 , the saw platform pivots from the outer side of the platform . while this modification of the standard circular saw is an alternate preferred embodiment , the device described herein will also perform satisfactorily with standard , off the shelf circular saws that are commonly found and manufactured in the industry . a key concept of this invention is utilizing the electric motor of a standard circular saw to run both the saw blade and the impeller . this modification of existing circular saws allows the saw to be self contained and moveable from site to site . modifying the armature to support the impeller , along with the other structure necessary to create the saw blade chamber on the saw side and the vacuum chamber on the impeller side is an important and innovative part of this invention . the dimensions for the various elements can be varied according to the uses and designs of the power saws . for example , the saw blade chamber may be anywhere from two inches wide , as shown approximately in the drawing figures , to twelve inches wide . while the hoses are made of standard rubber , they can also be plastic fabricated hoses . alternatively the entire shroud around the blade could be made of one piece , and the saw blade casing , impeller vacuum housing , and blade chamber could be manufactured as a one piece , unitary manufactured unit . as additional enhancements of this invention , lighting inside the blade chamber could be provided . further , laser guides could be incorporated in this device while still keeping within the spirit and disclosure of this invention . ( obviously , laser guides would be much more effective with the removal of the dust and debris from the normal work site by the vacuum system .) in addition , a peep site could be built into the clear outer plate on the blade side to allow the workman a better view of the blade and its cutting path . the peep site would allow the workman to see the work closer to the actual blade - cutting surface and work piece . | 8 |
fig1 illustrates the typical anatomical position of a flexible endoscope when used to cannulate the papilla of vater . a flexible endoscope 100 , in this case a duodenoscope , is passed through the patient &# 39 ; s mouth ( not shown ), the esophagus 102 , the stomach 104 , and into the first part of the duodenum 106 . the endoscopist then maneuvers a distal end 118 of the endoscope so that it is positioned adjacent to the papilla of vater 110 . fig1 also illustrates a portion of the pancreatobiliary system . the pancreatic duct 112 joins the common bile duct 108 coming from the gallbladder 114 and liver ( not shown ). secretions from the liver and pancreas are collected by this ductal system and empty into the duodenum via a small orifice in the papilla of vater 110 . one of the objectives of the medical procedure known as ercp ( endoscopic retrograde cholangiopancreatography ) is to cannulate the papilla of vater with a thin flexible cannula 116 through which x - ray contrast media is injected to enable the pancreatobiliary ductal system to be seen radiographically via a fluoroscope . fig2 shows an enlarged view of the distal end of the endoscope and the cannulation procedure . the distal end 118 of the endoscope 100 with side - viewing optics is positioned in the duodenum 106 with its tip close to the papilla of vater 110 . the operator can move an elevator 200 contained in the endoscope tip up and down relative to the endoscope by means of an elevator control wire 206 which runs up the shaft of the endoscope from the elevator to the control handle of the endoscope ( not shown ). the operator observes the position of the catheter relative to the papilla of vater as he / she manipulates the position of the endoscope itself and the cannula passing through the endoscope . the line of sight ( direction of view ) 208 of the endoscope is approximately perpendicular to the axis of the endoscope to enable it to optimally visualize the papilla of vater en face . with difficult but careful manipulation of the endoscope and the cannula , the operator is generally able to insert the tip of the ercp cannula 116 through the orifice of the papilla , and into the lumen 202 of the ductal system . fig3 illustrates a problem that is commonly encountered when a standard plastic ercp cannula 116 is inserted into the ductal orifice 204 of the papilla of vater 110 at an angle with the duct 202 . pushing the tip of the cannula against the papilla will often embed it in the tissue rather than allowing it to slide successfully into the duct . fig4 a illustrates the advantage of a first embodiment . the distal end of the cannulation device 402 is composed of a series of segments 400 which allow it to flex and align with the axis of the ductal lumen 202 . as fig4 b illustrates , once the most distal few segments enter the lumen , they guide the rest of the cannulation device 402 into the duct . the flexibility of the segmented tip prevents it from embedding itself in the wall of the tissue , and enables it to preferentially slide into the duct itself . fig5 is a cross - sectional view of the tip of the first embodiment shown in fig4 a and 4b . the shaft of the cannulation device 402 is composed of two main components . an outer component is a sheath 500 composed of either plastic tubing or wound wire ( coil wire ) that creates the outer surface of the device . inside this sheath is a control wire 502 that runs throughout the length of the sheath &# 39 ; s lumen 506 and terminates by running through the center of a series of segmental elements 400 . in the embodiment illustrated in fig5 , these segmental elements take the form of spherical beads each of which has a central lumen 508 through which the flexible control wire 502 passes . the dimension of the control wire and the dimension of the holes within the beads are such that the beads are loosely strung over the control wire . the control wire is firmly affixed to the most distal of the beads at a fixation point 504 . depending upon the materials selected for the control wire and the beads , the method of fixation may be soldering , an epoxy adhesive , thermoplastic welding , etc . while fig5 illustrates an embodiment with five beads , any number of segments could be used , depending upon the desired tip characteristics and the particular intended application for the device . fig6 a & amp ; 6b illustrate how the shape and flexibility of the segmented tip will change depending upon the position and tension placed on the control wire . since the distal - most bead is firmly affixed to the flexible control wire , and since extension of the control wire from the tip of the shaft 602 will cause the beads to separate — releasing the tension in the control wire and extending the beads will cause the beaded tip to become increasingly more flexible . the final rigidity of the beaded section will be largely determined by the inherent flexibility of the control wire 502 itself . on the other hand , if tension is put on the control wire to pull the beads against one another and against the distal end 602 of the shaft 402 , the beaded portion of the cannulation device will become increasingly more rigid and less easily deflected , as illustrated in fig6 b . by varying the amount of tension placed on the control wire , the tip of the cannulation device can vary progressively from being very floppy to becoming very rigid . this ability to immediately change the flexibility of the tip of the device over a wide range is part of the utility of the apparatus . fig7 illustrates the components of a complete cannulation device of the first embodiment . the shaft of the device 402 has sufficient length to reach the target anatomy of the patient . in the ercp application illustrated in fig1 , the shaft of the device must be at least as long as the channel of the endoscope through which it passes , plus some additional length so that it can be handled conveniently . in other applications the catheter may be inserted into the body directly without passing through another medical instrument , may be inserted through an access cannula ( e . g ., through a vascular catheter ), or other appropriate means of entry into the body . the overall length of the device must be appropriate for its application . likewise , the overall diameter of the shaft 402 and the diameter of the segmental elements 400 at its tip are made appropriate for the diameter of the duct or vessel that the device is intended to cannulate . the segmental elements 400 at the distal tip of the device are loosely strung over a flexible control wire 502 that runs through the lumen of the shaft to a handle 700 operated by the user . the diameter of the control wire and the materials of its construction are chosen to match the characteristics of the device with its intended application . the control wire may be composed of metal which would cause it to have more spring when in a relaxed ( non - tensioned state ), or be composed of a polymer which would cause it to be more floppy when relaxed , or composed of other material ( s ) exhibiting characteristics desirable for the particular intended medical application . the level of tension in the control wire 502 , and thereby the degree of rigidity in the tip of the device , is controlled by the operator by moving the slider 704 relative to the handle 700 . the handle has no stops or adjustments , allowing the operator to fully control the amount of tension placed on the handle , and thereby the degree of rigidity in the segmented tip . the embodiment illustrated in fig7 also contains an injection port 702 on the handle of the device , through which the operator can inject fluids ( such as x - ray contrast media ) through the lumen of the catheter 402 , which fluid then exits the distal end of the catheter 602 . fig8 illustrates that to allow fluid injected into the lumen 506 of the sheath 500 to exit from the tip 602 of the sheath , the control wire 502 must be extended to create a gap between the most proximal of the segmental elements 400 and the tip of the sheath 602 . this will allow fluid to flow 800 from the cannulation device into the duct in which it is residing . fig9 illustrates a second embodiment of an appropriate handle 700 for the cannulation device . similar to the previous embodiment , the control wire 502 is connected to the slider 704 . movement of the slider puts more or less tension in the control wire , thereby changing the flexibility of the segmented tip ( not shown ). however , in this embodiment , a stopper 900 is affixed to the control wire 502 as illustrated in fig9 a . this stopper limits the movement of the control wire . a proximal stop nut 902 limits movement of the control wire as the slider on the handle is “ closed ”, thereby limiting the maximum amount of tension placed on the segmental elements and the maximum rigidity of this section of the cannulation device . a distal stop nut 904 conversely limits the amount that the handle can be “ opened ”, thereby limiting the distance that the control wire can be extended from the tip of the cannula . in the embodiment illustrated in fig9 , the position of these maximum and minimum settings can be changed by the operator by changing the position of the threaded stop nuts on the handle . furthermore , each stop nut has a cutout 906 which allows the stopper 900 to bypass the stop nut when the stop nut is rotated into the “ free ” position , as illustrated in fig9 b . this feature allows the operator to quickly put the handle into a configuration in which the maximum and minimum limits of the control wire movement are overridden . when the stop nuts are put into the “ free ” configuration , the slider 704 can move back and forth freely without the stopper 900 encountering the stop nuts ( 902 & amp ; 904 ). fig1 illustrates a third embodiment of the handle 700 of the cannulation device of the present invention . as in the handle illustrated in fig9 , movement of the slider 704 moves the control wire and changes the rigidity of the segmented tip . however , movement of the control wire is limited by a stopper 900 affixed to the control wire . this stopper limits the movement of the control wire to the positions set by the proximal 902 and distal 904 stop nuts . the position of these stop nuts can be changed by the operator by rotating them over the threaded shaft on which they are mounted . furthermore , each of the stop nuts has a cutout 906 in it . the operator can quickly override the limits of the stop nuts by rotating the nuts to place them in a configuration whereby the stopper 900 passes through the cutouts 906 and is no longer limited by the stop nuts . the embodiment illustrated in fig1 also contains an injection port 702 through which fluids may be injected into the cannulation device . unlike the handles illustrated in fig7 & amp ; 10 which require that the operator constantly operate and monitor the tension in the control wire , a fourth embodiment of the handle which is illustrated in fig1 will apply a constant , and in this embodiment , an adjustable amount of tension in the control wire . the handle 150 is attached to the proximal end of the shaft 402 of the cannulation device . the proximal end of the control wire 502 running through the length of the shaft is rotatably fixed 154 to a stiffness adjustment nut 156 threaded 160 on the shaft 158 of the handle . as this adjustment nut 156 is screwed away from the handle 150 it pulls on the control wire 502 with an increasing amount of tension , making the segmented tip of the device more rigid . when the adjustment nut is screwed in the opposite direction it releases the tension in the control wire , reducing the rigidity of the segmented tip . a spring 152 on the handle puts pressure on the stiffness adjustment nut 156 thereby maintaining it in the position set by the operator . this embodiment of the handle allows the operator to set a constant amount of tension in the control wire , and thus a constant degree of rigidity in the segmented tip without the need to constantly hold ( or operate ) the handle . the degree of rigidity in the segmented tip can be changed by the operator as needed during the procedure . fig1 illustrates a fifth embodiment of the handle of the cannulation device . in this embodiment the control wire 502 is connected to a slider 704 on the handle 700 . a spring 152 places a constant , preset amount of force on the slider , and thereby a constant , preset amount of tension in the control wire 502 which in turn produces a constant preset degree of rigidity in the segmented tip . this preset amount of rigidity in the tip of the device can be adjusted by changing the position of the stiffness adjustment nut 156 . in this embodiment , the operator has the ability to further enhance the rigidity of the tip of the device by “ closing ” the handle by pulling the slider 704 towards the thumb ring 176 . this action increases the tension in the control wire , stiffening the tip . in a similar manner , the operator can “ open ” the handle by moving the slider 704 away from the thumb ring 176 . this action compresses the spring 152 , relaxing the tension in the control wire and making the segmented tip more flexible . although several embodiments for the handle of the cannulation device have been illustrated , one of ordinary skill in the art , in light of this teaching , can generate additional embodiments and modifications without departing from the spirit or exceeding the scope of the claimed invention . fig1 illustrates that the segmental elements 400 at the distal tip of the catheter 402 can likewise have several embodiments . as illustrated in fig1 a , in a first embodiment of the tip , the segmental elements have an approximate spherical shape . alternatively , as illustrated in fig1 b , the segmental elements may have an approximate cylindrical outermost surface with ends that allow them to flex with respect to each other . as fig1 c illustrates , the segmental elements may have other alternative shapes that facilitate smooth entry in ductal orifices and smooth passage along the wall of the duct or the vessel it is in . as fig1 d & amp ; 13e illustrate , there is a benefit to tapering the size of the individual segmental elements . the small diameter of the distal - most element facilitates its entry into small orifices , while the increasing diameter of subsequent elements guides the larger diameter catheter into the ductal system . in addition to tapering the size of the segmental elements , the cannula sheath 402 may have a tapered distal tip 178 , as illustrated in fig1 f . the present invention does not specify or limit the number of segmental elements used in the cannulation device . the device may only two ( fig1 g ) to improve the control that the operator has over the tip of the device , or may have many elements to increase the radius of tip deflection depending on the specific application for which the cannula is designed . the tips of prior art cannulas 116 also have various configurations . some are simply blunt tipped 186 tubes , as illustrated in fig1 a . others have a tapered 182 distal end to improve entry into small diameter orifices , as illustrated in fig1 b . some have a rounded 184 “ nose ”, as illustrated in fig1 c . another embodiment of the present invention , as illustrated by fig1 d , is to limit the number of segmental elements to one , and to configure the device such that when the element 400 is pulled against the sheath 500 by the control wire 502 running through its lumen , the combined profile of the element 400 and the distal tip of the cannula 180 create a surface that cannulates more easily than the open ended cannulas of prior art . the reason for this improved cannulation ability is that prior art cannulas are of necessity blunt at the very tip due to their open lumen . however , when the element of the current invention fills this open lumen with a rounded shape , it facilitates passage of the cannula tip over tissue and facilitates its entry into ductal orifices . as fig1 e illustrates , after cannulation , the control wire 502 is advanced moving the element 400 away from the distal end 180 of the catheter , allowing fluid to flow from the lumen 506 of the catheter out of the distal tip . this flow of fluid 800 allows the cannulation device to be used as a catheter following ductal cannulation . as fig1 f , fig1 g and fig1 h illustrate , the shape of the single element 400 may have many embodiments , including a proximal surface 188 that serves to position the element 400 in the center of the catheter &# 39 ; s distal end 180 . fig1 illustrates the components of one embodiment of a cannulation device with a single element at its distal tip . the element 400 is affixed to the distal end of a control wire 502 that runs through the catheter sheath 500 , through a control body 254 , and to a proximal handle 252 . as the handle 252 is moved towards and away from the control body 254 , it moves the distal element 400 away from and towards the distal end of the sheath , respectively . an injection port 702 on the control body allows the injection of fluid down the open lumen of the sheath , exiting at its distal end . a fluid seal 250 at the proximal end of the control body prevents this fluid from leaking out around the proximal end of the control wire . while the previous discussion has focused on the ability of the apparatus to enter a ductal orifice , the same is also useful in guiding passage of a cannula or guidewire through ductal systems such the fallopian tubes , the urinary tract , biliary and pancreatic ducts , blood vessels and similar lumened anatomy . as fig1 illustrates , the apparatus disclosed herein are useful for guiding the tip of commonly used guidewires and catheters into selected bifurcating tracts 192 of these ductal and vessel systems 190 . while there has been shown and described what is considered to be preferred embodiments of the invention , it will , of course , be understood that various modifications and changes in form or detail could readily be made without departing from the spirit of the invention . it is therefore intended that the invention be not limited to the exact forms described and illustrated , but should be constructed to cover all modifications that may fall within the scope of the appended claims . | 0 |
this invention provides an alternative way to fabricate double - gated transistors 80 using a silicon - on - insulator ( soi ) substrate as the starting material . since the technique of the present invention uses the top and bottom sides of the soi to form the gate , surface mobility is not degraded as in the case of fin fets . the soi transistors formed in accordance with the present invention have improved gate oxide integrity ( goi ) and leakage current control due to the corner rounding effect on the edge of the active region , the ‘ fin .’ fig1 schematically illustrates a structure 10 having a fully depleted silicon - on - insulator structure ( soi ) 16 formed thereover . structure 10 is preferably a semiconductor substrate comprised of silicon or germanium and is more preferably a silicon semiconductor substrate . soi 16 includes : a lower soi silicon oxide ( sio 2 ) layer 12 having a thickness of preferably from about 1000 to 5000 å and more preferably from about 2000 to 4000 å ; and an overlying soi silicon ( si ) layer 14 having a thickness of preferably from about 300 to 2000 å and more preferably from about 500 to 1500 å . formation of top oxide layer 18 and first top dummy layer 20 — fig2 as shown in fig2 , a top oxide ( silicon oxide — sio 2 ) layer 18 is formed over soi 16 to a thickness of preferably from about 90 to 110 å , more preferably from about 95 to 105 å and most preferably about 100 å . then , a first top dummy layer 20 is formed over top oxide layer 18 to a thickness of preferably from about 450 to 1050 å and more preferably from about 500 to 1000 å . the first top dummy layer 20 is preferably comprised of nitride , silicon nitride ( si 3 n 4 ) or silicon oxynitride ( sion ) and is more preferably comprised of nitride as will be used hereafter for illustrative purposes . the first top dummy layer has a thickness of preferably from about 450 to 1050 å and more preferably from about 500 to 1000 å . patterning of first top dummy nitride layer 20 / top oxide layer 18 / overlying soi si layer 14 — fig2 as shown in fig3 , the first top dummy nitride layer 20 , top oxide layer 18 and overlying soi silicon layer 14 of the soi 16 are patterned down to the lower soi oxide layer 12 to define : a patterned first top dummy nitride layer 20 ′/ top oxide layer 18 ′/ overlying soi silicon layer 14 ′ stack 30 with exposed side walls 31 ; the active region as shown and exposed portions 22 of lower soi silicon oxide layer 12 . the top nitride layer 10 , top oxide layer 18 and overlying soi silicon layer 14 may be patterned , for example , using an overlying patterned mask layer ( not shown ) preferably comprised of photoresist . patterned stack 30 may be roughly in the shape of a dumbbell with the opposing ends of the patterned overlying soi silicon layer 14 ′ being a opposing source region 34 and drain region 36 connected by a channel region 38 . as shown in fig4 , a rounded oxide layer 28 is formed over the exposed side walls 31 of the patterned overlying soi silicon layer 14 to help protect the patterned overlying soi silicon layer 14 from subsequent processing and completes formation of an oxide encased patterned overlying soi silicon layer 32 comprising : the patterned overlying soi silicon layer 14 ′, the rounded oxide layer 28 and the patterned top oxide layer 18 ′. as shown in fig4 , rounded oxide layer 28 has rounded corners 26 . rounded oxide layer 28 has a thickness of preferably from about 80 to 550 å and more preferably from about 100 to 500 å . rounded oxide layer 28 is preferably formed by an oxidation growth process at a temperature of preferably from about 800 to 1200 ° c . and more preferably from about 900 to 1100 ° c . for from about 10 to 120 minutes and more preferably from about 20 to 100 minutes . removal of patterned first top dummy nitride layer 20 ′— fig5 as shown in fig5 , the patterned first top dummy nitride layer 20 ′ is removed from the patterned stack 30 to expose the oxide encased patterned overlying soi silicon layer 32 . the patterned first top dummy nitride layer 20 ′ is preferably removed employing a hot phosphoric acid etch selective to oxide / silicon oxide . formation of second patterned dummy layer 40 — fig6 as shown in fig6 , a second patterned dummy layer 40 is formed over the structure of fig5 . second patterned dummy layer 40 may be patterned , for example , by using an overlying patterned gate reverse mask ( not shown ) and employing an anisotropic etch to form opening 42 opening up the gate area 50 . second patterned dummy layer 40 includes opening 42 that exposes : a gate portion 38 ′ of the channel region 38 of the oxide encased patterned overlying soi silicon layer 32 within gate area 50 ; and gate portions 22 ′ of lower soi silicon oxide layer 12 within gate area 50 . it is noted that the gate portion 38 ′ of the oxide encased patterned overlying soi silicon layer 32 has an overall rounded characteristic due to the formation of rounded oxide layer 28 . second patterned dummy layer 40 is preferably comprised of nitride , silicon nitride ( si 3 n 4 ) or silicon oxynitride ( sion ) and is more preferably comprised of nitride as will be used hereafter for illustrative purposes . second patterned dummy layer 40 has a thickness of preferably from about 1000 to 3000 å and more preferably from about 1500 to 2500 å . as shown in fig7 , an etch , preferably a dilute hf etch , is used to : ( 1 ) remove the portion of the patterned top oxide layer 18 ′ overlying the patterned overlying soi silicon layer 32 ′ within gate area 50 ; ( 2 ) remove the portion of the rounded oxide layer 28 overlying the side walls 31 of the patterned overlying soi silicon layer 32 ′ within gate area 50 ; and ( 3 ) etch the soi oxide layer 12 exposed within opening 42 to form an undercut 44 within etched soi oxide layer 12 ′ extending below the now denuded patterned overlying soi silicon layer 32 ′ within gate area 50 . the soi oxide layer 12 is preferably etched using a dilute hf etch or a buffered oxide etch ( boe ) and more preferably using a dilute hf etch . undercut 44 of the etched soi oxide layer 12 ′ is preferably from about 500 to 3000 å and more preferably from about 1000 to 2000 å deep and preferably protrudes from about 500 to 3000 å and more preferably from about 500 to 1000 å under the leading edges of opening 42 of second patterned dummy nitride layer 40 . formation of conformal gate oxide layer 32 — fig7 as further shown in fig7 , a conformal oxide layer 46 is formed , preferably by growth , around the denuded patterned overlying soi silicon layer 32 ′ within gate area 50 to form a conformal oxide rounded gate portion 48 of the patterned overlying soi silicon layer 14 ′. conformal oxide layer 46 is grown on the exposed top , bottom and sides of the gate portion of the patterned overlying soi silicon layer 14 ′ to a thickness of preferably from about 5 to 200 å and more preferably from about 10 to 50 å . as shown in fig8 , a gate layer is formed over the patterned dummy nitride layer 40 , filling opening 42 and is planarized to remove the excess of the gate layer from over the top of patterned dummy nitride layer 40 to form a planarized gate 52 within opening 42 . gate 52 is preferably comprised of polysilicon ( poly ), tungsten ( w ), w — si x , silicon germanium ( sige ) or aluminum ( al ) and is more preferably polysilicon ( poly ) as will be used hereafter for purposes of illustration . poly gate 52 includes upper gate 56 and lower gate 54 separated by the conformal oxide rounded gate portion 48 of the patterned overlying soi silicon layer 14 ′ as more clearly shown in fig1 and 12 . since polysilicon , for example , has good gap filling properties and the poly growth is conformal , poly gate 52 wraps completely around the conformal oxide layer 46 previously grown around the channel region 38 of patterned soi silicon layer 14 ′ within gate area 50 . the gate layer is preferably planarized by a chemical mechanical polishing ( cmp ) process to form the poly gate 52 . removal of the patterned dummy nitride layer 40 — fig9 as shown in fig9 , the patterned dummy nitride layer 40 is removed from the structure of fig8 to expose : the side walls 79 of upper poly gate 56 ; and the rounded oxide layer 28 ′ of oxide encased patterned overlying soi silicon layer 32 outside gate area 50 . the patterned dummy nitride layer 40 is preferably removed using hot phosphoric acid . ldd implantation , formation of spacers 60 and source - drain implants — fig9 as shown in fig1 , conventional sde or ldd implants 100 are performed and will exist under the spacers 60 ( see below ) and overlap the gate by a small portion . the silicon substrate is thin enough such that the sde / ldd extend from top to bottom of the si substrate . spacers 60 are then formed over the sidewalls 79 of upper poly gate 56 , and spacers 62 are formed over the exposed rounded oxide layer 28 ′ of oxide encased patterned overlying soi silicon layer 32 outside gate area 50 as shown in fig1 . the rounded oxide layer 28 and the exposed portions of the patterned top oxide layer 18 ′ overlying the patterned overlying patterned soi silicon layer 14 are removed during the spacer etching in the formation of spacers 60 , 62 . source - drain ( s / d ) implants are then respectively formed into source region 34 and drain region 36 , for example , to form source 34 ′ and drain 36 ′ to complete formation of double - gated transistor 80 with a conformal oxide rounded gate portion 48 of the patterned overlying soi silicon layer 14 ′. fig1 is a cross - sectional representation of fig1 along line 11 — 11 and illustrates upper gate 56 and lower gate 54 of poly gate 52 separated by the conformal oxide rounded gate portion 48 of the patterned overlying soi silicon layer 14 ′. sidewall spacers 60 extend over the side walls 42 of upper gate 56 of poly gate 52 . sidewall spacers 62 extend over the exposed rounded oxide layer 28 ′ of oxide encased patterned overlying soi silicon layer 32 outside gate area 50 . fig1 is a cross - sectional representation of fig1 along line 12 — 12 , perpendicular to line 11 — 11 , and illustrates upper gate 56 and lower gate 54 of poly gate 52 separated by the conformal oxide rounded gate portion 48 of the patterned overlying soi silicon layer 14 ′. sidewall spacers 60 extend over the side walls 79 of upper gate 56 of poly gate 52 . as most clearly shown in fig1 , the formation of rounded oxide layer 28 ( see fig4 ) causes additional portions of the patterned soi silicon layer 14 ′ to be oxidized : ( 1 ) proximate top oxide layer 18 ; and ( 2 ) proximate soi silicon oxide layer 12 to form a rounded patterned soi silicon layer 14 ′. optionally , a standard salicidation process may then be used ( tisi , cosi , etc ., e . g .). the advantages of one or more embodiments of the present invention include the rounded active region improves gate oxide integrity ( goi ) and leakage current control . 1 ) making use of the top and bottom surfaces of the soi for gate oxide channel formation — due to the fact that both surfaces have low surface roughness , the mobility is improved ; 2 ) gate oxide is formed all around the channel which is more like a circular fet rather than a planar fet ; and 3 ) w or wn may be used to form a metal gate instead of using polysilicon . while particular embodiments of the present invention have been illustrated and described , it is not intended to limit the invention , except as defined by the following claims . | 7 |
fig1 is a schematic cross - sectional view illustrating a light - emitting diode ( led ) package according to an embodiment of the invention . fig2 is a schematic three - dimensional view illustrating an led package according to an embodiment of the invention . fig3 illustrates a spectrum of an led package according to an embodiment of the invention . with reference to fig1 to fig3 , an led package 100 provided herein includes a rectangular carrier 110 , an led chip 120 , and an encapsulant 130 . the rectangular carrier 110 has an upper surface 110 a . the led chip 120 is mounted on the upper surface 110 a and is electrically connected to the rectangular carrier 110 . the encapsulant 130 covers the upper surface 110 a of the rectangular carrier 110 and the led chip 120 , so as to convert first light l 1 emitted from the led chip into second light l 2 . note that a wavelength of the first light l 1 is shorter than a wavelength of the second light l 2 . in the present embodiment , the entire upper surface 110 a of the rectangular carrier 110 is covered by the encapsulant 130 . the encapsulant 130 has a curved convex surface 130 a . in a thickness direction t of the encapsulant 130 , a maximum height from the curved convex surface 130 a to the upper surface 110 a of the rectangular carrier 110 is h , a width of the encapsulant is w , and a ratio of h to w is within a range from 0 . 05 to 0 . 5 . according to the present embodiment , the rectangular carrier 110 is a rectangular circuit board , for instance . for instance , the rectangular carrier 110 may be a ceramic circuit board , a metal core printed circuit board ( mcpcb ), a lead frame , or any other carrier that is suitable for carrying the led chip 120 . the rectangular carrier 110 provided in the present embodiment includes a plurality of circuit layers ( not shown ), for instance , and the circuit layers are suitable for being electrically connected to the led chip 120 . besides , the led chip 120 is electrically connected to the rectangular carrier 110 by flip - chip - bonding , for instance . particularly , a conductive bump b may be formed on the led chip 120 or on the rectangular carrier 110 according to the present embodiment , such that the led chip 120 may be electrically connected to the rectangular carrier 110 via the conductive bump b . as shown in fig1 , in addition to the upper surface 110 a , the rectangular carrier 110 has a bottom surface 110 b opposite to the upper surface 110 a , and the circuit layers in the rectangular carrier 110 can be distributed onto the upper surface 110 a , the bottom surface 110 b , and the inside of the rectangular carrier 110 . in most cases , the circuit layers on the upper surface 10 a include a plurality of bonding pads bp electrically connected to the led chip 120 , and the circuit layers on the bottom surface 110 b include a plurality of outer contacts ot . the circuit layers ( e . g ., conductive vias ) distributed into the rectangular carrier 110 can be applied to connect the bonding pads bp and the outer contacts ot . thereby , the led package 100 can be arranged on other circuit carriers through the outer contacts ot distributed onto the bottom surface 110 b of the rectangular carrier 110 , such that the led chip 120 can be electrically connected to other circuit carriers . for instance , the led package 100 provided in the present embodiment can be a surface mount device ( smd ), and the outer contacts ot can be directly fixed onto the circuit carriers via solder . as shown in fig1 and fig2 , the outer shape of the encapsulant 130 provided in the present embodiment is different from that of the lens portion of the conventional led chip package . specifically , although the encapsulant 130 has the curved convex surface 130 a , the outer profile of the curved convex surface 130 a is the same as the outer profile of the rectangular carrier 110 ; that is , the edge of the encapsulant 130 is aligned to the edge of the rectangular carrier 110 . according to the present embodiment , the maximum width w max of the encapsulant 130 is equal to a length of a diagonal of the rectangular carrier 110 , and the minimum width w min of the encapsulant 130 is equal to a length of one side of the rectangular carrier 110 . for instance , the minimum width w min of the encapsulant 130 is equal to a length of a short side of the rectangular carrier 110 . as shown in fig1 , a distance between the curved convex surface 130 a and the upper surface 110 a of the rectangular carrier 110 gradually increases from the edge of the rectangular carrier 110 to the center of the rectangular carrier 110 . besides , an included angle between the curved convex surface 130 a and the upper surface 110 a exists at the edge of the rectangular carrier 110 and is an acute angle θ , and the acute angle θ is within a range from 5 degrees to 75 degrees , for instance . the encapsulant 130 provided in the present embodiment is silicone doped with a phosphor material 132 , for instance , and a dopant concentration of the phosphor material 132 is within a range from 50 % to 60 %, for instance . the external quantum efficiency of the encapsulant 130 is within a range from 61 % to 63 %, for instance . a peak wavelength ( λ p ) of the first light l 1 emitted from the led chip 120 is between 435 nanometers and 475 nanometers , for instance . besides , second light l 2 is generated after the first light l 1 excites the phosphor material 132 , and a peak wavelength ( λ p ) of the second light l 2 emitted by exciting the phosphor material 132 is between 570 nanometers and 630 nanometers , for instance . here , the peak wavelength ( λ p ) of the first light l 1 emitted from the led chip 120 is defined as a corresponding wavelength of the first light l 1 with the maximum intensity according to the spectrum of the first light l 1 , and the peak wavelength ( λ p ) of the second light l 2 emitted from the phosphor material 132 is defined as a corresponding wavelength of the second light l 2 with the maximum intensity according to the spectrum of the second light l 2 . that is , the led chip 120 may be a blue led chip , and the phosphor material 132 is capable of being excited by blue light and emitting orange - yellow light . besides , the first light l 1 emitted from the led chip 120 is mostly ( e . g ., at least 90 %) converted into the second light l 2 ; therefore , the second light l 2 emitted by exciting the phosphor material 132 accounts for more than 90 % in the led package 100 , and the first light l 1 emitted from the led chip 120 accounts for less than 10 %, as shown by the spectrum in fig3 , for instance . in the present embodiment , the phosphor material 132 is ca x eu y ( si , al ) 12 ( o , n ) 16 , for instance , wherein x is within a range from 0 to 2 . 5 , and y is within a range from 0 . 01 to 0 . 2 . preferably , x is 1 . 67 , and y is 0 . 08 , for instance ; additionally , the peak wavelength ( λ p ) of the second light l 2 emitted by exciting the phosphor material 132 is between 599 nanometers and 610 nanometers , for instance . in the present embodiment , a dominant wavelength ( λ d ) of the light obtained by mixing the first light l 1 ( emitted from the led chip 120 ) with the second light l 2 ( emitted by exciting the phosphor material 132 ) is between 585 nanometers and 595 nanometers , for instance . here , after the first light l 1 and the second light l 2 are mixed , the dominant wavelength ( λ d ) of the mixed light can be calculated according to the chromo coordinate of the mixed light and the chromo coordinate of a reference illuminant ( e . g ., an equal - energy white light point w e ). the way to calculate the dominant wavelength ( λ d ) is elaborated below . here , the equal - energy white light point w e with the chromo coordinate ( 0 . 3333 , 0 . 3333 ) in the cie 1931 chromaticity diagram serves as a reference illuminant . given that the point s represents the light generated by mixing the first light l 1 with the second light l 2 and has the chromo coordinate ( x , y ), the point w e and the point s are connected and extended to be intersected with the spectrum locus at a point λ d . the corresponding wavelength of the point λ d ( with the chromo coordinate ( x d , y d )) on the spectrum locus is the dominant wavelength ( λ d ). according to the present embodiment , the first light l 1 emitted from the led chip 120 and the second light l 2 emitted by exciting the phosphor material 132 in the encapsulant 130 are mixed to obtain orange - yellow light . the cie 1931 chromo coordinate ( x , y ) of the mixed orange - yellow light satisfies following conditions , for instance : to sum up , the encapsulant of the led package provided herein has the curved convex surface and entirely covers the upper surface of the rectangular carrier . said design allows the bonding area between the encapsulant and the rectangular carrier to be increased , thus enhancing the device reliability of the led package . moreover , according to the embodiments provided above , the encapsulant is doped with the phosphor material which allows most of the first light emitted from the led chip to be converted into the second light . the first light is mixed with the second light to obtain the orange - yellow light . thereby , the led package can be better applied for the purpose of vehicle illumination . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the disclosed embodiments without departing from the scope or spirit of the disclosure . in view of the foregoing , it is intended that the disclosure cover modifications and variations of this disclosure provided they fall within the scope of the following claims and their equivalents . | 7 |
generally , the preferred embodiment carries out a process in which a high temperature sample gas is cooled to a temperature below about 300 ° f . and is there sampled at positive pressure by use of a thin film polymer type humidity / temperature sensor . this prevents the danger of damage to the sensor while permitting the use of a sensor which does not require oxygen , ice water or cleaning fluids . referring to fig1 a closed sample chamber 2 is formed from a rigid insulating material , preferably synthetic mica , known by the trade name of &# 34 ; mycalex &# 34 ;. the pump head 100 , including the high pressure outlet , of an electrically driven diaphragm pump 4 is fitted in the pump chamber 2 , preferably by being fluid tightly mounted thereto in a manner which would be obvious to those skilled in the art . the sample chamber 2 has a sealable opening ( not shown ) for access to the pump head . for example , the lid 2a of the sample chamber may be removably mounted and positioned by pins extending from the chamber walls and inserted in positioning holes of the lid . a sample conduit 6 has one end connected to the suction inlet of the pump 4 via a quick release coupling 8 of any well known type , for example the qf - 4 - b - 4pm by nupro company . a fine mesh ( 40 to 140 micron ) stainless steel in line filter 10 is positioned at the inlet end of the conduit 6 . the sample conduit 6 is formed in two parts . a first , cool down , portion 12 is formed at the end of the conduit 6 closest to the filter 10 and the region whose humidity is to be measured . the hot gas loses heat by conduction through the sample conduit 6 and so cools as it approaches the pump 4 . the rate of cooling is greatest at the cool down portion 12 of the sample conduit 6 , i . e ., at that end closest to the filter 10 . nonetheless , the inlet end of the conduit 6 is subjected to high temperatures as high as 600 ° f ., or more . it is therefore necessary to form the cool down portion 12 of a material capable of withstanding high temperatures without damage . in the preferred embodiment shown in fig2 the cool down portion 12 is formed with a stainless steel inner sleeve 12a , and so is rigid . the stainless steel inner sleeve is capable of withstanding the expected temperatures without damage , but its high conductivity presents the danger of cooling to a temperature where condensation of the sample gas may occur . the cool down portion 12 therefore provides for both heat tracing and insulation for the stainless steel sleeve . for example , the stainless steel sleeve 12a can be covered by a spirally wound heat tracing tape 12b , which is in turn covered with a foam insulation 12c , the entire arrangement being enclosed within a hard insulating casing 12d , such as one formed of polyurethane . as the high temperature gas from the high temperature region 82 passes through the cool down portion 12 , its temperature drops from as high as 600 ° f ., or more , to a temperature near that at which sampling can be performed , i . e ., to near 300 ° f ., and preferably to about 400 ° f . the heat tracing and insulation assure that the temperature of the gas in the cool down portion will not fall to a temperature where condensation becomes a problem . the remainder of the sample conduit 6 is formed as a flexible portion 14 which is made from a high temperature insulating material , for example nylon fiber reinforced polytetrafluoroethylene ( teflon ). at least a portion of the flexible portion 14 is heat traced and further insulated . moreover , the flexible portion 14 is connected to the pump 4 via quick disconnect 8 and to the cool down portion 12 in an airtight manner . an exhaust conduit 16 is connected to the bottom of the sample chamber 2 and leads to an atmospheric port . the relative humidity and temperature of the sample air within the sample chamber are measured by the probe of a solid state thin film type relative humidity / temperature sensor 20 such as the thin film polymer sensor ht - 250r manufactured by rotronic instrument corporation of huntington , ny . the rotronic sensor can measure relative humidity and temperatures in environments up to 302 ° f . additionally , an electronic barometer 22 is mounted to the outside of the sample chamber . it has a port extending into the sample chamber , and so can measure the absolute pressure ( barometric pressure plus gauge pressure ) within the sample chamber . the barometer 22 is preferably the px961 by omega engineering . although the relative humidity can be directly measured , it varies with the temperature of the sample , and so is not a good indicator of the absolute moisture content . however , both the dew point ( tdp ) and humidity ratio ( w ) of the sample can be calculated based upon the relative humidity , temperature and , in the case of humidity ratio , absolute pressure , as follows : p * v is the saturated vapor pressure tc is the measured temperature in celsius a , b , c are coef . for water that change at 60c and have the values : 8 . 10765 ; 1750 . 286 ; 235 for tc & lt ; 60c 7 . 96681 ; 1668 . 210 ; 228 for 60c & lt ; tc 150c , pv is the partial pressure of the vapor whose relative humidity hr is measured , yh20 = pv / pa 3 where : yh20 is the mole fraction of water , and absolute pressure pa is measured , yda is the mole fraction of dry air , humidity ratio ( w )= 18 and 29 are the equivalent weights of water and dry air respectively . units are thus lbs h20 / lb da pv &# 39 ; denotes partial pressure calculated based on tc and hr of system by eq . 2 pv =( hr x p * v ) / 100 % then at dew point hr = 100 % ( by definition ). thus at dew point pv = p * v by eq . 2 and tdp =(( b /( a - log pv &# 39 ;))- c . the above calculations of humidity ratio and dew point are preferably performed by a programmable computer 24 such as an opto 22 model lc 2 computer ( fig3 ) which receives data from the relative humidity / temperature sensor 20 and pressure transmitter 22 via an a / d input / output rack 26 which may be an opto 22 manufactured i / 0 rack . the calculated values for humidity ratio and dew point are sent back to the i / 0 rack 26 and supplied , together with the sensed relative humidity , temperature and absolute pressure as analog outputs to a digital process indicator 28 including optical displays , such as dp81 - v - 206 - scl by omega engineering . an analog output from the i / o rack 26 can also be delivered to a chart recorded 30 for keeping a written record of the humidity ratio and / or dew point over time . the computer 24 is also connected to an rs232 interface 32 such as an opto 22 ac 7 card which permits output to , for example , a general purpose computer programmed to allow the user to watch all five outputs ( i . e ., measured pressure , temperature and relative humidity , and calculated w and tdp ), log the outputs to disk at specified intervals and have a real time trending displayed . the data can also be stored in a file for ease of use with conventional spread sheet software . the i / o rack 26 receives both 5 volt dc current and ± 15 volt dc current from modules 34 and 36 which convert a 110 volt ac commercially available current . the commercially available current is also converted to a 28 volts dc current by the module 38 and delivered to the electronic barometer 22 . although the humidity ratio of a hot air sample remains constant at all temperatures , this is only true so long as the air sample at all times remains above its dew point temperature . if the sample falls below the dew point temperature at any time , condensation will occur , affecting the accuracy of the relative humidity readings . these dew points range as high as 210 ° f . it is therefore important that the sample always be maintained above the dew point temperature , and preferably 10 °- 20 ° f . higher . conversely , the sample must also be maintained below about 300 ° f . in order to avoid damage to the probe . as described above , the temperature of the sample drops in the sample conduit 6 . the length of the rigid portion 12 should be selected so that an anticipated sample will be cooled to below the maximum temperature range of the flexible conduit , preferably 300 ° f .- 400 ° f ., at the downstream end of the rigid portion 12 . the temperature of the sample at the downstream end of the flexible portion must not be so low that condensation will occur before the sample reaches the sample chamber 2 . this cannot be reliably done by the simple expedient of selecting the length of the rigid and flexible portions 12 and 14 , since the temperature of the sample which reaches the sample chamber 2 will be affected by other factors , including ambient air temperature , the insulating qualities of the sample conduit 6 and the length of the sample conduit 6 . the present invention therefore provides a thermostatically controlled heater in the sample conduit 6 . for example , the sample conduit 6 is heat traced with a heater wire as a heating element 40 ( fig4 ). the current to the heating element 40 is delivered through a solid state relay ( ssr ) 42 whose operation is controlled by a solid state controller 44 , such as cn9111 by omega engineering . the controller 44 is in turn thermostatically responsive to signals from a k type thermocouple 46 cemented to the interior of the portion 14 of the sample conduit 6 at the downstream end thereof . the controller 44 has pid control algorithms for thermostatically maintaining the temperature of the sample at the desired set point , for example above the dew point temperature but below 300 ° f . similar considerations hold true within the sample chamber itself . for this purpose , heating mats 48 ( only one is shown in fig1 although 3 are preferred ) are mounted within the sample chamber and thermostatically controlled by a controller similar to controller 44 , but responsive to a thermocouple 50 cemented to the bottom of the sample chamber . an important feature of the present invention is that the sample chamber 2 is positively pressurized by the pump 4 . this eliminates the danger of air leaks into the sample chamber which would produce false humidity readings . any air leaks within the sample chamber would leak air out , and so would not affect the humidity readings . although the sample conduit 6 is at negative pressure , air leaks from the sample conduit can be prevented by a tight connection between the sample conduit 6 and the region 82 whose humidity is to be measured . this connection can be made by a releasable connector such as a nut and ferrule . quick release connectors are to be avoided at this location because they have a tendency to leak . on the other hand , a quick release connector 8 is used at the connection between the sample conduit 6 and the pump head 100 . since this connection is within the sample chamber , which is at positive pressure , any leakage will be of gas into the pump head and that leakage will be of sample gas , so that the accuracy of humidity readings will not be affected . another important feature of the invention is the use of a mycalex sample chamber . mycalex has the dual benefit of being both easy to machine and heat insulating . machinability is important because the walls must be drilled and tapped for assembly , and holes must be drilled and tapped in the walls for the sensors 20 and 22 . heat insulation is important because heat losses through the wall of the sample chamber could produce a temperature gradient near the walls . since the measured relative humidity is temperature dependent , false temperature readings will result in false humidity ratio readings . good insulation characteristics for the walls of the sample chamber are also important to avoid the formation of localized cold regions in which condensation can occur . low heat loss through the walls of the sample chamber is also important in minimizing the frequency of the heat up - cool down cycles of the temperature controller for the heating mats 48 . the sensor 20 responds more rapidly to changes in relative humidity than it does to changes in temperature , which means that the computer 24 will calculate false humidity ratio values until both the relative humidity and temperature stabilize . high insulation values for the sample chamber walls will minimize temperature fluctuations , and so will minimize errors due to nonstable temperatures . the humidity determining device of the invention is preferably contained within a case , and so is portable . top , front , back and side views of the case , showing the components contained therein in shadow , are shown in fig5 - 9 , respectively . the case 60 can be hinged and releasably latched for access to the components therein . the case has additional components necessitated by the portable nature of the device . for example , a fan 62 having a filter ( not shown ) circulates air through the case and vents the same through vent 64 in order to prevent heat build - up within the case which could damage the electrical components of the i / o rack , computer , etc . electrical plugs 66 provide connections for standard 110 volt ac current which directly powers the heating elements 40 or 48 for the hose and sample chamber , and which power the low voltage components via the modules 34 - 38 . an amphenol military type connector 68 mounted on the casing provides electrical connection for the conduit heating elements 40 and k thermocouple 46 . in use , the case is opened , the sample conduit 6 is removed from the casing and the heating elements thereof plugged into the connector 68 . after opening the mycalex sample chamber , the quick release connector 8 is connected to a mating connection 80 at the pump head , then the sample chamber is sealed closed . standard , commercially available electrical power is then supplied to the device via plug 66 . after power to the device has been turned on , the controllers 44 for heating elements 40 and 48 are adjusted to their set point temperatures . once the temperatures are stable , the inlet end of sample conduit 6 is connected in order to draw hot air from the region 82 to be sampled , through the sample conduit 6 , into the sample chamber 2 , and out through the exhaust conduit 16 which exhausts outside of the case 60 . the process indicator 28 is then monitored until the detected temperature , relative humidity and pressure stabilize , at which point an accurate reading of the humidity ratio and dew point of the sample can be continuously determined . it should be noted that the accuracy of the preferred humidity / temperature sensor 20 is at a maximum for relative humidities above 10 %. the controllers 44 should therefore be set so that the relative humidity is always maintained above 10 %. for example , if the dew point is 70 ° f . and the controllers &# 39 ; set point is set at 160 ° f ., then the sample relative humidity will be approximately 8 %. the set point should therefore be reduced to a level in which the relative humidity is greater than 10 %, but less than 100 %. for example , in the above example the lower set point could be 100 ° f ., at which temperature the relative humidity is approximately 40 %. obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 6 |
the present invention relates to a method for identifying peptide compounds derived from hsp70 which have at least one mutation or one modification with respect to the natural hsp70 sequence , said compounds bringing about a t response specific for tumors , comprising the following steps : a ) pcr - amplifying a dna fragment encoding hsp70 , obtained from one or more tumor ( s ), b ) cloning the dna obtained in step a ) into a vector capable of replicating in a bacterium , c ) sequencing said fragment in each bacterial colony obtained after culturing the bacteria of step b ), and identifying the mutation ( s ) in hsp70 , d ) determining the immunogenicity of the mutated peptide fragments among those identified in step c ). advantageously , step d ) consists of an elispot assay . it is possible to simply test the immunogenicity of the peptide fragments which have an anchoring sequence for a given hla molecule ( see below , “ reverse immunology ” method ). the peptide fragments to be tested in step d ) can easily be obtained by chemical synthesis using general knowledge in the technical field . in the context of the invention , the term “ hsp70 ” is intended to mean both hsp70 - 1 and hsp70 - 2 . the elispot assay is widely described in the documents of the prior art . for example , herr et al , ( 1998 ) relates to an elispot method for detecting and quantifying cd8 + t lymphocytes secreting tnf - α . in summary , multiscreen - ha plates ( milllipore , bedford , mass .) are coated with an anti - tnf - α antibody ( clone 195 ; boehringer mannheim ), and cd8 + t lymphocytes are added e2 in the presence of antigenic peptides . the secreted tnf - α is detected with a rabbit anti - tnf - α antibody ( serotec , oxford , uk ), a biotin - coupled rabbit anti - igg antibody ( boehringer mannheim ) and the biotin - avidin - peroxidase complex ( vector , burlingame , calif .). the number and surface area of the zones in which the cytokine is present are determined automatically by computer ( herr et al , ( 1997 ). other documents , such as herr et al , ( 1996 ) materials and methods section , paragraph 2 , pages 132 to 135 , and scheibenbogen et al , ( 1997 ) page 933 , disclose this method , and are also incorporated into the description by way of reference . the invention also relates to a method for revealing artificial point mutations or modifications which can increase the immunogenicity of the mutated peptide compounds derived from hsp70 , wherein it comprises the following steps : a ) determining fragments which have a sequence of approximately 9 to 10 amino acids comprising an anchoring motif for a given hla molecule , b ) introducing an additional point mutation or modification at residues 4 , 5 , 6 , 7 or 8 , c ) determining the immunogenicity of the peptide fragments obtained in step b ). preferably , step c ) consists of an elispot assay . this method is well known to persons skilled in the art . there may also be incorporated , by way of reference , into the description , the teachings which are to be found at the following internet address : this method makes it possible to determine any artificial point mutation or modification , ( not present in human tumors ) which would be capable of improving the active principle ( the immunogenic mutated peptide ), using the so - called “ reverse immunology ” method . based on the knowledge of the amino acid sequence of a protein , such as hsp70 , it is possible to predict which of the peptides can bind to an hla pocket , whatever its specificity ( hla - a2 , hla - a1 , hla - b7 , etc . ), then to test these peptides in vitro for their capacity to bind effectively to the hla allele under consideration , and then to introduce a point mutation or modification into the amino acids at certain positions which are critical for affinity . the bimas computer program enables such a prediction to be obtained . the general rules regarding the amino acids involved in anchoring to hla molecules are given in parker et al , ( 1992 and 1994 ) and rammensee et al , ( 1995 ). this information is incorporated by way of reference into the description . of course , the method according to the invention is not limited to the use of the bimas program , and can be used with any equivalent program . another aspect of the invention relates to a peptide compound which can be obtained using a method described above . this compound is characterized by the fact that it comprises a sequence of at least 8 consecutive amino acids of hsp70 , by the fact that it has at least one mutation or one modification with respect to the natural hsp70 sequence , and by the fact that it brings about a specific t response . a specific aspect relates to a peptide compound having at least 80 % homology with the amino acids between positions 286 and 294 of hsp70 . preferably , the amino acid at position 293 is w isoleucine , leucine , valine , alanine , glycine or phenylalanine , more particularly isoleucine . the preferred peptide compounds of the invention have at least one of the following sequences : said compounds can also comprise unnatural amino acids which may or may not be equivalent to the natural amino acids . the term “ peptide compound ” is intended to mean an entity consisting at a minimum of a peptide fragment of hsp70 as defined above , or of a series of said peptide fragments , and having optionally one or more other elements other than natural or unnatural amino acids . the purpose of these elements is to chemically or physically protect said peptide fragments , and / or to promote their absorption by the body , and / or their administration , and / or their bioavailability . for example , this protection enables the peptides to reach their targets without undergoing the action of diverse proteases present in the body . such chemical modifications may also increase the affinity of an antigenic peptide for hla - a2 molecules , and allow an increased effectiveness of the vaccine in vivo to be obtained , rosenberg et al , ( 1998 ). protective chemical groups known to persons skilled in the art , which react with the nh2 and / or cooh ends of a peptide , this modification not significantly lowering the immunogenic nature of the peptide . the lipids or fatty acids which are covalently bonded to the peptide fragments so as to form peptide compounds termed lipopeptides . palmitic acid is one example among others , vitiello et al , ( 1995 ), which is incorporated into the description by way of reference . a carrier protein for said peptide fragments which possesses restriction sites and enables the intact peptide fragments to be conveyed to their sites of action in the body . a second aspect of the invention relates to the dna fragments encoding the peptide fragments mentioned above . the term “ dna fragments ” is intended to mean single - stranded or double - stranded dna , cdna and / or rna fragments . the nucleotide sequence corresponding to the amino acid sequence of said peptide fragments can vary so as to comprise all the various possible codons for a given amino acid according to the principle of degeneracy of the genetic code . a subject of the present invention is also a vector for expressing a peptide fragment , containing an abovementioned dna fragment fused to a promoter which is strong and effective in eukaryotic and / or in prokaryotic cells , in particular in human cells . the vector can be viral , a plasmid vector or a pseudovector , and can comprise selection markers and express immunological adjuvants such as cytokines and / or lymphokines . the invention also relates to dendritic cells loaded with peptide compounds , and dentritic cells transformed with the expression vector expressing the peptide fragments . these cells can also be macrophages . nestle et al , ( 1998 ), discloses a vaccination method which consists in loading the dendritic cells taken from a patient with antigenic peptides ( in culture in vitro ), and injecting them into the lymphatic system of this same patient . this publication is incorporated into the description by way of reference . the subject of another aspect of the invention is a pharmaceutical composition comprising a peptide compound , or a mixture of peptide compounds , according to the invention and a pharmaceutically acceptable vehicle . this composition can also comprise one or more immunological adjuvants , in particular factors which are cytotoxic for tumors . the invention also relates to a pharmaceutical composition comprising an expression vector as mentioned above and a pharmaceutically acceptable vehicle , or a dna fragment according to the invention , or alternatively the cells indicated above , and a pharmaceutically acceptable vehicle . a further aspect of the invention relates to a combination product comprising at least one peptide compound as claimed in the invention and at least one agent which induces cellular stress , for simultaneous or separate use , or for use spread out over time , intended for treating cancer . preferably , said agent can be capable of inducing overexpression of heat shock proteins , in particular hsp70 . advantageously , this agent is an apoptosis inducer , selected in particular from dna - damaging agents and glucocorticoid receptor ligands , or from pro - apoptotic second messengers . the combination product can comprise a viral vector which has a gene which encodes an enzyme for activating said pro - apoptotic agents , in particular thymidine kinase . the expression “ agent which induces cellular stress ” refers to any agent which is capable of inducing overexpression of heat shock proteins , in particular hsp70 . these agents can be in particular apoptosis - inducers . the expression “ apoptosis - inducing agent ” is intended to mean any substance which directly or indirectly affects the viability of a cell . said apoptosis - inducing agent of the present invention can be selected in particular from dna - damaging agents and glucocorticoid receptor ligands , or from pro - apoptotic second messengers . these agents can be selected preferably from those commonly used in the treatment of cancer . thus , said pro - apoptotic second messenger is in particular selected from the following compounds : glucocorticoid derivatives , from alkylating agents such as nitrogen mustards , for example cyclophosphamide , platinum complexes , for example cisplatin , ethyleneimine derivatives , dimethanesulfonoxy - alkane derivatives , piperazine derivatives , from topoisomerase inhibitors , such as topoisomerase 2 inhibitors , for example anthracyclines , epipodophyllotoxin such as etoposide , or topoisomerase - 1 inhibitors , for example camptothecin derivatives , from antimetabolites , such as antifolates , for example methotrexate , antipurines , for example 6 - mercaptopurine , or antipyrimidines , for example 5 - fluorouracil , from antimitotic agents , such as vinca alcaloids or taxoids such as taxotere , and from diverse cytolytic agents such as bleomycin , dacarbazine , hydroxycarbamide , asparaginase , mitoguazone or plicamycin . these antineoplastic agents are described in actualité pharmaceutiques no . 302 ( october 1992 ) pages 38 to 39 and 41 to 43 , incorporated into the description by way of reference . said apoptosis - inducing agent can also be chosen from gamma radiation used in radiotherapy , etoposide , doxorubicin , dexamethasone , ceramide , such as c8 - ceramide , and lonidamine . some of said anticancer agents are more particularly disclosed in u . s . pat . no . 5 , 260 , 327 , which relates to the use of lonidamine for treating metastases , in jo 5017353 , which relates to the use of lonidamine in combination with other anticancer agents , and in ep 291151 , which discloses the use of phlorizin derivatives . these documents are incorporated into the description by way of reference . the product according to the present invention can also comprise a viral vector which has a gene which encodes an enzyme which makes it possible to activate the abovementioned compounds and / or agents , for example thymidine kinase . many patents relate to the use of suicide genes which are activated in specific tissues , in particular for sensitizing cancerous cells to nucleotide analogs . among these documents , which are incorporated into the description by way of reference , are : ep 494776 , ep 690129 , ep 657540 and ep 657541 , which relate in particular to the manufacturing of a medicinal product comprising a vector which has a gene which is capable of catalyzing the changing of a prodrug into an active substance . more particularly , the subject of ep 657539 is the use of the thymidine kinase gene with a cellular specificity , for treating cancer . in another embodiment , the agent which induces cellular stress is selected from compounds which induce tumor hypoxia , in particular from angiogenesis inhibitors . mention may be made in particular of endostatin and angiostatin disclosed by j . folkman , thrombospondin - 1 and - 2 ( tsp - 1 , - 2 ) locopo et al ( 1998 ); the factors ifn gamma , tnf alpha and il - 1alpha , maier et al ( 1999 ), and u - 995 , an inhibitor derived from shark cartilage , sheu et al ( 1998 ). these publications , the review on natural inhibitors , paper et al ( 1998 ), and the general review on the various known inhibitors , harris et al ( 1998 ), are incorporated by way of reference into the description . the pharmaceutical composition or combination product according to the invention can also comprise one or more immunological adjuvants , in particular agents which are cytotoxic for tumors . these products can comprise a pharmaceutical vehicle which is compatible with iv , subcutaneous , oral or nasal administration , and which is preferably selected from positively or negatively charged liposomes , nanoparticles or lipid emulsions . the present invention also relates to the use of a peptide compound for manufacturing a medicinal product , in particular intended for treating cancer , particularly solid tumors , especially carcinomas , melanomas , neuroblastomas and neck and head cancers , preferably renal carcinomas . this medicinal product can be intended for immunization ex situ or in situ . the invention also relates to the use of said peptide compound for increasing , in culture medium , the tumor ctl population and / or inducing the secretion by said ctls of cytotoxic factors , such as for example il - 2 , ifn - γ or tnf , and / or for stimulating the immune defenses , in particular so as to increase the tumor ctl population and / or induce the secretion by said ctls of cytotoxic factors , such as for example il - 2 , ifn - γor tnf . of course , the compositions and products of the invention can be used in combination with radiotherapy . advantageously , the compositions and products of the invention can be taken advantage of to perform repeated immunization for the purpose of causing a breakdown of tolerance against the corresponding natural peptide ( nonmutated ) in a patient . specifically , since it is known that hsp70 is or may be overexpressed in tumors , it is most advantageous to be able to immunize patients against this protein . immunization with the mutated peptides of this protein is capable of breaking down the tolerance of the immune system of patients with respect to hsp70 and consequently , of specifically stimulating cytotoxic and helper t lymphocytes against cancerous cells , whatever the type of cancer or of patient . an additional aspect of the invention relates to a method for producing an antibody which binds to an hsp70 mutant , in particular to the hsp70 - 2 i - 293 mutant , comprising the steps consisting in : a ) immunizing a mammal with a peptide compound as claimed in the invention , b ) isolating a monoclonal antibody which binds to hsp70 - 2 - 293 , particularly to hsp70 - 2 i - 293 , in an immunological assay . the present invention also comprises a monoclonal antibody which binds to hsp70 - 2 - 293 , particularly to hsp70 - 2 i - 293 , and a method for detecting the hsp70 - 2 - 293 mutation or modification , in particular the hsp70 - 2 i - 293 mutation or modification , in which the steps consist in : a ) bringing a sample taken from an individual into contact with one said monoclonal antibody , b ) allowing the formation of the antibody / hsp70 - 2 - 293 complex , c ) detecting hsp70 - 2 - 293 by means of a detectable label which is in the complex or which binds to the complex . in a further embodiment , the present invention relates to a diagnostic kit comprising in particular one or more of said antibodies . this kit can in particular be used for detecting cancer and for the prognostic of established cancer in an individual . finally , a subject of the invention is also a pharmaceutical composition comprising one or more of said monocolonal antibodies and a pharmaceutically acceptable vehicle . the present invention relates , in the same way , to the use of the abovementioned pharmaceutical composition in medicine , for manufacturing a medicinal product , in particular for treating cancer , particularly for treating solid tumors , advantageously carcinomas , melanomas , neuroblastomas , and neck and head cancers , preferably renal carcinomas . the subject of the present invention thus makes it possible to stimulate the immune defenses by increasing the population of ctls specific for tumors , and by inducing the secretion by said ctls of cytotoxic factors . such an amplification of the specific ctls amounts to bringing about and to expanding a veritable army of cells which destroy tumors . specifically , cytotoxic t lymphocytes play a specific role in antigen recognition , and infiltrate into even solid tumors . the activity of ctls consists in recognizing the antigen combined with syngeneic class i mhc molecules . the ctls and the target cell then form a bond via the cd8 - tcr association with mhc i . recognition , highly specific binding , and formation of the tcr - cd8 - mhci ( antigenic peptide ) ternary complex . secretion by ctls of perforin and of various enzymes toward the target cell membrane . formation of channels in the target cell membrane by polymerization of the perforin by an enzyme , in the presence of calcium ( polyperforin channels ). passage of proteases and of toxins through the channels , and action inside the target cell . other toxic factors , such as tnf - α , lymphotoxin ( tnf - β ) and ifn - γ , released by the ctls bind to specific receptors of the target cell membrane . apoptosis is then observed , characterized by the fragmentation of dna , by budding of the cytoplasmic membrane , and by the disintegration of the cell into small fragments ( apoptotic bodies ). a subject of the invention is thus to supply the body with sufficient amounts of peptides which have a high immunogenic potential and are specific for tumors . such peptide fragments are very rare , diluted among an infinite number of peptides , and difficult to identify . in fact , the binding of the peptides with the mhc molecule is located in an invagination which has a specific topology and specific physicochemical properties , which vary depending on the nature of the amino acids involved . thus , a peptide ( approximately 9 amino acids ) binds to an mhc as a function of the nature of these side chains and of its complementarity with the mhc molecule cavity . this association with the mhc takes place in specific intracellular organisms . antigenic proteins are generally degraded to peptides in proteasomes ( ubiquitous multicatalytic proteinase complexes ) before the transport of said peptides into the rough endoplasmic reticulum ( rer ). the mhc i synthesis and the assembly with the peptides takes place in the rer . then , the antigen - mhc i complexes are exported to the surface of the cells via the golgi apparatus . it is thus understood why only certain peptides can bind to the mhc i . with regard to the peptides of the present invention , it has been demonstrated ( see below ) that they have a very low dissociation constant kd ( very strong association ). in this respect , they make it possible to activate the immune system effectively , in particular the ctls . the ctls specific for rcc can be isolated from the tumor - infiltrating lymphocytes ( tils ) of a patient . at least 80 % of the rcc tils are activated dr + lag - 3 + cd8 + cells , angevin et al . ( 1997 ). subsequent to a short activation of these tils in vitro , a response of th1 - polarized type was observed ( secretion of il - 2 and of interferon γ , but not of il - 4 ). on the other hand , finke et al , ( 1993 ) has published that the apparent lack of activity of tils in vivo is due to the poor functioning of the various regulatory cascades in these cells . however , among the 5 ctls described in the present invention , clone 2a11 ( tcrbv1j1s6 ) is particularly advantageous since it is amplified at the tumor site and represents up to 3 % of the tcr α / β + tils . in addition , this clone recognizes an antigen specific for tumors which is presented by hla - cw16 , angevin et al . ( 1997 ). this thus demonstrates that the hla - c molecules are capable of presenting elements at the tumor site in this patient . hsp70 is encoded by the duplicated locus ( hsp70 - 1 , hsp70 - 2 ) located in the mhc region at 92 kb from the c2 gene in the direction of the telomer , milner et al , ( 1990 ). this dna segment is termed class iv region , and comprises at least 7 genes involved in inflammatory responses and stress responses , gruen , ( 1997 ). the two intron - lacking genes ( hsp70 - 1 and hsp70 - 2 ) encode an identical protein of 641 amino acids . there are a few sequence differences in the promoter region and complete divergence in the untranslated 3 ′ region . using a probe specific for hsp70 - 2 , a rise in the amount of mrna ( 2 . 4 kb ) has been shown subsequent to a heat shock . the hsp70 - 2 probe has made it possible to detect a small amount of 2 . 4 - kb mrna in the constitutive rna of the cell lines of the rcc tumor and in frozen surgical samples of said tumor . the reason for which the allogenic cell line hla - a2 + rcc , which expresses low levels of hsp70 - 2 mrna , was not killed by ctl 11c2 , may be due to the difference observed in target sensitization assays between the mutated peptides and the wild - type decapeptide 286 - 295 ( 5 × 10 − 11 m and 5 × 10 − 8 m , respectively , for maximum half - lysis ). the transcription and overexpression of wild - type hsp70 - 2 in cos - 7 cells induce the secretion of tnf by ctl 11c2 . it is known that hsps are nonpolymorphic molecules which do not differ in their primary structure among normal tissues and cancers , or among normal cells and cells infected with viruses . thus , the immunization capacity of preparations comprising hsp is due to the association of the hsp molecules with peptides generated by the cells from which the hsps were isolated . specifically , the hsp - peptide complexes can be generated in vitro , and the biological activity of such complexes is comparable to that of the hsp - peptide complexes generated in vivo , blachere et al , ( 1997 ). while this observation demonstrates that hsps are adjuvants which elicit a response from cd8 + t cells , our results indicate that certain peptide fragments of hsp70 are directly immunogenic . for the remainder of the description and for the examples , reference will be made to the figures whose legend is given below . fig1 : specific lytic activity of clone 11c2 against the rcc - 7 autologous cell line . the cytotoxicity of the 11c2 - ctls with respect to the rcc - 7 cell line was assayed by the standard chromium release assay at various effector / target ratios ( e / t ratio ). the inhibition of the cytotoxic activity of 11c2 was assayed after several preincubations of the ctls for two hours with the anti - hla class 1 mab ( monoclonal antibody ) indicated , at a predetermined saturation concentration . fig2 : secretion of tnf by the 11c2 - ctl clone during stimulation with the rcc - 7 autologous cell line . 5000 ctls were incubated with 20 , 000 rcc - 7 cells . the amount of tnf was measured after culturing for 20 hours , by assaying the toxicity of the supernatants with tnf - sensitive wehi - 164 cells ( clone 13 ). the inhibition of the secretion of tnf was assayed after preincubation of clone 11c2 for two hours with the anti - class 1 hla mab as indicated . fig3 : cytotoxicity of the 11c2 ctls on multiple rcc allogenic cell lines . 11c2 was assayed on the rcc - 7 autologous line and on multiple rcc allogenic cell lines ( rcc - 8 , rcc - 9 , rcc - 10 and rcc - 11 ) in a standard chromium release assay at the e / t ratio indicated . the hla molecules shared with rcc - 7 are indicated in brackets . fig4 : stimulation of the 11c2 ctl by the cells transiently cotransfected with the autologous hla - a * 0201 cddn and the a18 cdna . the 11c2 ctl was added 48 hours after cotransfection . the tnf contained in the supernatants was estimated 20 hours later by assaying its toxicity on wehi - 164 cells ( clone 13 ). the stimulatory cells comprise the rcc - 7 cell line as a positive control and cos - 7 cells which are nontransfected or transfected with the hla * 0201 cdna alone as a negative control . fig5 : location of the epitope region of hsp70 - 2 recognized by the 11c2 ctl . ( a ) the total length of the hsp70 - 2 cdna is represented schematically in black and white . 5 ′ ut and 3 ′ ut correspond to the 5 ′ and 3 ′ untranslated regions respectively . the coding region ( in black ) begins with the translation start site ( atg codon ) and corresponds to nucleotide + 1 . the multiple truncated clones obtained from the a18 cdna are represented in gray . the a18 cdna begins at nucleotide 577 of the coding region . the mutated nucleotide is marked with an asterisk ( position 877 ). ( b ) illustrates the stimulation of the 11c2 ctl by cos - 7 cells temporarily cotransfected with the autologous hla - a * 0201 cdna and with each of the various truncated a18 cdnas . the transfected cells were incubated for 24 hours with 5000 11c2 ctls , and the ld amount of tnf was measured 20 hours later . the control stimulatory cells comprise cos - 7 cells which are non - transfected or transfected with the a18 cdna alone , as a negative control , and cotransfected with the a18 and a * 0201 cdnas as a positive control . fig6 : lysis by 11c2 ctls of the autologous cell line transformed with ebv and incubated with the peptides encoded by hsp70 - 2 2000 cells transformed with ebv and labeled with 51 cr were incubated for 1 hour in the presence of the indicated hsp70 - 2 peptides ( seq id nos . 2 , 7 , 1 , and 8 ) at multiple concentrations . the 11c2 ctl was then added at an effector / target ratio ( e / t ) of 31 / 1 . chromium release was measured 4 hours later . the asterisks indicate the mutated amino acids . fig7 : induction of hla - a2 expression on t2 cells by the hsp70 - 2 antigenic peptides . t2 cells were incubated at 26 ° c . for 16 hours in serum - free medium , with or without peptide at a concentration of 20 μm . next , the peptides ( seq id nos . 2 , 7 , 1 , and 8 ) were again added , and the cells were incubated at 37 ° c . at 30 - minute or one - hour intervals , the cell pellets were collected and the change in hla - a2 expression was analyzed by flow cytometry with an anti - hla - a2 mab ( ma2 . 1 ). the amino acid sequences of the peptides are represented . the mutated amino acid is represented by an asterisk . the total cytoplasmic rna ( 15 μg ), derived from the rcc - 7 tumor ( row no . 1 ), from the rcc - 7 cell line ( no . 2 ), and the autologous cell line transformed with ebv ( no . 3 ), is maintained at 37 ° c . ( subrow c ) or treated by heat shock for 2 hours at 40 ° c . ( subrow hs ), was fractionated on denaturing formaldehyde / agarose gel and transferred onto hybond - n + nylon membrane . the northern blot was hybridized with the probes consisting of a fragment specific for hsp70 and for the glyceraldehyde - 3 - phosphate dehydrogenase ( gapdh ) cdna . the migration position of the 28s and 18s rnas is given . the approximately 2 . 4 - kb hsp70 - 2 transcript is indicated by an arrow above the 18s rna and above the gapdh mrna . this figure shows that the mutation or modification brings about a highly increased immunogenecity power . mutated hsp is the peptide compound according to the invention , hsp nat is the corresponding natural peptide ( nonmutated ), mp is the positive control ( very immunogenic peptide of the “ matrix protein ” and t2 is the negative control ( cells not stimulated by the peptide ). the studies of the present invention have allowed the isolation of rcc - ctl clones originating from tils ( tumor - infiltrating lymphocytes ) obtained in three different experiments and using two experimental conditions ( use of il - 2 or of il - 2 + il - 7 + il - 12 ). between the 20th and 30th day , these cells , belonging to the cultures which show considerable lysis of the autologous cell line of the rcc - 7 tumor , were cloned by a limiting dilution . out of 8 clones obtained by this protocol , 5 were selected as a function of their distinct tcr phenotype . all the clones are tcr α / β + cd8 + cd4 − cytotoxic cells , and produce tnf when they are stimulated by autologous cells of the tumor . the blocking effect of the anti - class 1 mab wc / 32 showed that the cytotoxic activity is mhc i molecule - restricted ( fig1 ). the lytic activity of clone 11c2 was blocked by mab ma2 . 1 specific for hla - a2 ( fig2 ). this result suggests that hla - a2 is the presentation molecule for 11c2 , and that 11c2 recognizes the autologous cells of the tumors ( fig3 ). in order to identify the gene encoding the antigen a genetic approach was used , comprising the transfection of a cdna library originating from the rcc tumor into cos - 7 cells with the cdna encoding the hla - a2 presentation molecule , seed b . ( 1987 ). the expression vector used contains the sv40 origin of replication , which allows a considerable multiplication of the episomes of the transfected plasmid , and thus high expression of the transfected genes . a cdna library was used which was constructed in the pcdna i expression vector using the rnas originating from the rcc - 7 cell line . this library was divided into 400 parts of 200 recombinant plasmids , and each part was cotransfected in duplicate with the pcdna i autologous hla - a * 0201 construct , into cos - 7 cells . the cos - 7 cells were then assayed for their capacity to stimulate the production of tnf by clone 11c2 . 48 hours later , the cotransfected cos - 7 cells were incubated overnight with 11c2 , and the tnf concentration in the supernatant was determined through its cytotoxic action on wehi cells . the amount of tnf in the supernatants is below 5 pg / ml , except for two pairs ( 40 and 45 pg / ml ) of duplicated experiments . the second screening was carried out by transfecting the cos cells with 100 parts of 20 recombinant plasmids originating from the extraction of double positives . finally , a third screening led to two cdna clones ( termed a8 and b65 ) being isolated , which make it possible to transfer the antigen expression into the hla - a 0201 cos - 7 cells . the results obtained with the a18 cdna clone is presented in fig4 . the sequence of the longest cdna ( a18 ) is 1 . 9 kb with 100 % homology to the nucleotides from 577 to 2876 of the hsp70 - 2 cdna , except for a mutation at position 877 ( an adenine in place of a thymine ). position + 1 is the translation start site of hsp70 - 2 , milner et al , 1990 . with the aim of identifying the entire length of the hsp70 - 2 cdna , and in order to verify whether the mutation is only present at the tumor site , we performed a pcr ( hsp70 - 2 is an intron - lacking gene ) on the dna originating from the extraction of rcc - 7 cells and of b cells transformed with ebv and of pha blasts . a single 2 - kb product , corresponding to nucleotide − 36 to 1974 , was obtained in each of the cases , and was subcloned into the vector pcdna i for sequencing and expression . 4 of the 7 dna clones , obtained from the tumor fragment , have the mutation . for the cells transformed with ebv and the blasts , none of the 14 dna sequences analyzed carries the mutation . thus , the mutation is present only on a chromosome in the tumor cells and is absent in the normal cells . in order to delimit the minimum nucleotide region encoding the antigenic peptide , multiple truncated cdnas were obtained from the a18 cdna clone . the use of exonuclease iii made it possible to gradually generate deletions starting from the 3 ′ end of the cdna ( fig5 ). these cdna fragments were cotransfected into cos - 7 cells with the autologous hla - a * 0201 cdna . a minimum coding nucleotide region was located between nucleotides 730 and 944 . the truncation in the region carrying the single mutation specific for the tumor abolishes recognition by 11 c2 ctls . peptides carrying the hlas - a * 0201 binding motif were sought in this region , and among the 18 peptides assayed , only 2 ( the nonapeptide slfegidiy ( seq id no : 1 ), amino acids 286 to 294 , and the decapeptide slfegidiyt ( seq id no : 2 ), amino acids carrying the mutant isoleucine residue at position 8 were recognized . maximum half - lysis was obtained with only 5 × 10 − 11 m of the decapeptide , compared to 5 × 10 − 7 m of the nonapeptide ( fig6 ). 11 c2 ctl also recognizes the wild - type decapeptide 286 - 295 ( slfegidfyt ) ( seq id no : 7 ), with a maximum half - lysis of 5 × 10 − 8 m , but not the wild - type nonapeptide 286 - 294 ( fig6 ). antigenic peptides which can bind hla - a2 can regulate positively the expression of hla - a2 molecules in t2 cells , nijman et al . ( 1993 ). the binding capacity of the hsp70 - 2 286 - 295 decapeptides ( mutated and wild - type ) was compared to that of the nonapeptide 286 - 294 . the binding of these two decapeptides is stable over a period of 4 hours at 20 μm without showing any difference between the mutant and wild - type forms ( fig7 ). the hsp70 - 2 nonapeptides are less effective , but their binding is comparable to that of the mart - 1 27 - 35 peptide to hla - a2 . as could be expected , no effect was observed for the control peptide hla - b7 ( see fig7 ). a probe specific for the hsp70 - 2 locus , including the 3 ′ untranslated region , was used to examine the expression of the hsp70 - 2 gene . a 2 . 4 - kb mrna was detected in the autologous cells transformed with ebv . similarly , a low level of expression was observed in the untreated rcc - 7 cells and in the frozen surgical samples of rcc - 7 ( fig8 ). low levels of expression were also observed in other tumors , in particular in melanomas , neuroblastomas , adenocarcinomas of the colon and bladder tumor fragments . the cell lines were established from the cells of renal carcinoma rcc , as described previously by angevin et al , 1997 . in summary , the primary tumors were obtained from untreated patients who had undergone a radical nephrectomy in our institution . patient 7 ( hla - a2 , - a29 , - b44 , - b51 , - cw15 , - cw16 ) is a 54 - year - old male individual with a metastatic rcc . after surgery and enzymatic digestion , fresh cell suspensions from the rcc tumors were seeded in a culture medium composed of dulbeccos &# 39 ; modified eagle medium ( dmem ), penicillin ( 50 iu / ml ), streptomycin ( 50 μg / ml ), 1 % of 200 mm l - glutamine , 1 % of 200 mm sodium pyruvate , 10 % of fetal calf serum ( fcs ) and 1 % of ultroser g ( gibco - brl , paisley , uk ). this medium is termed , in the remainder of the document , “ rcc medium ”. all the tumor cell lines were maintained in this rcc medium . the rcc - 7 cell line was obtained from the primary tumor of patient 7 . the ebv autologous cell line was obtained after infection of pbmcs of patient 7 . the cell line transformed with ebv was maintained in rpmi 1640 ( gibco - brl ), supplemented with 10 % of fcs . wehi - 164 clone 13 , a tnf - sensitive mouse fibrosarcoma cell line , was diligently provided by benoit van den eynde ( ludwig institute for cancer research , brussels , belgium ), and was cultured in rpmi 1640 ( seromed , biochrom kg , berlin , germany ) supplemented with l - glutamine , sodium pyruvate , antibiotics and 5 % of fcs , at a concentration of 0 . 01 to 0 . 05 × 10 6 cells / ml . the mutant human cell line cem × 721 . 174 . t2 ( t2 ), salter et al , ( 1989 ), was maintained in rpmi - 1640 supplemented with 10 % of fcs . this cell line was diligently provided by pierre langlade ( pasteur institute , paris , france ). all cell cultures were maintained in an atmosphere saturated with water and with a 5 % co 2 content . the tils , originating from the tumor suspensions , were inoculated in flasks containing rpmi 1640 , penicillin , streptomycin , 1 % of l - glutamine , 1 % of sodium pyruvate and 8 % of human ab serum ( institut jacques boy s . a ., reims , france ), termed complete medium . the tils were seeded at the same concentration in complete medium supplemented with 10 iu / ml of ril - 2 , 50 iu / ml of ril - 7 ( sanofi , toulouse , france ) and 10 iu / ml of ril - 12 ( genetics institute , cambridge , mass . ), for three days . from the 3 rd day onward , the tils were fed using the complete medium with 30 iu / ml of ril - 2 , 50 iu / ml of ril - 7 and 10 iu / ml of ril - 12 . the phenotype and the cytotoxic activity of the til cell lines were characterized after 14 and 21 days of stimulation . the mabs conjugated either to fluorescein ( fitc ) or to phycoerythrin ( pe ), and directed against the tcr α / β , cd3 ( leu4 ), cd4 ( leu3a ), cd8 ( leu8 ), cd80 ( b7 . 1 ) and hla dr ( l249 ), were purchased from becton dickinson ( mountain view , calif .). cd56 ( nkh1a ) originates from coultronics ( hialeah , fla .). the tils were characterized by double immunostaining , by incubating the cells for 30 min at 4 ° c . with fitc - or pe - mab . the flow cytometry analysis was carried out on a facscan ( becton dickinson ) and using the cellquest software . the laboratory ascites were w6 . 32 ( anti - hla - a / b / c ), ma2 . 1 ( anti - hla - a2 and - b17 ) and b1 . 23 . 2 ( anti - hla - b / c ), and were selected for the functional and immunofluorescence experiments , at predetermined saturation concentrations up to a final dilution of between 1 / 200 and 1 / 2000 . after culturing for 3 weeks , the lymphocytes were cloned by diluting them to the limit . the cloning was performed between 600 and 0 . 6 cells / well , in 96 - well plates containing rpmi medium supplemented with 8 % of human ab serum , 30 iu / ml of ril - 2 and 3 % of tcgf . at the bottom of the wells , a feeder layer was cultured consisting of irradiated autologous tumor cells ( 1 × 10 4 / well ), of irradiated allogenic lymphocytes ( 8 × 10 4 per well ) and of irradiated cells transformed with ebv ( 2 × 10 4 / well ). the clones were fed three times per week with the complete medium containing ril2 and tcgf . the immunological phenotype and the cytotoxicity were characterized for the cloned cells . the cytotoxicity assays were carried out using the standard 4 - hour chromium release assay , as described above , angevin et al , ( 1997 ). in summary , 2 × 10 3 51 cr - labeled target cells were incubated for 4 hours at 37 ° c ., with the effector cells at various e / t ratios , in a final volume of 200 μl . with regard to lysis inhibition by the mabs , the target cells were preincubated for two hours in the presence of saturating concentrations of mab , before adding the effector cells . at the end of the incubation , 40 μl of supernatant were transferred to lumaplate 96 solid scintillation plates ( packard instruments , meriden , conn . ), were dried overnight and counted in a beta - radioactivity counter ( packard instruments ). the class 1 hla alleles were cloned using the pcr method described by ennis et al , ( 1990 ), with a few slight modifications . the total rna was prepared from the rcc - 7 cell line using rna b ( bioprobe systems ). the c ) first cdna strand was synthesized with an oligo ( dt ) probe and reverse transcriptase ( invitrogen ). the cdna was used as a matrix for a 30 - cycle pcr amplification with the following probes : these probes correspond to the consensus sequences of the 5 ′ and 3 ′ untranslated regions , respectively , of the class 1 alleles . these probes are identical to the hla - 5p2 and hla - 3p2 probes described above , ennis et al . ( 1990 ), except for the cloning site ( the sal i and hind iii sites for 5p2 , and the hind iii and xba i sites for 3p2 , respectively , were replaced . the pcr products were digested with hind iii and xba i , and ligated into the plasmid pcdna i ( invitrogen ) these constructs were transfected into e . coli mc 1061 / p3 . the plasmid dna was then extracted from several colonies using qiagen columns ( qiagen ). the dna sequencing was carried out using the “ abi prism dye terminator cycle sequencing ready reaction kit ” ( applied biosystems ) and an automatic dna sequencer . the sequences were compared to the class i hla nucleotide sequences available in the databases . the poly ( a )+ rna was extracted from the rcc - 7 cell line using the mrna isolation system ( fast track kit 2 . 0 , invitrogen ), respecting the manufacturer &# 39 ; s instructions . the first cdna strand was synthesized using amv reverse transcriptase with an oligo - dt probe containing a not i site at its 5 ′ end . the rna - cdna hybrid created by the synthesis of the first strand was transformed into double - stranded cdna with dna polymerase i in combination with rnase h and dna ligase from e . coli . next , t4 dna polymerase was used to produce a blunt cleavage in the cdna . bstx i linkers were added , and the size of the cdna was obtained by fractionation on agarose gel . the cdna of desired size ( longer than 800 nucleotides ) was ligated into the vector pcdna i cleaved with bstx i / not i , and the suitable e . coli strain ( mc1061 / p3 ) was transformed . for the screening experiments , the plasmid dna obtained from some bacterial colonies was prepared according to the following protocol : 100 or 200 colonies , cultured in lb - agar medium ( with 30 μl / ml of ampicillin and 10 μl / ml of tetracycline , were seeded in 2 ml of lb medium and incubated overnight at 37 ° c . the plasmid dna was extracted using the alkaline lysis method , birnboim et al , ( 1979 ), and was resuspended in 30 μl in 10 mm tris - 1 mm edta , ph 7 . 5 , containing 20 μl / ml of rnase a . the plasmid dna concentration was adjusted to 40 ng / μl . the transfection experiments were carried out by the “ deae - dextran - chloroquin method , brichard et al , ( 1993 ). three days before transfection , the cos - 7 cells were seeded in 96 - microwell plates at the concentration of 5 × 10 3 cells / well , in 150 μl of rpmi medium containing 20 % of fetal calf serum . for the transfection , the medium was replaced with 30 μl of deae - dextran / dna mixture . these mixtures were prepared for double transfections in microwells by adding sequentially : 200 ng of plasmid dna originating from the cdna library , 200 ng of plasmid pcdna i / hla - a * 0201 , 25 μl of 150 mm nacl , 10 mm tris , ph 7 . 4 ( termed tbs buffer ), 35 μl of tbs containing 1 mg / ml of deae - dextran ( pharmacia biotech europe gmbh , saclay , france ). the cells were incubated with this mixture plus 105 μl of dmem supplemented with 10 % of non - complemented “ nuserum ” ( becton dickinson ) and 100 mm of chloroquin ( sigma - aldrich chimie sarl , saint quentin fallavier , france ), for 30 minutes at room temperature . next , the cells were incubated for 4 hours at 37 ° c . under a 5 % co 2 atmosphere . after incubation , the medium was removed , and the cells were incubated for 2 min in 1 × pbs containing 10 % of a solution of dimethyl sulfoxide . the cells were washed once with 1 × pbs , and incubated in rpmi containing 10 % of fcs for 48 hours . the medium was then removed and the cells were washed once with 1 × pbs . 5000 ctls were added to the wells in 100 μl of rpmi containing 10 % of fcs , after 20 hours , the supernatant was collected and its tnf content was determined by assaying its cytotoxicity on wehi - 164 clones 13 in an mtt ( 3 -[ 4 , 5 - dimethylthiozole ]- 2 , 5 - diphenyltetrazolium bromide ( sigma - aldrich ) calorimetric assay , as described previously , traversari et al , ( 1992 ). with regard to the inhibition of the secretion of tnf by the mabs , the target cells were preincubated for 2 hours in the presence of a saturating concentration of mabs , before adding the effector cells for a further 20 hours . the genomic dna was extracted from the rcc - 7 cell line with dnazol ™ ( life technologies ). 1 μl of dna was used for a pcr reaction using taq dna polymerase ( perkin elmer ). the following probes were used : ( nucleotides 1955 to 1974 , antisense ), seq id no . 6 . these probes contain the hind iii and xba i restriction sites , respectively . the conditions for the pcr were 98 ° c . for 1 min , followed by 30 amplification cycles ( 98 ° c . for 15 sec , 65 ° c . for 1 min , 72 ° c . for 2 min , with a final extension for 10 min at 72 ° c .). the pcr product obtained was digested with hind iii and xba i and purified on absorbent glass beads ( geneclean ), and was then subcloned into the hind iii and xba i sites of the expression vector pcdna i for sequencing and cotransfection , with hla - a * 0201 , into the cos - 7 cells . the a18 cdna was isolated from the cdna library manufactured from the expression vector pcdna i . the plasmid was digested with sph i and xba i , before treatment with exonuclease iii in order to generate gradual deletions starting from the 3 ′ end of the a18 cdna . in order to obtain a considerable number of truncated cdna clones , the “ exo mung bean deletion kit ” ( stratagene ) was used . after ligation , the bacterium e . coli mc1061 / p3 was transformed with the truncated cdnas . the plasmid dna was extracted from each clone , and then sequenced and cotransfected , with hla - a * 0201 into the cos - 7 cells . in the screening assay , the peptides used were synthesized by “ pepset technology ” ( chiron technologies , suresnes , france ). for the functional assays , the peptides were synthesized on solid phase using f - moc ( temporary nh2 - terminal protection ), and were purified by preparative hplc . the analytical hplc indicates that the peptides are at least 95 % pure . the lyophilized peptides were dissolved in 10 mm of dmso in water , and conserved at − 20 ° c . the peptides were used in a chromium release assay . 2000 autologous cells transformed with ebv , and labeled with 51 cr , were incubated for 1 hour at 37 ° c . on 96 - well plates , with diverse concentrations of peptides , before adding 11c2 ctls . t2 cells , nijman et al , ( 1993 ), were cultured 48 hours before the assay , in a serum - free aim - vwmedium ( gibco - brl ). for the binding assays , the t2 cells ( 106 ) were incubated at 26 ° c . for 16 hours in the same medium in 0 . 8 % of dmso , with or without peptide at a concentration of 20 μm . next , the peptides ( 20 μm ) were again added , and the cells were incubated at 37 ° c . at 30 - min or one - hour intervals , the cell pellets were collected , and the hla - a2 expression level was monitored using the anti - hla - a2 mab ( ma2 . 1 ). the cells were either maintained at 37 ° c . or underwent a heat shock at 42 ° c . for 2 hours , before recovery by centrifugation . the total rna was extracted by guanidinium isothocyanate lysis , and was ultra - centrifuged in cesium chloride . samples of total rna ( 15 μg ) were fractionated in a denaturing gel containing 1 % of formaldehyde - agarose , and were transferred onto hybond - n + nylon membranes respecting the manufacturer &# 39 ; s instructions ( amersham france s . a ., les ulis , france ). the northern blot was hybridized with a probe specific for hsp70 - 2 ( nucleotides 1955 to 2159 ) and with the glyceraldehyde - 3 - phosphate dehydrogenase ( gapdh ) probe . all probes were labeled with [ 32 p ] dctp ( 3000 ci mmol − 1 ) using the prime - it ™ ii random primer labeling kit ( stratagene ). the hybridization was carried out at 45 ° c . for 16 hours with the hsp70 - 2 probe ( 106 cpm / ml ) and the gapdh probe ( 105 cpm / ml ). the membranes were washed twice with 2 × ssc at room temperature , once for 45 min with 2 × ssc / 0 . 1 % sds at 62 ° c ., and once at 62 ° c . for 10 min with 0 . 1 × ssc , before autoradiography at 80 ° c . for 11 days . cd8 + cells were isolated from hla - a2 - positive donors by negative immunomagnetic purification ( using antibodies against cd4 and cd56 cells ). 100 , 000 cd8 + cells were directly added to 100 , 000 hla - a2 . 1 - positive t2 cells loaded with 10 − 6 m of peptides , in 96 - well plates in which the bottom is coated with nitrocellulose ( millipore ). after stimulation of the cd8 + cells for 20 hours , an elispot - ifnγ assay was performed . the results are given in table i below . the positive control is the peptide mp or “ matrix protein ”, this being an influenza virus envelope protein which is very immunogenic in humans . these results show that it is possible to induce human cd8 lymphocytes from healthy hla - a2 + individuals with the preferred peptide compound of the invention ( seq id no . 1 and 2 ), but not with the corresponding nonmutated peptide . it clearly emerges that the mutation brings about a highly increased immunogenicity power , since lymphocytes which have never been stimulated by this peptide are able to secrete interferon gamma within 24 hours , without any culturing in vitro or addition of cytokines . alexander j . p ., kudoh s ., melsop k . a ., hamilton t . a ., edinger m . g ., tubbs r . r ., sica d ., tuason l ., klein e ., bukowski r . m ., and finke j . h . 1993 , t - cells infiltrating renal cell carcinoma display a poor proliferative response even though they can produce interleukin 2 and express interleukin 2 receptors . cancer res . 53 : 1380 . angevin e ., kremer f ., gaudin c ., hercend t ., and triebel f . 1997 , analysis of t - cell immune response in renal cell carcinoma ; polarization to type 1 - like differentiation pattren , clonal t cell expansion and tumor - specific cytotoxity , int . j . cancer 72 : 431 . bernhard h ., karbach j ., wolfel t ., busch p ., storkel s ., stockle m ., wolfel c ., seliger b ., huber c ., buschenfelde k . h . m . z ., and knuth a . 1994 , cellular immune response to human renal - cell carcinomas ; definition of a common antigen recognized by hla - a2 restricted cytotoxic t - lymphocyte ( ctl ) clones . international journal of cancer 59 : 837 . birnboim h . c ., and doly j . 1979 . a rapid alkaline extraction procedure for screening recombinant plasmid dna . nucleic acid , res . 7 : 1513 . blachere n . e ., li z ., chandawarkar r . y ., suto r ., jaikaria n . s ., basu s ., udono h ., and srivastava p . k . 1997 . heat shock protein - peptide complexes , reconstituted in vitro , elicit peptide - specific cytotoxic t lymphocytes response and tumor immunity . j . exp . med . 186 : 1315 . brichard v ., pel a . v ., wölfel t ., wölfel c ., plaen e . d ., lethé b ., coulie p ., and boon t . 1993 . the tyrosinase gene codes for an antigen recognized by autologous cytolytic t lymphocytes on hla - a2 melanomas . j . exp . med . 178 : 489 . brouwenstijn n ., gaugler b ., kruse k . m ., spek c . w . v . d ., mulder a ., osanto s ., eynde b . j . v . d ., and schrier p . i . 1996 . renal - cell carcinoma - specific lysis by cytotoxic t - lymphocyte clones isolated from peripheral blood lymphocytes and tumor - infiltrating lymphocytes . inter . j . cancer 68 : 177 . ennis p . d ., zemmour j ., salter r . d ., and parham p . 1990 . rapid cloning of hla - a , b cdna by using the polymerase chain reaction : frequency and nature of errors produced in amplification . proc . natl . acad . sci . 87 : 2833 . even j ., lim a ., puisieux i ., ferradini l ., dietrich p . y ., toubert a ., hercend t ., triebel f ., pannetier c ., and kourilsky p . 1995 . t - cell repertoires in healthy and diseased human tissues analysed by t - cell receptor beta - chain cdr3 size determination : evidence for oligoclonal expansions in tumours and inflammatory diseases . research immunology . 146 : 65 . farace f ., angevin e ., poullion i ., leboullaire c ., ferir g ., elias d ., escudier b ., and triebel f . 1997 . t - cell receptor cdr3 size distribution analysis to evaluate specific t - cell response to cancer vaccines . inter . j . cancer 71 : 972 . finke j . h ., zea a . h ., stanley j ., longo d . l ., mizoguchi h ., tubbs r . r ., wiltrout r . h ., o &# 39 ; shea j . j ., kudoh s ., klein e ., bukowski r . m ., and ochoa a . c . 1993 . loss of t - cell receptor zeta chain and p561ck in t - cells infiltrating human renal cell carcinoma . cancer research , 53 : 5613 . gaugler b ., brouwenstijn n ., vantomme v ., szikora j . p ., spek c . w . v . d ., patard j . j ., boon t ., schrier p ., and eynde b . j . v . d . 1996 . a new gene coding for an antigen recognized by autologous cytolytic t lymphocytes on a human renal carcinoma . immunogenetics . 44 : 323 . genevee c ., diu a ., nierat j ., caignard a ., dietrich p . y ., ferradini l ., roman - roman s ., triebel f ., and hercend t . 1992 . an experimentally validated panel of subsfamily - specific oligonucleotide primers ( valphal - w29 / vbetal - w24 ) for the study of human t cell receptor variable v gene segment usage by polymerase chain reaction . eur . j . immunol . 22 : 1261 . gruen j . r ., and weissman s . m . 1997 . evolving views of the major histocompatibility complex . blood . 90 : 4252 . harris sr ; thorgeirsson up , tumor angiogenesis : biology and therapeutic prospects , in vivo 1998 november - december ; 12 ( 6 ): 563 - 70 herr w , protzer u , lohse a w , gerken g , zum buschenfelde k h m , wolfel t . quantification of cd8 + lymphocytes responsive to human immunodeficiency virus ( hiv ) peptide antigens in hiv - infected patients and seronegative persons at high risk for recent hiv exposure . journal of infdis 1998 ; 178 : 260 - 265 . herr w , schneider j , lohse a w , zum buschenfelde k h m , wolfel t . detection and quantification of blood derived cd8 + t lymphocytes secreting tumor necrosis factor alfa in response to hla - a2 . 1 binding melanomy and viral peptide antigens . journal of 1 mm meth 191 ; 1996 ; 131 - 142 . herr w , linn b , leister n , wandel e , meyer zum buschenfelde k h , wolfel t . the use of computer - assisted video image analysis for the quantification of cd8 + t lymphocytes producing tumor necrosis factor spots in response to peptide antigens . journal of 1 mm meth 1997 ; 203 : 141 - 152 . kumar a ., farace f ., gaudin c ., and triebel f . 1996 . clonal t cell expansion induced by interleukin - 2 therapy in blood and tumors . j . clin . invest . 97 : 1219 . locopo n ; fanelli m ; gasparini g . clinical significance of angiogenic factors in breast cancer , breast cancer res treat 1998 ; 52 ( 1 - 3 ): 159 - 73 ., maier j a ; morelli d ; lazzerini d ; menard s . ; colnaghi m i ; balsari a , inhibition of fibronectin activated migration of microvascular endothelial cells by il1 alpha , tnf alpha and if gamma , cytokine 1999 february ; 11 ( 2 ): 134 - 9 . milner c . m ., and campbell r . d ., 1990 . structure and expression of the three mhc - linked hsp70 genes . immunogenetics . 32 : 242 . milner c . m ., and campbell r . d ., 1992 . polymorphic analysis of the three mhc - linked hsp70 genes . immunogenetics . 36 : 357 . nestle f . o ., alijagic s ., gilliet m ., sun y ., grabbe s ., dummer r ., burg g . and schadendorf d ., 1998 . vaccination of melanoma patients with peptide or tumor lysate - pulsed dendritic cells . nature medicine 3 328 : 332 . nijman h . w ., houbiers j . g ., vierboom m . p ., burg s . h . v . d ., drijfhout j . w ., d &# 39 ; amaro j ., kenemans p ., melief c . j ., and kast w . m . 1993 . identification of peptide sequences that potentially trigger hla - a2 . 1 - restricted cytotoxic t lymphocytes . eur . j . immunol . 23 ( 6 ): 1215 . pannetier c ., cochet m ., darche s ., casrouge a ., zoller m ., and kourilsky p . 1993 . the sizes of the cdr3 hypervariable regions of the murine t - cell receptor beta chains vary as a function of the recombined germ - like segments . proc . natl . acad . sci . usa 90 : 2472 . paper dh , natural products as angiogenesis inhibitors , planta med 1998 december ; 64 ( 8 ): 686 - 95 . rosenberg s . a . 1992 . the immunotherapy and gene therapy of cancer . journal of clinical oncology 10 : 180 . rosenberg s . a ., yang j . c ., schwartzentruber d . j ., hwu p ., marincola f . m ., topalian s . l ., restifo n . p ., dudley m . e ., schwartz s . l ., spiess p . j ., wunderlich j . r ., parkhurst m . r ., kawakami y ., seipp c . a ., einhorn j . h . and d . e . white 1998 . immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma . nature medicine 3 321 : 327 . salter r . d ., norment a . m ., chen b . p ., clayberger c ., kresky a . m ., littman d . r ., and parham p . 1989 . polymorphism in the alpha3 domain of hla - a molecules affects binding to cd8 . nature 338 : 345 . scheibenbogen c , lee k h , stevanovic s , witzens m , willhauck m , waldmann v , nacher h , rammensee h g , keilhoz u . analysis of the t cell response to tumor and viral peptide antigens by an ifn - gammy elispot assay . int . journal cancer 1997 ; 932 - 936 . sheu jr ; fu cc ; tsai ml ; chung wj , effect of u - 995 , a potent shark cartilage - derived angiogenesis inhibitor , on anti - angiogenesis and anti - tumor activities . anticancer res 1998 november - december ; 18 ( 6a ): 4435 - 41 . traversari c ., van der bruggen p ., luescher i . f ., lurquin c ., chomez p ., van pel a ., de plaen e ., amar - costesec a ., and boon t , 1992 . a nonapeptide encoded by human gene mage - 1 is recognized on hla - a1 by cytolytic t lymphocytes directed against tumor antigen mz2 - e . j . exp . med . 176 : 1453 . vitiello a ., ishioka g ., grey h . m ., rose r ., farness p ., lafond r ., yuan l ., chisari f ., v ., furze j ., bartholomeuz r ., and chesnut r . w ., 1995 . development of a lipopeptide - based therapeutic vaccine to treat chronic hbv infection . j . clin . invest . 95 341 : 349 . | 0 |
referring to fig1 ( a ) and 1 ( b ), a tilting pad thrust bearing arrangement 10 comprises a rigid backing surface 11 defined on a support member or carrier 12 formed either as a thick ring of mild steel or possibly as a prepared surface of a larger machine part or casing . the backing surface surrounds a longitudinal axis 15 and faces in a first direction ( indicated by arrow 16 ) along the axis towards a working surface 17 of a machine shaft to be borne thereby . the arrangement 10 also comprises a plurality of bearing pads , identified generically as 20 i ; in this embodiment there are six pads 20 1 , 20 2 , . . . 20 6 . the bearing pads overlie the backing surface 11 arrayed uniformly about the longitudinal axis 15 and each having , at opposite faces thereof , a substantially flat bearing surface 21 i facing axially in the direction 16 and a substantially flat supported surface 22 i facing axially towards the backing surface 11 and by way of which the pad is mounted . the bearing pads are mounted with respect to the backing surface by mounting means , indicated generally at 25 , disposed between the pads and backing surface . the mounting means comprises support surface means , indicated generally at 26 , defined coaxially with respect to the backing surface . in this embodiment , the support surface means is defined by the backing surface 11 itself , although this need not be so as described in other embodiments hereinafter . the mounting means further comprises a mounting member preferably in the form of a flat annular mounting ring 30 of incompressible resilient material , conveniently spring steel , coaxial with respect to the backing surface . the ring is circumferentially continuous and notionally divided into circumferentially extending sectors 31 1 , 31 2 . . . , associated one with each bearing pad , by mounting points 32 1 , 32 2 , . . . at each side of the pad , that is , between adjacent pads . as with the bearing pads , it is convenient to refer to these and other replicated parts by the generic subscript “ i ”. each mounting point 32 i comprises a headed fastener 33 i , such as a thread forming rivet adapted to be driven into a pre - drilled hole and thereby cut a co - operating thread which locks it against removal , or a conventional screw , the shank 34 i of which extends through an aperture 35 i in the mounting ring and on which is carried a spacer 36 i formed by a stand - off sleeve ( possibly as a stack of washers ) that disposes the mounting ring spaced from the support surface backing surface ( 11 ) by a predetermined stand - off distance . the mounting means finally includes fastening means , indicated generally at 40 , extending through the ring sector 31 i associated with each pad and clamping the supported surface of the pad with respect to the ring sector and defining a clamped region thereof . this is most readily illustrated by reference to the bearing pads 20 1 and 20 2 for different aspects . for the bearing pad 20 1 the fastening means comprises a fastener 41 1 of the self - tapping / thread cutting type described above which has a head portion 42 1 and shank portion 43 1 forced into a pre - drilled hole 44 1 in the supported surface of the pad by way of an aperture 45 1 in the ring sector so as to clamp the ring sector , at least in the region around the aperture , between the head 42 1 and the supported surface of the pad and define the aforementioned clamped region 46 1 . the head portion 42 1 is shaped as a generally hemispherical dome and dimensioned to extend away from the clamped region into abutment with the support surface means ( backing surface 11 ) to bias the clamped region 46 1 away from the support surface with respect to the mounting points which fix the stand - off distance of the ring sector at each side of the pad . it will be seen from the generally radially - directed view of bearing pad 20 2 and mounting ring sector 31 2 that the axial bias of the clamped region 46 2 is small but has the effect of introducing a slight ‘ wave ’ into the mounting ring such that the clamped region is at the crest thereof and the flat supported regions of the pad displaced therefrom circumferentially are slightly spaced from the mounting ring . furthermore , the dome - shaped head of the fastener 41 2 forms a pivot for the bearing pad and ring sector permitting it to tilt in operation about an axis in the radial direction of pad 20 2 and working surface 17 . it will be appreciated that the amount of pad tilt required is very small and readily accommodated for a wide variety of pad sizes by a displacement at the side of the pad of about 0 . 1 mm and that a bias displacement due to the fastener head of this order of magnitude is adequate , although , of course , it can be chosen to suit particular requirements . it will be appreciated that a simple dome - like fastener head provides a pivot fulcrum without recourse to specific alignment of the fastener with respect to the pad or mounting ring . however , if desired , then a fastener could be employed with a head of different contour or one that is elongated as a ridge in one direction and assembled with it extending in a radial direction . similarly , a plurality of dome - headed or like - headed fasteners could be employed spaced radially to provide a plurality of pivot points for each pad . however , the use of a single fastener , particularly one having a shank of circular cross - sector , does mean that each pad may become rotated about the shank despite the clamping effect . to this end rotation stop means , indicated generally at 50 , may be included . in the embodiment of arrangement 10 , the rotation stop means comprises a stop fastener 51 i in the form of second headed fastener , identical to the fastener 41 1 , which is disposed radially inwardly of the fastener 41 i and secured in a hole 54 i in the pad by way of an aperture 55 i in the mounting ring sector , but preferably without applying a clamping force . to prevent the head of the fastener abutting the support surface ( backing surface 11 ) the radially inner part of the backing surface is recessed at 56 . it will be appreciated that such rotation stop means may take other forms as expedient for manufacture . for example , referring to fig2 and a sectional elevation through part of a second embodiment of tilting pad thrust bearing arrangement 60 , a similar headed fastener 51 ′ i is employed as the rotation stop . it differs however in that the head is smaller and this obviates the need for recessing the backing surface . furthermore , the fastener is disposed radially inwards of the edge of the mounting ring rather than extending by way of an aperture therein . clearly either feature could be applied to fastener 51 i . referring to fig3 a third embodiment 70 has a rotation stop arrangement 71 comprising an axially extending tab or flange 72 formed at the radially inner ( or outer ) edge of the mounting ring sector 31 i and a co - operating recess 73 formed in the supported surface of the bearing pad . fig4 shows a fourth embodiment 80 in which the rotation stop arrangement 81 comprises such a tab as flange 82 disposed to overlie the radially inner ( or outer ) edge of the bearing pad . clearly the tabs 72 and 82 may be disposed other than radially in line with the clamping fastener 41 and more than one may be used for each bearing pad . fig5 shows a fifth embodiment 90 which differs in that the rotation stop means 91 comprises an axial extension 92 formed by displacing pad material at a radially inner ( or outer ) edge of the pad or before or after assembly with respect to the mounting ring . in all of the above described embodiments , the mounting ring has been a circumferentially complete ring on which the sectors associated with each bearing pad are defined notionally by the various mounting apertures therethrough at the mounting points and clamping points . it will be appreciated that each bearing pad has associated therewith an actuate ring sector which extends only between adjacent mounting points at which it is clamped contiguously with an adjacent sector . the mounting ring sectors may be formed from any suitable load . bearing and resiliently flexible material . in the embodiments described above , the figures show the headed fastener defining a pivot which is substantially central in respect of the circumferential length of the bearing pad . it will be appreciated that the pivot may be disposed off centre if desired . whereas the arrangements described in fig1 ( a ) to 5 are simple in terms of components , it is possible also to employ manufacturing techniques which complement the cost effective nature of the construction . for example , assuming the mounting ring sectors are defined by a continuous ring , the pads are arrayed with the bearing surfaces on a flat surface and the drilled supported surfaces uppermost . the apeartured mounting ring is then disposed on the supporting surfaces with the apertures aligned and the self - tapping headed portions of the aforementioned type , which are harder then the backing surface , are driven in to clamp the ring to the individual bearing pads . this sub - assembly is then placed overlying the backing surface which has been pre - drilled at the mounting points and at which the spacers are disposed . the mounting point fasteners ( or temporary pegs ) are then partially driven in to locate the mounting ring loosely . the arrangement is subjected to axial clamping between the bearing surfaces and backing surface to bed each fastener head / pivot with respect to the backing surface ( that is , possibly indent the surface by the harder fastener material ) so that all of the bearing surfaces are in a common plane and notwithstanding any variation in dimensions of the headed fasteners . thereafter the pivot point fasteners may be driven in to the extent determined by the stand - off spacers . it should be noted that in this respect , any variation in stand - off distance between various mounting points is less important than variation in bearing pad distance from the supporting surface . as indicated above , the support surface means is conveniently provided by the backing surface 11 . however , it may be appropriate for it to take different form . referring to fig6 which shows in sectional elevation , a part of a sixth embodiment of a tilting pad thrust bearing arrangement 100 in which those parts which have been described above are given like references . the support surface means comprises a further resilient annular ring 101 ( hereinafter called the support surface ring 26 ) mounted spaced from the backing surface by the mounting points 132 i ( corresponding to mounting points 32 ) and stand - off spacers 136 i corresponding to stand - off spacers 36 . the head 42 i of the fastener 41 i abuts the . ring 101 between the mounting points . the resilience of the support surface ring is less than that of the mounting ring , that is , it has greater stiffness , so that the dimensions of fastener head 42 i biases the clamping region 46 i with respect to the support surface and mounting points to permit tilting of the bearing pad . however , under axial load , there is an extra degree of axial resilience to accommodate load variations . in this figure , the headed fastener , and the pivot it defines , is shown as displaced from the centre of the pad in a circumferential direction . a variation of such arrangement is illustrated in fig7 for a seventh embodiment of tilting pad thrust bearing arrangement 200 . here the support surface ring 201 is supported with respect to the backing surface close to where the headed fastener 41 i abuts it and the stand - off displacement between mounting ring sector 31 i and support surface ring 201 is defined ‘ floating ’ with respect to the backing surface . such support surface ring 101 or 201 may , like the mounting ring be formed of discrete sectors . | 5 |
fig1 depicts a first embodiment of a system 100 , which allows for users on a web - based network over the internet 50 to simulate a mill reline . the simulation is for determining an “ optimal work flow ” for carrying out the mill reline . the term “ optimal work flow ” includes within its meaning the optimisation of tool configurations used for the mill reline , and optimisation of the mill parameters . a plurality of users , five of which are shown in fig1 as users ( with computer access ) 1 ( a )- 1 ( c ) and 2 ( a )- 2 ( b ) are members of a web - based “ simulation ” network , administered by a website owner or alternatively a website administrator ( not shown ) on behalf of the owner , via at least a first computer 10 . users 1 ( a )- 1 ( c ) may be maintenance managers / engineers at mine sites , whilst user 2 ( a ) may be a plant designer , and user 2 ( b ) may be a mill manufacturing designer / engineer . a simulation database 11 associated with simulation software ( application ) 12 reside on first computer 10 administered by the earlier mentioned administrator . the users are able to access application 12 , via a website . a website page screen selection ( not shown ) allows users 1 ( a )- 1 ( c ) to register and then use the web - based simulation network by selecting various menus . each user 1 ( a )- 1 ( c ), 2 ( a )- 2 ( b ) in a conventional way is able to register their details with the system . a “ mill reline raw data ” database 21 with associated database software 22 resides on another computer 20 and is also administered by the earlier mentioned administrator . database 21 contains a relational database of mill reline data , relating to particular mine sites . this data may for a particular mine site , include video captured recordings of actual relines , inventory of equipment and details of available personnel to carry out the reline . “ raw data ” provided to database 21 can be analysed and if suitable verified by the administrator for use as comparative / benchmarking purposes . “ verified data ” can then be copied or transferred by the administrator from database 21 to database 11 associated with simulation software 12 . where “ raw data ” is provided by a user 1 ( a )-( c ) in video captured recordings to database 21 , it may require analysis by the administrator ( or authorised operator ) to refine and verify data prior to it being suitable for use in software 12 . in use , a maintenance manager such as user 1 ( a ) may for example video record an actual “ mill reline ” as it is performed . the resultant video recording ( not shown ) along with other data may be provided by user 1 ( a ) over the internet 50 to database 21 . the video recording may be analysed and refined for simulation purposes prior to being provided as “ refined and verified data ” to simulation database 11 . this “ refined and verified data ” may then be used for simulation purposes . whilst maintenance managers ( users 1 ( a )- 1 ( c )) may wish to run a simulation for benchmarking and / or optimization for existing mine sites , user ( plant designer ) 2 ( a ) or user ( mill manufacturer ) 2 ( b ) may wish to input proposed liner arrangement data and resources to simulate future reline scenarios for proposed new site and / or mill designs . fig2 depicts an example flow diagram of steps to simulate a mill reline as follows . with reference to fig2 , user ( maintenance manager ) 1 ( a ), may for instance : input mill structure and site constraints as indicated at block 31 input proposed liner arrangement as indicated at block 32 input yes for “ is this an existing site ?” as indicated at decision block 33 input yes for “ is this for benchmarking ?” as indicated at decision block 34 select best practice variables from database 11 as indicated at block 37 define reline scenario , includes tool inventory available , labour available , priorities and liner sequence as indicated at block 39 run the simulation as indicated at predefined process block 40 if reline duration is not acceptable , input no at decision block 42 analyze the output data and plan a revised scenario at 41 before returning to block 39 if reline duration is acceptable , input yes at decision block 42 finish analysis at block 43 . where a maintenance manager 1 ( a ) is instead not doing it for benchmarking , then at block 34 he would answer no , and instead have to provide a video of an “ actual mill reline ” as indicated at block 36 . the earlier mentioned administrator ( or personnel acting on behalf of the administrator ) could then analyse the video and extract the data necessary to input at block 38 . the maintenance manager 1 ( a ) could then run through the steps shown at blocks 39 - 43 of fig2 . where a plant designer 2 ( a ) or mill manufacturing engineer 2 ( b ) were wishing to simulate a proposed mill reline , they would take the following steps . input “ proposed ” mill structure and site constraints as indicated at block 31 input proposed liner arrangement as indicated at block 32 select variables from database 11 to estimate performance as indicated at decision block 35 define proposed reline scenario , includes tool inventory available , labour available , priorities and liner sequence as indicated at block 39 run the simulation as indicated at predefined process block 40 if reline duration is not acceptable , input no at decision block 42 analyze the output data and plan a revised proposed scenario at 41 before returning to block 39 if reline duration is acceptable , input yes at decision block 42 finish analysis at block 43 . in the abovementioned embodiment , databases 11 and 21 are shown as separate databases , but they could in another embodiment be a single database of data . in the abovementioned embodiment , user 1 ( a ) may record a video of an actual mill reline to capture data . however it should be understood that instead of recording a video of an actual mill reline , user 1 ( a ) could have a “ time and motion study ” conducted on an actual mill reline to collect similar data . this “ time and motion study ” could be conducted by a consultant or contractor , preferably associated with or certified by the abovementioned administrator . an explanation of how simulation software ( application ) 12 has been developed and used in system 100 is as follows . there are four major contributors to controlling the timing of mill relining shutdowns and the speed of liner exchange , these being : the liners themselves ( their size and quantity ); the reline planning process and relining crew proficiency ; relining equipment ; and plant design surrounding the grinding mills . simulation software 12 includes “ discrete event software ” is used to model complex process flow where the interplay of operations or part / labour flows cannot be predicted using analytic methods and where the only other alternative to modelling is trying out the changes on a live system . in order to provide a simulation of a mill reline model , we started with four separate mining sites which use russell 8 ™ or russell twin 8 ™ mill mining machines . these four mining sites were initially studied to collate identifying major variables related to equipment used . these major variables are shown in table 1 . in order to be effective as a simulation model it should be able to easily change and analyse the effects on reline time of something as small as : the speed of the liner cart ; the size of , or distance to , the liner lay down area ; the size , type , priority or number of any tool in any particular work zone ; whether the liner cart is loaded from the rear or the side . using a single or twin mill relining machine ; changing the number of liners in the mill ; or , installing an elevating platform ; the number of personnel on dayshift or nightshift . all variables are treated as discrete time / frequency distributions ; five discrete intervals are used for each variable . the time measurement of the operations associated with each variable are grouped or averaged together into five logical time intervals and a count of the number of occurrences at that time entered in the frequency column . the use of distributions rather than overall average times is essential to the accuracy of simulation software . for example if the time taken for a mill relining machine to retrieve a worn liner is represented by the distribution in table 2 ( shown below ) and the time taken for the liner cart to return to pick up the liner is represented in table 3 ( shown below ), if overall average times ( 75 sec for the machine and 74 sec for the liner cart ) were used , it appears that the machine never waits for the liner cart . however it is obvious from the tables that ( using this fictitious data ) the machine may wait at times up to 250 − 30 = 220 seconds for the liner cart . the total time the machine waits depends on the order in which the variables are combined . a random number stream is used to select the time assigned to an event based on its relative frequency in the appropriate variable . this type of relationship is repeated throughout the reline thousands of times and illustrates why a simulation such as this is necessary to provide sensible real world results . it should be noted that the distributions in tables 2 and 3 are for illustration purposes only . in the actual simulation each of these actual activities is the result of the combination of many variables . the data populating each variable is determined from video recordings of actual relines at each of the separate mining sites , whilst even based on a small set of data of say only four mine sites , the method of simulating a mill reline is possible , a larger data set is required for simulations to be statistically accurate . the relative effectiveness of various tools , for example the time difference between a thunderbolt ™ 1500 and a thunderbolt ™ 750 hammer removing the same liner bolt , needed to be considered . to allow one variable to be used by different sized hammers a theoretical relative effectiveness index was calculated . this will be validated in the future via experiment . similar experiments will be required for comparing rattle guns and suspension methods . the modelling process begins by specifying the geometry of the mill and its surroundings and defining the shape and location of each liner and fastener . a 3d model is generated progressively as data is entered ; this provides visual validation of the progress and accuracy of construction . the area around the mill is divided into six independent work zones two each on the feed end , discharge end and shell . the floor levels in each zone are entered and also the height that is accessible at each zone . the charge level and access height inside the mill are also specified . these inputs result in transparent surfaces at the heights specified and are provided as visual prompts to the operator when planning a reline scenario . fig3 shows a fully populated 3d model of the outside of a mill 55 , whilst fig4 shows an “ animation screen ” ( or web page ) 60 for the simulation in which the “ six work zones ” surrounding the mill are schematically depicted . the variables appropriate to each liner and fastener are then assigned . the user selects these from the data set that is most appropriate to the liner / fastener element being defined . if the simulation relates to an existing mill these variables can be sourced from data gathered during previous relines . if it is a new mill the data selected can be sourced from the nearest geometric and operational match . it is anticipated that over time database 11 will become comprehensive , covering a wide range of mills and operating parameters , including a greater variety of tools used in mill relining . in the future a data set will evolve in database 11 that captures the current best practice time and frequency distributions may be constructed to allow mill owners to “ benchmark ” the relative performance of their relines . once the mill is constructed and populated with liners and fasteners any number of reline scenarios can be defined , run and analysed as discussed below . using the same 3d model constructed during mill setup , the operator is able to rotate the mill to its starting angle and select liners for removal in this position . any fasteners associated with the liner are automatically selected at the same time . as liners to be removed are selected , they are identified by a change in colour . the transparent surfaces representing the floor and reach height provide a guide as to which liners are accessible . this data is captured via a check box and then the liners that are to be replaced before inching are selected in the same way . the mill is then rotated to the next position and the liners for removal and replacement are selected . this process is repeated until the full reline is specified . each of the six external work zones is programmed to operate independently and can be configured with any tool combination . tools that can be specified in each zone include any combination or quantity of : thunderbolt ™ hammers or sledge hammers ; rattle guns ( range of sizes ); high torque tools ( torque multipliers ); washer removal tools ; t - mag ™ hammer moil guides ; elevating platforms ; manual platforms ; jib or monorail tool suspension ; oxy acetylene torches ( this equipment is shared between zones ). the number of reline personnel available is entered and can be varied from day to night shift . tools are only active if sufficient labour is available , so labour control is important . the operator can assign priorities to the feed , shell and discharge work zones and specify the preferred number of operators for each stage of nut , washer , bolt and liner removal . labour is then allocated according to zone priority and stage . each operation commences after the preceding operation is complete or after a user specified number of nuts or washers is removed . if t - mag ™ hammer moil guides are used washers need not be removed . if high torque tools are specified these will be used to remove nuts that the rattle gun cannot . if high torque tools are not specified seized nuts are removed using the oxy acetylene torch . liner knock in will be carried out by the largest hammer specified for the zone where possible . liner removal commences once liner knock in is complete . russell ™ single or twin mill relining machines can be specified for the scenario along with the variables that define their behaviour . there is a great deal of flexibility around the set up of the storage yard , liner lay down area , number and method of operation of forklifts and travelling distances . the method of operation of the liner cart / s can also be easily configured . set up times are allocated for the relining machine between the various reline phases . the number of personnel working on the mill charge is specified . they commence by placing slings on accessible liners using o - zone ™ liner lifting tools or chains and hooks if o - zone ™ tools are not specified . walk time between liners and tool specific slinging times dictate how long this task takes . the relining machine operator randomly selects liners and the program uses different variables depending on whether the liner must be dislodged from the mill , turned on the charge or can be removed immediately . the next phase of the reline , liner placement , commences once all liners specified for the current mill position are removed . because the russell twin ™ machines are completely independent , there is an option in the program to allow either of the twin machines to commence placing liners before the other machine has completed removal . liner placement is largely dictated by the type of liner being placed and the placement variables specified during mill set up . the program , as it executes the scenario , creates an animation of the reline . this is a very useful tool as it provides visual verification that everything is interacting as expected . the speed of the animation can be varied however it does significantly slow the program down . once satisfied that the scenario is running correctly , the animation can be turned off allowing fast computation . as the reline runs data relating to the timing of every function is collated and stored in the program . various reports are generated that reveal the performance of the reline . bottlenecks and areas that require focus are also highlighted . as previously indicated , the assignment and control of labor is critical in replicating the real world situation and predicting the duration of relines . the software 12 is written so that an analyst ( user ) can prioritize zones and assign desired team sizes to each zone for each phase of fastener and liner removal . the total number of personnel available for both night and day shifts and the maximum number in any one zone are specified for each simulation . as the software ( application ) 12 runs it assigns labor to the high priority zones to satisfy the demand and the desired team size for the task being undertaken . if there is insufficient labor to satisfy the requirements of all zones those with a lower priority must wait until labor becomes free . the software ( application ) 12 is written to reflect the four major phases of a reline : the terms “ comprising ” and “ including ” ( and their grammatical variations ) as used herein are used in inclusive sense and not in the exclusive sense of “ consisting only of ”. | 1 |
in order to provide a clear and consistent understanding of the terms used in the present specification , a number of definitions are provided below . moreover , unless defined otherwise , all technical and scientific terms as used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention pertains . the use of the word “ a ” or “ an ” when used in conjunction with the term “ comprising ” in the claims and / or the specification may mean “ one ”, but it is also consistent with the meaning of “ one or more ”, “ at least one ”, and “ one or more than one ”. similarly , the word “ another ” may mean at least a second or more . as used in this specification and claim ( s ), the words “ comprising ” ( and any form of comprising , such as “ comprise ” and “ comprises ”), “ having ” ( and any form of having , such as “ have ” and “ has ”), “ including ” ( and any form of including , such as “ include ” and “ includes ”) or “ containing ” ( and any form of containing , such as “ contain ” and “ contains ”), are inclusive or open - ended and do not exclude additional , unrecited elements or process steps . the term “ about ” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value . the term “ derivative ” as used herein , is understood as being a substance similar in structure to another compound but differing in some slight structural detail . the present description refers to a number of chemical terms and abbreviations used by those skilled in the art . nevertheless , definitions of selected terms are provided for clarity and consistency . as used herein , the term “ alkyl ” can be straight - chain or branched . examples of alkyl residues containing from 1 to 6 carbon atoms are methyl , ethyl , propyl , butyl , pentyl , hexyl , the n - isomers of all these residues , isopropyl , isobutyl , isopentyl , neopentyl , isohexyl , 3 - methylpentyl , sec - butyl , tert - butyl , or tert - pentyl . as used herein , the term “ cycloalkyl ” can be monocyclic or polycyclic , for example monocyclic , bicyclic or tricyclic , i . e ., they can for example be monocycloalkyl residues , bicycloalkyl residues and tricycloalkyl residues , provided they have a suitable number of carbon atoms and the parent hydrocarbon systems are stable . a bicyclic or tricyclic cycloalkyl residue has to contain at least 4 carbon atoms . in an embodiment , a bicyclic or tricyclic cycloalkyl residue contains at least 5 carbon atoms . in a further embodiment , a bicyclic or tricyclic cycloalkyl residue contains at least 6 carbon atoms and up to the number of carbon atoms specified in the respective definition . cycloalkyl residues can be saturated or contain one or more double bonds within the ring system . in particular they can be saturated or contain one double bond within the ring system . in unsaturated cycloalkyl residues the double bonds can be present in any suitable positions . monocycloalkyl residues are , for example , cyclopropyl , cyclobutyl , cyclopentyl , cyclopentenyl , cyclohexyl , cyclohexenyl , cycloheptyl , cycloheptenyl , cyclooctyl , cyclononyl , cyclodecyl , cycloundecyl , cyclododecyl or cyclotetradecyl , which can also be substituted , for example by c 1 - c 4 alkyl . examples of substituted cycloalkyl residues are 4 - methylcyclohexyl and 2 , 3 - dimethylcyclopentyl . examples of parent structures of bicyclic ring systems are norbornane , bicyclo [ 2 . 2 . 1 ] heptane , bicyclo [ 2 . 2 . 2 ] octane and bicyclo [ 3 . 2 . 1 ] octane . as used herein , the term “ aryl ” means an aromatic substituent which is a single ring or multiple rings fused together . when formed of multiple rings , at least one of the constituent rings is aromatic . in an embodiment , aryl substituents include phenyl , naphthyl and anthracyl groups . the term “ heteroaryl ”, as used herein , is understood as being unsaturated rings of five or six atoms containing one or two o - and / or s - atoms and / or one to four n - atoms , provided that the total number of hetero - atoms in the ring is 4 or less . the heteroaryl ring is attached by way of an available carbon or nitrogen atom . non - limiting examples of heteroaryl groups include 2 -, 3 -, or 4 - pyridyl , 4 - imidazolyl , 4 - thiazolyl , 2 - and 3 - thienyl , and 2 - and 3 - furyl . the term “ heteroaryl ”, as used herein , is understood as also including bicyclic rings wherein the five or six membered ring containing o , s and n - atoms as defined above is fused to a benzene or pyridyl ring . non - limiting examples of bicyclic rings include but are not limited to 2 - and 3 - indolyl as well as 4 - and 5 - quinolinyl . it was surmised that if a fluorogen was prepared bearing two maleimide groups , then its latent fluorescence would only be realized upon its reaction with two equivalents of thiol . furthermore , if the positioning of the maleimide groups was such that they were separated by a pre - determined distance , then the resulting fluorogen should react rapidly and specifically with compounds presenting two sulfhydryl groups separated by the corresponding distance . probe protein targets were designed to react efficiently with their complementary dimaleimide groups , through two cysteine residues whose pendant thiol groups would be solvent exposed , sterically unhindered and separated by an appropriate distance , namely that between the corresponding maleimide groups , as determined by molecular modeling . small α - helical proteins (˜ about 30 amino acids ) were selected as probe protein targets since their secondary structural motif is of sufficiently limited conformational flexibility so as to allow the precise positioning of the cysteine residues . furthermore , the mass of these probe proteins is around one - tenth of the mass added in previous gfp - based assays , representing much less perturbation of native protein localization and function and allowing greater sensitivity for detection of biologically relevant events . with two cysteine residues positioned at a fixed geometry , spatially separated by a defined distance , these probe proteins will be able to react with the dimaleimide fluorogenic compounds , forming a fluorescent covalent adduct . the novel fluorogenic markers and labeling method of the present disclosure comprises several features making it appropriate for genomic screening of molecular interactions : 1 ) the markers and method are not limited in their application to a single assay , but are capable of being used in a series of assays in which the fluorogen and protein target sequence may be chosen according to their efficacy in a particular cell type appropriate to the study of the interactions of a given class of proteins ; 2 ) the method can be automated and tailored for high - throughput fluorescent screening ; and 3 ) the markers are designed at the level of the atomic structure and three - dimensional conformation of the target protein motifs , allowing control over the flexibility and specificity of the probe fragments used . the fluorogenic labeling method of the present disclosure has the potential to improve upon existing methods : 1 ) the relatively small probe proteins that are used in the method of the present disclosure have a far smaller potential to disrupt the localization and interactions of the native proteins than the relatively large protein fragments used in other methods ; 2 ) the signal reaction being a simple reaction between a pair of protein - thiols and a thiol - selective small molecule fluorogen , it is less sensitive to the effects of variation of cellular conditions than the folding of fluorescent protein applications ; and 3 ) the inherent flexibility of the method of the present disclosure to design fluorogenic probes with many different spectral qualities that react specifically with different protein targets provides for the encoding of protein interactions in a variety of ways , including the potential for multiplexed protein expression analysis in vivo and in vitro . maleimide groups are known for undergoing specific thiol addition reactions . they have been used in the context of analytical chemistry for the detection of thiols , based on the specificity of their reaction [ 19 ] and have been applied with success to protein labeling in vivo [ 4 ]. their ability to quench fluorescence is also well - known [ 15 ]. it was surmised that a latent fluorophore bearing two maleimide groups would have to react at both maleimide groups in order to fluoresce , since one unreacted maleimide group would be sufficient to quench fluorescence . in an embodiment , the present disclosure relates to fluorogens bearing two maleimide groups separated by distance that is defined by their conformational rigidity . in an embodiment , the dimaleimide fluorogens are designed to react with peptide sequences bearing two cysteine residues separated by a complementary distance ( scheme 1 ). in order to minimize the distance between the dimaleimide fragment and its fluorophore , and hence improve on the fluorescence quench efficiency , fluorogens were designed comprising a structure in which the fluorophore is directly attached to a modified dimaleimide fragment . the synthesis of the dimaleimide fragment was initiated starting with 3 , 5 - dinitrobenzoic acid undergoing a schmidt rearrangement , leading quantitatively to the 3 , 5 - dinitroaniline ( 1 ). the 3 , 5 - dinitroaniline ( 1 ) was then submitted to catalytic hydrogenation and a mono boc protection , giving triamine ( 2 ) as a base scaffold for the dimaleimide fragment . the mono - protected phenylenetriamine was then reacted with excess citraconic anhydride , leading to the dimaleamic acid derivative which was then cyclized to the dimaleimide core ( 3 ) upon treatment with hmds and zncl 2 . the fluorogen ( 5 ) was obtained by deprotection of the boc group with excess tfa and coupling of the corresponding aniline with dansyl chloride in pyridine ( scheme 2 ). spectroscopic characterization of fluorogen 5 included absorbance and fluorescence emission maxima as well as the fluorescence enhancement ( fe ) ratio . the spectroscopic characteristics were evaluated in two solvent systems ( dmso and hepes ( ph 7 . 4 )/ 5 % dmso ). the fe ratio determination was carried out by reacting 5 with excess mercaptopropionic acid ( mpa ) and then dividing the final fluorescence by the initial fluorescence intensity , at a specific fluorogen concentration . in pure dmso , the initial fluorescence intensity was found to be approximately 2 , where upon reaction with mpa the fluorescence intensity increased by over 300 - fold ( fig1 ). in aqueous media ( hepes / 5 % dmso ) the initial fluorescence intensity was at the level of the background noise , leading to a fluorescence enhancement ratio of over 175 . the synthesis of the dimaleimide fragment was initiated starting with 3 , 5 - dinitrobenzoic acid undergoing reduction with sodium borohydride to provide 3 , 5 - dinitrobenzylic alcohol 6 . protected amine 7 was obtained by using phthalimide as a nucleophile under mitsonobu conditions . subsequent exchange of protecting groups provided boc - protected amine 8 . treatment of 8 with tfa and coupling of the resulting free amine with 7 - methoxycoumarin - 3 - carboxylic acid resulted in compound 9 which was subsequently submitted to catalytic hydrogenation providing diamine 10 . the fluorogen ( 11 ) was obtained by reaction of 10 with citraconic anhydride and subsequent cyclization of the in situ generated dimaleamic acid ( scheme 3 ). spectroscopic characterization of fluorogen 11 included absorbance and fluorescence emission maxima as well as the fluorescence enhancement ( fe ) ratio . the spectroscopic characteristics of 11 were evaluated in hepes ( ph 7 . 4 )/ 5 % dmso ). the fe ratio determination was carried out by reacting 11 with excess mercaptopropionic acid ( mpa ) and then dividing the final fluorescence by the initial fluorescence intensity , at a specific fluorogen concentration . upon reaction with excess mpa the fluorescence intensity increased by a factor of 6 . 4 ( fig2 ). the synthesis of the dimaleimide fragment 12 was initiated starting with 3 , 5 - diaminobenzoic acid undergoing reaction with citraconic anhydride and subsequent cyclization of the in situ generated dimaleamic acid . the bodipy fluorogen 13 was obtained following the condensation reaction of two pyrroles with the acyl chloride of 12 and subsequent oxidation and complexation with trifluoroboron diethyl etherate ( scheme 4 ). the bodipy fluorophore of 13 is attached to the dimaleimide core by a simple sigma bond , conferring great conformational rigidity between the two fragments . spectroscopic characterization of fluorogen 13 included absorbance and fluorescence emission maxima as well as the fluorescence enhancement ( fe ) ratio . the spectroscopic characteristics of 13 were evaluated in hepes ( ph 7 . 4 )/ 5 % dmso ). the fe ratio determination was carried out by reacting 13 with excess mercaptopropionic acid ( mpa ) and then dividing the final fluorescence by the initial fluorescence intensity , at a specific fluorogen concentration . upon reaction with excess mpa the fluorescence intensity increased by a factor of 3 . 5 ( fig3 ). fluorogen 17 was designed to bring the maleimide groups closer to the fluorescent moiety . the synthesis of fluorogen 21 is presented in scheme 5 . diiodination of benzoic acid , followed by a double sonogashira coupling with boc protected p - ethynylaniline according to standard coupling conditions afforded intermediate 15 . removal of the boc groups with tfa , followed by reaction with citraconic anhydride and further cyclization by treatment with ac 2 o and naoac provided intermediate 16 . treatment of 16 with 2 , 4 - dimethylpyrrole and bf 3 — oet 2 completed the synthesis fluorogen 17 . spectroscopic characterization of fluorogen 17 included absorbance and fluorescence emission maxima as well as the fluorescence enhancement ( fe ) ratio . the spectroscopic characteristics of 17 were evaluated in hepes ( ph 7 . 4 )/ 5 % dmso ). the fe ratio determination was carried out by reacting 17 with excess mercaptopropionic acid ( mpa ) and then dividing the final fluorescence by the initial fluorescence intensity , at a specific fluorogen concentration . upon reaction with excess mpa the fluorescence intensity increased by a factor of 6 . 4 ( fig1 ). fluorogen 21 comprises a fluorophore which is connected to the dimaleimide fragment through a benzylic amine linkage . this type of linkage allows for additional conformational flexibility whereby the maleimide group can approach the fluorophore more closely , allowing for more significant quenching . reduction of aldehyde with nabh 4 provided the corresponding alcohol 18 which was subjected to a mitsunobu reaction to yield the corresponding phthalimide derivative 19 . treatment of the benzylic phthalimide with hydrazine provided the free amine which was subsequently coupled to the fluorophore [ e . g . dansyl - cl , fitc and coumarin - co 2 h ]. double sonogashira coupling of 20 with p - alkyne - maleimido - phenyl completed the synthesis fluorogen 21 . ( scheme 6 ). selected photophysical properties of fluorogens 5 , 11 and 13 and corresponding di - mpa adducts obtained by reaction with excess mpa , are illustrated in table 1 . all starting materials were obtained commercially from sigma - aldrich and used without further purification . solvents were dried using glasscontour system ( irvine , calif .) columns . reactions requiring anhydrous conditions were carried out under a dry nitrogen atmosphere employing conventional benchtop techniques . 13 c and 1 h nmr spectra were recorded on amxr400 and amx300 spectrometers and were referenced to the residual proton or 13 c signal of the solvent . mass spectra were determined by fab + ionization on an autospec q spectrometer at the regional mass spectrometry centre at the université de montréal . melting points ( uncorrected ) were determined on an ez - melt ( srs ) melting point apparatus . absorbance spectra were recorded at 25 ° c ., with a cary - 100 spectrometer . emission spectra and fluorescence intensity measurements were recorded at 25 ° c . with a cary eclipse fluorometer . excitation and emission slits were fixed at 5 nm . protocol : 3 - mercaptopropionic acid ( 50 eq ) was added to a 1 to 4 mm dmso solution of fluorogen . the resulting mixture was stirred at 25 ° c ., in the dark for 18 hours after which fluorescence intensities of a dilution in hepes buffer ( ph 7 . 4 ) were recorded . final fluorescence intensity was then divided by the initial florescence intensity at the same fluorogen concentration leading to the fluorescence enhancement ratio for the fluorogen . 3 , 5 - dinitroaniline ( 1 ): to a solution of 3 , 5 - dinitrobenzoic acid ( 4 . 0 g , 18 . 9 mmol ) in a mixture of concentrated sulfuric acid ( 6 ml ), 30 % fuming sulfuric acid ( 18 ml ) and chcl 3 ( 25 ml ) was added sodium azide ( 1 . 4 g , 21 . 7 mmol ), in small portions . the resulting mixture was heated to reflux ( 80 ° c .) for 3 hours and then cooled to 25 ° c . after which it was poured on ice . an orange solid was isolated after vacuum filtration ( 3 . 25 g , 17 . 7 mmol , 94 %). 1 h nmr ( 300 mhz , cdcl 3 ) δ 8 . 14 ( t , j = 1 . 8 hz , 1h ), 7 . 64 ( d , j = 1 . 8 hz , 2h ), 4 . 39 ( s ( br ), 2h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 151 . 9 , 150 . 1 , 113 . 1 , 105 . 2 ; hrms ( esi ) calculated for c 6 h 4 n 3 o 4 [ m − h ] − : 182 . 0195 . found : 182 . 0207 . m . p . : 113 . 1 ° c . tert - butyl n - 3 , 5 - diaminophenylcarbamate ( 2 ): a solution of 1 ( 2 . 3 g , 12 . 56 mmol ) in thf / meoh ( 30 / 5 ml ) in the presence of pd / c 10 % ( 50 % w / w h 2 o ) was stirred at room temperature under hydrogen ( 10 atm .) for 24 h after which the solvents were filtered on celite . the resulting phenylenetriamine was used in the next step without further purification . the filtrate volume was increased to 200 ml after which a solution of boc 2 o ( 2 . 7 g , 12 . 56 mmol ) in thf ( 20 ml ) was added over 30 minutes . the resulting solution was heated to reflux for 16 hours after which volatiles were evaporated under reduced pressure . the crude was then purified by flash chromatography on silica gel ( elution gradient dcm / hex ( 8 : 2 ) to dcm / meoh ( 49 : 1 )) to give 2 ( 958 mg , 4 . 29 mmol , 35 %) as an off - white solid . 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 18 ( d , j = 2 hz , 2h ), 5 . 95 ( bs , 1h ), 5 . 73 ( t , j = 2 . 0 hz , 1h ), 3 . 57 ( bs , 4h ), 1 . 50 ( bs , 9h ); 13 c nmr ( 100 mhz , cdcl 3 ) δ 152 . 5 , 148 . 0 , 140 . 1 , 96 . 8 , 96 . 0 , 80 . 1 , 28 . 2 ; hrms ( esi ) calculated for c 11 h 17 n 3 o 2 na [ m + na ] + : 246 . 1218 . found : 246 . 1214 . tert - butyl n - 3 , 5 - di -( 2 - methylmaleimido ) phenylcarbamate ( 3 ): citraconic anhydride ( 1 . 56 ml , 17 . 47 mmol ) was added to a solution of 2 ( 1 . 3 g , 5 . 82 mmol ) in chcl 3 ( 20 ml ) and the resulting mixture was stirred at 25 ° c . for 3 hours after which volatiles were evaporated under reduced pressure . the crude was triturated with et 2 o and filtered under reduced pressure giving the dimaleamic acid as a beige solid ( 2 . 59 g , 5 . 80 mmol , quantitative ) that was used in the next step without further purification . dimaleamic acid ( 400 mg , 0 . 894 mmol ) and zncl 2 ( 365 mg , 2 . 68 mmol ) were dissolved in toluene / dmf ( 40 : 5 ml ) after which a dilute solution of hmds ( 0 . 84 ml , 4 . 02 mmol ) in toluene ( 5 ml ) was added over 20 minutes . the resulting mixture was then heated to reflux for 4 hours after which the volatiles were evaporated under reduced pressure . the resulting residue was dissolved in etoac and washed successively with 0 . 1 m hcl and saturated na 2 co 3 . the crude product was then purified by flash chromatography on silica gel ( toluene / etoac 5 %) to give 3 as an off - white solid ( 780 mg , 1 . 90 mmol , 53 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 42 ( d , j = 2 . 4 hz , 2h ), 7 . 12 ( t , j = 2 . 4 hz ), 6 . 59 ( bs , 1h ), 6 . 43 ( q , j = 2 . 4 hz , 2h ), 2 . 12 ( q , j = 2 . 4 hz , 6h ), 1 . 47 ( bs , 9h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 170 . 0 , 168 . 9 , 152 . 2 , 145 . 7 , 139 . 5 , 132 . 5 , 127 . 4 , 116 . 5 , 114 . 1 , 80 . 9 , 28 . 1 , 11 . 0 ; hrms ( esi ) calculated for c 21 h 21 n 3 o 6 na [ m + na ] + : 434 . 1331 . found : 434 . 1323 . m . p . : 179 ° c . 3 , 5 - di -( 3 - methylmaleimido ) anilinium trifluoroacetate ( 4 ): a solution of 3 ( 780 mg , 1 . 90 mmol ) in chcl 3 ( 10 ml ) was treated with tfa ( 5 . 9 ml , 76 mmol ) at 25 ° c . for 3 hours after which the volatiles were evaporated . an off - white solid was then precipitated with et 2 o ( 805 mg , 1 . 89 mmol , quantitative ). the tfa salt 4 was used in the next step without further purification . n - dansyl - 3 , 5 - di -( 3 - methylmaleimido ) aniline ( 5 ): dansyl chloride ( 139 mg , 0 . 517 mmol ) in pyridine ( 3 ml ) was added to a pyridine solution of 4 ( 200 mg , 0 . 517 mmol ). the resulting mixture was stirred at 25 ° c . for 18 hours after which the volatiles were evaporated under reduced pressure . the resulting oil was taken back in chcl 3 and the organic phase was washed with aqueous saturated na 2 co 3 , dried over mgso 4 and evaporated . the crude was purified by flash chromatography on silica gel ( tol / etoac 10 %) giving 5 as a light green solid ( 40 mg , 0 . 074 mmol , 16 %). 1 h nmr ( 400 mhz , ( cd 3 ) 2 co ) δ 9 . 71 ( s , 1h ), 8 . 56 ( d , j = 8 . 4 hz , 1h ), 8 . 51 ( d , j = 8 . 8 hz , 1h ), 8 . 39 ( dd , j 1 = 1 . 2 , 7 . 2 hz , 1h ), 7 . 62 - 7 . 58 ( td , j = 1 . 2 , 7 . 2 hz , 2h ), 7 . 28 - 7 . 27 ( m , 3h ), 7 . 11 ( t , j = 2 . 0 hz , 1h ), 6 . 63 - 6 . 61 ( m , 2h ); 13 c nmr ( 75 mhz , ( cd 3 ) 2 co ) δ 171 . 3 , 170 . 4 , 152 . 8 , 135 . 4 , 134 . 0 , 131 . 7 , 131 . 5 , 130 . 3 , 130 . 2 , 129 . 6 , 128 . 7 , 124 . 9 , 119 . 8 , 119 . 6 , 116 . 6 , 115 . 9 , 46 . 3 , 12 . 1 ; hrms ( esi ) calculated for c 28 h 25 n 4 o 6 s [ m + h ] + : 545 . 1516 . found : 545 . 1489 . m . p . : 230 ° c . ( 3 , 5 - dinitrophenyl ) methanol ( 6 ): to a suspension of nabh 4 ( 2 . 85 g , 75 . 4 mmol ) in dry thf ( 40 ml ) at 0 ° c . was added a solution of 3 , 5 - dinitrobenzoic acid ( 8 . 0 g , 37 . 7 mmol ) in thf ( 20 ml ), followed by the addition of bf 3 . oet 2 ( 12 . 5 ml , 98 . 0 mmol ). the resulting mixture was warmed to 25 ° c . and stirred for 1 hour after which the reaction was quenched with 1 m hcl . the aqueous phase was extracted with dcm and the organic phase was then washed with saturated na 2 co 3 . the organic phase was dried over mgso 4 and evaporated under reduced pressure to give the title compound 6 as an orange solid ( 5 . 01 g , 25 . 3 mmol , 67 %). 1 h nmr ( 400 mhz , (( cd 3 ) 2 c )) δ 8 . 91 ( t , j = 0 . 4 hz , 1h ), 8 . 57 ( dd , j = 1 . 2 , 2 . 0 hz , 2h ), 4 . 93 ( d , j = 5 . 2 hz , 2h ), 3 . 57 ( bs , 1h ); 13 c nmr ( 75 mhz , ( cd 3 ) 2 co ) δ 149 . 4 , 148 . 4 ( 2c ), 127 . 0 ( 2c ), 117 . 6 , 62 . 8 ; hrms ( esi ) calculated for c 7 h 5 n 2 o 5 [ m − h ] − : 197 . 0204 . found : 197 . 0200 . m . p . : 89 ° c . n -( 3 , 5 - dinitrophenyl ) methylphthalimide ( 7 ): to a solution of 3 , 5 - dinitrobenzylic alcohol 6 ( 1 . 38 g , 6 . 94 mmol ), triphenylphosphine ( 2 . 19 g , 8 . 33 mmol ) and phthalimide ( 1 . 23 g , 8 . 33 mmol ) in dry thf ( 40 ml ) was added diad ( 1 . 64 ml , 8 . 33 mmol ) under an n 2 atmosphere . the resulting mixture was stirred at 25 ° c . for 48 hours after which solvents were evaporated under reduced pressure . the crude product mixture was triturated in etoac and filtered under reduced pressure to give the title compound 7 as a beige solid ( 1 . 33 g , 4 . 05 mmol , 58 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 98 ( t , j = 2 . 0 hz , 1h ), 8 . 61 ( d , j = 2 . 0 hz , 2h ), 7 . 93 - 7 . 89 ( m , 2h ), 7 . 81 - 7 . 77 ( m , 2h ), 5 . 05 ( s , 2h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 168 . 5 , 168 . 4 , 149 . 6 , 141 . 3 , 135 . 5 , 132 . 5 , 129 . 6 , 124 . 7 , 119 . 3 , 41 . 2 ; hrms ( esi ) calculated for c 15 h 10 n 3 o 6 [ m + h ] + : 328 . 0564 . found : 328 . 0568 . m . p . : 171 ° c . tert - butyl n - 3 , 5 - dinitrobenzylcarbamate ( 8 ): to a solution of 7 ( 960 mg , 2 . 93 mmol ) in thf ( 20 ml ) were added hydrazine ( 1 . 14 ml , 23 . 4 mmol ) and p - nitrotoluenesulfonic acid ( 280 mg , 1 . 47 mmol ). the resulting mixture was heated to reflux for 2 hours after which it was cooled to 25 ° c . and saturated na 2 co 3 was added . the aqueous phase was extracted with chcl 3 and the organic fractions were combined , dried over mgso 4 and evaporated under reduced pressure to give the free benzylic amine as a yellow solid that was used in the next step without further purification . a solution of the benzylic amine in meoh ( 20 ml ) was treated with boc 2 o ( 1 . 28 g , 5 . 86 mmol ) and net 3 ( 0 . 62 ml , 4 . 40 mmol ). the resulting mixture was heated to reflux for 45 minutes and then stirred at 25 ° c . for 18 hours , after which solvents were evaporated . the crude product mixture was dissolved in chcl 3 and the organic phase was washed with 0 . 1 m hcl , dried over mgso 4 and evaporated under reduced pressure . the solid was purified by flash chromatography on silica gel ( dcm / hex 20 %) to give the title compound 8 as a white solid ( 945 mg , 2 . 34 mmol , 80 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 93 ( bs , 1h ), 8 . 49 ( d , j = 2 . 4 hz , 2h ), 5 . 28 ( bs , 1nh ), 4 . 52 ( d , j = 6 . 0 hz , 2h ), 1 . 47 ( bs , 9h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 155 . 8 , 148 . 4 , 144 . 2 , 127 . 1 , 117 . 5 , 80 . 6 , 43 . 4 , 28 . 1 ; hrms ( esi ) calculated for c 12 h 15 n 3 o 6 [ m ] − : 297 . 0963 . found : 297 . 0966 . m . p . : 94 ° c . 7 - methoxy - 3 -( 3 , 5 - dinitrobenzyl ) aminocarbonylcoumarin ( 9 ): tfa ( 2 . 77 ml , 36 mmol ) was added to a solution of the benzylic amine 8 (( 267 mg , 0 . 898 mmol ) in dcm ( 10 ml ). the resulting mixture was stirred at 25 ° c . for 2 hours after which solvents were evaporated . addition of et 2 o to the resulting oil led to the formation of a precipitate that was used in the next step without further purification . a solution of the tfa salt in acn ( 10 ml ) was added to a solution of 7 - methoxycoumarin - 3 - carboxylic acid ( 218 mg , 0 . 988 mmol ), edc ( 189 mg , 0 . 988 mmol ), hobt ( 134 mg , 0 . 988 mmol ) and net 3 ( 0 . 26 ml , 1 . 89 mmol ) in acn ( 20 ml ). the resulting mixture was stirred at 25 ° c . for 18 hours after which solvents were evaporated under reduced pressure . the crude reaction product mixture was dissolved in chcl 3 and the organic phase was washed successively with saturated na 2 co 3 and 0 . 1 m hcl , dried over mgso 4 and evaporated under reduced pressure to give 9 as a beige solid ( 298 mg , 0 . 747 mmol , 83 %). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 41 ( t , j = 5 . 6 hz , 1h ), 8 . 45 ( s , 1h ), 8 . 72 ( t , j = 2 . 0 hz , 1h ), 8 . 65 ( d , j = 2 . 0 hz , 2h ) 7 . 90 ( d , j = 8 . 8 hz , 1h ), 7 . 13 ( d , j = 2 . 4 hz , 1h ), 7 . 05 ( dd , j = 2 . 4 , 8 . 8 hz , 1h ), 4 . 75 ( d , j = 6 . 0 hz , 1h ), 3 . 92 ( s , 3h ); 13 c nmr ( 75 mhz , dmso - d 6 ) δ 165 . 0 , 162 . 7 , 161 . 1 , 156 . 8 , 148 . 8 , 148 . 4 , 144 . 6 , 132 . 1 , 128 . 7 , 117 . 7 , 115 . 0 , 114 . 1 , 112 . 6 , 100 . 8 , 56 . 8 , 31 . 2 ; hrms ( esi ) calculated for c 18 h 13 n 3 o 8 na [ m + na ] + : 422 . 0589 . found : 422 . 0595 . m . p . : 233 ° c . 7 - methoxy - 3 -( 3 , 5 - di -( 3 - methylmaleimido ) benzyl ) aminocarbonyl coumarin ( 11 ): to a suspension of 9 ( 80 mg , 0 . 203 mmol ) in dmf ( 8 ml ) was added pd / c 10 % ( 50 % h 2 o w / w ). the resulting mixture was stirred under hydrogen ( 1 atm ) at 25 ° c . for 18 hours after which it was filtered on celite . the resulting diamine 10 was subsequently used in the next step without further purification . citraconic anhydride ( 0 . 06 ml , 0 . 609 mmol ) was added to the filtrate and the resulting mixture was stirred at 25 ° c . for 18 hours after which toluene ( 20 ml ) was added , followed by zncl 2 ( 83 mg , 0 . 609 mmol ) and hmds ( 0 . 13 ml , 0 . 609 mmol ). the resulting mixture was heated to reflux for 4 hours and solvents were evaporated under reduced pressure . the crude reaction mixture was dissolved in etoac and the organic phase was washed successively with 0 . 1 m hcl and saturated na 2 co 3 , dried over mgso 4 and evaporated under reduced pressure to give the title compound ii as a beige solid ( 38 mg , 0 . 072 mmol , 35 %). nmr ( 400 mhz , dmso - d 6 ) δ 9 . 20 ( bs , 1nh ), 8 . 86 ( s , 1h ), 7 . 95 - 7 . 91 ( m , 2h ), 7 . 35 ( s , 1h ), 7 . 22 ( s , 1h ), 7 . 13 ( s , 1h ), 7 . 05 ( d , j = 8 . 0 hz , 1h ), 6 . 81 ( s , 2h ), 4 . 61 ( d , j = 5 . 2 hz , 2h ), 3 . 91 ( s , 3h ), 2 . 07 ( s , 6h ); 13 c nmr ( 75 mhz , dmso - d 6 ) δ 171 . 6 , 170 . 7 , 165 . 8 , 163 . 0 , 162 . 0 , 157 . 5 , 149 . 4 , 147 . 1 , 142 . 3 , 133 . 6 , 132 . 9 , 128 . 8 , 126 . 0 , 124 . 6 , 1156 . 0 , 115 . 0 , 113 . 4 , 101 . 6 , 57 . 5 , 43 . 5 , 12 . 1 ; hrms ( esi ) calculated for c 28 h 22 n 3 o 8 [ m + h ] + : 528 . 1421 . found : 528 . 1401 . 3 , 5 - di -( 3 - methylmaleimido ) benzoic acid ( 12 ): to a solution of 3 , 5 - diaminobenzoic acid ( 1 . 0 g , 6 . 58 mmol ) in acetone ( 40 ml ) was added citraconic anhydride ( 1 . 8 ml , 19 . 74 mmol ) and the resulting mixture was stirred at 25 ° c . for 2 hours after which solvents were evaporated under reduced pressure . the crude solid was triturated in et 2 o , filtered under reduced pressure and used in the next step without further purification . the dimaleamic acid ( 500 mg , 1 . 33 mmol ) was dissolved in dmf ( 5 ml ) and then toluene ( 40 ml ) was added , followed by zncl 2 ( 544 mg , 3 . 99 mmol ) and hmds ( 1 . 13 ml , 5 . 98 mmol ). the resulting mixture was heated to reflux for 5 hours after which the solvents were evaporated . the title compound 12 was obtained as an off - white solid after precipitation with 0 . 1 m hcl ( 417 mg , 1 . 22 mmol , 92 %). 1 h nmr ( 300 mhz , dmso - d 6 ) δ 7 . 94 ( d , j = 1 . 8 hz , 2h ), 7 . 62 ( t , j = 1 . 8 hz , 1h ), 6 . 83 ( q , j = 1 . 8 hz , 2h ), 2 . 08 ( d , j = 1 . 8 hz , 6h ); 13 c nmr ( 75 mhz , dmso - d 6 ) δ 170 . 4 , 169 . 5 , 166 . 2 , 146 . 2 , 132 . 8 , 132 . 2 , 128 . 2 , 127 . 8 , 126 . 0 , 11 . 0 ; hrms ( esi ) calculated for c 17 h 13 n 2 o 6 [ m + h ] + : 341 . 0768 . found : 341 . 0770 . m . p . : 254 ° c . ( dec .). 8 -( 3 ′, 5 ′- di -( 3 - methylmaleimido )- phenyl - 4 , 4 - difluoro - 4 - bora - 3a , 4a - diaza - s - indacene ( 13 ; bodipy ): acid 12 ( 80 mg , 0 . 235 mmol ) in dcm ( 15 ml ) was treated with thionyl chloride ( 3 ml ) and heated to reflux for 2 hours after which the volatiles were evaporated . the crude mixture was dissolved in chcl 3 and evaporated again 3 more times and the resulting acid chloride was used in the next step without further purification . 1 , 3 - dimethylpyrrole was added to a solution of the acid chloride in dcm ( 20 ml ). the resulting mixture was stirred at 50 ° c . for 2 hours after which the volatiles were evaporated . the resulting solid was dissolved in dcm / tol ( 5 / 20 ml ) and then treated with net 3 ( 0 . 20 ml , 1 . 41 mmol ) at 25 ° c . for 30 minutes , followed by the addition of bf 3 . oet 2 ( 0 . 06 ml , 0 . 470 mmol ). the resulting mixture was heated at 70 ° c . for 2 hours . solvents were evaporated and the crude was purified by flash chromatography on silica gel dcm / thf giving a dark pink solid ( 60 mg , 0 . 111 mmol , 47 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 66 ( bs , 2h ), 7 . 35 ( bs , 1h ), 6 . 48 ( bs , 2h ), 5 . 98 ( s ( 1 ), 1h ), 5 . 87 ( s ( 1 ), 1h ), 2 . 53 ( s , 6h ), 2 . 28 ( s , 6h ), 1 . 55 ( s , 6h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 183 . 5 , 170 . 8 , 169 . 7 , 156 . 9 , 146 . 9 , 144 . 3 , 142 . 1 , 137 . 1 , 134 . 1 , 133 . 2 , 132 . 0 , 128 . 5 , 124 . 8 , 124 . 7 , 124 . 6 , 122 . 4 , 114 . 1 , 15 . 5 , 14 . 8 , 12 . 0 ; hrms ( esi ) calculated for c 29 h 26 bf 2 n 4 o 4 [ m + h ] + : 543 . 2031 . found : 543 . 2010 . m . p . : 118 ° c . 2 , 6 - diiodobenzoic acid ( 14 ): benzoic acid ( 500 mg , 4 . 54 mmol ), pd ( oac ) 2 ( 52 mg , 0 . 23 mmol ), iph ( o 2 cf 3 ) 2 ( 2 . 19 g , 6 . 81 mmol ) and iodine ( 1 . 73 g , 6 . 81 mmol ) were dissolved in dmf ( 10 ml ) in a screw cap tube and the resulting mixture was heated at 100 ° c . over 48 hours . the mixture was cooled to 25 ° c ., etoac was added and the organic phase was washed with 0 . 5 m hcl and saturated aqueous nacl . the crude mixture was then purified by flash chromatography on silica gel ( 60 % dcm / 40 % hexanes ) to give 14 as a white solid ( 1 . 10 g , 2 . 95 mmol , 65 %). characterization was consistent as published ( angew . chem . int ed . 2008 , 47 , 5215 - 5219 ). 2 , 6 - bis (( 4 - tert - butoxycarbonylaminophenyl ) ethynyl ) benzoic acid ( 15 ): in a two - neck flask equipped with a condenser and a stirring bar were placed pdcl 2 ( pph 3 ) 2 ( 38 mg , 0 . 054 mmol ), cui ( 5 mg , 0 . 027 mmol ) and 14 ( 1 . 0 g , 2 . 68 mmol ). the system was purged with a 1 / 1 mixture of n 2 / h 2 . solids were then suspended in previously degassed net 3 ( 2 . 2 ml , 16 . 1 mmol ), then heated to 80 ° c . after which a 4 - n - boc - ethynylaniline solution ( 1 . 2 mg , 5 . 36 mmol ) in acn ( 20 ml ) was added . the resulting mixture was heated to reflux over 18 hours after which it was filtered on a celite pad and solvents were removed by evaporation . the crude product was purified by flash chromatography on silica gel ( dcm / 30 % tol to dcm / 10 % tol gradient ) to give 15 as a yellow solid ( 930 mg , 1 . 68 mmol , 61 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 77 - 7 . 73 ( m , 2h ), 7 . 59 - 7 . 54 ( m , 4h ), 7 . 52 - 7 . 50 ( m , 1h ), 7 . 45 - 7 . 41 ( m , 4h ), 6 . 30 ( bs , 2 nh ), 1 . 56 ( bs , 18h ); hrms ( esi ) calculated for c 33 h 33 n 2 o 6 [ m + h ] + : 553 . 2339 . found : 553 . 2333 . m . p . 118 ° c . 2 , 6 - bis (( 4 -( 3 - methylmaleimido ) phenyl ) ethynyl ) benzoic acid ( 16 ): tfa ( 2 . 85 ml , 37 mmol ) was added to a solution of 15 ( 508 mg , 0 . 920 mmol ) in dcm ( 25 ml ) and the resulting mixture was stirred at 25 ° c . over 3 hours after which solvents were evaporated under reduced pressure . the resulting dianiline intermediate was used in the next step without further purification . the dianiline was dissolved in thf / meoh ( 15 / 5 ml ) and then treated with citraconic anhydride ( 0 . 25 ml , 2 . 76 mmol ) at 25 ° c . over 18 hours after which solvents were evaporated under reduced pressure . the resulting dimaleamic acid was dissolved in ac 2 o and treated with naoac ( 30 mg , 0 . 368 mmol ) at 110 ° c . over 8 hours after which solvents were evaporated . the resulting oil was dissolved in dcm and the organic phase was washed with 0 . 1 m hcl , dried over mgso 4 and evaporated under reduced pressure . the dimaleimide 16 was precipitated as a yellow solid upon addition of et 2 o and hexanes ( 255 mg , 0 . 472 mmol , 51 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 96 - 7 . 87 ( m , 3h ), 7 . 77 - 7 . 68 ( m , 4h ), 7 . 49 - 7 . 45 ( m , 4h ), 6 . 51 ( bs , 2h ), 2 . 19 ( bs , 6h ); hrms ( esi ) calculated for c 33 h 21 n 2 o 6 [ m + h ] + : 541 . 1397 . found : 541 . 1394 . 8 -( 2 ′, 6 ′- di -(( 4 ″-( 3 - methylmaleimido ) phenyl ) ethynyl ))- 4 , 4 - difluoro - 4 - bora - 3a , 4a - diaza - s - indacene ( 17 ): a solution of 16 ( 75 mg , 0 . 139 mmol ) in dcm ( 7 ml ) was treated with oxalyl chloride ( 18 μl , 0 . 208 mmol ) and one drop of dmf at 60 ° c . over 2 hours after which solvents were evaporated under reduced pressure . the resulting acyl chloride was dissolved in dcm which was subsequently evaporated ( repeated three times ), and then used in the next step without further purification . to a solution of the acyl chloride in dcm ( 3 ml ) was added 2 , 4 - dimethylpyrrole ( 29 μl , 0 . 278 mmol ) and the resulting mixture was stirred at 50 ° c . over 2 hours after which toluene ( 3 ml ) and et 3 n were added . the resulting mixture was stirred at 50 ° c . for 30 minutes before bf 3 — oet 2 ( 0 . 47 ml , 1 . 95 mmol ) was added and the solution was heated at 50 ° c . over 90 minutes . the solvents were then evaporated under reduced pressure and the crude product was purified by flash chromatography ( dcm / hex ) to give 17 as a red solid ( 45 mg , 0 . 061 mmol , 44 %). ( 3 , 5 - dibromopyridin - 4 - yl ) methanol ( 18 ): solid nabh 4 ( 35 mg , 0 . 91 , mmol ) was added to a solution of 3 , 5 - dinitrobenzoic acid ( 220 mg , 0 . 83 mmol ) in absolute ethanol ( 10 ml ) at 0 ° c . the resulting mixture was warmed to 25 ° c . and stirred for 4 hours after which the reaction was quenched with aqueous nh 4 cl . the aqueous phase was extracted with etoac and the organic phase was dried over mgso 4 and evaporated under reduced pressure to give the title compound as a white solid ( 212 mg , 0 . 80 mmol , 96 %). 1 h nmr ( 300 mhz , ( cdcl 3 ) δ 8 . 67 - 8 . 63 ( m , 2h ), 4 . 96 ( bs , 2h ), 2 . 69 ( bs , oh ). n -( 3 , 5 - dibromopyridin - 4 - yl ) methylphthalimide ( 19 ): to a solution of benzylic alcohol 18 ( 300 mg , 1 . 13 mmol ), triphenylphosphine ( 357 mg , 1 . 36 mmol ) and phthalimide ( 200 mg , 1 . 36 mmol ) in dry thf ( 10 ml ) was added diad ( 0 . 26 ml , 1 . 36 mmol ) under an n 2 atmosphere . the resulting mixture was stirred at 25 ° c . for 24 hours after which solvents were evaporated under reduced pressure . the crude product mixture was purified by chromatography on silica gel to give the title compound 19 as a white ( 300 mg , 0 . 762 mmol , 67 %). 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 68 ( bs , 2h ), 7 . 88 - 7 . 83 ( m , 2h ), 7 . 78 - 7 . 75 ( m , 2h ), 5 . 13 ( s , 2h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 168 . 1 , 151 . 8 , 142 . 7 , 135 . 1 , 132 . 4 , 124 . 4 , 43 . 3 ; ms ( esi ) calculated for c 14 h 9 n 2 o 2 br 2 [ m + h ] + : 397 . 04 . found : 396 . 90 . n -( 3 , 5 - dibromopyridin - 4 - yl ) methylphthalimide ( 20 ): to a solution of phthalimide 19 ( 300 mg , 0 . 76 mmol ) in thf ( 10 ml ) were added hydrazine ( 0 . 30 ml , 6 . 10 mmol ) and a catalytic amount of p - toluenesulfonic acid ( 4 mg , 0 . 15 mmol ). the resulting mixture was heated to reflux over 90 minutes after which saturated aqueous na 2 co 3 was added . the aqueous phase was extracted with etoac and the organic phases were combined , dried over mgso 4 and evaporated under reduced pressure . the resulting benzylic amine was used in the next step without further purification . the benzylic amine was dissolved in dcm ( 15 ml ) and then added to a solution of dansyl chloride ( 246 mg , 0 . 91 mmol ) and et 3 n ( 0 . 21 ml , 1 . 52 mmol ). the resulting mixture was stirred at 25 ° c . overnight after which solvents were evaporated under reduced pressure . the crude reaction mixture was purified by chromatography on silica gel to give the title compound as a pale green solid ( 332 mg , 0 . 668 mmol , 88 %). 1 h nmr ( 300 mhz , cdcl 3 ) δ 8 . 42 ( d , j = 8 . 7 hz , 1h ), 8 . 30 ( d , j = 8 . 7 hz , 1h ), 8 . 17 ( bs , 1h ), 8 . 14 ( s , 2h ), 7 . 49 ( t , j = 8 . 7 hz , 1h ), 7 . 42 ( t , j = 8 . 7 hz , 1h ), 7 . 12 ( d , j = 8 . 7 hz , 1h ), 5 . 90 ( t , j = 6 . 6 hz , nh ), 4 . 42 ( d , j = 6 . 9 hz ), 2 . 85 ( s , 6h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ 152 . 7 , 151 . 1 , 143 . 5 , 134 . 6 , 131 . 6 , 131 . 3 , 130 . 1 , 130 . 0 , 129 . 5 , 123 . 8 , 123 . 5 , 119 . 5 , 116 . 0 , 47 . 0 , 46 . 2 . 1 . liang , f . ; holt , i . ; pertea , g . ; karamycheva , s . ; salzberg , s . ; quackenbush , j . : “ gene index analysis of the human genome estimates approximately 120 , 000 ” nat . genet . 2000 , 25 , 239 - 240 . 2 . roest crollius , h . ; jaillon , o . ; dasilva , c . ; bouneau , l . ; fischer , c . ; fizames , c . ; wincker , p . ; brottier , p . ; quetier , f . ; saurin , w . ; weissenbach , j . : “ estimate of human gene number provided by genome - wide analysis using ”, nat . genet . 2000 , 25 , 235 - 238 . 3 . ewing , b . ; green , p . : “ analysis of expressed sequence tags indicates 35 , 000 human genes ”, nat . genet . 2000 , 25 , 232 - 234 . 4 . for example , see haughland , r . p . in handbook of fluorescent probes and research chemicals , molecular probes , eugene , oreg ., 1992 , 5th edn . 5 . sipple , t . o . : “ new fluorochromes for thiols : maleimide and iodoacetamide derivatives of 3 - phenyl coumarin fluorophore ”, j . histochem . cytochem . 1981 , 29 , 314 - 321 . 6 . corrie , j . e . t . : “ thiol - reactive fluorescent probes for protein labeling ”, j . chem . soc . perkin trans . 1 1994 , 2975 - 2982 . 7 . for a recent review , see : zhang , j . ; campbell , r . e . ; ting , a . y . ; tsien , r . y . : “ creating new fluorescent probes for cell biology ”, nature rev . 2002 , 3 , 906 - 918 . 8 . tsien , r . y . : “ the green fluorescent protein ”, annu . rev . biochem . 1998 , 67 , 509 - 544 . 9 . griffin , b . a . ; adams , r . s . ; tsien , r . y . : “ specific covalent labeling of recombinant protein molecules inside live cells ”, science 1998 , 281 , 269 - 272 . 10 . griffin , b . a . ; adams , s . r . ; jones , j . ; tsien , r . y . : “ fluorescent labeling of recombinant proteins in living cells with flash ”, methods enzymol . 2000 , 327 , 565 - 578 . 11 . gaietta , g . ; deerinck , t . j . ; adams , s . r . ; bouwer , j . ; tour , o . ; laird , d . w . ; sosinsky , g . e . ; tsien , r . y . ; ellisman , m . h . : “ multicolor and electron microscopic imaging of connexin trafficking ”, science 2002 , 296 , 503 - 507 . 12 . girouard , s . ; keillor , j . w . “ elaboration d &# 39 ; un fluorophore permettant une étude d &# 39 ; apposition protéique ”, m . sc . thesis , université de montréal , 2000 . 13 . houle , m .- h . ; keillor , j . w . “ synthèse d &# 39 ; un composé fluorogénique permettant l &# 39 ; étude de l &# 39 ; apposition protéique ”, m . sc . thesis , université de montréal , 2003 . 14 . kanaoka , y . ; sekine , t . ; machida , m . ; soma , y . ; tanizawa , k . ; ban , y . : “ studies on protein - sulfuryl reagent . synthesis of benzimidazole derivatives of maleimide ; fluorescent labeling of maleimide ”, chem . pharm . bull . 1964 , 12 , 127 . 15 . guy , j . ; caron , k . ; dufresne , s . ; michnick , s . w . ; skene , w . ; keillor , j . w . : “ convergent preparation and photophysical characterization of dimaleimide dansyl fluorogens : elucidation of the maleimide fluorescence quenching mechanism ”, j . am . chem . soc . 2007 , 129 , 11969 . 16 . langmuir , m . e . ; yang , j . r . ; moussa , a . m . ; laura , r . ; lecompte , k . a . : “ new naphtopyranone based fluorescent thiol probes ”, tetrahedron lett . 1995 , 36 , 3989 . 17 . yang , j .- r . ; langmuir , m . e . : “ synthesis and properties of a maleimide fluorescent thiol reagent derived a naphtopyranone ”, j . heterocyclic chem . 1991 , 28 , 1177 . 19 . russ , a . ; bump , e . a . : “ detection and quantitation of biological sulfhydryls ”, methods biochem . anal . 1988 , 33 , 165 - 241 . | 8 |
referring initially to fig1 illustrated is a schematic diagram of an exemplary two - switch three - phase boost converter 100 with three l - c resonant branches . the two - switch three - phase boost converter 100 receives input power from a three - phase ac voltage source 110 through first , second and third boost inductors la , lb , lc that are coupled to a three - phase rectifier 120 . the three - phase rectifier 120 includes a plurality of diodes d1 - d6 arranged in a full bridge configuration . also shown coupled to the first , second and third boost inductors la , lb , lc are three resonant branches ( not separately referenced ), each including a resonant capacitor and a resonant inductor . specifically , the first boost inductor la is coupled to a first resonant capacitor ca and a first resonant inductor l1 , the second boost inductor lb is coupled to a second resonant capacitor cb and a second resonant inductor l2 , and the third boost inductor lc is coupled to a third resonant capacitor cc and a third resonant inductor l3 . a freewheeling circuit 130 that includes a plurality of diodes d7 - d12 is also coupled to the three resonant branches . a common terminal of the first , second and third resonant inductors l1 , l2 , l3 is coupled to a node d between the first and second boost switches s1 , s2 . a regulation circuit 140 senses an output voltage vout and provides gate drive signals to the first and second boost switches s1 , s2 . an output capacitor co is also shown coupled across the first and second boost switches s1 , s2 to filter the output dc waveform . as the operation of the converter 100 over a switching cycle is described in greater detail below , the following assumptions and conditions apply ( of course , the assumptions and conditions are not necessary to the operation of the boost converter 100 ). ( 1 ) the capacitors ca , cb and cc are relatively high frequency capacitors , i . e ., the average current through each capacitor over a switching cycle is small enough compared with the high frequency operating current for its voltage to stay in its designed operating region . in other words , the low frequency components of their currents are relatively small . ( 2 ) all the inductors are relatively high frequency inductors , i . e ., the average volts - second applied on each inductor over a switching cycle is close to zero . in other words , the inductors do not carry low frequency voltages . ( 3 ) phase voltage ( va ) and phase current ( ia ) coupled to the first boost inductor la are greater than 0 , or positive ; phase voltages ( vb and vc ) and currents ( ib and ic ) coupled to the second and third boost inductors lb , lc are negative . ( 4 ) the currents in the first , second and third boost inductors la , lb , lc are continuous . ( 5 ) the first and second switches s1 , s2 are operated complementarily with duty cycles of about 50 %. it should be noted that the following operational modes are for illustrative purposes and that the operational modes may vary with different operating conditions . also , for the purposes of the following description and referring to fig1 positive inductor current is defined as moving from left to right and capacitor voltage is defined as positive on its left terminal . at the end of the second boost switch s2 conduction , i . e ., on , period , the first resonant capacitor ca is charged by the input current ia to a positive value while the second and third resonant capacitors cb , cc are fully discharged from negative voltages . also , at this time , the current in the first resonant inductor l1 is positive and is equal to the current in the first boost inductor la . the current in the second resonant inductor l2 is also positive and its amplitude is determined by the resonance between the second resonant capacitor cb and inductor l2 that occurs when the second boost switch s2 was turned on . the current in the third resonant inductor l3 is also positive and its amplitude is determined by the resonance between the third resonant capacitor cc and inductor l3 that occurs when the second boost switch s2 was turned on . it should be noted that all the resonant inductors carry positive currents at this time . mode 1 : at the beginning of this first mode , the second boost switch s2 is turned off and the first boost switch s1 is turned on . once the second boost switch s2 is off , the three positive resonant inductor currents force the node d to move to the top rail and the diode ds1 conducts , allowing the first boost switch s1 to be turned on at zero voltage . if the switches &# 39 ; duty - cycles are not close to 50 %, however , this soft - switching condition may be lost . with the first boost switch s1 on , the positive voltage on the first resonant capacitor ca is applied on the first resonant inductor l1 through diode d1 , driving the current in the first resonant inductor l1 from a positive value down in a resonant fashion . during this first mode , the second and third resonant inductors l2 , l3 first encounter the full output voltage vout through the first boost switch s1 and the diodes d11 , d12 . the second and third resonant inductors &# 39 ; l2 , l3 currents also decrease from their positive values back to zero . during this mode , the voltages on the second and third resonant capacitors cb , cc remain at zero . mode 2 : in the second mode , the resonance between the first resonant capacitor ca and inductor l1 continues and the current in the first resonant inductor l1 continues to decrease . the currents in the second and third resonant inductors l2 , l3 change to negative and begin to charge the second and third resonant capacitors cb , cc to negative voltages . the voltages applied on the second and third resonant inductors l2 , l3 are the differences between the output voltage vout and the voltages on the second and third resonant capacitors cb , cc , respectively . the currents in the second and third resonant inductors l2 , l3 then increase in the negative direction . this increase is almost linear , because the voltages on the second and third resonant capacitors cb , cc remain small compared to the output voltage vout . mode 3 : in the third more , once the currents in the second and third resonant inductors l2 , l3 &# 34 ; catch up &# 34 ; with the phase currents ib and ic , their changing rate is greatly reduced , since they are in series with the substantially larger second and third boost inductors lb , lc . also during this mode , the input phase currents ib , ic charge their respective second and third resonant capacitors cb , cc to negative voltages . concurrently , the resonance between the first resonant capacitor ca and inductor l1 continues with the current in the first resonant inductor l1 becoming negative . the voltage on the first resonant capacitor ca also decreases with this resonance and may reach zero if the switch on time is longer than 1 / 4 of the resonant period . if the voltage on the first resonant capacitor ca reaches zero , the current in the first resonant inductor l1 freewheels through the diode d7 and the voltage on the first resonant capacitor ca remains at zero , since both the diodes d1 , d7 are conducting . at the end of this third mode , all three currents in the first , second and third resonant inductors l1 , l2 , l3 are negative and conduct through the first boost switch s1 . also , the voltage on the first resonant capacitor ca is zero if fully discharged . the voltages on the second and third resonant capacitors cb , cc are negative , with their amplitudes determined by their corresponding phase currents . mode 4 : in the fourth mode , the first boost switch s1 turns off and the second boost switch s2 turns on . once the first boost switch s1 is off , the three negative resonant inductor currents force the node d to move to the bottom rail through diode ds2 and allow the second boost switch s2 to be turned on at zero voltage . the first resonant inductor l1 encounters the full output voltage vout as its negative current goes through the diodes d7 , ds2 . this current decreases in amplitude under the full output voltage vout and then reverses its direction and the first resonant inductor l1 forms a series circuit with the first resonant capacitor ca when the diode d7 stops conducting . the first resonant inductor l1 now encounters the output voltage vout less the voltage on the first resonant capacitor ca , and its current ramps up . once it reaches the input phase current ia , the diode d1 stops conducting and the full input phase current ia flows into the first resonant capacitor ca . additionally , the second and third resonant capacitors cb , cc resonate with the second and third resonant inductors l2 , l3 , respectively . the currents in the second and third resonant inductors l2 , l3 also increase from their negative values to positive values . if the second and third resonant capacitors cb , cc are fully discharged , the currents in the second and third resonant inductors l2 , l3 freewheels through the diodes d11 and d12 . this reaches the condition in which the above - described mode 1 is entered . turning now to fig2 illustrated is a schematic diagram of an embodiment of a boost converter 200 with wye ( y ) connected resonant capacitors constructed according to the principles of the present invention . the converter 200 includes first , second and third boost inductors la , lb , lc that are coupled to an ac input power source 210 . a rectifier 220 that includes a plurality of diodes d1 - d6 arranged in a full bridge configuration is also coupled to the boost inductors . those skilled in the art should readily appreciate that , in other advantageous embodiments , controllable switches may be used in place of the diodes in the rectifier 220 . the rectifier 220 provides partial paths for the three input phase currents to flow to the output . also shown in the illustrated embodiment are first and second boost switches s1 , s2 that , in an advantageous embodiment , are metal oxide semiconductor field - effect transistors ( mosfets ). in another advantageous embodiment , other switching devices , such as insulated gate bipolar transistors ( igbts ), may also be advantageously employed . the first and second boost switches s1 , s2 , in an advantageous embodiment , are operated complementarily with duty cycles of about 50 %. it should be noted that the duty cycles of the first and second boost switches s1 , s2 may be varied and may be used to control the input power level . in another advantageous embodiment , the switching frequency of the boost switches s1 , s2 may be used to control the input power . the first , second and third boost inductors la , lb , lc are also shown coupled to a switching network 240 that includes first , second and third resonant capacitors ca , cb , cc wye ( y ) connected with the first , second and third resonant inductors l1 , l2 , l3 , respectively , and to a node d between the first and second boost switches s1 , s2 . also included in the switching network 240 are a plurality of diodes d7 - d14 that include blocking diodes d13 , d14 . the diodes d7 - d14 together with the first and second boost switches s1 , s2 provide a path for resonant currents to flow . a regulation circuit 230 senses an output voltage vout and provides gate drive signals to the first and second boost switches s1 , s2 . in an advantageous embodiment , the regulation circuit includes a pwm controller . those skilled in the art are familiar with the construction and operation of pwm controllers ; thus , they will not hereinafter be described in detail . an output capacitor co is also shown coupled across the rectifier 220 to filter the output dc waveform . the operation of the converter 200 is best described by referring to fig3 with continuing reference to fig2 . turning now to fig3 illustrated are exemplary drive signals , current and voltage waveforms 300 of the converter 200 illustrated in fig2 . the waveforms 300 include first and second drive signals 310 , 320 of the first and second boost switches s1 , s2 , respectively and first , second and third current waveforms 330 , 340 , 350 corresponding to inductor currents in the first , second and third resonant inductors l1 , l2 , l3 , respectively . also illustrated are first , second and third voltage waveforms 360 , 370 , 380 corresponding to voltages across the first , second and third resonant capacitors ca , cb , cc , respectively . the following assumptions and initial conditions apply in describing the operation of the converter 200 in greater detail over an exemplary switching cycle ( of course , the assumptions and conditions are not necessary to the operation of the converter 200 ). ( 1 ) all the capacitors except the output capacitor co are relatively high frequency capacitors , i . e ., the average current through each capacitor over a switching cycle is sufficiently small compared to the high frequency operating current such that its voltage stays in its designed operating region . in other words , the low frequency components of their currents are relatively small . ( 2 ) all the inductors are relatively high frequency inductors , i . e ., the average volt - second applied on each boost inductor over a switching cycle is close to zero . in other words , the boost inductors do not carry low frequency voltages . ( 3 ) phase voltage ( va ) and phase current ( ia ) coupled to the first boost inductor la are greater than 0 , or positive ; phase voltages ( vb and vc ) and currents ( ib and ic ) coupled to the second and third boost inductors lb , lc are negative . ( 4 ) all phase currents ( ia , ib and ic ) are in continuous conduction mode ( ccm ). ( 5 ) the first and second boost switches s1 , s2 are operated complementarily with duty cycles of about 50 %. it should be noted that the following operational modes are for illustrative purposes and that the operational modes may vary with different operating conditions . also , for the purposes of the following description and referring to fig2 positive inductor current is defined as moving from left to right and capacitor voltage is defined as positive on its top , or upper , terminal . at the end of the second boost switch s2 conduction period , the current in the first resonant inductor l1 , i . e ., represented by a first current waveform 330 , is zero ( inductor l1 is fully discharged ) and the voltage across the first resonant capacitor ca , represented by a first voltage waveform 360 , is at a high value ( possibly clamped to the positive output voltage vout ). the currents in the second and third resonant inductors l2 , l3 , represented by second and third current waveforms 340 , 350 , respectively , are negative ( the negative voltages on the second and third resonant capacitors cb , cc are applied on the second and third resonant inductors l2 , l3 before this time ). the voltages on the second and third resonant capacitors cb , cc , represented by second and third voltage waveforms 370 , 380 , respectively , are relatively small , since their energy has been discharged into the second and third resonant inductors l2 , l3 . the exemplary operation of the converter 200 begins , at time t0 , with the second boost switch s2 being turned off . immediately following the turning off of the second boost switch s2 , depending upon the switching scheme employed , the first boost switch s1 is turned on . the first resonant capacitor ca voltage is immediately applied on the first resonant inductor l1 and the resonance begins with the initial zero current in the first resonant inductor l1 . subsequently , the current in the first resonant inductor l1 increases in a resonance fashion and the voltage across the first resonant capacitor ca decreases accordingly . with the second boost switch s2 off , the currents in the second and third resonant inductors l2 , l3 follow the current paths through diodes d11 , d12 , d14 . consequently , the second and third resonant inductors l2 , l3 encounter the output voltage vout , minus the voltage across the first resonant capacitor ca in series with the voltages across the second and third resonant capacitors cb , cc , causing the negative currents in the second and third resonant inductors l2 , l3 to decrease in amplitude . during this period , the second and third resonant capacitors cb , cc are charged in the positive direction . once the current in the second resonant inductor l2 is lower in amplitude than the current in the second boost inductor lb , the current in the second resonant capacitor cb changes direction and begins to be charge the second resonant capacitor cb towards the negative polarity . the same conditions are also true for the third resonant inductor and capacitor l3 , cc . it should be noted that , during this mode ( first boost switch s1 on ), the currents in the second and third resonant inductors l2 , l3 reach zero . before the first boost switch s1 turns off , the voltage across the first resonant ca is relatively low ( its energy has been transferred into the first resonant inductor l1 ). also prior to the turn - off of the first boost switch s1 , the voltages across the second and third resonant inductors cb , cc are charged to almost their negative peak values . at time t3 , the first boost switch s1 is turned off and the second boost switch s2 is turned on . once the first boost switch s1 is off , the current in the first resonant inductor l1 conducts through the diodes d7 , d13 and is discharged to the output . the voltage across the first resonant capacitor ca is charged to a relatively high positive value by the input current in the first boost inductor la . at the same time , the voltages across the second and third resonant capacitors cb , cc are immediately applied to the second and third resonant inductors l2 , l3 , respectively , which in turn , drive their currents towards negative from zero . subsequently , the voltages across the second and third resonant capacitors cb , cc are discharged to a smaller value in amplitude . this reaches the initial conditions at time t0 described above and completes a switching cycle . it should be emphasized that the above described operation of the converter 200 over an exemplary switching cycle is one example under a particular set of operating conditions . it should be noted that , for different operating conditions , the results may be different due to the complex resonant processes involved . the first , second and third resonant inductors l1 , l2 , l3 currents in the converter 200 , unlike the converter 100 resonant inductors &# 39 ; currents , are not required to increase to a much larger value than the continuous input phase currents ia , ib , ic , because the resonance between the resonant capacitors and the resonance inductors does not rely on the current levels in the boost inductors . as a result , the boost switches s1 , s2 conduct less currents than the converter 100 boost switches . the lower current handling requirement for the converter 200 boost switches provides significant advantages in terms of cost and design when selecting power switching devices for the boost switches s1 , s2 . while specific embodiments of a power converter and a method for reducing a input current thd have been illustrated and described , other embodiments are well within the broad scope of the present invention . for a better understanding of switching power converters , in general , see &# 34 ; principles of power electronics &# 34 ; by john g . kassakian , et al ., addison wesley , inc . ( 1991 ), which is incorporated herein by reference . although the present invention and its advantages have been described in detail , those skilled in the art should understand that they can make various changes , substitutions and alterations herein without departing from the spirit and scope of the invention in its broadest form . | 7 |
embodiments of the present invention will be described hereinafter with reference to the accompanying drawings . in the following description , the constituent elements having substantially the same function and arrangement are denoted by the same reference numerals , and repetitive descriptions will be made only when necessary . with reference to fig1 - 3 , one example of the inventive tie 1 is shown in which a head 5 including a front side 6 and a back side 7 is connected to a tail 60 that has at least one different cross - sectional geometry from the cross - sectional geometry of the head 5 . at least one of the front side 6 and back side 7 of the head 5 is typically configured to display or receive an informational visual indicator such as a writing , stamping , or sticker . in the example shown , a neck 65 occupies a portion of the tail 60 and serves to strengthen the connection between the head 5 and the tail 60 . for example , as measured in the radial direction , the neck 65 can have larger dimensions than the tail 60 . in some examples , the tail does not include the neck 65 . the tie 1 can be formed of any of a variety of flexible materials , but plastics such as polypropylene are typically used . in some embodiments , the tie 1 is color - coded for a particular use . as would be familiar to a person of ordinary skill in the art , the tail 60 extends away from the head 5 in a longitudinal direction ( to the right in fig1 ) and is configured to bend around an object in order to be secured to the object when the tail is in a locked position . the head 5 further includes a lock protrusion 75 . the lock protrusion 75 includes a lock 70 and typically includes one or more tab 72 disposed on or near the lock 70 . as shown in fig1 - 3 , the lock protrusion 75 may be generally conical in shape . however , other shapes are possible . as further shown in fig1 - 3 a series of barbs 10 are disposed on the tail 60 . the barbs 10 are separated from each other by a series of core portions 20 . as shown in fig1 - 3 , the barbs 10 may be conical or shaped as a truncated cone . in one embodiment , the barbs 10 have a maximum ( major ) diameter of 0 . 085 inches and a cone angle of 15 degrees . in one example , there is a 0 . 07 inch distance from a perpendicular face corresponding to the major diameter of one of the barbs 10 and the conical portion of the next closest of the barbs 10 . as the barbs 10 are made to slide into the lock 70 , the conical or frustoconical shape assists in a ratcheting effect in which the barbs 10 pass through the lock 70 and are locked in place by the tab 72 so as to resist passing through the lock 70 in a direction opposite to that of entry . the core portions 20 typically have a major ( outermost ) diameter of approximately 0 . 06 inches , where “ approximately ” means plus or minus 0 . 01 inch . in some applications , the barbs 10 and / or core portions 20 are not round , but are instead oval , polygonal , or some other shape . in these cases , the minimum cross - sectional dimension is preferably 0 . 06 inches . however , with all of the above - noted dimensions , variations are available depending upon the need of the user . as shown in fig1 - 3 , an optional intermediate grip 30 may be disposed on the tail 60 and serves to allow a user to comfortably grip the tail 60 without touching the barbs 10 . in some embodiments , the intermediate grip 30 is omitted in order to simplify manufacture . in some embodiments , the intermediate grip 30 has a flattened cross - section ( fig1 - 12 ) in order to allow a strong , but still flexible tie 1 . in other words , the flattened intermediate grip 30 allows a preferred direction of bending , which can make inspection of the front side 6 and back side 7 of the head 5 easier . the intermediate grip 30 may be incorporated into any of the embodiments of the present invention disclosed herein . fig1 - 3 also depict an optional stopper 40 , which may be used to stop movement of the tail 60 at a predetermined position and / or to prevent over - tightening . in some instances , it is preferable not to tighten the tail 60 to the extent that the loop formed by the tail 60 after the tail 60 passes through the lock 70 grabs the object around which the tail 60 is wrapped . for example , if the tie 1 is used to identify an inspection date for a fire extinguisher , it is generally preferable to allow easy inspection of the front side 6 and back side 7 by providing a loose connection between the tail 60 and the connection loop or orifice on the fire extinguisher . the loose connection allows the front side 6 and back side 7 to be examined without putting strain on the tail 60 , and therefore assists in allowing the tail 60 to avoid wear and tear while it is attached to the fire extinguisher . fig4 - 5 depict examples without the optional stopper 40 or intermediate grip 30 . fig7 - 9 depict examples without the stopper 40 and with grips 63 disposed on the disposable portion 62 . the grips 63 typically have a diameter smaller than the diameter of the barbs 10 in order to allow smooth passage of the tail 60 through the lock 70 . the grip 63 may be incorporated into any of the embodiments of the invention disclosed herein . if the optional stopper 40 is disposed on the tail 60 , then the barbs 10 disposed between the head 5 and the stopper 40 will typically be unused inasmuch as these barbs will not pass through the lock 70 during attachment . fig1 - 3 depict barbs between the stopper 40 and head 5 in order to show that the same tail 60 may be made to include or not include the stopper 40 depending on the needs of the user . the barbs 10 disposed between the stopper 40 and the end of the tie 1 opposite the head 5 are used to secure the tie 1 in the lock 70 . as shown in fig1 - 3 , a predetermined break - away 50 is disposed on the tail 60 . the predetermined break - away 50 is typically the physically weakest point on the tail 60 and allows a user to cleanly snap off the disposable portion 62 after the tail 60 is looped through the lock 70 and the item to which the tie 1 is attached . preferably , the tensile force required to break the tail via the predetermined break - away 50 , as measured by pulling straight down the length of the tie 1 , is between four and eight pounds , while the force required to break the tail 60 without the predetermined break - away 50 is between seven and eleven pounds . preferably , the force required to break the tail 60 at the predetermined break - away 50 is less than the force required to break the tail 60 without the predetermined break - away 50 . thus , the predetermined break - away 50 provides a convenient predetermined failure section allowing the user to know in advance of breaking exactly where the tail 60 of the tie 1 will break once sufficient tensile force is applied to the tie 1 . preferably , the ratio of diameter of the predetermined break - away 50 to the diameter or largest dimension of the core portions 20 is 2 / 3 in order to allow a significant difference in tensile strength between these two components and to ensure that the predetermined break - away 50 breaks before any of the core portions 20 or other parts of the tail 60 break . preferably , the outermost dimension or diameter of the predetermined break - away 50 is approximately 0 . 04 inches . additionally , it is preferable that the predetermined break - away 50 be approximately 0 . 10 inches long in order to provide a visible indication of the break point to a user prior to breaking . it should be noted that in some embodiments , the cross - section of the tail is not circular . similarly , in some embodiments , the cross - section of the predetermined break - away 50 is not circular . in examples where the cross - section of one or both of the tail 60 and predetermined break - away 50 is not circular , it is preferred that similar breakage characteristics are provided by the tail 60 and predetermined break - away 50 to those noted above regarding the 2 / 3 diameter . in other words , the ratio of cross - sectional area of the tail 60 , in the direction the tail 60 extends from the head 5 , is larger than the cross - sectional area of the predetermined break - away 50 . preferably , when one or more of the predetermined break - away 50 and tail 60 is non - circular , the ratio of the cross - sectional area of the predetermined break - away 50 to the minimum cross - sectional area of the tail 60 other than the predetermined break - away 50 is 4 / 9 , just as it would be for circular cross - sections when the ratio of the diameters is 2 / 3 . as further shown in fig1 - 3 , the tail 60 may include a disposable portion 62 , which can be gripped by the user and inserted into the lock 70 . in other embodiments , the barbs 10 extend across the area occupied by the disposable portion 62 in fig1 - 3 . in practice , the user wraps the tie 1 around an object to be secured or tagged , and the user pulls the tail 60 through the lock 70 until at least one of the barbs 10 are locked by the tab 72 . due to the shape of the barbs 10 , the barbs 10 cannot be easily pulled back through the lock 70 , and the tie 1 is permanently wrapped around the object until the tie 1 is cut or otherwise damaged . if the optional stopper 40 is present , the user will typically pull the tail 60 until it “ bottoms out ” on the stopper 40 . at this point , or when the tie grips the object if no stopper is present , the user pulls with greater force , and the tail 60 will break at the predetermined break - away 50 while leaving no portion , or only a short stub , of the tail 60 protruding from the lock 70 . thus , the predetermined break - away 50 allows a clean break to be formed without an unwieldy portion of the tail 60 dangling from the lock 70 , which could get caught or tangled on other objects . this clean break is particularly helpful when tagging fire extinguishers as these are often handled during emergency situations . although only certain embodiments of this invention have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiment without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention . | 8 |
the following detailed description is presented to enable any person skilled in the art to make and use the embodiments described herein . for purposes of explanation , specific nomenclature is set forth to provide a thorough understanding . however , it will be apparent to one skilled in the art that the specific nomenclature is not required . descriptions of specific applications are provided only as representative examples . various modifications to the preferred embodiments will be readily apparent to one skilled in the art , and the general principles defined herein may be applied to other embodiments and applications . the present inventions are not intended to be limited to the embodiments shown , but are to be accorded the widest possible scope consistent with the principles and features disclosed herein . the embodiments described herein are generally directed to devices and methods for supporting cga solder columns of an ic package to prevent damage to the solder columns due to shock , vibration , and long - term compressive load . with reference now to fig1 to 5 , various embodiments of a supporting device will be described . as will be described in more detail below , the supporting device may be used in a variety of configurations to provide mechanical support for cga solder columns on an ic package . fig1 shows an embodiment of the supporting device . in this embodiment , the supporting device is in the form of a corner shim 101 . the shim 101 can be made of any material that is mechanically strong enough to support an application specific integrated circuit ( asic ) 103 . examples of the shim material include , but are not limited to , plastics , ceramics , metal , and metal alloy . preferably , the shim 101 is made of a material with a coefficient of thermal expansion ( cte ) that closely matches the cte of the solder columns . a shim 101 with a matching cte may be preferred in high temperature applications such as a burn - in test of semiconductor wafers and high power ic packages . in this embodiment , a shim 101 is placed at each corner of the asic 103 . however , it is understood that the number of shims used in a particular application may vary according to the particular requirement of the application , and that the shims 101 may be placed in other depopulated areas . for example , the shims 101 may be placed along the sides of the asic 103 , if there are depopulated areas along the side of the asic 103 that allow the insertion of the shim 101 . preferably , the pcb 105 , asic 103 and shims 101 are designed to accommodate each other so that shim installation can be automated . there is no particular limitation on the size and shape of the shim 101 . generally , the size of the shim 101 is minimized to reduce consumption of pcb real estate . in the embodiments shown in fig2 and 3 , the shims 101 are designed in such a shape that an extrusion 111 of the shim 101 can be inserted into the space between the underside of the asic 103 and the topside of the pcb 105 . the extrusion 111 may have a thickness that is smaller than the distance between the asic 103 and the pcb 105 , so that the extrusion 111 may be slipped into the space between the asic 103 and the pcb 105 without stretching the solder columns 107 . however , the extrusion 111 may be thick enough to provide mechanical support to the asic 103 and prevent shorting or joint failure due to creeping of the solder columns 107 under a long - term compressive load . in other words , there is preferably a small gap 125 between the extrusion 111 and the asic 103 immediately after the shim 101 is installed ( fig4 a ). as shown in fig4 b , when the apparatus is in use , the solder columns 107 will start to creep over time due to stress and the gap 125 will be closed . when the upper surface of the extrusion 111 comes into contact with the undersurface of the asic 103 , the asic 103 is fully supported by the shims 101 and the stress on the solder columns 107 is relaxed . the shim 101 may also be designed in such a shape that , after being fully inserted between the asic 103 and the pcb 105 , the extrusion 111 of the shim 101 will not come into contact with any of the solder columns 107 of the asic 103 . in the embodiments shown in fig2 and 3 , this goal is achieved by the design of a base 113 , which would come into contact with the edges of the asic 103 and stop the advance of the shim 101 before the extrusion 111 comes into contact with any of the solder columns 107 . in order to prevent any undesired movement of the shim 103 , the shim 103 may be mechanically and removably fastened to the pcb 105 . the shim 103 may be fastened to the pcb with a screw or with a snap - and - catch mechanism such as a dimple 119 . fig3 a to 4 b illustrate several embodiments of the fastening mechanism . with reference now to fig3 a , the shim 101 is fastened by a screw 115 from the bottom of the base 113 through a hole 121 on the pcb 105 . alternatively , the screw 115 may be installed from the top of the base 113 , through the base 113 , through the hole 121 , and into a bolster 117 underneath the pcb 105 ( fig3 b ). in another embodiment , a threaded adaptor 127 is inserted into the hole 121 to convert the unthreaded hole 121 into a threaded hole for the installation of the shim 101 ( fig3 c ). with reference now to fig4 a , the shim 101 is pushed into a position so that the dimple 119 on the base 113 of the shim 101 clicks into the hole 121 on the pcb 105 and immobilizes the shim 101 . the dimple 119 does not have to have a tight fit with the hole 121 , so long as horizontal movement of the shim 101 is restricted by the dimple 119 and the matching hole 121 and so that the shim 101 cannot come into contact with the solder columns 107 . since the vertical movement of the shim 101 is restricted by the extrusion 111 in between the asic 103 and the pcb 105 , the shim 101 is properly secured on the pcb 105 . over time , when the gap 125 is closed due to minor creeping of the solder columns 107 ( fig4 b ), the shim 101 will be completely immobilized . it should be noted , however , that the shim 101 can be removed at any time and reinstalled at the same or different location . fig5 depicts a method 500 for mechanically supporting an ic package having a cga interconnection with a pcb . the method 500 preferably comprises the steps of inserting shims between the ic package and the pcb ( step 503 ), and fastening the shims to the pcb to secure the support to the ic package and prevent damage to the solder columns of the ic package by undesired movement of the shims ( step 505 ). preferably , the shims are inserted after the ic package is solder attached to the pcb , so that the presence of the shims will not interfere with the soldering process . shims 101 may be removed for rework of the asic 103 and reinstalled after the rework of the asic 103 . the preferred embodiments of the supporting device of the present invention are intended to be illustrative and not limiting . it should be understood that modifications and variations can be made by persons skilled in the art in light of the above teachings . therefore , changes may be made in the particular embodiments disclosed which are within the scope of what is described as defined by the appended claims . | 7 |
before explaining at least one embodiment of the inventive concepts disclosed herein in detail , it is to be understood that the inventive concepts are not limited in their application to the details of construction and the arrangement of the components or steps or methodologies set forth in the following description or illustrated in the drawings . in the following detailed description of embodiments of the instant inventive concepts , numerous specific details are set forth in order to provide a more thorough understanding of the inventive concepts . however , it will be apparent to one of ordinary skill in the art having the benefit of the instant disclosure that the inventive concepts disclosed herein may be practiced without these specific details . in other instances , well - known features may not be described in detail to avoid unnecessarily complicating the instant disclosure . the inventive concepts disclosed herein are capable of other embodiments or of being practiced or carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting . as used herein a letter following a reference numeral is intended to reference an embodiment of the feature or element that may be similar , but not necessarily identical , to a previously described element or feature bearing the same reference numeral ( e . g ., 1 , 1 a , 1 b ). such shorthand notations are used for purposes of convenience only , and should not be construed to limit the inventive concepts disclosed herein in any way unless expressly stated to the contrary . further , unless expressly stated to the contrary , “ or ” refers to an inclusive or and not to an exclusive or . for example , a condition a or b is satisfied by anyone of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). in addition , use of the “ a ” or “ an ” are employed to describe elements and components of embodiments of the instant inventive concepts . this is done merely for convenience and to give a general sense of the inventive concepts , and “ a ’ and “ an ” are intended to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise . finally , as used herein any reference to “ one embodiment ,” or “ some embodiments ” means that a particular element , feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the inventive concepts disclosed herein . the appearances of the phrase “ in some embodiments ” in various places in the specification are not necessarily all referring to the same embodiment , and embodiments of the inventive concepts disclosed may include one or more of the features expressly described or inherently present herein , or any combination or sub - combination of two or more such features , along with any other features which may not necessarily be expressly described or inherently present in the instant disclosure . broadly , embodiments of the inventive concepts disclosed herein are directed to a system and related method for providing stall recovery symbology via a head - up display ( hud ) or other avionics display element . when a stall is detected , the system may help the pilot quickly and intuitively recover from the stall according to faa stall recovery guidelines . stall recovery symbology may prevent the pilot or crew from inadvertently exacerbating the stall in their urgency to take action . referring to fig1 , an exemplary embodiment of a system 100 for providing stall recovery symbology according to the inventive concepts disclosed herein may include a controller 102 including one or more processors 104 and a display element 106 including a projector 108 or similar display module and a combiner 110 or similar display surface . the controller 110 may be connected to one or more aircraft sensors 112 or avionics systems 114 of an aircraft in which the system 100 is embodied . the display element 106 may be a primary flight display ( pfd ) or head - down display ( hdd ), a head - up display ( hud ), a head - mounted display ( hmd ), or a head - worn display ( hwd ) configured to display fully or partially immersive imagery corresponding to the environment surrounding the aircraft . the display element 106 may include graphics processors ( e . g ., a synthetic vision system ( svs )) for generating explanatory symbology related to the environment and merging the symbology with the imagery to generate a combined vision stream displayed via the combiner 110 . the processors 104 of the controller 102 may generate some or all of the symbology of a combined vision stream . based on data collected from the aircraft sensors 112 or avionics systems 114 , the controller 102 may determine that a near - stall or stall condition is present . for example , the controller 102 may be coupled to a stall warning system of the aircraft , or to external pitot tubes , vanes , or other mechanisms configured for sensing an unusual angle of attack ( aoa ) characteristic of a stall or near - stall condition . the controller 102 may determine that a stall or near - stall condition exists based on a combination of the aoa , the aircraft pitch , the current airspeed , or other relevant factors . referring to fig2 a , an exemplary embodiment of a system 100 a for providing stall recovery symbology may be implemented identically to the system 100 of fig1 , except that when a stall or near - stall condition is detected by the controller 102 ( fig1 ), the system 100 a may fade out some or all of the symbology normally displayed via the combiner 110 or display surface of the system 100 a and generate stall recovery symbology . for example , the airspeed indicator 116 , altitude indicator 118 , artificial horizon 120 , boresight symbol 122 , stall warning symbol 124 , or other relevant symbology ( e . g ., an aoa warning ( not shown )) may be retained . furthermore , the stall warning symbol 124 may be accompanied by an auditory alert while stall conditions persist . however , the system 100 a may determine if the autopilot or autothrottle system of the aircraft is activated and display an autopilot annunciator 126 to provide the pilot with immediate recognition of the autopilot active status so that the autopilot system can be disabled . the autopilot annunciator 126 may include an autothrottle annunciator 126 a indicating an active autothrottle status . the system 100 a may terminate the autopilot annunciator 126 or autothrottle annunciator 126 a upon determination that the autopilot or autothrottle system has been disengaged . in some embodiments , an active autopilot system may execute stall recovery procedures without direct pilot input . the system 100 a may continue to monitor stall recovery and update the displayed stall recovery symbology accordingly , depending on detected pitch , roll or thrust changes , until stall or near - stall conditions are no longer present . during initial entry into the stall recovery symbology , the system 100 a may generate and display a stall attitude recovery ( sar ) symbol 128 indicating a target pitch attitude of the aircraft for stall recovery . when the sar 128 is not conformal to the aircraft boresight symbol 122 , the system 100 a may display a stall recovery chevron ( src ) 130 which rotates above the earth frame , similarly to the aircraft pitch scales 130 . the src 130 may indicate the desired direction of pitch correction to achieve the target pitch attitude indicated by the sar 128 . the sar 128 may be displayed as a ghosted ( dashed ) symbol when not fully within the artificial horizon 120 ( e . g ., when the sar 128 is partially clipped or cropped ), and may rotate or move vertically relative to the earth frame , similarly to the src 130 . as the pilot reduces the aircraft pitch or aoa , the presentation of the sar 128 and src 130 may be modified to reflect changes in aircraft pitch or aoa by appearing closer to the boresight symbol 122 . for example , as the sar 128 becomes fully visible within the artificial horizon 120 , the sar may provide situational awareness of the aircraft roll orientation ( in addition to that provided by the artificial horizon 120 ) so that the pilot may level the wings pursuant to stall recovery . when the sar 128 is aligned with the boresight symbol 122 , the src 130 may be terminated to indicate pitch recovery , or the achievement of the target pitch attitude . referring now to fig2 b , an exemplary embodiment of a system 100 b for providing stall recovery symbology may be implemented identically to the system 100 a of fig2 a , except that when the pilot has achieved a target pitch attitude , the src 130 ( fig2 a ) may be terminated and the sar ( 128 a ) displayed via the combiner 110 or display surface as a solid symbol ( e . g ., neither ghosted nor cropped ) aligned with the aircraft boresight symbol 122 . the sar 128 a may further indicate that the pilot has leveled the wings , and that the roll angle of the aircraft is therefore aligned with the horizontal ( as indicated by the artificial horizon 120 ). symbology displayed by the system 100 b may include pitch guides 132 and roll guides 134 for establishing target pitch or roll zones for the pitch and roll attitudes of the aircraft ( as portrayed by the sar 128 a ). the system 100 b may provide auditory guidance to the pilot in adjusting the pitch and roll attitudes of the aircraft to achieve the target pitch or roll zones indicated by the pitch guides 132 and roll guides 134 . the autopilot annunciator 126 may continue to be displayed ( and the corresponding auditory alert may continue to sound ) if the autopilot has not been disengaged . referring to fig2 c , an exemplary embodiment of a system 100 c for providing stall recovery symbology may be implemented identically to the system 100 b of fig2 b , except that once the aircraft has achieved the target pitch attitude indicating a corrected aoa , the system 100 c may display ( via the combiner 110 ( fig1 ) or display surface ) a stall thrust recovery ( str ) symbol 136 . the str 136 may aid the pilot in correcting the airspeed while preventing over - or under - thrust conditions that may inhibit or counteract stall recovery . the display and modification of the str 136 and thrust correction command may be determined algorithmically by the controller 102 ( fig1 ), based on the total lift equation ( for lift l , lift coefficient c l air density ρ , velocity v , and wing surface area s ). the controller 102 may determine that the aircraft has achieved stable flight , e . g ., that near - stall or stall conditions no longer exist . accordingly , visible and auditory stall warnings ( e . g ., the stall warning symbol 124 ( fig2 a ) and corresponding alert ) may be terminated by the controller 102 . the system 100 c may transition into the normal symbology displayed via the combiner 110 or display surface , e . g ., by blending the sar 128 a into the flight path symbol 138 , so the pilot does not have to scan the display surface to locate the flight path symbol . the str 136 may be accompanied by a target airspeed guide 140 , indicating a target airspeed toward which the pilot may adjust , as well as auditory guidance in adjusting airspeed to achieve the target airspeed . stall recovery symbology may be displayed via the combiner 110 or display surface as monochrome or colored symbols , depending on , e . g ., whether the display element 106 ( fig1 ) is a pfd / hdd , hud , hmd , or hwd . stall recovery symbology may be further modified according to human factors considerations . for example , the stall recovery symbology may be implemented as flashing symbols , or more boldly than the airspeed indicator 116 or altitude indicator 118 to appear brighter or to be more easily identified and instantly interpreted by the pilot . referring now to fig3 a , an exemplary embodiment of a method 200 for providing stall recovery symbology according to the inventive concepts disclosed herein may be implemented by the system 100 in some embodiments , and may include one or more of the following steps . at a step 202 , the controller of the display element ( hdd , hud , hmd , hwd ) detects a near - stall or stall condition of the aircraft . for example , the controller may determine a stall based on the aircraft angle of attack ( aoa ) or based on the aircraft configuration ( e . g ., the detected state of aircraft flaps , gear , or other internal and external components ). the controller may be coupled to a stall warning system , which may be used as a basis for determining stall or near - stall conditions . at a step 204 , the controller determines whether the aircraft autopilot or autothrottle system is active . at a step 206 , the display element displays a stall warning symbol . the stall warning may include auditory alerts or warnings generated by the display element . at a step 208 , the display element displays an annunciator corresponding to the active status of the autopilot or autothrottle . at a step 210 , the display element displays pitch correction and roll correction symbols . for example , the display element may display a sar corresponding to a target pitch attitude associated with stall recovery , and a src indicating the desired direction of pitch correction for achieving the target pitch attitude . the sar may indicate the target roll attitude as well as the target pitch attitude . the display element may display additional symbology to guide the pilot toward the target pitch and roll attitudes . the displayed symbology may be accompanied by auditory alerts . at a step 212 , the controller detects a change in the aircraft pitch attitude ( aoa ) or a change in the aircraft roll attitude . at a step 214 , the controller modifies the pitch correction symbology or the roll correction symbology displayed by the display element in response to the detected change in pitch attitude / aoa or the detected change in roll attitude . for example , the controller may remove the src if the aircraft has achieved level flight , and display stall thrust recovery symbology to provide the pilot with thrust correction guidance . referring now to fig3 b , the method 200 may include additional steps 216 and 218 . at the step 216 , the controller detects a change in airspeed or thrust of the aircraft . at the step 218 , the controller modifies the thrust correction symbology displayed by the display element in response to the detected change in airspeed or thrust . as will be appreciated from the above , systems and methods according to embodiments of the inventive concepts disclosed herein may provide enhanced situational awareness and simplified guidance for quickly and efficiently taking steps to recover aircraft of all sizes and configurations from stall or near - stall conditions . stall recovery symbology may provide pilots with clear guidance through the stall recovery process , reducing the possibility that the urgency of a stall condition may inadvertently lead to counterproductive actions . it is to be understood that embodiments of the methods according to the inventive concepts disclosed herein may include one or more of the steps described herein . further , such steps may be carried out in any desired order and two or more of the steps may be carried out simultaneously with one another . two or more of the steps disclosed herein may be combined in a single step , and in some embodiments , one or more of the steps may be carried out as two or more sub - steps . further , other steps or sub - steps may be carried out in addition to , or as substitutes to one or more of the steps disclosed herein . from the above description , it is clear that the inventive concepts disclosed herein are well adapted to carry out the objectives and to attain the advantages mentioned herein as well as those inherent in the inventive concepts disclosed herein . while presently preferred embodiments of the inventive concepts disclosed herein have been described for purposes of this disclosure , it will be understood that numerous changes may be made which will readily suggest themselves to those skilled in the art and which are accomplished within the broad scope and coverage of the inventive concepts disclosed and claimed herein . | 1 |
the amines of the instant invention are compounds of formulas 1 , 1c , 1f , 1g , and 1h and the pharmaceutically acceptable salts thereof . z 1 to z 4 are each independently selected from hydrogen and methyl ; in formula 1 above r cannot be sulfonic acid when m is 2 and n is 1 . ( suman - chaulan n ., et al ., european journal of pharmacology , 1993 ; 244 : 293 - 301 .) since amino acids are amphoteric , pharmacologically compatible salts can be salts of appropriate inorganic or organic acids , for example , hydrochloric , sulphuric , phosphoric , acetic , oxalic , lactic , citric , malic , salicylic , malonic , maleic , succinic , methanesulfonic acid , and ascorbic . starting from corresponding hydroxides or carbonates , salts with alkali metals or alkaline earth metals , for example , sodium , potassium , magnesium , or calcium are formed . salts with quaternary ammonium ions can also be prepared with , for example , the tetramethyl - ammonium ion . the carboxyl group of the amino acids can be esterified by known means . certain of the compounds of the present invention can exist in unsolvated forms as well as solvated forms , including hydrated forms . in general , the solvated forms , including hydrated forms , are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present invention . novel intermediates useful in the preparation of the final compounds are included in the invention . the terms used to define the invention are as described below . sulfonamides are those of formula — nhso 2 r 15 or — so 2 nhr 15 wherein r 15 is a straight or branched alkyl group of from 1 to 6 carbons or a trifluoromethyl . amides are compounds of formula — nhcor 12 wherein r 12 is straight or branched alkyl of from 1 to 6 carbons , benzyl , and phenyl . heterocycles are groups of from 1 to 2 rings , with from 1 to 6 heteroatoms selected from oxygen , nitrogen , and sulfur . the term alkyl is a straight or branched group of from 1 to 11 carbon atoms including but not limited to methyl , ethyl , propyl , n - propyl , isopropyl , butyl , 2 - butyl , tert - butyl , pentyl , hexyl , and n - hexyl , heptyl , octyl , nonyl , decyl , and undecyl except as where otherwise stated . the cycloalkyl groups are from 3 to 8 carbons and are cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl , cycloheptyl , and cyclooctyl unless otherwise stated . the benzyl and phenyl groups may be unsubstituted or substituted by from 1 to 3 substituents selected from hydroxy , carboxy , carboalkoxy , halogen , cf 3 , nitro , alkyl , and alkoxy . preferred are halogens . carboalkoxy is — cooalkyl wherein alkyl is as described above . preferred are carbomethoxy and carboethoxy . certain of the compounds of the present invention can exist in unsolvated forms as well as solvated forms , including hydrated forms . in general , the solvated forms , including hydrated forms , are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present invention . certain of the compounds of the present invention possess one or more chiral centers and each center may exist in the r ( d ) or s ( l ) configuration . the present invention includes all enantiomeric and epimeric forms as well as the appropriate mixtures thereof . the radioligand binding assay using [ 3 h ] gabapentin and the α 2 δ subunit derived from porcine brain tissue was used (“ the novel anti - convulsant drug , gabapentin , binds to the a 2 δ subunit of a calcium channel ”, gee n . s ., et al ., j . biol . chem ., 1996 ; 271 ( 10 ): 5768 - 5776 ). the compounds of the invention show good binding affinity to the α 2 δ subunit . gabapentin ( neurontin ®) is about 0 . 10 to 0 . 12 μm in this assay . since the compounds of the instant invention also bind to the subunit , they are expected to exhibit pharmacologic properties comparable to gabapentin . for example , as agents for convulsions , anxiety , and pain . 3 -( 1 - aminomethyl - cyclohexylmethyl )- 4h -[ 1 , 2 , 4 ] oxadiazol - 5 - one ; hydrochloride was active in the carrageenan induced hyperalgesia assay . when dosed at 30 mg / kg orally in the rat , the compound increased paw withdrawal latency by 80 . 6 % at 1 hour and 76 % at 2 hours . by comparison , gabapentin at this dose caused a 49 . 9 % increase at 1 hour and only a 19 . 9 % increase at 2 hours . thus , the former compound appears to have an antihyperalgesic effect of longer duration than gabapentin . c -[ 1 -( 1h - tetrazol - 5 - ylmethyl )- cyclohexyl ]- methylamine hydrochloride , when tested in the dba2 audiogenic seizure model at 10 mg / kg after oral dosing , gave 60 % protection after 1 hour postdose , 100 % protection after 2 hours postdose , 100 % protection after 4 hours postdose , and 80 % after 6 hours postdose . in the same assay , gabapentin , dosed at 10 mg / kg orally , gave no significant response . at 30 mg / kg it gave 100 % protection at 2 hours postdose . the compounds of the invention are related to neurontin ®, a marketed drug effective in the treatment of epilepsy . neurontin ® is 1 -( aminomethyl )- cyclohexaneacetic acid of structural formula the compounds of the invention are also expected to be useful in the treatment of epilepsy . the present invention also relates to therapeutic use of the compounds of the mimetic as agents for neurodegenerative disorders . such neurodegenerative disorders are , for example , alzheimer &# 39 ; s disease , huntington &# 39 ; s disease , parkinson &# 39 ; s disease , amyotrophic lateral sclerosis , and epilepsy . the present invention also covers treating neurodegenerative disorders termed acute brain injury . these include but are not limited to : stroke , head trauma , and asphyxia . stroke refers to a cerebral vascular disease and may also be referred to as a cerebral vascular incident ( cva ) and includes acute thromboembolic stroke . stroke includes both focal and global ischemia . also , included are transient cerebral ischemic attacks and other cerebral vascular problems accompanied by cerebral ischemia such as in a patient undergoing carotid endarterectomy specifically or other cerebrovascular or vascular surgical procedures in general , or diagnostic vascular procedures including cerebral angiography and the like . acute pain is usually short - lived and is associated with hyperactivity of the sympathetic nervous system . examples are postoperative pain and allodynia . chronic pain is usually defined as pain persisting from 3 to 6 months and includes somatogenic pains and psychogenic pains . other pain is nociceptive . still other pain is caused by injury or infection of peripheral sensory nerves . it includes , but is not limited to pain from peripheral nerve trauma , herpes virus infection , diabetes mellitus , causalgia , plexus avulsion , neuroma , limb amputation , and vasculitis . neuropathic pain is also caused by nerve damage from chronic alcoholism , human immunodeficiency virus infection , hypothyroidism , uremia , or vitamin deficiencies . neuropathic pain includes , but is not limited to pain caused by nerve injury such as , for example , the pain diabetics suffer from . psychogenic pain is that which occurs without an organic origin such as low back pain , atypical facial pain , and chronic headache . other types of pain are : inflammatory pain , osteoarthritic pain , trigeminal neuralgia , cancer pain , diabetic neuropathy , restless leg syndrome , acute herpetic and postherpetic neuralgia , causalgia , brachial plexus avulsion , occipital neuralgia , gout , phantom limb , burn , and other forms of neuralgia , neuropathic and idiopathic pain syndrome . other incidents are head trauma , spinal cord trauma , or injury from general anoxia , hypoxia , hypoglycemia , and hypotension as well as similar injuries seen during procedures from embole , hyperfusion , and hypoxia . the compounds of the instant invention will be useful in gastrointestinal disorders , for example , irritable bowel syndrome ( ibs ). the instant invention would be useful in a range of incidents , for example , during cardiac bypass surgery , in incidents of intracranial hemorrhage , in perinatal asphyxia , in cardiac arrest , and status epilepticus . a skilled physician will be able to determine the appropriate situation in which subjects are susceptible to or at risk of , for example , stroke as well as suffering from stroke for administration by methods of the present invention . the compounds of the invention are also expected to be useful in the treatment of depression . depression can be the result of organic disease , secondary to stress associated with personal loss , or idiopathic in origin . there is a strong tendency for familial occurrence of some forms of depression suggesting a mechanistic cause for at least some forms of depression . the diagnosis of depression is made primarily by quantification of alterations in patients &# 39 ; mood . these evaluations of mood are generally performed by a physician or quantified by a neuropsychologist using validated rating scales , such as the hamilton depression rating scale or the brief psychiatric rating scale . numerous other scales have been developed to quantify and measure the degree of mood alterations in patients with depression , such as insomnia , difficulty with concentration , lack of energy , feelings of worthlessness , and guilt . the standards for diagnosis of depression as well as all psychiatric diagnoses are collected in the diagnostic and statistical manual of mental disorders ( fourth edition ) referred to as the dsm - iv - r manual published by the american psychiatric association , 1994 . gaba is an inhibitory neurotransmitter with the central nervous system . within the general context of inhibition , it seems likely that gaba - mimetics might decrease or inhibit cerebral function and might therefore slow function and decrease mood leading to depression . the compounds of the instant invention may produce an anticonvulsant effect through the increase of newly created gaba at the synaptic junction . if gabapentin does indeed increase gaba levels or the effectiveness of gaba at the synaptic junction , then it could be classified as a gaba - mimetic and might decrease or inhibit cerebral function and might , therefore , slow function and decrease mood leading to depression . the fact that a gaba agonist or gaba - mimetic might work just the opposite way by increasing mood and thus , be an antidepressant , is a new concept , different from the prevailing opinion of gaba activity heretofore . the compounds of the instant invention are also expected to be useful in the treatment of anxiety and of panic as demonstrated by means of standard pharmacological procedures . nociceptive pressure thresholds were measured in the rat paw pressure test using an analgesymeter ( randall - sellitto method : randall l . o ., sellitto j . j ., a method for measurement of analgesic activity on inflamed tissue . arch . int . pharmacodyn ., 4 : 409 - 419 ( 1957 )). male sprague - dawley rats ( 70 - 90 g ) were trained on this apparatus before the test day . pressure was gradually applied to the hind paw of each rat and nociceptive thresholds were determined as the pressure ( g ) required to elicit paw withdrawal . a cutoff point of 250 g was used to prevent any tissue damage to the paw . on the test day , two to three baseline measurements were taken before animals were administered 100 μl of 2 % carrageenin by intraplantar injection into the right hind paw . nociceptive thresholds were taken again 3 hours after carrageenin to establish that animals were exhibiting hyperalgesia . animals were dosed with either gabapentin ( 3 - 300 mg / kg , s . c . ), morphine ( 3 mg / kg , s . c . ), or saline at 3 . 5 hours after carrageenin and nociceptive thresholds were examined at 4 , 4 . 5 , and 5 hours post carrageenin . tonic seizures in mice are induced by subcutaneous administration of semicarbazide ( 750 mg / kg ). the latency to the tonic extension of forepaws is noted . any mice not convulsing within 2 . 0 hours after semicarbazide are considered protected and given a maximum latency score of 120 minutes . male hooded lister rats ( 200 - 250 g ) are obtained from interfauna ( huntingdon , uk ) and male to mice ( 20 - 25 g ) are obtained from bantin and kingman ( hull , uk ). both rodent species are housed in groups of six . ten common marmosets ( callithrix jacchus ) weighing between 280 and 360 g , bred at manchester university medical school ( manchester , uk ) are housed in pairs . all animals are housed under a 12 - hour light / dark cycle ( lights on at 07 . 00 hour ) and with food and water ad libitum . drugs are administered either intraperitoneally ( ip ) or subcutaneously ( sc ) 40 minutes before the test in a volume of 1 ml / kg for rats and marmosets and 10 ml / kg for mice . the apparatus is an open - topped box , 45 cm long , 27 cm wide , and 27 cm high , divided into a small ( 2 / 5 ) and a large ( 3 / 5 ) area by a partition that extended 20 cm above the walls ( costall b ., et al ., exploration of mice in a black and white box : validation as a model of anxiety . pharmacol . biochem . behav ., 32 : 777 - 785 ( 1989 )). there is a 7 . 5 × 7 . 5 cm opening in the center of the partition at floor level . the small compartment is painted black and the large compartment white . the white compartment is illuminated by a 60 - w tungsten bulb . the laboratory is illuminated by red light . each mouse is tested by placing it in the center of the white area and allowing it to explore the novel environment for 5 minutes . the time spent in the illuminated side is measured ( kilfoil t ., et al ., effects of anxiolytic and anxiogenic drugs on exploratory activity in a simple model of anxiety in mice . neuropharmacol ., 28 : 901 - 905 ( 1989 )). a standard elevated x - maze ( handley s . l ., et al ., effects of alpha - adrenoceptor agonists and antagonists in a maze - exploration model of ‘ fear ’- motivated behavior . naunyn - schiedebera &# 39 ; s arch . pharmacol ., 327 : 1 - 5 ( 1984 )), was automated as previously described ( field , et al ., automation of the rat elevated x - maze test of anxiety . br . j . pharmacol ., 102 ( suppl ): 304p ( 1991 )). the animals are placed on the center of the x - maze facing one of the open arms . for determining anxiolytic effects the entries and time spent on the end half sections of the open arms is measured during the 5 - minute test period ( costall , et al ., use of the elevated plus maze to assess anxiolytic potential in the rat . br . j . pharmacol ., 96 ( suppl ): 312p ( 1989 )). the total number of body postures exhibited by the animal towards the threat stimulus ( a human standing approximately 0 . 5 m away from the marmoset cage and staring into the eyes of the marmoset ) is recorded during the 2 - minute test period . the body postures scored are slit stares , tail postures , scent marking of the cage / perches , piloerection , retreats , and arching of the back . each animal is exposed to the threat stimulus twice on the test day before and after drug treatment . the difference between the two scores is analyzed using one - way analysis of variance followed by dunnett &# 39 ; s t - test . all drug treatments are carried out sc at least 2 hours after the first ( control ) threat . the pretreatment time for each compound is 40 minutes . rats are trained to press levers for food reward in operant chambers . the schedule consists of alternations of four 4 - minute unpunished periods on variable interval of 30 seconds signaled by chamber lights on and three 3 - minute punished periods on fixed ratio 5 ( by footshock concomitant to food delivery ) signaled by chamber lights off . the degree of footshock is adjusted for each rat to obtain approximately 80 % to 90 % suppression of responding in comparison with unpunished responding . rats receive saline vehicle on training days . the compounds of the instant invention are also expected to be useful in the treatment of pain and phobic disorders ( am . j . pain manag ., 5 : 7 - 9 ( 1995 )). the compounds of the instant invention are also expected to be useful in treating the symptoms of manic , acute or chronic , single upside , or recurring depression . they are also expected to be useful in treating and / or preventing bipolar disorder ( u . s . pat . no . 5 , 510 , 381 ). injections of trinitrobenzene sulfonic ( tnbs ) into the colon have been found to induce chronic colitis . in human , digestive disorders are often associated with visceral pain . in these pathologies , the visceral pain threshold is decreased indicating a visceral hypersensitivity . consequently , this study was designed to evaluate the effect of injection of tnbs into the colon on visceral pain threshold in a experimental model of colonic distension . male sprague - dawley rats ( janvier , le genest - st - ilse , france ) weighing 340 - 400 g are used . the animals are housed 3 per cage in a regulated environment ( 20 ± 1 ° c ., 50 ± 5 % humidity , with light 8 : 00 am to 8 : 00 pm ). under anesthesia ( ketamine 80 mg / kg i . p ; acepromazin 12 mg / kg ip ), the injection of tnbs ( 50 mg / kg ) or saline ( 1 . 5 ml / kg ) is performed into the proximal colon ( 1 cm from the cecum ). after the surgery , animals are individually housed in polypropylene cages and kept in a regulated environment ( 20 ± 1 ° c ., 50 ± 5 % humidity , with light 8 : 00 am to 8 : 00 pm ) during 7 days . at day 7 after tnbs administration , a balloon ( 5 - 6 cm length ) is inserted by anus and kept in position ( tip of balloon 5 cm from the anus ) by taping the catheter to the base of the tail . the balloon is progressively inflated by step of 5 mm hg , from 0 to 75 mm hg , each step of inflation lasting 30 seconds . each cycle of colonic distension is controlled by a standard barostat ( abs , st - dié , france ). the threshold corresponds to the pressure which produced the first abdominal contraction and the cycle of distension is then discontinued . the colonic threshold ( pressure expressed in mm hg ) is determined after performance of four cycles of distension on the same animal . data is analyzed by comparing test compound - treated group with tnbs - treated group and control group . mean and sem are calculated for each group . the antiallodynic activity of the compound is calculated as follows : group a : mean of the colonic threshold in the test compound - treated group statistical significance between each group was determined by using a one - way anova followed by student &# 39 ; s unpaired t - test . differences were considered statistically significant at p & lt ; 0 . 05 . tnbs is dissolved in etoh 30 % and injected under a volume of 0 . 5 ml / rat . tnbs is purchased from fluka . oral administration of the test compound or its vehicle is performed 1 hour before the colonic distension cycle . sub - cutaneous administration of the test compound or its vehicle is performed 30 minutes before the colonic distension cycle . the compounds of the present invention can be prepared and administered in a wide variety of oral and parenteral dosage forms . thus , the compounds of the present invention can be administered by injection , that is , intravenously , intramuscularly , intracutaneously , subcutaneously , intraduodenally , or intraperitoneally . also , the compounds of the present invention can be administered by inhalation , for example , intranasally . additionally , the compounds of the present invention can be administered transdermally . it will be obvious to those skilled in the art that the following dosage forms may comprise as the active component , either a compound of formula i or a corresponding pharmaceutically acceptable salt of a compound of formula i . for preparing pharmaceutical compositions from the compounds of the present invention , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , pills , capsules , cachets , suppositories , and dispersible granules . a solid carrier can be one or more substances which may also act as diluents , flavoring agents , binders , preservatives , tablet disintegrating agents , or an encapsulating material . in powders , the carrier is a finely divided solid which is in a mixture with the finely divided active component . in tablets , the active component is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired . the powders and tablets preferably contain from five or ten to about seventy percent of the active compound . suitable carriers are magnesium carbonate , magnesium stearate , talc , sugar , lactose , pectin , dextrin , starch , gelatin , tragacanth , methylcellulose , sodium carboxymethylcellulose , a low melting wax , cocoa butter , and the like . the term “ preparation ” is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers , is surrounded by a carrier , which is thus in association with it . similarly , cachets and lozenges are included . tablets , powders , capsules , pills , cachets , and lozenges can be used as solid dosage forms suitable for oral administration . for preparing suppositories , a low melting wax , such as a mixture of fatty acid glycerides or cocoa butter , is first melted and the active component is dispersed homogeneously therein , as by stirring . the molten homogenous mixture is then poured into convenient sized molds , allowed to cool , and thereby to solidify . liquid form preparations include solutions , suspensions , and emulsions , for example , water or water propylene glycol solutions . for parenteral injection liquid preparations can be formulated in solution in aqueous polyethylene glycol solution . aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants , flavors , stabilizing and thickening agents as desired . aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material , such as natural or synthetic gums , resins , methylcellulose , sodium carboxymethylcellulose , and other well - known suspending agents . also included are solid form preparations which are intended to be converted , shortly before use , to liquid form preparations for oral administration . such liquid forms include solutions , suspensions , and emulsions . these preparations may contain , in addition to the active component , colorants , flavors , stabilizers , buffers , artificial and natural sweeteners , dispersants , thickeners , solubilizing agents , and the like . the pharmaceutical preparation is preferably in unit dosage form . in such form the preparation is subdivided into unit doses containing appropriate quantities of the active component . the unit dosage form can be a packaged preparation , the package containing discrete quantities of preparation , such as packeted tablets , capsules , and powders in vials or ampoules . also , the unit dosage form can be a capsule , tablet , cachet , or lozenge itself , or it can be the appropriate number of any of these in packaged form . the quantity of active component in a unit dose preparation may be varied or adjusted from 0 . 1 mg to 1 g according to the particular application and the potency of the active component . in medical use the drug may be administered three times daily as , for example , capsules of 100 or 300 mg . the composition can , if desired , also contain other compatible therapeutic agents . in therapeutic use , the compounds utilized in the pharmaceutical method of this invention are administered at the initial dosage of about 0 . 01 mg to about 100 mg / kg daily . a daily dose range of about 0 . 01 mg to about 100 mg / kg is preferred . the dosages , however , may be varied depending upon the requirements of the patient , the severity of the condition being treated , and the compound being employed . determination of the proper dosage for a particular situation is within the skill of the art . generally , treatment is initiated with smaller dosages which are less than the optimum dose of the compound . thereafter , the dosage is increased by small increments until the optimum effect under the circumstances is reached . for convenience , the total daily dosage may be divided and administered in portions during the day , if desired . sulfonamides of the instant invention can be synthesized by the general route outlined in scheme 1 . tetrazoles can be synthesized by the general route outlined in scheme 2 . amides can be synthesized by the general route outlined in scheme 3 . can be synthesized by the general route outlined in scheme 4 . compound 1 [( 1 - nitromethyl - cyclohexyl ) acetonitrile ] can be treated with hydroxylamine hydrochloride in the presence of a base such as triethylamine to give compound 2 . the heterocyclic compound 3 can be prepared from compound 2 by treatment with iso - butyl chloroformate in the presence of a base such as pyridine followed by reflux in a solvent such as xylene . the nitro compound ( compound 3 ) can be converted to the required amine by reduction , for example , with iron and hydrochloric acid . can be synthesized by the general route outlined in scheme 5a . can be synthesized by the general route outlined in scheme 5b . can be synthesized by the general route shown in scheme 6 below : compound 1 [( nitromethyl - cyclohexyl ) acetonitrile ] can be treated with hydroxylamine hydrochloride in the presence of a base such as triethylamine to give compound 2 . the heterocyclic compound 3 can be prepared from compound 2 by treatment with 1 , 1 ′- thiocarbonyldiimidazole followed by a base such as 1 , 8 - diazabicyclo -[ 4 , 5 , 0 ]- undec - 7 - ene ( dbu ) or 1 , 5 - diazabicyclo [ 2 . 2 . 2 ] octane ] ( dbn ). the nitro compound ( compound 3 ) can be converted to the required amine by reduction , for example , with iron and hydrochloric acid . can be synthesized following the general route as shown in scheme 7 . compound 1 [( nitromethyl - cyclohexyl ) acetonitrile ] can be treated with hydroxylamine hydrochloride in the presence of a base such as triethylamine to give compound 2 . the heterocyclic compound 3 can be prepared from compound 2 by treatment with 1 , 1 ′- thiocarbonyldiimidazole followed by treatment with silica gel or boron trifluoride etherate . the nitro compound ( compound 3 ) can be converted to the required amine by reduction , for example , with iron and hydrochloric acid . can be synthesized following the general route outlined in scheme 8 : compound 1 [( nitromethyl - cyclohexyl ) acetonitrile ] can be treated with hydroxylamine hydrochloride in the presence of a base such as triethylamine to give compound 2 . the heterocyclic compound 3 can be prepared from compound 2 by treatment with thionyl chloride in the presence of a base such as pyridine . the nitro compound ( compound 3 ) can be converted to the required amine by reduction , for example , with iron and hydrochloric acid . the following examples are illustrative of the instant invention ; they are not intended to limit the scope . sodium hydride ( 60 % in oil , 0 . 80 g , 20 mmol ) was suspended in 50 ml tetrahydrofuran and chilled in ice under nitrogen . diethylcyanomethyl phosphonate ( 3 . 85 g , 22 mmol ) was added dropwise in 10 ml tetrahydrofuran and stirring continued for 15 minutes to give a clear solution . cyclohexanone ( 1 . 90 g , 19 mol ) was added in 5 ml tetrahydrofuran and the reaction mixture allowed to warm up to room temperature . the liquor was decanted and the residue washed three times with ether . the liquor and washings were combined , washed with dilute hydrochloric acid and water , dried over magnesium sulphate , filtered , and evaporated to dryness . the residue was purified by chromatography on silica eluting with heptane / ethyl acetate 4 : 1 to give the required product as a colorless oil ( 1 . 5 g . 67 %). 1 h nmr 400 mhz ( cdcl 3 ): δ1 . 50 ( m , 6h ), 2 . 25 ( t , j = 5 . 6hz , 2h ), 2 . 49 ( t , j = 6 . 8hz , 2h ), 5 . 04 ( s , 1h ). the nitrile ( compound 2 , 0 . 78 g , 6 . 44 mmol ), nitromethane ( 0 . 80 g , 13 . 11 mmol ) and tetrabutyl ammonium fluoride ( 1 . 0 m in tetrahydrofuran , 10 ml , 10 mmol ) were heated in 20 ml tetrahydrofuran to 70 ° c overnight . the reaction mixture was diluted with ethyl acetate and washed with dilute hydrochloric acid and water , dried over magnesium sulphate , filtered , and evaporated to dryness . the residue was purified by chromatography on silica eluting with heptane / ethyl acetate 3 : 1 to give the required product as a yellow oil ( 0 . 83 g , 71 %). 1 h nmr 400 mhz ( cdcl 3 ): δ1 . 57 ( s , 10h ), 2 . 63 ( s , 2h ), 4 . 52 ( s , 2h ). analysis calculated for c 9 h 13 n 2 o 2 : c , 59 . 32 ; h , 7 . 74 ; n , 15 . 37 . borane methyl sulphide ( 2 . 0 m in toluene , 1 . 3 ml , 2 . 6 mmol ) was added to compound 3 ( 0 . 4 g , 2 . 2 mmol ) in toluene ( 10 ml ) under nitrogen . after heating to 60 ° c . for 3 hours , the mixture was allowed to cool , and 15 ml methanol was added followed by 15 ml 4 m hcl in dioxan . after reflux for 1 hour , the mixture was evaporated to dryness . crystallization from ethyl acetate gave the required product as colorless crystals ( 0 . 23 g , 47 %); mp 170 - 173 ° c . 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 30 - 1 . 50 ( m , 10h ), 1 . 64 - 1 . 69 ( m , 2h ), 2 . 82 - 2 . 86 ( m , 2h ), 4 . 57 ( s , 2h ), 7 . 89 ( s , 3h ). analysis calculated for c 9 h 18 n 2 o 2 . hcl . 0 . 2h 2 o ; c , 47 . 77 ; h , 8 . 64 ; n , 12 . 38 . triethylamine ( 0 . 64 g , 6 . 3 mmol ) was added dropwise to a mixture of the amine hydrochloride salt ( compound 4 , 0 . 70 g , 3 . 1 mmol ) and methane sulfonyl chloride ( 0 . 36 g , 6 . 3 mmol ) in tetrahydrofuran ( 35 nl ). after stirring at room temperature for 2 hours , the mixture was filtered , diluted with ethyl acetate , and washed with dilute hydrochloric acid , saturated sodium bicarbonate solution , and water , dried over magnesium sulphate , filtered , and evaporated to dryness . the residue was crystallized from ethyl acetate / heptane to give colorless crystals ( 0 . 39 g , 47 %); mp 86 - 88 ° c . 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 35 - 1 . 50 ( m , 10h ), 1 . 55 - 1 . 60 ( m , 2h ), 2 . 89 ( s , 3h ), 2 . 99 - 3 . 06 ( m , 2h ), 4 . 55 ( s , 2h ), 6 . 93 ( t , j = 6hz , 1h ). analysis calculated for c 10 h 20 n 2 o 4 s : c , 45 . 44 ; h , 7 . 63 ; n , 10 . 60 ; s , 12 . 13 . ten percent palladium on carbon was added under nitrogen to a solution of compound 5 ( 0 . 35 g , 1 . 3 mmol ) in methanol ( 50 ml ). the mixture was shaken under 40 psi hydrogen for 6 hours and then filtered through keiselguhr . the filtrate was evaporated to dryness . 4n hcl in dioxan was added followed by ether to give the product as a colorless crystalline solid ( 0 . 33 g , 92 %); mp 196 - 199 ° c . 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 25 - 1 . 45 ( m , 10h ), 1 . 55 - 1 . 60 ( m , 5h ), 2 . 70 - 2 . 75 ( m , 2h ), 2 . 90 - 2 . 95 ( m , 5h ), 6 . 86 ( t , j = 6 . 0hz , 1h ), 7 . 86 ( bs , 3 ). analysis calculated for c 10 h 22 n 2 o 2 s . hcl . 0 . 25h 2 o : c , 43 . 63 ; h , 8 . 60 ; n , 10 . 17 . to a soluton of the bis nitrile ( griffiths g ., mettler h ., mills l . s ., and previdoli f ., helv . chim . acta , 74 : 309 ( 1991 )) ( 1 . 48 g , 10 mmol ) in toluene ( 20 ml ) under nitrogen was added trimethylsilylazide ( 1 . 15 g , 10 mmol ) followed by trimethylaluminium ( 5 ml , 2 . 0 m in hexanes , 10 mmol ). after heating to 90 ° c . overnight , the mixture was allowed to cool and added carefully to ethyl acetate , ice and 6n hydrochloric acid . the aqueous phase was extracted with ethyl acetate , and the extracts washed with water , dried over magnesium sulphate , and evaporated to dryness . crystallization gave the required compound ( 158 mg , 8 %). the tetrazole ( compound 8 , 158 mg , 0 . 83 mmol ) in methanol was added to a washed suspension of raney nickel in methanol . the mixture was shaken under 40 psi hydrogen for 3 . 5 hours and then filtered to remove the catalyst and evaporated to dryness . the residue was partitioned between ethyl acetate and dilute hydrochloric acid . the aqueous phase was separated and evaporated to dryness . recrystallization from methanol / ether gave the required product ( 44 mg , 23 %); mp 176 - 179 ° c . 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 20 - 1 . 60 ( m , 10h ), 2 . 84 ( s , 2h ), 3 . 07 ( s , 2h ), 8 . 06 ( bs , 3h ). sodium hydride ( 60 % in oil , 0 . 80 g , 20 mmol ) was suspended in 50 ml tetrahydrofuran and chilled in ice under nitrogen . diethylcyanomethyl phosphonate ( 3 . 85 g , 22 mmol ) was added dropwise in 10 ml tetrahydrofuran and stirring continued for 15 minutes to give a clear solution . cyclohexanone ( 1 . 90 g , 19 mmol ) was added in 5 ml tetrahydrofuran and the reaction mixture allowed to warm up to room temperature . the liquor was decanted and the residue washed three times with ether . the liquor and washings were combined , washed with dilute hydrochloric acid and water , dried over magnesium sulphate , filtered , and evaporated to dryness . the residue was purified by chromatography on silica eluting with heptane / ethyl acetate 4 : 1 to give the required product as a colorless oil ( 1 . 5 g , 67 %). 1h nmr 400 mhz ( cdcl 3 ): δ1 . 50 ( m , 6h ), 2 . 25 ( t , j = 5 . 6 hz , 2h ), 2 . 49 ( t , j = 6 . 8 hz , 2h ), 5 . 04 ( s , 1h ). the nitrile ( compound 2 , 0 . 78 g , 6 . 44 mmol ), nitromethane ( 0 . 80 g , 13 . 11 mmol ) and tetrabutyl ammonium fluoride ( 1 . 0 m in tetrahydrofuran , 10 ml , 10 mmol ) were heated in 20 ml tetrahydrofuran to 70 ° c . overnight . the reaction mixture was diluted with ethyl acetate and washed with dilute hydrochloric acid and water , dried over magnesium sulphate , filtered , and evaporated to dryness . the residue was purified by chromatography on silica eluting with heptane / ethyl acetate 3 : 1 to give the required product as a yellow oil ( 0 . 83 g , 71 %). 1 h nmr 400 mhz ( cdcl 3 ): δ1 . 57 ( s , 10h ), 2 . 63 ( s , 2h ), 4 . 52 ( s , 2h ). analysis calculated for c 9 h 13 n 2 o 2 : c , 59 . 32 ; h , 7 . 74 ; n , 15 . 37 . borane methyl sulphide ( 2 . 0 m in toluene , 1 . 3 ml , 2 . 6 mmol ) was added to compound 3 ( 0 . 4 g , 2 . 2 mmol ) in toluene ( 10 ml ) under nitrogen . after heating to 60 ° c . for 3 hours , the mixture was allowed to cool , and 15 ml methanol was added followed by 15 ml 4 m hcl in dioxan . after reflux for 1 hour , the mixture was evaporated to dryness . crystallization from ethyl acetate gave the required product as colorless crystals ( 0 . 23 g , 47 %); mp 170 - 173 ° c . 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 30 - 1 . 50 ( m , 10h ), 1 . 64 - 1 . 69 ( m , 2h ), 2 . 82 - 2 . 86 ( m , 2h ), 4 . 57 ( s , 2h ), 7 . 89 ( s , 3h ). analysis calculated for c 9 h 18 n 2 o 2 . hcl . 0 . 2h 2 o : c , 47 . 77 ; h , 8 . 64 ; n , 12 . 38 . the amine hydrochloride salt ( compound 4 , 0 . 50 g , 2 . 25 mmol ) was reacted with acetyl chloride ( 0 . 20 g , 2 . 55 mmol ) and triethylamine ( 0 . 45 g , 4 . 45 mmol ) in tetrahydrofuran following the procedure described in example 1 , step 4 . purification by chromatography on silica eluting with ethyl acetate gave the required product as a crystalline solid ( 0 . 35 g , 69 %); mp 68 - 70 ° c . 1 h nmr 400 mhz ( cdcl 3 ): δ1 . 40 - 1 . 60 ( m , 10h ), 1 . 60 - 1 . 65 ( m , 2h ), 1 . 98 ( s , 3h ), 3 . 30 - 3 . 40 ( m , 2h ), 4 . 40 ( s , 2h ), 5 . 59 ( bs , 1h ). compound 5 ( 0 . 30 g , 1 . 3 mmol ) was hydrogenated in the presence of 10 % palladium on carbon following the procedure described in example 1 , step 5 to give the product as the hydrochloride salt ( 0 . 35 g , 100 %). 1 h nmr 400 mhz ( d 6 - dmso ): δ1 . 20 - 1 . 40 ( m , 10h ), 1 . 40 - 1 . 50 ( m , 2h ), 1 . 81 ( s , 3h ), 2 . 75 ( q , j = 6 . 0hz , 2h ), 2 . 95 - 3 . 05 ( m , 2h ), 7 . 99 ( bs , 3h ), 8 . 06 ( t , j = 4 . 8 hz , 1h ). a solution of gabapentin ( 1 ) ( 9 . 37g , 0 . 0547 mol ) in 125 ml 1n naoh and 50 ml thf was cooled to 0 ° c . and a solution of di - tert - butyl dicarbonate ( 13 . 1 g , 0 . 06 mol ) in 200 ml thf was slowly added . the reaction mixture was stirred at room temperature 2 hours and concentrated on a rotary evaporator to remove thf . the concentrate was saturated with kh 2 po 4 and extracted 3 × etoac . the etoac extracts were washed 2 × brine and dried over mgso4 . evaporation yielded 14 . 8 g ( 100 %) white solid , mp 109 - 111 ° c . 1 hnmr ( cdcl 3 ) δ1 . 2 - 1 . 4 ( m , 19h ), 2 . 27 ( s , 2h ), 3 . 11 ( d , 2h , j = 6 . 84 hz ), 4 . 95 ( broad , 1h ). analysis calculated for c 14 h 25 no 4 : c , 61 . 97 ; h , 9 . 29 ; n , 5 . 16 . [ 1 -( tert - butoxycarbonylamino - methyl )- cyclohexyl ]- acetic acid ( 2 ) ( 152 g , 0 . 56 mdl ) was taken up in 1 l thf and triethylamine ( 66 . 2 g , 0 . 65 mol ) and cooled to − 10 ° c . over a 1 - hour period , isobutyraldehyde was added ( 84 . 7 g , 0 . 62 mol ), and the heterogeneous mixture was stirred at 0 ° c . for 15 minutes . ammonia gas was bubbled into the cold reaction mixture for 30 minutes , and the mixture was allowed to warm to room temperature . after 16 hours stirring , the reaction mixture was evaporated to dryness on a rotary evaporator , and the residue was taken up in water , extracted 3 × etoac , washed 2 × brine and dried over mgso 4 . evaporation yielded an oil which was crystallized from pentane to yield 116 . 5 g ( 77 %) white crystals , mp 123 - 125 ° c . 1 hnmr ( cdcl 3 ) δ1 . 2 - 1 . 6 ( m , 19h ), 2 . 12 ( s , 2h ), 3 . 13 ( d , 2h , j = 7 . 08hz ), 4 . 97 ( s , 1h ), 5 . 43 ( s , 1h ), 7 . 34 ( s , 1h ). analysis calculated for c 14 h 26 n 2 o 3 : c , 62 . 19 ; h , 9 . 69 ; n , 10 . 36 . cyanuric chloride ( 39 . 5 g , 0 . 214 mol ) was added to ( 1 - carbamoylmethyl - cyclohexylmethyl )- carbamic acid tert - butyl ester ( 3 ) ( 116 g , 0 . 429 mol ) in 400 ml dmf . an ice - water bath was used to moderate the exotherm , and the reaction mixture was stirred at room temperature for 1 . 5 hours . the mixture was poured into ice - water containing 120 g ( 1 . 43 mol ) nahco 3 and was extracted 4 × etoac . the extracts were washed 1 × water , 2 × brine and dried over na 2 so 4 . evaporation yielded an oil which was taken up in 3 : 1 hexane / etoac and filtered through silica gel . evaporation yielded white crystals ( 86 . 5 g , 80 %); mp 54 - 58 ° c . 1 hnmr ( cdcl 3 ) δ1 . 3 - 1 . 5 ( m , 19h ), 2 . 30 ( s , 2h ), 3 . 15 ( d , 2h , j = 7 . 00 hz ), 4 . 60 ( broad , 1h ). analysis calculated for c 14 h 24 n 2 o 2 : c , 66 . 63 ; h , 9 . 59 ; n , 11 . 10 . a suspension of hydroxylamine hydrochloride ( 69 . 5 g , 1 . 00 mol ) in dmso ( 300 ml ) was cooled in ice - water , and triethylamine ( 106 . 7 g , 1 . 05 mol ) was added . the resulting exotherm brought the temperature to 20 ° c . the mixture was stirred at this temperature 15 minutes , and triethylamine hydrochloride was filtered off and washed with thf . the filtrate was concentrated to remove thf , and ( 1 - cyanomethyl - cyclohexylmethyl )- carbamic acid tert - butyl ester ( 4 ) ( 50 . 4 g , 0 . 2 mol ) was added , and the mixture was heated at 75 ° c . for 15 hours . after cooling , the reaction mixture was diluted with water ( 1 l ) and extracted 3 × etoac . the etoac extracts were washed 1 × saturated kh 2 po 4 , 1 × saturated nahco 3 , 2 × brine and dried over na 2 so 4 . evaporation yielded a gummy solid which was triturated in et 2 o to give white crystals , 25 . 2 g ( 44 %); mp 125 - 127 ° c . 1 hnmr ( cdcl 3 ) δ1 . 3 - 1 . 5 ( m 19h ), 1 . 99 ( s , 2h ), 3 . 12 ( d , 2h j = 6 . 84 hz ), 4 . 93 ( t , 1h , j = 6 . 84 hz ), 5 . 40 ( s , 1h ). analysis calculated for c 14 h 27 n 3 o 3 : c , 58 . 92 ; h , 9 . 54 ; n , 14 . 72 . a solution of [ 1 -( n - hydroxycarbamimidoylmethyl )- cyclohexylmethyl ]- carbamic acid tert - butyl ester ( 5 ) ( 25 . 1 g , 0 . 088 mol ) and pyridine ( 7 . 82 g , 0 . 099 mol ) in dmf ( 200 ml ) was cooled in ice - water as isobutyraldehyde ( 12 . 32 g , 0 . 09 mol ) was added dropwise . after 15 minutes , the bath was removed and the mixture was stirred at room temperature 2 hours , diluted with water , and extracted 3 × etoac . the extracts were washed 1 × water , 2 × brine and dried over na 2 so 4 . evaporation yielded an oil , 34 g ( 100 %) which was used without further purification . boc - gabapentin amidoxime carbamate ( 33 . 88 g , 0 . 088 mol ) was taken up in xylene ( 250 ml ) and heated under reflux 2 . 5 hours . the xylene was evaporated off and the residue taken up in et 2 o and extracted 3 × 75 ml 1n naoh . the alkaline extracts were acidified with saturated kh 2 po 4 and extracted 3 × et 2 o . the et 2 o extracts were washed 1 × saturated kh 2 po 4 , 2 × brine and dried over na 2 so 4 . evaporation yielded 17 . 9 g ( 65 %) of a cream - colored solid , mp 140 - 143 ° c . 1 hnmr ( cdcl 3 ) δ1 . 0 - 1 . 6 ( m , 19h ), 2 . 42 ( s , 2h ), 3 . 00 ( d , 2h , j = 7 . 32 hz ). 4 . 86 ( t , 1h , j = 7 . 08 hz ), 11 . 30 ( s , 1h ). analysis calculated for c 15 h 25 n 3 o 4 : c , 57 . 86 ; h , 8 . 09 ; n , 13 . 49 . a solution of boc - gabapentin oxadiazolone ( 17 . 7 g , 0 . 0568 mol ) in 4 m hcl in dioxane ( 200 ml ) was allowed to stand 1 . 5 hours . concentration to half volume followed by addition of et 2 o gave a precipitate which was filtered off and recrystallized from meoh to give white crystals ( 12 . 98 g , 92 . 7 %), mp 209 - 212 ° c . 1 hnmr ( dmso - d 6 ) δ1 . 2 - 1 . 5 ( m , 10h ), 2 . 64 ( s , 4h ), 2 . 79 ( s , 2h ), 7 . 98 ( s , 3h ), 12 . 35 ( s , 1h ). analysis calculated for c 10 h 17 n 3 o 2 . hcl : c , 48 . 49 ; h , 7 . 32 ; n , 16 . 96 ; cl , 14 . 31 . a mixture of [ 1 -( n - hydroxycarbamimidoylmethyl )- cyclohexylmethyl ]- carbamic acid tert - butyl ester ( 4 . 85 g , 0 . 017 mol ), 90 % 1 , 1 ′- thiocarbonyldiimidazole ( 3 . 96 g , 0 . 02 mol ) and dbu ( 10 . 39 g , 0 . 068 mol ) in mecn ( 150 ml ) was stirred at room temperature 19 hours . the reaction mixture was evaporated to dryness , suspended in saturated kh 2 po 4 and extracted 3 × etoac . the etoac extracts were washed 2 × saturated kh 2 po 4 , 2 × brine and dried over na 2 so 4 . evaporation followed by filtration through silica gel , eluting with 3 : 1 etoac / hexane yielded , upon evaporation , a solid which was recrystallized from et2o / hexane to give a pale pink solid , 2 . 6 g ( 47 %), mp 160 - 161 ° c . 1 hnmr ( cdcl 3 ) δ1 . 1 - 1 . 6 ( m , 19h ), 2 . 53 ( s , 2h ), 3 . 00 ( d , 2h , j = 7 . 33hz ), 4 . 90 ( t , 1h , j = 7 . 08 hz ), 12 . 88 ( s , 1h ). analysis calculated for c 15 h 25 n 3 o 3 s : c , 55 . 02 ; h , 7 . 70 ; n , 12 . 83 ; s , 9 . 79 . ( 2 . 5 g , 0 . 0076 mol ) was taken up in 4 m hcl in 1 , 4 - dioxane ( 75 ml ) and stirred at room temperature . the precipitate which formed was filtered off and recrystallized from meoh - et 2 o to yield 1 . 31 g ( 66 %) white solid , mp 210 - 212 ° c . 1 hnmr ( dmso - d 6 ) δ1 . 2 - 1 . 5 ( m , 10h ), 2 . 79 - 2 . 85 ( m , 4h ), 7 . 99 ( s , 3h ). analysis calculated for c 10 h 17 n 3 os . hcl : c , 45 . 53 ; h , 6 . 88 ; n , 15 . 93 , s , 12 . 16 ; cl , 13 . 44 . found : c , 45 . 92 ; h , 6 . 71 ; n , 15 . 83 ; s , 11 . 81 ; cl , 13 . 48 . to a solution of the bis nitrile ( ref wo 9733859 ) ( 1 . 2 g , 6 . 38 mmol ) in toluene ( 10 ml ) was added trimethylsilylazide ( 1 . 48 g , 12 . 87 mmol ) followed by dibutyl tin oxide ( 0 . 16 g , 0 . 64 mmol ). after heating to 95 ° for 3 days the mixture was diluted with ethyl acetate , washed with 1n hcl and water , dried over magnesium sulphate , and evaporated to dryness . crystallization gave the required compound ( 0 . 3 g , 20 %); mp 189 - 191 ° c . 400 mhz nmr ( d 6 - dmso ) δ1 . 50 - 1 . 70 ( m , 4h ), 1 . 75 - 2 . 10 ( m , 10h ), 3 . 48 ( s , 2h ). the tetrazole obtained in step 1 ( 0 . 60 g , 2 . 59 mmol ) in methanol ( 100 ml ) was added to a washed suspension of nickel catalyst in methanol . the mixture was shaken under 40 psi hydrogen overnight and then filtered to remove the catalyst and evaporated to dryness . the residue was dissolved in methanol and ethereal hydrogen chloride added . addition of ether and filtration gave the required product ( 0 . 19 g , 22 %). mp 232 - 236 ° c . 400 mhz nmr ( d 6 - dmso ) δ1 . 40 - 1 . 70 ( m , 8h ), 1 . 75 - 1 . 95 ( m , 4h ), 2 . 05 - 2 . 15 ( m , 2h ), 3 . 13 ( s , 2h ), 3 . 29 ( s , 2h ), 8 . 0 ( bs , 3h ). the nitrile obtained in step 3 was prepared in an analogous manner to ( 0 . 47 g , 1 . 9 mmol ) was shaken with nickel catalyst ( one spatula full , washed ) under 50 psi hydrogen overnight . filtration through kieselguhr and evaporation followed by treatment with methanol and ethereal hydrogen chloride gave the required product which was crystallized from methanol and acetonitrile ( 25 mg , 5 %); mp 250 - 252 ° c . 400 mhz nmr δ1 . 49 ( s , 2h ), 1 . 54 ( d , j = 13 . 7 hz , 2h ), 1 . 59 ( d , j = 13 . 7 hz ), 1 . 67 ( s , 2h ), 1 . 83 ( s , 1h ), 1 . 90 ( s , 1h ), 1 . 97 ( d , j = 12 . 9 hz , 2h ), 2 . 19 ( d , j = 12 . 7 hz , 2h ), 3 . 15 ( s , 2h ), 3 . 34 ( s , obscured by water ), 7 . 99 ( bs , 3h ). trans - 3 , 4 - dimethyl cyclopentanone ( 2 . 91 g , 25 . 94 mmol ), ethyl cyanoacetate ( 2 . 93 g , 25 . 93 mmol ), ammonium acetate ( 0 . 20 g , 2 . 60 mmol ), and acetic acid ( 0 . 31 g , 5 . 17 mmol ) were heated together in refluxing toluene under a dean - starck trap for 24 hours . after cooling and filtration through kieselguhr , evaporation gave the required product as an off - white solid ( 5 . 0 g , 93 %). 400 mhz nmr δ1 . 08 ( d , j = 6 . 0 hz , 3h ), 1 . 09 ( d , j = 6 . 4 hz , 3h ), 1 . 34 ( t , j = 7 . 2 hz , 3h ), 1 . 55 - 1 . 70 ( m , 2h ), 2 . 30 - 2 . 45 ( m , 2h ), 3 . 08 ( dd , j = 20 . 0 hz , 8 . 0 hz ,: 1h ), 3 . 43 ( dd , j = 20 . 0 hz , 7 . 0 hz , 1h ), 4 . 26 ( q , j = 7 . 1 hz , 2h ). mass spec es + 208 . 19 ( m + h ) + , 225 . 19 , 230 . 16 ( 100 %, ( m + na ) + ). the product from step 1 ( 5 . 0 g , 24 . 1 mmol ) was refluxed with potassium cyanide ( 1 . 57 g , 24 . 2 mmol ) in ethanol / 10 % water ( 50 ml ) overnight . evaporation to dryness and purification by chromatography eluting with ethyl acetate / heptane 1 : 1 gave the required product as a yellow oil 2 . 9 g ( 74 %). tlc rf 0 . 45 ethyl acetate / heptane 1 : 1 . 400 mhz nmr δ1 . 05 ( d , j = 8 . 4 hz , 3h ), 1 . 07 ( d , j = 8 . 8 hz , 3h ), 1 . 49 ( dd , j = 13 . 2 , 11 . 6 hz , 1h ), 1 . 60 - 1 . 70 ( m , 1h ), 1 . 75 - 1 . 90 ( m , 1h ), 1 . 96 ( dd , j = 13 . 6 , 14 . 8 hz , 1h ), 2 . 19 ( dd , j = 14 . 0 , 8 . 4 hz , 1h ), 2 . 48 ( dd , j = 13 . 2 , 6 . 4 hz , 1h ), 2 . 73 ( s , 2h ). the bis - nitrile from step 2 ( 1 . 62 g , 10 mmol ) was heated with trimethylsilyl azide ( 2 . 84 g , 24 . 7 mmol ) and di - butyl tin oxide ( 0 . 24 g , 0 . 96 mmol ) in toluene ( 50 ml ) to 100 ° c . overnight . the reaction mixture was diluted with ethyl acetate and washed with dilute hydrochloric acid and water . the solution was dried over magnesium sulphate and evaporated to dryness . purification by chromatography eluting with ethyl acetate gave the required product as a colorless oil 0 . 94 g , ( 46 %). mass spec es + 206 . 23 ( m + h ) + , 228 . 26 ( m + na ) + . 400 mhz nmr cdcl 3 δ1 . 04 ( d , j = 7 . 2 hz , 3h ), 1 . 05 ( d , j = 6 . 4 hz ), 1 . 56 ( dd , j = 11 . 6 , 1 . 6 , 11 . 6 hz , 1h ), 1 . 55 - 1 . 65 ( m , 1h ), 1 . 65 - 1 . 75 ( m , 1h ), 1 . 83 ( dd , j = 13 . 6 , 9 . 2 hz , 1h ), 2 . 27 ( dd , j = 14 . 0 , 8 . 0 hz ), 2 . 35 ( dd , j = 13 . 0 , 6 . 8 hz , 1h ), 3 . 36 ( s , 2h ). the tetrazole obtained in step 3 ( 0 . 90 g , 0 . 44 mmol ) and nickel catalyst ( one spatula full , washed ) were shaken together in methanol ( 200 ml ) overnight . the mixture was filtered through kieselguhr and evaporated to dryness . the residue was treated with methanol and ethereal hydrogen chloride and then stirred with di - tertiarybutyl dicarbonate ( 0 . 80 g , 3 . 67 mmol ) and sodium bicarbonate ( 0 . 80 g , 9 . 52 mmol ) in aqueous dioxan ( 1 : 1 , 20 ml ) overnight . the mixture was diluted with ethyl acetate and the aqueous phase separated , acidified , and extracted 3 × with ethyl acetate . the extracts were dried over magnesium sulphate , filtered and evaporated to give a colorless oil . this oil was stirred with 4 m hydrogen chloride in dioxan ( 5 ml ) overnight and then evaporated to dryness to give the required product 0 . 24 g ( 76 %). 400 mhz d 6 - dmso δ0 . 88 ( d , j = 6 . 4 hz , 3h ), 0 . 89 ( d , j = 5 . 6 hz , 3h ), 1 . 15 - 1 . 25 ( m , 3h ), 1 . 35 - 1 . 45 ( m , 1h ), 1 . 70 - 1 . 80 ( m , 2h ), 2 . 82 ( d , j = 13 . 2 hz , 1h ), 2 . 89 ( d , j = 13 . 2 hz , 1h ), 3 . 04 ( d , j = 15 . 2 hz , 1h ), 3 . 05 ( d , j = 15 . 2 hz , 1h ). elemental analysis calculated for c 10 h 19 n 5 . hcl . 0 . 5h 2 o : c , 47 . 14 ; h , 8 . 31 ; n , 27 . 49 . | 2 |
fig1 is the schematic diagram of the pulse wave application system . the pulse wave application system comprises a control unit 10 for controlling the output state of the pulse wave , and plural booths 14 respectively connected to the control unit 10 and having plural operation tables 12 ( see fig2 ) for conducting the pulse wave application . as shown in fig2 , the operation table 12 is structured in a manner that a chair 18 , on which a user 16 is seated , has a head set 20 formed in a shape of a head phone attached to the chair 18 . the head set 20 comprises an elastic bridge member 22 and a pair of electrodes 26 and 28 attached to the bridge member 22 for supplying the pulse wave outputted from the pulse wave output controlling circuit 24 ( see fig1 and 3 ), which will be described later , to the human body . the pair of electrodes 26 and 28 is structured in a manner that carbon electrode agents 26 a and 28 a are covered with sponges 30 containing an application solution , and the entire shape of each electrode is a thin disk . this pair of electrode 26 and 28 is directly put on both ears when the user 16 puts the bridge member 22 on his / her head . a wire 32 to the pair of electrodes 26 and 28 is connected to the control unit 10 ( see fig1 ) either directly or through the inside of the chair 18 . various sensors ( not shown in the drawing ) for detecting the user &# 39 ; s heart rate , pulse , blood pressure , brain wave , and so forth may be mounted on the operation table 12 . the detection results by the sensors may be inputted in the control unit 10 so as to be collectively managed and used as one of the parameters for determining the output state of the pulse wave for medical treatment . the plural booths 14 ( see fig1 ) are designed in a manner that different pulse waves can be outputted from the pairs of electrodes 26 and 28 for each unit . users are divided into groups of those receiving the pulse waves of the same condition , and sorted out into respective booths 14 . accordingly , it is possible to conduct the simultaneous treatments ( supply of the pulse waves ) for a plurality of users . fig3 shows the pulse wave output controlling circuit 24 , which functions as the pulse wave output controlling unit which is the main control of the control unit 10 . a power supply circuit 34 , which is activated by a general commercial power supply ( alternate current 100v , 50 / 60 hz ), outputs respectively different d - c voltages v 1 , v 2 and v 3 . a power line 36 of v 1 is connected to a switching circuit 38 . this switching circuit 38 serves to control the on / off switching of a pulse signal from a cr oscillator ( op amplifier ) 40 . the cr circuit 40 can output pulse waves of different frequencies depending on changes of contained resistance values . the cr oscillator is connected to a ring counter 42 . although fig3 shows an example of the scale - of - 4 counter , it is also possible to apply a scale - of - n counter . the ring counter 42 of the scale - of - 4 counter is operated by a clock signal ( clk ) from a clock circuit 44 , which signal is inputted after the system is turned on . the ring counter 42 can take out four kinds of outputs ( a to d ). the clock signal ( clk ) outputted from the clock circuit 44 is reset by a signal d of the ring counter or by a reset signal ( res ) from a one - shot circuit 46 . the reset signal ( res ) from the one - shot circuit 46 is inputted into a flip - flop circuit ( f / f ) 48 , and an output signal of the f / f circuit 48 is reversed every time the reset signal is inputted . the output signal of the f / f circuit 48 is inputted in a relay contact 52 , in which an output signal from the switching circuit 38 is inputted through a constant - current circuit ( fet ) 50 . the relay circuit 52 is connected with a power line 54 of direct current v 2 from the power supply circuit 36 . the polarity of the pulse wave is reversed by the signal from the f / f circuit 48 to be output to the pair of electrodes 26 and 28 . in other words , the pulse wave output controlling circuit 24 generates four kinds of pulse waves , polarities of which can be respectively reversed . combination of the pulse waves may be different among users 16 . for example , there are cases in which the combination of the pulse waves is made different by switching the frequencies of the pulse waves at certain intervals , or applying pulse waves of different frequencies alternately , or repeating a switching pattern of the polarities of the pulse waves . moreover , it is also possible to change a pulse width and pulse amplitude accordingly . the working of the present embodiment will be explained with reference to the timing chart in fig4 . when the power supply circuit 34 is turned on , the clock signal ( clk ) is outputted from the clock circuit 44 , thereby operating the scale - of - 4 ring counter 42 . by this operation of the scale - of - 4 ring counter 42 , four kinds of outputs are taken and sent to the cr oscillator 40 . accordingly , the resistance value changes in the cr oscillator and four kinds of frequencies are generated . the four kinds of frequencies are outputted to the switching circuit 38 in a specified order on the basis of a predetermined pattern , and the on / off control is conducted . then , at the constant current circuit 50 , the currents of the frequencies are controlled to be constant , and then sent to the relay circuit 52 . the relay circuit 52 conducts the on / off control of the output of the direct current v 2 from the power line 54 on the basis of the inputted frequencies and the output from the relay circuit 52 is sent to the pair of electrodes 26 and 28 . when the ring counter 42 makes one turn , the reset signal ( res ) is outputted from the one - shot circuit 46 . this reset signal ( res ) resets the clock signal , operates the f / f circuit 48 , and reverses the output signal ( rly ) of the f / f circuit 48 . the reversed output signal is inputted into the relay circuit 52 , and it is thereby possible to reverse the polarity of the pulse waves outputted from the relay circuit 52 to the pair of electrodes 26 and 28 . the switching circuit controls the d - c voltage v 1 , which is to be applied to the constant current circuit with the output of the cr oscillator in order to supply a pulse wave as a final output . the output time of the scale - of - 4 ring counter is t 1 . the frequencies of the pulse waves oscillated from the cr oscillator on the basis of the different outputs ( a to d ) from the scale - of - 4 ring counter , are f 1 , f 2 , f 3 , and f 4 respectively . t 2 is an output time of the reset signal . when the pulse waves , the frequencies and polarity of which are changed in a predetermined pattern controlled as above , are supplied to a user , the activity level of the user &# 39 ; s brain can be stimulated . for example , if the brain is stimulated by a pulse wave of a specific pattern , it is possible to improve senile dementia , congenital intelligence impairment , or abnormal color sensation . for example , it is possible to bring the intelligence quotient and the learning ability of a down syndrome patient up to a normal level . it is also possible to prevent a decline in brain functions with advancing age . moreover , as for a physically unimpaired person , it is possible to quicken the functioning of the brain and to improve the activities of the brain such as memory , judgement , decision , and thinking . according to the inventor &# 39 ; s knowledge , an ear has points leading to each organ of the human body and both ears respectively have points for energization that electrically lead to the neural circuit system of the brain . accordingly , when the pulse wave is applied to both ears , electricity flows from the right ear through the neural circuit of the brain to the left ear and also from the left ear through the neural circuit to the right ear . when electricity is applied by putting the electrodes , at both ears , it is directly applied to the brain system and the brain functions are activated , thereby improving and preventing the aforementioned statuses . moreover , it is possible to recover , improve , and enhance the functions of each organ such as internal organs connecting to each point in the both ears . the pulse wave output controlling circuit can appropriately change the characteristics of the output state of the pulse wave . for example , methods of changing a frequency include : ( 1 ) changing the pulse wave frequency from a low frequency to a high frequency ; ( 2 ) changing the pulse wave frequency from a high frequency to a low frequency ; ( 3 ) outputting these frequencies alternately . the pulse wave output controlling circuit also changes the polarity of the pulse . it further controls the output time to output the pulse wave of a specific frequency . the characteristics of the output state of the pulse wave are changed by either outputting the pulse wave alone or outputting the combination of the pulse waves . the methods of changing the output state of the pulse wave will be explained in more detail , again with reference to fig4 . in the respective periods of t 1 , pulse waves of the frequencies f 1 , f 2 , f 3 , and f 4 are outputted respectively in a sequential order . at this time , the frequencies are changed in the manner expressed as , for example , f 1 & gt ; f 2 & gt ; f 3 & gt ; f 4 or f 1 & lt ; f 2 & lt ; f 3 & lt ; f 4 . the frequencies may be appropriately changed in the manner expressed as f 1 & gt ; f 2 & gt ; f 3 & lt ; f 4 & lt ; f 5 . in fig4 , the output period of pulse waves f 1 to f 4 makes one cycle . upon the completion of the output of the pulse wave group in one cycle , the polarity of the pulse waves is changed in a sequential order and the pulse waves are continuously outputted . the kinds of pulse waves are not limited to the above examples . the method of changing the frequencies of the pulse waves is not limited to the above example either . specifically , the control for changing characteristics and forms of the outputted pulse waves is conducted to output signals which are made by combining pulse waves of different frequencies . the changing control is conducted by making a signal group one set , in which pulse waves of high frequencies and pulse waves of low frequencies are repeated , and after the completion of the output of one set of signals , by changing the polarity of the pulse waves and outputting the signals of the aforementioned set , thereby and outputting the signal groups having different polarities alternately . moreover , according to this embodiment explained above , the energization by means of the pulse wave outputs is systematized and plural users under different conditions are divided into respective groups and sorted out into different treatment booths 14 respectively . accordingly , it is possible to provide treatments simultaneously to a large number of users in different patterns of outputting pulse waves . the pair of electrodes 26 and 28 may be put not only on the ears , but also on temples or inside the nose , which are the points allowing the pulse waves to be applied directly to the brain . the electrodes may also be placed at asymmetrical positions , for example , by putting one electrode 26 on an ear and the other electrode 28 on the nose . in the above embodiment , the pair of electrodes 26 and 28 is put on the ears which the pulse waves are supplied in a predetermined pattern . however , as shown in fig5 , it is possible to provide a pair of secondary electrodes 56 and 58 ( hereinafter referred to as “ subelectrodes 56 and 58 ”) while providing the pair of electrodes 26 and 28 as main electrodes ( hereinafter referred to as the “ main electrodes 26 and 28 ”). specifically , a rectangular guide block 60 is mounted on the treatment table 12 in such a manner that it protrudes upward from a seat member 18 a of the chair 18 . on both sides of the guide block 60 are mounted sponge members 30 containing the application solution and the pair of the subelectrodes 56 and 58 , which are composed of subelectrode agents 56 a and 58 a made from carbon and contained in the sponge members 30 . the user seated in the chair 18 puts the back of his / her hands on the pair of subelectrodes 56 and 58 , thereby receiving the supply of a pulse wave , which is equal to the pulse wave of a specified pattern that is supplied to the pair of main electrodes 26 and 28 placed on the ears . by supplying the pulse waves both to the ears and to the back of the hands , it is possible to obtain synergistic effects , thereby enabling a quick and more effective therapy . in this variation , the device and system for supplying the pulse wave are made in a shape of a small box . this box oscillates a specific pulse wave according to instructions from the program which controls the oscillation pattern ( pulse wave voltage and current , pulse wave frequency and wavelength , and combinations thereof ) of the aforementioned pulse wave and which is stored in the memory inside the box . fig6 is a functional block diagram of a system which implements the pulse oscillation via the internet . in this system , a master server 100 is connected with an internet server 102 , and the internet server is connected with a personal computer or an alternative pc unit 104 ( such as a home video game machine having a communication function ) as a client . each client is connected with a pulse generation device . the pulse generation device is shown in fig3 as already described above . to this pulse generation device , the four kinds of output signals a to d shown in fig3 are transmitted from the client . fig7 is a functional block diagram of the client 104 and the pulse generation device 106 . pulse wave signals ( for example , a to d in fig3 ) generated at the pulse generation unit 108 within the personal computer are transmitted to the op amplifier 40 . this pulse generation unit 108 is composed of a cpu and a buffer circuit , and is supplied with necessary electricity from the power supply circuit ( v 3 ). a reversed signal ( rly ) is outputted from the pulse generation unit 108 within the client to the relay contact 52 . the master server 100 implements control processing necessary for each client to operate the system as illustrated in to fig6 and 7 . the internet server 102 functions as a certificate server and controls the transmission of data and programs between the master server 100 and the respective clients 104 and the billing for the respective clients . this operation will be hereinafter explained in the order of events . explained first is a case in which the user accesses the master server for the first time . the user either accesses a homepage of a manager who manages the master server , or downloads from memory media such as cds into a client , a connection program to the master server or an operation system program for operating the system in fig7 . next , the master server newly registers the user &# 39 ; s id , password , and account in the certificate server . subsequently , when the user accesses the master server , the master server makes inquiries to the certificate server about the id and the password and decides whether or not the user is registered . the master server also makes inquiries to the certificate server about the account situation and decides whether or not it is possible to connect the client to the master server . if it is decided that the client can be connected to the master server , the aforementioned os program is activated . first , the master server requires the client to make preparations necessary for conducting the pulse application . examples of such preparations include turning on the pulse generation device , connecting the application electrodes to the pulse generation device , and putting the electrodes on the user &# 39 ; s ears . next , when the user notifies the master server of the completion of all preparations and of the pulse application start request , the master server sends to the client a pulse wave generation control signal according to the operating system . the client generates the aforementioned pulse waves ( a to d in fig3 ) on the basis of the control signal . the master server sends the control signal to the client for a specified period of time . after the specified period of time had elapsed , the master server completes the sending of the control signal and notifies the client of the completion of the pulse wave generation . the master server can provide the client with sound information such as music and english conversations or image information , during the pulse wave generation period . while the pulse wave is being applied to the user , the user &# 39 ; s sensibility to the external stimulation information increases and the information acquiring ability enhances . the necessary sound information can be provided from the client to speakers by arranging the waterproof speakers at positions on the electrode devices where they contact the ears and by connecting the ends of the waterproof speakers to the client . even after the client downloaded from the master server a file of the pulse wave generation control signal and the connection by the client to the server was cut off by the downloaded control signal file , it is possible to make the pulse generation device generate a pulse for a specified period of time . after the specified period of time had elapsed , the os program deletes the control signal file . it is possible to set plural patterns of the pulse wave generation control signal according to the status of the user . it is also possible to cause the master server to make inquiries to the respective users about their physical conditions and symptoms and to transmit to the client the pulse wave control signals having the necessary wave forms and frequencies according to the physical conditions of the users . according to this variation , a desirable pulse signal for treating human bodies can be outputted from each client by means of the program obtained via the network . in the above example , the control program is supplied to the communication terminal by using a communication unit . however , it is possible to download , into the memory device of a microcomputer , the control program stored in various kinds of non - communication media such as cds , mds , fds , and dvds instead of the communication media and the carrier wave media on the communication network . moreover , the microcomputer may be integrated with the box comprising the pulse wave output controlling circuit . the pulse waves of the pattern shown in fig4 were applied dozens of times in total to three patients who had serious abnormal color sensations . the pulse wave application was conducted once a day , 2 to 3 times a week . the pair of the electrodes was put on the respective ears and the application was conducted for an hour at a time . a test using a color vision testing table revealed that each patient who had serious abnormal color sensation before the application , had his color vision finally improved to the level of a physically unimpaired person . the pulse application was conducted for several years on a down syndrome patient . the application method of the pulse wave was the same as in the case of the abnormal color sensations . the intelligence quotient of the patient finally rose to the level equivalent to that of a physically unimpaired person . by providing the pulse waves of a predetermined pattern based on the results of many years of study by the applicant , to the head of the human body in order to stimulate the brain directly , it is possible to improve or activate the functioning of the brain . this system allows pulse waves to be provided to a large number of users in respectively different patterns , and it enables a quick , reliable application treatment . moreover , the use of the head set 20 frees the user &# 39 ; s hands . accordingly , stimulation can also be given to the back of their hands by means of the pulse waves , thereby obtaining synergistic effects with the pulse wave supplied to the ears . in the above embodiment and the variation , explanations were given about the hardware structure as the pulse wave output controlling circuit 24 . however , it is possible to use software to control the pulse generation and the polarity by storing in the software a program for generating pulse waves and changing the polarity of the pulse waves . as explained above , according to this invention , it is possible to provide an application system for a human body , which enables enhancement , improvement , and amelioration of the comprehensive activity level of the cranial nerve and the central nervous system . it is also possible to provide an application system for a human body , which enables improvement of the abnormal color sensation as well as improvement of and recovery from the senile dementia and congenital intelligence impairment . moreover , it is possible to provide an application system , which enables enhancement of mental activity and intelligence level , such as eq and iq , of even a physically unimpaired person . furthermore , it is possible to provide a system which achieves activation of the entire nervous system of the human body . | 0 |
embodiments are provided which enable a variety of end - users to manage trailers , trailer visits , drivers , driver visits , as well as shipments across supply chains . it is recognized that according to today &# 39 ; s status quo , there are multiple conflicting definitions of what precisely these terms , such as for example a trailer visit or a shipment , mean . herein is described a generalized approach that accommodates and works with existing definitions . the embodiments are founded upon a unique data model , referred to as the least common denominator model . the model reflects the recognized and leveraged data regarding trailers and shipments which are common to all end users . importantly , the least common denominator model facilitates the mapping of trailer states to shipping states . an exemplary spreadsheet is provided that illustrates such mapping . the data in the model may be shared among varied types of end users , such as for example shippers , carriers , drivers , persons at headquarters , etc . thus , the least common denominator model allows for the provision of universal dashboards for shipment and trailer management , because the different type of end users are able to share common types of data and terminology . as well , the novel and inventive least common denominator model allows for and facilitates a vast amount of data regarding trailers and shipments being stored and mined at the corporate level as well as at the local , e . g . yard , level . thus , the least common denominator data model combined with the vast and varied data stored at the corporate level and even the local level allow for the computing of meaningful , optimized statistics regarding trailers and shipments . further , it is recognized that while the least common denominator model is at an appropriate level of detail as a common language among various end - users , each end - user , based on his or her job and role , requires one or more additional levels of information to perform his or her tasks . embodiments allow such detail at a local level . in an embodiment , each local facility has the ability to extend its trailer model and the embodiment then provides for mapping the local trailer state to the least common denominator model . three novel and inventive concepts are described herein . the first may be referred to as “ managing trailers and shipments across the supply chain .” this novel and inventive concept encompasses the least common denominator model and its numerous applications including but not limited to shipment execution , performance metrics , modeled exceptions , unmodeled exceptions , capturing trailer states , and the like . a second novel and inventive concept described herein may be referred to as , “ generalized dashboards for shipment / trailer management ; ability to monitor meaningful statistics .” this novel and inventive concept , employing the least common denominator model , provides a universal view of and access to the shipment data , which facilitates planning and real - time remediation regarding planned operation as well as exceptions , both modeled and unmodeled . a third novel and inventive concept described herein may be referred to as , “ generalized analysis and optimization for shipment / trailer visit management ; ability to analyze / optimize meaningful statistics .” this novel and inventive concept , employing the least common denominator model , facilitates monitoring and planning operation based on analysis and statistics as well as facilitating the use of or creating of meaningful metrics and statistics , such as for example , performance metrics . a novel and inventive corporate platform is provided which is configured to provision the universal dashboard and to perform the analysis and generate the statistics . two different type of work flow scenarios are described in detail to illustrate the novel and inventive concepts using screen shots of actual implementation . lastly , an example machine overview in the form of a computer system is described in detail . an overview in summary , bulleted form of embodiments discussed herein is provided herein below . under each concept , relevant issues , e . g . regarding the status quo of existing operations and yard management systems and environments , are listed . following the list of items that are considered to be currently status quo are a list of exemplary features and embodiments described herein that address and otherwise improve upon the status quo . it should be appreciated that such list is illustrative and is not exhaustive and that persons of ordinary skill in the art will understand that embodiments in accordance with this invention may be practiced without such specific details . execution corresponds to day - to - day activities for managing trailers and shipments across the supply chain different data models for trailers across corporations or within a corporation different data models for shipments across corporations or within a corporation independent management of trailers and shipments ( by local operations and hq transportation ) least common denominator data model for shipments ( a set of states ) least common denominator data model for trailers ( a set of states ) ability to extend the trailer data model with additional states on a per location basis a mapping from “ many ” trailer states to “ one ” shipment state on a per location basis allowing locations to manage trailers and trailer state transitions as they see fit — eliminate local redundancy managing shipments indirectly across the supply chain — eliminate redundancy across the supply chain and provide visibility shipments as conduit to carry information from site to site and provide visibility across the supply chain if trailer state is defined by attributes that can take on multiple values , not all attribute - value combinations need to be valid on the shipment not every transition may be valid , some may be modeled exceptions , other unmodeled exceptions a trailer attribute may not be in the least - common denominator data model across all sites that are relevant in a large subset of locations introducing an extended set of states to trailers that are relevant to a subset of locations but not all enabling each site to declare extended states it is interested in making extended trailer attributes / states visible at a location through the shipment , as per the location &# 39 ; s specification that are performing or have performed to plan that failed to perform to “ positive path ” plan , but have / had modeled / understood exceptions that had serious unmodeled exceptions during execution as a result calculating “ average ” key performance indicators ( kpis ) and performance metrics that are meaningless due to high standard deviation — i . e . a few outliers limited ability to adorn trailer visits / shipments by state / type to analyze them separately , e . g . live / drop ; arrive loaded - left loaded vs . arrived empty - left loaded . a generalized data model on trailer visits / shipments that includes the notions of : positive - path operation operations with known / modeled exceptions operations with exceptions that are not modeled ability to report on the number of trailer visits / shipments that fall in each of the three operation categories ability to capture trailer visit / shipment adornments . for purposes of understanding herein , adornments may mean states : ability to report on the number of trailer visits / shipments that fall into adornment categories ability to set performance targets and report trailer visits / shipments / locations that are within the kpi or outside it uniform visibility of shipment state across the supply chain with minimal redundant data entry ability to have meaningful and detailed numeric kpis and metrics that are not skewed by outliers monitoring is collective set of activates the progress of trailer and shipments in real time with dashboards , alerts , and notifications , observing metrics and kpis and taking action as appropriate . access to meaningful statistics is essential for success . essentially monitoring forms a layer of abstraction on the details of execution details to allow appropriate users to control proper operation . operational users that operate on the physical trailer and indicate state change use of “ planned ” and “ estimated ” time fields to remain in a given state and to make a state transition at a given time point if too long in a given state — more than a percentage / interval above the allowed time in state if transition does not take place within an interval after the expected transition time pre - warning within an interval before the expected transition time leverage data model that distinguishes trailers , trailer visits , shipments that have been performing positive - path operation operations with known / modeled exceptions operations with exceptions that are not modeled ability to report on the number of trailer visits / shipments that fall in each of the three operation categories ability to monitor / report on the number of trailer visits / shipments that fall into adornment categories ability to set performance targets and report trailer visits / shipments / locations that are within the kpi or outside it ability to intervene and plan both for positive path operation as well as for exceptions for more efficient operation analysis looks at past performance with reports and dashboards , looks at metrics and kpls , planes process changes and resets kpi targets for optimization for shipment / trailer visit management . access to meaningful statistics is essential for success . no generalized way of analyzing “ trailer visit ”/ shipment timeliness and performance and overall optimization operational users that operate on the physical trailer during the “ trailer visit ” and indicate state change use of “ planned ” and “ estimated ” time fields to remain in a given state , and to make a state transition at a given time point if too long in a given state — more than a percentage / interval above the allowed time in state if transition does not take place within an interval after the expected transition time pre - warning within an interval before the expected transition time a generalized data model on trailer visits / shipments that includes the notions of : positive - path operation operations with known / modeled exceptions operations with exceptions that are not modeled ability to report on the number of trailer visits / shipments that fall in each of the three operation categories ability to report on the number of trailer visits / shipments that fall into adornment categories ability to set performance targets and report trailer visits / shipments / locations that are within the kpi or outside it ability to plan for more efficient operation in the future both for positive path operation as well as for exceptions ability to better model exceptions by better understanding unmodeled exceptions and categorizing and modeling them ability to modify kpls , metrics , and standard operation processes for shipments and trailer visits of different type and introduce new ones to increase overall productivity as set by business objectives for purposes of understanding embodiments herein , the following terminology may be defined as follows . trailers , drivers , and tractors are assets with static characteristics ; each check - in / check - out of a trailer or driver to a site constitutes a trailer visit or driver visit ; a shipment starts in one site , e . g . from - site , and ends in another site , e . g . to - site ; visits and shipments exist for short durations ; during a trailer visit , a trailer is associated with : one inbound shipment , more specifically the to - site of that shipment ; and one outbound shipment , more specifically the from - site of that shipment ; and a driver which brought it in a driver which took it away typically , there are different data models for shipments across corporations . for purposes of understanding herein , a trailer visit is a journey from gate to gate and a shipment is a journey from one yard to another yard . thus , people who manage the trailers are considered to be inside the yard , sometimes referred to as the “ four fences ,” whereas people who manage the shipments may be at headquarters . typically , there are degrees of redundant trailer and shipment data entry and management both in a given location and across a network . it should be appreciated that one cause of such different data entry and management are a result from having different types of customers . typically , a user enters the data , ships the shipment to destination at which such data is entered in a destination system . thus , to address this issue , the system provides a least common denominator data model for shipments such that the shipping entities , the destination entities , the carrier , and headquarters can all know what is progress on a particular shipment . importantly , in an embodiment , shipping data or shipping states map to the trailer states . for example , a person managing the trailer may be looking at the data and ask , “ is this trailer empty or loaded ?” he is not thinking about shipments . he is asking , “ is there something in the trailer ?” thus , such person needs to be able to know , for example , “ no , this is empty now ,” without understanding the shipment . meanwhile , if the trailer just got unloaded , the corresponding shipment gets closed because it just got accepted . as well , if the trailer starts getting loaded with the next shipment , that shipment needs to start in the system . thus , with the system , users can just look at their work and , at the same time , the big picture viewpoint gets updated . as discussed hereinabove , a novel and inventive least common denominator model is provided . to understand the model and , in particular , the schema of the data depicted in the model , a description of basic concepts is provided . regarding basic concepts , for example , shipment , a typical work flow may include : start with a shipment , select an appropriate trailer , assign the shipment to the trailer , move the trailer to a dock door , load the trailer , have the trailer be picked up , drive the trailer to its destination , unload the trailer at a dock door , and then close the shipment . the trailer visit version of this flow includes but is not limited to the trailer arriving at the source yard , the trailer is emptied , and then such trailer is loaded with the shipment and sent out . the trailer may arrive empty to be loaded and leave loaded . or , the trailer may arrive loaded and leave empty . as well , there are exception cases . for example , the wrong load arrives or the yard never needed a particular extra empty trailer to send out anything . in general , things are loaded , things are unloaded , and things go wrong . such operations may be a matter of perspective in terms of the from - site , the two - site , and the headquarters view of the world . for example , given a trailer , as far as the from - site is concerned , there is a load that is outbound , i . e . it is going out . the from - site recognizes it has a trailer that is empty and assigns a shipment to it . this to - site has the viewpoint that , “ a shipment is going to come into me . it &# 39 ; s empty in the source facility .” as far as the individual at headquarters is concerned , the shipment is in an empty , unassigned state and knows what trailer the shipment is being placed . nothing else has started . another approach to viewing the above - mentioned activity is the following progression , in accordance with an embodiment . the trailer is outbound loading , outbound loaded , pending departure , and at the checkout . then , it &# 39 ; s en route . it &# 39 ; s checking in , recent departure . it should be appreciated that once it &# 39 ; s en route , the individual at the from - site knows the trailer or shipment has left ; it &# 39 ; s going . as far as the individual at the to - site is concerned , the trailer or shipment is coming in . once it checks in at the to - site , individual at headquarters may say , “ hey , the thing i shipped is actually at the destination .” such information may be important to headquarters or the individual at the from - site because such person may be getting that trailer back eventually . in an embodiment , a carrier perspective is addressed . for example , by using one or more embodiments herein , a dispatcher at the carrier headquarters may see the trailer begin loading and ensures that the driver arrives at the site on time or , alternatively , accelerates or delays the driver arrival time at the site as appropriate . the driver may be able to make these adjustments on the ground in real time . the site and the driver coordinate to ensure a most expeditious processing of the driver inside the facility . once the trailer is picked up , as the driver is driving to the destination , the driver may provide arrival time updates . the destination site itself may participate in the collaboration , may instruct the driver to arrive earlier or later . at the same time they make the preparations to process the driver most expeditiously . thus , embodiments herein enable two or more sets of operators inside the facility and at headquarters to communicate in the same language . a least common denominator model (“ system ”) is provided that enables such operators to perform their roles , their jobs , via one system and one record of the data that are updated in a way that is consistent with each role . that is , embodiments herein determine , model , and use the least common denominator informational data on which everyone agrees . as well , embodiments build in flexibility such that other role players or even the same role players may extend the system by customizing particular aspects to their benefit while maintaining the shared model . embodiments of the invention to enable shipment visibility across a shipping network and the different perspectives of different roles thereof may be understood with reference to fig1 a - 1i , respectively . fig1 a is a schematic diagram showing seven steps from a shipping management perspective of either yard , such as from a headquarters perspective . for example , shipping management steps from load status perspective may include but are not limited to : assigned to a trailer ( 4 ), loading ( 5 ), loaded ( 6 ), check - out ( 7 ), en - route , check - in ( 1 ), loaded ( 2 ), emptying ( 3 ), and closed ( 4 ). as well , the system provides visibility to trailer and yard management activities from load status perspective including but not limited to : check - in ( 1 ), loaded idle in yard ( 2 ), emptying “ inbound shipment ” ( 3 ), empty idle in yard ( 4 ), loading “ outbound shipment ” ( 5 ), loaded idle in yard ( 6 ), and check - out ( 7 ). fig1 b is a schematic diagram illustrating the various states of a shipment . fig1 c is a schematic diagram illustrating the various sequence of states ( state trajectories ) of trailers in a facility also referred to as a trailer visit . fig1 d is a schematic diagram showing two cases when something undesirable occurs , such as for example , a trailer arrives loaded and is never emptied or a trailer arrives empty and is never loaded . fig1 e is a schematic diagram illustrating what else can go wrong during trailer visits inside the yard while loading / unloading . later , these undesirable trajectories form modelled and unmodelled exceptions . fig1 f is a schematic diagram presenting event states and trajectories from the perspective of “ from - site / yard ,” “ to - site / yard ,” and “ headquarters / shipment .” fig1 g is a schematic diagram illustrating the different trailer states for a drop load , in which the driver arrives with one trailer and leaves with a different trailer . fig1 h is a schematic diagram illustrating drop load exceptions when things went wrong or are undesirable . fig1 i is a schematic diagram illustrating live drop event states . these are the state trajectories from the driver or tractor perspective during the driver or tractor visit . embodiments herein provide common visibility across the supply chain using the least common denominator model , which enables accurate and real time assessment of a shipment from one facility to another as viewed by each facility and headquarters , as follows . as an example , consider a shipment that needs to go from the source facility to the destination . somebody who is in charge of shipments has to assign that shipment to a trailer . somebody at the destination views , via the system , that there is progress ; shipment is assigned to a trailer . the trailer then is ready to be moved to the dock so that it can be loaded . in an embodiment , a user may create a move . the user may view a pending move . that is , the user may be the person at the dock door who &# 39 ; s going to load the trailer . as well , a person inside the yard truck may view the move . a yard truck is a small truck inside the yard that moves trailers back and forth , very much like a regular truck , but smaller . there may be a person inside the yard truck who needs to execute the move . thus , via the system , he accepts the move . subsequently , he completes the move . at that point , in the example , the system shows a trailer that &# 39 ; s outbound empty and that needs to leave . in an embodiment , it is possible to continue operating on such trailer via the system . the system may show that the trailer has started loading and then that it is outbound loaded . it finished loading . a next move may be created . such move may reflect that the trailer is parked back in the yard and that it is ready to leave . in the embodiment , users of the system at the other end , e . g . destination , are able to view the progress . as well , via the system , users may view that the load is ready to be picked up , the driver arrives with another empty trailer , and the driver is going to drop the empty trailer and pick up this loaded trailer . continuing with the example of the embodiment , the carrier picks up the trailer at the gate and leaves . at the destination facility , the users of the system are enables to view such progress . then there is a check - in when the trailer arrives . enabled by the system , the source facility now knows that the shipment is at destination . the operators at the destination empty the trailer . and , the shipment is closed . it should be appreciated that in accordance with embodiments herein the trailer and trailer status inside the facility and the shipment and shipment status have been effectively modeled in such a way that all players understand the model . thus , even though , for the trailer , people may employ a particular local lingo , the system enables a universal way of approaching communication of a shipment . further , in an embodiment , an individual site may employ a much more complex and extended model for the state of the shipment or the trailer . such local details may be extracted by mapping appropriately the local states to the least common denominator model . there are multiple prevailing definitions of the word shipment in the industry today . sometimes it refers to the goods in the trailer as it is driven from one site to another , sometimes it is a load tendered to a carrier that consists of multiple stops , and sometimes there may be multiple shipments in the trailer . in practice shipments may often consist of multiple legs . for example , a particular shipment may consist of multiple legs where shipment starts with an empty trailer at a first facility , where items may or may not be loaded onto the trailer , e . g . the facility may be only supplying an empty trailer . then , over a sequence of facilities , each facility may or may not unload or load items onto the trailer until the trailer arrives at a last facility , where the shipment ends . the last facility may be where the trailer is completely emptied or may be to where the empty trailer is ultimately delivered . for purposes of understanding herein , a shipment ( more precisely a shipment leg ) may be limited to a trip between two sites , the source site and the destination site with a given load . as such it is independent of the initial origin and the ultimate destination of the load or shipment route . in a given leg , the source may have added to the load , and the destination may have subtracted from the load . it should be appreciated that for purposes of understanding herein , a single shipment may consist of multiple bills of lading that correspond to multiple purchase orders . for brevity , the remainder of the discussion herein may be on shipment legs ( referred to as shipments for brevity ) and correspond to a trailer load ( in the industry referred to as tl ) with the understanding that shipment routes may be constructed from shipment legs and that , at each leg , multiple bills of lading or purchase orders ( in the industry referred to as ltl ) may be processed . an embodiment provides customization of the system per each location or site . that is , in an embodiment , the least common denominator model may not capture data about every aspect that may be important to a user . for example , a particular site that manages refrigerated trailers needs to be able to say , “ look , there are refrigerated trailers , and there are dry trailers . and my refrigerated trailer has three compartments , and i load my refrigerated trailer across three different dock doors in my facility , because there is the extremely cold , there is the cold , and there is the zero degree celsius stuff . i will pick them up from different parts of my warehouse .” another user at another site with refrigerated trailers may not have that ; for example he may ship out everything at minus - 4 degrees celsius . such person may just park such trailer at the dock door and load it . it may well be that the source facility consists of a very large warehouse , where goods that must be shipped at different temperatures are loaded across different dock doors . in this case , the loading sequence and related process flows through operations may be modeled to track progress across multiple loads . the loading sequence across doors may be strict or one may load the trailer at an arbitrary sequence . in an embodiment , at the destination facility , tracking such detail may be unnecessary , when using the least common denominator model , the destination facility knows that the loading has started and that there is an estimated time of departure , and hence an estimated time of arrival , for the trailer . conversely once such trailer arrives at the destination facility , the facility may have a smaller warehouse , which may unload the trailer at one single dock door and distribute the goods appropriately in the warehouse . again , to the source the relevant piece of information is the acceptance of the delivery of the shipment , not the detailed sequence of the unloading of the trailer , which is addressed by embodiments herein . across the network , the receiver of such shipments may not care about such level of detail , while that level of detail , i . e . in the way the trailer is handled , may be important at the yard . the person at the yard may need to move such trailer from dock door to dock door . thus , an embodiment extends the trailer data model . that is , from the system point of view , the trailer entity has a more detailed state space than the shipment entity . in an embodiment , the following guidelines are incorporated into the data model : one simple shipment data model across all sites ; one core trailer data model across all sites ; individual yards continue managing trailers ; “ keep it simple ” for local yard operational users , because without such users , the situation may be “ garbage in garbage out ”; and central personnel gains visibility to and manages trailers and shipments . an embodiment can be understood with reference to fig2 a , a schematic diagram showing a trailer and shipment data model at a high level . at each gate / yard , particular data pertaining to that gate / yard are required . examples of such data include but are not limited to trailer visit data , inbound shipment data and outbound shipment data . example of required trailer visit data may include but are not limited to trailer id and standard carrier alpha code ( scac ). data that pertain to across the network or when the shipment is en route may include but are not limited to shipment id and data about the from - site and the to - site . one model in accordance with an embodiment differentiates between the actual trailer and its visit to a facility . a trailer has a lifespan of years whereas a trailer visit has a much shorter life span , e . g . hours for a live load , days for a drop load , longer if the trailer is used for storage in the facility . while the static characteristics of a trailer play a role in its use during a trailer visit , typically they do not change during the trailer visit . as such the model uses different elements to describe the state and state trajectory of a trailer visit . in an embodiment , the trailer visit data model may include but is not limited to the following characteristics or attributes : it should be appreciated that in an embodiment some of the above - cited characteristics or attributes may be required by all sites , e . g . some system , static , or core attributes , or that others may not be utilized by all sites . it should be appreciated that in an embodiment the system is configurable to add trailer state attributes at and for any particular site . the system enables a user to manage an entire evolution of the trailer and count the amount of time spent in each state . in an embodiment , trailer visit state core attributes may include but are not limited to the following : in an embodiment , trailer visit state system managed elements may include but are not limited to the following : location : dock , yard , spot , etc . ; and move : none , pending / active / planned move ; no - shipment , trailer load ( tl ); less than a trailer load ( ltl ), no op ; as with the trailer , drivers and tractors also have static , system , core , predefined , and custom attributes . as with trailers , the static characteristics of a driver or tractor are unlikely to change during a driver visit or tractor visit . similarly the state of a driver visit and tractor visit and their relationship to trailer and shipment are modelled with different elements . also , as depicted above in fig1 g and fig1 i , the state trajectories of a driver - tractor pair differ for drop ( different check - in and check - out trailers ) and live loads ( same check - in and check - out trailer ). otherwise in one embodiment the driver visit state may be described as : at gate in yard w / inbound in yard w / o trailer in yard w / outbound at gate checked out . in an embodiment , shipment data model identifier information may include but are not limited to the following data : in an embodiment , shipment data model relations may include but are not limited to the following data : in an embodiment , shipment data model system functions may include but are not limited to the following : in an embodiment , shipment data model planning attributes may include but are not limited to the following : planned arrival time ; planned departure time ; estimated arrival time ; estimated departure time ; inbound comments ; outbound comments ; planned loading time ; planned unloading time ; and etc . in an embodiment , characteristics or attributes for shipment statuses for full trailer loads may include but are not limited to the following : fig2 b is a schematic diagram showing how an embodiment synchronizes trailer and shipment states across the from site and to site . trailer states are correlated with shipment - in states and shipment - out states . for example , check - in inbound / loaded is correlated with shipment - in : shipment set , inbound - loaded . regarding shipment - out , check - in inbound / loaded is correlated with “ available .” for example , via the system , a user can perform the following operations , i . e . typically physical actions on the trailer and shipment , which result in the trailer and shipment state trajectory to evolve in synch , as depicted in fig2 b . for example , assume the load status was loaded and the user started unloading the trailer . now , the trailer is empty . the trailer was in the yard . the user created a move . now the trailer actually got moved to the dock door . the trailer stayed at the dock door . the move completed . another move is created and the trailer goes from dock to yard . eventually a driver comes with a tractor , picks up the trailer and shipment , and transfers it to another facility ( the to - site ). fig2 b ( b ) then illustrates the state trajectory in the to - site . another move may be created for the trailer to go from yard to dock . start move to dock . finish move to dock . start unloading . finish unloading . create move to yard . start move to yard . finish move to yard . and , finally the movement is done and the shipment is closed . execution sequences are discussed in more detail below and in the context of fig8 and fig9 . thus , the system is configured to enable such user to manage the time , e . g . measuring and shortening the time for greater efficiency . for example , the person at the dock may be waiting . the trailer is in movement and so forth . thus , the user may want to know all of this timing . in an embodiment , some characteristics of a shipment may be primarily related to a particular stop of the shipment , or the en - route portion . that is , such characteristics may apply as the shipment is being driven from source to destination . as well , other characteristics may apply to an end or a stop of a particular leg . in an embodiment , shipment leg characteristics may include but are not limited to the following characteristics : load type ( e . g . dry , refrigerated ); shipment type ( e . g . dry , reefer ); weight ; volume ; seal id ; load type ; and etc . in an embodiment , shipment stop characteristics may include but are not limited to the following . it should be appreciated that each type below has an inbound and outbound value . outbound handling method : ( live , drop ); outbound action : ( tl , . . . , ltl , noop ); and etc , inbound handling method : ( live , drop ); inbound action : ( tl , . . . , ltl , noop ); and etc . one skilled in the art may readily recognize that some of the planning and system attributes are shipment stop attributes , e . g . planned or estimated arrival time , inbound appointment time , etc . as discussed above the least common denominator model can easily be extended to track additional information necessary in local operations . in an embodiment , the below conditions are incorporated into the system : sites can define additional trailer attributes and manage “ local ” trailer actions , e . g . : loading stage { dry , conditioned , reefer } “ load status == loading ” in this case abstracts such “ stage ” information and only reflects the fact that loading has started local site can develop the necessary work - flows / operations to manage the loading stages when all load stages have completed loading , then and only then , is the “ load status ” set to “ loaded ” the generalized shipment state “ o - loading ” works for everyone . it should also be noted that , in an embodiment , additional trailer attributes can actually be copied into the shipment at the from - site during check - out for it to make it available to the to - site at check - in . while from a least common denominator data model perspective this data may not be shared globally , however , this allows sites to share data selectively . an embodiment of mapping trailer state to shipment state can be understood with reference to fig3 a - 3h . fig3 a - 3h is a spreadsheet of the possible combinations of trailer states in combination with shipment states in accordance with an embodiment . it should be appreciated that while the discussion of the mapping of trailer states to shipment states concerns an implementation of such mapping in a spreadsheet , the spreadsheet paradigm is by way of example and is not meant to be limiting . one skilled in the art would readily recognize that embodiments may include and indeed implement the mapping using technologies other than a spreadsheet . for example , such mappings can be stored in volatile or non - volatile memories in the form of tables , etc . thus , discussions herein using “ spreadsheets ” are meant for purposes of understanding only and are not meant to be limiting . the first column is movement type , the entries of which include but are not limited to : inbound , outbound , pickup , storage , maintenance , and relay . the second column is load status , the entries of which include but are not limited to : loaded , loading , empty , and unloading . the third column is handling method , the entries of which include but are not limited to : live and drop . the fourth column is inbounduse , the entries of which include but are not limited to : trailer loads ( tl ,) noshipment , and relay . the fifth column is outbounduse , the entries of which include but are not limited to : available , tl , donotreuse , and relay . the sixth column is valid , the entries of which include but are not limited to : yes , no , and blank . the seventh column is inbound shipment state ( iss ), the entries of which include but are not limited to : i - loaded , na , i - exception , empty , i - unloading , closed , and blank . the eighth column is outbound shipment state ( oss ), the entries of which include but are not limited to : na , assigned , o - loaded , o - loading , o - exception , and o - pickup . the ninth column states whether this is a valid checkin state ( valid cis ), which describes whether a trailer can be checked in in this state , the entries of which include but are not limited to : yes and no ; acceptable errors may be modeled over time . the tenth column indicate whether a trailer in the given state can be checked out checkout state ( valid cos ), the entries of which include but are not limited to : yes and no ; various error scenarios may be introduced over time . in an embodiment , to configure the system , a user may go through each of or some of the rows and columns combinations in a given spreadsheet such as the spreadsheet described above and decide whether each row and column combination is valid . for example , regarding an inbound shipment and the inbound shipment states mapped thereto , a user may determine that he is not even allowed to have an inbound state without an inbound shipment . because if the state is inbound loaded without a shipment , it may not make any sense . thus , such may not be a valid state . that is , if it is an inbound loaded state , then the user needs such state to have a trailer and it probably would be loaded . thus , in an embodiment , the spreadsheet is completed with consideration for the needs of a particular business . this mapping also lays the foundation of normal ( positive path ) operations vs . modeled and unmodelled exceptions . an embodiment provides a way for a map , e . g . spreadsheet , to have meaning from one location to another . in an embodiment , each player at each facility has access to the spreadsheet . examples of players may be the shipper , the truck driver , and the person at the destination . none of the players share the trailer visit data directly . the trailer visit data are not visible , more importantly they not modifiable across the network . however , the shipment data is visible across the network . there is one shipment and there is knowledge of where is the shipment . for example , if the shipment is in a particular yard ( source stop or destination stop ), then that facility is operating on the shipment and the corresponding shipment stop attributes . the others players cannot act on such data . if the shipment is en route , the driver may act on the data . and , if the shipment is at the destination , the destination can act on the data . that is , there is a clear ownership of who can change what data on the shipment and when based on shipment state and location . because as a player operates on the trailer visit data , if the shipment state is a function of the trailer state , wherever is the trailer , is the only place where the trailer visit data can change . thus , whoever has access to the trailer , physical trailer , is the one enabled to make trailer state changes from one place to another and who then as a result is changing the shipment data . in an embodiment , not every interested party , e . g . driver , user at source , user at destination , user at headquarters , etc ., is required to get the same spreadsheet . for example , interested parties may use totally different trailer attributes and trailer attribute values . however , it has been found to be beneficial in an embodiment for interested parties to have the same set of values for inbound and outbound shipment states . for example , in an embodiment , interested parties use the same movement type ; use the same load status , handling method . such users use a set of core trailer attributes , i . e . the same spreadsheet . however , in an embodiment , users may customize by basing their customization on such spreadsheet . such users may add other trailer attributes and therein have their own mapping of trailers states to shipment state . in an embodiment , headquarters does not have a spreadsheet . because headquarters typically requires to view the shipment , which may be the least common denominator , plus other information that may be relevant . in an embodiment , the spreadsheet is local . the facility owns it . thus , at a particular facility , the users own their particular spreadsheet that does the mapping in accordance with the least common denominator and with the particular trailer states . in an embodiment , there are four players : the source facility , the destination facility , the headquarters , and the trucker . and each of those has a dataset that is personal to them by which they keep track of the shipment . each of them has a different set of data , because different data is pertinent to them . they do not need the information the other players need necessarily , and vice versa . thus , they each have their own subset of the total dataset , however they all have something in common , which is the data from the least common denominator model . in an embodiment , local trailer attributes are not available outside the local environment . in another embodiment local trailer attributes can be shared with other parties without meaningful , guaranteed semantics such as name value pairs . fig4 is a chart of particular trailer states or events , load statuses , location , and waiting on labor versus elapsed time , in accordance with an embodiment . it illustrates how the model is used to focus on idle time . fig4 captures a trailer loading sequence and highlights where one is waiting on some specific physical labor or a human intervention . in one embodiment , the sequence starts with a loaded trailer in the yard . a traffic manager ( tm ) creates a move for the trailer to be moved from yard to dock . at this point , the wait starts for the yard truck driver ( ytd ) to accept and then to complete the move . until the move is completed , there cannot be progress on this shipment . once the trailer is parked at the dock door , the onus is on the dock worker ( dw ) to unload the trailer most expeditiously . until the trailer is unloaded there is no progress . once the trailer is unloaded the system must be notified that the unloading is completed . such responsibility may lie with the dock worker or a traffic manager ( tm ). at such time , in one embodiment , it may be desirable to move the trailer back to yard . in another embodiment it may be desirable to move the trailer to another dock door . in yet another embodiment , the trailer may stay at such dock door and be loaded with an outbound shipment . once the new move is created , it is up to the yard truck driver to move the trailer back to the yard . until such move is completed , the unloading of a subsequent shipment cannot be started . it should be appreciated that given a mapping from trailer states to shipment states , in an embodiment , not every state , combination of states , or mapping of states may be valid , for example , from an operational point of view . while one may have standard operating processes for a positive path operation , there are some exceptions that occur frequently that one has to include them in “ typical system behavior .” for example , a person at the yard may have unloaded a shipment to realize that such shipment wasn &# 39 ; t supposed to be for that person . for instance , it may have been meant to go across the street . however , the person had opened the shipment and started unloading it and then realized the error . thus , in this example , the person closes the shipment , puts everything back in , and then sends the shipment back . in an embodiment , the system is configured to model exceptions , for example , that occur with a predetermined acceptance of frequency . in an embodiment , the system is configured to provide rules for handling the modeled exceptions . as mentioned above , it should be appreciated that given a mapping from trailer states to shipment states , in an embodiment , not every state , combination of states , or mapping of states , or state transitions may be valid , for example , from an operational point of view . an embodiment can be understood by the same example described in the section above , modeled exceptions . it should be appreciated that sometimes there are exceptions that occur , however they are not modeled . given the limited frequency and limited impact of some exceptions , for sake of simplicity , it is more beneficial to lump some exceptions that occur into one “ unknown exception ” and then delegate its resolution to entities outside the model . for example , a particular exception may not occur frequently enough to warrant modeling . for example , modeling such exception may incur costs that are not justified given a cost benefit analysis , such as incurring an expensive programming cost plus roll - out to production costs , or even training cost at all employee levels . in an embodiment , the system is configured to handle exceptions that are not modeled exceptions . for example , the system is configured to provide a notification , which may cause a person to obtain assistance , such as calling a supervisor who calls it tech support , who then corrects the problem . in an embodiment , the system is configured to provide rules and guidance for handling the unmodeled exceptions but delegate to the “ qualified ” users to resolve the exception . in an embodiment , a user may , as unmodeled exceptions happen , go back to the system and modify the system such as to prevent such unmodeled exceptions from happening . or , the user may determine that if the unmodeled exception is going to keep happening , to make it into a modeled exception . in essence , embodiments herein provide users with the ability also to evolve and improve their business over time . as the context of discussion is monitoring an analysis , it should be appreciated that an ultimate goal is to prevent exceptions from happening . as a user is able to reduce the frequency of some main “ modelled ” exceptions the user can over time focus on less frequent exceptions , model them , and then focus on preventing them . in an embodiment , the system is configured to provide , but is not limited to provide the following functional categories : execution steps taken to handle a trailer and shipment which in the process provide the data for monitoring and analysis ; monitoring one or more processes that look at present data , focus on immediate issues , and accelerate trailer visits and shipments ; analysis one or more processes that look at past data to understand and improve performance , develop score cards , measure kpls , and the like ; it should be appreciated that in an embodiment , planning is part of each functional category . one skilled in the art may readily recognize that the categories may be viewed , respectively , as operational ( execution ), tactical ( monitoring ), and strategic ( analysis ) planning . in an embodiment , users of the system may include but are not limited to gate personnel , yard truck drivers , traffic managers , dock operators , transportation managers including those at headquarters , shift supervisors , general managers ( gm ) and so forth . table a illustrates site users of the system , their execution functions , what they monitor , and relevant analysis informational data , according to an embodiment . table b illustrates particular headquarters site users of the system , their execution functions , what they monitor , and relevant analysis informational data , according to an embodiment . table c illustrates other users of the system , who are from the site &# 39 ; s perspective guest users , their execution functions , what they monitor , and what relevant analysis informational data they look at , according to an embodiment . a guest user may be a user that works for another corporation or is a private fleet driver . table d provides a perspective of operational execution functions , according to an embodiment and illustrates local and central focus area . a preferred embodiment can be understood by the following example of operational site users and their tasks for unloading a trailer with minimum intervention due to the network aspect of the system . such example is for illustrative purposes and is not meant to be limiting . specify that load will empty at dock 12 — set journey “ dock 12 round - trip unload ” verify information upon trailer arrival , correct as necessary request drop in zone 3 start journey ( journeys are discussed below ) perform the unloading specify ( wms or tablet interface at dock ) that trailer is empty the sequence of figures fig5 a to fig5 k show different exemplary interfaces that different users may leverage for various execution , monitoring , and analysis capabilities . fig5 a shows a high level outline of the different user views for execution , monitoring , and analysis . fig5 b shows a sample view for shipments that a shipment manager may use . fig5 c shows a sample view for a traffic manager that is overseeing the trailer movement in the yard . fig5 d shows a sample view for a dock manager which uses a “ whiteboard ” to manage the trailers at the dock doors . fig5 e shows a sample yard truck view that yard truck driver uses to interact with the system . fig5 f shows a sample web gate view that a person at the main gate uses to check a trailer and a driver , in and out . the figures fig5 b - 5f are sample execution users and their interfaces . fig5 g shows a sample dashboards view . fig5 h shows a sample view for watches . fig5 i shows a sample yard situations view . these three are monitoring capabilities to observer the system and intervene where necessary . fig5 j shows a sample reports view . fig5 k shows a sample custom / scheduled reports view . these two are analysis users who need to assess past performance and modify future processes and kpis . before we get into implementation details of a possible embodiment we discuss some additional constructs that increase the value of the invention . an embodiment can be understood with reference to fig6 , a chart of asset operations including but not limited to type of label , filter , auto assignments , what must be set , what can be set , check out and types of options . these are customizable operations that can be used to build workflows based on data model elements . they shield individual users from the details of the data model and bring the assembly line approach to the workflow execution . users may be interested in implementing a sequence of planned moves also referred to herein as a journey . in one embodiment , a journey is a sequence of moves each created only when certain conditions are satisfied , such as for example but not limited to : an example of such journey is : dockdoor12 round - trip unload , wherein such journey : movement type = inbound load status = loaded first move : move trailer to dock 12 only created if door 12 is empty in an embodiment , a journey may be authorized only on trailers that match a filter . fig7 a is a sample screen shot of an asset specification and planned moves page of the system according to an embodiment . in the example , attributes of movement type and load status are shown , as well as the comparison type . the respective values are inbound and loaded , respectively . the system determines and shows that there is currently one matching asset . there are drop down boxes for attributes , comparison , and values , as well as a selection box to add other constraints . in the embodiment , regarding the planned moves , the following types of data , but not limited to such types of data , can be configured : status , destination , spotter , additional asset conditions , stage area , and options . as well , users may indicate which parking area to put trailer , which spot , and to add a move , etc . fig7 b is a sample screen shot of an embodiment where the system determines an appropriate journey for processing an inbound trailer / shipment . fig7 c is a sample screen shot of the planned moves for a particular journey , according to an embodiment . both for monitoring and analysis one needs to leverage metrics and key performance indicators ( kpi ) s to oversee execution . in monitoring , one focuses on current performance to intervene , while in analysis one looks at past performance , to make process changes and to change metric and kpi targets . metrics may be expressed a single numbers or as a sequence ( vector ) of numbers . examples of number metrics are : the total number of moves performed by spotter 1 last week the number of trailers that checked out between set dates the average time - in - yard for trailers that checked out between set dates the total number of moves performed by all spotters last week the number of trailers that checked out between set dates by trailer scac a metric or kpi can be used to express a performance value , or one can also work with a “ target ” and show performance against a target . one can also look at the time history of a metric and kpi . reports may be used to generate multidimensional data . they can be used to look at current information or to look at past performance . the number of moves performed by spotter 1 , last week by hour and day , e . g . 168 values total time in yard for each trailer for trailers that checked - out between set dates as mentioned hereinabove , two different types of work flow scenarios are described in detail using screen shots of an actual implementation . embodiments may be understood with reference to the following sets of figures , depicting particular work flows . fig8 a - 8am depict an exemplary drop load scenario according to an embodiment and discussed in detail below . fig9 a - 9o depict an exemplary live load scenario according to an embodiment and discussed in detail below . for purposes of understanding the work flow screen shots , four execution roles referenced in the exemplary users and functional categories are listed below under their respective area of responsibility : may be at source / destination / headquarters depending on organization , shipper , and source / destination facility . in the work flow scenarios screen shots , source tabs and destination tabs are provided . source tabs include but are not limited to “ gate view ,” “ yard truck ,” “ dock view ,” and “ ship view .” the middle tab is “ hq view ” for headquarters view . the destination tabs include but are not limited to the same tabs as the source tabs , but the displays represent data from the destination point of view , whereas the source tabs represent data from the source point of view . fig8 a - 8am are sample screen shots of the exemplary drop load scenario , according to an embodiment . the user perspectives depicted are gate person , yard truck driver , dock manager , shipment manager both at source , and destination facilities as well has headquarters personnel at either facility &# 39 ; s corporation . fig8 a shows how a shipment is created in an overall integration upload of shipments in the system . an outbound panel is shown in which information is requested and collected . for example , shipment id is requested and , in the screen shot , is depicted as shipment 7 . as another example , the destination is selected in a dropdown box as “ grb .” fig8 b shows a source - ship view and hq view of panels configured to enable a user to configure eligible trailer filters , as well as filter shipments panels , and to assign the shipment to a trailer . fig8 c shows a destination - ship view and hq view of pending arrivals . fig8 d shows a source - dock view of a particular trailer that is ready to be moved to dock where one can also see the shipment assigned to the trailer . by selecting “ express create move ” one can create a move . fig8 e shows a source - dock view of a screen to create the move to dock . fig8 f - 8g each shows a source - dock view of a screen to view the pending move . fig8 h shows a source - yard truck view to see and accept the move . fig8 i shows a source - yard truck view to work on the move to complete the move . fig8 j shows a source - yard truck view to complete the move . fig8 k shows a source - dock view to view the assets at each dock . fig8 l shows a source - dock view to start loading . fig8 m shows a source - dock view to finish loading . fig8 n shows a source - dock view to create the move to the yard . fig8 o also shows a source - dock view to create the move to the yard . fig8 p shows a source - yard truck view to see and accept the move . fig8 q shows a source - yard truck view to complete the move . fig8 r shows a source - yard truck view to override the destination . fig8 s shows a source - dock view to see that an asset is ready to be picked up . fig8 t shows a hq view and a destination - ship view to see the process and , in particular , to see that the load is ready to be picked up . fig8 u shows a source - gate view to see that the carrier arrives with an empty drop , which , in an embodiment , is via a tag scan . fig8 v shows a source - gate view to check in an empty - drop trailer . fig8 w shows a source - gate view to fill in detailed information . fig8 x shows a source - gate view of a carrier that picks up a trailer that comes to the exit . fig8 y shows a source - gate view of a carrier exiting and ids for the trailer and shipment are tagged . fig8 z shows a source - gate view showing a carrier exits . fig8 aa is an hq view and a destination - ship view showing that a shipment is en route . fig8 ab is an hq view and a destination - ship view showing an inbound planner action panel . fig8 ac is a destination - gate view showing that a carrier arrives at the gate . fig8 ad is a destination - gate view showing that an urgent load is directed to door e 1 . fig8 ae is a source - ship view and an hq view showing the progress on recent departures . fig8 af is a destination - ship view and an hq view showing the progress on recent arrivals . fig8 ag is a destination - dock view to start unloading . fig8 ah is a destination - dock view to finish the unloading . fig8 ai is a destination - dock view to create a move . fig8 aj is a destination - yard truck view to see and accept the move . fig8 ak is a source - ship view and an hq view to show the progress and when the shipment is unloaded . fig8 al is a destination - dock view to close the shipment and accept the shipper load and count ( slc ). fig8 am is a source - ship view and an hq view showing a shipment is closed . it should be appreciated that in an embodiment , arrival event updates are sent to transportation management system ( tms ). in this case for illustrative purposes , the tms from oracle corp , referred to as otm , is used . any delays trigger one or more alerts . as well , because carriers also have access to the real time shipment status , they can better arrange just - in - time arrival , reducing loaded trailer idle time in the yard . embodiments herein enable faster check - in / check - out of the carrier driver , which saves significant driver idle time . it further should be appreciated that in accordance with embodiments herein , the carrier driver may pick up a different trailer at the destination site and depart . at this point the carrier may have completed its responsibilities for the shipment . significantly , getting the carrier driver in and out faster saves transportation cost . planning for the arrival of the trailer , reduces the idle time of the loaded trailer in the yard . fig9 a - 9o are sample screen shots of the exemplary live load scenario , according to an embodiment . fig9 a is a screen shot showing a shipment is created for a tendered shipment upload in the system . an outbound panel is shown in which information is requested and collected . for example , shipment id is requested and , in the screen shot , is depicted as shipment 9 . as another example , the destination is selected in a dropdown box as “ grb .” fig9 b is a hq view showing the shipment in the system . fig9 c is a source - ship view to show appointment information arrives via integration into the system . fig9 d is a source - gate view to show that the carrier checks in empty . fig9 e is a source - gate view showing that the carrier is directed to door 9 and that door 8 is busy . fig9 f is a source - dock view showing the trailers that are at which dock . fig9 g is a source - dock view to start loading . fig9 h is a source - dock view to finish loading . fig9 i is a source - gate view to show that the carrier arrives at the gate and the ids for the trailer and shipment are tagged . fig9 j is a source - gate view showing the carrier is checked out . fig9 k is an hq view and a destination - ship view showing that the shipment is en route . fig9 l is an hq view and a destination - ship view for arrival instructions . fig9 m is a destination - gate view to show the carrier is at the gate . fig9 n is a destination - gate view for last minute instructions , such as but not limited to “ convert to drop .” fig9 o is a destination - dock view about the particular trailer . it should be appreciated that in an embodiment , carrier arrival / departure times are reported to the otm . an embodiment provides delay alerting . in both drop / live scenarios the order fulfillment cycle is short . as mentioned hereinabove , the least common denominator model may be used in the provisioning of universal dashboards for shipment and trailer management based on such data . in this way , the universal dashboard enables different types of end users to share and communicate regarding common types of data and terminology . 4 . 3 . 1 exemplary exceptions and monitoring at site level with alerts and notifications in an embodiment , alerts and notifications are provided . for example , if there are situations that occur in the yard , then the system provides a set of site alerts . regarding particular assets , notifications are provided . as well , configurable business rules are provided that may be referred to as watches . an embodiment includes but is not limited to the following : pre - defined e . g . “ possible missed check - out ”; and configurable e . g . “ dock lane overstay ” configure n - hours fig1 a is a sample screen shot snippet of yard situation alerts and in particular a list of key performance indicators ( kpi ) reported in the yard situation area . for example , dock overstays , i . e . number of trailers that have been at the dock for too long , are 4 . the number loaded too long , i . e . the number of trailers that have been in a loaded state , is 6 . the number of missed checkouts is 1 , and the number of not scanned ( referring to the real time location system performance ) is 13 . in an embodiment , a complete list of available kpi measures may appear on the configuration page for this parameter . kpis may be customer specific and may differ from site to site . additionally , kpis may not appear unless there are instances of the condition they describe . fig1 b is a screen shot of yard situation details . for example , the figures show excess time at the dock doors and excess time in the loaded state — details of previous kpis . fig1 c is a screen shot of notifications created on individual or set of assets . fig1 d is a screen shot of notifications created on individual or set of assets for configurable conditions and recipients . fig1 e is a screen shot of particular watches . in an embodiment , watches are alerts that are emailed to users and are based on rules selected by the user . such rules may range from , but are not limited to , loaded too long , attribute changes , to auto checkout of assets for tasking only location . fig1 f is a screen shot illustrating that watches are a set of business rules . fig1 g is a screen shot illustrating that such business rules of fig1 f may be configured and instantiated as needed . fig1 h and fig1 i are each a screen shot of a configurable dashboard in according to an embodiment . an embodiment of the dashboard can be understood with reference to fig1 a - 11l . fig1 a is a sample screen shot of a central access to an entire network , according to an embodiment . in particular , it shows the monitoring view of data regarding trailers : overview and shipments : overview . it should be appreciated that sequence 11 b - 11 d is an example of a very structured kpi / metric that has been defined and that has acceptable value thresholds and an attached process of handling the situation when the site is outside the acceptable thresholds . fig1 b is a sample screen shot of the monitoring view of carrier trailer pool management , according to an embodiment . specifically , data displayed are by site and by scac contractual pool sizes that are not in compliance . any carrier that is below contractual threshold is highlighted for immediate action . fig1 c is a sample screen shot of the next step in the exemplary remediation process . when a user clicks on the cell in fig1 b representing alam 1 site , for carrier scac abkw the user sees the detail that while the contract specifies 3 - 5 trailers , currently there are 2 . this sample shows that access to site details may be obtained at central transportation control . fig1 d is the next step of detail , namely the actual list of trailers and their current state , showing how information is actionable , according to an embodiment . a next step may be to inform a carrier with an e - mail with the on screen action button . sequence 11 e - 11 h is an example of a situation where a user may not have a very well defined metric / kpi for a condition . however , an experienced user may be looking at the situation more broadly to identify a condition that is problematic , even when there may be no particular rule that identifies it as such . the intent of such sequence example is that over time such type of exercise using embodiments herein may result in additional structured kpis . fig1 e is a screen shot of a sample dashboard view for monitoring a yard , referred to therein as yard slicer , according to an embodiment . in particular , statistical data are computed and presented for check - in date , arrival time of day , trailer count by time in yard , trailer count by time in current state , etc . it should be appreciated that not every situation can be reduced into one kpi , and , thus , by way of the dashboard , one skilled in the art may slice - dice the data . for example , one may click and drag interface attributes to simplify access . this particular example focuses on aging trailers in yard . fig1 f is a screen shot of the dashboard in which an aged trailer still in inbound state is clearly indicated , according to an embodiment . fig1 g is a screen shot of an example execution view in which it is shown that the first level of detail reveals no action has been taken on trailer . fig1 h is a sample screen shot of site level detail , which can be accessed at central control , according to an embodiment . see fig1 i is a screen shot of a monitoring view of example kpi values , according to an embodiment . for example , one skilled in the art may use such configured dashboard page to manage that trailers should not idle in “ inbound loaded ” or “ outbound loaded ” state above set thresholds ( separate for live vs . drop ) and other similar drill down capabilities . fig1 j is a screen shot of a monitoring view of more kpls , according to an embodiment . some kpi exception management examples may include but are not limited to : real time focus on appointments ; and any late arrivals or departures immediately flagged . it should be appreciated that in an embodiment the system may know appointment times through integration ; actual execution details , appointment adjustments are managed by users on the ground , supported by rfid data gathering automation . it should be appreciated that fig1 i and fig1 j depict structured cases . it should be appreciated that in an embodiment , such dashboards are configured to be visible and legible when accessed from tablets , smartphones , or any device and from anywhere . as mentioned above , the least common denominator data model combined with the vast and varied data stored at the corporate level and at the local level allow for the computing of meaningful , optimized statistics regarding trailers and shipments . an embodiment is provided that uses such vast amount of collected or stored data to provide the basis for a plethora of reports . one embodiment enables number metrics to be planned , projected , determined , etc ., based on analyses of such data . as well , kpis may be determined from analyses of the data or may be used to drive the business , such as for example in setting target metrics . an embodiment enables analyzing elements and events for the purposes of understanding performance . for example , events may be placed into categories or buckets to help organize and determine solutions to particular areas . for example , placing events in particular categories may be used to answer the following questions : “ if everything goes well , what happens ? what are the exceptions that i &# 39 ; m having ? what can i do to reduce them ? what are the unmodeled exceptions ? are these happening frequently enough so that i need to model it , because they are a cost of doing business ? or , if something that i modeled never occurs , then maybe i should get rid of it and treat this as an unmodeled exception .” the system may be configured to enable a user to detect inefficiencies , such as for example , determine how long a trailer , on average , sits in the yard waiting to be picked up . the user may not want to keep a trailer which broke down , had a flat tire , could not move , and had a missing part such that it sat in the yard for four days . thus , the system provides a utility to such user by enabling him to determine by performing analytics and viewing related data that he does not want to keep such trailer . in an embodiment , performance metrics are derived based on positive paths , as well as handled exceptions . for example , using statistical analysis , exceptions may be determined based on the number of standard deviations away from the norm the exception may occur . an exception may be deemed an outlier or may illuminate an area which needs improvement . thus , the provided data model in accordance with embodiments herein enable , result in , and cause improved performance analysis . in an embodiment , the system is configured not to mix data among the three categories : positive path , modeled exceptions and unmodeled exception . such mixing may result in meaningless average numbers . for example , when a user is monitoring the data , the user may want to know if an operation is an unmodeled exception ; for example , if the user needs to get involved . if an operation is a modeled exception , then the user may want to continue to monitor such type of operation . for an example implementation , the modeled exception may cause a yellow alert , as opposed to a red alert , and the workers may be able to handle the exception . one embodiment is configured to provide the reports , number metrics , and kpls , as described hereinbelow . it should be appreciated that the particular details are illustrative and are not meant to be limiting . fig1 a is a sample performance report generated from the system , according to an embodiment . fig1 b is a sample trailer visit statistics report , according to an embodiment . fig1 c is another sample of a trailer visit statistics report , according to an embodiment . fig1 d is a sample shipments history report , according to an embodiment . fig1 e is a sample vector metric report , according to an embodiment . fig1 f is another sample number metric report where one compares numbers across the network , according to an embodiment . fig1 g is another sample number metric report , according to an embodiment . fig1 h is a sample graph of a number metric whose value is saved on a set interval , according to an embodiment . it should be appreciated that fig1 a and fig1 h depict structured kpi cases , enabling one skilled in the art to create similar reports to explore new kpi opportunities . similar to monitoring , analysis can be performed at site level or at corporate level . it should be appreciated that some of the previous examples under monitoring were to manage exceptions in real time . here we provide an example of using past data to identify trouble spots . fig1 is a screen shot of an analysis view , according to an embodiment . for example , statistical values regarding source facility , destination facility , and dwell times are computed and presented . fig1 shows an example of using past data to identify trouble spots to define new metrics . the system is configured to enable easy navigation . for example , the system is configured to allow a user to look at all shipments from the last month with click and drag . in this example , a user is able to look at all shipments from alameda i to alameda iv and see that a large variance of total duration time is revealed . thus , the user can is enabled to ask himself what is the root cause , such as for example , is it day of the week . by way of this inventive dashboard , the user is enabled to target and focus on the root cause of a problematic area and make corrections thereto . it should be appreciated that fig1 depicts unstructured cases , enabling one skilled in the art to create similar reports to explore structured kpi opportunities at network level . as discussed hereinabove , the least common denominator model enables the provision of a platform , which , in turn , enables the provision of a universal dashboard as well as the generation of meaningful analysis and statistics . one embodiment can be understood with reference to fig1 a , a schematic diagram of main components of the platform at a high level . in the embodiment , individual facilities ( nst - med , dsc - pc1 , . . . ) use interfaces to manage execution . monitoring , and analysis functions from a site perspective . meanwhile services provided at network level , such as a corporate portal and asset manager may provide same functional categories from a corporate and network perspective for all corporations collaborating on this data . in one embodiment , each site can have their own data repository for their local data , while the collaborative data and application servers can be separated into five but not limited to five , sub - components , reflecting five different perspectives . such data are depicted in the figure as shipment manager , asset visit manager , analysis manager , authentication manager , and asset manager , respectively . it should be appreciated that one skilled in the art could readily recognize that such volume of comprehensive trailer and shipment data that is accessible at the network level may be organized in a variety of ways and that the five categories depicted therein are illustrative and are not meant to be limiting . as well , such volume of data may be organized for various audiences as discussed hereinabove . as well , depending on type of access whether it is for execution and monitoring for real time transactions , or after the fact off - line analysis a user can structure the data differently to meet latency and throughput requirements . finally a plurality of interfaces can be provided at the network level such as a carrier portal , driver portal , 3pl portal etc . fig1 b is a schematic diagram that illustrates main components from the enterprise perspective , according to an embodiment . in the embodiment , automated data is gathered , e . g . via hardware on yard trucks and facility gates using , but not limited to using , gps , rfid sensors , and the like . the embodiment provides a web hosted solution that may be scalable , performs computations , and validates input data , and so on . such web hosted solution enables streamlined local integrations as well as asset management across sites . the embodiment provides relevant interfaces including but not limited to interfaces for execution , monitoring , analysis , and planning . an embodiment contemplates or provides global back end capabilities including but not limited to : ability to analyze closed shipments and trailer visits central location for kpi trends from each site list of users list of trailers , permanent tags , characteristics list of drivers , e . g . drivers as assets list of facilities contains kpis / dashboards from all sites in one central location ability to view dashboard boxes from multiple sites on one page ability to create dashboard boxes against multiple sites ability to click through to additional detail in an embodiment , a corporate portal may provide but is not limited to provide the following capabilities : single sign on to all facilities ability to operate on shipments and trailers that are en route to a corporate facility ability to click through to additional detail ability to view dashboard boxes from multiple sites on one page ability to create dashboard boxes against multiple sites centralize certain site responsibilities to reduce headcount and increase execution precision perform shipment and trailer planning at hq move certain check - in / check - out tasks to a central location improve load planning with tare weights tighter management of trailer pools accelerate a driver &# 39 ; s and tractor &# 39 ; s visit through the facility accelerate a trailer &# 39 ; s visit through the facility collaboration with suppliers and customer to reduce empty miles reduce safety stock inventory fig1 is a block schematic diagram of a system in the exemplary form of a computer system 1500 within which a set of instructions for causing the system to perform any one of the foregoing methodologies may be executed . in alternative embodiments , the system may comprise a network router , a network switch , a network bridge , personal digital assistant ( pda ), a cellular telephone , a web appliance or any system capable of executing a sequence of instructions that specify actions to be taken by that system . the computer system 1500 includes a processor 1502 , a main memory 1504 and a static memory 1506 , which communicate with each other via a bus 1508 . the computer system 1500 may further include a display unit 1510 , for example , a liquid crystal display ( lcd ) or a cathode ray tube ( crt ). the computer system 1500 also includes an alphanumeric input device 1512 , for example , a keyboard ; a cursor control device 1514 , for example , a mouse ; a disk drive unit 1516 , a signal generation device 1518 , for example , a speaker , and a network interface device 1528 . the disk drive unit 1516 includes a machine - readable medium 1524 on which is stored a set of executable instructions , i . e . software , 1526 embodying any one , or all , of the methodologies described herein below . the software 1526 is also shown to reside , completely or at least partially , within the main memory 1504 and / or within the processor 1502 . the software 1526 may further be transmitted or received over a network 1530 by means of a network interface device 1528 . in contrast to the system 1500 discussed above , a different embodiment uses logic circuitry instead of computer - executed instructions to implement processing entities . depending upon the particular requirements of the application in the areas of speed , expense , tooling costs , and the like , this logic may be implemented by constructing an application - specific integrated circuit ( asic ) having thousands of tiny integrated transistors . such an asic may be implemented with cmos ( complementary metal oxide semiconductor ), ttl ( transistor - transistor logic ), vlsi ( very large systems integration ), or another suitable construction . other alternatives include a digital signal processing chip ( dsp ), discrete circuitry ( such as resistors , capacitors , diodes , inductors , and transistors ), field programmable gate array ( fpga ), programmable logic array ( pla ), programmable logic device ( pld ), and the like . it is to be understood that embodiments may be used as or to support software programs or software modules executed upon some form of processing core ( such as the cpu of a computer ) or otherwise implemented or realized upon or within a system or computer readable medium . a machine - readable medium includes any mechanism for storing or transmitting information in a form readable by a machine , e . g . a computer . for example , a machine readable medium includes read - only memory ( rom ); random access memory ( ram ); magnetic disk storage media ; optical storage media ; flash memory devices ; electrical , optical , acoustical or other form of propagated signals , for example , carrier waves , infrared signals , digital signals , etc . ; or any other type of media suitable for storing or transmitting information . further , it is to be understood that embodiments may include performing operations and using storage with cloud computing . for the purposes of discussion herein , cloud computing may mean executing algorithms on any network that is accessible by internet - enabled or network - enabled devices , servers , or clients and that do not require complex hardware configurations , e . g . requiring cables and complex software configurations , e . g . requiring a consultant to install . for example , embodiments may provide one or more cloud computing solutions that enable users , e . g . users on the go , to manage shipment on such internet - enabled or other network - enabled devices , servers , or clients . it further should be appreciated that one or more cloud computing embodiments include managing shipment using mobile devices , tablets , and the like , as such devices become standard consumer devices . although the invention is described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the spirit and scope of the present invention . accordingly , the invention should only be limited by the claims included below . | 6 |
fig1 shows a simplified version of the resuscitation device 1 . the mechanisms used for compressing the chest includes compression assembly 2 which includes a chest compression belt 3 with buckles 4l and 4r , a friction liner 5 , a support board 6 and a motor driven spool assembly 7 . the support board 6 is placed under a cardiac arrest victim , and the compression belt 3 and friction liner 5 are wrapped around the victim &# 39 ; s chest . the chest compression belt , having a left side 3l and a right side 3r , is buckled over the victims chest by latching the buckles 4l and 4r together . in this configuration , the friction liner 5 will fit between the chest compression belt 3 and the victim and any clothes worn by the victim . the compression belt may be made of any strong material , and sail cloth has proven adequate for use . the compression belt may also be referred to as a vest , corset , girdle , strap or band . the friction liner may be made of teflon ®, tyvek ™ or any other low friction material ( by low friction , we mean a material that will permit sliding of the compression belt with less friction than expected between the belt and the victims clothing or bare skin ). the friction liner may be made with any suitable lining material , as its purpose is to protect the victim from rubbing injury caused by the compression belt , and it may also serve to limit frictional forces impeding the compression belt operation . the friction liner can be provided in the form of a belt , vest , corset , girdle , strap or band , and may partially or completely encircle the chest . the front of the compression belt 3 , including the buckles 4l and 4r , are configured to provide a broad pressure point over the sternum of the victim . this is illustrated in fig2 . large openings 8 may be provided to accommodate female breasts and obese male breasts . the underside of the buckles 4l and 4r are smooth and broad , to distribute compressive force evenly over a wide area of the chest corresponding to the sternum . the point at which the buckle attaches to the chest compression belt may vary considerably , from the front of the chest to the back of the compression assembly , and the openings 8 may be provided in the buckles rather than the belt itself . fig3 shows a detail of the buckles 4l and 4r used to fasten the compression belt about the chest of the victim . the buckle may be of any type , and preferably includes a latch sensing switch 9 operably connected through wire 10 the motor control system ( see fig1 ) to indicate that the device has been buckled about the victims chest and is ready for the initiation of compression cycles . the buckles shown in fig3 are d - ring shaped buckles with large openings 8 , attached to the compression belt 3 . other fasteners and fastening means may be used . the chest compression belt 3 is repeatedly tightened about the chest of a victim through the action of one or more tightening spools which make up the spool assembly 7 located within the support board 6 . the spool assembly , illustrated in fig4 includes at least one spool or reel connected to the compression belt 3 at the back of the belt , preferably near the center or saggital line 11 of the compression belt ( although it may be located on the front or side of compression belt ). fig4 shows a view of the spool assembly and its attachment to the compression belt . a spool assembly includes a single drive spool 12 operably connected to the motor 14 through drive shaft 15 . the compression belt is secured to the drive spool in any suitable manner . in this case a longitudinal slot 16 provided in the drive spool 12 . the slot extends radially or chordally through the drive spool , and extends axially for a length corresponding to the width of the compression belt , leaving the ends 17 solid for connection to the drive shaft 15 and journal shaft 18 . the belt is slipped through the slot to created a secure connection between the belt and the drive spool . when secured in this manner , the rotation of the drive spool 12 will take up the right side of the compression belt 3r and the left side of the compression belt 3l and roll them up onto the spool , thus tightening the compression belt about the chest of the victim wearing the device . spindles or alignment rollers 19 provide for alignment and low friction feed of the belt onto the roll created by operation of the drive shaft . many alternative embodiments can be envisioned for the rolling mechanism , and one such alternative is illustrated in fig5 . spools 12r and 12r are aligned in parallel and interconnected by a transmission gear 20 and planetary gear 21 and journaled upon shafts 18l and 18r . the drive shaft 15 is attached to spool 12r ( or spool 12l ) and operably attached to motor 14 . the motor turns the shaft 15r and spool 12r in a counterclockwise direction to pull the right side of the compression belt 3r to the left and roll onto the spool . the transmission gear 20 acts upon the planetary gear 21 to cause clockwise rotation of spool 12r , which in turn pulls and wraps the left side of the compression belt 31 onto the spool 121 . thus , many embodiments of mechanisms which can cause repeated cyclic tightening of the compression vest about the chest of the victim may be envisioned . the compression belt serves to radially compress the chest through the cooperative action of the belt , board , and buckle , and to disperse the compressive force around the chest . the motor is energized to rotate the spools and cause the compression belt to constrict around the chest of a victim . a motor such as a battery operated hand drill motor provides adequate chest compression for the purposes of cpr . to cause repetitive constriction of the compression belt 3 , the motor 14 must be attached via a clutch 22 or other such mechanism . the motor 14 may be attached to the drive shaft 15 through a torque slipping clutching mechanism which engages the drive shaft until a high torque is achieved ( indicating great resistance to further constriction , and thus indicating that the victim &# 39 ; s chest has been compressed ), and releases automatically upon such high torque , only to re - engage after the belt has been expanded in response to the normal elastic expansion of the victim &# 39 ; s chest . in this manner , repetitive compression is achieved without need to repeatedly energize and de - energize the motor , thereby extending the length of operating time for any given battery supply . alternatively , the motor may be repeatedly energized and de - energized , with the spools spinning freely during periods in which the belt is de - energized , wherein the clutch mechanism 22 will be similar to clutch mechanisms used on electric drills ( which engage during operation of the drill but spin freely when the drill is de - energized ). while the natural elastic expansion of the chest should make it unnecessary to drive the belt toward a loose condition , positive loosening may be achieved by reversing the motor or reversing the action of the motor through appropriate clutch or gear mechanisms . timing of compressions is regulated through a computer module or a simple relay ( windshield wiper style relays ), and preferably will conform to standard of the advanced cardiac life support guidelines or cardiopulmonary resuscitation guidelines , or any other medically acceptable resuscitation regime . current guidelines put forth by the american heart association call for 60 - 100 chest compressions per minute . the motor is preferably battery powered , with provisions for taking power from any available power source . batteries 23 may be stored within the support board 6 . three volt batteries of convenient size , already available for use with numerous power tools , provide about five minutes of compression per battery , while twelve volt batteries ( 1700 ma - h per battery ) have provided about ten minutes of compression per battery . a thirty minute total battery capacity is desirable ( corresponding to the estimated average time between cardiac arrest and transport to the hospital ). accordingly , several batteries may be installed within the support board and electrically connected to the motor and its controller . the batteries are provided with a trickle charge through a charger socket and charger plugged into 120v ac power when the device is not in use . ( it is intended that the device be installed in factories , office buildings , airplanes and other facilities with relatively stable sources of power , and that the unit remain plugged in and charging when not in use .) if ac power is readily available at the site of use , the device may continue to run on ac power to preserve the batteries for later use . the unit may also be plugged into an automobile power jack with an appropriate auto adapter , thus providing for use where an automobile is the only source of power , and for extended use in an ambulance . fig6 shows the resuscitation device installed on a cardiac arrest victim . the support board is placed under the victim , and the right and left portions of the compression belt are wrapped around the victim &# 39 ; s chest and buckled over the front of the chest , indicated by arrow 25 . once in place , the system may be put into operation by manually starting the motors or by automatic initiation given the proper feedback from sensors located on the device , including the buckle latch sensors . a number of features may be combined with the basic system described above . the structure necessary for housing the operating mechanism for the belt , referred to as the support board above , can serve also as storage for additional devices used during resuscitation . fig7 illustrates the resuscitation device 1 in a potential commercial embodiment . the support board 6 is sized to reach approximately from the lower lumbar region to the shoulders of a victim . the compression module 26 is separable from the support board 6 , and includes the compression belt and friction vest stored within the compression module . the spool assembly and motor are also stored within the compression module , although the motor may also be installed in the support board . in this figure , the compression module comprises a small support board 27 which fits into the larger system support board 28 . taking advantage of available space in the system support board , a compartment 29 for storage of airway management devices ( bag masks , oxygen masks , etc . ), and a compartment 30 for storage of defibrillation equipment ( electrodes and paddles , etc .) are included with the support board . a control and communication module 31 may also be incorporated into the support board . a small oxygen bottle 32 may be included , along with hoses routed to an accessible point on the board , and any connector desired for connection between the oxygen bottle and devices provided in the airway management compartment . batteries 23 are stored within the support board ( the number of the batteries chosen according the desired operating time , and the placement of the batteries dictated by available space ). batteries are operably connected to the motor in the compression module through electrical connectors 33 and appropriate wiring throughout the support board . the batteries can also be operably connected to the defibrillation module and control and communications module . although long life batteries can be used , rechargeable batteries may be preferred . accordingly , charging connection 34 on the support board is provided for charging the batteries or operating the device through outside power supplies . the device is intended to be stored for long periods of time between uses , and storage holder 35 is provide for this purpose . the storage holder can include such necessities as power supply connectors , power plug , a charging transformer . a removal sensor 36 is included in the support board to sense when the support board is removed from the storage holder ( which , as described below , can be used as a condition indicating use of the device , and therefore the need to alert emergency medical personnel ). the removal sensor can comprise a simple limit switch which senses physical removal of the system , and the limit switch can be used as a power switch or awaken switch which starts initiation of the system . the removal sensor can comprise a current sensor on the charging lines which treat cessation of charging current , increase in current draw through the charging system , or motor current as an indication of use . the choice of sensor may be made with many practical considerations in mind , such as the desire to avoid treating power outages as indications of use and other such unintended initiations . the state in which the device is deemed to be &# 34 ; in use &# 34 ; can be chosen according to the practical considerations , and in most instances it is expected that mere removal of the resuscitation device from the holder will constitute a clear signal someone has determined that a victim requires its use , and that emergency medical personnel should be dispatched to the location of the device . there are some environments in which later conditions will be used to indicate that the device is &# 34 ; in use ,&# 34 ; such as when installed in ambulances , airplanes , hospitals or other environments where it might be advisable to remove the device from its storage holder as a precaution or preparatory measure , and delay initiation of communications until the device is deployed or installed on the victim . in such cases , the buckle latch shown in fig3 can be used as the sensor that indicates that the resuscitation device is in use . fig8 shows the details of the compression module 26 . when not in use , the module is covered with a tear sheet 37 which protects the compression belt from wear . the buckles are readily visible under the tear sheet . the electrical connectors 38 connect the batteries in the support board with the motor inside the compression module . the inside of the compression belt is fitted with penetrating electrodes 39 in the right sternum parasaggital location 40 and left rib medial location 41 for establishing the electrode contact needed for ekg sensing . these electrodes may be dispensed in environments where proper placement of the defibrillation electrodes can be assumed due to a high level of training amongst likely bystanders and first responders . the friction vest 5 is secured to the compression module above the spool assembly location . fig9 shows a detail view of the defibrillation module in the compartment 30 . the defibrillation module includes a pair of defibrillation electrodes 42 connected to the batteries through the power connections 43 . the defibrillation electrodes will be controlled by circuitry housed within the defibrillation module , and may be connected to the control module through the data port 44 . the defibrillation module is releasably attached to the support board 28 with quick release latches 51 . tear sheet 46 protects the components of the defibrillation module during storage and provides ready access for use . fig1 shows the detail view of the airway management module in the compartment 29 , which includes an oxygen mask 47 , a length of tubing 48 and an air fitting 49 connecting the oxygen mask to the oxygen bottle within the support board . the oxygen mask serves as a blood gas exchange means , supplying oxygen to the lungs for exchange with blood gas such as co 2 . optional medicine injectors 50 may be operably connected to the masks or hose to provide for automatic injection of acls medications into the airway . the defibrillation module is releasably attached to the support board 28 with quick release latches 51 . tear sheet 46 protects the components of the airway management module during storage and provides ready access for use . an end - tidal co 2 monitor 52 can be included in the mask to provide for biological feedback and monitoring of the success of the cpr . a skin mounted blood oxygen level monitor 53 can also be mounted on the mask for the same purpose ( fingertip blood oxygen sensors may also be used , and supplied in the overall assembly to be readily available ). the biological data obtained by the sensors is transmitted to the control module via appropriate wiring in the mask and support board . fig1 shows a detail view of the control and communications module . the control unit 54 is connected to the compression module , defibrillation module and the airway management module through appropriate wiring through the support board . the control unit is optionally connected to the communications unit 55 . the communications unit includes means for communicating the ekg and other measured medical parameters sensed on the board to the screen 56 and via telephone to remote medical personnel . the communications unit can include a telephone handset or speaker phone . because the device is most likely to be used at a location separate from the storage holder , the communications module preferably includes a wireless communication device , such as wireless telephone , radio telephone or cellular , and any necessary telephone base will be installed in the storage holder . the communications unit and control unit are set up to operate in the following manner , also illustrated in the block diagram of fig1 . the device may remain mounted in a charging unit for months between use , and will be removed from the charging unit for use . upon removal of the device from its storage location , a sensor in the control unit senses the removal ( through limit switches , magnetic switches , or motion sensors , current sensors in the charging system , or otherwise ) and initiates the system , checking functions , energizing a display unit and accomplishing other typical warm - up functions . as a first step , the system initiates a telephone communication with a medical facility through the communications unit . the communication may use any communication medium , whether it be standard telephone lines , cellular telephone system , paging system or radio transmitter . the system may be set up to initiate communications with central medical facility , such as a local 911 emergency system , a nearby hospital or ambulance service , or a central facility staffed with medical personnel trained specifically on the remote use of the device ( all generally referred to as medical personnel ). upon establishing communication , the communications unit informs medical personnel of the location or identification of the device ( which may be stored in computer memory in the communications unit , or determined through gps or other such system ), and this information can be used to dispatch an emergency medical team to the location of the device . in a simple embodiment which does not require a computer to control the actions of the alert feature , the removal sensor may comprise a limit switch , while the communications module may comprise a simple telephone unit installed in the storage holder together with a tape recorded message , where the operation of the relay in response to removal of the resuscitation device includes initiation of the telephone call to 911 and playback of an alert message providing alert information such as the location of the board . the communications unit may also be provided with an alert button which may be operated by a bystander regardless of the use of the board to summon an emergency team to the location regardless of the condition of the resuscitation device . before the emergency medical team arrives , a bystander will place the board under the victim , buckle the compression belt around the victim and apply defibrillation and / or sensing electrodes ( or vice versa )( alternatively , sensing electrodes can be included on the inner surface of the compression belt ). the system monitors the installation of the belt through signals provided through latching sensors in the buckle . the system monitors biological input , which can comprise monitoring of ekg signals from the ekg electrode patches of the defibrillation module , monitoring ekg signals belt mounted electrodes , monitoring signals from an end - tidal co 2 monitor from the airway management module , and any other biological signal sensor incorporated into the device . the system can also monitor or respond to manually inputted instruction from the control unit , in order to provide on - site emergency medical personnel with control of the device when they arrive on scene . during operation , the system transmits all available biological information , including ekg signals , blood pressure , end - tidal co 2 and any other monitored biological parameter to the remote medical facility , and it can also transmit information regarding the configuration of the device , including battery life , system operating limit settings ( i . e ., whether the system is set for automatic operation , permissive operation , or disabled in any function ) so that medical personnel can ensure that the appropriate configuration is in effect . communication with the medical facility will allow emergency medical personnel to diagnose the condition of the patient and , through signals sent from the medical personnel to the communications unit , permit , initiate or prohibit certain additional therapeutic acls actions . for example , upon diagnosing the ekg conditions which indicate the need for defibrillation , the medical personnel can send a signal to the communications unit which acts upon the control unit to permit manual operation of the defibrillation electrodes by the bystander . the system also provides for application of a defibrillation shock via remote signal from the medical personnel . the device can incorporate the expert system such as the automatic external defibrillator . the medical personnel can also communicate other actions , and ensure that certain acts are undertaken by the bystander through the communication system . for example , the medical personnel may communicate verbally with the bystander to ascertain the cause of the cardiac arrest , the proper placement of the oxygen mask , appropriate clearing of the airway , and other information . where the airway management module is provided with medication such as epinephrine , lidocaine , bretylium or other drugs called for in the acls guidelines ( or newly proposed drugs such as t3 ), the medical personnel can instruct by - standers to inject appropriate medication through the airway . where automatic injectors such as those described in kramer , interactive external defibrillation and drug injection system , u . s . pat . no . 5 , 405 , 362 ( apr . 11 , 1995 ) are provided , or similar system with non - osseous injectors are provided , the medical personnel can instruct by - standers to inject appropriate medication through these injectors . where the injectors are provided with means for automatic operation based on measured ekg signals , blood pressure and end - tidal co2 , the medical personnel can send signals to the system to initiate injection by remote control of the medical personnel , permit injection by local control as determined by the expert system , permit injection by by - standers , or prohibit injection by the system or bystanders . for example , the system can be initially set up to forbid any injection . medical personnel , having diagnosed ventricular fibrillation through the information provided by the communications unit , can send an appropriate signal to permit or initiate injection of epinephrine , and also send a signal to prohibit injection of atropine until called for under the acls guidelines . a newly proposed drug t3 can be administered through the airway , into the lungs , as a therapy for cardiac arrest . controlled injection into the airway can be initiated or prohibited in the same manner . thus , all actions in the acls , including compression , defibrillation , drug injection can be accomplished through the system under the guidance of medical personnel from a remote location , or they may be accomplished through expert systems installed in the control module . each of these functions in incorporated in a system that automatically initiates communication with medical personnel and informs medical personnel of the location of the device so that emergency medical personnel my be dispatched to the location . the repeated compression will be initiated upon buckling of the compression belt ( automatically ) or a switch can be provided for the bystander to initiate compression . the system will continue compression cycles , until de - activated , according the motor control block diagram of fig1 . upon initiation of the system , the control unit will monitor installation of the belt via appropriate sensors in the buckles or through other sensors . when the motor control 57 receives the initiate compression signal from the control unit , the motor is started . the motor is preferably run continuously , rather than stopped and started , to avoid repeated application of startup current and thus conserve battery power . when the motor is up to speed , the clutch is engaged . as a baseline , the clutch is engaged every second for one - half second . this cyclic engagement of the clutch continues repeatedly for five cycles , as recommended by current cpr guidelines , and then is interrupted for a respiration pause , if desired . to avoid excessive drain on the batteries , the motor controller includes a torque sensor ( sensing current supply to the motor , for example ), and monitors the torque or load on the motor . a threshold is established above which further compression is not desired or useful , and if this occurs during the half second of clutch engagement , then the clutch is disengaged and the cycle continues . the system can monitor the effectiveness of the compression stroke by monitoring the co2 content of the victim &# 39 ; s exhalant . where co 2 content is low , indicating inadequate circulation , the control system increases the torque limit until the co 2 levels are acceptable ( or until the maximum torque of the motor is achieved .) this is another example of the device &# 39 ; s use of biological signals to control operation of the system . the cycle time and period , number of cycles between respiration pauses , and the torque limit , can be set according to current guidelines , and can also be varied by the remote medical personnel via the remote control capabilities of the control unit . thus , while the preferred embodiments of the devices and methods have been described in reference to the environment in which they were developed , they are merely illustrative of the principles of the inventions . other embodiments and configurations may be devised without departing from the spirit of the inventions and the scope of the appended claims . | 0 |
before the present methods are described , it is to be understood that this invention is not limited to particular methods , and experimental conditions described , as such methods and conditions may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to be limiting , since the scope of the present invention will be limited only by the appended claims . as used in this specification and the appended claims , the singular forms “ a ”, “ an ”, and “ the ” include plural references unless the context clearly dictates otherwise . thus for example , references to “ a method ” include one or more methods , and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are now described . all publications mentioned herein are incorporated herein by reference in their entirety . the present invention provides a method of identifying a human subject likely to benefit from treatment of obesity or an obesity - related condition with a cntf - related drug , where the identification of the subject is based upon their genotype . more specifically , the invention describes at least one genetic allele for optimizing efficacy and / or safety of drug therapy with a cntf - related drug . the method of the invention allows identification of human subjects most likely to receive maximum health benefits from treatment with a cntf - related drug . methods for identifying genetic variances and the presence or absence of specific alleles are known in the art , see for example u . s . 2004 / 0082000 , which publication is herein specifically incorporated by reference in its entirety . in related aspects , the invention features methods of identifying a human subject who should avoid treatment regimens involving a cntf - related molecule as a person unlikely to benefit from such treatment . by the term “ effective dose ” or “ therapeutically effective dose ” is meant a dose that produces the desired effect for which it is administered . the exact dose will depend on the purpose of the treatment , and will be ascertainable by one skilled in the art using known techniques ( see , for example , lloyd ( 1999 ) the art , science and technology of pharmaceutical compounding ). for example , when the condition being treated is obesity , a therapeutically effective amount of cntf or a cntf - related molecule is an amount which results in a medically meaningful or statistically significant weight loss . one of skill in the art understands how to determine whether weight loss is statistically significant . generally , statistical significance is recognized at p values of 0 . 05 , 0 . 01 , or 0 . 001 . the terms “ cntf - related diseases or condition ” are commonly recognized in the art and designate the presence of signs and / or symptoms in an individual or patient that are generally recognized as abnormal . diseases or conditions may be diagnosed and categorized based on pathological or undesirable changes . in a preferred embodiment , the disease or condition of interest is obesity . in another embodiment , the condition is metabolic syndrome ( also known as syndrome x ), generally defined as involving three of more of central / abdominal obesity , fasting triglycerides greater than or equal to 150 mg / dl , hdl cholesterol less than 40 mg / dl ( men ) or 50 mg / dl ( women ), blood pressure greater than or equal to 130 / 85 , and / or fasting glucose greater than or equal to 110 mg / dl . in another embodiment , the condition is non - insulin dependent diabetes mellitus ( type ii diabetes or niddm ), diabetic angiopathy , atherosclerosis , diabetic nephropathy , diabetic neuropathy , and diabetic ocular complications such as retinopathy , cataract formation and glaucoma ; dyslipidemia , polycysitic ovarian syndrome , hyperglycemia , hyperlipidemia , hypercholesterolemia , hypertriglyceridemia , hyperinsulinemia , and / or hypertension . in connection with the methods of this invention , unless otherwise indicated , the term “ suffering from a disease or condition ” means that a person is either presently subject to the signs and symptoms , or is more likely to develop such signs and symptoms than a normal person in the population . the term “ allele ” refers to the different sequence variants found at different polymorphic regions . the sequence variants may be single or multiple base changes , including without limitation insertions , deletions , or substitutions , or may be a variable number of sequence repeats . the term “ allelic pattern ” refers to the identity of an allele or alleles at one or more polymorphic regions . for example , an allelic pattern may consist of a single allele at a polymorphic site or either a homozygous or heterozygous state at a single polymorphic site . in the context of this invention , the term “ haplotype ” refers to a cis arrangement of two or more polymorphic nucleotides , i . e ., variances , on a particular chromosome , e . g ., in a particular gene . the haplotype preserves information about the phase of the polymorphic nucleotides — that is , which set of variances were inherited from one parent , and which from the other . a genotyping test does not provide information about phase . for example , an individual heterozygous at nucleotide 25 of a gene ( both a and c are present ) and also at nucleotide 100 ( both g and t are present ) could have haplotypes 25a - 100g and 25c - 100t , or alternatively 25a - 100t and 25c - 100g . only a haplotyping test can discriminate these two cases definitively . haplotypes may also be determined by detection of the expressed gene products of the hla locus via means known to the art , including , for example , serology . the terms “ variances ”, “ variants ” and “ polymorphisms ”, as used herein , may also refer to a set of variances , haplotypes or a mixture of the two , unless otherwise indicated . further , the term variance , variant or polymorphism ( singular ), as used herein , also encompasses a haplotype unless otherewise indicated . this usage is intended to minimize the need for cumbersome phrases such as : “ . . . measure correlation between drug response and a variance , variances , haplotype , haplotypes or a combination of variances and haplotypes . . . ”, throughout the application . instead , the italicized text in the foregoing sentence can be represented by the word “ variance ”, “ variant ” or “ polymorphism ”. similarly , the term “ genotype ”, as used herein , means a procedure for determining the status of one or more variances in a gene , including a set of variances comprising a haplotype . thus phrases such as “ . . . genotype a patient . . . ” refer to determining the status of one or more variances , including a set of variances for which phase is known ( i . e . a haplotype ). in preferred embodiments of this invention , the frequency of the variance or variant form of the gene in a population is known . measures of frequency known in the art include “ allele frequency ”, namely the fraction of genes in a population that have one specific variance or set of variances . the allele frequencies for any gene should sum to 1 . another measure of frequency known in the art is the “ heterozygote frequency ” namely , the fraction of individuals in a population who carry two alleles , or two forms of a particular variance or variant form of a gene , one inherited from each parent . alternatively , the number of individuals who are homozygous for a particular form of a gene may be a useful measure . the term “ genotype ” in the context of this invention refers to the alleles present in dna from a subject or patient , where an allele can be defined by the particular nucleotide ( s ) present in a nucleic acid sequence at a particular site ( s ). the process of genotyping involves using diagnostic tests for specific variances that have already been identified . it will be apparent that such diagnostic tests can only be performed after variances and variant forms of the gene have been identified . identification of new variances can be accomplished by a variety of methods , alone or in combination , including , for example . dna sequencing , sscp ( sequence specific oligonucleotide hybridization , sequence specific dna amplification ), heteroduplex analysis , denaturing gradient gel electrophoresis ( dgge ), heteroduplex cleavage ( either enzymatic as with t4 endonuclease 7 , or chemical as with osmium tetroxide and hydroxylamine ), computational methods ( described herein ), and other methods described herein as well as others known to those skilled in the art . in the context of this invention , the term “ analyzing a sequence ” refers to determining at least some sequence information about the sequence , e . g ., determining the nucleotides present at a particular site or sites in the sequence , particularly sites that are known to vary in a population , or determining the base sequence of all or of a portion of the particular sequence . in this regard , “ population ” refers to a defined group of individuals or a group of individuals with a particular disease or condition or individuals that may be treated with a specific drug identified by , but not limited to geographic , ethnic , race , gender , and / or cultural indices . in most cases a population will preferably encompass at least ten thousand , one hundred thousand , one million , ten million , or more individuals , with the larger numbers being more preferable . in preferred embodiments of this invention , the population refers to individuals with a specific disease or condition that may be treated with a specific drug . in embodiments of this invention , the allele frequency , heterozygote frequency , or homozygote frequency of a specific variance or variant form of a gene is known . in preferred embodiments of this invention , the frequency of one or more variances that may predict response to a treatment is determined in one or more populations using a diagnostic test . as used herein , the terms “ effective ” and “ effectiveness ” includes both pharmacological effectiveness and physiological safety . pharmacological effectiveness refers to the ability of the treatment to result in a desired biological effect in the patient , e . g ., weight loss . physiological safety refers to the level of toxicity , or other adverse physiological effects at the cellular , organ and / or organism level ( often referred to as side - effects ) resulting from administration of the treatment . on the other hand , the term “ ineffective ” indicates that a treatment does not provide sufficient pharmacological effect to be therapeutically useful , even in the absence of deleterious effects , at least in the unstratified population . ( such a treatment may be ineffective in a subgroup that can be identified by the presence of one or more sequence variances or alleles .) “ less effective ” means that the treatment results in a therapeutically significant lower level of pharmacological effectiveness and / or a therapeutically greater level of adverse physiological effects , e . g ., greater liver toxicity . the method of the invention encompasses the administration of [ ds1 ] cntf , or a modified variant thereof . in a preferred embodiment , the method of the invention is practiced with cntf or a modified cntf . a modified cntf molecule termed axokine ™ ( seq id no : 1 - 2 ) ( regeneron pharmaceuticals , inc .) described in u . s . pat . no . 6 , 472 , 178 , the disclosure of which is herein specifically incorporated by reference . modified cntf molecules useful in the method of the present invention include , for example , rg297 , rg242 , rhcntf , rhcntfδ13 , ax - 1 , ax - 13 , ax - 15 , or any other modified cntf that enhances the molecules therapeutic properties . the cntf and modified cntf molecules useful for practicing the present invention may be prepared by cloning and expression in a prokaryotic or eukaryotic expression system as described , for example in masiakowski et al . ( 1991 ) j . neurosci . 57 : 1003 - 1012 and in wo 91 / 04316 . the recombinant neurotrophin gene may be expressed and purified utilizing any number of methods . an allele associated with weight loss response to axokine ® treatment can be detected by any of a variety of available techniques , including : 1 ) performing a hybridization reaction between a nucleic acid sample and a probe that is capable of hybridizing to the allele ; 2 ) sequencing at least a portion of the allele ; or 3 ) determining the electrophoretic mobility of the allele or fragments thereof ( e . g ., fragments generated by endonuclease digestion ). the allele can optionally be subjected to an amplification step prior to performance of the detection step . preferred amplification methods are selected from the group consisting of : the polymerase chain reaction ( pcr ), the ligase chain reaction ( lcr ), strand displacement amplification ( sda ), cloning , and variations of the above ( e . g . rt - pcr and allele specific amplification ). oligonucleotides necessary for amplification may be selected for example , from within the hla drβ1 gene loci , either flanking the marker of interest ( as required for pcr amplification ) or directly overlapping the marker ( as in aso hybridization ). in a particularly preferred embodiment , the sample is hybridized with a set of primers , which hybridize 5 ′ and 3 ′ in a sense or antisense sequence to the allele of interest , and is subjected to a pcr amplification . an allele of interest may also be detected indirectly , e . g . by analyzing the protein product encoded by the dna . for example , where the marker in question results in the translation of a variable protein , the protein can be detected by any of a variety of protein detection methods . such methods include immunodetection and biochemical tests , such as size fractionation , where the protein has a change in apparent molecular weight either through truncation , elongation , altered folding or altered post - translational modifications . an allele whose presence is identified with individuals responding to obesity treatment with axokine ® with a medically meaningful weight loss is considered a desirable allele . examples of type of allele include allele 1501 of hla drβ1 . an allele whose presence is identified with individuals not responding to obesity treatment with axokine ® with a medically meaningful weight loss is considered an undesirable allele . examples of type of allele include allele 0701 of hla drβ1 . the present invention is useful in a diagnostic product to detect the presence of allele 1501 or structurally related alleles . accordingly , the invention encompasses the use of diagnostic kits based on a variety of methodologies , e . g ., sequence , chip , mass - spectroscopy , which are capable of finding signature sequences indicative of the hla alleles described herein or closely related molecules . the invention also provides an article of manufacturing comprising packaging material and a pharmaceutical agent contained within the packaging material , wherein the pharmaceutical agent comprises means for detecting the presence of allele 1501 or structurally related alleles , and packaging material comprises a label or package insert which indicates that the detection means can be used to identify a candidate subject suitable for treatment of obesity with axokine ®. the following example is put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the methods and compositions of the invention , and are not intended to limit the scope of what the inventors regard as their invention . efforts have been made to ensure accuracy with respect to numbers used ( e . g ., amounts , temperature , etc .) but some experimental errors and deviations should be accounted for . unless indicated otherwise , parts are parts by weight , molecular weight is average molecular weight , temperature is in degrees centigrade , and pressure is at or near atmospheric . determination of hla dr beta 1 allele correlating with weight loss resulting from axokine ® treatment . selection of treatment population . male and non - pregnant , non - lactating female subjects , aged 18 to 70 years , with a bmi ( body mass index : weight /[ height ] 2 ) of 27 to 55 kg / m 2 , inclusive , were selected for the study as follows : subjects having a bmi of 30 to 55 kg / m 2 in the absence of obesity - related risk factors or having a bmi of 27 to 55 kg / m 2 in the presence of obesity - related risk factors , such as hypertension , dyslipidemia , etc . blood specimens for the pharmacogenetic analysis were obtained with consent from approximately 530 patients who participated in the axokine ® clinical studies . these samples were acquired and dna was purified and stored . samples were coded via a process known as “ de - identification ”. the initial genotyping analyses focused on hla drβ1 . this locus is highly polymorphic and there are differences in frequencies of various alleles between populations of different ethnic background . in these clinical trials , approximately 85 % of subjects were of european - american origin ; therefore , only samples from these patients were genotyped , as numbers from other ethnic groups were considered too small to enable statistically meaningful results to be obtained . aliquots ( 50 ug ) of purified dna from each subject ( n = 562 ) were shipped frozen and analyzed by amplification and sequencing . coding on samples will remain “ as - is ” in “ de - identified ” state . genotyping and data reporting . high resolution sequence based genotyping was performed for hla dr betal allele identification ( 4 digit ) on all specified samples . results . high resolution of hla drβ1 was performed for every study subject of european - american descent who had provided a dna specimen . in an initial analysis , the frequency of the most common hla drβ1 alleles ( alleles 0701 , 1501 , 0301 , 0401 , 0101 , and 1101 ) were compared between the axokine ® study group and a published reference population ( klitz et al . ( 2003 ) tissue antigens 62 : 296 - 307 , herein specifically incorporated by reference in its entirety ). the allele frequency in the sample population was similar to that of the general population ( fig1 ). in the next analysis , the proportion of subjects with at least one of the common alleles was compared between subjects who tested positive for axokine ® antibodies at some point during the study . the subpopulation having allele 1501 composed about 25 % of the population and was found to correlate significantly with weight loss resulting from axokine ® treatment . fig2 shows that allele 1501 positive subjects had a mean weight loss of 2 . 5 kg relative to the mean weight loss of group d and 4 . 5 kg relative to the group expressing allele 0701 . the results are further summarized in table 1 for allele 1501 positive and negative subjects relative to their respective placebo - treated groups . 5 % responders are subject who lost 5 % or more of their initial body weight ; 10 % responders are subjects who lost 10 % or more of their initial body weight . | 2 |
the following describes , in detail , embodiments according to the present invention by reference to the accompanying drawings . fig2 depicts a block diagram illustrating a computer system based on the present invention in which the c compiler runs . the computer system comprises a cpu 201 , a main storage 202 , an external storage 203 , a display device 204 and a keyboard 205 . the keyboard 205 allows a user to enter a compiler start command . the display 204 shows a compile end message or an error message . the external storage 203 stores a source program 206 and an object program 207 . the main storage 202 stores an intermediate language 208 , a symbol table 209 , a reference table 210 of array elements in a loop and a loop table 211 which are needed in a compiling process . the cpu 201 control the compiling process . fig3 depicts a flow chart illustrating the compiling process . the compiling process is carried out in an order of a lexical analysis 301 , a syntax analysis 302 , a transposition 303 , an optimization 304 and a code generation 305 . the lexical analysis 301 , the syntax analysis 302 , the optimization 304 and the code generation 305 are the same as in the usual compiling process . the following briefly describes these steps . the lexical analysis in step 301 arranges the c source program stored in mere character strings to lexicon ( word ) strings . a method for the lexical analysis is described , for example in the &# 34 ; compiler i -- principles , techniques and tools ,&# 34 ; science inc ., by aho , et al . fig4 depicts an example of the c source program . this is lexically analyzed to lexicon strings as shown in fig5 . in fig5 each of the words is represented by a set of kind 501 and lexicon 502 . the words are arranged in order of occurrence in the source program . keywords of the kind include a keyword for the program an &# 34 ; id &# 34 ; for identifier , a &# 34 ; punc &# 34 ; for punctuation and a &# 34 ; num &# 34 ; for number . step 302 analyzes the lexicon strings . the syntax analysis is different in the process depending on a statement which is a declaration or execution . for the declaration statement , the identifier declared is registered in the symbol table 209 . for the execution statement , the intermediate language 208 is created . a method for the syntax analysis , a method for creating the symbol table 209 and a method for creating the intermediate language 208 are also described in the &# 34 ; compiler i -- principles , techniques and tools &# 34 ; mentioned above . fig6 is an example of the symbol table 209 , which corresponds to the program in fig4 . data registered in the symbol table 209 in fig6 include names 601 , occurrence positions 602 , types 603 and transposition flags 604 . the names 601 are names of the identifiers . the occurrence positions 602 are positions at which the identifiers are declared , or positions in or out of the function . the types 603 represent types of the identifiers . as an example , &# 34 ; array ( int , 200 , 300 )&# 34 ; represents a type of &# 34 ;( two - dimensional ) array in which an element type is an integer and the number of elements is 300 * 200 .&# 34 ; the transposition flags 604 are flags set at the transposing step 303 , which as will be described later , are initially set to &# 34 ; off &# 34 ;. fig7 depicts an example of the intermediate language 208 , which also corresponds to the program in fig4 . in the figure , the intermediate language 208 is represented by a tree . the tree is a set of nodes and edges . in the memory of the computer , each of the nodes is represented by a memory area of fixed or variable length , and each of the edges is represented by a pointer indicating an address of the area . in the figure , however , the node is represented by a square , and the edge by a connecting line between the nodes . each node points to one parent node and zero or more child nodes . note that only a special node , called the route , points to no parent node . in the figure , the edge extending upward from the node points to the parent node and the edge extending downward points to the child note . the children are called the first child , the second child , and so on from the left . as an example , the parent node of &# 34 ;{ }&# 34 ; 703 is &# 34 ; func &# 34 ; 701 , and the child node is &# 34 ; for &# 34 ; 704 . the route node is &# 34 ; func &# 34 ; 701 . the tree is used in many compilers since it is suitable to represent a logical structure of the program . step 303 executes the transpositioning process , which will be described in detail later . step 304 scans the execution statements represented in the tree structure and optimizes the program by finding redundant portions to delete . the optimization step is also described in the &# 34 ; compiler i -- principles , techniques and tools &# 34 ; mentioned above , and is described no more here as it has no relationship to the essence of the present invention . step 305 generates the object program stated in assembly language before feeding it out to the object program 207 . ( there is a compiler that can generate an object module in machine language .) the symbol table generates a define area instruction and a define constant instruction in assembly language . the intermediate language generates a machine language instruction in assembly language . this code generation process also is described no more here as it has no relationship to the essence of the present invention . the following describes the process at step 303 in detail which is a feature of the present invention . fig1 depicts a detailed flow chart of the transposition 303 . the transposition process is carried out in the order of a loop structure recognition 101 , an array reference analysis 102 in the loop , a transposition target array selection 103 , and array copy code generation 104 and an array element reference replacement 105 . the following describes these steps in detail . step 101 recognizes the loop structure . this step scans the intermediate language to find the node representing the loop before recognizing a sentence which is repeatedly executed in the loop . ( the sentence is hereinafter referred to as the loop execution statement .) the step then registers the statement in the loop table 211 . the nodes representing the loop in the c language include &# 34 ; for &# 34 ; and &# 34 ; while &# 34 ;. the loop structure recognition is described below by reference to the example of the intermediate language in fig7 . scanning is started with the route of the tree . the &# 34 ; func &# 34 ; 701 represents a function definition . the first child represents a function name &# 34 ; main &# 34 ; 702 , and the second child is a function body &# 34 ;{ }&# 34 ; 703 . if scanning is moved to the second child &# 34 ;{ }&# 34 ; 703 , then it finds a first statement &# 34 ; for &# 34 ; 704 which is a kind of loop node . since the fourth statement represents the statement to be executed by the &# 34 ; for &# 34 ; node , scanning is moved to the fourth child . ( the first child is an initial value setting statement , the second child is a repetition judging statement , and the third child is a control variable updating statement . these will be described later .) the fourth child &# 34 ; for &# 34 ; 705 is again a &# 34 ; for &# 34 ; node ( a second &# 34 ; for &# 34 ; statement ). when the scanning reaches the fourth child , there is a &# 34 ; for &# 34 ; node 706 ( a third &# 34 ; for &# 34 ; statement ). scanning , then , is moved to a fourth child &# 34 ;{ }&# 34 ; 707 . a child of the fourth child &# 34 ;{ }&# 34 ; 707 is an assignment node &# 34 ;=&# 34 ; 708 . it is seen that the loop nest below 704 is a triple nested loop , and the loop executed statement is represented by node 708 . fig1 depicts a structure of the loop table . for each of the loops , a loop number 1001 , a node 1002 , a control variable 1003 , a child loop list 1004 , an execution statement list 1005 and a number of repetition times 1006 are registered . the loop numbers 1001 are numbered with 1 , 2 , 3 , and so on in the order of occurrence . the node is a node representing the loop . the loop control variable is a variable that is defined by the first child of the loop child , compared by the second child and added with only one ( 1 ) by the third child . in the case of the &# 34 ; for &# 34 ; node 706 , for example , a variable &# 34 ; k &# 34 ; is defined by the first child &# 34 ;=&# 34 ; 715 , compared by the second child &# 34 ;& lt ;&# 34 ; 716 and added with one by the third child &# 34 ;++&# 34 ; 717 . the variable &# 34 ; k &# 34 ; is the loop control variable . the child loop list 1004 is a list of numbers of the loops which are directly contained in the loop . the execution statement list is a list of the execution statement nodes directly contained in the loop . the &# 34 ; for &# 34 ; node 706 , for example , contains the assignment &# 34 ;=&# 34 ; node 708 as the execution statement . the number of repetition times is a range of the control value of &# 34 ; k &# 34 ;, or the final value minus the initial value plus one ( 1 ). for the &# 34 ; for &# 34 ; node 706 , as an example , the variable &# 34 ; k &# 34 ; takes the initial value of 0 and the final value of 299 as the loop is repeated while the &# 34 ; k &# 34 ; is less than 300 . the number of repetition times , therefore , is 300 . this ends the recognition of the loop structure . next , are analyzed in step 102 the array references in the loop . the intermediate language of the loop execution statement is scanned , the array reference node is found , an array name , a subscript expression and a reference state are checked , and the results in the reference table 210 of the array elements in the loop are registered . this process is described below by reference to the example of the intermediate language in fig7 . in the intermediate language , the second child of the array element reference node &# 34 ;[ ]&# 34 ; represents a subscript of a dimension which is farther right , and the first child represents a subscript or an array name of a dimension which is farther left . the first child of the assignment node ( indicated by &# 34 ;=&# 34 ;) represents an assignment destination ( definition side ), and the second child represents an assignment source ( use side ). the process is started from the loop execution statement in the example in fig7 since the statement is an assignment statement for node 708 . a first child of node 708 is &# 34 ;[ ]&# 34 ; 709 , and a second child is &# 34 ; j &# 34 ; 710 . a first child of node &# 34 ;[ ]&# 34 ; 709 is &# 34 ;[ ]&# 34 ; 711 again of which a second child is &# 34 ; k &# 34 ; 712 . a second right subscript of the array element expression , therefore , is &# 34 ; k &# 34 ;. a first child of &# 34 ;[ ]&# 34 ; 711 is &# 34 ; a &# 34 ; 713 , which is an array name . these can be summarized : it can be found that the array name of the array reference expression below &# 34 ;=&# 34 ; 709 is &# 34 ; a &# 34 ;, the array dimension is two , the subscript expression of the first dimension ( leftmost ) is &# 34 ; k &# 34 ;, and that of the second dimension is &# 34 ; j &# 34 ;. the array reference expression is on the definition side as it is the first child of the assignment node &# 34 ;=&# 34 ; 708 . an array element reference expression of the second child of the &# 34 ;=&# 34 ; 708 is analyzed in a similar way . with the analysis described above , we should create an array element reference expression table as shown in fig8 . as to the array reference expressions in execution , the array element reference expression table holds the array name 801 , the number of dimensions 802 , the subscript expression list 803 which is a list of the &# 39 ; subscript expressions of the dimensions , the states of reference for differentiating definition from use and the loop list which is a list of the loop nodes containing the array element expressions . next , step 103 selects the array to be transposed . the step obtains the transposition flag &# 34 ; c &# 34 ; and the dimension &# 34 ; p &# 34 ; for each of the arrays ( the array names ) occurring in the array element reference table which is to be transposed . the array is not transposed if &# 34 ; c = false &# 34 ; or &# 34 ; p = 0 &# 34 ;. an algorithm for obtaining &# 34 ; c &# 34 ; and &# 34 ; p &# 34 ; for the given array is described below with reference to a flow chart in fig9 . as an example , let the array reference expression table in fig8 and the intermediate language in fig7 be used . the transposition flag &# 34 ; c &# 34 ; and the dimension &# 34 ; p &# 34 ; for array &# 34 ; a &# 34 ; are obtained since only array &# 34 ; a &# 34 ; occurs in the table in fig8 . let the transposition flag &# 34 ; c &# 34 ; be off and the dimension &# 34 ; p &# 34 ; be 0 . step 902 checks whether or not there are any array element reference expressions which are not processed yet for the given array . if not , the process ends . if so , only one of the reference expressions is taken out and control then goes to step 903 . first , the first reference expression 806 is taken out since array &# 34 ; a &# 34 ; has two reference expressions . step 903 checks whether or not the subscript list of the reference expression has the control variable for the innermost loop . if not , control returns to step 902 . if so , control goes to step 904 . the innermost loop is indicated by a loop number of the last ( the rightmost ) loop in the loop list . its control variable is indicated by a control variable in the loop table . for the reference expression 806 , the last loop in the node list is &# 34 ; 1 &# 34 ; and the control variable is &# 34 ; k &# 34 ;. control goes to step 904 as the subscript list for the reference has expression 806 has &# 34 ; k &# 34 ; listed first . let the dimension of the subscript expression containing the innermost loop control variable by &# 34 ; q &# 34 ;. &# 34 ; q &# 34 ;= 1 as the subscript list for the subscript expression 806 has &# 34 ; k &# 34 ; listed first . step 905 checks whether or not &# 34 ; q &# 34 ; is equal to the number of dimensions of the reference expression or if &# 34 ; q &# 34 ; is the rightmost dimension . if so , control goes to &# 34 ; c = false &# 34 ; at step 906 before ending . for the reference expression 806 , &# 34 ; q = 1 &# 34 ; and control goes to step 907 since the number of dimension is 2 . step 907 checks whether or not &# 34 ; p = 0 &# 34 ; or &# 34 ; p = q &# 34 ; has been held . if so , control goes to step 908 . if not , control goes to &# 34 ; c = false &# 34 ; at step 906 before ending . for the reference expression , control goes to step 908 as &# 34 ; p = 0 &# 34 ;. step 908 checks whether or not a memory location indicated by the reference expression is accessed two or more times in the loop . if so , &# 34 ; c = true &# 34 ; is made at step 909 . if not , &# 34 ; c &# 34 ; is left as it was , and control returns to step 902 . accessing two or more times in the loop is checked by comparing the total number of repetition times of the loops with the number of memory locations indicated by the reference expression . if the former is greater than the latter , it is judged that the accessing is made two or more times . the total number of repetition times of the loops is a multiplication of the repetition times of the loops indicated in the loop list . the number of memory locations indicated by the reference expression is a multiplication of moving ranges of the subscript expressions of all the dimensions . for the reference expression 806 , as an example , the total number of repetition times of the loop is 1024 * 200 * 300 = 61440000 . ( it is found in the loop table that the numbers of repetition times of the loops 1 , 2 and 3 are 1024 , 200 and 300 , respectively .) the number of memory locations indicated by the reference expression is 300 * 200 = 6000 . ( the subscript expression &# 34 ; k &# 34 ; in the first dimension moves from 0 to 299 , and the subscript expression &# 34 ; j &# 34 ; in the second dimension moves from 0 to 199 .) since the former is greater , the memory location indicated by the reference expression 806 is accessed two or more times in the loop . thus , &# 34 ; c = true &# 34 ;. that ends the process for the reference 806 . in turn , control returns to step 902 . the reference expression 807 also is similarly processed at step 903 to step 908 . control returns to step 903 again . as there is no reference remained for &# 34 ; a &# 34 ;, the process ends . the &# 34 ; a &# 34 ; array is to be transposed since &# 34 ; p = 1 &# 34 ; and &# 34 ; c = true &# 34 ; at the end of the process . next , step 104 generates copy codes for the array to be transposed . first , an array symbol for a copy destination is generated before being registered in the symbol table . a name of the symbol should be unique , or not coincide with any of the other symbol names . a type of symbol should be array ( e , n1 , . . . , nm , . . . , np ) with a type of the array to be transposed being array ( e , n1 , . . . , np , . . . nm ) and the dimension to be transposed being &# 34 ; p &# 34 ;. fig1 shows the symbol table after an example program was transposed . since array &# 34 ; a &# 34 ; 605 is to be transposed , a copy destination array symbol &# 34 ; ta &# 34 ; 606 is generated for it . since the type of &# 34 ; a &# 34 ; is array ( int , 300 , 200 ) and &# 34 ; p = 1 &# 34 ;, the type of &# 34 ; ta &# 34 ; becomes array ( int , 200 , 300 ). a transposition flag 604 for the array to be transposed is turned on , &# 34 ; ta &# 34 ; is set in a transposition array field 607 and the value &# 34 ; p &# 34 ; is set to 1 in the transposition dimension field 608 . next , the intermediate language is to be copied while the array to be transposed is transposed to the copy destination array . the copying node during the transposition is &# 34 ; tcopy &# 34 ;. a first child of the &# 34 ; tcopy &# 34 ; node is the array name of the copy destination and a second child is the array name of the copy source . this node is inserted just before , after or both , the node representing the loop nest . this process is described below by reference to a flow chart in fig1 . step 1301 checks the reference states of the reference expressions in the array element reference table . if there is at least one reference expression in which the reference state is &# 34 ; use &# 34 ;, control goes to step 1302 . if not , control goes to step 1303 . since the reference state of the reference expression 807 in the example program in fig8 is &# 34 ; use &# 34 ;, control goes to step 1302 . step 1302 generates the &# 34 ; tcopy &# 34 ; node in which the newly generated array name is a first child and the array name to be transposed is a second child . the &# 34 ; tcopy &# 34 ; node is inserted just before the loop nest . the case in the example program is shown in fig1 . the &# 34 ; tcopy &# 34 ; node 1401 is inserted , its first child is &# 34 ; ta &# 34 ; 1402 and the second child is &# 34 ; a &# 34 ; 1403 . step 1303 checks the reference states of the reference expressions . if there is at least one reference expression in which the reference state is &# 34 ; definition &# 34 ;, control goes to step 1304 . if not , control ends at step 1303 . as the reference state of the reference expression 806 in the example program in fig8 is &# 34 ; definition &# 34 ;, control goes to step 1304 . step 1304 generates the &# 34 ; tcopy &# 34 ; node in which the newly generated array name is a second child and the array name to be transposed is a first child . the &# 34 ; tcopy &# 34 ; node is inserted just after the loop nest . the case in the example program also is shown in fig1 . the &# 34 ; tcopy &# 34 ; node 1404 is inserted , its second child is &# 34 ; ta &# 34 ; 1406 and the first child is &# 34 ; a &# 34 ; 1405 . fig1 is an image of the c program for the process represented by the &# 34 ; tcopy &# 34 ; node . the figure shows a copy from &# 34 ; a &# 34 ; to &# 34 ; ta &# 34 ; and a copy from &# 34 ; ta &# 34 ; to &# 34 ; a &# 34 ;. we may generate the intermediate language corresponding to the program in fig1 in place of the &# 34 ; tcopy &# 34 ; node . in turn , step 105 changes the array element reference to a transposition member reference . that is , the intermediate language corresponding to the loop nest is scanned again . if scanning finds a reference to the array element in which the transposition flag is on , it is transposed to an array element reference ( copy destination array element reference ) after transposition . in the example program , reference &# 34 ; a &# 34 ; is transposed to reference &# 34 ; ta &# 34 ;. this process is described below with reference to fig7 and 14 . in fig7 scanning is started with the &# 34 ; for &# 34 ; node 704 which is to be rewritten . scanning then finds array &# 34 ; a &# 34 ; at the node 713 in which the transposition flag 604 is on . array &# 34 ; a &# 34 ; is then transposed to array &# 34 ; ta &# 34 ; indicated in the transposition array 607 . this is shown in fig1 ( node 1410 ). the subscript expression represented by the transposition dimension 608 , further , is replaced by the rightmost subscript expression . that is , the &# 34 ; k &# 34 ; ( first dimension ) indicated at the node 712 in fig7 is replaced with the &# 34 ; j &# 34 ; ( rightmost dimension ) indicated at the node 710 . this is shown in fig1 ( nodes 1409 and 1411 ). this ends the first replacement . if scanning the tree is continued , array &# 34 ; a &# 34 ; is found at the node 715 again . replacement of this array is also made . the results are shown in fig1 . this ends the detailed description of the transposition process at step 303 . fig1 is a source image of the c program which represents the contents of the intermediate language and the symbol table at the end of step 303 . ( the compiler will not generate and feed out such a program , but can feed out it .) line 1202 newly declares the copy destination array &# 34 ; ta &# 34 ;. this corresponds to the symbol of the entry 606 in the symbol table in fig1 . the &# 34 ; tcopy &# 34 ; statements on lines 1206 and 1212 correspond to the nodes represented by the intermediate languages 1401 and 1404 . an assignment statement on line 1210 refers to the &# 34 ; ta &# 34 ; array , but not to the &# 34 ; a &# 34 ; array which is different in the order of subscripts from the source program . following step 303 , step 304 ( optimization ) and step 305 ( code generation ) are processed as if the c program in fig1 is the source program . this process is the same as the conventional compiler . the optimization carried out at step 304 includes the conventional optimization called loop unrolling . loop unrolling rewrites the program so that one loop repetition can execute the repetition of two or more times . this is effective in halving the number of loop end judgements . the program in fig1 is an example of the program in fig4 in which loop unrolling is made as to the innermost loop . in the program in fig1 , there are two assignment statements on line 1608 and 1609 . the &# 34 ; k &# 34 ; is increased by two as shown on line 1607 . the number of loop repetitions is halved . a program in fig1 is the program in fig1 in which loop unrolling has been made in a similar way . next , a description of the program with no transposition process and also a description with the transposition process , in view of the array access by reference to fig1 , 17 and 18 follows . effects of the embodiment then will be described . in the program in fig1 , the loop execution statements 1608 and 1609 can access up to four array elements , which include &# 34 ; a [ k ][ j ]&# 34 ;, &# 34 ; a [ k + 1 ][ j - 1 ]&# 34 ;, &# 34 ; a [ k + 1 ][ j ]&# 34 ; and &# 34 ; a [ k + 2 ][ j - 1 ]&# 34 ;. fig1 a shows element positions in the memory . a kind of microprocessor has one read ( load ) or write ( store ) instruction that can read or write two or more data continuously arranged in the memory at one time . of the four elements in fig1 , the two elements &# 34 ; a [ k + 1 ][ j - 1 ]&# 34 ; and &# 34 ; a [ k + 1 ][ j ]&# 34 ; are adjoining . since the element &# 34 ; a [ k + 1 ][ j - 1 ]&# 34 ; is used for ( load ) and the element &# 34 ; a [ k + 1 ][ j ]&# 34 ; is used for definition ( store ), however , those instructions cannot be used . this is because the other two elements are not adjoining . the loop execution statement needs four instructions in total since each element needs one load or store instruction . next , the program , after it is transposed as shown in fig1 , is discussed . in the program in fig1 , loop execution statement 1709 and 1710 also can access up to four array elements , which include &# 34 ; ta [ j ][ k ]&# 34 ;, &# 34 ; ta [ j ][ k + 1 ]&# 34 ;, &# 34 ; ta [ j - 1 ][ k + 1 ] and &# 34 ; ta [ j - 1 ][ k + 2 ]. fig1 b shows element positions on the memory . the elements &# 34 ; ta [ j ][ k ]&# 34 ; and &# 34 ; ta [ j ][ k + 1 ]&# 34 ; are adjoining and &# 34 ; ta [ j - 1 ][ k + 1 ]&# 34 ; and &# 34 ; ta [ j - 1 ][ k + 2 ] are adjoining . both of the former two are for load , and both of the latter two are for store . the program can use the above - mentioned instruction capable of loading and storing two data at a time , thus requiring only the two instructions . as described thus far , the embodiment can generate an instruction string that is advantageous for the computer ( processor ) having the instruction capable of loading and storing two data at a time . the present invention can generate the object code by using the instruction capable of loading and storing two data at a time since the array elements to be accessed continuously in the loop in time can be continuously accessed in space as well . the loop conversion method according to the present invention provides the advantage that a similar effect of loop interchange is obtained even for the loop that cannot be interchanged . the loop conversion method according to the present invention provides the advantage that the replacement can be made only if the overhead of the array copy can be ignored . | 6 |
referring now to fig1 one side of the device pair of the invention is illustrated generally at 10 . the device as set forth above is particularly suited for positioning , in an aligned manner , the rear axle of a motorcycle or other apparatus which requires aligned positioning of an axle to adjust the drive means thereof . it will be appreciated that many different apparati can be adjusted and aligned using the device of the invention either without or with minor modification . such uses are within the scope of this invention . similarly it will be appreciated that although in the preferred embodiment of the present invention the pair of devices is required ( as illustrated in use in fig6 ), a single side of the device pair of the invention may be employed for particular apparati which require frequent disassembly so that adjustment thereof can simply be accomplished by tightening nut 24 until the scale 18 is at the predetermined position . with reference particularly to all of the drawing figures the preferred embodiment of the invention is illustrated . it should be noted that in the most preferred embodiment of the invention the ring 12 is preferably integral with threaded stud 16 for strength , however , it is acceptable for the ring 12 to be welded to stud 16 , if desired . ring 12 preferably provides an inner surface 13 having a diameter of approximately 3 / 4 of an inch , however , may be sized accordingly to closely fit the outer diameter of the axle upon which it will ride . inner surface 13 should be smooth bored for enhanced operation of the device . outer surface 14 of ring 12 must be dimensioned to fit within a swingarm 30 ( illustrated in phantom in fig6 ) yet maintain sufficient thickness between inner surface 13 and outer surface 14 to provide enough strength to move axle 32 forwardly and rearwardly as desired . it will be appreciated by one of skill in the art that it is not necessary that ring 12 actually maintain the position of the axle independently , rather it must only provide positioning strength . axle nut 34 maintains the axle after positioning , nut 34 not being a part of the invention . stud 16 , attached to ring 12 either by being initially integrally formed therewith or subsequently attached thereto , extends for at least several inches to provides a scale 18 and a threaded portion 20 . scale 18 preferably provides a graduated system as illustrated in fig1 and 2 . scale 18 is most preferably flat ground and engraved with several numerals and full and half lines of sufficient size to be easily read by the unaided eye . it will be appreciated , however , that the scale may be created without flat grinding stud 16 , if desired , by such as engraving the curved surface of the stud 16 . it should also be noted that scale 18 is preferably inverted from one side of the motorcycle swing arm 30 to the other such that the numerals are right - side - up on both sides of swing arm 30 . finally , stud 16 includes threaded portion 20 which most preferably is of a 1 / 2 -- 20 thread . as illustrated in each of the figures , block 22 is provided to abut swingarm 30 to provide , inter alia , a bearing surface 23 on which nut 24 will bear . block 22 abuts swingarm 30 with orienting and aligning plateau 25 and abutting shoulder 26 . plateau 25 and shoulder 26 ensure that block 22 is properly positioned and aligned for both aesthetic and functional purposes . it will be recognized that the entire block 22 assembly with plateau 25 could be round or oval as opposed to square or rectangular ( preferred ) if a rounded or oval swing arm 30 were employed on the motorcycle to be fitted . other shapes are also acceptable with the mere proviso that the inner shape of the swingarm be matched by the plateau of block 22 . block 22 , in the preferred embodiment provides window 27 , most preferably with indicator line 28 . window 27 is most preferably an arcuately ground section as shown which provides both an extended indicator line 28 and a sight 29 which . intersects central bore 40 providing a direct view of scale 18 when stud 16 is inserted in central bore 40 . it will be appreciated , however , that many different window types may be employed without departing from the spirit and scope of the invention . for ease of insertion of stud 16 in central bore 40 an angled countersink 41 is provided , as illustrated in fig1 and 4 , in the plateau 25 , to act as a funnel for stud 16 . block 22 may be machined externally as desired for aesthetic purposes . in the most preferred embodiment nut 24 includes a polymeric ring which functions to lock the nut in place regardless of vibration . it will be appreciated , of course , however that two nuts 24 tightened together will provide an identical function . this type of locking of two nuts together is well known in the art and therefore does not require illustration . it will be understood that any type of material may be used for either of the stud or block providing that the material is of sufficient strength to withstand compression of an axle nut and of sufficient tensile strength to allow a user to position the axle of the apparatus . while preferred embodiments have been shown and described , various modifications and substitutions may be made thereto without departing from the spirit and scope of the invention . accordingly , it is to be understood that the present invention has been described by way of illustration and not limitation . | 6 |
fig1 illustrates the present invention with respect to a token such as a prepaid card that has a magnetic stripe linked to an account stored in an account server associated with a prepaid card issuer . the card issuer issues a prepaid card that is acquired by a user , for example in a retail outlet , by ordering over the internet or phone , etc . the prepaid card may be initially activated and loaded with an initial amount , for example $ 50 , but preactivation and loading is not required . activation may occur at the point of sale , over the telephone , via the internet , etc . as known in the art . the card holder is able to provide deposit information to third parties , shown as depositor a , depositor b , and depositor c , as follows . each depositor will be provided with the account number or other identifying indicia of the prepaid card , which in this example is account number 12345678 . each depositor may also be given a unique depositor identifier such as a pin or access number that he will use to make the desired deposit . the pin may be determined in various ways . in one embodiment , pins are generated by the card issuer and provided to the card holder . they may be provided in a written statement , email , via internet access of a web site for the issuer , over the telephone , etc . in any event , the card holder will have a series of pins that he can associate with and distribute to the desired depositors . for example , he may simply tell depositor a his pin , and then tell depositor b his pin , etc . the system may also require the user to request a new pin as desired , rather than giving them to the card holder in batch format . pins may have a limited lifespan , such as one month , which would require the card holder to distribute a new pin to a depositor once the old pin has expired . once a depositor has its pin , it can proceed to make a deposit of a subset of funds into the prepaid card account . this may be done in one or more of several manners . for example , the depositor may log onto a web site operated by the card issuer , where he may enter his pin ( he may also need to enter the card holder &# 39 ; s account number ) and indicate a payment . the payment may be made by credit card , debit card , etc ., similar to any type of purchase of a product over the internet . a transaction fee may be charged to the depositor and / or the card holder for this service . the depositor may also make deposits via terminals such as existing atms modified to operate in accordance with this invention . once payment has been made , the account is credited with the appropriate amount and that subset of funds is available to be used by the card holder . there may be a deposit notification mechanism employed , such as email to the account holder informing him of the deposit amount , or a text message or phone call , etc . deposits may be made into the account on an automatic or periodic basis . for example , a depositor may specify that he would like a $ 250 deposit to be made , funded by his credit card , at the end of each month . this would continue for a specified number of payments , or until a specified date is reached , or indefinitely until modified by the depositor . this may be referred to as an automatic reload function . optionally , there may be a mechanism employed for storing an identifying indicia of the depositor along with the pin he has been assigned . for example , the depositor &# 39 ; s name may be associated with the pin . this may be done by the cardholder or such as via a web site entry , for example when the card holder obtains the pin . he would enter the depositor &# 39 ; s name and the card issuer would store the depositor &# 39 ; s name with the pin . in this case , the deposit notification could also have the name of the depositor as follows : “ john smith has just deposited $ 500 to your card account 12345678 ” in the alternative , the depositor may only have a pin and he may be able to enter his name or other identifier into the system . in addition , a statement is issued periodically , such as on a monthly basis , as shown in fig2 . the account statement would show a list of all deposits made , give the name and / or name of the depositor , etc . this allows the user to easily see who has made deposits and it what amounts and when the deposits were made . the statement may be mailed to the user , emailed to the user , or made accessible via a web site , etc . as a result of the present invention , the card holder has easy access to deposits made by a number of persons , and can easily determine who has given him funds and in which amounts . the depositors do not have access to other depositors &# 39 ; records , so one depositor can &# 39 ; t find out how much another depositor has given the card holder . many applications for this technology exist , such as in a business context . for example , an attorney could open a prepaid card account and distribute a pin to each of his clients . the client could easily make payment whenever desired by using the preassigned pin as described above . thus , the attorney could collect funds into his account and have records of which client has made timely payments , etc . the prepaid card could be linked to their accounts held by the attorney , such as a savings and checking account , so that the attorney could transfer funds as desired after they have been deposited . other businesses that may rely on cash transactions will also greatly benefit from this invention . for example , a landscaper or gardener might set up a card under this invention and distribute pins to each customer , requesting that they make payment into their respective pin as bills become payable . other occupations such as independent sales contractors , waiters , and the like are also benefited accordingly . another application would be a gift service . a user would obtain the card , perhaps as a birthday or wedding gift . the user would then obtain and distribute pins as described above to persons wishing to provide a gift . each person could then make a gift deposit to the user &# 39 ; s card , and the user would know which person gave him which amounts , etc . as described above . this invention also has applicability in the area of direct deposit , where an employer is given a pin and can deposit an employee &# 39 ; s paycheck into the account as described herein . governmental agencies can be provided with a pin , such as for social security deposits and disability payment deposits . automatic bill payment mechanisms may also be employed with the present invention . fig1 illustrates how the prepaid gift card is used in a credit card environment in the same manner as any other credit card . after the card account has been funded , the user may present the card just as a credit card to a merchant or point of sale terminal , who would use the purchase authorization system of the credit card network ( the acquiring bank and card issuer ) to ascertain if the transaction should be approved and the prepaid card should be debited accordingly ( funds reduced in the user account ), as known in the art . wired and wireless networks may be used in this invention . the user may also access funds via a terminal such as an atm , which may be an existing atm modified ( if so required ) in accordance with this invention . for example , one application of this invention provides for a user to have a card that may be used to access funds from an atm , wherein the funds are available from deposits made by various depositors in accordance with this invention . this would allow a user in a country different from the depositor ( s ) to be provided with easy access to cash funds from an atm as soon as they are deposited by the various depositors as described above . in a further embodiment , a depositor may be able to impose certain rules ( as shown in rules database in fig1 ) that govern how funds are utilized by the card holder . for example , a depositor may only want the card holder to use the funds that depositor has deposited for food and clothing , and not for video games and liquor . rules can be entered into the system , for example over a web site link , that will allow the depositor to impose such conditions . in that event , a given transaction may be disallowed , for example if the card holder tries to purchase an xbox console for $ 150 and such purchase would require use of funds that have been earmarked for food only . the card issuer would then not allow the transaction to proceed when queried by the merchant acquiring bank as part of the transaction . in addition to depositing cash into the prepaid card account , other items of value may be transferred such as reward points . a depositor may be able to exchange reward points that he has in one of his reward point accounts into a reward account associated with the prepaid card . thus , depositor a could deposit 1 , 000 reward points from an airline account , depositor b could deposit 500 reward points from his credit card reward account , etc . an exchange rate may be used to determine how many exchange reward points are then credited to the card holder &# 39 ; s account . for example , the card holder may end up with 1 , 300 total exchange points in a reward account linked to the prepaid card . the present invention may also be used in conjunction with a stored value card such as a smart card wherein the account value ( s ) are stored in processing circuitry on the card itself rather than in a server - based account as described above . in this embodiment , a temporary account may exist for the purpose of allowing depositors to make deposits as described above . the deposit amounts will be stored temporarily ( in one account or several individual accounts ) until such time that the user presents his smart card to the system , typically by entering it into a reading terminal such as a at a pos . at that time , the deposited values temporarily held in the system will be transferred to the smart card so that the card holds al of the deposited values . the user may then use the card known in the art . in the prior art , stored value cards are usually not linked to a specific user , and therefore they may be used by anyone who presets the card to a merchant . this provides for a very low level of security since the card is essentially the same as cash . under the present invention , the stored value card is linked to a specific user and therefore the user may request that the card be voided in the event that it is lost or misplaced . a new card may be issued in its place and be usable instead of the original card . the stored value card of the present invention may also be linked to special offers such that the user of the card is provided with access to thee offers by using the card as described herein . tokens other than prepaid cards may also be used with this invention . for example , a multifunction card or smart card may be adopted to include the functionality of the present invention in addition to other functions , such as credit card functions , debit card functions , and the like , as well known in the art . in addition , this invention may be used without a physical token , wherein the user may simply enter an account number in order to gain access to the account ( e . g . over the internet , at an atm , via the telephone , at a pos terminal , etc .) as described , the funds that the depositors deposit into the account ( and that are used by the user ) will typically be of a monetary value such as cash or credit , but may also include non - monetary value such as reward points , intangible privileges ( e . g . privileges in using a country club ), subscription services ( e . g . rights to obtaining a massage , emission or energy credits ), coupons , vouchers , and anything having any type of value . | 6 |
here under , the preferred embodiments of the present invention will be described . fig1 is a cross - sectional view for explaining the configuration of a rack and pinion type steering device 10 having a rack guide of a rolling type according to a first embodiment of the present invention . the rack and pinion type steering device 10 is so configured as to arrange a pinion shaft 14 and a rack shaft 15 in the interior of a housing 11 . the pinion shaft 14 is rotationally supported by a ball bearing 12 and a needle bearing 13 . the rack shaft 15 is so arranged as to be movable in the axial direction by the aid of a rack bush not shown . an end of the rack shaft 15 is coupled with a tie rod having a link unit that changes the direction of the tire wheels through a ball joint not shown . a rack tooth 15 a of the rack shaft 15 is meshed with a pinion tooth 14 a of the pinion that is integrally formed with the above pinion shaft 14 . further , a rack guide 16 is disposed at an opposite side of the pinion shaft 14 with respect to the rack shaft 15 in the interior of the housing 11 . the rack guide 16 is so configured as to press the rack shaft 15 from the back surface to appropriately maintain a meshing state of the pinion tooth 14 a with the rack tooth 15 a . the rack guide 16 is made up of a rack guide holder 21 that is totally formed in a substantially cylindrical shape , a pin 22 that is arranged in a pin support hole 21 a which is defined in an inner space of the rack guide holder 21 in a direction orthogonal to the axial direction of the rack shaft 15 , and a roller 24 having a needle bearing 23 pressed into a center portion thereof and having an outer peripheral surface formed in a hand drum shape . the roller 24 is installed on the pin 22 and rotationally disposed in the inner space of the rack guide holder 21 . the outer peripheral surface of the hand drum shape of the roller 24 is brought in rolling contact with the back surface of the rack shaft 15 ( a surface at an opposite side of the meshed surface ) so as to press the rack shaft 15 toward the meshed surface . the housing 11 is equipped with a rack guide portion 11 a having a cylindrical aperture that guides the rack guide holder 21 , and the outer peripheral surface of the rack guide holder 21 is fitted with the rack guide portion 11 a . also , a screw is formed in the inner surface of the rack guide portion 11 a on a lower side ( on an opposite side of the rack shaft 15 ) of the rack guide portion 11 a of the housing 11 , so as to be meshed with an adjustment screw 25 . the adjustment screw 25 is formed of a cylindrical member having a bottom . the adjustment screw 25 is so configured as to be meshed with the rack guide portion 11 a , and press the rack guide holder 21 toward the rack shaft 15 through a disc spring 26 interposed between the adjustment screw 25 and the rack guide holder 21 . the screwing amount of the adjustment screw 25 is so adjusted as to appropriately adjust the meshing state of the rack tooth 15 a with the pinion tooth 14 a . the rack guide holder 21 can be displaced by the amount of the elastic deformation of the disc spring 26 . a description will be given of the configuration of the outer peripheral surface of the roller 24 and a method of forming the outer peripheral portion . the cross - sectional configuration of the outer peripheral surface of the roller 24 is identical with the cross - sectional configuration of the outer peripheral surface of the roller 110 in the conventional art described with reference to fig7 in advance . that is , the cross - sectional configuration of the outer peripheral surface of the roller 24 is made up of curved surfaces consisting of two circular arcs having the radius of curvatures r 1 and r 2 ( r 1 can be equal to r 2 ) which are larger than the radius of curvature rr of the cross - sectional configuration of the outer peripheral surface of the rack shaft 15 . a description will be given of a method of forming the outer peripheral surface of the roller 24 . first , the configuration of the outer peripheral surface of the roller 24 is formed into an outer peripheral surface having the above cross - sectional configuration , that is , a cross - sectional configuration that consists of two circulate arcs . the outer peripheral surface is surface hardened by known appropriate means . subsequently , the pinion shaft 14 , the rack shaft 15 , and the rack guide holder 21 are assembled in the interior of the housing 11 , and the adjustment screw 25 is fastened more than usual to supply an excessive load more than that originally supplied to the rack guide holder 21 . the rack shaft 15 is reciprocated in the axial direction under a state where the excessive load more than that originally supplied is supplied to the rack guide holder 21 , thereby plastically deforming the outer peripheral surface of the roller 24 into the configuration of the outer peripheral surface of the rack shaft 15 so as to follow the outer peripheral surface of the rack shaft . the plastic deformation makes the cross - sectional configurations ( radii r 1 and r 2 ) of the outer peripheral surface of the roller 24 coincide with the cross - sectional configuration ( radius rr ) of the outer peripheral surface of the rack shaft ( r 1 = r 2 = rr ) as a result , the outer peripheral surface of the roller 24 comes in line contact with the outer peripheral surface of the rack shaft with a high precision . fig2 is a diagram showing the cross - sectional configuration of the outer peripheral surface of the roller 24 that has been plastically deformed . the outer peripheral surface of the roller 24 and the outer peripheral surface of the rack shaft 15 come in line contact with each other in areas of portions c and d . a portion e is a groove that is defined in the roller 24 in advance . the face hardening treatment of the outer peripheral surface of the above roller 24 is conducted by a method such as a known carburization quenching or a nitriding treatment . in this situation , it is desirable that the thickness of the hardened layer is about 0 . 1 to 0 . 6 mm , and it is undesirable that the hardened layer is too thick because plastic deformation is difficult . according to the above configuration , the outer peripheral surface of the roller and the outer peripheral surface of the rack shaft come in line contact with each other , and the contact area increases , thereby making it possible to decrease the contact surface pressure . as a result , it is possible to suppress the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle noise from occurring . a second embodiment is similar in the configuration to the rack and pinion type steering device 10 having the rack guide of the rolling type according to the first embodiment , and only the configuration of the outer peripheral surface of the roller 24 is different from that in the first embodiment . accordingly , the configuration of the rack and pinion type steering device having the rack guide is omitted from the detailed description with fig1 and its description , and only differences will be described . fig3 is a diagram for explaining a cross - sectional configuration of the outer peripheral surface of the roller which has not yet been plastically deformed according to a second embodiment . in the second embodiment , the cross - sectional configuration of the outer peripheral surface of the roller 24 is formed into a curved surface having a radius of curvature r 1 smaller than the radius of curvature rr which is the cross - sectional configuration of the outer peripheral surface of the rack shaft 15 . for that reason , the outer ring of the roller 24 and the outer peripheral surface of the rack shaft 15 come in contact with each other at only points a and b . in the second embodiment , the configuration of the outer peripheral surface of the roller 24 is formed into the cross - sectional configuration shown in fig3 , and the outer peripheral surface is face - hardened by known appropriate means . then , the pinion shaft 14 , the rack shaft 15 , and the rack guide holder 21 are assembled in the interior of the housing 11 , and the adjustment screw 13 is fastened more than usual to supply an excessive load more than that originally supplied to the rack guide holder 21 . the rack shaft 15 is reciprocated in the axial direction under a state where the excessive load more than that originally supplied is supplied to the rack guide holder 21 , thereby plastically deforming the outer peripheral surface of the roller 24 into the configuration of the outer peripheral surface of the rack shaft 15 so as to follow the outer peripheral surface of the rack shaft . the plastic deformation makes the cross - sectional configurations ( radius r 1 ) of the outer peripheral surface of the roller 24 coincide with the cross - sectional configuration ( radius rr ) of the outer peripheral surface of the rack shaft ( r 1 = rr ) as a result , the outer peripheral surface of the roller 24 comes in line contact with the outer peripheral surface of the rack shaft with a high precision . similarly , in the second embodiment , the cross - sectional configuration ( radius r 1 ) of the outer peripheral surface of the roller 24 that has been plastically deformed is shown in fig2 . the outer peripheral surface of the roller 24 and the outer peripheral surface of the rack shaft 15 come in line contact with each other in areas of portions c and d . a portion e is a groove that is defined in the roller 24 in advance . the surface hardening treatment of the outer peripheral surface of the above roller 24 is conducted by a method such as a known carburization quenching or a nitriding treatment as in the first embodiment . it is desirable that the thickness of the hardened layer is about 0 . 1 to 0 . 6 mm , and it is undesirable that the hardened layer is too thick because plastic deformation is difficult . similarly , in the second embodiment , the contact area of the outer peripheral surface of the roller with the outer peripheral surface of the rack shaft increases , thereby making it possible to reduce the contact surface pressure . as a result , it is possible to suppress the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle noise from occurring . a third embodiment is similar in the configuration to the rack and pinion type steering device 10 having the rack guide of the rolling type according to the first embodiment , and only a method of plastically deforming the configuration of the outer peripheral surface of the roller 24 is different from the methods of the first and second embodiments . accordingly , the configuration of the rack and pinion type steering device having the rack guide is omitted from the detailed description with the first embodiment shown in fig1 , and only differences will be described . the cross - sectional configuration of the outer peripheral surface of the roller 24 which has not yet been plastically deformed according to the third embodiment is identical with the conventional cross - sectional configuration shown in fig7 , and also identical with the configuration of the outer peripheral surface which has not yet been plastically deformed according to the first embodiment . that is , the cross - sectional configuration of the outer peripheral surface of the roller 11 is formed of a curved surface consisting of two circular arcs with curved surfaces r 1 and r 2 ( r 1 can be equal to r 2 ) having the radius of curvatures larger than the radius of curvature rr which is the cross - sectional configuration of the outer peripheral surface of the rack shaft 15 . for that reason , the outer ring of the roller 24 and the outer peripheral surface of the rack shaft 15 come in contact with each other at only points a and b . in the third embodiment , the configuration of the outer peripheral surface of the roller 24 is first formed into the cross - sectional configuration shown in fig7 , and the outer peripheral surface is surface hardened by known appropriate means . then , as shown in fig4 , a load f is applied to the end of the rack shaft 15 to press the rack shaft 15 toward the roller 24 within the rack guide holder 21 . since fig1 shows a state in which the rack shaft 15 is disposed perpendicularly to the paper surface , the end of the rack shaft 15 is disposed on a front side from the paper surface . in fig4 , a load is applied to a ball joint 31 that is a coupling portion of the end of the rack shaft 15 with the tie rod 30 . alternatively , the load f can be applied directly to the end of rack shaft 15 . the significant matter resides in that the rack shaft 15 is pressed toward the roller 25 within the rack guide holder 21 . the rack shaft 15 is reciprocated in the axial direction under a state where the excessive load more than that originally supplied is supplied to the rack guide holder 21 , thereby plastically deforming the outer peripheral surface of the roller 24 into the configuration of the outer peripheral surface of the rack shaft 15 so as to follow the outer peripheral surface of the rack shaft . the plastic deformation makes the cross - sectional configurations ( radii r 1 and r 2 ) of the outer peripheral surface of the roller 24 coincide with the cross - sectional configuration ( radius rr ) of the outer peripheral surface of the rack shaft ( r 1 = r 2 = rr ). as a result , the outer peripheral surface of the roller 24 comes in line contact with the outer peripheral surface of the rack shaft with a high precision . similarly , in the third embodiment , the cross - sectional configuration ( radius r 1 ) of the outer peripheral surface of the roller 24 that has been plastically deformed is shown in fig2 . the outer peripheral surface of the roller 24 and the outer peripheral surface of the rack shaft 15 come in line contact with each other in areas of portions c and d . a portion e is a groove that is defined in the roller 24 in advance . the surface hardening treatment of the outer peripheral surface of the above roller 24 is conducted by a method such as a known carburization quenching or a nitriding treatment as in the first and second embodiments . it is desirable that the thickness of the hardened layer is about 0 . 1 to 0 . 6 mm , and it is undesirable that the hardened layer is too thick because plastic deformation is difficult . in the above third embodiment , the cross - sectional configuration of the outer peripheral surface of the roller 24 which has not yet been plastically deformed is described as the conventional cross - sectional configuration shown in fig7 , and the cross - sectional configuration of the roller 24 according to the first embodiment which has not yet been plastically deformed shown in fig7 . alternatively , the cross - sectional configuration can be formed in the cross - sectional configuration of the roller 24 according to the second embodiment shown in fig3 which has not yet been plastically deformed . similarly , in the third embodiment , the contact area of the outer peripheral surface of the roller with the outer peripheral surface of the rack shaft increases , thereby making it possible to reduce the contact surface pressure . as a result , it is possible to suppress the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle noise from occurring . as has been described above , according to the rack and pinion type steering device of the present invention , the outer peripheral surface of the roller that is rotatably installed on the rack guide is formed around the rotating axis in the hand drum configuration . the outer peripheral surface of the hand drum shape has a configuration that comes in line contact with the outer peripheral surface on the opposite side of the meshed surface of the rack surface with the pinion . more specifically , the cross - sectional configuration of the hand drum shaped outer peripheral surface of the roller is formed with a curvature identical with the curvature of the cross - sectional configuration of the outer peripheral surface on the opposite side of the meshed surface of the rack shaft with the pinion . with the above configuration , the contact area of the outer peripheral surface of the roller with the outer peripheral surface of the rack shaft increases , thereby making it possible to reduce the contact surface pressure . as a result , it is possible to suppress the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle from occurring . also , according to the method of manufacturing the rack and pinion type steering device of the present invention , after the roller that is rotatably installed on the rack guide is formed with the hand drum shaped outer peripheral surface having a curvature different from the curvature of the outer peripheral surface on an opposite side of the meshed surface of the rack shaft with the pinion , the rack shaft is reciprocated in the axial direction and plastically deformed while the rack shaft is pressed toward the hand drum shaped outer peripheral surface , and the hand drum shaped outer peripheral surface of the roller is formed in the configuration that comes in line contact with the outer peripheral surface of the rack shaft . in the outer peripheral surface of the roller that has been manufactured by the manufacturing method , the hand drum shaped outer peripheral surface of the roller and the outer peripheral surface of the rack shaft come in line contact with each other with a high precision . with the above configuration , the contact area of the outer peripheral surface of the roller with the outer peripheral surface of the rack shaft increases , thereby making it possible to reduce the contact surface pressure . as a result , it is possible to suppress the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle from occurring . then , since the hand drum shaped outer peripheral surface of the roller is plastically deformed so as to follow the outer peripheral surface of the rack shaft , the outer peripheral surface of the roller can come in line contact with the outer peripheral surface of the rack shaft with a high precision without conducting a precise current work , and the treatment of the hand drum shaped outer peripheral surface of the roller can be easily conducted with a high precision . in the rack and pinion type steering device having the rack guide which can prevent the rattle noise from occurring and the method of manufacturing the steering device , a contact state of the outer peripheral surface of the rack shaft with the outer peripheral surface of the roller of the rack guide holder changes from a point contact to a line contact to enlarge the contact area and reduce the contact surface pressure . with the above configuration , it is possible to prevent the wear of the contact surface , prevent an increase in the excessive rack guide movable amount , and prevent rattle noise from occurring . also , the treatment of the hand drum shaped outer peripheral surface of the roller can be easily conducted with a high precision . | 8 |
an accelerometer according to the invention includes a moving mass 2 suspended via suspension arms 80 and 81 ( fig2 ) from a peripheral frame 3 . the suspension arms 80 and 81 comprise piezoelectric gauges which are not depicted in fig2 . the moving mass 2 is secured to a pole piece 14 . this pole piece 14 is inserted in a chamber which consists of a pole piece 12 . the pole piece 12 itself consists of a main part 121 , of a secondary part 122 ; the main and secondary parts being connected by a permanent magnet 5 . a coil 6 is secured to the secondary part 122 . in this example of a negative - stiffness motor , the pole piece 14 is subjected to the presence of various magnetic fields depicted by arrows in fig2 . these arrows relate to the magnetic fields created by the permanent magnet 5 . this pole piece 14 is in unstable equilibrium and tends to shift along an axis z perpendicular to the plane of the moving mass 2 . as it moves away from a middle position depicted by the axis aa &# 39 ;, it carries the moving mass with it and creates stresses in the piezoelectric gauges which are located on the suspension arms 80 and 81 . this manifests itself via an electronic circuit , which is not depicted , in a return current which acts on the coil 6 and tends to keep the assembly in a fixed position . what happens is that the supply field of the coil 6 creates a magnetic field at the pole piece 14 and this tends to make the said piece return to the mid - plane aa &# 39 ;. for example , if in this position of unstable equilibrium the piece 14 tends to move closer to the silicon part , the control current created in the coil tends to move the said piece 14 away from the silicon part . the electromagnetic motor , which is said to have negative stiffness , used by an accelerometer according to the invention is therefore supplied with current in order to allow the piezoelectric gauges to bring the moving mass back into a state of equilibrium via the piece 14 . when this accelerometer is subjected to external stresses , especially of the seismic movements type , it operates in a similar way to the way described earlier ; the motor tends continuously to return the piece 14 to the mid - plane aa &# 39 ;. this type of control makes it possible to use suspension arms 80 , 81 which are thick enough to prevent breakage while at the same time maintaining sufficient sensitivity on account of the reduction in overall stiffness of the accelerometer as a whole . given the high sensitivity required of the accelerometer , low accelerations along the sensitive axis z lead to high stresses in the silicon piezoelectric gauges , and the yield point could soon be reached . in order to alleviate this drawback , the accelerometer according to the invention comprises systems of stops which limit the displacements of the moving parts along the sensitive axis , these systems being built into the sensitive part which consists of the moving mass connected via suspension arms comprising strain gauges , to a fixed frame . according to one alternative form of the invention , this sensitive part of the accelerometer consists of two monocrystalline silicon wafers 7 and 8 , in which there are defined , by the elimination of material ( by chemical etching ), the suspension arms , the piezoresistive gauges and electrical conductors for connecting the gauges to the outside . more specifically , according to one alternative form of the invention , all the pieces 12 and 14 are secured to a moving mass 2 and to a peripheral frame 3 which are produced from a stack of two silicon wafers . as illustrated in fig2 the peripheral frame comprises a so - called upper part , the part 31 , produced in a first silicon wafer called the upper wafer 7 , and a part known as the lower part , the part 32 , produced from a second silicon wafer known as the lower wafer 8 . the part 31 is secured to the pieces 121 and 122 . likewise , the moving mass 2 comprises a so - called upper part , the part 21 , made in the wafer 7 and a so - called lower part , the part 22 , made in the wafer 8 . the part 21 is connected to the piece 14 via an element 144 . in this fig2 the parts 21 , 22 , 31 and 32 have been depicted very diagrammatically and will be described in greater detail using fig3 a , 3b , 4a and 4b . fig3 a and 3b respectively depict views from above of the upper wafer 7 and of the lower wafer 8 . the upper wafer 7 comprises the upper part of the moving mass 21 consisting of a central part 23 and of two immobilizinging arms 24 and 25 which lie one on either side of the central part and are oriented along the axis y depicted in fig3 a . the upper wafer 7 also comprises the upper part 31 of the fixed frame , which consists of a peripheral part 33 and of two arms 34 and 35 , which in fig3 a are oriented along the axis x . part 42 of the immobilizing arm 25 and part 43 of the immobilizing arm 24 constitute counter - stops on the part 21 of the moving mass . part 43 of the immobilizing arm 34 and part 44 of the arm 35 constitute stops on the part 31 of the fixed frame . this wafer 7 also comprises two suspension arms 80 and 81 connecting the central part 23 of the moving mass to the arms 34 and 35 secured to the fixed frame . fig3 b relates to the lower wafer 8 . this wafer 8 comprises the lower part 22 of the moving mass which consists of a central part 16 and of two immobilizing arms 27 and 28 which in fig3 b are oriented along the axis x . the wafer 8 also comprises the lower part 32 of the peripheral frame , which consists of a peripheral part 36 and of two arms 47 and 48 which in fig3 b are oriented along the axis y . part 42 of the immobilizing arm 25 and part 41 of the immobilizing arm 24 constitute counter - stops facing the stop 48 part of the arm 38 and the stop 47 part of the arm 37 , respectively . likewise , part 45 of the immobilizing arm 27 and part 46 of the immobilizing arm 28 constitute counter - stops facing the stop 43 of the arm 34 and the stop 44 of the arm 35 , respectively . fig4 a and 4b illustrate cross - sections on planes bb &# 39 ; and cc &# 39 ; depicted in fig3 a or 3b , of the stack of wafers 7 and 8 , and show how the various stops and the various counter - stops can be produced . the arms 27 , 28 , 37 and 38 of the lower wafer 8 have the same architecture . they consist of an element of thickness e 1 less than the thickness e 0 of the thickness of the silicon wafer . the difference in level between elements of thickness e 1 and those of thickness e 0 makes it possible to produce the stops or counterstops for the counter - stops or stops respectively facing them . the arms 24 , 25 , 34 and 35 of the upper wafer 7 all have the same architecture . they consist of a single element of thickness e 0 , part of each arm facing the thinned part of an arm on the lower wafer 8 . according to an alternative form of the invention , the wafers 7 and 8 also comprise slender guide arms as illustrated in fig5 a and 5b . the upper wafer 7 comprises four guide arms 91 , 92 , 93 , 94 which are oriented at 45 ° to the axes x and y , in a plane parallel to the plane of the moving mass . these guide arms may , more specifically , lie in the same plane as the plane containing the suspension arms 80 and 81 . likewise , the lower wafer 8 comprises four slender guide arms 95 , 96 , 97 , 98 also oriented at 45 ° to the axes x and y . these guide arms may lie in the lower part of the wafer 8 . the various immobilizing , suspension and guide arms may be produced by steps of masking by photolithography then etching . the wafers 7 and 8 for that may advantageously be wafers of the simox type containing an embedded layer of oxide and also covered with oxide , the well - controlled thickness of silicon between two oxide layers makes it possible for the dimensions of the suspension arms or of the guide arms to be gauged very accurately . before the wafers 7 and 8 are assembled in the conventional way , the immobilizing arms are connected both to the mass which will later be a moving mass , and to the peripheral frame . at the time of manufacture of the stops and counter - stops , by chemical etching , a precut is made at the intended openings between immobilizing arm and or peripheral frame . after the two wafers have been assembled , the final cut for freeing the moving mass from the fixed frame is made at the precuts , by laser attack . more specifically , the precuts are made respectively : on the wafer 7 between the element 33 and the immobilizing arms 25 and 24 ; on the wafer 8 between the element 26 and the arms 38 and 37 . this type of operation makes assembling the wafers 7 and 8 easier . fig6 depicts a perspective view of one example of an accelerometer according to the invention , using a so - called negative - stiffness motor and a silicon part made from a stack of two wafers . the motor part comprises a pole piece 12 fixed to the part 33 of the silicon wafer 7 . the piece 12 is a cylindrical container which has two openings in planes perpendicular to the axis of revolution of the cylinder . one opening allows the element 14 to be fixed to the moving mass . the other opening is made so that the forces of the magnetic fields which present in the container can be adjusted as a function of the polar mass of the element 121 , and to allow a position of equilibrium to be set . the pole piece 14 is connected to the central part 23 of the mass 2 via the part 144 which may typically be made of pyrex for example . the assembly which consists of the coil 6 and the magnet 5 is encapsulated in a plastic 56 giving the assembly integrity . fig6 shows one configuration of an accelerometer comprising silicon wafers , in which wafers guide arms such as those depicted , namely the elements 95 , 96 and 97 have especially been produced . this figure also shows the two immobilizing arms 27 and 28 which are connected to the central part 26 of the moving mass inscribed in the wafer 8 , and the two arms 37 and 38 connected to the fixed frame 36 , also inscribed in the wafer 8 . | 6 |
hereinafter , the present disclosure will be described in more detail in order to facilitate understanding of the present invention . it should be understood that the terms and words used in the present specification and claims should not be construed as limited to general and dictionary meanings , but interpreted based on the meanings and concepts corresponding to technical aspects of the present disclosure based on the principle that the inventor is allowed to properly define the terms to describe its invention in the best way . the terms used in this specification are just for explaining exemplary embodiments and it is not intended to restrict the present disclosure . the singular expression may include the plural expression unless it is differently expressed contextually . it should be understood that the terms “ include ”, “ equip ”, “ have ”, or the like are used to designate the existence of characteristics taken effect , numbers , steps , components , or combinations thereof , and do not exclude the existence or the possibility of addition of one or more different characteristics , numbers , steps , components of combinations thereof beforehand . in the present specification , ‘ catalyst system ’ or ‘ catalyst composition ’ means what can be obtained as the catalyst composition having activity by mixing 3 components including a source of transition metal ( for example , a transition metal compound such as an organic chromium compound ), a ligand compound , and a cocatalyst , or alternatively 2 components of an organic chromium compound that the ligand compound is coordinated to the transition metal and a cocatalyst , at the same time or in an arbitrary order . said 3 components or 2 components of the catalyst system may be mixed in the presence or absence of a proper solvent and a monomer , and the terms may be used interchangeably . in the present specification , hydrocarbyl means all compounds consisting only of carbon and hydrogen , and includes , for example , an alkyl group , an aryl group , an alkenyl group , a cycloalkyl group and the like . in the use of the term hydrocarbyl , it may mean both linear and branched chain , and both unsubstituted and substituted unless it is especially mentioned . for example , a c1 to c20 alkyl group may include a methyl group , an ethyl group , a propyl group , an isopropyl group , a butyl group , an isobutyl group , a pentyl group , an isopentyl group and a neopentyl group , and a c6 to c20 aryl group may include a phenyl group , a naphthyl group and an anthracenyl group , but is not limited thereto . an alkylaryl group means an aryl group having at least one alkyl group as a substituent , and an arylalkyl group means an alkyl group having at least one aryl group as a substituent . in the present specification , a hetero atom may mean n , o , s , or p , and a heteroaryl group may mean that any one of the carbons of the aromatic ring , such as a pyridyl group , is substituted with a hetero atom . the same applies to the cases of a heteroarylalkyl group , a heteroalkylaryl group , a heteroalkenylaryl group , and the like . according to the present disclosure , the ligand compound which is coordinated with a transition metal in the catalyst system for olefin oligomerization to obtain a high selectivity for alpha - olefin , a small amount of by - products , and a high activity of the catalyst system is provided . according to one embodiment of present disclosure , the ligand compound is represented by the following chemical formula 1 . r1 to r4 are the same as or different from each other , and are each independently a c6 to c20 aryl group or a c7 to c20 alkylaryl group , r6 is selected from the group consisting of a c2 to c20 alkyl group optionally containing one or more heteroatoms , a c2 to c20 alkenyl group optionally containing one or more heteroatoms , a c6 to c20 aryl group , a c7 to c20 arylalkyl group , a c7 to c20 alkylaryl group , a c7 to c20 arylalkenyl group , a c7 to c20 alkenylaryl group , a c5 to c20 heteroaryl group , a c6 to c20 heteroarylalkyl group , a c6 to c20 heteroarylalkenyl group , a c3 to c20 cycloalkyl group optionally containing one or more heteroatoms and a c3 to c20 cycloalkenyl group optionally containing one or more heteroatoms , r7 to r9 are the same as or different from each other , and are each independently selected from the group consisting of hydrogen , a c1 to c20 alkyl group , a c1 to c20 alkenyl group , a c7 to c20 arylalkyl group , a c7 to c20 arylalkenyl group , a c3 to c20 cycloalkyl group , a c3 to c20 cycloalkenyl group , a c6 to c20 aryl group and a c7 to c20 alkylaryl group . as described above , the ligand compound represented by chemical formula 1 may be , for example , a compound that the 2 - position and 6 - position carbons of the aniline compound are substituted with the r5 and r6 , and the group substituted for the 2 - position and 6 - position carbons ( r5 and r6 , respectively ) can change the properties of the ligand compound and the catalyst system for oligomerization including the same . particularly , when an alkyl group having 2 or more carbon atoms , for example , a c2 to c20 alkyl group , is substituted for the 2 - position carbon ( r5 ), or a methyl group is substituted for the 2 - position carbon ( r5 ), a substituent having a structure different from that of the 2 - position carbon may be bonded to the 6 - position carbon ( r6 ). in an embodiment of the ligand compound , when r5 is a methyl group or an isopropyl group , r6 may be a c2 to c20 linear alkyl group optionally containing one or more heteroatoms , or various asymmetric substituents as described above ( i . e ., substituents having a structure different from that of r5 ), more preferably the c2 to c20 linear alkyl group , a substituent containing one or more heteroatoms , or a substituent containing one or more aromatic groups . in an embodiment of the ligand compound , when r5 is a methyl group , r6 may be selected from the group consisting of a c2 to c20 , or c2 to c3 linear alkyl group optionally containing one or more heteroatoms , a c2 to c20 , or c2 to c3 alkenyl group containing one or more heteroatoms , a c6 to c20 aryl group , a c7 to c20 arylalkyl group , a c7 to c20 alkylaryl group , a c7 to c20 arylalkenyl group , a c7 to c20 alkenylaryl group , a c5 to c20 heteroaryl group , a c6 to c20 heteroarylalkyl group , a c6 to c20 heteroarylalkenyl group , a c3 to c20 cycloalkyl group containing one or more heteroatoms and a c3 to c20 cycloalkenyl group containing one or more heteroatoms . as described above , in the ligand compound represented by the chemical formula 1 , both of r5 and r6 may not be methyl groups , or the ligand compound may have an asymmetric substituent structure that r5 and r6 are different from each other . in a more suitable example , the ligand compound may be a linear alkyl group having at least 2 carbon atoms , or a substituent containing at least one heteroatom or aromatic group . due to the structural features of the substituent of the aniline group , the catalyst system containing the ligand compound can easily react with pnp - cr according to various conditions such as electronic and steric environment around the transition metal to exhibit not only high oligomerization reaction activity but also a high selectivity for 1 - hexene , 1 - octene and the like . further , it is possible to greatly reduce the production of by - products of solid alpha - olefin form such as 1 - hexene isomers which have a large effect on the product even in a small amount in the oligomerization . additionally , due to the increase of 1 - hexene and the decrease of the by - products , the separation of these may be unnecessary , and this can also bring an energy saving effect . in the mean time , in the ligand compound represented by chemical formula 1 , r1 to r4 and r7 to r9 may be various substituents as described above , but in a more specific example , r7 to r9 may be hydrogen and r1 to r4 may be phenyl groups . also , the ligand compound may be synthesized by the following reaction formula 1 , but is not limited thereto . in reaction formula 1 , g1 may be a phenyl group having r5 to r9 of the chemical formula 1 , g2 and g3 may be respectively r1 to r4 of chemical formula 1 , and x may be halogen . the above reaction formula 1 is a general reaction formula for synthesizing the ligand compound represented by the chemical formula 1 , and may be a reaction that amine and phosphine react to form a diphosphinoamine . in other words , it may be a reaction that the amine makes the departure of the leaving group represented by x of the phosphine as a nucleophile and is substituted for . and , the x is not particularly limited as long as it is a functional group which is easily released and is stable after being released , for example , cl , br , or i as halogen . according to another exemplary embodiment of the present disclosure , a catalyst system for oligomerization including the ligand compound , a transition metal compound and a cocatalyst , or including an organic transition metal compound wherein the ligand compound is coordinated to the transition metal may be provided . as used herein , the term ‘ oligomerization ’ means polymerization of a small number of olefins . for example , oligomerization collectively refers to multimerization , including trimerization or tetramerization , according to the repeating number of olefins to be polymerized . in the present disclosure , particularly , the oligomerization refers to selective preparation of 1 - hexene and 1 - octene , which are main comonomers of lldpe , from ethylene . this selective olefin oligomerization reaction is closely related to the catalyst system used . the catalyst system used in the olefin oligomerization reaction includes a transition metal compound serving as a main catalyst , a ligand compound and a cocatalyst . and , the structure of the active catalyst species can be changed according to the chemical structure of the ligand compound , thereby olefin selectivity , the activity , or the amount of by - products produced may vary . the transition metal compound of the catalyst system for oligomerization according to the exemplary embodiment of the present disclosure serves as a main catalyst . the ligand compound may be in the form of an organic transition metal compound coordinated to a transition metal , or may be in the form of a catalyst composition present in a mixed state with the ligand compound . in the example of the organic transition metal compound , phosphorus ( p ) in the diphosphinoamine group of the ligand compound may be an active site , which may be coordinated while receiving electrons from the transition metal . in an exemplary embodiment , the transition metal compound represented by mx 3 and the ligand compound represented by the chemical formula 1 may have a form of the organic transition metal compound by coordinate bonding in the form of the following chemical formula 1 - 1 : in the chemical formula 1 - 1 , r1 to r9 are the same as in chemical formula 1 , m may be a transition metal , preferably cr , x1 to x3 may be each independently h , f , cl , br , i , or an alkyl group , an alkenyl group , an arylalkyl group , a heteroalkyl group , a heteroalkenyl group , or a heteroarylalkyl group having 1 to 6 carbon atoms , or halogen . specifically , the organic transition metal compound may be an organic chromium compound that the ligand compound is coordinated to chromium atom . for the chromium compound ( that is , the chromium compound coordinated to the ligand compound ) for forming the organic chromium compound , for example , at least one selected from the group consisting of chromium ( iii ) acetylacetonate , tris ( tetrahydrofuran ) chromium trichloride , chromium ( iii )- 2 - ethylhexanoate , chromium ( iii ) tris ( 2 , 2 , 6 , 6 - tetramethyl - 3 , 5 - heptanedionate ), chromium ( iii ) benzoylacetonate , chromium ( iii ) hexafluoro - 2 , 4 - pentanedionate , and chromium ( iii ) acetate hydroxide may be used . the cocatalyst may be an organic metal compound containing the group 13 metal , and is not particularly limited as long as it may be generally used in olefin oligomerization in the presence of a catalyst of a transition metal compound . specifically , the cocatalyst may be at least one selected from the group consisting of the compounds represented by the following chemical formulae 2 to 4 . in the chemical formula 2 , r 5 are the same as or different from each other , and are each independently a halogen radical , a c1 to c20 hydrocarbyl radical , or a c1 to c20 hydrocarbyl radical substituted with halogen , and c is an integer of 2 or more , d is aluminum or boron , r 6 are the same as or different from each other , and are each independently hydrogen , halogen , a c1 to c20 hydrocarbyl or a c1 to c20 hydrocarbyl substituted with halogen , l is neutral lewis base , [ l - h ] + is bronsted acid , q is br 3 + or al 3 + , and e are independently a c6 to c20 aryl group or a c1 to c20 alkyl group , unsubstituted or substituted with at least one selected from the group consisting of halogen , a c1 to c20 hydrocarbyl , an alkoxy group and a phenoxy group . the compound represented by chemical formula 2 may be modified methyl aluminoxane ( mmao ), methyl aluminoxane ( mao ), ethyl aluminoxane , isobutyl aluminoxane , butyl aluminoxane , and the like . the compound represented by chemical formula 3 may be trimethylaluminum , triethylaluminum , triisobutylaluminum , tripropylaluminum , tributylaluminum , dimethylchloroaluminum , dimethylisobutylaluminum , dimethylethylaluminum , diethylchloroaluminum , triisopropylaluminum , tri - s - butylaluminum , tricyclopentylaluminum , tripentylaluminum , triisopentylaluminum , trihexylaluminum , ethyldimethylaluminum , methyldiethylaluminum , triphenylaluminum , tri - p - tolylaluminum , dimethylaluminummethoxide , dimethylaluminumethoxide , trimethylboron , triethylboron , triisobutylboron , tripropylboron , tributylboron , and the like . the compound represented by chemical formula 4 may be triethylammonium tetraphenylborate , tributylammonium tetraphenylborate , trimethylammonium tetraphenylborate , tripropylammonium tetraphenylborate , trimethylammonium tetra ( p - tolyl ) borate , tripropylammonium tetra ( p - tolyl ) borate , triethylammonium tetra ( o , p - dimethylphenyl ) borate , trimethylammonium tetra ( o , p - dimethylphenyl ) borate , tributylammonium tetra ( p - trifluoromethylphenyl ) borate , trimethylammonium tetra ( p - trifluoromethylphenyl ) borate , tributylammonium tetrapentafluorophenylborate , n , n - diethylanilinium tetraphenylborate , n , n - diethylanilinium tetraphenylborate , n , n - diethylanilinium tetrapentafluorophenylborate , diethylammonium tetrapentafluorophenylborate , triphenylphosphonium tetraphenylborate , trimethylphosphonium tetraphenylborate , triethylammonium tetraphenylaluminum , tributylammonium tetraphenylaluminum , trimethylammonium tetraphenylaluminum , tripropylammonium tetraphenylaluminum , trimethylammonium tetra ( p - tolyl ) aluminum , tripropylammonium tetra ( p - tolyl ) aluminum , triethylammonium tetra ( o , p - dimethylphenyl ) aluminum , tributylammonium tetra ( p - trifluoromethylphenyl ) aluminum , trimethylammonium tetra ( p - trifluoromethylphenyl ) aluminum , tributylammonium tetrapentafluorophenylaluminum , n , n - diethylanilinium tetraphenylaluminum , n , n - diethylanilinium tetraphenylaluminum , n , n - diethylanilinium tetrapentafluorophenylaluminum , diethylammonium tetrapentafluorophenylaluminum , triphenylphosphonium tetraphenylaluminum , trimethylphosphonium tetraphenylaluminum , triphenylcarbonium tetraphenylborate , triphenylcarbonium tetraphenylaluminum , triphenylcarbonium tetra ( p - trifluoromethylphenyl ) borate , triphenylcarbonium tetrapentafluorophenylborate , and the like . in the catalyst system for oligomerization of the exemplary embodiment , the aluminoxane - based compound , more preferably methyl aluminoxane ( mao ) or modified methyl aluminoxane ( mmao ) may be used as the cocatalyst . to increase the selectivity to linear alpha olefins and the multimerization reaction activity of the catalyst system for oligomerization , the mole ratio of the ligand compound : the transition metal compound : the cocatalyst may be controlled to be about 0 . 5 : 1 : 1 to about 10 : 1 : 10 , 000 , preferably about 0 . 5 : 1 : 100 to about 5 : 1 : 3 , 000 . but the catalyst system for oligomerization according to the present disclosure is not limited thereto . in the catalyst system for oligomerization including the ligand compound represented by the chemical formula 1 , the transition metal compound and the cocatalyst , the three components of the catalyst system may be mixed at the same time or in an arbitrary order in the presence of a proper solvent and in the presence or absence of a monomer to obtain an active catalyst . the proper solvent may be heptane , toluene , cyclohexane , methylcyclohexane , 1 - hexene , diethylether , tetrahydrofuran , acetonitrile , dichloromethane , chloroform , chlorobenzene , methanol , acetone , and the like , but is not limited thereto . according to another embodiment of the present disclosure , a method for olefin oligomerization , including the step of multimerizing olefins in the presence of the catalyst system for oligomerization is provided . in this method , the activity of the reaction and the selectivity may be improved by using the catalyst system for olefin oligomerization described above . in addition , the content of by - products produced as a result of oligomerization may be greatly reduced . at this time , the olefin may include ethylene . the method for oligomerization of the present disclosure may be carried out by applying the catalyst system for oligomerization and a common device and contact technology . the oligomerization may be carried out by a homogeneous liquid phase reaction in the presence or absence of an inert solvent , by a slurry reaction using the catalyst system that is partially or not totally dissolved , by a two - phase liquid / liquid reaction , or by a bulk reaction or a gas phase reaction in which the product olefin acts as a main medium , and the homogeneous liquid phase reaction may be preferable . the olefin oligomerization reaction may be carried out in the presence of an inert solvent that doesn &# 39 ; t react with the catalyst compound and the activator . the proper inert solvent may be benzene , toluene , xylene , cumene , heptane , cyclohexane , methylcyclohexane , methylcyclopentane , hexane , pentane , butane , isobutene , and the like , but is not limited thereto . at this time , the solvent may be used after removing a small amount of water or air acting as a catalyst poison by treating with a small amount of alkylaluminum . the olefin oligomerization reaction may be carried out at a temperature of about 5 ° c . to about 200 ° c ., preferably about 30 ° c . to about 150 ° c . the olefin oligomerization reaction may be carried out at a pressure of about 1 bar to about 300 bar , preferably about 2 bar to about 150 bar . the range of the temperature and pressure may be an optimal condition for olefin multimerization reaction . when the olefin is multimerized in the range of the temperature and pressure above , the selectivity to the desired alpha - olefin may be excellent , the amount of by - products may be reduced , the efficiency of the process operation may be increased , and the cost may be reduced . according to one embodiment of the present disclosure , the catalyst system using the compound represented by chemical formula 1 as a ligand may have improved activity compared with the conventional oligomerization catalyst system . therefore , when ethylene is oligomerized using the catalyst system , 1 - hexene and 1 - octene may be selectively synthesized , and the amount of the 1 - hexene isomer may be greatly reduced , which can be confirmed in the following examples . hereinafter , embodiments of the present invention are described in detail so that those skilled in the art are able to easily perform . but the present disclosure may be embodied in various forms , and the scope of the present disclosure is not limited to the examples provided herein . all the reactions were carried out under argon using schlenk technique or a glovebox . the synthesized ligands were analyzed by 1 h ( 500 mhz ) and 31 p ( 202 mhz ) nmr spectra using a varian 500 mhz spectrometer . the shifts were expressed in ppm as a downfield from tms with a residual solvent peak as a reference . the phosphorous probes were calibrated with aqueous h 3 po 4 . under argon , 2 - ethyl - 6 - methylaniline ( 10 mmol ) and triethylamine ( 3 equiv . to amine ) were dissolved in dichloromethane ( 80 ml ). while the flask was immersed in a water bath , chlorodiphenylphosphine ( 20 mmol ) was slowly introduced , and the mixture was stirred overnight . after the solvent was removed under vacuum , another solvent ( diethyl ether , tetrahydrofuran or hexane ) was introduced , the mixture was sufficiently stirred , and triethylammonium chloride salt was removed by an air - free glass filter . the solvent was removed in the filtrate to obtain a product . the ligand compound was prepared by the same method as synthesis example 1 , except using 2 , 6 - diethylaniline instead of the 2 - ethyl - 6 - methylaniline used in synthesis example 1 . the ligand compound was prepared by the same method as synthesis example 1 , except using 2 - methoxy - 6 - methylaniline instead of the 2 - ethyl - 6 - methylaniline used in synthesis example 1 . the ligand compound was prepared by the same method as synthesis example 1 , except using 2 , 4 - dimethyl - 6 - phenylaniline instead of the 2 - ethyl - 6 - methylaniline used in synthesis example 1 . the ligand compound was prepared by the same method as synthesis example 1 , except using 2 , 6 - dimethylaniline instead of the 2 - ethyl - 6 - methylaniline used in synthesis example 1 . the ligand compound was prepared by the same method as synthesis example 1 , except using 2 - methylaniline instead of the 2 - ethyl - 6 - methylaniline used in synthesis example 1 . under argon gas , cr ( acac ) 3 ( 17 . 5 mg , 0 . 05 mmol ) and the ligand compound prepared in the synthesis example 1 ( 1 . 1 eq . to cr ) were introduced in a flask , methylcyclohexane ( 100 ml ) was added , and the mixture was stirred to prepare a 0 . 5 mm ( based on cr ) solution . a 600 ml parr reactor was prepared , vacuum was applied at 120 ° c . for 2 hours , and then , the inside was replaced with argon , and the temperature was decreased to 45 ° c . and , 140 g of methylcyclohexane and 1 . 6 ml of mmao ( 8 . 6 wt %, isoheptane solution ) were introduced , and 5 ml of the 0 . 5 mm solution ( 2 . 5 umol ) was introduced in the reactor . a valve of an ethylene line adjusted to 60 bar was opened to fill the inside of the reactor with ethylene , followed by stirring at 500 rpm for 15 minutes . the valve of an ethylene line was closed , the reactor was cooled down to 0 ° c . with a dry ice / acetone bath , and then , non - reacted ethylene was slowly vented , and 1 ml of nonane ( gc internal standard ) was introduced . and then , a portion of the liquid part of the reactor was taken and quenched with water , and the organic part was filtered with a ptfe syringe filter to be analyzed by gc . to the remaining reaction solution , 400 ml of ethanol / hcl ( 10 vol %) was added , and the mixture was stirred and filtered to obtain polymer . the obtained polymer was dried overnight in a 60 ° c . vacuum oven , and weighed . oligomerization , gc analysis and weighing of the obtained polymer were carried out in the same manner as in example 1 , except using the ligand compound prepared in synthesis example 2 instead of the ligand compound prepared in synthesis example 1 . oligomerization , gc analysis and weighing of the obtained polymer were carried out in the same manner as in example 1 , except using the ligand compound prepared in synthesis example 3 instead of the ligand compound prepared in synthesis example 1 . oligomerization , gc analysis and weighing of the obtained polymer were carried out in the same manner as in example 1 , except using the ligand compound prepared in synthesis example 4 instead of the ligand compound prepared in synthesis example 1 . oligomerization , gc analysis and weighing of the obtained polymer were carried out in the same manner as in example 1 , except using the ligand compound prepared in comparative synthesis example 1 instead of the ligand compound prepared in synthesis example 1 . oligomerization , gc analysis and weighing of the obtained polymer were carried out in the same manner as in example 1 , except using the ligand compound prepared in comparative synthesis example 2 instead of the ligand compound prepared in synthesis example 1 . the results of examples 1 to 4 and comparative examples 1 and 2 are shown in the following table 1 . as shown in table 1 , it was confirmed that using the ligand compounds of synthesis examples 1 and 2 produced a smaller amount of by - products such as hexene isomers , and exhibited a higher hao selectivity than the case using the ligand compounds of comparative synthesis example 1 . further , even in example 3 using a hetero atom - substituted ligand compound ( synthesis example 3 ), it was confirmed that there was no problem in using the catalyst system with the group containing the hetero atom for the oligomerization reaction . in addition , it was confirmed that example 4 using an aryl group - substituted ligand compound ( synthesis example 4 ) was also very useful for the oligomerization reaction . while the preferred examples of the present invention have been shown and described in detail , it should be understood that various substitutions , modifications and variations may be made by those skilled in the art without departing from the spirit or scope of the invention . accordingly , all such modifications and variations are included in the scope of the invention as defined by the following claims . | 2 |
the following detailed description is merely exemplary in nature and is not intended to limit application and uses . furthermore , there is no intention to be bound by any theory presented in the preceding background or summary or the following detailed description . in the present description and in the annexed claims by the expression “ key - on action ” it is generally meant an action by which in a vehicle powered by a diesel engine with a conventional glowing system the user determines the activation of the glow plugs associated with the engine . in such a motor vehicle having a conventional key - operated ignition and starting switch , such a “ key - on action ” is represented by the introduction and rotation of the key to the so - called “ on ” position , i . e . a position in which the ignition and starting switch allows on - board electrical systems to be supplied with power from the battery and causes the glow plugs to be activated . in vehicles which are not provided with such an ignition and starting switch , by “ key - on action ” it is meant any equivalent action , performed also with means different from a key , and capable of causing , in a conventional glowing system for a diesel engine , the activation of the glow plugs . briefly , the method according to the present invention consists in that the glow plugs 6 are activated in sequence , one after the other , and not contemporaneously , after a driver key - on action . so , it is not anymore necessary to supply the glow plugs 6 with a great quantity of energy , thus leading to a significant reduction of the electrical power consumption during the activation phase . as a result , the power circuit design is improved and simplified . in fig2 is shown a block diagram of a vehicle 50 using a method according to the invention . the vehicle 50 comprises a power control unit 52 arranged to control an engine 2 , having a plurality of glow plugs 6 , and a transmission system 54 of the vehicle 50 . the vehicle 50 further comprises a vehicle control unit 56 arranged to detect the driver key - on action . the power control unit 52 comprises an electronic control module 22 for driving the glow plugs 6 . the vehicle control unit 56 detects the occurrence of a driver key - on action and then activates the power control unit 52 which in turn starts the engine 2 . the power control unit 52 further comprises a memory 58 for storing data indicative of the activation sequence of the cylinders 4 , i . e ., data indicating the order in which the cylinders 4 must be activated as soon as the engine is started . in fact , engine cylinders 4 do not fire all at the same time but they are activated in a sequence . the glow plugs 6 can therefore be activated individually in a predetermined sequence , i . e ., the same sequence in which the cylinders 4 must be activated , without affecting the glowing system quickness . the activation of the glow plugs 6 is performed in a sequential manner because the engine 2 does not need to have all the glow plugs 6 hot at the same time . during the cranking of the engine 2 , the engine speed is quite lower than when the engine 2 is running , for example , during the cranking phase the engine speed is approximately 200 rpm while during the running phase the engine speed is above approximately 800 rpm . this allows a time delay , between the activation of each cylinder 4 , quite high , for example approximately 100 ms , so allowing to shift the activation of each glow plug 6 without affecting the performance of the engine 2 . the time delay between one activation and the next one is a predetermined value defined by the power control unit 52 in dependence of engine conditions , for example the engine coolant temperature , the air temperature or the engine starter motor speed . the optimal delay is a trade off between the quickness requested , the power circuit electrical power limits and the maximum delay applicable without affecting the glowing quickness . the first two parameters depend on the environmental factors while the third parameter is mainly related to the engine speed during the cranking phase . in fig3 - 6 are illustrated a plurality of graphs showing the results of the method according to an embodiment of the invention . in fig3 a first , a second , a third and a fourth graph show the voltage across four different glow plugs 6 : as it can be noted , the voltage is applied to each glow plug 6 in a sequential manner , and the voltage increase begins in the first glow plug 6 when the power control unit 52 detects the driver key - on action , shown in a fifth graph of said fig3 . in fig4 a first , a second , a third and a fourth graph show the temperature in the four different glow plugs 6 : when each glow plug 6 is supplied with a high voltage , the temperature starts to increase until it reaches the predetermined working temperature ; at this moment , the voltage is lowered to the nominal value necessary to keep said working temperature ( see fig3 ). a fifth graph shows the driver key - on action . in fig5 a first , a second , a third and a fourth graph show the power dissipated in the four glow plugs 6 . a fifth graph shows the total power peak which is lower than the corresponding value of the prior art systems , for instance approximately 1700 w . in fig6 a first , a second , a third and a fourth graph show the current dissipated in the four glow plugs 6 . a fifth graph shows the total current peak which is lower than the corresponding value of the prior art systems , for instance approximately 150 w . clearly , provided that the principle of the invention is retained , the forms of embodiment and the details of manufacture may vary greatly from what has been described and illustrated purely by way of non - restrictive example , without thereby departing from the scope of the invention as defined in the accompanying claims . moreover , while at least one exemplary embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . it should also be appreciated that the exemplary embodiment or exemplary embodiments are only examples , and are not intended to limit the scope , applicability , or configuration in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing an exemplary embodiment it being understood that various changes may be made in the function and arrangement of elements described in an exemplary embodiment without departing from the scope as set forth in the appended claims and their legal equivalents . | 5 |
the machine comprises a frame which is built into a housing 1 with a through - c channel . in the bottom of said channel c there is disposed a conveyor belt 2 . in the example shown , the belt is a commonly - known endless rubber belt which is provided with a number of suction holes for suction from underneath the belt , so that items 3 to be sanded , such as panels , doors , etc ., placed on the belt will be secured on the belt without the need for further fastening . as shown , the belt 2 can be moved through the machine 1 , so that the items can be machined inside the machine . to effect the machining , in the machine &# 39 ; s upper part there is mounted a machining apparatus comprising a motor 6 and an arm 7 which is secured to the motor shaft to extend substantially radially from the motor axis . at the end of the arm 7 remote from the motor there is mounted a vertical pivot 8 ( see fig2 ) supporting an underlying slide shoe 10 or the like so that the slide shoe 10 can turn around the vertical pivot 8 . the underside of shoe 10 is an inverted v shape having side legs which can grip around a slide rail 11 , in that said slide rail 11 extends longitudinally with the machine as shown in fig2 . the slide rail 11 is secured to a bracket 12 , see fig1 which in turn is secured to a fixed part 13 of a carriage having four wheels 5 resting on guide rails 4 on the movable sanding and moving equipment itself , which in principle is illustrated in fig3 . the guide rails 4 extend across and parallel to the top side of the forward moving part of belt 2 and transversely to the direction of motion of the belt . the axis of rotation 9 of the pivot 8 is substantially coincident with the axis of rotation of the spindle drive 26 . the spindle drive 26 comprises a housing from which spindles 28 project outwardly , and on which can be secured sanding elements in the form of rollers 29 , as shown in fig1 and 2 . as indicated by the arrows , the spindles 28 alternately rotate the one way and the other way around , while at the same time all of the spindles are turned around by means of a drive 27 with a motor 25 . a motor 24 is mounted for the rotation of the spindles via the drive . a motor 24 is carried by the carriage , and at its downwardly facing end the motor 24 is connected to a drive 26 from which a number of spindles 28 extends radially outward in a plane which is parallel to the top side of the forward moving part of the belt 2 . by means of the drive 26 , the spindles 28 and sanding elements 29 provided thereon can rotate in both directions , alternatively . the entire drive 26 with spindles 28 and sanding elements 29 will be rotated by means of a motor 25 and a drive 27 about an axis 9 directed at right angles to the top side of the forward moving part of the belt 2 . the whole of this spindle drive 26 is suspended in journals 23 at the end of two supporting arms 22 , which at their opposite ends are pivotally connected to a wheel axle 16 with wheels 5 . the motor 24 and the drive 26 are together with the motor 25 and its drive 27 supported in the journals 23 and are furthermore supported in a displaceable manner in vertical direction on the fixed part 13 in the carriage , which further support is not shown in the drawing . it will be understood that the mentioned two motors 24 and 25 and the drives 26 and 27 can only be vertically displaced , so that the shown axis 9 remains at right angles to the top side of the forward moving part of the belt 2 . at the middle of the arms 22 there are linked a pair of shorter arms 20 , the opposite ends of which are provided with a wheel axle 15 with wheels 5 . these wheels 5 can rest on two guide rails 4 which extend transversely to the machine 1 and therewith to the path of movement of the belt 2 , as shown in fig2 . the one wheel axle 15 extends through a pair of guide slots 14 in the fixed part 13 . also linked to the wheel axle 15 are the legs of a yoke 17 which in the center is in threaded engagement with a spindle 18 which can be turned by a motor 19 . the end of the spindle 18 is linked loosely to the other wheel axle 16 . by rotation of a motor 19 a thread spindle 18 is rotated so that its thread engagement with a yoke 17 will cause it to be screwed into and out of the yoke 17 , respectively . since that end of the thread spindle 18 which turns away from the yoke 17 surrounds an axle 16 , and the yoke 17 is connected with another axle 15 , the distance between the two axles 15 , 16 is shortened and increased , respectively . the arm pairs 20 and 22 hereby turn in the manner of jaw - tongs about their shared axis 21 , whereby that end of the arm pair 22 which has journals 23 is vertically lowered and raised , respectively . there is hereby formed a raising and lowering arrangement for the spindle drive , which by turning of the threaded spindle 18 results either in a lengthening of the arms 20 and 22 and thus a raising of the spindle drive 26 , or a shortening for the lowering of the spindle drive 26 . by this raising or lowering of the journals 23 and the displacement attachment of the motor 26 to the fixed part 13 in the carriage , the vertical direction of the axis 9 is constantly maintained , although it is parallelly displaced along the guide rails 4 , whereby the spindles 28 can be turned by the drive 26 in different horizontal planes . the distance from the mutual pivot joint 21 of the arms 20 and 22 to the wheel axle 15 is the same as the distance to the journal 23 for the drive 26 , whereby it is ensured that the spindles 28 will always be in the same plane . by rotation of the motor 6 , the free end of the arm 7 is moved in a circular movement which also applies to the slide shoe 10 . the slide shoe 10 is pivotal about the pivot 8 relative to the arm 7 , but is at the same time guided by the rail in such a manner that the slide show 10 can only be displaced in the longitudinal direction of the rail 11 , i . e . parallel to the direction of motion of belt 2 . as mentioned , the moving arrangement for the carriage comprises a rotatable arm 7 which can drive the slide shoe 10 on the slide rail 11 around in a circular movement , as shown in fig2 . since the motor 6 is secured to the frame , rotation of the motor 6 will move the slide shoe 10 in a circular movement relative to the rail 11 and the connected carriage which by means of the wheel pairs 5 can ride on the guide rails 4 . the circular motion of the slide shoe 10 is therefore partly converted into a to and from motion along the rail 11 and to a reciprocating motion of the carriage on the guide rails 4 . the carriage with the wheels 5 will hereby roll on the guide rails 4 from the one end of the rails to the other , between the fully - drawn position to that shown with stippled lines in fig1 and 2 . as will appear from the drawing , the sanding rollers 29 are moved a distance past the extent of the items 3 along the breadth of the belt , whereby the sanding is effected within the movement pattern of the rollers 29 , and preferably some distance inside . instead of the described machining apparatus comprising a carriage on rails which extends transversely to the feeding direction of the belt by means of an actuator , other forms of movement arrangements can be used . the spindle drive will thus be connected to a turning arrangement which gives the drive a rotating circular movement over the belt , or a reciprocating movement in an arcuate path transversely to the feeding direction of the belt . referring to fig4 an alternative embodiment of the present invention is shown where the drive is given a rotating circular movement over the belt . the conveyor belt and the machining apparatus , as previously described in relation to fig1 and 3 , are shown in fig4 . however , at the end of the remote arm 7 , there is mounted a vertical pivot 30 , which is rotatably attached to a bracket 31 which in turn is secured to a fixed part 32 of the carriage which has four wheels resting on guide rails 33 . consequently , in this embodiment , the slide rail 11 is eliminated . the axis of rotation of the pivot is substantially coincidental with the axis of rotation of the spindle drive 26 , as described previously . however , rather than resulting in a transverse movement as the arm 7 moves in response to the motor 6 , the entire drive unit is moved in a circular direction , as illustrated by the outer boundary 34 , drawn with a solid line . the apparatus has a carriage having all four wheels resting on guide rails which extend in a circle around the moving part of the belt and overlapping it somewhat so that any item carried on the belt will be acted upon not only by the circular motions of the sanding rollers , but will also be subject to the overlapping circles of the entire head of the apparatus as it rotates about the belt . the suspension of the spindle drive 26 is the same as described previously with journals 23 at the end of two supporting arms 22 which are connected at the opposite ends and pivotally connected to an axle 16 . arms 20 with shared axis 21 connected to axle 15 and cooperating with guide slots 14 in fixed part 13 are also used . however , wheels for supporting the carriage are not located on the axle 16 . rather wheels 36 are attached to an axle 37 which extends from the yoke 17 so as to reduce the center of the wheel extension and to increase the efficiency of the device in circular operation . in addition , the wheels 36 and wheels 38 have a jointed connection to their associated axels , so as to adapt to the curvature of the rails . however , this has no effect on the ability of the supporting arms to allow the two motors 24 and 25 and drives 26 and 27 to be vertically displaced . the other elements of the apparatus remain the same as that described in relation to fig2 and 3 , except that as an alternative embodiment of the invention , the spindle 18 which can be turned by a motor 19 , is replaced by a spring 39 located between the axle 16 and the yoke 17 . in the embodiment described in fig3 rotation of a motor 19 rotates a threaded spindle 18 so that its thread engagement with the yoke will cause it to be screwed into and out of the yoke so as to adjust the difference between the two axels 15 and 16 , which in turn results in a vertical raising and lowering of the spindle drive unit . in the alternative embodiment , the spring 39 is located between the yoke 17 and axle 16 which provides resilient biasing to balance the weight of the spindle drive against the spring force pressure . consequently , the weight of the spindle drive can be lessened or increased by the spring pressure such that the optimal pressure for sanding is achieved , yet any excessive resistance which is encountered due to the height of a particular article passing through the machine will overcome the spring bias and allow the spindle drive to move upwardly to prevent an overpressure condition and over - sanding of the article as it passes through the machine . consequently , the height of the spindle drive is adjusted automatically while the machine is in operation . it is contemplated that the amount of spring biasing could be altered automatically during machine operation , using a motor similar to that described in relation to threaded shaft 18 , which can result in a tightening or loosening of the spring pressure without an operator having to gain access to the interior of the machine . of course , manual adjustment is also possible using a screw 40 as shown in fig5 which can be adjusted between sanding operations . the sanding rollers 29 are made to rotate by means of the motor 24 , and are turned around the axis of rotation 9 by means of the motor 25 . the moving arrangement for the carriage can now be activated by starting the motor 6 on the machine 1 , whereby the carriage will move in a reciprocating manner on the guide rails 4 . items 3 can now be placed on the belt 2 , which can be moved to traverse through the machine by means of a suitable driving arrangement ( not shown ). the sanding rollers 29 can now be lowered by means of the motor 19 until a suitable contact is established between the sanding elements on the rollers and the items . the sanding movement , which is described by the individual sanding elements on the rollers 29 , comprises both a rotation around the spindle axle and a turning movement around the center axis 9 of the drive , whereby the area shown in fully - drawn lines in fig1 and 2 is swept , and also a reciprocating transverse movement for sweeping between the fully - drawn area and the area shown with stippled lines . the sanding rollers 29 are made to rotate by means of the motor 24 , and are turned around the axis of rotation 9 by means of the motor 25 . the moving arrangement for the carriage can now be activated by starting the motor 6 on the machine 1 , whereby the carriage will move in a circular manner on the guide rails 33 . items 3 can now be placed on the belt , which can be made to traverse through the machine by means of a suitable driving arrangement ( not shown ). the sanding rollers 29 , being suspended by the spring 39 are maintained in a balanced position offset by the weight of the drive , and respond by vertically raising or lowering of the drive in response to resistance pressure established by the height of the objects which are passing between the sanding elements of the rollers . the drive , however , maintains its planar orientation during this raising or lowering movement . the sanding movement , which is described by the individual sanding elements on the rollers 29 , comprise both a rotation about the spindle axes and a turning movement around the center axes of the drive , whereby the area shown in fully drawn lines in fig4 are swept , and also circular movement for sweeping the entire circular area which covers the belt is achieved . the result achieved hereby is the especially effective sanding mentioned above , in that the sanding is effected by a relatively constant speed of contact between the item and the individual sanding elements , which is due to the expedient equalization of the speed components during the movement reversals of the carriage , or by the circular over lap pattern . in addition to the advantage of the more uniform sanding in the full extent of the belt 2 , which reduces sanding damage and increases the efficiency , a considerably more uniform wear is achieved on the sanding rollers 29 , which therefore require less frequent replacement , which results in low operational expenses . | 1 |
reference is made in detail to embodiments of the invention . while the invention is described in conjunction with the embodiments , the invention is intended to cover alternatives , modifications , and equivalents , which may be included within the spirit and scope of the invention as defined by the appended claims . furthermore , in the following detailed description of the invention , numerous specific details are set forth in order to provide a thorough understanding of the invention . however , as is obvious to one ordinarily skilled in the art , the invention may be practiced without these specific details . in other instances , well - known methods , procedures , components , and circuits have not been described in detail so that aspects of the invention will not be obscured . the present invention provides a method for programming and erasing charge - trapped devices . the memory device includes an oxide - nitride - oxide structure . an embodiment of the invention is illustrated in fig2 a - 2c . fig2 a illustrates a cross - sectional view of a charge - trapped memory device . fig2 a includes a p - silicon substrate 200 . the silicon substrate has two doped junctions 202 and 204 . disposed over the substrate 200 is an oxide - nitride - oxide ( ono ) structure 207 . the ono structure 207 includes bottom and top oxide layers 206 and 210 , respectively . a nitride layer 208 is disposed between the top and bottom oxide layers 206 and 210 . a gate ( not shown ) is defined over the top oxide layer 210 . in fig2 a , the device is firstly reset through fowler - nordheim (− fn ) gate injection as illustrated by arrows 212 . fowler - nordham gate injection is accomplished by applying a negative voltage to the gate . the negative voltage to the gate places the device in a reset / erase state . the reset / erase state is the dynamic balance state of the gate injection and the charge de - trapping mechanisms . the applied negative voltage is in the range of about − 15v to about − 23v . programming can be carried out by applying a positive gate voltage as shown in fig2 b . application of a positive voltage in the range of about 20v causes the device to inject electrons from the n - inversion channel 205 to the trapping layer 208 as indicated by arrows 214 . a negative voltage is applied to the gate in order to restore the device from the programmed state to the reset \ erased state . in one embodiment , the applied negative voltage is the same as the amount of voltage applied in fig2 a for resetting . the erase process is illustrated in fig2 c . when a negative voltage is applied to the gate , additional injected electrons during the programming operation , as shown in fig2 b , may be propelled out of the trapping layer in the erase cycle as indicated by the arrows 216 in fig2 c . in one embodiment of the invention , the gate is made of material having a large effective barrier height to reduce the gate injection . gates with p + poly gate or metal gate with a high work function is preferred over n + polygate , as this will reduce the threshold voltage ( v t ) of the reset state . moreover , − fn erasing is possible with the use of p + poly gate material . the p + poly gate material effectively reduces the gate injection , allowing the gate to be operated under a large negative gate voltage v g . in one embodiment , the p +- poly gate may be fabricated by depositing an un - doped poly silicon film , followed by implanting boron or bf2 into the poly silicon film . the large negative gate voltage enhances the electron de - trapping . also , with the use of a large v g , thick tunnel oxides may be used . use of thick tunnel oxide helps to prevent charge leakage and this makes the device more reliable . in one embodiment , a tunnel oxide layer having a thickness ranging from 3 nm to 6 nm is used . although a small amount of gate injection still occurs , the erasing operation acts as a dynamic balance between the gate injection and the electron trapping . as illustrated in fig2 c , the negative voltage applied during the erase operation repels the additional electrons and restores the device to the balance state . the erase operation described above is self - converging . fig3 a to 3 c illustrate the experimental result of the memory operation in accordance with an embodiment of the invention . the result is for a device that is fabricated by nrom technology with 0 . 25 m design rule . the poly gate is boron doped p + poly gate to reduce the gate injection . the thickness of the bottom oxide , nitride trapping layer and top blocking oxide are 5 . 5 , 6 , and 9 nm , respectively . fig3 a is a graph illustrating the reset state of the device in accordance with an embodiment of the invention . the threshold voltage v t is shown on the y - axis and the time in seconds is shown on the x - axis . for resetting the device , a gate voltage of about − 21 v and a read voltage of about 1v is applied . the resetting operation proceeds as described above . subsequent to resetting , the device can be programmed . fig3 b is a graph illustrating the program state of the device in accordance with an embodiment of the invention . in fig3 b , the threshold voltage v t is plotted on the y - axis and the time in seconds is plotted on the x - axis . each of the lines illustrated by the different shapes , represent a different gate voltage . the gate voltage range from about 17v to about 20v . fig3 c is a graph illustrating the erase state in accordance with an embodiment of the invention . like fig3 a and 3 b , the threshold voltage v t is shown on the y - axis and the time in seconds is shown on the x - axis . to erase the device , the same negative gate voltage as the reset operation can be applied to restore the device to the original reset \ erase state . the reason is because a dynamic balance state happens when the gate voltage is about − 21 v . under this gate voltage , only certain v t state can be kept stable in order to keep the gate injection and electron - de - trapping balance each other . in this way , the additional injected electrons by a positive gate voltage can be propelled out of nitride . the erase operation described above is self - convergent . as such , the present invention eliminates the issues associated with over - erase . fig4 is a graph illustrating the endurance properties of the operation in accordance with an embodiment of the invention . the v t is shown on the y - axis and the number of cycles is shown on the x - axis . the programming as described above , is accomplished by applying a voltage in the range of about 20v . the erase operation is accomplished by applying a voltage of about − 21v as described above with respect to fig3 c . as can be seen , the present invention provides high charge retention due to the thick bottom oxide used . the thick bottom oxide also helps to avoid hot - hole injection , which further helps to retain the charge . fig5 is a graph that shows the charge loss for 1k program / erase cycles in high temperature baking environment in accordance with an embodiment of the invention . the v t loss is shown on the y - axis and the baking time in years is shown on the x - axis . even here the charge loss is small . referring to fig6 , the figure illustrates barrier height 600 required for gate injection in accordance with an embodiment of the present invention . the barrier height is generally maintained high in order to reduce the gate injection and threshold reset voltage . in one embodiment , the barrier height is larger than that of oxide and silicon conduction band offset , of about 3 . 1 ev . in case of a heavily doped p + - poly gate , the barrier height should be close to the band offset between the oxide and silicon valence band , namely , 4 . 2 ev . this way , the fowler - nordham tunneling from the poly gate can be greatly reduced , and the reset \ erase state v t can be lowered . fig7 shows a cross sectional view of a charge - trapping memory device in accordance with an embodiment of the invention . the memory device includes a p - substrate 700 and source and drain junctions 702 and 704 . the memory device further includes a top oxide layer 710 and bottom oxide layer 706 . a trapping layer 708 is disposed between two oxide layers 706 and 710 . a gate 712 is disposed over the top oxide layer 710 . when a voltage is applied to the gate 712 , a channel 714 is formed under the oxide layer 706 between the drain 702 and source 704 . applying a negative voltage to the gate 712 may reset the charged memory device described in fig7 . the negative voltage effectively resets the device . in one embodiment of the present invention , fowler - nordheim tunneling is used to program and erase the memory device . fowler - nordheim tunneling is accomplished by applying a powerful electric field across the oxide layer , which enables electrons to tunnel through the oxide . in the charge - trapped memory device described in fig7 , the gate may be of the type p + poly gate so the gate injection may be reduced . the gate may also be made of metals with large work functions , such as platinum . in order to enhance the de - trapping of electrons and the erase speed , the thickness of the bottom oxide layer may be adjusted . also , the property parameters of the individual layers that make up the ono stack may be adjusted . for example , materials with high dielectric constant ( k ), such as al 2 o 3 or hf 2 o 3 , may be used in place of conventional nitride - trapping layers so that the de - trapping rate may be varied . as such , the erase characteristics of the device in the present invention will differ from that of conventional charge - trapping devices , as the trap state energy spectrum will be different from that of a nitride layer . this also helps to alter the erase speed . high - k tunnel oxide is likely to decrease the barrier height required for detrapping and tunneling . consequently , the detrapping and the erase speed may be increased . also , the use of a high - k material for the bottom oxide layer is likely to decrease the top oxide electric field , which is also likely to result in reduced gate injection . in one embodiment , the high - k material that may be used to replace the top oxide preferably have a dielectric constant of about 9 , and a barrier height for gate injection greater than about 3 ev , in order to reduce the gate injection . the invention has been described thus far in terms of several exemplary embodiments . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specifications and practice of the invention . the embodiments and preferred features described above should be considered exemplary , with the scope of the invention being defined by the appended claims and their equivalents . | 6 |
a preferred embodiment of a coin sorting machine with a coin jam detecting device will be described with reference to the accompanying drawings . in fig1 reference numeral 1 designates a main coin supplying mechanism , which comprises : a rotary disk 3 driven by an electric motor 2 ; and a guide member 4 protruding above the rotary disk 3 so as to guide coins which are supplied from a hopper ( not shown ) onto the rotary disk 3 and are aligned along the periphery of the rotary disk 3 by centrifugal force . by the guide member 4 , the coins are delivered one by one into a coin sorting path 5 extending from the rotary disk 3 . the coin sorting path 5 is provided with two elongated guide control members 6 and 7 along its two sides in such a manner that a coin sliding surface 8 is defined between the guide control members 6 and 7 . in the coin sliding surface 8 there are provided a plurality of coin sorting sections 9 through 12 which are rectangular openings each having a first side aligned perpendicular to coin sorting path 5 and an opposite side spaced from the first side according to the diameters of coins to be handled by the machine . at least one conveying roller 13 adapted to slide coins along the coin sorting path 5 is provided above the path 5 for each of the coin sorting sections 9 through 12 . these are mounted on respective shafts in a direction oblique with respect to the coin conveying direction , or the longitudinal axis of the coin sorting path , as shown in fig1 . these conveying rollers 13 operate to convey coins loaded on the coin sorting path 5 , pushing each coin against the guide control member 6 , as a result of which the coins thus conveyed are dropped through the respective openings in the order of the diameters of the coins . that is , if it is assumed that 1 - yen , 50 - yen , 5 - yen , 100 - yen , and 10 - yen coins in the japanese monetary system ( whose diameters increase in the described order ) are sorted by the machine , 1 - yen coins are first dropped through the first opening , 50 - yen coins are next dropped through the next opening , and so forth . however , it should be noted that no opening is provided for 10 - yen coins , and 10 - yen coins are allowed to pass through the coin sorting path 5 and to drop into a sorted coin delivery section 18 ( described later ). sorted coin delivery section 14 , 15 , 16 , and 17 are provided under the respective coin sorting sections 9 , 10 , 11 , and 12 in a manner such that the coin sorting sections communicate with the sorted coin delivery sections . in addition , the above - described coin delivery section 18 for 10 - yen coins is provided at the end of the coin sorting path 5 . the sorted coin delivery sections 14 , 15 , 16 , 17 , and 18 have opening at their respective lower end portions , so that the sorted coins are dropped through the openings onto the rotary disks 24 of coin counting mechanisms 19 , 20 , 21 , 22 , and 23 , respectively . the coin counting mechanisms 19 through 23 are each designed so that coins received on the rotary disk 24 are delivered by the centrifugal force thereof one after another to a coin counting path 25 . an endless conveyor belt 26 is provided above each coin counting path 25 to slide the coins along the path 25 . in each coin counting path 25 , there is provided a counting ring 27 which is turned through a predetermined angle by a coin passing through the coin counting path 25 . thus , the sorted coins are counted separately according to their denominations by the respective counting rings 27 . when a predetermined number of coins is counted by the counting ring 27 , the latter is mechanically locked so as to block the flow of coins on the respective coin counting path . the coins which pass through the coin counting paths provided separately according to the denominations are allowed to drop into respective coin containers 28 through 32 provided separately according to the denominations . in fig1 reference numeral 33 designates a coin detecting switch for detecting the number of coins supplied to the coin supplying mechanism 1 . the coin detecting switch 33 is operated by a lever 34 which is actuated by coins on the rotary disk 3 , to thereby count the number of coins supplied to the coin supplying mechanism . in the coin sorting path 5 are provided intermediate coin detecting switches 35 , 36 , 37 and 38 for the respective coin sorting sections 9 , 10 , 11 and 12 , for detecting the presence or absence of coins on the coin sorting path 5 . these switches 35 , 36 , 37 , and 38 are operated by the upward movement of the respective conveying rollers 13 caused by coins conveyed along the coin detecting path 5 . the coin counting mechanisms 19 , 20 , 21 , 22 , and 23 are further provided with coin detecting switches 39 , 40 , 41 , 42 , and 43 , respectively , each of which is disposed between the rotary disk 24 and the coin counting path 25 of the corresponding coin counting mechanism for operation in response to the presence or absence of a coin delivered to the coin counting path 25 from the rotary disk 24 . coin counting and detecting switches 44 , 45 , 46 , 47 and 48 are operated by the predetermined angle rotation of the counting rings 27 in the coin counting mechanisms 19 , 20 , 21 , 22 , and 23 , respectively , so as to simultaneously count and detect a coin . the operation of the machine thus organized will be described in detail . a number of coins to be sorted out are loaded in the hopper , and are introduced onto the coin sorting path 5 one after another with the aid of the centrifugal force of the rotary disk 3 . the coins thus introduced are conveyed along the edge of the guide control member 6 on one side of the coin sorting path 5 by the conveying rollers 13 , and are sorted out according to the different diameters thereof . the coins thus sorted out are allowed to drop through the respective sorted coin delivering sections 14 through 18 onto the respective rotary disks 19 through 23 . the sorted coins on each rotary disk 24 are further delivered one by one to the coin counting path 25 by the centrifugal force of the rotary disk 24 . the coin thus delivered causes the counting ring 27 to turn through its predetermined angle , and is then allowed to drop into the respective money container . thus , all of the sorted coins are put in the respective money containers 28 through 32 . each of the coin counting and detecting switches 44 through 48 is operated by the predetermined angle rotation of the counting ring 27 as was described . in this connection , the coins may be electrically counted by the use of electrical counting signals . now , a coin jamming detecting device according to the invention will be described with reference to a circuit diagram shown in fig2 . it should be noted that for simplification of description the circuit is for detection of coin james of only three denominations ( 1 - yen , 50 - yen , and 5 - yen ). in fig2 a , reference numeral 50 is a coin - supplying - quantity detecting switch means which , when the coin detecting switch 33 ( fig1 ) detects coins for a predetermined period of time , or produces coin detection signals for a predetermined period of time , produces a high level signal ( hereinafter referred to merely as a &# 34 ; h &# 34 ; signal , when applicable ); that is , it produces the &# 34 ; h &# 34 ; signal by delaying the detection signal for about three seconds , for instance . the circuit further comprises : coin - introduction detecting switch means 51 , 57 , and 58 ; counting detecting switch means 54 , 55 , and 56 ; and intermediate detecting switch means 52 and 53 , as shown in fig2 a . the coin - introduction detecting switch means 51 ( or 57 or 58 ) operates to produce a &# 34 ; h &# 34 ; signal when the coin detecting switch 39 ( or 40 or 41 ) in the coin counting mechanism 19 ( or 20 or 21 ) has detected the corresponding coins for a predetermined period of time , and to allow the detection signal of the switch 39 ( or 40 or 41 ) to be produced with a delay time of the order of three seconds , for instance . the counting detecting switch means 54 ( or 55 or 56 ) operates to produce a &# 34 ; h &# 34 ; signal when the switch 44 ( or 45 or 46 ) in the coin counting mechanism 19 ( or 20 or 21 ) has detected the corresponding coins for a predetermined period of time , and to allow the detection signal of the switch 44 ( or 45 or 46 ) to be produced with a delay time of the order of three seconds . the intermediate detecting switch means 52 and 53 operate to produce &# 34 ; h &# 34 ; signals when the coin detecting switches 35 and 36 in the coin sorting path 5 output coin detection signals for predetermined periods of time , and to allow the signals from the respective switches 35 and 36 to be produced with a delay time of the order of three seconds . the detecting switch means 51 and 54 deal with the first coins , or 1 - yen coins ; the detecting switch means 52 , 55 , and 57 deal with the second coins , or 50 - yen coins ; and the detecting switch means 53 , 56 , and 58 deal with the third coins , or 5 - yen coins . reference numeral 59 ( fig2 b ) designates a first coin jam display section which operates to indicate a jam of the first coins in the first coin sorting section 9 or on the rotary disk 24 of the first coin counting mechanism 19 . more specifically , this display section 59 provides an indication when the coin detecting switch 33 has detected a coin for the predetermined period of time while neither the coin detecting switch 35 nor 39 has detected coins for the predetermined period of time . a second coin jam display section 60 indicates a jam of the first coins in the coin counting path 25 of the first coin counting mechanism 19 . more specifically , the display section 60 provides an indication when either the switch 39 or the switch 44 in the first coin counting mechanism 19 but not both has detected a coin for the predetermined period of time . a third coin jam display section 62 indicates a jam of second coins in the coin counting path 25 of the second coin counting mechanism 20 . this display section 62 indicates when either the switch 40 or the switch 45 in the second coin counting mechanism 20 but not both has detected a coin for the predetermined period of time . similarly as in the third coin jam display section , a fourth coin jam display section 63 indicates a jam of third coins caused in the coin counting path 25 of the third coin counting mechanism 21 . this display section 63 indicates when either the switch 41 or the switch 46 in the third coin counting mechanism 21 but not both has detected a coin for the predetermined period of time . reference numeral 64 designates a fifth coin jam display section . if , when the coin , detecting switch 35 in the coin sorting path 5 has detected a coin for the predetermined period of time , both the switch 45 in the second coin counting mechanism 20 , and the switch 36 in the coin sorting path 5 have detected no coins , the fifth coin jam display section 64 , provides an indication . furthermore , the display section 64 also provides an indication in the case when the second coin detecting switch 36 in the coin sorting path 5 has detected a coin for the predetermined period of time , and both the coin detecting switch 46 of the third coin counting mechanism 21 and the third coin detecting switch 37 in the coin sorting path 5 have detected no coins . thus , the display section 64 can display the jam of coins between the coin sorting section 10 and the coin counting mechanism 20 , and the jam of coins caused between the coin sorting section 11 and the coin counting mechanism 21 . it goes without saying that , for dealing with the jamming of 100 - yen and 10 - yen coins , it is possible to provide circuits similar to the above - described circuit for dealing with the jamming of 5 - yen and 50 - yen coins . when any of the display sections 59 through 64 indicates a jam of coins , a stop control section 65 operates to stop the operation of the coin sorting machine . a terminal 66 is to clear the memory as to the jammed coins , or to erase the display of the jammed coins , if any , when the power switch of the coin sorting machine is turned on or when the operation of the apparatus is started again after the jammed coins have been removed . the operation of the circuit shown in fig2 a and 2b will be described . when the coin detecting switch 33 in the coin supplying mechanism 1 has detected coins for the predetermined period of time , the first detecting switch means 50 produces the &# 34 ; h &# 34 ; signal . if in this case the coin detecting switch 39 in the first counting mechanism 19 and the coin detecting switch 35 in the coin sorting path 5 have detected no coins , an &# 34 ; h &# 34 ; signal is produced by an and gate 68 through the detecting switch means 51 and 52 and a nor gate 67 . this &# 34 ; h &# 34 ; signal is delayed for about three seconds by a delay circuit 69 , to confirm the occurrence of a coin jam . the &# 34 ; h &# 34 ; signal thus delayed serves to set a flip - flop circuit 70 , the output of which causes the first coin jam display section 59 to indicate a jam of coins caused in the first coin sorting section 9 or on the rotary disk 24 in the first coin counting mechanism 19 , for instance , by turning on a lamp . the output of the flip - flop circuit 70 is further applied to the stop control section through an or circuit 71 so as to stop the operation of the machine , whereby the jammed coins in these sections can be detected . in this operation , on the other hand , other flip - flop circuits 76 , 77 , 78 , and 79 are locked through nor gates 72 , 73 , 74 , and 75 so as to prohibit the display operations of the other coin jam display sections 60 , 62 , 63 and 64 , respectively . after removal of the jammed coins , the machine is started again . in this case , the flip - flop circuits 70 , 76 , 77 , 78 , and 79 are reset through the respective nor gates 80 , 72 , 73 , 74 , and 75 by a start signal applied through the terminal 66 , and the display on the display section 59 is erased , for instance , by turning off the lamp while the stop control section 65 is rendered inoperative . when either of the detecting switch means 51 or 54 but not both has detected a coin for the predetermined period of time through the switches 39 and 44 in the first coin counting mechanism , the flip - flop circuit 76 is set through an exclusive or gate 81 and a delay circuit 82 , and in response to the output of the flip - flop circuit 76 the display section 60 provides an indication of a coin jam while the stop control section 65 is operated to suspend the operation of the machine . on the other hand , the output of the flip - flop circuit 76 is further applied through the nor gates 80 , 73 , 74 and 75 to the flip - flop circuits 70 , 77 , 78 and 79 to reset the latter flip - flop circuits and thereby prohibit the display operations of the display sections 59 , 62 , 63 and 64 , respectively . in order to start the machine again , the start signal is applied through the terminal 66 . as a result , the flip - flop circuit 76 is reset , the display indicating a coin jam is erased , and the stop control section 65 is released . the indication of a jam of 50 - yen coins and of a jam of 5 - yen coins are carried out in a manner similar to that described above . if the detecting switch means 52 with the switch 35 of the coin sorting path 5 has detected coins for the predetermined period of time but the detecting switch means 55 with the switch 39 of the first coin counting mechanism has not detected coins , an &# 34 ; h &# 34 ; signal is produced from an and gate 84 through an exclusive or gate 83 . in this case , if the second coin sorting path 5 is not detecting coins , then the detecting switch means 53 produces an &# 34 ; l &# 34 ; signal , which is applied to an and gate 85 through an inverter 101 , and therefore the and gate 85 provides an &# 34 ; h &# 34 ; signal . if in this case the signal from the switch 35 is detected for a predetermined period of time ( approximately three second , for instance ) by a delay circuit 86 , the &# 34 ; h &# 34 ; signal is applied through an and gate 87 , an or gate 88 , and a delay circuit 89 to the flip - flop circuit 79 to set the latter . as a result , the display section 79 indicates the occurrence of a coin jam on the coin sorting path 5 . on the other hand , the stop control section 65 is operated through an or gate 71 to suspend the operation of coin sorting machine . after removal of the jammed coins , the start signal is applied through the terminal 66 to reset the flip - flop circuit 79 . as a result , the display of the display section 79 is erased , and the coin sorting operation is started again . in addition , in the circuit shown in fig2 a , reference numeral 100 is an inverter to which the detection signal from the third detecting switch 37 in the coin sorting path 5 may be applied . detection signals representative of the jamming of other coins ( such as 100 - yen or 10 - yen coins not shown ) may be applied to the or gate 88 . furthermore , in fig2 reference numerals 91 , 92 , and 93 designate exclusive or gates ; reference numerals 94 , 95 , and 96 , and gates ; and reference numerals 97 , 98 , and 99 , delay circuits . as is apparent from the above description , according to the invention location of where in the coin sorting machine a coin jam occurs can be quickly and readily achieved , which leads to an improvement in performance of the coin sorting machine . | 6 |
referring more specifically to the drawings , the present invention is embodied in the system and method generally shown in fig1 and fig2 . it will be appreciated that the system may vary as to configuration and as to details of the components , and that the method may vary as to the specific steps and sequence , without departing from the basic concepts as disclosed herein . referring first to fig1 , an exemplary embodiment of a system according to the present invention is illustrated . in the embodiment shown , one or more cameras 10 are installed in a facility 12 of a non - profit or charitable organization ( also referred to herein as the “ facility provider ” ). the purpose of the cameras and microphones is to provide a video and audio feed ( also referred to herein as a “ media feed ” ) to a remote user ( also referred to herein as a “ virtual guest ”) who cannot attend an event . the service provider charges a fee to the person or organization holding the event ( also referred to herein as the “ event host ” ) for use of the system to provide the media feed to the remotely located virtual guest . typically , the cameras would be placed at key vantage points that would provide various views of the area . for example , the cameras could be placed at high elevations at corners of the facility to look down on an area . another approach would be to place a camera in the back of the facility looking forward , another camera in the front of the facility looking backward , and another camera focused on a podium , altar , or other key location . it will be appreciated that the vantage points are a matter of choice to provide the desired coverage area , and that specific vantage points are not critical to practice of the present invention . many commercially available cameras also include microphones , in which case the audio would be picked up at the same locations . alternatively , the microphones would be placed in appropriate locations for picking up sound associated with the video . the cameras 10 are in turn connected to a router / modem 14 or the like that receives video feeds from the cameras and interfaces those video feeds with the internet 16 through a broadband link 18 . the audio feeds are received and transmitted in the same manner . the broadband link would typically be a lower cost dsl or cable broadband link , but higher cost , high speed links such as t 1 or t 3 links could be used as well . in one mode of operation , the router / modem would have an ip address that could be accessed over the internet via one or more client devices 20 . the client devices 18 could be computer workstations , personal digital assistants , cellular telephones , or any other device with internet access . it will be appreciated , however , that the bandwidth of the broadband link could be insufficient if a large number of client devices access the cameras at the same time . to address this situation , an alternative embodiment of the invention employs a server 22 between the video feed and the client devices . in this way , the server 20 can receive the video feed from the cameras using the bandwidth provided by a typical dsl or cable link . the server 22 would then be connected to a high bandwidth connection 24 , such as a t 1 or t 3 connection to provide access by a large number of client devices . the audio feeds are then received and transmitted via server 22 in the same manner . it will be appreciated , therefore , that server 22 would be located offsite from the facility 12 such as in a data center , and could be controlled either locally or remotely . in a further embodiment , a recording device 26 is provided for recording the video and audio feeds . recording device 26 can be any conventional video recording device such as a vcr , dvd - r , and the like . the video feeds from the cameras 10 would be routed to the recording device 26 using conventional hardware which is well known to those skilled in the art . the audio feeds would be routed to the recording device 26 in the same manner . in one embodiment of the invention , the cameras 10 are fixed position cameras . accordingly , the video feed or recording would represent raw footage . in a further embodiment , the cameras 10 are equipped with motorized position controls so that they can be moved to obtain different views . additionally , the cameras could have remote zoom capabilities . the technology for remotely controlling position and zoom of video cameras is known to those skilled in the art and will not be described in detail herein . furthermore , those skilled in the art will appreciate that once these capabilities are provided , camera position and zoom can be controlled remotely by a client device . in this way , the views can be altered during the event to provide a customized broadcast or recording . in the embodiment of the invention that uses a sever 22 , which is the preferred embodiment , server 20 will provide user access to a website . at the website , the virtual guest will be provided with the capability of viewing the video feed from only one camera , from multiple cameras , enlarging the video feed from a particular camera , and other viewing options . for example , if there are four cameras providing video feeds , the virtual guest could choose to view all four on the display of the client device ( e . g ., side by side or in quadrants ). the virtual guest can then select to view one of the video feeds full screen , or fewer than all four . in a further embodiment of the invention , the video can be freeze - framed to provide video clips . the virtual guest can then store the video clips in memory on the client device , print the video clips as photographs , or store the video clips on the server . furthermore , the website can provide online ordering capabilities . for example , the virtual guest could choose to order a copy of a recording of the video feeds . or , the virtual guest could make a donation to the facility provider . furthermore , the website can provide a link to the facility provider &# 39 ; s website . further enhancements can be provided to the user through the website as well . for example , the website can provide a map that can be clicked on by the virtual guest to locate events in a particular part of the country or locale . alternatively , or in addition , the virtual guest could enter search information to locate an event . this will enable the virtual guest , who for some reason cannot remember exactly where the event is being held , to quickly and easily locate the event that they want to view . it will be appreciated that , for privacy reasons , the virtual guest would not be able to access every event but only that event to which the virtual guest was invited . therefore , in one embodiment , the virtual guest will be required to enter a password to gain access to the video feed for the event . in one embodiment , the password would be mailed or e - mailed to a guest list by the event host . in another embodiment , the server would automatically e - mail the password to those on a guest list provided by the event host . additional e - commerce options that can be designed into the website include selling advertising on the user interface while the event is being broadcast . for example , a funeral home , wedding dress store , or other business could purchase banner space on the website which could include a link to the website of that business . it will be appreciated by those skilled in the art that foregoing and other viewing and e - commerce options can be provided by the website using conventional web design and programming techniques . with the foregoing in mind , it will be appreciated that the invention can provide a source of revenue to the service provider . in other words , the service provider would charge for the broadcast and recording of the event . this can be done by , for example , charging the event host a fee . alternatively , the facility provider could be charged a fee by the service provider and in turn the facility provider could pass the fee through to the event host . in a further alternative , the facility provider would charge the event host a fee and pay over all or a portion of the fee to the service provider . however , in the preferred embodiment of the invention , the service provider charges the event host the fee rather than facility provider . of course , there may be times when the facility provider is holding its own event , in which case they would be charged the fee by the service provider . referring to fig2 , an embodiment of a method of collecting and disbursing fees for the service is illustrated . in the embodiment shown , the service provider charges the event host a fee of “ a ” dollars at step 100 the service provider then retains “ b ” dollars to cover installation , maintenance and operation of the system at step 102 , and donates “ a minus b ” dollars to the facility provider at step 104 . once the cost of the equipment is recovered at step 106 , the service provider has the option of donating the equipment to the facility provider at step 108 and , in addition , has the further option of donating a higher share of the revenues to the facility provider as a result of the recovery of the cost of the equipment at steps 110 through 114 . these options can be employed separately or in combination . for example , at step 110 the service provider charges the event host a fee of “ a ” dollars . the service provider than retains “ c ” dollars at step 112 , wherein “ c ” is less than “ b ”. at step 114 , the service provider then donates “ a minus c ” dollars to the facility provider . it will be appreciated that the foregoing methods provide revenue and tax benefits to the service provider and a source of charitable donations to the facility provider . it will also be appreciated that the foregoing revenue collection and disbursement method can be modified for use with private entities or organizations or for other circumstances where tax benefits may not be available . for example , the service provider may elect to retain the entire fee charged to the event host . the facility provider may then charge the service provider a fee for providing the facilities for the event . alternatively , the facility provider may charge the event host a fee and pay over a portion of the fee to the service provider . once the service provider recovers the cost of the equipment installed at the facility , the service provider can reduce its share of the fee for providing the service , or continue to receive the same share of the fee the entity with a corresponding increase in profit . in one embodiment of the invention , a website is provided through which an event host can arrange for use of the system at a facility provider where the service provider has already installed equipment for broadcasting live video and audio over the internet . through one or more web pages or screens , the event host would , for example , register the event , select a broadcast package from the service provider , and then invite guests to access or “ attend ” the event over the internet . first , for example , the event host would begin the registration process by clicking or otherwise selecting a “ getting started ” or “ registration ” or other link . in response , the event host is presented with a web page that presents several types of events from which to select ( e . g ., baptism , wedding , graduation , memorial , communion , etc .). the event host would then select the type of event and an associated web page “ template ” or “ wallpaper ” which would appear on the screen of the invited guests . a typical template or wallpaper would have graphics and text associated with a particular type of event , and , for example , would identify the date of the event , the time of the event , and the place of the event . additionally , the template or wallpaper would have segments or windows in which the video feed ( s ) would be viewed , and , if multiple camera views are available or provided , will also present links for selection of different camera views by the invited guest . after selecting a type of event and template , the event host is presented with a screen or web page to identify the event . here , the event host would input , for example , the date of the event , time of the event , start and end time of the event , the location of the event ( e . g ., city and state ), and whether the event is a public or private event . next , based on the state and city of the event , the event host is presented with a screen or web page where the event host can select from a list of participating facilities ( e . g ., a particular church ) in that city and state where the event host will be holding the event . once the facility provider is selected , the event host is presented with a screen or web page from which the event host can select and purchase a package and options for the event . for example , the event host could select a basic package comprising the live video streaming and a free template . the event host could also select , and purchase , options such as multi - camera broadcast , an enhanced website for the event , invitation management , guest books , photo albums , and event recording and hosting . next , the event host is presented with a screen or webpage where the event host can provide detailed registration information concerning the event , such as name , e - mail address , password , mailing address , phone number , fax number , number of in - person guests expected , number of invited “ virtual ” guests expected , whether the event host wants to make a donation , and other general information . once the event host has registered and paid for the event , the event host is issued an “ event code ” to distribute to the guests that will allow them to login to the event if they cannot attend in person . in addition , the event host has the option of providing e - mail addresses of the guests , in which case the service provider distributes the event code automatically . at the date and time of the event , the guests can then go to the home page of the service provider &# 39 ; s website and enter the event code to obtain access to the event as a “ virtual guest ”. those skilled in the art will appreciate that there are numerous ways in which a website can be constructed to implement all or a portion of the aspects of the present invention and the foregoing is provided by way of example only . although the description above contains many details , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . therefore , it will be appreciated that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more .” all structural , chemical , and functional equivalents to the elements of the above - described preferred embodiment that are known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for .” | 6 |
this invention will be better understood with the reference to fig1 through fig3 . the same numerals indicate the same elements in all drawing figures . viewing , simultaneously , fig1 through fig3 , numeral 10 indicates a support structure . a pair of identical support structures 10 is disposed in a mirror image arrangement , as particularly shown in fig3 . numeral 20 indicates an existing stud . an existing building structure has a plurality of existing studs 20 , which are typically spaced 16 ″ on center . each existing stud 20 comprises a bottom end indicated by numeral 20 a and a top end indicated by numeral 20 b . bottom end 20 a is affixed to an existing bottom plate indicated by numeral 30 . top end 20 b is affixed to an existing first top plate indicated by numeral 40 . existing first top plate 40 is affixed to an existing second top plate indicated by numeral 50 . existing second top plate 50 is affixed to an existing floor joist indicated by numeral 60 . existing bottom plate 30 is affixed to an existing foundation indicated by numeral 70 . numeral 80 indicates a new knee brace . new knee brace 80 comprises a first end indicated by numeral 80 a and a second end indicated by numeral 80 b . numeral 90 indicates a new stud . new stud 90 is sized identically to existing stud 20 . new stud 90 is disposed next to existing stud 20 between existing first top plate 40 and existing bottom plate 30 . new stud 90 and existing stud 20 sandwich first end 80 a substantially in the middle of existing stud 80 ( i . e ., the distance from bottom end 20 a to first end 80 a is substantially equal to the distance from first end 80 a to top end 20 b ). this is done to maximize the vertical load carrying capacity . numeral 100 indicates a first new connection means . first new connection means 100 affixes first end 80 a to existing stud 20 and to new stud 90 . first new connection means 100 is configured to withstand a first force . first new connection means 100 is designed to 2 to 2 . 5 times the horizontal load on the frame and is based on seismic demand calculations for specific locations , the angle of new knee brace 80 and capacity of the connection times 1 . 3 . numeral 110 indicates a second new connection means . second new connection means 110 affixes second end 80 b to the existing floor joist 60 . second new connection means 110 is configured to withstand a first force . first new connection means 100 and second new connection means 110 are configured in such a way that the distance between top end 20 b and first end 80 a is substantially two times the distance between top end 20 b and second end 80 b . numeral 120 indicates a new spacer . new spacer 120 is sandwiched between existing stud 20 and new stud 90 . numeral 130 indicates a new stud to joist connection means . new stud to joist connection means 130 affixes existing stud 20 to existing floor joist 60 . new stud to joist connection means 130 is configured to permit rotation of existing floor joist 60 with respect to existing first top plate 40 , existing second top plate 50 and existing stud 20 . at the same time , new stud to joist connection means 130 is configured to prevent vertical separation of existing joist 60 from existing first top plate 40 , existing second top plate 50 and existing stud 20 ( i . e . it resists vertical uplift force yet the structural elements are free to rotate ). the nails connecting existing joist 60 to the top plate prevent horizontal movement of the joist relative to the stud . new stud to joist connection means 130 is configured to withstand a second force . numeral 140 indicates a new stud to bottom plate connection means . new stud to bottom plate connection means 140 is configured to permit rotation of existing bottom plate 30 with respect to existing stud 20 . at the same time , new stud to bottom plate connection means 140 is configured to prevent separation of existing bottom plate 30 from existing stud 20 . new stud to bottom plate connection means 140 is configured to withstand a second force . the second force is at least 30 % higher than the first force . it has been determined through experiment that the capacity of all other components of the system is based on the second force being at least 30 % higher than the first force , it all works best to allow first new connection means 100 and second new connection means 110 to act as a fuse and fail first in the event of an earthquake , thus saving the building structure from developing less desirable non - ductile ( or brittle ) collapse mechanism . numeral 150 indicates a new block means . new block means 150 is disposed between new knee braces 80 in identical support structures 10 disposed in a mirror image arrangement . new block means 150 is bracing new knee braces 80 , placed side by side on opposite side of the adjacent existing joist 60 , against each other . in the preferred embodiment described with reference to fig1 - 3 , first new connection means 100 and second new connection means 110 comprise six nails , said six nails being 0 . 131 ″× 3 . 25 ″ nails . in the case of first new connection means 100 , three of said nails are applied from the side of new stud 90 and three of said nails are applied from the side of existing stud 20 . the nails are spaced as a minimum such as to meet industry accepted requirements for preventing wood splitting . in the case of second new connection means 110 , all six nails are applied from the side of new knee brace 80 following the same requirements . further , in the preferred embodiment described with reference to fig1 - 3 , new stud to joist connection means 130 comprises a hurricane tie , such as simpson h2 - a product . also , new knee braces 80 , new block means 150 , new stud 90 and new spacer are 120 are each shown as formed of a 2 × 4 wood members . at least one pair of identical support structures 10 must be used for earthquake retrofit . usually , several pairs of identical support structures 10 are installed , depending on the level of protection desired . obviously , a larger number of pairs of identical support structures 10 installed provides greater earthquake resistance . in an alternative embodiment , combinations of singular support structures 10 , rather than identical pairs thereof , are installed . the above description applies , with equal force , to singular support structures 10 , except new block means 150 is not provided . a minimum of two support structures 10 must be used , but they do not need to be used in pairs . while the present invention has been described and defined by reference to the preferred embodiment of the invention , such reference does not imply a limitation on the invention , and no such limitation is to be inferred . the invention is capable of considerable modification , alteration , and equivalents in form and function , as would occur to those ordinarily skilled and knowledgeable in the pertinent arts . the depicted and described preferred embodiment of the invention is exemplary only , and is not exhaustive of the scope of the invention . consequently , the invention is intended to be limited only by the spirit and scope of the appended claims , giving full cognizance to equivalents in all respects . | 4 |
as shown in the figs ., a display device 10 in accordance with the present invention includes a base tray 12 and a display member 14 . the base tray component 12 has a bottom wall 16 , a front wall 18 , a rear wall 20 and two parallel side walls 22 , 24 . together , the bottom , front , rear and side walls are joined at their intersections by appropriate means ( e . g ., adhesively , by mechanical fasteners such as screws or the like , or by welding ) to define an upwardly open material receiving area . the area , and therefore the base tray 12 generally , preferably is sized to hold a stack of standard sheet material , such as 81 / 2 &# 34 ;× 11 &# 34 ; sheets or 81 / 2 &# 34 ;× 14 &# 34 ; sheets , such sheet material being indicated at 26 in fig1 and 3 . the front wall 18 of the base tray 12 includes a generally central relieved region 28 to facilitate the removal of the sheet material 26 therefrom . the relieved region 28 includes radiused or rounded corners , both indicated at 30 . although the side walls 22 , 24 are shown as substantially level and continuous along their upper edge , they may be provided with relieved region similar to relieved region 28 . a plurality of tacky , slip - preventing pads 29 are provided on the underside of the bottom wall 16 . the display member 14 comprises a substantially continuous rear wall 34 , a front wall 36 , side walls 38 , 40 and a bottom wall 42 . together the walls of the display member 14 are joined to define a hollow material receiving cavity indicated generally at 44 . the cavity 44 is free of obstruction and has an open upper edge or top . the display member 14 may be provided in alternative embodiments . for example , in the embodiment of the display member 14 depicted in fig1 the display member 14 includes a generally central divider wall 46 generally parallel to the side walls 38 , 40 and extending from the bottom wall 42 to the open top of the display member 14 . the divider wall 46 splits or divides the member 14 to provide two material receiving cavities , both indicated at 44 &# 39 ;. in the embodiment depicted in fig2 ( common elements of the display member ( s ) 14 being commonly numbered ), the cavity 44 is not divided whereby it accommodates 81 / 2 &# 34 ;× 11 &# 34 ; sheets . in either embodiment , adjacent to the upper , front edge of the front wall 36 , the member 14 is provided with a relieved region 50 to facilitate removal of material , such as the brochures 51 ( shown in fig1 ). in the embodiment depicted in fig1 wherein the display member 14 includes multiple material receiving cavities 44 &# 39 ;, a relieved region 52 is provided for each cavity . although not shown with rounded corners , the corners may be rounded similarly to the corner of the region 28 . with continued reference to the figs ., an external material receiving receptacle 54 is attached to the display member 14 . the external receptacle 54 is specially adapted for business cards and is defined by a bottom wall 56 , a front wall 58 and two generally parallel side walls 60 , 62 . as in the base tray 12 and the display member 14 , the front wall 58 is provided with a relieved region 64 . like the display member 14 , the external receptacle 54 may be available in multiple embodiments . referring to fig1 the external receptacle 54 is split by a generally central divider 66 parallel to the side walls 60 , 62 . in fig2 a single external receptacle 54 is associated with the display member 14 and the bottom wall 56 thereof is slightly set off above the bottom wall 42 of the display member 14 . referring to fig3 the range of motion of the display member 14 relative to the base tray member 12 is depicted . broadly , the display member 14 has two operational positions , fully opened display position and a closed position ( the closed position depicted in phantom ). the hinged or pivotal folding movement of the display member 14 between the two positions is enabled by the trunion connectors , both indicated at 70 , at each side of the display device 10 . fig4 depicts one of the substantially identical trunion connectors 70 . specifically , the connectors 70 include a threaded screw - like pin 72 , a generally cylindrical trunion guide bushing 74 with a shoulder 75 and a spacer washer 76 . the trunion bushing 74 is received and secured ( glued or friction fit ) in an aperture in the side walls 36 , 38 of the display member 14 adjacent to the bottom wall 42 thereof . the pin 72 is received in tapped apertures provided near the upper edge of the side walls 22 , 24 of the base tray 12 adjacent to the rear wall 20 . when the display member 14 and tray 12 are connected ( fig1 and 2 ), the pins 72 are coaxial and provide a hinge or pivot about which the display member 14 moves through an arc . it should be appreciated from fig4 that the trunion bushing 74 and pin 72 do not extend into the cavity 44 of the display member 14 , thereby preventing interference with the contents of the cavity 44 . one of the advantages of the present invention is depicted in fig3 . in the fully open position , the display member 14 rests against the rear wall 20 of the base tray 12 at an angle of approximately 30 degrees past vertical relative to the bottom wall 16 of the base tray 12 , i . e ., the angle between the bottom wall 16 and the front wall 36 of the display member is about 120 °. this angle , which may be varied between about 110 ° to 140 ° degrees , provides for the attractive , easily perceived viewing or display of material contained in the internal cavity 44 of the display member 14 . with continued reference to fig3 in the closed position ( depicted in phantom ) the display member 14 is nested substantially within the tray 12 and rests against any display material 26 contained in the base tray 12 . depending on the amount of material 26 in the tray 12 , the front wall 36 or only the upper front edge thereof will contact the material 26 . this contact helps to hold the material 26 in place during transportation or movement of the display device 10 . although not depicted , it should be appreciated that the display device 10 of the present invention may be carried by hand or in a briefcase or the like generally vertically in its closed position . by generally vertically , it is meant that the rear wall 20 of the base tray 12 and the bottom walls 56 , 42 of the external receptacle 54 and display member 14 , respectively , are generally parallel and in the lowermost position , i . e ., the device 10 is rotated 90 degrees from its closed position shown in fig3 . moving the display device 10 in this position , i . e ., with the front wall 18 and the openings of the external receptacle 54 and internal cavities 44 , 44 &# 39 ; uppermost , will provide that material 26 contained by the display device 10 will remain in place . another advantage of the present invention is associated with the trunion pivot joints 70 . the joints 70 semi - permanently and movably connect to the base tray 12 , but it should be appreciated that the complimentary threaded and tapped nature of the joint pins 72 and apertures in the side walls 22 , 24 of the base tray 12 make it convenient and easy to remove one display member 14 ( e . g ., the embodiment depicted in fig2 ), and replace it with another display member embodiment ( e . g ., the display member embodiment depicted in fig1 ). in use , a sales person or real estate agent may carry the display device 10 of the present invention in closed position to a point of sale or display . the device 10 may be filled with information carrying material 26 such as sheet material , tri - fold brochures or business cards prior to leaving for the site or , upon arrival , after the display member 14 is moved to its open display position as shown in fig3 if it is necessary to move the display device 10 to another location , either at the same site or to an other site , the display member 14 may be pivoted downwardly toward its closed position along the arc &# 34 ; a &# 34 ; shown in fig3 without removing the displayed material 26 therefrom . it should be appreciated that when closed the display member 14 and the base tray 12 are nested and that the display device 10 occupies a minimum of space and may be moved easily . when closed , placed in a generally vertical position ( i . e ., as if it were standing on the rear wall 20 ) and inserted in a briefcase or carried by hand to another location the material 26 and the device 10 will tend to remain organized and in place . the display device 10 of the present invention , as depicted all of the figs ., is preferably entirely formed of a clear , durable and scratch - resistant material such as lexan ® or suitable polycarbonate or other plastic material . nonetheless , portions of the device 10 may be formed from non - transparent material or may carry permanent marking or color , as long as at least the front wall 36 of the display member 14 and the front wall 58 of the external receptacle 54 are substantially clear so that dispaly material 26 or other items may be visible therethrough . a number of other variations of the present invention can be made . for example , the internal dimensions of the base tray 12 , the cavity ( s ) 44 ( or 44 &# 39 ;) of the display member 14 and the material receiving cavity of the external receptacle 54 may be provided in various sizes to accommodate many different types of material . portions of the display device 10 such as the front wall may be curved or otherwise adapted to display specific materials . various methods might be used to releasably lock the display device 10 , particularly the display member 14 , in its open and closed positions . for example , a coil spring or ball and socket detent , a push in and twist or bayonet type releasable lock might be incorporated in the trunion pivot joints 70 joining the display member 14 to the base tray 12 . alternatively , when the display member 14 is in its open position , an elastic strap or band may be connected to the rear uppermost edge of the display member 14 and extend and be attached to a portion of the base tray 12 to hold the display member 14 in its open position . various suitable hinges might be used to interconnect the base tray 12 and display member 14 , for example , a continuous &# 34 ; living &# 34 ; hinge or a piano - type hinge may be positioned along the upper edge of the rear wall 20 and an edge of the bottom wall 42 of the display member 14 . other equivalent hinge structures might be used as well , as long as the display member 14 is free to move into its open and closed positions . hinged , releasably lockable covers ( e . g ., by snap locks ) may be may be provided at the open ends of the cavities 44 , 44 &# 39 ; and the external receptacle 54 . the display device 10 may be marked with appropriate instructions and portions of it may be provided with permanent or semi - permanent displays of information . a carrying handle may be provided on the front wall 18 of the base tray 12 to facilitate transportation of the display device 10 . it should be understood that as an alternative to purchasing or obtaining the display device 10 in one of its embodiments ( either fig1 or 2 ), the purchaser may obtain the device 10 as an assembled unit and later obtain another embodiment of the display member 14 . additionally , although only two embodiments of the display member 14 are shown , it should be appreciated that other embodiments may be provided as well . although the description of the preferred embodiment has been presented , it is contemplated that various changes , including those mentioned above , could be made without deviating from the spirit of the present invention . it is therefore desired that the preceding description be considered as illustrative , not restrictive , and that reference be made to the appended claims rather than to the foregoing description to indicate the scope of the invention . | 6 |
the design version of the system according to this invention as shown in fig1 includes a freely movable , manually operated ultrasound scanning head 2 , an ultrasound recording i . e . acquisition device 9 , an image processing unit 8 and a positional locating device 10 , serving to acquire three - dimensional ultrasound images of the body 1 . the locating device 10 permits positional and orientational determination of the ultrasound scanning head 2 and thus the determination of the spatial position and orientation of the tomographic ultrasound images . mounted on the ultrasound head 2 are transmitters 4 which emit electromagnetic waves . spatially fixed cameras 6 , for example digital cameras , are provided and serve to capture the said electromagnetic waves emitted by the transmitters 4 . the transmitters 4 are imaged on the ultrasound scanning head 2 . the evaluation unit 7 then computes from these images the position and orientation of the ultrasound scanning head 2 . with the aid of a handle 5 , the operator can freely move the ultrasound scanning head 2 and is thus able to assemble a complete three - dimensional tomographic image of the body 1 as derived from the three - dimensional data record defined in the image processing unit . fig2 shows a design version of the system according to this invention , which includes a freely movable , manually guided ultrasound scanning head 2 , an ultrasound acquisition device 9 , an image processing unit 8 , a positional locating device 10 and a control - point reference field 12 consisting of light - emitting diodes ( leds ), serving to acquire three - dimensional ultrasonographic images of the body 1 . the locating device 10 permits positional and orientational determination of the ultrasound scanning head 2 and thus the determination of the spatial position and orientation of the tomographic ultrasound images . attached to the ultrasound scanning head 2 are transmitters 4 which emit electromagnetic waves . cameras 6 , for example digital cameras , serve to capture the said electromagnetic waves emitted by the transmitters 4 . in this implementation of the invention , the cameras 6 are not spatially fixed , their position 11 being determined by the acquisition and evaluation of the images produced by a spatially fixed control - point reference field 12 . as the two cameras 6 capture the electromagnetic waves emitted by the transmitters 4 , these transmitters 4 are imaged on individual image planes . the evaluation unit 7 then computes from the distorted perspectives of the two images the position and orientation of the ultrasound scanning head 2 . with the aid of a handle 5 , the operator can freely move the ultrasound scanning head 2 and is thus able to assemble a complete three - dimensional tomographic image of the body 1 as derived from the three - dimensional data record defined in the image processing unit . fig3 shows a design version of the system according to this invention , which includes a freely movable , manually guided ultrasound scanning head b , an ultrasound acquisition device 9 , an image processing unit 8 and a positional locating device 10 for the acquisition of ultrasound images a . the positional locating device 10 permits positional and orientational determination of the ultrasound scanning head b and thus the determination of the spatial position and orientation of the tomographic ultrasound images a . connected to the ultrasound scanning head b are fixed transmitters f ; g ; h which emit electromagnetic waves . spatially fixed cameras 6 , for instance digital cameras , are provided for recording the electromagnetic waves emitted by the transmitters f ; g ; h . the cameras 6 capture these electromagnetic waves emitted by the transmitters f ; g ; h and from the images thus acquired the evaluation unit 7 then calculates the position and orientation of the ultrasound scanning head b . with the aid of a handle 5 , the operator can freely move the ultrasound scanning head b and is thus able to assemble a complete three - dimensional tomographic image of the body as derived from the three - dimensional data record defined in the image processing unit . fig4 is intended to explain the photogrammetric method employed using the specific example titled “ reconstruction ( of the coordinates ) from two perspective views with known positions of the image planes relative to each other and with known internal orientation ”, as per jordan / eggert / kneissl , manual of geodetic surveying , 1972 , page 2271 : 146 . 2 reconstruction from two perspective views with known positions of the image planes relative to each other and with known internal orientation : given the respective internal orientation , one knows the visual rays [ o 1 ], [ o 2 ] and their position relative to the image planes . knowing the mutual position of the image planes thus means knowing the mutual position of the visual ray bundles . the known spatial position of π 1 , π 2 , o 1 , o 2 yields the core axis o , the straight line s =( π 1 π 2 ), the epipoles k 1 , k 2 and the perspective allocation of the epipolar ray bundles relative to s . for any image pair p 1 , p 2 tied to corresponding epipolar rays , this will ensure that the visual rays s 1 =[ o 1 p 1 ] and s 2 =[ o 2 p 2 ] will intersect at a spatial point p . one thus knows the position of p in the system of visual ray bundles . to determine the position of p in a given spatial reference system s one must know the position of 1 , 2 within s . if the latter is not readily available , it must be determined per par . 145 . 3 . as an example of an empirical , nonautomatic reconstruction , the following will address the so - called plane - table photogrammetry . a ) in plane - table photogrammetry ( fig4 ) & lt ;( a ), in its simplest representation , with ccd chips to be assigned to the image planes 1 , 2 & gt ; γ is assumed to be a horizontal plane ( planimetric plane ). the image planes π 1 , π 2 are assumed to be vertical , i . e . the main visual rays [ o 1 , h 1 ], [ o 2 , h 2 ] to be horizontal . h 1 , h 2 constitute the image horizontal in π 1 , π 2 . x 1 , z 1 and x 2 , z 2 , respectively , are the image coordinates in 1 and 2 , respectively . the point of origin of each image coordinate system is the main point , the x - axis points extend in the horizontal direction . 1 , 2 are assumed to represent the height of the central points o 1 , o 2 above γ . it is also possible from the coordinates x 1 , x 2 of any given image points p 1 , p 2 to enter into the known planimetric planes π ′ 1 , π ′ 2 the planimetric planes p 1 ′ , p 2 , , identifying the planimetric plane p ′ of the spatial point p to be reconstructed as a cross section of the planimetric visual - ray planes s ′ 1 =[ o ′ 1 p ′ 1 ] and s ′ 1 =[ o ′ 2 p ′ 2 ] ( forward section . while the base line o ′ 1 o ′ 2 is applied at the map scale , the image widths and x - coordinates will be multiplied by a suitable factor in a manner which will allow s ′ 1 , s ′ 2 to be traced with sufficient accuracy . from the similar triangles o 2 pq and o 2 p 2 q 2 one can derive the height ζ 2 of p above the plane [ o 2 h 2 ] via ζ 2 = z 2 o 2 ′ p ′ o 2 ′ p 2 ′ this yields the height ζ of p above γ by way of ζ = 2 + ζ 2 . by means of an analogous calculation of ζ = 1 + ζ 1 one can compensate for any errors . as is shown in fig4 the planimetric planes k ′ 1 , k ′ 2 of the epipoles k 1 , k 2 are determined as intersections i . e . crossover points of the baseline o ′=[ o ′ 1 o ′ 2 ] with π ′ 1 , π ′ 2 , their respective height above γ , meaning their position in π 1 , π 2 , is found by inverting the trapezoid o ′ 1 o ′ 2 o 2 o 1 , dragging along the vertical carrier line for k 1 and k 2 . the epipolar rays are needed for identifying appropriate epipoles in the images of object characteristics . if the image planes π 1 *, π 2 * were to be in some general spatial position , one could easily revert to the case , just discussed , of vertical image planes π 1 , π 2 . one would only have to reproject π 1 * from o 1 to π 1 and π 2 * from o 2 to π 2 . without such reprojection , the total of the points p ′ per fig4 would make up the normal plane of the imaged object on a plane perpendicular to π 1 * and π 2 * and ζ would be the distance between point p and this plane . | 0 |
the present invention provides an image processing apparatus and method for effectively suppressing noise of image . the preferred embodiments are disclosed as below . please refer to fig1 , which shows a flow chart of the image processing method of an embodiment of the invention . the image processing method can be applied for reducing noises of a captured or recorded image in a color filter array ( cfa ) domain . particularly , the cfa is arranged in a bayer pattern . as shown in fig1 , the method includes the following steps : step s 53 , split the captured or recorded image to a green color plane , a red color plane , and a blue color plane . step s 55 , for the green color plane , the red color plane , and the blue color plane , sequentially mask a working window on each of the color planes such that each of the pixels of each color plane is sequentially located at the center of the working window and referred to as a central pixel ( c c ). step s 57 , classify the pixels other than the central pixel in the working window into n edge pixels ( c edge , i ) and m non - edge pixels ( c non , j ). both n and m are integers larger than 1 , i is an integer index ranging from 1 to n , and j is an integer index ranging from 1 to m . step s 59 , calculate a filtered central pixel ( c fc ) according to the following equation , and replace the central pixel ( c c ) with the filtered central pixel ( c fc ): c fc = c c + ∑ i = 1 n c edge , i · wei 2 ( c c - c edge , i ) + ∑ j = 1 m c non , j · wei 1 ( c c - c non , j ) 1 + ∑ i = 1 n wei 2 ( c c - c edge , i ) + ∑ j = 1 m wei 1 ( c c - c non , j ) [ equation 1 ] wherein wei1 is a first distribution function , and wei2 is a second distribution function . please refer to fig2 , which illustrates the color plane masked by the working window 20 of an embodiment of the invention . as shown in fig2 , the above - mentioned captured or recorded image is split into a green color plane ( fig2 a ), a red color plane ( fig2 b ), and a blue color plane ( fig2 c ), and each of the three color planes is masked by the working window 20 . furthermore , the area masked by the working window 20 on the green color plane contains total thirteen pixels from g 1 to g 12 and the central pixel g c . moreover , among the thirteen pixels , pixels g 2 , g 6 , g 7 , and g 11 are classified as edge pixels , whereas pixel g 1 , g 3 , g 4 , g 5 , g 8 , g 9 , g 10 , and g 12 are classified as non - edge pixels . therefore , according to the method of the invention , the central pixel g c is calculated by the above - mentioned [ equation 1 ] as a filtered central g fc : g fc ={ g c +[ g 1 · wei 1 (| g c − g 1 |)]+[ g 2 · wei 2 (| g c − g 2 |)]+[ g 3 · wei 1 (| g c − g 3 |)]+[ g 4 · wei 1 (| g c − g 4 |)]+[ g 5 · wei 1 (| g c − g 5 |)]+[ g 6 · wei 2 (| g c g 6 |)]+[ g 7 · wei 2 (| g c − g 7 |)]+[ g 8 · wei 1 (| g c − g 8 |)]+[ g 9 · wei 1 (| g c − g 9 |)]+[ g 10 · wei 1 (| g c − g 10 |)]+[ g 11 · wei 2 (| g c − g 11 |)]+[ g 12 · wei 1 (| g c − g 12 |)]}/{ 1 + wei 1 (| g c − g 1 |)+ wei 2 (| g c − g 2 |)+ wei 1 (| g c − g 3 |)+ wei 1 (| g c − g 4 |)+ wei 1 (| g c − g 5 |)+ wei 2 (| g c − g 6 |)+ wei 2 (| g c − g 7 |)+ wei 1 (| g c − g 8 |)+ wei 1 (| g c − g 9 |)+ wei 1 (| g c − g 10 |)+ wei 2 (| g c − g 11 |)+ wei 1 (| g c − g 12 |)} furthermore , other pixels on the green color plane are sequentially calculated to obtain the filtered pixel value thereof by the calculating method described above . in addition , the area masked by the working window 20 on the red color plane of fig2 b contains total nine pixels from r 1 to r 8 and the central pixel r c . moreover , among the nine pixels , pixels r 2 , r 4 , r 5 , and r 7 are classified as edge pixels , whereas pixels r 1 , r 3 , r 6 , and r 8 are classified as non - edge pixels . therefore , according to the method of the invention , the central pixel r c is calculated by the above - mentioned [ equation 1 ] as a filtered central r fc : r fc ={ r c +[ r 1 · wei 1 (| r c − r 1 |)]+[ r 2 · wei 2 (| r c − r 2 |)]+[ r 3 − wei 1 (| r c − r 3 |)]+[ r 4 · wei 2 (| r c − r 4 |)]+[ r 5 · wei 2 (| r c − r 5 |)]+[ r 6 · wei 1 (| r c − r 6 |)]+[ r 7 − wei 2 (| r c − r 7 |)]+[ r 8 · wei 1 (| r c − r 8 |)]}/{ 1 + wei 1 (| r c − r 1 |)+ wei 2 (| r c − r 2 |)+ wei 1 (| r c − r 3 |)+ wei 2 (| r c − r 4 |)+ wei 2 (| r c − r 5 |)+ wei 1 (| r c − r 6 |)+ wei 2 (| r c − r 7 |)+ wei 1 (| r c − r 8 |)} similarly , other pixels on the red color plane are sequentially calculated to obtain the filtered pixel value thereof by the calculating method described above . furthermore , the area masked by the working window 20 on the blue color plane of fig2 c contains total nine pixels from b 1 to b 8 and the central pixel b c . among the nine pixels , pixels r 2 , r 4 , r 5 , and r 7 are classified as edge pixels , whereas pixels r 1 , r 3 , r 6 , and r 8 are classified as non - edge pixels . therefore , according to the method of the invention , the central pixel b c is calculated by the above - mentioned [ equation 1 ] as a filtered central b fc : b fc ={ b c +[ b 1 · wei 1 (| b c · b 1 |)]+[ b 2 · wei 2 (| b c − b 2 |)]+[ b 3 · wei 1 (| b c − b 3 |)]+[ b 4 · wei 2 (| b c − b 4 |)]+[ b 5 · wei 2 (| b c − b 5 |)]+[ b 6 · wei 1 (| b c − b 6 |)]+[ b 7 · wei 2 (| b c − b 7 |)]+[ b 8 · wei 1 (| b c − b 8 |)]}/{ 1 + wei 1 (| b c − b 1 |)+ wei 2 (| b c − b 2 |)+ wei 1 (| b c − b 3 |)+ wei 2 (| b c − b 4 |)+ wei 2 (| b c − b 5 |)+ wei 1 (| b c − b 6 |)+ wei 2 (| b c − b 7 |)+ wei 1 (| b c − b 8 |)} similarly , other pixels on the blue color plane are sequentially calculated to obtain the filtered pixel value thereof by the calculating method described above . in an embodiment , both the first distribution function and the second distribution function are rayleigh distribution functions . please refer to fig3 , which shows the rayleigh distribution functions of the invention . in fig3 , the cross axle represents the modulus of the deviation of the central pixel and other pixels ; and the vertical axle represents the value of the rayleigh distribution function with the modulus . in the embodiment , when the other pixels belong to non - edge pixels , the rayleigh distribution function ( the first distribution function ) as shown in fig3 a is applied , and when the other pixels belong to edge pixels , the rayleigh distribution function ( the second distribution function ) as shown in fig3 b is applied . furthermore , in practice , the first distribution function and the second distribution function can be implemented as a first step function and a second step function respectively by simplifying the rayleigh distribution function . please refer to fig4 a and fig4 b . fig4 a shows the first step function simplified from the first rayleigh distribution function of fig3 a ; and fig4 b shows the second step function simplified from the second rayleigh distribution function of fig3 b . in practice , the first step function is suitable for calculating on the non - edge pixels ; and the second step function is suitable for calculating the edge pixels . please note that the image processing method can optionally contain plural sets of the first distribution function and the second distribution function , for instance , sets of the first distribution function and the second distribution function for different iso values , so as to increase the noise suppression efficiency . by the above - mentioned methods , the present invention re - calculates the pixel value of each pixel of each color plane , based on the distinguish of the edge pixels and the non - edge pixels , and on the first distribution function and the second distribution , and replaces the original pixel value by the re - calculated pixel value , so as to suppress the noises of a captured or recorded image remained in the cfa domain . please refer further to fig5 , which shows a functional block of the image processing apparatus 1 of an embodiment of the invention . the image processing apparatus 1 is used for suppressing the noises of a captured or recorded image remained in the cfa domain . particularly , the cfa is arranged in a bayer pattern as shown in fig5 , the image processing apparatus 1 includes an image capturing / recording unit 12 , a splitting unit 14 , a storage unit 16 , and an image processing unit 18 . the image capturing / recording unit 12 , such as ccd or cmos sensing device , is used for capturing / recording the image . the splitting unit 14 is coupled to the image capturing / recording unit 12 , for splitting the image into a green color plane , a red color plane , and a blue color plane . in addition , the storage unit 16 is coupled to the splitting unit 14 , for separately receiving a green color plane , a red color plane and a blue color plane of the image . furthermore , the image processing unit 18 is coupled to the storage unit 16 , for sequentially masking a working window on the green color plane , the red color plane , and the blue color plane , such that each pixel on each of the said color planes is sequentially located at the center of the working window and referred to as a central pixel ( c c ). the image processing unit 18 also classifies the pixels other than the central pixel in the working window into n edge pixels ( c edge , i ) and m non - edge pixels ( c non , j ). both n and m both are integers larger than 1 , i is an integer index ranging from 1 to n , and j is an integer index ranging from 1 to m . furthermore , the image processing unit 18 also calculates a filtered central pixel ( c fc ) according to the above - mentioned [ equation 1 ], and replaces the central pixel ( c c ) with the filtered central pixel ( c fc ). the image processing apparatus 1 can suppress the noises of the image remained in the cfa domain by the above - mentioned units . please note that the equation used for the image process apparatus 1 to calculate the filtered central pixel ( c fc ) is the same as the above - mentioned [ equation 1 ], and both the first distribution function and the second distribution function can also be rayleigh distribution functions or step functions , thus , discussion of unnecessary details will be omitted . in summary , the image processing apparatus and method of the invention can calculate the pixels ( edge pixels and non - edge pixels ) with different characteristics remained in the cfa domain by corresponding distribution functions , to reach the noise suppression effect . furthermore , the image processing apparatus and method of the invention can increase the whole image processing efficiency and reduce the hardware cost . particularly , the image processing apparatus and method of the invention can effectively suppress the noises in an image to increase the quality of the image , and can apply different distribution function according to different processing conditions to calculate the pixel value to reach the optimal effect . with the example and explanations above , the features and spirits of the invention will be hopefully well described . those skilled in the art will readily observe that numerous modifications and alterations of the device may be made while retaining the teaching of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims . | 6 |
referring to fig3 - 5 , the present invention mainly has a cellular phone / fixed network telephone switching device 5 which operates in combination with an on / off device 6 . the cellular phone / fixed network telephone switching device mainly includes a cellular phone mount 50 , an acoustic frequency signal amplifying unit 51 , a fixed network telephone signal transformation unit 52 , a fixed network telephone / cellular phone switching unit 53 , an incoming call detecting unit 54 , a charger unit 55 , a central control unit 56 , an on state signal generating unit for on / off device 57 , an on state / off - hook state detecting unit 58 and an on / off state control unit 59 . the cellular phone mount 50 is used to house a cellular phone t which is coupled by wire to the switching device 5 and is connected to an antenna 501 . the acoustic frequency signal amplifying unit 51 is used to properly amplify the output or input acoustic frequency signals of a cellular phone . if the level of the acoustic input and output of the cellular phone is close to that of the fixed network telephone , then the amplifying rate of the acoustic frequency signal amplifying unit 51 is equal to one . the fixed network telephone signal transformation unit 52 is used to converting input and output acoustic frequency signals of a cellular phone into acoustic frequency signals compatible with specifications of a fixed network telephone . the fixed network telephone / cellular phone switching unit 53 is responsible for selective switching connection between a fixed network communication or cellular phone communication to a fixed - network telephone 4 and is subject to the control of the incoming call detecting unit 54 . the incoming call detecting unit 54 is used to detect if an incoming call is transmitted to a cellular phone ; and if the cellular phone is being in communication so as to control the operational connection position of the fixed network telephone / cellular phone switching unit 53 . the charger unit 55 is used to supply electrical power to a battery of the cellular phone 3 when it is put in a stand - by state . the central control unit 56 operates according to the results of detection of the incoming call detecting unit 54 and the on state / off - hook state detecting unit 58 to control the actions of the on state signal generating unit for on / off device 57 , the on / off state control unit 59 and the fixed network telephone signal transformation unit 52 . the on state signal generating unit for on / off device 57 is simplified in the present invention to be a grounding short circuit switch which serves as a short circuit signal generating device . it is controlled by the central control unit 56 to output the on state actuation signal of the on / off device 6 . the on state / off - hook state detecting unit 58 is responsible for detecting the on and off state of the on / off device 6 and the off - hook state of the receiver of a telephone . the on / off state control unit 59 receives control signals transmitted from the central control unit 56 to control the switching selection of the fixed network telephone / cellular phone switching unit 53 . the on / off device 6 operates in collaboration with the cellular phone / fixed network telephone switching device 5 comprises an on / off command signal detecting unit for on / off device 61 , a vibration ring echo signal generating unit 62 , a central control and on / off control unit 63 , a vibration ring high voltage signal detecting unit 64 and a switching unit 65 . the on / off command signal detecting unit for on / off device 61 is employed to detect the on / off state of the on / off device 6 for the use of the central control and on / off control unit 63 . the vibration ring echo signal generating unit 62 is subject to the control of the central control and on / off control unit 63 to produce vibration ring echo signals . the central control and on / off control unit 63 controls the on / off switching operation of the switching unit and controls the vibration ring echo signal generating unit 62 to produce vibration ring echo signals according to the detected signals of the vibration ring high voltage signal detecting unit 64 and the on / off command signal detecting unit for on / off device 61 . the vibration ring high voltage signal detecting unit 64 is responsible for detecting the high voltage signals of the vibration ring . the switching unit 65 is controlled by the central control and on / off control unit 63 to switch between on and off states of the on / off device . by way of the assembly of the above components , when the cellular phone t is receiving an incoming call , the cellular phone / fixed network telephone switching device 5 will operate according to the following procedures , as shown in fig6 . when a cellular phone is receiving an incoming call , the incoming call detecting unit 54 will detect the incoming call and actuate the central control unit 56 to control over the on / off state control unit 59 and the fixed network telephone / cellular phone switching unit 53 to switch to the circuit of the fixed - network telephone 4 . at this moment , the connection a 1 , b 1 , c 1 and a 2 , b 2 , c 2 of the fixed - network telephone / cellular phone switching unit 53 is put in an off state . ( 1 ) when the on state / off - hook state detecting unit 58 detects that any one of the fixed network telephones 4 including the main telephone set 41 or the extension lines 42 , 43 , 44 , 45 is put in an off - hook state , the central control unit 56 controls the on / off state control unit 59 to actuate the fixed network telephone / cellular phone switching unit 53 so as to switch the connection of b 1 , c 1 and b 2 , c 2 to an on state . as the main telephone set 41 is detected in a communication state , a call interruption signal is being issued to warn the user till the flash button ( it functions identically to hang up a receiver and then pick it up again ) is pressed for receiving . as a receiving action is completed with the receiver set in an on - hook state or an incoming call detecting signal disappears and the on / off device 6 is set in an off state ( if the on / off device 6 is in an on state , an on / off command signal for the on / off device is sent and received by the on / off command signal detecting unit for on / off device 61 so as to activate the central control and on / off control unit 63 to switch the connections d 1 , e 1 , d 2 , e 2 of the switching unit 65 to an off state ), a stand - by state is resumed . ( 3 ) an extension line is being used for communication ( it means an extension line being taken up ) the on / off device 6 issues a high voltage signal to actuate the vibration ring of the main telephone set 41 to produce a ringing sound . as a receiver is detected to be picked up ( in an off - hook state ), the vibration ring stops . when a call action is completed ( the receiver being put in an on - hook state ), or an incoming call detecting signal disappears and the on / off device is in an off state ( if the on / off device 6 is in an on state , an on / off command signal for the on / off device is sent and received by the on / off command signal detecting unit for on / off device 61 so as to activate the central control and on / off control unit 63 to switch the connections d 1 , e 1 , d 2 , e 2 of the switching unit 65 to an off state ), a stand - by state is resumed . ( 1 ) when the on / off device 6 is detected in an on state ( if the on / off device 6 is in an off state , the central control unit 56 actuates the on state signal generating unit for on / off device 57 to transmit a signal which is detected by the on / off command signal detecting unit for on / off device 61 so as to activate the central control and on / off control unit 63 to switch the connections d 1 , e 1 , d 2 , e 2 of the switching unit 65 to an off state ), the on / off device 6 generates vibration ring high voltage signals to get the main telephone set 41 and the extension lines 42 , 43 , 44 , 45 . . . to ring together . ( 2 ) if an off - hook state is detected , then the vibration ring stops to operate ; at this time , the connection lines between b 1 , c 1 and b 2 , c 2 of the fixed network telephone / cellular phone switching unit 53 are set in an on state : ( a ) if the main telephone set 41 is engaging in a receiving operation and the on / off device is in an off state ( if it is in an on state , the on / off device 6 will be set in an off state by the on / off command signal generating unit of the on / off device ), the internal circuit of the cellular phone / fixed network telephone main switching unit 5 is cut off its connection to the fixed network and the other extension lines are still in connection to the fixed network . ( b ) if a phone call is received via the extension lines 42 , 43 , 44 , 45 . . . . . . , then the connection lines a 1 , b 1 , c 1 and a 2 , b 2 , c 2 of the fixed network telephone / cellular phone switching unit 53 are set in an off state and are connected to other extension lines network telephone / cellular phone switching unit 53 ; and d 1 , d 2 , e 1 , e 2 of the on / off device are put in an on state so as to make the main set and each extension line separated from the fixed network . ( 3 ) after the completion of a communication , the receiver is put in an on - hook state or the disappearance of a detection signal , and the on / off device is set in an off state ( if it is in an on state , the on / off device 6 will be set in an off state by a on / off command signal generating unit ), a stand - by state is resumed . as to the on / off device 6 , it operates in the following procedures , as illustrated in fig8 : 1 . when an on / off command signal is detected and if the on / off device 6 is originally set in an off state , then the on / off device 6 is switched to an on state ; and if the on / off device 6 is originally set in an on state , then it is switched to an off state . 2 . if no on / off command signal is detected and a vibration ring signal is detected ( indicating the fixed network is being used for communication ), then a communication interrupting signal is issued to warn the user of a cellular phone that an incoming call is being received . the proceeding practical embodiment shows application of the devices of the present invention combined with a general fixed network telephone . on the same theoretical ground , the devices 5 ′ of the present invention can be directly housed in a fixed network telephone p , as shown in fig9 , so as to permit people already having a fixed network telephone not to replace the old fixed network telephone . if a user is not equipped with a fixed network telephone at first , a new fixed network telephone can be purchased according with the following recommended embodiment . it is made up of a cellular phone mount 50 ′, an acoustic frequency signal amplifying unit 51 ′, a fixed network telephone signal switching unit 52 ′, a fixed network telephone / cellular phone switching unit 53 ′, an incoming call detecting unit 54 ′, a charger unit 55 ′, a central control unit 56 ′, an open circuit signal generating unit for on / off device 57 ′, an on state / off - hook detecting unit 58 ′, an on / off state control unit 59 ′. it is combined with a conventional fixed network telephone circuit to form a fixed network telephone p . all these components similar to those cited in the first embodiment are not repeatedly described . thereby it provides a fixed network telephone p that can meet all the requirements of the present invention . in summary , the present invention enables a cellular phone to receive calls via a fixed network telephone , and is particularly suitable for a fixed network telephone system having a plurality of extension lines . | 7 |
the preparation and activation of a metal assisted cold storage or macs medium for the storage of hydrogen is illustrated in fig1 . initially , a porous support 10 , which can , e . g ., be activated carbon , zeolite , aluminum oxide , or any other suitable hydrogen adsorbent ( or absorbent ) material , with a suitably high surface area factor , is treated by dispersing a suitable transition metal 11 thereon to form a resulting macs structure 12 . the metal can be a transition metal from group viii , and can be selected from the family ni , pd , pt ; co , rh , ir ; or fe , ru , os . the macs storage medium 12 is placed in a suitable refrigerable pressure vessel , and is prepared or activated by carrying out dehydration and reduction . a dehydration step 13 removes impurities , principally moisture , from the macs storage medium 12 . here evacuation with moderate heat ( 323 k .) application has been found to be effective . selection of an optimum temperature is critical in dehydration as well as in reduction . in order to preserve the activity and the intrinsic sorptive properties of a carbon / transition - metal macs medium , a temperature below 373 k . should be observed . normal dehydration temperature is 323 k . the evacuation and heating cycle is carried out for several hours , and preferably overnight . at this point , an inert - gas purge step 14 is carried out . here , after the evacuation step , helium gas is introduced and is flow cycled through the macs vessel until the weight of the macs material is determined to be constant . the temperature during the helium purge is also held at 323 k . then , the vessel is again evacuated , and the reduction phase , which can be either dry reduction or wet reduction , is carried out . reduction is an important step in activation procedures for hydrogen sorption and transfer because it restores the power of the metal particles , which have been allowed to oxidize in the open air . if a dry reduction step 15 is desired after the heat is removed following evacuation , hydrogen is introduced at room temperature at a rate of 50 cc / minute to reduce the metal particles . the system is heated after this step and maintained at 323 k . until the weight remains constant . a macs storage medium formed of metal on activated carbon heated above 373 k . can cause catalyst sintering ( massive growth of the metal particles ) with the possibility of pore blocking . thus the full potential of macs systems can be achieved by treatment at temperatures lower than 373 k . this reduction in flowing hydrogen is called dry reduction because the water produced is removed during the reduction phase . the material treated as described above is called &# 34 ; dry macs &# 34 ; 16 . if a wet reduction step 17 is followed , the reduction is carried out under quiescent conditions , i . e ., using static hydrogen at atmospheric pressure . wet reduction entrains some water as a promoter which enhances the transfer of hydrogen . water is a reduction product , and the water has a co - catalytic effect on the enhancement of hydrogen transfer from the metal to the carbon . the temperature for this phase is also maintained at 323 k . the material treated in wet reduction is called &# 34 ; wet macs &# 34 ; 18 . the reduction phases 15 or 17 in the activation of the macs storage medium are critical to maximize hydrogen storage and release . weight loss during the reduction is related to the reaction for pd / carbon macs : for example , the results of a typical reaction of a 1 % pd / carbon catalyst are presented as follows : the theoretical weight loss expected based on above reaction can be determined for a 1 % pd / carbon macs storage medium as follows : it can be seen that both theoretical and experimental weight losses are equal . thus reduction is substantially completed even at 323 k . at the same time , the carbon alone does not change in weight during the reduction phase . the enhancement in hydrogen storage capacity on dry macs , relative to storage on activated carbon , has been observed . here hydrogen is charged ( step 19 ) onto the macs material at low temperatures . an enhancement of 7 % in the hydrogen storage capacity on dry macs was observed at liquid nitrogen temperature compared to carbon alone ( see table i ). the hydrogen was 100 % recoverable . the amount of metal loading has no significant influence , although dry platinum - macs shows higher enhancement than dry palladium - macs by 5 %. at an elevated temperature ( 85 k .) there was 8 . 5 % enhancement on dry macs , as compared to carbon alone . wet macs storage medium 18 also shows considerable enhancement for hydrogen storage . with water acting as a promoter , more hydrogen is adsorbed on the wet macs than on the dry macs . the amount of hydrogen uptake on wet macs is a function of charging time . the relationship of hydrogen uptake to charging time for wet and dry 5 % pd / c macs is shown in fig2 . hydrogen continues to be adsorbed on the wet macs even after the temperature reaches an equilibrium value , whereas hydrogen adsorption on dry macs stops at that equilibrium value . for four hour charging times on wet macs , 40 % more hydrogen is adsorbed at 77 k . at 85 k ., there was 20 % enhancement after 20 minutes of charging . it was observed in experiments that the rate of hydrogen adsorption , after the temperature of the macs medium reaches its equilibrium value , remains constant regardless of metal loading , table - 3 shows that similar amounts of water per unit weight of the macs ( about 0 . 5 gm to 0 . 6 gm water / kg macs ) are entrained , although the amount of water produced during the wet reduction depends somewhat on the metal loading . the rate of hydrogen adsorption on wet macs at equilibrium is fairly constant . this indicates that there are more active sites available on the support than are used in dry macs or carbon storage systems , and thus much more hydrogen can be adsorbed . table - 4 shows that the activated carbon has a total unit surface area factor of 1167 m 2 / g which corresponds to 5 . 75 × 10 25 active storage sites for each kilogram of macs material , and that the total number of sites required to accommodate hydrogen in an adsorbed monolayer is 7 . 46 × 10 24 sites / kg of macs . the water seems to function as a &# 34 ; bridge &# 34 ; by which heat transfer as well as mass transfer is enhanced . the water effect on wet macs systems makes it more practicable if one employs cold temperatures ( between 78 k . and room temperature ) rather than cryogenic temperature ( below 78 k .) for charging of the macs with hydrogen . the kinetics of adsorption / desorption of hydrogen on the macs storage medium can be explained with reference to fig3 which is a normalized plot , depicting hydrogen uptake as a function of temperature while the charging pressure was maintained at a constant one atmosphere . fig4 is also a normalized plot showing the dependence of adsorbed hydrogen uptake on pressure at 78 k . all the tested macs storage media adsorb comparable percentages of hydrogen at a given temperature and pressure . the similarity in the shape of the isotherms indicates that all macs materials have similar kinetics and that the difference in total hydrogen uptake is principally due to the effect of the transition metal , which alters only the activation energy barrier but not the reaction kinetics . if we consider langmuir &# 39 ; s postulate , for a single gaseous component , a , surface adsorption may be represented by the following mechanism : ## str1 ## the rate of adsorption can be written as : for complete monolayer coverage , the above equation can be expressed as where [ a ] and [ s ] denote the concentration of the component and sites , respectively , [ a · s ] denotes the concentration of occupied sites , and [ m ] is the maximum concentration of available sites . adsorption and desorption rate constants k a and k d , respectively , for the single gaseous component normally follow the arrhenius functionality relations given by where r is the gas constant , t is in degrees k ., and e a , e d , a a , and a d are as given in table - 5 . during charging experiments , the adsorption of hydrogen is irreversible , thus equation ( 3 ) becomes weight gain / loss due to adsorption / desorption can be obtained by linearly programming the temperature down from room temperature to 77 k . then the adsorption rate is given by where , for the conditions described , a a is a constant with units of mole / second . the basis for determining the desorption kinetics follows a parallel methodology to that used to obtain the adsorption kinetics . examples of carbon storage and pd / c macs media are as follows : ii . 1 % pd / c = activated carbon with a dispersion of 1 % by weight of palladium metal ; iii . 5 % pd / c = activated carbon with a dispersion of 5 % by weight of palladium metal . the basis carbon was the engelhard carbon product mentioned above . these were pretreated in identical manners as dry macs and as wet macs . a comparison of these examples will be made with reference to the tables and to the charts of the drawings . fig5 and 6 are arrhenius plots of the adsorption / desorption rates for 1 % pd / carbon and carbon , respectively . what emerges from these results is the existence of two regions in the arrhenius plot of 1 % pd / carbon corresponding to an initial slower hydrogen uptake followed by a more rapid hydrogen uptake . between 77 k . and 173 k . and between 173 k . and 273 k . there are two linear regions which indicate two binding states for hydrogen on macs material . for activated carbon alone ( fig6 ) only a single linear region is seen . table - 5 summarizes the kinetic parameters e a , e d , a a , and a d over two temperature ranges for the adsorption / desorption processes . as is apparent from the chart of fig4 pressure drives the hydrogen adsorption . fig7 shows the absolute weight change due to the hydrogen uptake at 77 k . for carbon , 1 % pd / carbon and 5 % pd / carbon after identical activation and charging procedures . the role of pressure is not linear , however , and the effect of added pressure diminishes as pressure increases , although the total hydrogen uptake capacity increases with pressure . carpetis et al , mentioned earlier , discusses hydrogen adsorption on carbon at 77 k . and indicates a pressure dependence . these experimental results were obtained in the pressure range from 2 bar to 42 bar . higher pressure seems to produce higher uptakes of hydrogen adsorption in carbon in a more linear fashion . in a comparison of hydrogen storage on carbon and on macs hydrogen at a given pressure was contacted with the carbon and with a 5 % p +/ c macs , and weight gain was measured . the results as shown in table 6 clearly indicate superior h 2 takeup for macs at elevated pressures . as discussed above , dry macs shows 8 . 5 % enhancement compared to carbon alone at 85 k . ( table - 1 ). on wet macs , the hydrogen is also continuously adsorbed at a rate of 1 . 13 gm h 2 per hour per kilogram of macs medium after the final equilibrium temperature of 85 k . is reached , so significantly more hydrogen is stored . apparatus according to this invention are shown schematically in fig8 . here a hydrogen source 20 , for example a cathode of an electrolytic cell , supplies hydrogen gas through a chiller 22 to a previously activated storage cell 24 . the latter has an inner vessel 26 filled with a macs material , for example nickel - zeolite or palladium - carbon . an outer jacket 28 surrounds the inner vesel and can be filled with a refrigerant or with a liquefied inert gas or liquid nitrogen to keep the macs material in the desired cold temperature range . here , a liquid nitrogen source 30 cycles nitrogen to the chiller 22 and to the jacket 28 of the storage cell 24 . the hydrogen is supplied , either directly from the source 20 or indirectly after having been released from storage in the cell 24 , to an energy converter 32 . the latter can be e . g ., a fuel cell which combines the hydrogen with oxygen to produce electricity , or can be a turbine or internal combustion engine . while examples of suitable macs substances have been specifically discussed , and for hydrogen storage at certain temperatures , it will become apparent that many variations and modifications can be made as to the materials used and the operating conditions with which employed , without departure from the scope and spirit of the invention as defined in the appended claims . table 1______________________________________summary of storage results______________________________________activated carbon ( engelhard ) 77k ( four hour 85k ( 20 minute charge ) charge ) gm h . sub . 2 / kg . catalyst : 14 . 5 ± 0 . 95 13 . 0______________________________________ dry wet______________________________________1 % pd / carbon 77k ( 4 - hr . 85k 77k ( 4 - hr . 85k charge ) ( 20 min . charge ) ( 20 min . charge ) charge ) gm h . sub . 2 / kg . cat . : 15 . 3 ± 0 . 86 14 . 0 20 . 3 15 . 1 % enhancement : 6 % 8 % 40 % 16 % 5 % pd / carbon 77k ( 4 - hr . 85k 77k ( 4 - hr . 85k charge ) ( 20 min . charge ) ( 20 min . charge ) charge ) gm h . sub . 2 / kg . cat . : 15 . 2 ± 0 . 34 14 . 4 21 . 9 ± 0 . 87 16 . 2 % enhancement : 5 % 11 % 51 % 25 % 5 % pt / carbon 77k ( 4 - hr . 85k 77k ( 4 - hr . 85k charge ) ( 20 min . charge ) ( 20 min . charge ) charge ) gm h . sub . 2 / kg . cat . : 15 . 9 ± 1 . 25 14 . 1 19 . 1 ± 1 . 87 15 . 5 % enhancement : 10 % 8 % 32 % 19 % ______________________________________ note : results where standard deviations are reported were from more than 8 replicate experiments ; results where standard deviations are not reported were from between 1 - 3 replicate experiments . table 2______________________________________physicochemical properties of activated carbon and 5 % pd / c bet metal area % metal % h o______________________________________c 1175 m / g -- -- 7 % pd / c 1167 m / g 8 . 2 m / g 4 . 83 % 54 % ______________________________________ table 3______________________________________water entrainment water produced water entrained mg / kg sample mg / kg sample______________________________________1 % pd / carbon 1 . 02 0 . 525 % pd / carbon 2 . 49 0 . 62______________________________________ | 8 |
the valve of the present invention is especially suited for controlling the flow of a combustible gas to gas - fired appliances such as a furnace , water heater or gas - burning fireplace . the valve configuration obviates the need to rely on machined surfaces in order to establish seals between moving parts within the valve and further allows the use of plastic in the construction of certain components within the valve . [ 0020 ] fig1 is a perspective view of a valve of the present invention . the valve 12 includes a valve body 14 , an inlet port 16 and an outlet port 18 . control knob 20 is rotatable and depressible to enable manual actuation of the valve . in the particular embodiment shown , a thermocouple - powered electromagnet is insertable into a bore 22 formed at the base of the valve body . [ 0021 ] fig2 is a cross - sectional view of the valve shown in fig1 taken along lines ii - ii . a conical cavity 24 is formed in the valve body 14 and is dimensioned to receive rotatable plug element 26 therein . endcap 28 is attached to the top of the valve body to serve as an end wall for cavity 24 and to thereby enclose plug element 26 . an aperture 30 formed in the center of the endcap permits the extension of stem 32 therethrough so as to be rotatable and longitudinally shiftable . o - ring 34 achieves a positive seal between stem 32 and end cap 28 . push rod 36 is attached to stem 32 and extends through the center of the plug element through which it is longitudinally shiftable . compression spring 38 is nested in the interior of the stem and serves to bias plug element 26 into the cavity 24 . a hole ( not visible ) and conduit formed in the side of conical cavity is in fluid communication with outlet port 18 . the base of the conical cavity opens into chamber 40 , which is in fluid communication with inlet port 16 . valve 42 seals off chamber 40 from cavity 24 when urged against valve seat 44 by spring 46 . bore 22 is configured to receive an electromagnet for holding valve 42 in its open position when energized by a thermocouple . [ 0022 ] fig3 is an enlarged perspective view of plug element 26 , while fig4 is a cross - section thereof . the plug has a conical outer surface and a hollow interior that is divided into an open lower chamber 50 and open upper chamber 51 . an orifice 53 formed in the side of the plug extends into its hollow interior . an array of sealing ridges are formed on the exterior surface of the plug including a circumferential pair of sealing ridges 54 about the wide end of the plug and a circumferential pair of sealing ridge 56 about the narrow end of the plug . at least two longitudinally oriented pairs of sealing ridges 58 , 60 extend between the two pairs of circumferential sealing ridges . additional sealing ridges ( e . g . 61 ) may be formed on the surface of the plug . the sealing ridges are formed as part of an over - molded layer 62 of silicon rubber that covers most of the plug . the overmolded layer is at least 0 . 015 ″ thick while the ridges extend outwardly beyond the conical surface defined by the overmolded and exposed portions of the plug element to a height of approximately 0 . 008 ″. single as well as paired ridges may be employed to form the required seals , as may different types of rubber and rubber - like materials . [ 0023 ] fig5 is an enlargement of the circled portion shown in fig4 . the illustration shows the cross - sectional configuration of the paired sealing ridges 54 and further shows an undercut 64 formed in the plug itself . the undercuts extend across the surface of the plug directly below each of the sealing ridges to ensure that a positive bond and a mechanical interlocking with the plastic is achieved and further serve to enhance the pliability of the sealing ridges . additional undercuts may be formed at various locations about the surface of the plug to provide further anchoring points for the overmolding . [ 0024 ] fig6 is a cross - sectional view taken perpendicular to the longitudinal axis of the plug 26 . this view clearly shows the longitudinal ridge pairs 58 , 60 that are positioned on either side of orifice 53 . an additional ridge pair 61 is shown disposed therebetween . multiple undercuts 64 are visible at numerous locations about the plug &# 39 ; s surface so as to ensure a secure bond and mechanical interlocking with the overmolding 62 as well as to impart additional pliability to the sealing ridges . the overmolding is at least 0 . 015 ″ thick and substantially thicker within the undercuts 64 . the ridges 58 , 60 , 61 extend beyond the conical surface by 0 . 008 ″. [ 0025 ] fig7 is a further enlarged cross - sectional view of the section circled in fig6 . ridge pairs 60 protruding from the surface of the overmolding 62 and beyond the surface of the plug 26 are clearly visible as is undercut 64 that is positioned directly below the sealing ridges . the valve of the present invention is manufactured using wellknown metal casting , plastic molding and overmolding techniques . the valve body 14 and end cap 28 are cast of an aluminum alloy . the conical cavity 24 is cast into the valve body and is used in its as - cast condition without any machining of its interior surface . the plug element 26 is formed of a molded plastic such as a polyphthalamide ( e . g . as - 1566 hs ) which is selected for its low shrink rate , its ability to withstand high temperatures of up to 520 ° f . and the strong bond it forms with silicone rubber . the molded plug element is subsequently subjected to the overmolding process without any machining of the plug elements exterior surface . the preferred overmolding material is a silicone rubber , which is selected for its ability to bond with the plastic plug , its imperviousness to methane , and its pliability throughout a wide temperature range . various silicone rubbers may be used as well as other rubber - like materials . during assembly , a lubricant that is compatible with both the plastic and the rubber sealing ridges is preferably applied to the plug to provide lubrication and to prevent galling . in use , the valve 12 positively precludes the passage of gas from the inlet port 16 to the outlet port 18 by rotation of the plug element 26 via knob 20 to a position in which there is no overlap between the opening formed in the side of the conical cavity 24 and orifice 53 formed in the side of the plug . sealing ridges 54 , 56 , 58 , 60 completely surround the opening while the bias generated by spring 38 ensures that sealing ridges firmly come to bear on the cavity wall . the circumferential sealing ridges 54 , 56 in concert with the vertical sealing ridges 58 , 60 and any additional ridges that may extend between the circumferential sealing ridges ensure that no gas can reach the hole formed on the side of the conical cavity 24 . the use of ridge pairs rather than a single ridge configuration enhances the robustness of the valve and provides redundancy in the sealing mechanism . when knob 20 is depressed , push rod 36 transfers pressure to the supplemental valve 42 to overcome the force exerted by spring 46 and allow the supplemental valve to open . further rotation of the knob serves to rotate the plug 26 to a position wherein orifice 53 overlaps with the opening formed in the side of the cavity wall . a flowpath through the entire valve is thereby established to set the inlet valve 16 into fluid communication with the outlet valve 18 . gas will freely be admitted from inlet port 16 and chamber 40 into the interior of plug 26 , out through orifice 53 and on into outlet port 18 . once a flame has been established at the burner and a thermocouple or thermopile is able to generate sufficient power to energize an electromagnet received in bore 22 to hold valve 42 in its open position , pressure on knob 20 can be released and the valve will remain fully open until either the knob is rotated back into its closed position or when power to the electromagnet is discontinued . in the event the valve is subjected to extreme temperatures such as may be encountered during a fire , failure of all non - metallic parts including the plug element 26 can be expected . however , in view of the fact that the interior of the plug is entirely encapsulated by metallic elements , no appreciable external leakage will result . the tight tolerances between the valve body 14 and end cap 28 as well as the end cap 28 and stem 32 will ensure that only acceptable rates of leakage may occur despite the failure of gasket 29 or o - ring 34 . such gasket and o - ring serve to ensure zero - leakage during the normal service life of the valve . while a particular form of the invention has been illustrated and described , it will also be apparent to those skilled in the art that various modifications can be made without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited except by the appended claims . | 8 |
the invention includes embodiments that relate to a cure system comprising a compatiblized and passivated refectory solid and a hardener or a curing agent ( collectively “ curing agent ”). the curing agent may be liquid or fluid at a low temperature . the invention includes embodiments that relate to methods of making and / or using the cure system . in one embodiment , an adhesive system includes the cure system in combination with a curable resin . other embodiments relate to electronic devices made using the adhesive system . as used herein , cured refers to a curable composition having reactive groups in which more than half of the reactive groups have reacted or cross linked ; curing agent refers to a material that may interact with a curable resin to crosslink monomers in a resin system , such as an epoxy resin . approximating language , as used herein throughout the specification and claims , may be applied to modify any quantitative representation that could permissibly vary without resulting in a change in the basic function to which it is related . accordingly , a value modified by a term or terms , such as “ about ”, may not to be limited to the precise value specified . in at least some instances , the approximating language may correspond to the precision of an instrument for measuring the value . hydroxyl - free , hydroxyl - group free , solvent - free , no - flow , and the like include a complete absence of the indicated material or property , and further include a substantial absence of the indicated material . that is , the “ no -” and “- free ” modifiers , and the like , are not used in a strict or absolute sense and may contain insignificant , trace , residual or minimal amounts of the indicated material or property unless context or language indicates otherwise . derivatives may include conjugate acids or salts . stability , as used herein in the specification and claims , refers to the lack of reaction , or the lack thereof , of active termination sites on the surface of the refractory solid and the curing agent over a period of time , e . g ., one week , two weeks , and the like . the term “ functionalized ” may refer to a material in which functional groups have been manipulated or affected in some manner , such as reacted with a compatibilizing material or a passivating material . in one embodiment , a room temperature liquid cure system may include a compatiblized and passivated refectory solid and a liquid curing agent . the cure system may be combined with a curable resin to initiate cure of the resin , that is , to crosslink reactive monomers contained in the resin . particularly , the compatiblized and passivated refectory solid may be homogeneously dispersed into a low temperature liquid curing agent as filler to form the cure system . in one embodiment , the cure system may be combined with a curable resin to form an adhesive system . the adhesive system may cure quickly after combining , may have a pot life that extends for hours or days , or may have an indefinite pot life or desirable shelf life until a further triggering event occurs , such as the application of energy to the adhesive system . such energy may include thermal energy , e - beam energy , uv light , and the like . suitable compatiblized and passivated refectory solid may include a plurality of particles of one or more metal , metalloid , ceramic , or organic material . refractory may include materials with a high melting temperature , such as melting temperatures in a range of greater than about 1000 degrees celsius . in one embodiment , the solid may include aluminum , antimony , arsenic , beryllium , boron , carbon , chromium , copper , gallium , gold , germanium , indium , iron , hafnium , magnesium , manganese , molybdenum , phosphorous , silicon , silver , titanium , tungsten , or zirconium , or the like , or an alloy of two or more thereof . in one embodiment , the solid may include one or more of arsenic , aluminum , boron , gallium , germanium , silicon , titanium , or an oxide or nitride thereof , such as alumina , silica , titania , boron nitride , and the like . for ease of reference , silica may be used as a non - limiting example of a suitable solide . silica may include colloidal silica ( cs ), fused silica , or fumed silica , and the like . prior to compatibilizing and passivating , a suitable solid oxide may have an active surface termination site that comprises a silanol or hydroxyl group . a suitable solid nitride may have the active surface termination site include an amide or an imide . subesquent to compatibilizing and passivating , the density of active termination sites may be controlled to be in a predetermined range . for example , with colloidal nano - particle silica the active termination site density may be about 5 active sites per square nanometer ( oh / nm 2 ) or less , about 4 . 75 oh / nm 2 or less , or in a range of from about 5 oh / nm 2 to about 1 oh / nm 2 , from about 5 oh / nm 2 to about 3 oh / nm 2 , or from about 4 . 5 oh / nm 2 to about 4 . 0 oh / nm 2 . because the active termination site density may correspond to shelf life or stability , a suitable stability ratio ( the ratio of viscosity ( two weeks / initial )), may be less than about 5 , less than about 4 , less than about 3 less than about 2 , or about 1 . as noted hereinabove , compatibilizing and passivating or capping active termination sites may be accomplished by , for example , a sequential treatment . a first portion of active surface termination sites may be reacted with a compatiblizing composition . a suitable compatiblizing composition may include those disclosed hereinabove , such as an alkoxysilane having an organic moiety that may be one or more of acrylate , alkyl , phenyl , cyclohexyloxy , or glycidyl . of the remaining active termination sites , a second portion may be reacted with a passivating composition , such as a silazane or other capping agent as disclosed herein . a suitable water dispersion of colloidal silica for use as a precursor to compatiblized and passivated colloidal silica may be commercially obtained from , for example , nissan chemical america corporation ( houston , tex .) under the tradename snowtex , or nalco 1034a , which is available from nalco chemical company ( napier , ill .). snowtex 40 has an average particle size in a range of from about 10 nanometers to about 30 nanometers . the refectory solid initially may be hydrophilic or somewhat incompatible with an organic or non - polar phase due to the presence of active termination sites on the particle surface . for example , colloidal silica may be hydrophilic due to the presence of silanol groups at the surface . the hydrophilicity may make dispersion in an organic phase problematic or impracticable . compatiblizing the solid surface may create an organophilic coating on the surface of the solid particles to make the particles dispersible in , or compatible with , an organic phase or a non - polar liquid . compatiblizing may be accomplished with , for example , a trialkoxy organosilanes ( e . g ., phenyl trimethoxy silane , glycidoxy propyl trimethoxy silane , and the like ). to reduce further the content or density of active termination sites on the surface , the compatiblized refectory solid may be post treated or reacted with a capping agent or a passivating agent . the reaction with the capping agent may form particles with a relatively low content of available hydroxyl or silanol groups . as disclosed above , such functional groups may be referred to as active termination sites . a compatibilized refectory solid may be further treated or capped with one or more capping agent for passivation . suitable capping agents may include one or more of a triorganosilane , an organodisilazane , organoalkoxysilane , or an organohalosilane such as organochlorosilane . in one embodiment , the capping agent may include one or more of hexamethyl disilazane ( hmdz ), tetramethyl disilazane , divinyl tetramethyl disilazane , diphenyl tetramethyl disilazane , n -( trimethyl silyl ) diethylamine , 1 -( trimethyl silyl ) imidazole , trimethyl chlorosilane , pentamethyl chloro disiloxane , trimethylmethoxysilane and pentamethyl disiloxane , and the like . an acid , a base , or a condensation catalyst may be used to promote condensation of , for example , silanol groups on a silica particle surface and an alkoxy silane group to compatiblize the silica particle . suitable condensation catalysts may include organo - titanate and organo - tin compounds such as tetrabutyl titanate , titanium isopropoxy bis ( acetyl acetonate ), dibutyltin dilaurate , and the like , or combinations of two or more thereof . the compatiblized and passivated ( e . g ., capped ) particles may have a relatively reduced number and / or density of active termination sites on the particle surface . the reduced number or reduced density may provide a stable dispersion of particles in a curing agent , a curable resin , or a mixture of both curing agent and curable resin . further , reduced density of active termination sites ( e . g ., hydroxyl content on compatiblized and passivated silica ) may reduce or eliminate reactions with an anhydride , which may otherwise react with , for example , available hydroxyl groups . such anhydride / hydroxyl reactions may form a free acid . thus , reducing or eliminating active termination sites , such as by passivation , may reduce or eliminate free acid formation and may increase stability . the amount of refectory solid present in a cure system may be expressed as a weight percent of the total weight . the refectory solid may be present in a cure system in an amount greater than about 0 . 5 weight percent , or in a range of from about 0 . 5 weight percent to about 80 weight percent . in one embodiment , the refectory solid content may be present in a cure system in an amount in a range of from about 1 weight percent to about 5 weight percent , from about 5 weight percent to about 10 weight percent , from about 10 weight percent to about 20 weight percent , from about 20 weight percent to about 30 weight percent , from about 30 weight percent to about 40 weight percent , from about 40 weight percent to about 50 weight percent , from about 50 weight percent to about 60 weight percent , or greater than 60 weight percent . suitable refractory solids may have a surface area greater than about 20 square meters per gram , greater than about 60 square meters per gram , or greater than about 150 square meters per gram . the solid may include a plurality of nano - particles having an average diameter in a range of from about 1 nanometer to about 100 nanometers . in one embodiment , the refractory solids may have an average particle size of less than about 1 micrometer to about 500 nanometers , from about 500 nanometers to about 250 nanometers , from about 250 nanometers to about 100 nanometers , from about 100 nanometers to about 50 nanometers , from about 50 nanometers to about 25 nanometers , from about 25 nanometers to about 10 nanometers , from about 10 nanometers to about 5 nanometer , or less than about 5 nanometer . suitable particles may have one or more of a spherical , amorphous or geometric morphology . in one embodiment , the particles may be amorphous . suitable particles may be porous , may be non - porous , or may include some porous and some non - porous particles . the pores may be uniform in shape or size , or may be shaped and / or sized differently from each other . a suitable low temperature liquid curing agent may include an anhydride , such as carboxylic acid anhydride , with a relatively low melt point ( below about 100 degrees celsius ) or that may be liquid at about room temperature . low temperature may include temperatures in a range of less than about 100 degrees celsius , and particularly may include temperatures in a range of less than about 50 degrees celsius . in one embodiment , the curing agent is a flowable liquid in a temperature range of from about 25 degrees celsius to about 35 degrees celsius . liquid refers to a property of being fluid or able to flow or thermoplastically deform . a measure of fluidity may be expressed as viscosity , which is the degree to which a fluid may resist flow under an applied force , as measured by the tangential friction force per unit area divided by the velocity gradient under conditions of streamline flow . in one embodiment , the cure system at low temperature may have a brookfield viscosity of less than about 1000 poise , in a range of from 1000 poise about to about 100 poise , from about 100 poise to about 1000 centipoise , from about 1000 centipoise , or less than about 1000 centipoise . viscosity may be measured according to astm d - 2393 - 67 , which is incorporated herein by reference . the viscosity may differ from embodiment to embodiment , for example , in response to changes in filler loading or type , temperature , and selection of curing agent . suitable liquid or low melting temperature anhydrides may include one or more aromatic anhydride , aliphatic anhydride , or cycloaliphatic anhydride . the curing agent may include one or more carboxylic acid anhydrides , which may be selected from aromatic carboxylic acid anhydride , aliphatic carboxylic acid anhydride , or cycloaliphatic carboxylic acid anhydride . carboxylic anhydrides may be prepared by reacting a carboxylic acid with an acyl halide , or by dehydrating a carboxylic acid , that is , eliminate water between two carboxylic acid molecules to form the anhydride . alternatively , carboxylic acid anhydrides may be obtained commercially from common chemical suppliers . aromatic anhydrides may include one or more of benzoic anhydride ; phthalic anhydride ; 4 - nitrophthalic anhydride ; naphthalene tetracarboxylic acid dianhydride ; naphthalic anhydride ; tetrahydro phthalic anhydride ; derivatives thereof ; and the like . in one embodiment , a curing agent may include one or more aromatic carboxylic acid anhydrides . cycloaliphatic anhydrides may include one or more of cyclohexane dicarboxylic anhydride , hexahydro phthalic anhydride , methyl - hexahydro phthalic anhydride ( mhhpa ), derivatives thereof , and the like . in one embodiment , a curing agent may include 5 , 5 ′-( 1 , 1 , 3 , 3 , 5 ,- hexamethyl - 1 , 5 - trisiloxane diyl ) bis [ hexahydro 4 , 7 - methanoisobenzofuran - 1 , 3 - dione ] ( trisnba ), which is commercially available from ge silicones ( waterford , n . y .). in one embodiment , a curing agent may include one or more of butanoic anhydride ; dodecenyl succinic anhydride ; 2 , 2 - dimethyl glutaric anhydride ; ethanoic anhydride ; glutaric anhydride ; hexafluoro glutaric acid anhydride ; itaconic anhydride ; tetrapropenylsuccinic anhydride ; maleic anhydride ; 2 - methyl glutaric anhydride ; 2 - methyl propionic anhydride 1 , 2 - cyclohexane dicarboxylic anhydride ; octadecyl succinic anhydride ; 2 - or n - octenyl succinic anhydride ; 2 - phenylglutaric anhydride ; propionic acid anhydride ; 3 , 3 - tetramethylene glutaric anhydride ; derivatives thereof ; and the like . the cure system may be blended , dispersed and / or mixed into a curable resin to form an adhesive system . in one embodiment , the resin may have a filler pre - dispersed therein . that is , prior to mixing both the cure system and the resin system each have a high content of refractory solids dispersed therein . suitable resins may include one or more aliphatic epoxy resins , cycloaliphatic epoxy resins , or aromatic epoxy resins . suitable aliphatic epoxy resins may include one or more of butadiene dioxide , dimethyl pentane dioxide , diglycidyl ether , 1 , 4 - butanediol diglycidyl ether , diethylene glycol diglycidyl ether , and dipentene dioxide , and the like . suitable aliphatic epoxy monomers may include one or more of butadiene dioxide , dimethylpentane dioxide , diglycidyl ether , 1 , 4 - butanediol diglycidyl ether , diethylene glycol diglycidyl ether , or dipentene dioxide , and the like . in one embodiment , the aliphatic dioxirane monomer may include cyracure uvr 6105 , which is commercially available from dow chemical ( midland , mich .). suitable cycloaliphatic epoxy resins may include one or more of 3 - cyclohexenyl methyl - 3 - cyclohexenyl carboxylate diepoxide ; 2 -( 3 , 4 - epoxy ) cyclohexyl - 5 , 5 -( 3 , 4 - epoxy ) cyclohexane - m - dioxane ; 3 , 4 - epoxy cyclohexyl alkyl - 3 , 4 - epoxy cyclohexane carboxylate ; 3 , 4 - epoxy - 6 - methyl cyclohexyl methyl - 3 , 4 - epoxy - 6 - methyl cyclo hexane carboxylate ; vinyl cyclohexane dioxide ; bis ( 3 , 4 - epoxy cyclohexyl methyl ) adipate ; bis ( 3 , 4 - epoxy - 6 - methyl cyclohexyl methyl ) adipate ; bis ( 2 , 3 - epoxy cyclopentyl ) ether ; 2 , 2 - bis ( 4 -( 2 , 3 - epoxy propoxy ) cyclohexyl ) propane ; 2 , 6 - bis ( 2 , 3 - epoxy propoxy cyclohexyl - p - dioxane ); 2 , 6 - bis ( 2 , 3 - epoxy propoxy ) norbornene ; diglycidyl ether of linoleic acid dimer ; limonene dioxide ; 2 , 2 - bis ( 3 , 4 - epoxy cyclohexyl ) propane ; dicyclopentadiene dioxide ; 1 , 2 - epoxy - 6 -( 2 , 3 - epoxy propoxy ) hexahydro 4 , 7 - methanoindane ; p -( 2 , 3 - epoxy ) cyclopentyl phenyl - 2 , 3 - epoxypropyl ether ; 1 -( 2 , 3 - epoxy propoxy ) phenyl - 5 , 6 - epoxy hexahydro - 4 , 7 - methanoindane ; ( 2 , 3 - epoxy ) cyclopentyl phenyl - 2 , 3 - epoxy propyl ether ); 1 , 2 - bis ( 5 -( 1 , 2 - epoxy ) 4 , 7 - hexahydro methano indanoxyl ) ethane ; cyclopentenyl phenyl glycidyl ether ; cyclohexane diol diglycidyl ether ; diglycidyl hexahydrophthalate ; and 3 - cyclohexenyl methyl - 3 - cyclohexenyl carboxylate diepoxide ; and the like . in one embodiment , a cycloaliphatic epoxy monomer may include one or more 3 - cyclohexenyl methyl - 3 - cyclohexenyl carboxylate diepoxide , 3 -( 1 , 2 - epoxy ethyl )- 7 - oxabicycloheptane ; hexanedioic acid , bis ( 7 - oxabicyclo heptyl methyl ) ester ; 2 -( 7 - oxabicyclohept - 3 - yl )- spiro -( 1 , 3 - dioxa - 5 , 3 ′-( 7 )- oxabicyclo heptane ; and methyl 3 , 4 - epoxy cyclohexane carboxylate , and the like . suitable aromatic epoxy resins may include one or more of bisphenol - a epoxy resins , bisphenol - f epoxy resins , phenol novolac epoxy resins , cresol - novolac epoxy resins , biphenol epoxy resins , biphenyl epoxy resins , 4 , 4 ′- biphenyl epoxy resins , polyfunctional epoxy resins , divinylbenzene dioxide , resorcinol diglyciyl ether , and 2 - glycidyl phenyl glycidyl ether . other suitable resins may include silicone - epoxy resins and siloxane epoxy resins . bisphenol - f resins may be commerically available from resolution performance products ( pueblo , colo .). optional additives may be incorporated into the resin portion of the system , the curing agent portion of the system , or both . suitable additives may include one or more catalyst , accelerator , flexibilizer , carbinol , organic diluent , suspension agent , fire retardant , pigment , thermally conductive filler , electrically conductive filler , thermally insulative filler , electrically insulative filler , and the like . a suitable catalyst or accelerator may initiate a crosslinking process , accelerate cure rate , or decrease cure time or temperature of an adhesive system . a catalyst or accelerator may be present in an amount less than about 10 parts per million ( ppm ), in a range of from about 10 ppm to about 100 ppm , from about 100 ppm to about 0 . 1 weight percent , from about 0 . 1 weight percent to about 1 weight percent , or greater than about 1 weight percent of the total formulation weight . a suitable catalyst or an accelerator may include , but is not limited to , an onium catalyst or a free - radical generating compound . suitable onium catalysts may include bisaryliodonium salts ( e . g . bis ( dodecyl phenyl ) iodonium hexafluoro antimonate , ( octyl oxyphenyl phenyl ) iodonium hexafluoro antimonate , bisaryl iodonium tetrakis ( penta fluorophenyl ) borate ), triaryl sulphonium salts , and combinations of two or more thereof . suitable free - radical generating compounds may include one or more aromatic pinacols , benzoinalkyl ethers , organic peroxides , and the like . the presence of a free radical generating compound may enable decomposition of an onium salt at a relatively lower temperature . in one embodiment , a catalyst or an accelerator may be added to an epoxy - based adhesive system . useful catalysts or accelerators may include one or more amine ; alkyl - substituted imidazole ; imidazolium salt ; phosphine ; metal salt , such as aluminum acetyl acetonate ( al ( acac ) 3 ); salt of nitrogen - containing compound ; and the like . the nitrogen - containing compound may include , for example , one or more amine compounds , di - aza compounds , tri - aza compounds , polyamine compounds and the like . a salt of a nitrogen - containing compound may include , for example 1 , 8 - diazabicyclo ( 5 , 4 , 0 )- 7 - undecane . the salt of the nitrogen - containing compounds may be obtained commercially , for example , as polycat sa - 1 or polycat sa - 102 . polycat sa - 1 is a delayed - action , heat - activated catalyst based on the cyclic amine , 1 , 8 diaza - bicyclo ( 5 , 4 , 0 ) undec - ene - 7 . polycat sa - 1 contains dbu catalyst and an organic acid “ blocker ”. polycat is a trademark of air products and chemicals , inc ( allentown , pa .). other suitable catalysts may include triphenyl phosphine ( tpp ), n - methylimidazole ( nmi ), and / or dibutyl tin dilaurate ( dibutsn ). additives , such as flexibilizers , may include one or more organic compounds having a hydroxyl - containing moiety . suitable flexibilizers may include one or more of polyol or bisphenol . the polyol may be straight chain , branched , cycloaliphatic , or aromatic and may contain from about 2 to about 100 carbon atoms . examples of such polyfunctional alcohols may include one or more of ethylene glycol ; propylene glycol ; 2 , 2 - dimethyl - 1 , 3 - propane diol ; 2 - ethyl , 2 - methyl , 1 , 3 - propane diol ; 1 , 3 - pentane diol ; 1 , 5 - pentane diol ; dipropylene glycol ; 2 - methyl - 1 , 5 - pentane diol ; 1 , 6 - hexane diol ; dimethanol decalin , dimethanol bicyclo octane ; 1 , 4 - cyclohexane dimethanol ; triethylene glycol ; and 1 , 10 - decane diol . in one embodiment , an alcohol may include 3 - ethyl - 3 - hydroxymethyl oxetane ( commercially available as uvr6000 from dow chemicals ( midland , mich .)). suitable bisphenols may include one or more dihydroxy - substituted aromatic hydrocarbon . in one embodiment , a dihydroxy - substituted aromatic compound may include one or more of 4 , 4 ′-( 3 , 3 , 5 - trimethyl cyclohexylidene )- diphenol ; 2 , 2 - bis ( 4 - hydroxyphenyl ) propane ( bisphenol a ); 2 , 2 - bis ( 4 - hydroxyphenyl ) methane ( bisphenol f ); 2 , 2 - bis ( 4 - hydroxyl - 3 , 5 - dimethylphenyl ) propane ; 2 , 4 ′- dihydroxy diphenylmethane ; bis ( 2 - hydroxyphenyl ) methane ; bis ( 4 - hydroxyphenyl ) methane ; bis ( 4 - hydroxyl - 5 - nitrophenyl ) methane ; bis ( 4 - hydroxyl - 2 , 6 - dimethyl - 3 - methoxyphenyl ) methane ; 1 , 1 - bis ( 4 - hydroxyphenyl ) ethane ; 1 , 1 - bis ( 4 - hydroxyl - 2 - chlorophenyl ethane ; 2 , 2 - bis ( 3 - phenyl - 4 - hydroxyphenyl ) propane ; bis ( 4 - hydroxyphenyl ) cyclohexyl methane ; 2 , 2 - bis ( 4 - hydroxyphenyl )- 1 - phenylpropane ; 2 , 2 , 2 ′, 2 ′- tetrahydro - 3 , 3 , 3 ′, 3 ′- tetramethyl , 1 ′- spirobi { 1h - indene }- 6 , 6 ′- diol ( sbi ); 2 , 2 - bis ( 4 - hydroxyl - 3 - methylphenyl ) propane ( dmbpc ); and c1 - c13 alkyl - substituted resorcinols , and the like . a suitable organic diluent may be added to an adhesive system according to embodiments of the invention . the organic diluent may decrease a viscosity of the adhesive system . suitable reactive diluents may include , but are not limited to , dodecylglycidyl ether , 4 - vinyl - 1 - cyclohexane diepoxide , and di ( beta -( 3 , 4 - epoxy cyclohexyl ) ethyl ) tetramethyl disiloxane , or combinations of two or more thereof . other diluents may include monofunctional epoxies and / or compounds containing at least one epoxy functionality . such diluents may include , but are not limited to , alkyl derivatives of phenol glycidyl ethers such as 3 -( 2 - nonylphenyloxy )- 1 , 2 - epoxy propane or 3 -( 4 - nonylphenyloxy ) 1 , 2 - epoxy propane ; glycidyl ethers of phenol ; substituted phenols such as 2 - methylphenol , 4 - methyl phenol , 3 - methylphenol , 2 - butylphenol , 4 - butylphenol , 3 - octylphenol , 4 - octylphenol , 4 - t - butylphenol , 4 - phenylphenol , and 4 -( phenyl isopropylidene ) phenol ; and the like . in one embodiment , the reactive diluent may include 3 - ethyl - 3 - hydroxymethyl - oxetane , which is commercially available as uvr6000 from dow chemical ( midland , mich .). a suitable flame retardant may include one or more material that contains phosphorus , iron , halogen , oxide , or hydroxide . in one embodiment , a flame retardant additive may include phosphoramide , triphenyl phosphate ( tpp ), resorcinol diphosphate ( rdp ), bisphenol a disphosphate ( bpa - dp ), organic phosphine oxide , halogenated resin ( e . g ., tetrabromobisphenol a ), metal oxide ( e . g . bismuth oxide ), metal hydroxide ( e . g ., mgoh ), and combinations of two or more thereof . suitable pigment may include one or both of reactive and non - reactive materials . in one embodiment , a cure system may be produced by dispersion of refractory solids ( e . g . cs ) into a liquid curing agent and a solvent to form a solution . a suitable solvent may include a hydroxyl - group free solvent , such as propylene glycol methyl ether acetate , toluene , xylene , supercritical fluid ( e . g ., scf co 2 ), and the like . after the dispersion or mixing , the solvent may be removed . suitable solvent removal methods may include affecting the temperature and / or pressure to volatilize the solvent . that is , heat , vacuum , or both may be used to extract or remove the solvent from the dispersion . if a supercritical fluid , such as supercritical carbon dioxide , is used , room temperature and pressure may be sufficient to remove the solvent . subsequently , a solvent - free filled low temperature liquid cure system according to an embodiment of the invention may be recovered and stored . in one embodiment , a cure system further may be mixed with a curable resin to form an adhesive system . the resulting adhesive system may have a flowable or workable viscosity for a predetermined time , i . e ., pot life . for a no - flow underfill application , the viscosity may be such to allow flow of the underfill during dispensing on the substrate and formation of solder electrical connection during a reflow process . viscosity selection may be made by one or more of determining amounts of refractory solids in the resin , amounts of refractory solids in the cure system , the initial unfilled viscosity of the resin and / or cure system , temperature , the presence or amount of additives or flow - modifiers , control over working pressure , use of sonic vibrations , and the like . the adhesive system according to embodiments of the invention may be used in an electronic device . in one embodiment , the adhesive system may be used as an underfill material , such as a no - flow underfill , in a flip chip assembly to secure a chip to a substrate . the adhesive system may exhibit one or more of : prolonged room temperature stability , desirable solder ball fluxing , and a coefficient of thermal expansion below about 50 ppm /° c . when cured and used as , for example , an encapsulant or an underfill . in one embodiment , a cured adhesive system may have properties that include one or more of a low cte ( below about 40 ppm /° c . ), self - fluxing properties during application , a high tg ( above about 100 degrees celsius ), a high heat deflection temperature ( hdt ), and relatively high optical transparency . an embodiment of the invention may provide a no - flow underfill material having a coefficient of thermal expansion , when cured , of less than 50 ppm /° c ., in a range of from about 50 ppm /° c . to about 40 ppm /° c ., from about 40 ppm /° c . to about 30 ppm /° c ., or less than about 30 ppm /° c . an embodiment may enable a final filler loading of greater than 30 weight percent , a range of from about 30 weight percent to about 40 weight percent , from about 40 weight percent to about 50 weight percent , or greater than about 50 weight percent , while maintaining one or more of an acceptable level of processability , transparency , or a desirably high glass transition temperature ( tg ). processability relates to properties that may include flowability , viscosity , visco - elasticity , tack , wetability , out - gassing , percent void , shelf life , cure time , cure temperature , and the like . transparency relates to the property of permitting the relatively free passage of electromagnetic radiation through a pre - determined thickness of material without one or more refraction , reflection or absorption . glass transition temperature relates to an inflection point on a plot of modulus versus temperature . the tg indicates a temperature range above which a material may undergo plastic deformation , or may change from a rigid or brittle state to a rubbery or softened state . in one embodiment , an adhesive system may be a no - flow underfill , a capillary flow underfill , a wafer level underfill , a thermal interface material ( tim ), and / or pre - applied and optionally b - staged on a substrate , and may be dispensable and have utility in the fabrication of an electronic device , such as a computer , an optical device , or a semiconductor assembly . as an underfill material or encapsulant , the adhesive system may reinforce physical , mechanical , and electrical properties of solder bumps that may secure a chip to a substrate , and / or may act as flux during solder bump melting . no - flow underfilling may include dispensing an underfill encapsulant material on the substrate or semiconductor device and performing solder bump reflowing simultaneously with underfill encapsulant curing . wafer level underfilling may include dispensing underfill materials onto the wafer before dicing into individual chips that are subsequently mounted in the final structure via flip - chip type operations . alternatively to no - flow underfill , dispensing the underfill material may include applying in a fillet or bead extending along at least one edge of a chip , and allowing the underfill material to flow by capillary action under the chip to fill all , or nearly all , gaps between the chip and the substrate . in one embodiment , an adhesive according to embodiments of the invention may be energy cured , such as by heat , uv light , microwave energy , electron been energy , and the like . for heat or thermal curing , a suitable temperature may be in a range of from about 50 degrees celsius to about 100 degrees celsius , from about 100 degrees celsius to about 200 degrees celsius , from about 200 degrees celsius to about 250 degrees celsius , or greater than about 250 degrees celsius . for no flow underfill , the cure temperature is in a range of from about 183 degrees celsius ( melting point of eutectic solder ) to about 230 degrees celsius for sn / pb eutectic solder and from about 230 degrees celsius to about 260 degrees celsius for lead - free solder . curing may occur over a period of less than about 30 seconds , in a range between about 30 seconds and about 1 minute , from about 1 minute to about 5 minutes , from about 5 minutes to about 30 minutes , from about 30 minutes to about 1 hour , from about 1 hour to about 5 hours , or greater than about 5 hours . for no flow underfill a cure process ( during a reflow ) may be in a range of from about 3 minutes to about 10 minutes . optional post - curing may be performed at a temperature of less than 100 degrees celsius , in a range of from about 100 degrees celsius to about 150 degrees celsius , or greater than about 150 degrees celsius , over a period of less than one hour , in a range of from about 1 hour to about 4 hours , or greater than about 4 hours . for no - flow underfill , the post cure may be at a temperature in a range of from about 100 degrees celsius to about 160 degrees celsius over a period of from about 1 to about 4 hours . other times , temperatures and pressures for curing and post - curing may be selected with reference to application specific parameters . in one embodiment , a cure system according to an embodiment of the invention may consist essentially of a liquid curing agent and compatiblized and passivated silica . in another embodiment , a cure system may consist essentially of a liquid carboxylic acid anhydride curing agent , and compatiblized colloidal silica treated with a capping agent . in yet another embodiment , a cure system may consist essentially of a room temperature liquid anhydride - curing agent , and compatiblized and passivated colloidal silica having a nano - size average particle diameter . the following examples are intended only to illustrate methods and embodiments in accordance with the invention , and as such should not be construed as imposing limitations upon the claims . unless specified otherwise , all ingredients are commercially available from such common chemical suppliers as alpha aesar , inc . ( ward hill , mass . ), sigma - aldrich corp . ( st . louis , mo . ), and the like . a mixture is made by adding 300 grams of snowtex - zl ( 80 nm average particle size ) to 300 grams of isopropyl alcohol ( ipa ). after thoroughly mixing , 2 grams of phenyl trimethoxysilane ( ph ( ome ) 3 si ) is added to the mixture . the resulting mixture is refluxed for three hours . after reflux , the mixture is cooled to room temperature . the cooled mixture has 600 grams of methoxypropanol added while mixing , until thoroughly mixed . a stripping process removes 600 grams of volatile material , by weight . hexamethyl disilazane ( hmdz ) is added to the stripped mixture in an amount of 6 grams . the mixture is thoroughly mixed , refluxed for 1 hour at elevated temperature , and then stripped to 200 grams total weight . 300 grams of propylene glycol methyl ether acetate or 1 - methoxy - 2 - acetoxypropane ( pgmea ) is added and mixed thoroughly . the resulting mixture is stripped of 300 grams of volatile weight and filtered . the yield is 250 grams of compatiblized and passivated colloidal silica material having solids of 29 . 10 weight percent . the recovered sample is labeled sample 1a . an ingredient list is shown in table 1 , below . the above disclosed process is repeated to form sample 1b , the difference being that silica having an average particle size of 50 nm , rather than 80 nm , is used . the compatiblized and passivated colloidal silica materials produced in example 1 ( samples 1a and 1b ) are added to liquid anhydride materials methylhexahydrophthalic anhydride ( mhhpa ) and 5 , 5 ′-( 1 , 1 , 3 , 3 , 5 ,- hexamethyl - 1 , 5 - trisiloxane diyl ) bis [ hexahydro - 4 , 7 - methanoisobenzofuran - 1 , 3 - dione ] ( trisnba ) to form samples 2 - 4 . samples 2 - 4 were evaporated using a commercially available rotary evaporator at 70 degrees celsius . rotary evaporators may be obtained from , for example , thomas industries , inc . ( skokie , ill .). an ingredient list for the cure systems containing compatiblized and passivated silica is shown in table 2 . a list of properties for the samples 2 - 4 shown in table 2 is shown is table 3 . the viscosity measurements are performed with sp # 40 at 10 rpm , and the results are in centipoise , unless otherwise indicated . an aliphatic dioxirane monomer , cyracure uvr 6105 is blended with bisphenol f epoxy resin in a 75 / 25 ratio to form a base resin . a reactive diluent , uvr6000 , is added to the base resin to form a mixture . a cure catalyst , polycat sa - 1 , is added to the mixture of base resin and diluent to form a catalyzed mixture . the catalyzed mixture is blended with 60 weight percent of a cure system ( samples 2 or 3 ) at room temperature for approximately 10 minutes to form an adhesive system ( samples 5 and 6 , respectively ). after which , each adhesive system ( samples 5 and 6 ) is degassed at relatively high vacuum at room temperature for 20 minutes . samples 5 and 6 are stored at negative 40 degrees celsius . for test and evaluation , samples 5 and 6 are applied to a chip and to a substrate . the chip and substrate are set together to form an assembly . thermal energy is applied to cure the adhesive systems , samples 5 and 6 . test results are listed in table 5 . viscosity is performed with spindle # 40 at 20 rpm at room temperature , the results are in centipoise . the foregoing examples are merely illustrative , serving to illustrate only some of the features of the invention . the appended claims are intended to claim the invention as broadly as it has been conceived and the examples herein presented are illustrative of selected embodiments from a manifold of all possible embodiments . accordingly it is applicants &# 39 ; intention that the appended claims are not to be limited by the choice of examples utilized to illustrate features of the present invention . as used in the claims , the word “ comprises ” and its grammatical variants logically also subtend and include phrases of varying and differing extent such as for example , but not limited thereto , “ consisting essentially of ” and “ consisting of .” where necessary , ranges have been supplied , those ranges are inclusive of all sub - ranges there between . it is to be expected that variations in these ranges will suggest themselves to a practitioner having ordinary skill in the art and where not already dedicated to the public , those variations should where possible be construed to be covered by the appended claims . it is also anticipated that advances in science and technology will make equivalents and substitutions possible that are not now contemplated by reason of the imprecision of language and these variations should also be construed where possible to be covered by the appended claims . | 8 |
fig1 shows the expenditure in terms of equipment for the pick - by - vision method as a first example . a data - processing system 100 comprises a computer 101 and a communication interface or connection device 102 for wireless connection to mobile units 200 . a keyboard 104 makes it possible to enter data , in particular to select functions of a goods management system . many things are carried out in an automated manner , for example , customer orders . the inventory can be retrieved constantly updated . bottlenecks are to be avoided . the goods management software can inform a user about all currently active mobile units via a monitor 103 . further retrievable information includes current users , number of correct goods access operations , number of error messages , order picker start and end times , missing products , order receipts , tracking the order status , determining a possible delivery date , overstaffing or understaffing . the mobile units 200 have an optical display device 201 , an optical sensing detection device 202 and a device for data processing and communication via a wireless connection 206 . a sequence is , for example , shown briefly , as follows : a recently hired , untrained order picker is asked to take a mobile unit 200 from a charging station for storage batteries . usually , it is fully charged . if the charge condition is unsuitable , a block can prevent removal until the optimum charge condition has been reached . the order picker takes a suitable device and switches on the mobile unit 200 . the software powers up and the wireless interface awaits the logon sequence . the mobile unit 200 is recognized by the data processing device 100 based on a cyclical scan of new logons . after detection of the new device by the control center , the current equipment level is increased . a user identification is requested on the display device 201 of the mobile unit 200 . to this end , for the new order picker either his face was linked to his data in the system or an identification card with a personal barcode , possibly as a sticker , sewn - on badge or imprint attached to protective clothing or a helmet . the order picker holds the optical sensing detection device 202 , e . g ., a camera , against his face or the code , and the system transmits the release to the mobile unit 200 for task performance . in the data processing device 100 the device number is linked to the user identity , at the same time a time stamp occurs for the start of work . the data processing device 100 assigns the next goods list to the current mobile unit 200 according to a priority plan . first the order picker is welcomed by name via the display . there is the option here of ending the work promptly in the event of an identification error . the code might be incorrect , the wrong work clothing has been put on or the mobile unit 200 was accidentally pointed at a different order picker . the logon can be repeated by restarting ( switching on and off ). however , the incorrect logon is logged . once the welcome has been completed , the order picker needs only to follow the instructions of the mobile unit 200 for the route . first , the order picker is guided to a transport aid . arrows 205 on the display show the way . prominent objects or intersections in the route can also be displayed in the optical display device 201 . the transport aid to be selected is clearly assigned by the control center or data processing system 100 . this also makes it possible to continue a combination of goods that has been started but not completed , even by a different order picker . when the transport aid is reached , the instruction to take the same is transmitted . if the transport aid is clearly identified by the detection device , which can also be carried out by a barcode , and moved away from the location , the target of the next element of the task list of the user is transmitted to the mobile unit 200 . the directions are given again . location and target are two geographic points , which are used via software to the mobile unit 200 or in the control center or data processing system 100 for an automatic routing process through the warehouse by the shortest route . as a result , the mobile unit 200 indicates the direction by arrows 205 , the movement of the order picker through the warehouse is detected by optical sensing . the camera on the mobile unit 200 renders possible a comparison of image data with stored and geographically assigned warehouse positions and orientations . a certain barcode sign can thus precisely define the location . the orientation can additionally be detected by rotary sensors , e . g ., according to the gyroscope principle , so that a viewing angle defined for the alignment of the camera to the barcode sign is taken into account accordingly in the indication of direction in the event of a tilt , at the target location , the optical sensing detection device 202 recognizes the target object . the display indicates the object by suitable emphasis . if the correct object is moved into the transport aid , the detection device recognizes this , e . g ., since two image components are made congruent . the operation is completed , the next routing occurs . if the mobile unit 200 is switched off , the current order - picking status with the time log for the user is stored and integrated into the population of all orders . if all of the elements of a task list have been completed , that is , placed in the transport aid , the guidance of the filled transport aid to the target location occurs . guidance to another transport aid occurs . then further actions , such as packing and shipping of the goods can be carried out at the target location for the transport aid . the deletion of all goods is carried out in a similar manner through the detection of the removal from the transport aid by staff authorized to do so . since the control center or the data processing system 100 knows the precise number of goods deposited , a packer can here also verify again the correct order picking with the aid of the device presented . the transport aid number is again released in the system for a new list of goods . if an order picker takes the wrong object in error , a warning is given via the display device 201 or acoustically . the error is logged , any correction likewise . if the mobile unit 200 , as shown in fig1 , is embodied as a hand unit , work is somewhat limited . this can be remedied by a detachable attachment of the device to a transport aid . however , the fixing of the device to the body , e . g ., by a belt , is advantageous , and ideally the display device 201 is integrated into data goggles 300 , as shown in fig2 . future goggles render possible very light embodiments , so that freedom of movement is restricted only slightly . the field of view should remain as large as possible . fig3 shows a typical data helmet with a video monitor device or optical display device 201 similar to an electronic viewfinder for the display of augmented reality , integrating lines of sight from an optical sensing detection device 202 embodied as a camera . a transmission device 203 can be attached to a helmet 400 and is connected to a detection and display device via a wiring 204 . a closed unit thus results , which can easily be put on or taken off . fig4 shows a headband 600 in side view for attachment to the head . devices for image detection , image reproduction and data processing and communication or an optical sensing detection device 202 , an optical display device 201 and a transmission device 203 are mounted on the forehead here . a special embodiment of the mobile unit 200 is shown in fig5 . the headpiece shows here an image detection device 202 in the form of a video camera and a display device 201 in the form of a laser projector . the latter projects directional arrows onto the floor in front of the user . a correctly recognized article of goods can also be indicated with the aid of a projector , e . g ., by a circle . however , the prerequisite for this is that the projection beam is located in the field of view of the camera . preferably the laser projector permits a change of the projection direction from obliquely to the ground to straight ahead parallel to the line of sight of the detection device , in order to achieve a clear feedback . fig6 through 9 show possible representations during a product navigation , either through the display or the line of sight of the order picker . the shelf labels , for example , are used for orientation here . the letters a through h give the system the current location . the next list product is a white ball or a target object 500 . this is located in the vicinity of a marker g . a route planning ( central or in the mobile unit 200 ) determines the route information and produces the ( directional ) arrows 205 . if the order picker follows the arrow 205 , the view of the optical sensing detection device 202 then changes from fig7 to that in fig8 and finally to that in fig9 . the product is recognized and marked and can be removed in a controlled manner . the predominant but not restricted field of application relates to warehouses of wholesalers or mail - order companies as well as storage facilities or interim storage facilities of manufacturers or suppliers . with the method or the device according to the invention , for this the combination of goods inside a warehouse is thereby possible even by employees with no knowledge of the configuration of the warehouse and no knowledge of the location and position of the goods to be combined , wherein in particular several order pickers can work simultaneously . | 6 |
fig4 is a schematic view of a surface acoustic wave ( saw ) matched filter according to the present invention . referring to fig4 a stem 101 fixes a matched filter chip . a piezoelectric substrate 102 comprises , e . g ., an st - cut quartz substrate . an input idt 111 converts an electrical signal into saw signals . a bus bar 121 supplies an if signal matching the input center frequency of the matched filter from a spread spectrum input signal via an input pin 120 . bus bars 122 and 131z connect a ground electrode serving as the reference potential . bus bar 131y extracts the output of the saw matched filter and supplies an output to saw matched filter output pin 130 . an output idt 131 has electrode finger pairs 1311 , 1312 , 1313 , . . . , 131x . the electrode directions of these electrode finger pairs 1311 , 1312 , 1313 , . . . , 131x , i . e ., which of the electrode fingers connected to either the upper or lower electrodes in fig4 are to be disposed at the input idt side , are determined in correspondence with a pn code of a signal input to the input idt . for example , when the input code sequence is 1101011 . . . 01 , the direction of the electrode finger pairs 1313 , 1315 , and 131x - 1 is opposite that of other electrode finger pairs . the spacing between adjacent electrode finger pairs corresponds to the distance saw signals generated by the input idt 111 propagate within a time corresponding to the 1 - chip length of the code sequence . the input idt 111 has an arcuated shape with the concave surface facing the output idt 131 . the arcuated shape of the concave surface is not a shape that allows saws to converge , but does prevent saws excited by the input idt from diverging and allows saws to propagate substantially straight toward the output idt . fig4 a shows a cross - sectional view of the saw matched filter device depicted in fig4 . the cross - section of the saw matched filter as discussed in this embodiment shows a substrate 102a and a thin film 102b provided on the substrate . fig5 shows the result of simulation using the huygens &# 39 ; principle for the intensity distribution of saws obtained when saws excited by the arcuated idt propagate along a y - cut lithium niobate substrate as one example of the piezoelectric substrate in the z - axis direction . the saw matched filter normally adopts an st - cut quartz substrate which suffers fewer changes in velocity upon changes in temperature . however , fig5 shows the saw intensity distribution in the case of a y - cut lithium niobate substrate as an example of the propagation state of saws . in this example , the input signal to the arcuated idt has a center frequency of 200 mhz , a radius of curvature of 20 mm , and a central angle of the arc of 20 °. as can be seen from fig5 the saw intensity near the center is higher than that in fig3 and saws concentrated on the central line of the arcuated idt propagate 20 mm or more from the proximity of the end face of the output electrodes . the piezoelectric substrate may adopt a form in which the change in velocity due to a change in temperature is substantially zero or which is designed to have a change in velocity of substantially zero due to a change in temperature by forming a thin film on the piezoelectric substrate . in this case , a change in correlation peak detection level and a time shift of a synchronous signal due to a change in ambient temperature can be suppressed when the device is used in , e . g ., an ss communication system . with the above - mentioned shape of the input idt , since the influence of divergence of saws can be eliminated , when a substrate such as an st - cut quartz substrate , which has a small electromechanical coupling coefficient and suffers only a slight loss due to the electrode finger pairs , on the input idt side , of the output idt , is used , the detected signal level saw / electric - converted by the output electrode finger pairs on the input idt side of the output idt can be substantially equal to that obtained by the output electrode finger pairs farther from the input idt of the output idt , and a correlation peak matching the input code sequence can be obtained at high level . in order to permit further uniformity between the detected levels of the respective electrode finger pairs of the output idt , a method of apodizing the electrode fingers by weighting the crossing width of the electrode finger pairs of the output idt may be used . fig6 is a schematic view showing another embodiment of a surface acoustic wave ( saw ) matched filter according to the present invention . the same reference numerals in fig6 denote the same parts as in fig4 . referring to fig6 the input idt 111 has an arcuated shape with the concave surface facing the output idt 131 or a pseudo arcuated shape in consideration of the angle dependence of the propagation velocity of ultrasonic waves that propagate on the piezoelectric substrate . a position where saws excited by the input idt 111 with this shape are concentrated , form a straight equiphase surface perpendicular to the propagation direction , and are in phase with each other , i . e ., the focal point of the idt 111 is set near the electrode finger pair 131x , farthest from the input idt 111 , of the output idt 131 . in this case , since some of saw signals propagating from the input idt 111 travel without passing through the crossing electrode portions of the electrode finger pairs 1311 , 1312 , . . . of the output idt , the amount of energy to be converted into an electrical signal by the electrode finger pairs 1311 , 1312 , . . . of the output idt decreases as compared to the conventional matched filter shown in fig1 and conversely , the amount of energy to be converted into an electrical signal near the electrode finger pair 131x of the output idt farthest from the input idt 111 increases . in this manner , the saw energy amount that decreases as saws propagate along the electrode finger pairs of the output idt can be compensated for by the energy amount obtained by saws concentrated at the focal point , and the electrode finger pair 131x of the output idt farthest from the input idt 111 can convert an electrical signal in an amount substantially equal to that of an electrical signal converted by the electrode finger pair near the input idt . in this manner , the respective electrode finger pairs of the output idt can output electrical signals having substantially constant converted signal levels , and a more accurate correlation peak can be obtained with respect to an input signal of a predetermined code sequence . therefore , a high - level synchronous signal matching the input code sequence can be obtained . fig7 a and 7b are schematic views showing the arrangement used when the electrode fingers of the input idt and the output idt in the surface acoustic wave ( saw ) matched filter of the first or second embodiment of the present invention comprise split electrodes . in the case of the matched filter , since the time required for a saw that has passed through a given electrode pair of the output idt to reache the next electrode finger pair equals the time required for a saw reflected by a given electrode finger pair to reache the immediately preceding electrode finger pair , the influence of reflected waves serving as a noise source must be eliminated . fig7 b is an enlarged view of the electrode finger pairs of the output idt shown in fig7 a . in fig7 a and 7b , the line width and spacing of the electrode fingers are respectively λ / 8 . the split electrodes shown in fig7 a and 7b are used as means for suppressing reflected waves in a saw device , but are also effective in the matched filter of the present invention . in this embodiment , both the input idt and the output idt use split electrodes . however , either the input idt or the output idt may use split electrodes . fig8 is a schematic view showing the arrangement when the input idt and the output idt of the surface acoustic wave ( saw ) matched filter of the first or second embodiment of the present invention comprise three - phase type unidirectional idts . a three - phase type unidirectional idt obtains unidirectional characteristics by exciting or receiving saws using electric fields having phases 120 ° apart from each other ( or electric fields with 0 ° and 60 ° phases ). for example , signals output from the electrode finger pairs 1313 , 1315 , and 131x - 1 of the output idt have signs opposite to those of other electrode finger pairs , and signals synchronous with the input code sequence are obtained . ideally , the three - phase unidirectional idt suffers almost no reflection at the electrode fingers and is expected to have an increase in output by 6 db as compared with a bidirectional idt . on the other hand , as shown in fig9 an idt , which obtains unidirectional characteristics by shifting the reflection center from the excitation center such that one electrode finger of the split electrode shown in fig7 a and 7b is formed to be thick and the other electrode finger is formed to be thin , as shown in fig9 can be manufactured by a single photolithography process although it has small unidirectional characteristics . for this reason , a high - efficiency matched filter can be obtained with low cost , and a higher - level correlation peak can be obtained by suppressing reflection components due to the idt of a synchronous signal synchronized with the input code sequence . various other means for obtaining unidirectional characteristics such as a group type unidirectional saw device , a reflection bank type device , a unidirectional saw device using reflection by floating electrodes , and the like have been proposed ( 150th acoustic wave technique committee of the japan society for promotion of science , ed ., &# 34 ; acoustic wave element technique handbook &# 34 ;, ohm - sha shuppan , pp . 193 - 195 ). these unidirectional saw devices may be applied to the present invention . in the above - mentioned embodiments of the matched filter of the present invention , the input idt is arranged to have a substantially arcuated shape so that the input idt itself serves as the anti - divergence means . alternatively , as shown in fig1 as with the anti - divergence means , an acoustic lens may be used . saws excited by the input idt are controlled so that their equiphase surface becomes a concave shape . fig1 shows the arrangement in which an apodized idt is used as the input idt . with this arrangement , the electrode fingers of the input idt to be used may be weighted so that the intensity of a saw excited at the central portion , in the crossing width direction , of the crossing portion of electrode fingers is stronger than that of saws excited at the outer sides of the crossing portion . this structure is particularly preferable for the following reason . since the equiphase surface of propagating saws has a concave shape , saws excited at the outer sides of those excited by the input idt can be prevented from diverging , and the intensity of a saw excited at the central portion having a relatively small influence of divergence can be further enhanced . fig1 is a block diagram showing an example of a communication system using the above - mentioned saw matched filter . referring to fig1 , a transmission device 40 enclosed within an upper dotted rectangle ss - modulates a signal to be transmitted using a spread code , and transmits the modulated signal from an antenna 401 . the transmitted signal is received by a reception device 41 , and is demodulated . the reception device 41 comprises an antenna 411 , a high - frequency signal processing unit 412 , a synchronous circuit 413 , a code generator 414 , a spread demodulation circuit 415 , and a demodulation circuit 416 . the reception signal received by the antenna 411 is appropriately filtered and amplified by the high - frequency signal processing unit 412 , and is output as a transmission frequency band signal before or after it is converted into an appropriate intermediate frequency band ( if ) signal . the signal is input to the synchronous circuit 413 . the synchronous circuit 413 comprises a surface acoustic wave device 4131 using the saw device described in each of the above embodiments , and a signal processing circuit 4133 for processing the signal output from the saw device 4131 . synchronous circuit 413 outputs a spread code synchronous signal corresponding to the transmitted signal and a clock synchronous signal to code generator 414 . the saw device 4131 , as the saw matched filter , receives an output signal from the high - frequency signal processing unit 412 , and outputs a correlation peak when the polarity of the synchronous spread code component contained in the reception signal matches that of a code sequence of the electrode finger pairs of an output idt in the saw matched filter 4131 . therefore , the saw matched filter described in each of the above embodiments can obtain a synchronous signal which is free from noise interference , has a high correlation peak , and a high s / n ratio . the signal processing circuit 4133 detects the correlation peak from the synchronous signal input from the saw matched filter 4131 , reproduces a clock signal , and outputs the spread code synchronous signal and the clock signal to the code generator 414 . after synchronization is established , the code generator 414 generates a spread code whose clock and spread code phases are locked with those of the spread code at the transmitting side . this spread code is output to the spread demodulation circuit 415 , which recovers the signal before spread modulation . a signal output from the spread demodulation circuit 415 is a signal modulated by a popularly used modulation method such as frequency modulation , phase modulation , or the like , and is demodulated by the demodulation circuit 416 , known to those who are skilled in the art . fig1 and 14 are block diagrams showing examples of the transmission and reception devices of a communication system using the saw device described above . referring to fig1 , a serial - parallel converter 501 converts input serial data into n parallel data . multipliers 502 - 1 to 502 - n respectively multiply n parallel data with n spread codes output from a spread code generator 503 . the spread code generator 503 generate n different spread codes and a synchronous spread code . an adder 504 adds the synchronous spread code output from the spread code generator 503 to the n outputs from the multipliers 502 - 1 to 502 - n . a high - frequency section 505 converts the output from the adder 504 into a transmission frequency signal . the converted signal is transmitted from a transmission antenna 506 . referring to fig1 , the transmitted signal is received by a reception antenna 601 . the signal received by the antenna 601 is input to a high - frequency signal processing unit 602 . a synchronous circuit 603 uses the saw matched filter described in each of the above embodiments , which establishes and maintains synchronization with spread codes and a clock at the transmitting side . a spread code generator 604 generates n + 1 spread codes pn which are identical to spread codes at the transmitting side , generates reference spread code pno on the basis of the code synchronous signal and receives a clock signal input from the synchronous circuit 603 . a carrier reproducing circuit 605 reproduces the carrier signal on the basis of the reference ( carrier reproducing ) spread code pn0 output from the spread code generator 604 and the output from the high - frequency signal processing unit 602 . a baseband demodulation circuit 606 performs demodulation in a baseband using the output from the carrier reproducing circuit 605 , the output from the high - frequency signal processing unit 602 , and n spread codes pn output from the spread code generator 604 . a serializer 607 parallel - serial converts n parallel demodulated data output from the baseband demodulation circuit 605 . in the above arrangement , at the transmitting side , input data is converted by the serial - parallel converter 501 into n parallel data , the number of which is equal to the code division multiplex number . on the other hand , the spread code generator generates n + 1 spread codes pn0 to pnn which have an identical code period and are different from each other . of these codes , the spread code pn0 is exclusively used for synchronization and carrier reproduction , and is directly input to the adder 504 without being modulated by the parallel data . the n remaining spread codes pn1 to pnn are multiplied with , and modulated by , the n parallel data by the multipliers 502 - 1 to 502 - n . the modulated codes are input to the adder 504 . the adder 504 linearly adds the n + 1 input signals , and outputs the sum baseband signal to the high - frequency section 505 . subsequently , the baseband signal is converted by the high - frequency section 505 into a high - frequency signal having an appropriate center frequency , and the high - frequency signal is transmitted from the transmission antenna 506 . at the reception side , the signal received by the reception antenna 601 is appropriately filtered and amplified by the high - frequency signal processing unit 602 , and is output as the transmission frequency band signal before or after it is converted into an appropriate intermediate frequency band ( if ) signal . the signal is input to the synchronous circuit 603 . the synchronous circuit 603 comprises a surface acoustic wave device 6031 as the saw matched filter described in each of the above embodiments of the present invention , and a signal processing circuit 6033 for processing the signal output from the saw device 6031 and outputting a spread code synchronous signal corresponding to the transmitted signal and a clock synchronous signal to the spread code generator 604 . the saw device 6031 receives the output signal from the high - frequency signal processing unit 602 . note that the saw device 6031 outputs a high correlation peak when the synchronous spread code component included in the reception signal matches the polarity layout of the electrode fingers , corresponding to the signs , of the output electrode finger pairs of the saw device 6031 on the output electrode finger pair array of the saw device 6031 as the saw matched filter , thus obtaining a synchronous signal with a high s / n ratio . on the other hand , when they do not match each other , the output level of the electrode finger pair array is low , and a synchronous signal cannot be obtained . the signal processing circuit 6033 detects a correlation peak from the signal input from the saw device 6031 , reproduces a clock signal of the transmitted spread code pn0 , and outputs the code synchronous signal and clock signal to the spread code generator 604 . after synchronization is established , the spread code generator 604 generates spread codes whose clock and spread code phases are locked with those of the spread codes at the transmitting side . of these codes , the synchronous spread code pn0 is input to the carrier reproducing circuit 605 . the carrier reproducing circuit 605 despreads the reception signal converted into the transmission frequency band or intermediate frequency band signal as the output from the high - frequency signal processing unit 602 on the basis of the synchronous spread code pn0 , thereby reproducing a transmission frequency band or intermediate frequency band carrier . the carrier reproducing circuit 605 may comprise a circuit utilizing a phase - locked loop . the reception signal and the synchronous spread code pn0 are multiplied by a multiplier . after synchronization is established , the clock and code phases of the synchronous spread code in the reception signal are locked with those of the reference synchronous spread code , and the synchronous spread code pn0 at the transmitting side is not modulated by data . for this reason , the synchronous spread code pn0 is despread by the multiplier , and its output includes a carrier component . the output from the multiplier is input to a band - pass filter , and only the carrier component is extracted and output . the output from the filter is then input to a known phase - locked loop constituting a phase detector , a loop filter , and a voltage - controlled oscillator . the voltage - controlled oscillator outputs as a reproduced carrier , a signal , the phase of which is locked with that of the carrier component output from the band - pass filter . the reproduced carrier is input to the baseband demodulation circuit 606 . the baseband demodulation circuit 606 generates a baseband signal based on the reproduced carrier output from the carrier reproducing circuit 605 , and the output of the high - frequency signal processing unit 602 . the baseband signal is distributed into n signals , which are despread by the spread codes pn1 to pn0 as the outputs from the spread code generator 604 in units of code division channels . the despread signals are subjected to data demodulation as parallel signals . the n parallel demodulated data are converted into serial data by the serializer 607 , and the converted signal data is output . this embodiment exemplifies binary modulation . however , the present invention may be applied to other modulation methods such as orthogonal modulation . as described above , according to the present invention , in a so - called saw matched filter which transmits only a signal of a code sequence matching a predetermined code sequence by exciting saws using an input interdigital transducer formed on a piezoelectric substrate , and receiving signals by an output interdigital transducer in which electrode fingers are arranged in correspondence with a predetermined code sequence , electrical signal converted outputs over all the output electrode finger pairs can be made consistent with respect to signals that become smaller as the code is located near the end of the code sequence due to divergence of saws as the saws propagate . thus a signal with a high correlation peak and a high s / n ratio can be obtained . when the saw matched filter is used to establish synchronization of a spread spectrum ( ss ) communication reception device , stable demodulation with high reliability can be realized since a synchronous signal with a high s / n ratio can be obtained . | 7 |
the embodiments of the present invention will be described in the following with reference to the drawings . fig1 a is a block diagram showing functional blocks of a central office according to an embodiment of the present invention ; and fig1 b is a block diagram showing functional blocks of a remote terminal according to an embodiment of the present invention . as shown in fig1 a , the central office includes a reference clock signal generating unit 1 , a sliding window generating unit 2 , and a sliding window transmitting unit 3 . the reference signal generating unit 1 generates a reference clock signal having a frequency of , for example , 400 hz , synchronized with a tcm isdn transmission which interferes the central office and the remote terminal . the reference clock signal may be generated based on an external signal or within an internal signal generated by a crystal oscillator as an example . the sliding window generating unit 2 generates a downstream sliding window from the generated reference clock signal . the downstream sliding window discriminates whether the transmitting dmt symbols are received in a far end cross - talk duration or in the other duration at the remote terminal . the sliding window transmitting unit 3 transmits the dmt symbols according to the downstream sliding window to the remote terminal . as shown in fig1 b , the remote terminal includes a sliding window receiving unit 4 , a reference clock signal generating unit 5 , and a sliding window generating unit 6 . the sliding window receiving unit 4 receives the dmt symbol according to the downstream sliding window from the central office . the reference clock signal generating unit 5 generates a reference clock signal based on the reference clock signal generated by the reference clock signal generating unit 1 in the central office , and transmitted from the central office to the remote terminal . the sliding window generating unit 6 generates an upstream sliding window from the generated reference clock signal by the reference clock signal generating unit 5 . the generated downstream sliding window discriminates whether the received dmt symbols are received in a far end cross - talk duration or other duration at the remote terminal . the reference clock signal in the central office or in the remote terminal may be generally referred to as a timing signal which is synchronized with the transmission system which interferes the central office and the remote terminal . the dmt modulation will be explained using the g . lite as an example , with reference to fig1 a and 1b . this explanation and the associated drawing will describe only the downstream modulation / demodulation from the central office to the remote terminal . however , the dmt modulation is also possible in the upstream modulation / demodulation . firstly , transmitting data is input into an adsl transceiver unit ( atu ) in the central office and a non - symbol time ( ¼ khz ) of the data is stored in a serial to parallel buffer 10 . the stored data are divided into a plurality of groups . a predetermined number of transmission bits b 0 , . . . , or bi per a carrier signal is previously allocated to each group in accordance with a transmitting bitmap 60 which will be described later in detail . each group is output to an encoder 20 . in the encoder 20 , each group of the input bit series is converted into a signal point expressed by a complex number for an orthogonal amplitude modulation and is output to ifft 30 . the ifft 30 performs the conversion from each of the signal points to transmit signal sequence by an inverse fast fourier transform . the signals from the ifft 30 are output to a parallel to serial buffer 40 . here the sixteen tail points 240 - 255 of the outputs of the ifft 30 are added as a cyclic prefix to the head of each dmt symbol . the output of the parallel to serial buffer 40 is supplied to a d / a converter 50 in which the digital signal with a sampling frequency of 1 . 104 mhz is converted into an analog signal . the analog signal is transmitted through a metalic line 100 to a remote terminal . at the remote terminal side , the analog signal is converted into a digital signal with the sampling frequency of 1 . 104 mhz by an a / d converter 110 . each dmt symbol of the digital signal is stored in a serial to parallel buffer 120 . in the buffer 120 , the cyclic prefix is removed from the digital signal , and the remaining signal is output to an fft 130 . in the fft 130 , a fast fourier transform is effected to generate or demodulate the signal points . the demodulated signal points are decoded by a decoder 140 in accordance with a receiving bitmap 160 having the same values as those in the transmitting bitmap 60 . the decoded data are stored in a parallel to serial buffer 150 as receiving data of bit - sequences b 0 , and bi . fig2 is a diagram showing a method for transmitting synchronization signals according to an embodiment of the present invention . in fig2 , ( 1 ) represents a reference clock signal for transmitting a time compression modulation ( tcm ) signal having a frequency of 400 hz between the central office to the remote terminal ; ( 2 ) represents next durations , i . e ., c - next durations and fext durations , i . e ., c - fext durations at the central office which are synchronized with the reference clock signal ( 1 ) of 400 hz ; ( 3 ) represents fext durations , i . e ., r - next durations and next durations , i . e ., r - next durations at the remote terminal which are synchronized with the reference clock signal ( 1 ) of 400 hz ; ( 4 ) represents symbols a and b transmitted from the central office to the remote terminal during an initial training ; and ( 5 ) represents symbols a and b received by the remote terminal . the time difference between ( 4 ) and ( 5 ) is the propagation delay . each of the symbols a and b has a duration of 256 samples . the symbols a and b are used to inform the next duration and the fext duration from the central office to the remote terminal . the symbols a and b are signals obtained by selecting a carrier having a relatively low frequency at which tcm cross - talk is small ; modulating the selected carrier by the 4 - value qam as an example to obtain 4 signal points ; and selecting two signal points a and b from the 4 signal points . the phases of the two signal points a and b are different by 90 ° to each other . the selected signal points a and b are shown in fig1 , as an example . the two signal points are converted by the ifft 30 from the frequency domain to the time domain . at the remote terminal , it is impossible to discriminate each boundary of dmt symbols output from the ifft 30 in the central office . therefore , it is impossible to coincide an fft interval with a dmt symbol interval , so that signal points after modulation do not appear in correct phases or quadrants . however , by employing the two symbols a and b having phases different by 90 ° to each other , the modulated two symbols also have phases different by 90 ° to each other so that , even when there is an error in phase of the modulated signal points , the remote terminal can discriminate its next duration , i . e ., r - next duration from its fext duration , i . e ., r - fext duration . fig3 shows how to define the r - next duration and the r - fext duration when a signal having a frequency of 400 hz is transmitted during an initial training . at the central office , once an adsl modem detects the phase of the reference clock signal having the frequency of 400 hz , a dmt symbol counter for counting each sample and a counter for discriminating the next duration and the fext duration at the central office , i . e ., the c - next duration and the c - fext duration , are started , whereby it becomes possible to discriminate whether a received dmt symbol belongs to the c - next duration or the c - fext duration without generating the reference clock signal from the received dmt symbols . in fig3 , ( 1 ) shows counter values “ a ”, “ b ”, and “ c ”, the counter value “ a ” represents the fext duration at the remote terminal ; the counter value “ b ” represents the next duration at the remote terminal ; and the counter value “ c ” represents the remaining period obtained by subtracting ( a + b ) from one cycle period of the reference clock signal . these values are determined by taking a round trip delay generated by a propagation delay in the tcm isdn transmission , ( 2 ) in fig3 shows the case when all of the received dmt symbols are included in the r - fext duration at the remote terminal ; and ( 3 ) in fig3 shows the case when a part of the received dmt symbols are included in the r - next duration at the remote terminal . when the first dmt symbol is synchronized with the head of one cycle of the reference clock signal of 400 hz as shown in ( 2 ) of fig3 , the determination of whether n - th dmt symbol belongs to the r - fext duration or the r - next duration can be performed as follows . it is assumed that there are 2760 samples in one cycle of the reference clock signal of 400 hz , as shown in ( 1 ) of fig3 . also , each symbol is assumed to have 256 samples during training as shown in ( 2 ) of fig3 . then , a parameter s is defined as : if {( s & lt ;( a − 256 )} or ( s & gt ;( a + b )} is satisfied , then it is judged that the n - th symbol belongs to an r - fext duration . if {( a − 256 )≦ s ≦( a + b )} is satisfied , then it is judged that the n - th symbol belongs to an r - next duration . from an adsl modem in the central office , a sequence switching symbol is transmitted to inform the switching timing of the training sequence to the opposite party . if the receiving side cannot recognize the head of the sequence switching symbol , it is impossible to normally perform the training . in order to surely inform the sequence switching , the sequence switching symbol is transmitted at a time when the receiving side can receive the head of the sequence switching symbol during a fext duration according to an embodiment of the present invention at the receiving side . fig4 shows the timing of the sequence switching symbol informed from the central office to the remote terminal . in fig4 , ( 1 ) represents the reference clock signal of 400 hz ; ( 2 ) shows the c - next durations and c - fext durations at the central office ; ( 3 ) shows the head of the sequence switching symbol transmitted from the central office ; ( 4 ) shows the head of the sequence switching symbol received by the remote terminal ; and ( 5 ) shows the r - fext durations and r - next durations at the remote terminal . the slashed portions in the figure represent the head of the sequence switching symbol . as shown in ( 3 ) and ( 4 ) of fig4 , the head of the sequence switching symbol is received during the r - fext duration at the remote terminal . in the adsl modem also , during training , a signal to noise s / n is measured for each modulating carrier in the receiving signal to determine the number of bits to be transmitted for each modulating carrier . under the tcm cross - talk environment , the s / n measurement must be performed in each of the next durations and the fext durations by taking the influence of the next or the fext into account . fig5 shows how to define the next duration and the fext duration for measuring the s / n . in fig5 , ( 1 ) shows the reference clock signal of 400 hz ; ( 2 ) shows the original r - fext duration and the original r - next duration at the remote terminal when s / n is not measured ; ( 3 ) shows the definition of an r - fext duration “ a ” for measuring s / n and of an r - next duration “ e ” for measuring s / n ; ( 4 ) shows dmt symbols in the fext duration “ a ”; and ( 5 ) shows dmt symbols in the r - next duration “ e ”. as shown in fig5 , the r - next duration “ a ” for measuring s / n and the r - fext duration “ e ” for measuring s / n are defined within the original r - fext duration and the original r - next duration , respectively . the number of bit calculated from s / n measured in the next duration must be a value which can ensure a predetermined bit error rate ( hereinafter referred to as ber ). to this end , as shown in ( 4 ) of fig5 , only the dmt symbols within the r - fext duration “ a ” are used to measure the s / n in the r - fext duration ; and as shown in ( 5 ) of fig5 , only the dmt symbols within the r - next duration “ e ” are used to measure the s / n in the r - next duration . the dmt symbols which are not included in either the r - fext duration “ a ” or r - next duration “ e ” are not used to measure the s / n because they have no meaning as information to determine the number of bits to be transmitted . when the first symbol of the dmt symbols is synchronized with the head of the cycle of the receiving signal of 400 hz , the determination of whether the n - th symbol belongs to the fext duration for measuring s / n or the next duration for measuring s / n can be performed as follows . it is assumed that there are 2760 samples in one cycle of the reference signal of 400 hz , as shown in ( 1 ) of fig5 . also , each symbol is assumed to have 272 samples during communication , as shown in ( 4 ) of fig5 . then , a parameter s is defined as : if {( s & lt ;( a − 272 )} or { s & gt ;( a + d + e + f )} is satisfied , then it is judged that the n - th symbol belongs to an r - fext duration for measuring s / n . if {( a + d )& lt ; s & lt ;( a + d + e − 272 )} is satisfied , then it is judged that the n - th symbol belongs to an r - next duration for measuring s / n . if any one of the above conditions is not satisfied , then the n - th symbol is not considered for measuring s / n . if should be noted that ( d + e + f ) is equal to “ b ” in fig3 or in fig1 . fig6 is a block diagram of an s / n measuring unit in the adsl modem in the remote terminal . when a demodulator 210 receives receiving data , it outputs signal points of each carrier signal as demodulated data . a reference unit 220 outputs signal points of respective carrier signals which are to be received when there is no error . the difference between a signal point from the reference unit 220 and a corresponding demodulated signal point from the demodulator 210 is an error . the error is input to a selector 260 . further , a clock signal generated from a clock generator 230 in the remote terminal is divided by a frequency divider 240 into a signal having a frequency of 400 hz . the phase of the signal of 400 hz generated by the frequency divider 240 is synchronized with the phase of the signal of 400 hz transmitted from the central office . the signal of 400 hz from the frequency divider 240 is input to a phase discriminator 250 . the phase discriminator 250 judges , based on the signal of 400 hz input into the phase discriminator 250 , that the received dmt symbol belongs to a fext duration , a next duration , or other duration . the judged result is input to a selector 260 . the selector 260 transfers the above - mentioned error to a next duration s / n measuring unit 270 or a fext duration s / n measuring unit 280 , in accordance with the judged result from the phase discriminator 250 . each of the s / n measuring units integrates the errors to calculate s / n . the s / n for each carrier signal is output to a transmitting capacity calculating unit 290 . the transmitting capacity calculating unit 290 calculates the number of bits to be transmitted for each carrier signal , based on the s / n of each carrier signal , to output a bitmap b - next for a next duration and a bitmap b - fext for a fext duration . the adsl modem in the remote terminal calculates a transmitting capacity based on the b - next and the b - fext . that is , based on the fact that the value in the b - fext duration is the number of bits to be transmitted which can be received during r - fext durations only , and the value in the b - next duration is the number of bits to be transmitted which can be received in all durations , the following two values are obtained : then the larger transmitting capacity is selected by communication between the central office and the remote terminal . here the method to transmit data in all durations by using the bitmap b - next is referred to as the standard method ; and the method to transmit data only during r - fext durations is referred to as sliding window bitmap ( hereinafter referred to as swb ) method . fig7 is a graph showing the transmitting capacity in the standard method and in the swb method . the solid curve in the figure represent the standard method ; and the dashed curve represents the swb method . as shown in fig7 , under an environment where there is a tcm cross - talk , when the standard method is employed , the longer the length of the line becomes , the larger the influence of the next ; in contrast , when the swb method is employed , even though the transmitting capacity is not high when the line is short , the transmitting capacity is not largely lowered even when the length of the line becomes large . when the line length is l , the transmitting capacity according to the standard method is the same as the transmitting capacity according to the swb method . therefore , it is preferable to select the standard method when the line length is shorter than the length l , and to select the swb method when the line length is longer than the length l . fig8 shows a transmitting dmt symbols according to the standard method and the swb method . in fig8 , ( 1 ) shows the reference signal of 400 hz ; ( 2 ) shows the next durations and fext durations at the central office ; ( 3 ) shows dmt symbols transmitted from the central office according to the standard method ; ( 4 ) shows dtm symbols x obtained by the b - next bitmap ; and ( 5 ) shows dmt symbols y obtained by the b - fext bitmap . according to the swb method , the transmitting side slides the window so as to allocate transmitting bits to each carrier signal only when the transmitting side is in the c - next durations , that is , only when the receiving side is in the r - fext durations , and the receiving side slides the window to demodulate the received data during the r - fext durations , as shown in ( 5 ) of fig8 . further , the transmitting signal of a dmt symbol outside the sliding window may be a pilot tone for a timing synchronization , and the other carrier signal may be any signal . fig9 shows a transmitting signal pattern transmitted from the central office according to the swb method . in fig9 , ( 1 ) shows the reference clock signal of 400 hz ; ( 2 ) shows the fext durations and the next durations at the remote terminal ; and ( 3 ) shows the transmitting signal pattern transmitted from the central office . the adsl modem in the central office generates one super frame by 69 dmt symbols . in the 69 - th dmt symbol , a synchronizing symbol s indicating the boundary of the super frame is inserted . the synchronizing symbol s does not include user data . the adsl modem transmits the above - mentioned super frames . according to the swb method , five super frames form a single unit . the time duration of the single unit is made to coincide with an integer multiple of the time duration ( 2 . 5 ms ) of one cycle of the reference clock signal of 400 hz shown in ( 1 ). in order to allow the remote terminal to recognize the fifth super frame as a boundary of the super frames , the fourth synchronizing symbol s is inverted in the central office to be an inverted synchronizing symbol i . thus the signal point of the inverted synchronizing signal i is different by 180 ° from the signal point of the synchronizing signal s . by sending the inverted synchronizing signal i in the position of the fourth synchronizing symbol , the remote terminal can receive this inverted synchronizing signal i in an r - fext duration so that the remote terminal can surely establish a synchronization of its own swb with the swb of the central office . fig1 shows a transmitting signal pattern transmitted from the remote terminal according to the swb method . in fig1 , ( 1 ) shows the reference signal of 400 hz ; ( 2 ) shows the next durations and the fext durations at the central office ; and ( 3 ) shows the transmitting signal pattern transmitted from the remote terminal . the transmitting signal pattern transmitted from the remote terminal is similar to that transmitted from the central office . that is , sliding windows are formed to allow the central office to receive signals during its fext durations . similar to the central office , the remote terminal also generate a single unit consisting of five super frames . in order to allow the central office to recognize the boundary of the five super frames , the first synchronizing symbol is inverted in the remote terminal to be an inverted synchronizing symbol i . thus the signal point of the inverted synchronizing signal i is different by 180 ° from the signal point of the synchronizing signal s . by sending the inverted synchronizing signal i in the position of the first synchronizing symbol , the central office can receive this inverted synchronizing signal i in a fext duration so that the central office can detect that the remote terminal is correctly in synchronization according to the swb method . fig1 shows how to define the r - next duration and the r - fext duration when a signal of 400 hz is transmitted during data communication . during data communication , when all of the samples in a dmt symbol other than the cyclic prefix are within an fext duration , the dmt symbol is defined as the dmt symbol in the r - fext duration . in the other cases , the dmt symbol is defined as a dmt symbol in an r - next duration . the defined durations include the round trip delay mentioned before and a system margin . when the first dmt symbol is synchronized with the head of one cycle of the reference signal of 400 hz , the determination of whether n - th symbol belongs to the r - fext duration or the r - next duration can be performed as follows . it is assumed that there are 2760 samples in one cycle of the reference clock signal of 400 hz , as shown in ( 1 ) of fig1 . also , each symbol is assumed to have 272 samples during communication , as shown in ( 3 ) of fig1 . then a parameter s is defined as : if { s & lt ;( a − 272 )} or { s + 16 & gt ;( a + b )} is satisfied , then it is judged that the n - th symbol belongs to a fext duration ( b duration ). if {( a − 272 )≦ s } and { s + 16 ≦( a + b )} are satisfied , then it is judged that the n - th symbol belongs to an r - next duration ( a duration ). fig1 is a diagram showing a method for modified sliding window transmission system according to an embodiment of the present invention . as shown in fig1 , two dmt symbols x as outside of sliding window and y as inside of sliding window according to two bitmaps are employed . the dmt symbols x according to the first bitmap is used in the r - next durations . the dmt symbols y according to the second bitmap is used in the r - fext durations . | 7 |
reference will now be made in detail to various embodiments of the present invention ( s ), examples of which are illustrated in the accompanying drawings and described below . while the invention ( s ) will be described in conjunction with exemplary embodiments , it will be understood that present description is not intended to limit the invention ( s ) to those exemplary embodiments . on the contrary , the invention ( s ) is / are intended to cover not only the exemplary embodiments , but also various alternatives , modifications , equivalents and other embodiments , which may be included within the spirit and scope of the invention as defined by the appended claims . certain aspects of an injector according to the present invention are similar to that of a conventional injector . therefore , the same reference numerals are used for representing the same constituent elements . as shown in fig1 , the injector according to various embodiments of the present invention includes a needle 30 disposed in a housing 10 , and the needle 30 is adapted to move in the housing 10 reciprocally . in order to move the needle 30 reciprocally , an electromagnet is provided at an upper portion of the housing 10 . if current is applied to the electromagnet the needle 30 moves upwardly , and if current is not applied to the electromagnet the needle 30 moves downwardly and contacts with a needle seat 20 . in addition , a fuel passage is formed in the housing 10 . the fuel passage is always communicated with a fuel supply passage provided at an outside of the injector so as to receive fuel . fig4 illustrates arrangement of nozzle holes in an injector according to various embodiments of the present invention . as shown in fig4 , a plurality of first and second nozzle holes 42 and 44 is formed at the housing 10 under the needle seat 20 . the first and second nozzle holes 42 and 44 are selectively communicated with the fuel passage by reciprocal motion of the needle 30 . therefore , the fuel in the fuel passage is selectively injected to a combustion chamber through the first and second nozzle holes 42 and 44 . in order for the fuel passing through the first and second nozzle holes 42 and 44 to have different spraying characteristics , k factors of the first and second nozzle holes 42 and 44 are different from each other . that is , the first nozzle hole 42 has a first k factor , the second nozzle hole 44 has a second k factor , and the first k factor and the second k factor are different . for example , the first k factor is smaller than the second k factor . in this case , the fuel injected through the first nozzle hole 42 has short penetration length but spreads widely . therefore , the fuel is mixed with air well . thus , the fuel injected through the first nozzle hole 42 may improve emission at a partial load condition . in addition , the fuel injected through the second nozzle hole 44 has long penetration length , and thereby sufficient output may be obtained at middle load condition or high load condition . in addition , the first and second nozzle holes 42 and 44 are disposed alternately . further , the first and second nozzle holes 42 and 44 are disposed at an exterior circumference of the housing 10 having the same radius r . if the first and second nozzle holes 42 and 44 are disposed at the exterior circumference of the housing 10 having the same radius r , a distance from the needle seat 20 to the first nozzle hole 42 is the same as that from the needle seat 20 to the second nozzle hole 44 . this means that moving distances of the fuel for passing through the first and second nozzle holes 42 and 44 are the same . therefore , fuel amount passing through the first nozzle hole 42 is almost the same as that passing through the second nozzle hole 44 . therefore , effects of the injector according to various embodiments of the present invention are produced at an entire driving condition . fig5 a illustrates fuel spray x when the fuel is injected through a conventional injector having one k factor , and fig5 b illustrates fuel sprays x 1 and x 2 when the fuel is injected through the injector according to various embodiments of the present invention having two k factors . if the fuel is injected through a conventional injector , a plurality of fuel sprays x has almost the same shape . therefore , the fuel spray x spreads widely and may be overlapped with each other in a case that the fuel is injected through a conventional injector having small k factor . on the contrary , spaces between the fuel sprays x may be large in a case that the fuel is injected through a conventional injector having large k factor . therefore , utilization rate of air may be lowered . however , a first fuel spray x 1 injected through the nozzle hole having small k factor spreads widely and increases utilization rate of air , and a second fuel spray x 2 injected through the nozzle hole having large k factor is stretched long and generates sufficient output in a case that the fuel is injected through the injector according to various embodiments of the present invention . in addition , since the first fuel spray and the second fuel spray spread toward different portions of the combustion chamber , the first fuel spray and the second fuel spray are not overlapped with each other . therefore , generation of soot may be reduced , utilization rate of air and mixing rate of air and fuel may increase , and fuel economy may be improved according to various embodiments of the present invention . as described above , since fuel sprays injected through a plurality of nozzle holes having different k factors spreads toward different portions of a combustion chamber , utilization rate of air may increase according to various embodiments of the present invention . therefore , emission may be reduced , fuel economy may be improved , and sufficient output may be produced . since fuel sprays are not overlapped with each other , generation of soot may be prevented . for convenience in explanation and accurate definition in the appended claims , the terms upper and etc . are used to describe features of the exemplary embodiments with reference to the positions of such features as displayed in the figures . the foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teachings . the exemplary embodiments were chosen and described in order to explain certain principles of the invention and their practical application , to thereby enable others skilled in the art to make and utilize various exemplary embodiments of the present invention , as well as various alternatives and modifications thereof . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents . | 5 |
referring to fig1 a and 1b , one example embodiment of an arrangement for reducing the dead volume of a sample container 100 is illustrated . fig1 a depicts a first low pressure configuration for an arrangement disclosed . fig1 b depicts a second high pressure state of the arrangement disclosed in fig1 a . in the illustrated embodiment , the arrangement disclosed is used in a downhole sampling apparatus used in well services for the petroleum industry . although the arrangement described is used in a downhole sampling apparatus , the arrangement may be used in other sampling environments , such as in a laboratory setting or other industrial sampling situations where accuracy is important and the potential for contamination or dilution of the fluid stream is possible . a sample line 102 is configured to transport fluid from a source to the sample container 100 . in the example embodiment , the fluid transported is a petroleum fluid and the source of the fluid is found in geological stratum in a downhole environment . the fluid may be , for example , black oil or condensates of natural gas , as non - limiting examples . the fluid being sampled may be obtained through a probe placed in close proximity to the geological stratum where a pump module draws a vacuum , causing fluid to enter the probe and ultimately into the sample line 102 . additionally , the fluid being sampled may be obtained through a focused sampling packer . the sample line 102 may be insulated to keep the fluid in the same state , including pressure and temperature as much as possible to the sampling conditions . the sample line 102 may connect to other sample lines throughout a string of tools , such as downhole tools or laboratory equipment so the sampled fluid may be provided to different configurations for appropriate testing . in sample containers , for example , a significant dead volume exists . this dead volume , in the form of a volume of material in sampling lines prior to the sampling container , may contain water and / or oil . when a sampled fluid enters the sample line 102 and enters the dead volume , the sampled fluid is mixed with the fluid contained in the dead volume . contaminants may be introduced into the sampled fluid affecting overall testing results . additionally , in the case of pure water being in the sample line , the pure water will dilute the sample fluid , again affecting overall results . reduction of this sampled fluid mixing with dead volume fluid will increase the accuracy of results . one alternative example embodiment used to reduce dead volume fluid in the sample line 102 is to use a flow restrictor 106 in the sample line 102 . the flow restrictor 106 may be , for example , an expandable balloon . the flow restrictor , as illustrated in fig1 a , is fully inflated in times of relatively low pressure . the full inflation of the flow restrictor 106 prevents fluid from occupying through the dead volume area of the sample line 102 , thereby minimizing the mixing of fluids between sampled fluids and fluids in the dead volume . under times of higher pressure , as provided in fig1 b , the flow restrictor 106 is configured to deflate , thereby allowing fluid to flow along the sample line 102 . this deflation allows sampling to occur during times of higher pressure , when a downhole tool is configured to be experiencing inflow . the deflation may be automatic after reaching a predefined pressure in the sample line 102 or may be done through actuation through an operator . in the illustrated embodiment , the deflation occurs automatically as the control equipment required for operator initiated deflation is deleted for clarity of illustration . in another example embodiment , the flow restrictor 106 may be membrane material that is spring energized such that the spring force , per hooke &# 39 ; s law , is constant and that higher pressure values in the sample line 102 would cause additional deflection of the flow restrictor 106 , causing a greater flow path area . in relatively low pressure environments , the spring steel strength causes the membrane to remain in contact with the walls of the sample line 102 , therefore the dead volume is occupied and contamination is minimized . the flow restrictor 106 may be constructed from a high grade spring steel , for example , where the deflection capabilities are well known . in this embodiment , the membrane may be a fluid impervious material to prevent flow of fluids , thus the flow of fluids only occurs when deflection of the spring occurs . in either embodiment , a valve 104 may be placed in the sample line 102 . the valve 104 may be any kind of valve that would prevent fluid from flowing through the sample line 102 . the valve 104 may be electronically activated to allow an operator the ability to select when fluid flow should occur through the sample line 102 . in another example embodiment , inert particles may be placed within the sample line 102 such that the inert particles occupy volume in the sample line 102 . the inert particles may be kept in place by appropriate stops placed along the sample line . the inert particles may be placed in a container or membrane that allows fluid to flow through but retains particles within the container ; or particles can be used without a container or membrane to allow particles follow the flow of fluid into the sample container 100 ( to avoid plugging the flowline ). the inert particles may be tightly packed or loosely packed or , in an alternative configuration , the inert particles may be graded such that amount of flow path area is restricted to an even greater amount . the particles may be placed in the line for several sampling ( if contained by a membrane ) operations or may be a single use arrangement ( if not contained ). the particles may be spherical , as a non - limiting embodiment . referring to fig2 , an arrangement 200 for sampling fluids is illustrated . the arrangement 200 has an entry port 202 that allows fluid that is desired to be sampled into the arrangement 200 . for the sake of clarity , the fluids , similar to the embodiment described in fig2 , are from a downhole environment , although the fluids may be obtained in other environments . the piston 204 in the sample bottle may be configured to move through piston seals 206 that contact the remainder of the bottle . the movement of the piston movement may allow for a vacuum to be drawn , thereby causing fluids to enter the bottle . in the illustrated embodiment , two bottle ball valves 208 are present . a plunger 210 may be used to occupy the dead space in the sample line between the entry port 202 and the bottle ball valve 208 . this plunger 210 may be inserted or withdrawn , thereby occupying space or , in the case of withdrawal , allowing space . the plunger 210 may be activated by an operator , as desired . the plunger 210 may occupy all of the space between the entry port of the bottle ball valve or , in an alternative configuration , a portion of the dead volume between the entry port 202 and the bottle ball valve arrangement 208 . the plunger 210 may be operable from a first fully inserted position to a second fully removed position . when fully inserted , the plunger 210 inside o - ring 208 blocks the fluid passage to the bottle . when the plunger is retracted , partially or all the way to restriction 209 if it occupies the full passage cross - section , fluid in the entry port 202 is allowed to come in contact with piston 204 . a pump may then push the fluid into the sample chamber 200 displacing piston 204 , or vacuum can be applied to the opposite side of piston 204 , displacing it inside the sample chamber 200 forcing the fluid to be sampled into chamber 200 . it can be appreciated that the plunger 210 takes most of the dead volume between entry port 202 and the face of the sampling bottle piston 204 . referring to fig3 , an arrangement 300 is disclosed for sampling fluids , wherein the arrangement 300 has a minimum of dead volume , maximizing accuracy of sampling . a top end of the piston rod 302 is configured with a blank end so that fluid may not pass through the top end 302 when it is aligned with the sample line 308 . the piston rod 310 is further configured with a sample port 304 and a by - pass / flush line 306 . the piston rod 310 is movable through a series of positions . in the fully retracted position , the top end 302 of the piston rod 310 is aligned with the sample line 308 preventing materials from entering the sample bottle and eventually sample chamber 314 . the piston rod 310 is movable through a nitrogen piston 316 that is placed within a nitrogen chamber 318 . though action of the nitrogen piston 316 , the piston rod 310 moves between the various series of positions where either the top end 302 of the piston , the sample port 304 or the by - pass / flush line 306 are aligned with the sample 308 . when the sample port 304 is aligned with the sample line 308 fluid may enter the piston rod 310 and pass down through to the sample chamber 314 for storage . further activation of the piston rod 310 will cause the sample bottle to be closed , preventing fluid from escaping from the sample chamber 314 . an admission control valve 320 is positioned at the opposite end of the top end 302 for allowing extraction of the fluid sample in the sample chamber 314 . referring to fig4 , an expanded view of the piston rod end is illustrated . in the expanded view 400 , the bypass - flush line 306 is aligned with the sample line 308 so that fluid passes through the piston rod 310 without entering the sample chamber 314 . referring to fig5 , an expanded view of the piston rod end is illustrated in a sampling configuration . in this position for the embodiment , the piston rod 310 position allows fluid to enter the sample port 304 which then travels down the piston rod 310 to the sample bottle 414 . a seal 412 is provided on the sample bottle to allow the fluid to be retained in the sample bottle . referring to fig6 , an expanded view of the piston rod end is illustrated in a sealed configuration . in this position for the embodiment , the piston rod 310 position is fully inserted into the bottle to trap fluid within the sample bottle 414 . referring to fig7 , an arrangement 700 is presented for limiting dead volume for a sample bottle 714 . in the illustrated embodiment , a washer 704 prevents movement of the piston rod past a specific point . the washer 704 allows the sample port 712 to align with the sample line 706 so that fluid may enter the sample port 712 and be transferred down into the sample bottle 714 . fluid is kept in the sample bottle 714 through a sample bottle seal 708 . the washer 704 , although shown as a single washer , may be a series of washers to allow for step - wise insertion of the piston . the washer 704 may be selectively eliminated by an operator , so that a step progression of the piston occurs . elimination may be accomplished by successive burning of the washers 704 . burning may occur through imposition of an electric charge on the washer . the control wiring to accomplish this electric charge is omitted for clarity of illustration . a flared end 702 prevents the piston from entering the bottle after elimination of the last washer 704 . a bypass / flow line 710 is present in the piston to allow for flow to bypass the sample bottle 714 as necessary . referring to fig8 , a side view of a sample chamber with a piston rod 808 that is flush with the flowline 804 of a modular sample bottle formation tester 800 . the piston rod 808 in the illustrated configuration is movable . the flow line 804 may have a valve 802 installed to limit or increase flow as desired . a gasket 806 or sealing device may abut the piston rod 808 to prevent flow from escaping or entering the back chamber . the valve 802 closing may cause a back pressure sufficient to allow movement of the piston rod 808 and consequently flow into the bottle . the process may be reversible such that the piston rod 808 may reciprocate back once the pressure diminishes . the piston rod 808 may be kept in place through spring actuation , as a non - limiting embodiment . while the aspects has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the disclosure herein . | 4 |
fig1 is a schematic pictorial illustration of a medical system 20 , in accordance with an embodiment of the present invention . system 20 comprises a probe 30 , such as a catheter , which is adapted to be inserted into an internal body cavity , such as a chamber of a heart 40 , of a subject 50 . typically , the probe is used by a practitioner 60 for one or more medical diagnostic or therapeutic functions , such as intra - cardiac electrocardiography ( ecg ), mapping electrical potentials in the heart , performing ablation of heart tissue , or other medical functions . in order to facilitate effective application of the medical procedure , system 20 is adapted to determine the position of probe 30 within the body of the subject . the position of the probe , along with other diagnostic and / or therapeutic data , is typically displayed to practitioner 60 on monitor 70 , or presented by means of other suitable media . the distal tip of probe 30 comprises a plurality of electrodes 80 , 82 and 84 , referred to herein as probe - electrodes . the probe - electrodes are connected by wires through the insertion tube of probe 30 to a control unit 100 , which comprises first circuitry adapted to determine the position of the probe within the subject &# 39 ; s body and second circuitry adapted to perform one or more diagnostic or therapeutic functions . the first and second circuitries are referred to herein as the positioning and functional circuitries , respectively , and are shown in detail in the figures that follow . the term functional refers herein to one or more medical diagnostic or therapeutic functions of system 20 ( e . g ., measurement and mapping of cardiac electrical signals ). one or more of the probe - electrodes ( referred to herein as the positioning probe - electrodes ) are coupled to the positioning circuitry , while one or more of the probe - electrodes ( referred to herein as the functional probe - electrodes ) are coupled to the functional circuitry . typically , the same probe - electrodes are utilized both for positioning and for medical diagnostic or therapeutic functions . therefore , the first and second sets of electrodes typically overlap . however , in some cases , the two sets of electrodes may be disjoint . control unit 100 is further connected by wires through one or more cables 105 to a plurality of body - surface electrodes 110 , 112 , 114 , 116 , 118 , and 120 , which are coupled to a body - surface ( i . e ., the skin ) of the subject . the body - surface electrodes typically comprise adhesive skin patches . in alternative embodiments of the invention , the body - surface electrodes may vary in number and may take other forms . the body - surface electrodes comprise a set of first body - surface electrodes 110 , 112 , and 114 , referred herein as positioning body - surface electrodes , which are coupled to the positioning circuitry . the body - surface electrodes may additionally comprise one or more second body - surface electrodes 116 , 118 , and 120 , referred herein as functional body - surface electrodes , which are connected to the functional circuitry . typically , the two sets of body - surface electrodes are disjoint , but in some cases , the two sets may overlap . the positioning circuitry of the control unit is adapted to drive and measure electric currents , referred herein as positioning - currents , between the positioning probe - electrodes and the positioning body - surface electrodes . responsive to the measured positioning currents , a positioning processor ( shown in fig2 ), which is typically incorporated within control unit 100 , estimates the coordinates the distal end of probe 30 within the body . the positioning processor typically comprises a general - purpose computer processor , which is programmed in software to estimate the probe coordinates according to methods described in the above - cited patent application publications 2006 / 0173251 and 2007 / 0038078 . additionally or alternatively , the positioning processor may employ other suitable positioning methods . probe coordinate estimation is typically based on correspondence between positioning currents and respective distances of intra - body paths . for example , we may denote the distances from probe electrode 80 to body - surface electrodes 110 , 112 , and 114 by d 1 , d 2 , and d 3 , respectively , and denote the positioning currents from probe electrode 80 to body - surface electrodes 110 , 112 , and 114 by i 1 , i 2 , and i 3 , respectively . according to methods described in the above - cited patent applications , the ratio of distances d 1 : d 2 : d 3 can be estimated based on the ratio of currents i 1 : i 2 : i 3 . the coordinates of probe electrode 80 can than be derived from the estimated ratio d 1 : d 2 : d 3 . since probe coordinates calculation rely on positioning currents between related electrodes , it is desirable that the positioning currents not be influenced by electrical coupling with non - related electrodes . for example , if the ratio i 1 : i 2 : i 3 varies due to electrical coupling with functional probe - electrode 82 , the ratio d 1 : d 2 : d 3 might be incorrectly estimated . methods according to embodiments of the present invention , which are described hereinbelow , facilitate eliminating or reducing the effect of the functional electrodes on the positioning currents , thus enabling accurate and reliable positioning of probe 30 within the subject &# 39 ; s body . fig2 is a schematic diagram , showing interaction between probe - electrodes and body - surface electrodes , and associated circuitries thereof , in accordance with an embodiment of the present invention . as noted above , control unit 100 ( not shown explicitly in fig2 ) comprises positioning circuitry 200 , a positioning processor 205 , and functional circuitry 210 . positioning circuitry 200 comprises one or more positioning probe front - ends ( e . g ., front - ends 220 and 222 ), and each positioning probe front - end is coupled to a positioning probe - electrode ( e . g ., probe - electrodes 80 and 82 ). positioning probe front - end typically comprises a high impedance driver ( such as is shown below in fig6 ), which drives positioning currents between respective positioning probe electrode and a plurality of positioning body - surface electrodes . for example , positioning probe front - end 220 drives positioning currents i 1 , i 2 and i 3 between probe electrode 80 and body - surface electrodes 110 , 112 , and 114 , respectively . the impedance of positioning probe front - end 220 is typically much higher than the impedance of a path through a human body , and therefore positioning probe front - end 220 is approximately a current source . for example , a typical impedance of a path through a human body is 100 ohm , and the output impedance of a positioning probe front - end is typically higher than 100 , 000 ohm . the positioning currents are typically ac currents , for example ac currents in the range of 100 - 110 khz . therefore , the term impedance refers herein to impedance measured over the frequency range of the positioning currents , for example impedance measured over the range of 100 - 110 khz . positioning circuitry 200 also comprises current - sensing devices 230 , 232 and 234 , which are coupled to positioning body - surface electrodes 110 , 112 and 114 , and measure the respective positioning currents i 1 , i 2 , and i 3 . in alternative embodiments of the invention , the positioning currents may be measured by a single current - sensing device , by means of time multiplexing . based on the positioning currents i 1 , i 2 , and i 3 , positioning processor 205 calculates the coordinates of positioning probe - electrode 80 within body 50 , according to methods described in the above - cited patent applications , or according to other suitable current - based positioning methods . functional circuitry 210 of the control unit comprises one or more functional probe front - ends 240 and 242 , which are coupled to functional probe - electrodes 80 and 82 , respectively . functional circuitry 210 may also comprise one or more functional body - surface front - ends ( e . g ., a body - surface front - end 250 ), which are coupled to functional body - surface electrodes ( e . g ., functional body - surface electrode 120 ). in cases in which functional circuitry 210 comprises ecg circuitry , the body - surface electrode attached to the right leg of the subject serves typically as a common reference for differential ecg measurements . in those cases , the right leg electrode is typically coupled to the ground of the ecg circuitry via impedance on the order of 10 , 000 ohm . usually , grounds of distinct circuits of an electrical system are highly coupled , since all circuits of the same system are typically fed , directly or indirectly , by the same power source ( e . g ., the mains ). furthermore , it is a common practice to connect the grounds of all circuits of an electric system to one common ground . for example , all circuits that are implemented on the same printed circuit board ( pcb ) are typically connected to the same one or more ground layers of the pcb , all ground layers of all pcbs are typically connected to the system chassis , and the system chassis is typically connected to the mains ground . however , in embodiments of the present invention , positioning circuitry 200 and functional circuitry 210 are connected to distinct grounds 260 and 270 , respectively , and ground 260 is deliberately isolated from ground 270 . typically , ground 270 is implemented as one or more ground layers of one or more pcbs , which are connected to a system common ground , for example to the system chassis ; while ground 260 is implemented as a dedicated return path , which is isolated from the respective pcbs ground layers , and from the system common ground . isolating of ground 260 , according to embodiments of the present invention , is employed in order to maintain the validity and accuracy of the positioning process , as elaborated hereinbelow . in some embodiments of the present invention , isolated grounds 260 and 270 are further coupled by an inter - ground coupling impedance 280 ( e . g . a capacitor ), in order to eliminate or reduce the effect of parasitic couplings on the validity and accuracy of the positioning process , as elaborated further below . fig3 , 4 , and 5 are schematic electric diagrams , illustrating the potential influence of functional electrodes on positioning currents , in accordance with embodiments of the present invention . fig3 illustrates the effect of functional probe - electrode 82 on positioning currents i 1 , i 2 , and i 3 , which flow between positioning probe - electrode 80 and body - surface electrodes 110 , 112 , and 114 , respectively ( on the assumption that there is coupling between grounds 260 and 270 ). positioning currents i 1 , i 2 , and i 3 are driven by front - end 220 , and are measured by measurement devices 230 , 232 , and 234 , respectively . we denote the intra - body distances between probe - electrode 80 and body - surface electrodes 110 , 112 , and 114 , by d 1 , d 2 , and d 3 , respectively , as noted above . ( d 1 , d 2 , and d 3 are not shown in the figure ). the respective intra - body paths between the probe - electrode and body - surface electrode are denoted by p 1 , p 2 , and p 3 , and the respective intra - body impedances by z 1 , z 2 , and z 3 . positioning currents i 1 , i 2 , and i 3 are essentially proportional to respective impedances z 1 , z 2 , and z 3 , which are dependent on respective distances d 1 , d 2 , and d 3 , and this dependency provides the basis for the operation of the positioning processor . since functional probe - electrode 82 is also located within the body of the subject , there are inevitable electric coupling paths between electrode 82 and paths p 1 , p 2 , and p 3 . fig3 shows a coupling path z 4 between functional probe electrode 82 and an intermediate point 300 on path p 1 . similarly , there are coupling paths between probe electrode 82 and intermediate points on paths p 2 and p 3 . intermediate point 300 is illustrated in fig3 as breaking z 1 into two impedances z 1 a and z 1 b , wherein z 1 a + z 1 b = z 1 . this illustration is a simplified model of a typically much more complicated model , but it is helpful in illustrating the effect of the coupling between the functional probe electrodes and the positioning currents . if ground 260 of the positioning circuitry were coupled to ground 270 of the functional circuitry as in systems known in the art , there would be undesired currents that flow between positioning probe - electrode 80 and ground 260 , via functional probe - electrode 82 . the undesired currents change the desired positioning currents , and degrade the accuracy of the positioning process . for example , if front - end 220 comprises a current source , the undesired currents reduce the desired positioning currents , but each current is typically reduced by a different amount due to geometrical and physiological factors . consequently , the ratio of currents i 1 : i 2 : i 3 changes , thus reducing the accuracy of the position measurement . however , according to an embodiment of the present invention , ground 260 is isolated from ground 270 , and therefore undesired currents cannot flow via functional probe - electrode 82 . as a result , the positioning currents are not changed , and the validity and accuracy of the positioning process are maintained , regardless of the functional probe - electrodes . fig4 illustrates an embodiment in which the functional circuitry comprises ecg circuitry , and front - end 250 is coupled to electrode 120 , which is placed on the subject &# 39 ; s right leg . since right - leg ecg electrode 120 and positioning electrodes 110 , 112 , and 114 are all coupled to the skin , there is inevitable electrical coupling between electrode 120 and electrodes 110 , 112 , and 114 . ( for the sake of simplicity , only the coupling with electrode 110 is shown in the figure .) consequently , there is a parasitic electrical coupling between path p 1 and ground 260 , via functional probe - electrodes 82 and 84 , functional probe front - ends 240 and 242 , right - leg front - end 250 , and right - leg electrode 120 . ( similar coupling mechanisms , not shown in the figure , apply also to other paths , e . g ., paths p 2 and p 3 ). however , since the impedance of right - leg front - end 250 is typically about 10 , 000 ohm , the impedance of the parasitic coupling through right - leg electrode 120 is always above 10 , 000 ohm , regardless of the numbers of functional probe electrodes . consider , for example , the case of forty functional probe - electrodes , and assume that the impedance of each functional probe front - end is about 10 , 000 ohm . the collective impedance of the forty functional probe electrodes and their associated front - ends is 10 , 000 / 40 = 250 ohm . this low collective impedance could interfere significantly with the positioning process . however , since the impedance of right - leg front - end 250 is 10 , 000 ohm , and grounds 260 and 270 are isolated from one another , the overall parasitic impedance is as high as 10 , 250 ohm , and has minor effect on the positioning process . fig5 presents an embodiment of the present invention in which grounds 260 and 270 , which are deliberately isolated from each other , are further coupled by predetermined inter - ground coupling impedance 280 , typically implemented by a capacitor . the goal of the inter - ground coupling impedance is to reduce the influence of possible parasitic coupling , as explained hereinbelow . in typical configurations of system 20 , there might be parasitic couplings between ground 270 and positioning body - surface electrodes 110 , 112 and 114 . two such couplings , denoted by z 10 and z 12 , are shown in the figure . additionally , there might be parasitic couplings between ground 270 and measurement devices 230 , 232 , and 234 . two such coupling , denoted by z 20 and z 22 , are shown in the figure . parasitic couplings such as z 20 and z 22 might be caused , for example , by parasitic capacitance between the positioning circuitry ( e . g ., measurement devices 230 and 232 ) and the one or more ground layers of the pcbs . the parasitic couplings modify the readings of the measurement devices , and therefore degrade the accuracy of the positioning process . for example , parasitic couplings z 10 and z 20 ( z 12 and z 22 ) enable flow of parasitic current from positioning probe - electrode 80 , via functional probe - electrode 82 , to measurement device 230 ( 232 ), respectively , and thus increase the reading of the measurement device and degrade the accuracy of the ratio i 1 : i 2 : i 3 . in the embodiment shown in fig5 , the undesired effect of parasitic couplings , such as z 10 , z 11 , z 20 , and z 21 , is reduced by introducing inter - ground coupling impedance 280 between grounds 260 and 270 . the coupling impedance 280 is typically selected to be considerably lower than the values of the parasitic impedances z 10 , z 11 , z 20 , and z 21 . consequently , most of the parasitic currents flow through inter - ground coupling impedance 280 , and the parasitic currents trough the measurements devices are reduced accordingly . on the other hand , inter - ground coupling impedance 280 should be selected to be considerably higher than intra - body impedances z 1 , z 2 , and z 3 , in order to maintain the benefit of the isolation between grounds 260 and 270 , as elaborated above . in a typical system , the best value of the inter - ground coupling impedance to yield maximal accuracy of the positioning process , may be determined empirically . determining the value is facilitated by the fact that the overall accuracy of the positioning process is typically a concave function of the coupling impedance . for example , in a typical system , the total parasitic coupling is about 5 , 000 ohm , and the typical intra - body impedances are about 100 ohm . for such system , the value for the inter - ground coupling impedance should typically be about 1 , 000 ohm . fig3 , 4 , and 5 address the potential influence of functional probe - electrodes ( e . g ., probe - electrode 82 ) on positioning currents flowing through a positioning probe - electrode ( e . g ., probe - electrode 80 ). in principle , there might also be similar undesired influence of a first positioning probe - electrode on the positioning currents flowing from a second positioning probe - electrode . returning to fig2 , functional probe - electrode 82 is also a positioning probe - electrode , and is also coupled to positioning probe front - end 222 . therefore , undesired parasitic currents might in principle flow from positioning probe - electrode 80 , via positioning probe - electrode 82 and positioning front - end 222 , to ground 260 . however , since the impedance of positioning - probe front - end 222 is typically much higher than intra - body impedances z 1 , z 2 , and z 3 ( shown in fig3 ), the effect of coupling between positioning probe - electrodes is minor . for example , the impedance of positioning probe front - end 222 is typically above 100 , 000 ohm , while the values of intra - body impedances z 1 , z 2 , and z 3 are typically about 100 ohm . fig6 is a schematic electrical diagram , showing a typical implementation of positioning probe front - end 220 , in accordance with an embodiment of the present invention . front - end 220 typically comprises an isolation transformer 400 , whose primary winding is fed by an operational amplifier 410 driven by an ac source 420 , and whose secondary winding is coupled to positioning probe - electrode 80 and to ground 260 via resistors 430 and 440 , respectively . the impedance of resistors 430 and 440 is typically much higher than that of the subject &# 39 ; s body . for example , the impedance of resistors 430 and 440 is typically on the order of 60 , 000 ohm , while the typical impedance of the human body is typically on the order of 100 ohm . the primary winding of transformer 400 is coupled to common ground 270 , while the secondary winding is coupled to positioning circuitry ground 260 , which is isolated from common ground 270 . consequently , front - end 220 introduces no galvanic coupling between grounds 260 and 270 . there might be some parasitic capacitance between the secondary winding of transformer 400 and ground 270 , but the high value of resistor 440 reduces the effect of such parasitic capacitance , and front - end 220 maintains the isolation between grounds 260 and 270 . due to this isolation , the functional probe - electrodes do not affect the positioning currents flowing from the positioning probe - electrodes , and the accuracy of the positioning process is maintained . isolation transformer 400 can be further adapted to step up the voltage produced by amplifier 410 to a level suitable for driving the positioning currents , by appropriate selection of the ratio between the windings . as a typical example , transformer 400 may be adapted to step up the primary voltage by a factor of five , from 20 volts to 100 volts . it will thus be appreciated that the embodiments described above are cited by way of example , and that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and sub - combinations of the features described hereinabove , as well as variations and modifications thereof which would occur to persons skilled in the art upon reading the foregoing description and which are not disclosed in the prior art . | 0 |
illustrative embodiments of the invention are described below . while the invention is susceptible to various modifications and alternative forms , specific embodiments thereof have been shown by way of example in the drawings and are herein described in detail . it should be understood , however , that the description herein of specific embodiments is not intended to limit the invention to the particular forms disclosed , but on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the appended claims . it will of course be appreciated that in the development of any such actual embodiment , numerous implementation - specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as compliance with system - related and business - related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time - consuming , but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . as used herein , and as indicated in fig6 a , 6b , 6c , and 6d , the following terms are defined : in conventional cyclic adsorption process , the cycle time is determined by the mass and heat transfer rates of targeted gases into pores of adsorbent pellets or beads . these mass and heat transfer rates are a primary limiting fact for increasing bed productivity . due to low heat transfer in and out of granular adsorbent , conventional tsa operation normally prohibits its cycle process from operating at much short time . besides , the maximum gas space velocity inside the bed is restricted by the pressure drop and often by the bed fluidization limit . these are long - standing problems with the conventional adsorbent bed , and much pronounced when applied to large volume of process streams at near ambient pressure . the ways to overcome these problems described above are to use a structured adsorbent packing . structured adsorbents are well known in the art . for example , a thin laminated adsorbent sheet structures was fabricated by web coating slurried adsorbent mixture onto suitable support materials for psa applications . but it is limited in the density of adsorbent material achievable in the laminate as a result of the search of high kinetics , meaning very small thickness as explained below . in general , the characteristic heat and mass transfer time is proportional to the square of distance of mass and thermal transfer : where t h and t m are characteristic heat and mass transfer time . d h and d m are thermal and mass diffusivities , and h and l are transport distances . therefore , reducing the thickness of adsorbent layer improves heat and mass transfer rates . the mass and heat transfer rates increase in the structured adsorbent are not only due to the use of a thin layer of coated adsorbent but are also contributed by lowing gas flow boundary layer thickness along the channels . the mass transfer of adsorption molecules and heat flow from a gas phase to an adsorbed phase controlled by several steps , which include ( 1 ) diffusion in gas phase ; ( 2 ) resistance from boundary layer ; ( 3 ) macro - porous diffusion inside adsorbent ; and ( 4 ) micro - porous diffusion in adsorbent . in conventional adsorption process , boundary layer resistance and macro - porous diffusion resistance are the primary mass transfer controlling steps . typically , the macro - porous inside adsorbent is created by the binder material which is normally used to form a different shape of adsorbent from crystal particle for an easy handling . the diffusion distance of molecules travelling inside macro - pores before them reach the micro - pore surface is dependent on the radii of beaded adsorbent or thickness of the coated layer . conventionally , the particle size used in the adsorption processes is between 2 to 6 mm in diameter , therefore , the travelling distance of molecules diffusion inside the pores is around 1 to 3 mm . in the structured adsorbent technology for tsa application , the coating thickness of adsorbent layer can be less than 1 mm with the use of binder material to create macro - pore diffusional passage inside the thin adsorbent layer . referring now to fig1 a , 1b , 2a , and 2b , the instant invention is discussed . the binder material should be selected to exhibit a strong adhesive capability to bind crystal adsorbent particles together on the metallic wire mesh 100 and creates super macro - pore passage inside the layer . for example , with 1 mm thickness h of structured adsorbent sheet 104 , the molecular diffusional path reduces 50 % and then its corresponding characteristic heat and mass transfer time increases 4 times in comparison with conventional beaded particle of 2 mm diameter . in addition , the gas space velocity in the structured adsorbent bed is much higher than it is in a conventional beaded bed because bed fluidization is not an issue in structured packing . therefore , thickness of the boundary layer is much lower , which enhances transfer rates of both mass and heat through boundary layer and into the adsorbent . the structured adsorbent sheet 104 is made by casting or coating adsorbent slurry which consists of adsorbent crystal and selected binder material 105 onto substrate material 100 . the substrate material 100 is an electric conducting metallic heating wire mesh or screen with an appropriate mesh size 102 , 103 of pore opening . the wire diameter 101 can be for example around 0 . 05 mm or higher dependent on the electric energy and heating requirement . the substrate material can also be selected from thin metallic membrane , porous metallic sheet , metallic monolith . . . etc . the adsorbent casting process is similar to the process of making cement concrete blocks for building construction with the substrate material as a support structure as shown in fig1 a , 1b , 2a , and 2b . the shape of each adsorbent sheet 104 can be designed to fit special requirement . for example , it can be cast on a flat substrate sheet or a folded or curved shape . the flat adsorbent sheet 201 , 203 and folded or curved adsorbent sheet 202 stacking together form a structured adsorbent module 200 in which straight flow channels 204 are designed and created for gas flow through the structured adsorbent module 200 at much less pressure resistance . the actual size of channel opening 204 can be designed based on process requirement . the thickness δ of the structured adsorbent layer 105 for tsa application is preferred to be high to increase amount of adsorbent loading in comparison with psa application . it can be approximately the same order of magnitude as the wire diameter 101 or higher , i . e . both being approximately in the range 50 to 1000 microns . the relative adsorbent volume load ( adsorbent volume / adsorber volume ) is dependent on the actual thickness δ of adsorbent layer 105 on each structured adsorbent sheet 104 and pore opening 102 , 103 on the wired mesh screen 100 . for example , with wire mesh of wire diameter 101 of 100 microns and adsorbent coating thickness δ of 400 microns , the adsorbent loading can be reached is approximately 60 % with fluid flow channel 204 opening 0 . 5 mm . this value of adsorbent loading is equivalent to a bed loading for standard beaded adsorbent material (˜ 60 %). the effective adsorbent load of the structured adsorbent bed , taking into account of 20 % inert volume of the binder material necessary to maintain together the powder or crystals and to stick them onto the substrate is therefore in the order of 48 % with is the same as the actual loading of conventional beaded adsorbents achievable . the adsorbent loading may decrease slightly if it is necessary to increase the channel opening 204 in order to reduce the pressure drop across the fluid flowing channel 204 for capturing co2 from low pressure co2 sources . with the 400 microns thickness δ of the structured adsorbent layer 105 , the molecular diffusion distance has reduced 7 . 5 times compared with 3 mm diameter conventional beaded adsorbent . as a result , the characteristic heat and mass transfer time of molecules traveling inside the adsorbent layer decreases 56 times . the above mentioned structured adsorbents were normally targeted to be used in a pressure swing adsorption operation , where enhancement of mass transfer rate for adsorbate diffusing into adsorbent pore network was a key factor . for thermal ( electrical ) swing adsorption process , improvement of adsorbent loading density per unit structured bed and of heat transfer rate during regeneration is a primary concern , transfer mass should remain fast enough but is not as critical as in psa process for the co2 capture application . in this particular application , it is typically not necessary to remove all co2 from the co2 containing gas , such as maintaining the co2 mass transfer zone inside the bed . this is for instance in the case for air purification in front of an asu . typically the co2 is removed down to 0 . 1 ppm , thus decreasing the inlet co2 content ( from 400 to 500 ppm ) by a factor more than one thousand . in the case of co2 capture from its low concentration and low pressure sources , a recovery of 95 , 90 even 85 % will be a valuable target . this means we can afford to allow a small amount of co2 to break through ; therefore , a very high co2 adsorption kinetics may not be necessary . fig3 a , 3b and 3c show the mass transfer zone and its position in different cases . fig3 a shows schematically an adsorber bed 1 with a feed gas inlet 2 and outlet 3 ; the mass transfer front 4 a and the saturation zone 5 a . the area of 6 a represents the adsorbent which is not saturated with adsorbate . fig3 a represents a case where the targeted adsorption species are completely captured within the bed . in other words , its mass transfer zone ( mtz ) is in totality in the adsorber . due to a good kinetics , the length of the mtz is short , and therefore most of the adsorbent is fully used ( loaded ) where 6 a represents only a small area . similarly as shown in fig3 a but with a lower value of the kinetics , the mtz length is prolonged and the area of 6 b corresponding to the non - saturated adsorbent becomes important . the productivity in term of quantity of feed being treated is noticeably less than in the first case shown in fig3 a . the adsorption kinetics shown in fig3 c is the same as in fig3 b but complete removal of the adsorbed species is not required . with a 95 %+ recovery ( instead of 100 %), one can see it is possible ( see area 6 c ) to obtain as good productivity as in the case shown in fig3 a . for a tsa ( esa ) application of the structured adsorbent bed , it is preferred to increase adsorbent casting thickness δ in order to maximize the adsorbent loading without too much compromise the mass and energy ( heat ) transfer rates . for example , with the same wire mesh 100 of wire diameter 100 microns and increasing the adsorbent coating thickness δ to 600 microns , the adsorbent loading increases to 69 % by maintaining the same channel opening 204 at 0 . 5 mm . however , the molecular diffusion distance only reduces 5 times compared to conventional beaded material at particle diameter of 3 . 0 mm . as a result , the characteristic heat and mass transfer time of molecules traveling inside the adsorbent layer 105 decreases 25 times . this number is still enough for tsa operation . for example , with such improvement , it may reduce an 8 - hours of conventional tsa half cycle time to less than 30 minutes half cycle time . the structured adsorbent module 200 comprising a number of parallel straight flow channels 204 is made from individual adsorbent sheets 104 . the adsorbent sheets 104 consist of nano - adsorbent fine powder ( crystal ) applied to a metallic wire mesh sheet substrate 100 , or a macro - porous , thin , metallic membrane or metallic monolith , more generally of a power conducting and electrical heating material , selected from the materials which have better electric conductivity and carrier properties , such as nichol , copper , aluminum , stainless steel , carbon or combination of these materials . the process of fabrication of the adsorbent sheets 104 includes casting ( coating ) the nano - adsorbent fine powder ( or a nano zeolite crystal particle ) onto the substrate wire mesh sheet 100 with the help of selected binding material . this binding material glues nano particle together and is then converted to macro - porous frameworks inside adsorbent layer 105 after thermal treatment . the macro - porous structured of the frameworks create macropore diffusion passage to increase mass and energy transport rates inside the adsorbent layer 105 . in addition , this nano - adsorbent fine powder or zeolite crystal is modified ( ion exchanged ) or impregnated with certain promoters to enhance co2 adsorption , such as amine impregnation , if co2 adsorption is a targeted application . the preferred thickness δ of the nano - adsorbent fine powder layers 105 on the wire sheet 100 is dependent on the application and is in the range of 0 . 1 to 1 mm . for a psa application , higher molecular mass transfer rate inside the adsorbent layer is desired , therefore , a short molecular diffusion length , in other words , thinner adsorbent layer , is preferred . on the other hand , for a tsa ( esa ) application , the amount of adsorbent loading per bed is a primary concern within the acceptable mass and heat ( energy ) transfer rate compared with conventional beaded adsorbent . increase the adsorbent layer thickness δ ; enhance the loading of the adsorbent in the bed . in the design of the structured adsorbent sheet , the wire thickness ( diameter ) 101 of the substrate wire mesh 100 itself is less than 1 . 0 mm , preferentially less than 0 . 5 mm . the actual wire diameter 101 is determined based on the electric heating material used as the substrate and amount of power requirement for heating the structured adsorbent module , as well as mesh size of wire grid opening . the amount of mesh size 102 , 103 of grid support can also be determined based on mechanical strength requirement for the structured adsorbent sheet 104 , amount of binder material used in the process , potential thermal contraction and expansion of the wire material during tsa cycle , etc . different shapes and forms of channels 204 can be created for fluid to flow between adsorbent sheets 201 , 202 . to enhance the adsorbent loading per volume of structured module , the channels 204 are made from the same adsorbent sheet material 104 . the adsorbent sheet 104 can be made in different shapes and forms . for example , it can be made by folding the adsorbent sheet 104 in a curvature , triangular or rectangular shape . the individual straight and curved adsorbent sheets 104 stacking together form straight flow channels 204 . in addition , as indicated in fig5 a , 5b , and 5c , the channels 204 can be made from by inserting coated discs 5 a , wires 5 b , foams 5 c , membranes or random wires as mattress types . these inserting materials are preferably coated with nano - adsorbent fine powder to enhance adsorbent loading in the structured bed . the channel opening 204 is controlled by curved shape of the individual adsorbent sheet , which is in a range of 0 . 1 to 2 mm distance . the actual channel opening 204 can be designed based on the tsa process requirement ; such as gas superficial space velocity , cycle time , mass and energy transfer rates , etc . the channels 204 are created in the same direction as fluid flows through the bed . the structured adsorbent module is formed by stacking two straight adsorbent sheets adjacent to the curved adsorbent sheet or inserted adsorbent coated materials as a sandwich - type structured adsorbent . the channels 204 separated by curvature shaped adsorbent sheet allow process gas and regeneration fluid or regeneration purge fluid to pass through , where co 2 is readily adsorbed onto the nano - adsorbent crystal layers during adsorption step and released from the adsorbent during high temperature regeneration process . regeneration of adsorbent is achieved by raising the bed temperature with electrical energy . by selecting a good electrical conducting substrate material , such as copper , aluminum , stainless steel , carbon , or combination of them , the metal substrate wire mesh can be quickly heat up with electricity to a desired temperature . due to direct contact of build - in electric thermal elements with coated adsorbent , and thinner adsorbent coating layer ( less than 1 mm thickness ) compared to conventional beaded adsorbent material on the wire mesh substrate , the heat energy of thermal flow can be rapidly transferred into the adsorbent by thermal conduction and convection with a small amount of gas purge ; therefore , it releases the adsorbed co 2 from the surface of the adsorbent and the released rich co2 is further carried out with small regeneration purge flow . more importantly , during the heating of the adsorbent bed , the adsorbent inside the bed are heated homogenously throughout the whole volume of the bed with supplied electric energy . in other words , the adsorbent temperature at the top and bottom of the bed is raised simultaneously . the released co2 remains in the gas phase , and then is readily moved out off the bed with a small amount purge fluid . this is different than the conventional regeneration process where the introduced hot regeneration fluid has to flow from one end to another . the temperature wave front gradually moves through the bed due to thermal exchange caused by heat transfer . these heating and cooling steps in conventional tsa process are normally the controlling step and are energy intensive . more specifically , the amount regeneration fluid is normally limited and flow rate tends to be low to minimize energy requirement . the released co2 from hot adsorbent zone is partial adsorbed onto cool adsorbent in the fluid flow direction because of increase of co2 partial pressure in gas phase in cool adsorption reign . therefore , it takes longer time to regenerate the adsorbent bed with conventional regeneration process compared to the electric heating process of the present invention . in addition , small amount of purge fluid during regeneration process enhances thermal transfer of convection effect to help homogenizing the bed temperature in the structure and avoiding hot surfaces or spots , for example , near the electrical wires . the purge fluid can also effectively remove the desorbed co2 from the bed in present invention . in order to not dilute the co2 desorbed , it is preferable of use a co2 rich stream as the purge . in addition to the benefit of promoting homogenous heating of entitle adsorbent with small amount co2 rich purge stream , it can also avoid components such as water or other impurities migrating to the downstream by purging the bed in counter - current direction ( from top of the bed to bottom ). the bed cooling , or partial cooling , can be achieved by purging the bed with co 2 lean feed effluent stream or feed gas , preferentially by nitrogen through the structured bed channel 204 after disconnection of the electric power supply sources . the adsorbent should be cooled down rapidly due to much shorter heat transfer distance in the structured adsorbent layer compared to conventional beaded material . to compare with conventional beaded adsorbent bed , fig4 lists the estimated characteristic parameters of structured adsorbent . in fig2 a and 2b , the folded or curved structured adsorbent sheets are used to create flow channel 204 , for example in the form of triangle . the actual shape of the structured bed can be varied depending on the applications . it can be designed as a planar shape of structured adsorption tsa bed type or circuit shape of structured adsorbent column . one possible configuration for adsorption vessels of the present invention is to insert a roll of the structured beds . the structured bed consists of modules stacked together . each module consists of thin porous adsorbent sheets with straight and curved sheets adjacent each other as sandwich type to form channels 204 between repeating layers ; this type of bed is suitable for producing large rolls that can fill cylindrical adsorption bed . this configuration brings the advantage of low construction cost . the structure adsorbent sheet is made from nano - particle or crystal zeolite adsorbent with binder material gluing together onto a substrate support framework made from electric conducting materials . thick adsorbent layer is used with build - in electric wire mesh substrate for tsa application to improve heat transfer property , at meantime maintaining reasonable fast mass transfer characteristic of the structured material . the flow channels 204 in the structured bed are formulated from adsorbent sheet with straight and curved adsorbent sheets sandwiched together . the adsorbent regeneration is carried out by electric energy with build - in electric filaments as wire mesh substrate to uniformly heat adsorbent quickly by thermal conduction and convection . the entire adsorbent bed is heated homogenously with potential less energy requirement with small amount of purge fluid to avoid hot surface and meantime to carry out desorbed co2 . less regeneration gas ( co2 rich stream ) is needed compared with conventional beaded adsorbent bed . a method of purifying a fluid stream with a structured adsorbent unit is provided . the method includes at least one structured adsorbent unit 900 with a cycle time c , each structured adsorbent unit 900 comprising n adsorbing beds 800 , wherein n is greater than or equal to 3 , each adsorbing bed 800 comprising at least 2 adsorbent modules 200 , each adsorbent module 200 comprising a plurality of stacked sheets 201 , 202 , 203 , each sheet comprising a nano - adsorbent powder affixed together with binder material 105 onto a porous electrical heating substrate 100 . each bed 800 is subjected to a sequence comprising , in succession , an adsorption cycle , and a regeneration cycle . each bed is out of phase with the cycle for all the other vessels , provided that at least two vessels ( beds ) are in the adsorption step at any time , wherein there is a lag time between the start of cycles in successive beds . a non - limiting example of this is illustrated in fig9 a , 9 b , and 9 c . during a first time period ( 9 a ), bed a and bed b are in an adsorption cycle . fluid stream 902 is introduced to bed a and bed b , after which the targeted adsorption species ( e . g . co2 ) is adsorbed and product gas stream 904 is produced . simultaneously , bed c is in a regeneration cycle . fluid stream 902 does not enter this bed , but electricity 903 is allowed to heat the electrical heating substrate 100 . this desorbs the targeted adsorption species , which is released as stream 906 . during a second time period ( 9 b ), recently regenerated bed c is now in adsorption mode , along with bed c . during this time period , bed a is being regenerated as explained above . likewise , during a third time period ( 9 c ), recently regenerated bed a is back in adsorption mode , and now bed c is being regenerated . the adsorption cycle may include introducing a fluid stream 902 comprising a first component and a second component into the process fluid inlet the structured adsorbent bed , thereby producing an outlet stream 904 rich in the first component and depleted in the second component , and enriching the nano - adsorbent with the second component , and removing the outlet stream from the process fluid outlet . the regeneration cycle may include introducing an electrical current 903 into the porous electrical conducting substrate 100 of the structured adsorbent bed 800 , thereby increasing the bed temperature for regenerating the structured adsorbent module and releasing the second component 906 . the method may further include a cooling phase , comprising , introducing a cooling fluid stream into the process fluid inlet of the structured adsorbent bed , thereby cooling the regenerated adsorbent . the method may further include a re - pressurization phase before starting a new cycle . the lag time is the lag time the c / n . a non - limiting example of this is illustrated in fig1 a , 10b , 10c , 10d , and 10 e . during a first time period ( 10 a ), bed a and bed b are in an adsorption cycle . fluid stream 902 is introduced to bed a and bed b , after which the targeted adsorption species ( e . g . co2 ) is adsorbed and product gas stream 904 is produced . simultaneously , bed c is in a regeneration cycle . fluid stream 902 does not enter this bed , but electricity 903 is allowed to heat the electrical heating substrate 100 . this desorbs the targeted adsorption species , which is released as stream 906 . simultaneously , bed d is in a cooling cycle . a cooling fluid 901 is introduced into the heated , regenerated bed and discharged as spent stream 905 . simultaneously , bed d is in a repressurizing cycle . a repressurizing stream , illustrated as being stream 902 , but it can be any suitable stream that is available , is introduced into the bed which is then pressurized . during a second time period ( 10 b ), recently regenerated bed c is now in cooling mode , as explained above . during this time period , bed b is being regenerated as explained above . cooled bed d is being repressurized as explained above . repressurized bed e is now in an adsorption cycle , as is bed a . during a second time period ( 10 b ), recently regenerated bed c is now in cooling mode , as explained above . during this time period , bed b is being regenerated as explained above . cooled bed d is being repressurized as explained above . repressurized bed e is now in an adsorption cycle , as is bed a . during a third time period ( 10 c ), recently regenerated bed b is now in cooling mode , as explained above . during this time period , bed a is being regenerated as explained above . cooled bed c is being repressurized as explained above . repressurized bed d is now in an adsorption cycle , as is bed e . during a fourth time period ( 10 d ), recently regenerated bed a is now in cooling mode , as explained above . during this time period , bed e is being regenerated as explained above . cooled bed b is being repressurized as explained above . repressurized bed c is now in an adsorption cycle , as is bed d . during a fifth time period ( 10 e ), recently regenerated bed e is now in cooling mode , as explained above . during this time period , bed d is being regenerated as explained above . cooled bed a is being repressurized as explained above . repressurized bed b is now in an adsorption cycle , as is bed c . the adsorption cycle may include introducing a fluid stream 902 comprising a first component and a second component into the process fluid inlet the structured adsorbent bed , thereby producing an outlet stream 904 rich in the first component and depleted in the second component , and enriching the nano - adsorbent with the second component , and removing the outlet stream from the process fluid outlet . an electrical swing adsorption method for separating a gas mixture is provided . the method includes separating a more adsorbable component a , and more than 50 % of a less adsorbable component b , with a structured adsorbent unit comprising a cycle time c , each structured adsorbent unit comprising n structured adsorbent beds 800 , each structured adsorbing bed 800 comprising a plurality of stacked sheets 201 , 202 , 203 , each sheet comprising a nano - adsorbent powder affixed together with binder material 105 onto a porous electrical heating substrate 100 . each bed 800 is subjected to a sequence comprising , a repeating cycle of steps including an adsorption cycle . the cycle includes introducing the gas mixture 901 into the process fluid inlet the structured adsorbent module , thereby producing an outlet stream 904 rich in the component b and depleted in the component a , and enriching the nano - adsorbent with the component a , and removing the outlet stream from the process fluid outlet , wherein the recovery of component a is less than 100 %. the cycle also includes a regeneration cycle , including introducing an electrical current 903 into the porous electrical conducting substrate 100 of the second structured adsorbent module , thereby increasing the bed temperature for regenerating the structured adsorbent module and releasing the second component , wherein there is a lag time between the start of cycles in successive beds . the method may also include a cooling phase , including introducing a stream comprising more than 50 % of component b into the process fluid inlet of the third structured adsorbent module , thereby cooling the regenerated adsorbent . the method may also include a re - pressurization phase before starting a new cycle . there is a lag time is c / n . the recovery of component a may be less than 95 %, preferably less than 90 %. an electrical swing adsorption method for separating a gas mixture is provided . this method includes separating a gas mixture 901 that contains a more adsorbable component a , and more than 50 % of a less adsorbable component b . the method includes providing an adsorbent structure suitable for adsorbing a component a , of the parallel passage contractor type , introducing the gas mixture into the adsorbent structure , wherein the recovery of component a is less than 100 %. then heating the adsorbent structure to desorb the adsorbed species , and cooling the adsorbent structure with a stream comprising more than 50 % of component b . the recovery of component a is less than 95 %, preferably less than 90 %. | 1 |
while the invention is susceptible to various modifications and alternative forms , certain specific embodiments thereof have been shown by way of example in the drawings and will be described in detail . it should be understood , however , that it is not intended to limit the invention to the particular forms described , but , on the contrary , the intention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the invention as defined by the appended claims . turning now to the drawings and referring first to fig1 - 5 , a sign holder 10 is formed by folding a single sheet of transparent polymeric material along a fold line 11 to form a front panel 12 and a rear panel 13 . because the two adjacent panels 12 and 13 are open along their top edges , they form a cavity or pouch 14 between the two panels . when a sign 15 is inserted into the pouch 14 , the front surface of the sign 15 can be viewed through the transparent front panel 12 . the bottom edge of the sign 15 is supported by the fold in the polymeric sheet that forms the panels 12 and 13 . a variety of different materials may be used to form the panels 12 and 13 , but a preferred material is clear sheet stock of a material such as polyvinlychloride ( pvc ), mylar , petg or acetate . a particularly preferred material is pvc sheet stock having a thickness of approximately 0 . 010 inch . to facilitate the folding of the polymeric sheet to form the panels 12 and 13 , the sheet may be compressed along a transverse line corresponding to the fold line 11 ( see fig3 a and 3 b ) this compression may be effected simultaneously with the cutting of the sheet from a larger sheet , by simply compressing the sheet along the fold line 11 to reduce the sheet thickness by a few thousandths of an inch along that line . the compression preferably terminates inboard of the side edges of the sheet so that the sheet is not susceptible to tearing along the fold line at the side edges of the sheet . the sign 15 is typically a sheet of paper , paperboard or polymeric film having a printed or manually applied image on one or both sides . although the term “ sign ” will be used throughout the description of the preferred embodiments of the present invention , it should be understood that the content of the printed matter is immaterial as far as the present invention is concerned . for example , one of the many applications for this invention is bumper “ stickers ”, which are normally considered to be messages rather than signs . the present invention is useful with signs prepared on any flat media , regardless of content . moreover , there is no need for any adhesive backing or other attachment medium on either surface of the sign 15 , thereby minimizing the cost of preparation of the sign itself . in the illustrative embodiment of the invention in fig1 - 5 , lateral movement of the sign 15 within the pouch 14 is limited by a pair of suction cups 16 and 17 inserted through two pairs of mating holes 18 , 19 and 20 , 21 formed in the panels 12 and 13 adjacent the vertical side edges thereof the suction cups 16 and 17 are conventional , commercially available items which are molded to include integral holders 16 a , 17 a along with the actual suction cups 16 b , 17 b . the molded part is made of a flexible , resilient material so that it can be deformed to fit through a small opening such as the holes 18 - 21 , after which it returns to its normal shape . the molded part necks in sharply between the holder and the base of the suction cup so that it is captured securely in the folded plastic sheet after insertion . the resulting assembly contains the side edges of the sign inserted into the pouch 14 , to prevent the sign from escaping laterally from the pouch . in the illustrative embodiment of fig1 - 5 , the position of the fold line of the polymeric sheet is selected to form a rear panel 12 that is longer in the vertical dimension than the front panel 13 . consequently , the rear panel 13 extends vertically above the front panel 12 so that a portion 22 of the rear panel 13 extends above the top edge of the front panel 12 . the top portion 22 of the rear panel 13 facilitates the insertion of the sign 15 into the thin cavity 14 by providing a guiding entry surface , and can also be used to display permanent messages printed on the sign holder 10 itself . as illustrated in fig6 the top portion 22 may also be folded down over the top edge of the front panel 12 to close the top opening of the cavity 14 after a sign 15 has been inserted therein . to facilitate such folding , a second fold line 23 , similar to the fold line 11 , is preferably formed in the rear panel 13 at an elevation just slightly above that of the top edge of the front panel 12 . closing the top opening of the cavity 14 in this manner provides further protection against soiling and moisture , including rain , liquid splashing and the like . it can be seen from the description thus far that the present invention can be implemented with only three parts . the resulting sign holder can be formed in a wide variety of different sizes and shapes , thereby accommodating a wide variety of different applications . this sign holder is particularly suited for the display of signs on exhibition booths and store windows , but it has a wide variety of other applications such as noncommercial window displays , personal displays of small messages such as on walls , refrigerators , computers , etc . although the preferred embodiment of the invention uses a single sheet of polymeric material to form both the front and rear panels 12 and 13 , there may be no need for the rear panel 13 to be transparent . consequently , the front and rear panels 12 and 13 may be made of different materials , with the rear panel 13 being made of a less expensive , non - transparent material . the two panels must still be attached to each other to support the sign 15 along its lower edge , and this attachment may be effected by a variety of different means such as adhesive , discrete fasteners , heat sealing , spot welding , etc . when the holder 10 is mounted on a window or other transparent surface , it is often desirable to have both the front and rear panels 12 and 13 made of transparent material so that signs or messages in the cavity 14 can be viewed from both sides of the holder 10 . in this case , two signs 15 a and 15 b ( fig5 ) are normally inserted into the cavity 14 , one providing a display viewable through the front panel 12 and the other providing a display viewable through the rear panel 13 . the cavity may also be used to store additional signs or messages 15 c , as illustrated in fig6 between the two viewable signs 15 a and 15 b . these additional items 15 c may simply be extra copies of the viewable items for removal by the viewer , as the case of coupons , work instructions , bulletins and the like , or additional signs or messages to be displayed alternately or on different occasions . the suction cups used as the side fasteners in the preferred embodiment may also be replaced with alternative fasteners . for example , the modified embodiment illustrated in fig7 replaces the suction cups with conventional hook and loop fasteners , with the hook element 30 attached to the panels 12 and 13 , and the loop element 31 attached to a supporting surface 32 . the modified embodiment of fig8 uses a coating of releasable adhesive 33 on the surface of a flat plate 34 attached to the two panels 12 and 13 . fasteners which are easily removable from the panels 12 and 13 . for example , a wire support stand 40 shown in fig9 and 10 includes a pair of hooks 41 and 42 that fit through two pairs of registered holes in a pair of panels 43 and 44 forming a cavity 45 . the vertical elements 46 and 47 of the stand 40 hold the panels 43 and 44 in an upright position while they are supported on the hooks 41 and 42 . a similar pair of hooks 48 and 49 suspended from a ceiling 50 are illustrated in fig1 . the sign or message holder to be suspended on the hooks 48 and 49 are preferably located near the top of the holder . separate fasteners may be used to attach the front and rear panels 12 and 13 to each other ( to contain the sign 15 within the cavity 14 ), and to attach the sign holder 10 to the supporting surface on which it is mounted . for example , the two panels 12 and 13 may be attached to each other by means of adhesive , heat sealing , discrete fasteners , etc . the holder 10 may be attached to its supporting structure by the same means , or by the suction cups or other fastening devices employed in the preferred embodiments described above . it should also be noted that the fastening means for attaching the sign holder to its supporting structure may be anchored to both the front and rear panels 12 and 13 , as in the preferred embodiment described above , or to only the front panel 12 , capturing the rear panel 13 between the front panel 12 and the supporting structure . in the case of holders that use separate fastening means to attach the front and rear panels to each other , the fastening means that attaches the holder to a supporting structure may be attached to only the rear panel if desired . one of the advantages of this invention is that the sign or message holder can be easily made with virtually any desired length - to - width ratio (“ aspect ratio ”). for example , the holder of fig1 has an aspect ration much greater than one , while the holder of fig1 has an aspect ratio less than one . fig1 illustrates yet another embodiment having an aspect ratio of slightly less than 2 : 1 . thus , the holder of this invention can be readily tailored to display signs or messages of virtually any desired size and proportions . | 6 |
it is to be understood that the invention may assume various alternative orientations and step sequences , except where expressly specified to the contrary . it is also to be understood that the specific devices and processes illustrated in the attached drawings , and described in the following specification are simply exemplary embodiments of the inventive concepts defined in the appended claims . hence , specific dimensions , directions or other physical characteristics relating to the embodiments disclosed are not to be considered as limiting , unless the claims expressly state otherwise . now an embodiment that differs from the above - described prior art will be described below with reference to the accompanying drawings . fig2 a shows a double offset constant velocity joint 36 according to a first embodiment . the constant velocity joint 36 comprises an outer joint part 38 having a cylindrical inner surface 40 formed with a plurality of circumferentially spaced linear guide tracks 42 . an inner joint part 44 is also provided having an outer surface 46 formed with linear guide tracks 48 complimentary to those in the outer joint part 38 . a plurality of torque - transmitting balls 50 are disposed within the ball tracks 42 , 48 . a cage 52 retains the balls 50 in a plurality of circumferentially spaced pockets 54 . the cage 52 also comprises an inner concave spherical surface 56 and an outer convex spherical surface 58 offset to the opposite sides o 1 , o 2 in the axial direction from the center of ball pocket o . the outer convex spherical surface 58 contacts the cylindrical inner surface 40 of the outer joint part 38 , via the tracks 42 , while the inner concave spherical surface 56 contacts the outer convex spherical surface 58 of inner joint part 44 . the center of the inner joint part 44 is offset to a side o 1 facing its front opening rf and a ball 50 mainly reciprocates more on the portion of the tracks 42 , 48 facing the rear opening rf of cage 52 than on the portion of the tracks 42 , 48 facing the front opening of cage 52 by the offset amount . the center of the cage 52 may also be offset to a side ( not shown ). with respect to the center line o 1 of the outer convex spherical surface 46 of inner joint part 44 , two partial spherical surfaces 60 , 62 with their different radii r 21 , r 22 are formed on the outer surface 46 of the inner joint part 14 with respect to the center o 1 offset from the center of the ball 50 , respectively . an inner partial spherical surface 64 having the center o 1 is formed on the inner surface 56 of the cage 52 facing the front opening rf of the cage 16 from a position l offset to the front opening of the cage 16 . another partial spherical surface 66 with a larger spherical radius having the same center o 1 is formed on the inner surface 56 of the cage 16 facing the rear opening rr of the cage 16 . an open space k is provided between the two different spherical surfaces 60 , 62 , 64 , 66 with their different radii r 21 , r 22 to allow the inner joint part 14 to rotate relatively to the cage 16 along the spherical surfaces 60 , 62 , 64 , 66 . the size of open space k is determined by a relative circumferential movement of the inner joint part 14 to point o 2 , which is equivalent to half an articulation angle . fig2 b shows a difference in cage 52 between a conventional cage and the present case , in which rc represents an inner sphere radius of a conventional cage , as shown in the dotted line . the two radii r 21 , r 22 , of the partial spherical surfaces of the inner joint parts 60 , 62 are depicted . the location of surface 62 is formed from a position equivalent to half of a ball diameter d / 2 toward the front beginning opening of the cage rf . fig2 c shows a difference in the inner joint part 44 between a conventional inner joint part and the present inner joint part in which ri represents the outer sphere radius of a conventional inner joint part , as shown in dotted line . as an advantage of the present joint , the partial spherical surface 62 with the larger spherical radius r 22 formed on the outer surface 46 of the inner joint part 44 toward the rear opening rr of the cage 52 is larger than a spherical radius of the conventional art ri . this provides more margin of contact ellipse length (= r 22 − ri ) on a ball track , thus increasing joint durability and decreasing the size of the joint 36 by the increment in the radius of the spherical surface (= r 22 − ri ). the partial spherical surface 60 , with the smaller spherical radius r 21 formed on the inner joint part 44 toward the front opening of the cage 52 , has a smaller spherical radius than that of the conventional art ri . this provides more margin of contact length (= r 22 − rc = ss 1 ) on the surface of the ball pocket , thus increasing joint durability and decreasing the size of the joint 36 by the difference in the radius of the spherical surface of cage (= r 22 − rc ). fig3 a shows a double offset constant velocity joint 68 according to another embodiment . the same reference numbers from fig2 a , 2 b and 2 c are used for the same features in fig3 a , 3 b and 3 c . one difference between the embodiment depicted in fig2 a and the embodiment depicted in fig3 a is that a flat cylindrical surface 70 defined by l 1 and ro 1 is formed additionally on the partial spherical surface 60 of the inner joint part 44 ′ to assemble the inner joint part 44 ′ into the cage 52 through the rear opening diameter rr of cage 52 . the partial spherical surface 62 should be cut off at the central portion o of the inner joint part 44 ′ and also r 22 should not be greater than the rear opening diameter ro 1 . fig3 b and fig3 c show detailed drawings with regards to fig3 a . fig3 b shows a difference in cage 52 between a conventional cage and the present case . as in fig2 b , rc in fig3 b represents an inner sphere radius of a conventional cage . the two radii r 22 , r 21 of the partial spherical surfaces 60 , 62 of the inner joint part 44 ′ are depicted . the location of surface 64 is formed from a position equivalent to half a ball diameter d / 2 toward the front opening of cage rf . fig3 c shows a difference in the inner joint part 44 ′ between a conventional inner joint part and the present inner joint part where ri represents the outer sphere radius of a conventional inner joint part , as shown in dotted line . the advantages of joint 36 are thus achieved in the joint design for joint 68 . fig4 a is a view showing the operation of the joint 36 at a maximum articulation angle of b max , in which a first ball 72 having a phase angle of zero degrees travels toward a front opening diameter rf of the cage 52 on the ball track 48 of the inner joint part 44 by t 1 , while a second ball 74 having a phase angle of 180 degrees travels toward the rear opening diameter rr of the cage 52 on the ball track 48 of the inner joint part 44 by t 2 . while joint 36 is depicted in fig4 a , it can be readily appreciated that the operation depicted in fig4 a - 4d , can be readily applied to joint 68 of fig3 a - 3c . fig4 b is a view showing the difference in contact ellipse length margin on the outer spherical surface 46 of the inner joint part 44 between a conventional inner joint part and the inner joint part 44 of the present joint 36 at zero articulation angle . the conventional inner joint part outer spherical surface is depicted in dashed lines . fig4 c is a view showing the difference in contact ellipse length margin on the outer spherical surface 46 of the inner joint part 44 between a conventional inner joint part and the inner joint part 44 of the present joint 36 at a maximum articulation angle and at a zero phase angle . again , the conventional inner joint part outer spherical surface is depicted in dashed lines . fig4 d is a view showing the difference in contact ellipse length margin on the outer spherical surface 46 of the inner joint part 44 between a conventional inner joint part and the present joint 36 at a maximum articulation angle and at a phase angle of 180 degrees . the conventional inner joint part outer spherical surface is depicted in dashed lines . as shown in fig4 b to fig4 d , joint 36 has more margin of contact ellipse length than the conventional art by del at e meaning zero articulation angle . it also has more margin of contact ellipse length than the conventional art by del meaning t 2 and maximum articulation and a phase angle of 180 degrees than the conventional art . however , it does not have any more contact ellipse length margin than the conventional art at t 1 meaning maximum articulation and a phase angle of zero degrees , which means the present joint is equivalent to the conventional art at maximum articulation angle and at t 1 . however , since the margin of contact ellipse length at t 1 still becomes greater than that at t 2 , it is not necessary to secure more contact ellipse length margin on the central portion of the outer spherical surface 46 of the inner joint part 44 in terms of a margin in balance . consequently , present joint 36 has increased durability , while achieving a reduction of weight and size . on the other hand , the present joint 36 is designed in a fashion that the open space l , at zero articulation angle gets wider to ll at a phase angle of zero degrees and gets narrower to zero ( ll = 0 ) at a phase angle of 180 degrees , as shown in fig4 a . therefore , the mechanism of the present joint 36 provides a better lubrication system , meaning that grease is filled , when the open space becomes wider , while grease is squeezed out and pumped into the chasm between the parts when the open space becomes narrower . therefore , it can reduce friction between the cage 52 and the inner joint part 44 , eventually providing better nvh performance of the joint 68 . additionally , it also can supply a sufficient amount of lubrication between a ball 72 or 74 , and a ball track 48 , thus increasing the durability of the joint 36 and allowing the joint 36 to be made more compact in size . fig5 a and 5b show a double offset constant velocity joint 76 according to a preferred third embodiment that is intended to allow an inner joint part 78 to move in the axial direction z for the purpose of improving nvh characteristics related to engine idling . to achieve this objective , a first partial spherical surface 80 with a radius r 221 having a center o 12 offset from the center of cage inner surface o 1 is formed on an inner surface 82 of a cage 84 facing the rear opening rr of the cage 84 . a first flat cylindrical surface l 22 with inner diameter r 221 is smoothly formed to be directly adjacent to the first partial spherical surface 80 . a second partial spherical surface 86 defined by r 22 is adjacent to the first flat cylindrical surface l 22 and is extended approximately to a position offset from the center of the cage inner surface . the second partial spherical surface 86 has a center o 1 and faces the rear opening rr of the cage 84 . r 22 is less than r 221 . a third partial spherical surface 88 with a radius r 211 having a center o 11 offset from the center of the cage inner surface o 1 is formed on the inner surface of the cage 84 facing a front opening rf of the cage 96 . r 211 is smaller than r 221 . a second flat cylindrical surface l 21 with an inner diameter equal to the third partial spherical surface 88 is smoothly formed to be adjacent to the third partial spherical surface 88 and extends to cage front opening rf . a fourth partial spherical surface 90 with radius r 21 having a center o 1 is formed on the outer surface 92 of the inner joint part 78 facing the front opening rf of the cage 84 , in which a convex spherical surface defined by l 11 and r 211 is additionally formed and a flat cylindrical surface defined by r 212 and l 23 , smaller than the convex spherical surface in diameter , is additionally formed to get the convex spherical surface to contact the flat surface l 21 . r 21 is smaller than r 22 . fig6 shows a double offset constant velocity joint 94 according to the preferred fourth embodiment that is intended to allow an inner joint part 96 to move in the axial direction z for the purpose of improving nvh characteristics related to engine idling . to achieve this objective , a first partial spherical surface 98 with radius r 211 having a center o 12 offset from a center o 1 of the inner surface 100 of a cage 102 is formed on an outer surface of the inner joint part 96 facing a front opening rf of the cage 102 . a second partial spherical surface 106 with radius r 221 having a center o 11 offset from the center o 1 of the cage inner surface 100 is formed on the outer surface 104 of the inner joint part 96 facing the rear opening rf of the cage 102 . a third partial spherical surface 108 with radius r 21 having a center o 1 is formed on the inner surface 100 of the cage 102 facing the front opening rf of the cage 102 . a fourth partial spherical surface 102 with radius r 22 having a center o 1 is formed on the inner surface 100 of the cage 102 facing the rear opening rr of cage 102 . therefore , the inner joint part 96 is allowed to move in the axial direction z by dl 21 and dl 22 in accordance with the provisions of the patent statutes , the present invention has been described in what is considered to represent its preferred embodiments . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . | 5 |
digital content — a digital representation of an image , video , audio , text , software or other data . wide area network ( wan )— a network of communicating nodes , wherein some of the nodes are geographically dispersed , such as covering a distance between buildings , cities or countries . file sharing network — a network of nodes communicating according to a protocol allowing the sharing of digital content among the nodes . file sharing network client application — an application for connecting to a file sharing network and sharing digital content over the file sharing network . single - source download — a download of a piece of digital content , wherein the downloaded fragments of the piece originate from a single source node , for example from a single ip address . multi - source download — a download of a piece of digital content , wherein the downloaded fragments of the piece originate from a plurality of source nodes , for example from a plurality of ip addresses . external file hash — a hash value associated with a file , wherein the hash value is assigned by a distribution network ( such as a file sharing network ) and made available as a search key for the file . internal file hash — a hash value associated internally ( by the present disclosure ) with a file in the primary database , the hash value serving as a fingerprint for identifying similar or duplicate digital content . fig1 is a block diagram showing a system for identification and tracking of digital content distributors , comprising a primary database 101 , a data exchange server 102 , and one or more crawler nodes 103 , according to an embodiment of the present disclosure . a crawler node 103 establishes a connection to a wide area network according to a distribution protocol , such as a file sharing network protocol , an irc ( internet relay chat ) protocol , a spidering protocol and / or any other content distribution protocol , and initiates a search for a piece of digital content based on one or more search terms . by way of example and not by limitation , the figures depict crawlers 103 establishing connections to file sharing networks 104 via an appropriate file sharing protocol on a wide area network ; however it is understood that other distribution protocols on a wide area network ( as recited above ) can be used analogously . if a node in file sharing network 104 reports an availability of the sought piece of digital content , crawler node 103 logs such availability and optionally initiates a single - source or a multi - source download of the piece of digital content from the file sharing network 104 . the primary database 101 stores search terms for the crawler 103 searches , as well as any search results obtained from crawler node 103 . the data exchange server 102 acts as an interface between primary database 101 and crawler nodes 103 , retrieving search terms from primary database 101 and providing them to crawler 103 , as well as receiving search results from crawler node 103 and storing them in primary database 101 . any two crawler nodes 103 may establish connections with the same file sharing network 104 or with different file sharing networks 104 . fig2 is a flow diagram showing a method for identification and tracking of digital content distributors , according to an embodiment of the present disclosure . a crawler node 103 establishes 201 a connection to a file sharing network 104 and initiates 202 a search for a piece of digital content , the search comprising one or more search keywords obtained from primary database 101 via data exchange server 102 . crawler node 103 receives 203 a search result from the file sharing network , the search result indicating one or more distributors ( hereinafter also known as suspected distributors ) and respective pieces of digital content distributed by the one or more suspected distributors . as an example , such search result comprises an ip address of a suspected distributor , a port number as used by a suspected distributor , a file name , a file size , an external file hash and / or other identifiers which the file sharing network makes available regarding a piece of digital content made available by a suspected distributor , and / or other data about any digital content and suspected distributors . optionally , verify 204 ip addresses ( if obtained ) of any suspected distributors . optionally , determine 205 what other file sharing protocols ( if any ) are used by such suspected distributors . finally , log 206 any received and / or verified information about such suspected distributors and digital content , and relay the information to data exchange server 102 for storage in primary database 101 . optionally , perform preliminary filtering on the gathered information prior to sending to data exchange server 102 , for example by discarding information pertaining to files whose file names indicate a different content type than the content type under search ( e . g . a . avi video file when we are looking for something like an audio file ), or by discarding information pertaining to files that do not match all submitted keywords . optionally , crawler node 103 also requests statistical information from file sharing network 104 , such as the number of users currently using the file sharing network 104 , the set of files available on the file sharing network 104 , the number of files available on the file sharing network 104 , a list of the different versions of any sought piece of digital content available on the file sharing network 104 , and / or or any other statistical information about file sharing network 104 . if available and supplied by the file sharing network 104 , crawler node 103 stores such statistical information in primary server 101 . it may be the case that a file sharing network 104 discloses information about peers ( such as ip address , or other information described above ) in such as way that the disclosed information is decipherable only by a native client application 113 of the file sharing network 104 . this may be accomplished for example by encrypting such information in transit , and having the native client application 113 decrypt the information when needed to make a connection to the respective peers . in such a case , an optional embodiment of the present disclosure launches a native client application 113 of the file sharing network 104 , and retrieves such information by performing “ memory scraping ”, wherein memory allocation and memory usage of the client application 113 is monitored . fig3 is a diagram illustrating a memory scraping module 112 , according to an embodiment of the present disclosure . with initial user assistance , memory scraping module 112 deduces a pattern in the memory usage of the file sharing network 104 client application 113 . a user interacts with the file sharing network client application 113 as the user would normally when seeking out a file , comprising performing a search , examining the search results , and selecting a file for download . at the same time , the memory scraping module 112 monitors changes occurring in memory and deduces the pattern of memory usage for future automated parsing . once such a pattern is known and stored , memory scraping module 112 applies the pattern to search requests submitted by the file sharing network 104 client application 113 and / or to search results returned to the file sharing network 104 client application 113 , and decodes information about distributors , such as ip address , port number , file name , file size , external file hash and / or other identifiers . the information is then parsed into a format suitable for storage into primary database 101 . fig4 is a flow diagram showing a method for identification and tracking of digital content distributors , according to an embodiment of the present disclosure . the present disclosure teaches a method for doing intensive scans of the internet to trace distribution of copyrighted content and track propagation of such content . in this method , for each suspected distributor &# 39 ; s information stored in the data exchange server as identified by the crawler 210 , download of the specific file using the specific external identifier on the file sharing network in step 214 is requested by an evidence gathering module . if the file is found ( step 220 ) download of the file segment is initiated in step 225 . after the download has been completed successfully ( step 230 ) make an entry in the distributor log that documents for each file segment downloaded the source ip address , the amount of file segment received in bytes , sequence number of bytes , time and date of the download , percentage of the total file held by the source of the segment at a given point of time , file name , ( step 235 .) in step 240 a copy of the file segment is made and stored in the data exchange server . once a piece of digital content is suspected to have become available for download over a file sharing network , an attempt is made to confirm this suspicion by ( a ) initiating a multi - source download of the piece of digital content , or by ( b ) initiating a single - source download of the piece of digital content . once all segments are downloaded ( step 245 ), the segments are all assembled to make a complete digital copy of the file ( step 250 .) thereafter reports may be generated using the information stored in the distributor log and provided to client as proof of distribution of digital content on the file sharing network ( step 255 .) fig5 a is a flow diagram illustrating a method for performing a multi - source download of a piece of digital content , according to an embodiment of the present disclosure . establish 215 a connection to file sharing network 104 , and initiate 216 a download of the piece of digital content , wherein the file sharing network 104 dynamically arranges download sources for the piece of digital content , and wherein possibly different segments of the piece of digital content are obtained from different download sources . once content is successfully downloaded , verify 217 that the downloaded content indeed represents the sought piece of digital content . an example of verification step 217 comprises rendering the downloaded content ( for example by playing a downloaded video clip or audio clip , or by displaying a downloaded image or document on a viewing screen ) and using a human to verify that the downloaded content matches the sought content . optionally , an internal hash value is computed for the downloaded content , allowing efficient determination of whether the content already exists in primary database 101 and therefore is a duplicate that can be discarded . as another option , the content type may be determined by examining a header of the downloaded content . note that whereas a successful multi - source download of a piece of sought digital content confirms the suspicion that the content is available over a file sharing network 104 , such a multi - source download does not necessarily identify any one person ( or entity or ip address ) as a distributor of the entire piece of digital content . optionally , only a portion of the sought digital content is downloaded using multi - source download , establishing that such a portion of the sought content is made available by the file sharing network 104 . optionally , a multi - source download of sought digital content is automatically scheduled to be performed immediately , or at a later time , following the confirmation that a file sharing network 104 advertises availability of such content . fig5 b is a flow diagram illustrating a method for performing a single - source download of a piece of digital content , according to an embodiment of the present disclosure . establish 218 a connection to a specific suspected distributor , and initiate 218 a download of the piece of digital content from the suspected distributor . once content is successfully downloaded , verify 219 that the downloaded content indeed represents the sought piece of digital content . an example of verification step 219 comprises rendering the downloaded content ( for example by playing a downloaded video clip or audio clip , or by displaying a downloaded image or document on a viewing screen ) and using a human to verify that the downloaded content matches the sought content . note that in addition to confirming the suspicion that the digital content is available over a file sharing network 104 , a single - source download also identifies one person ( or entity or ip address ) as a distributor of the entire piece of digital content . optionally , only a portion of the sought digital content is downloaded using single - source download , establishing that such a portion of the sought content is made available by the distributor . optionally , a single - source download of sought digital content is automatically scheduled to be performed immediately , or at a later time , following the confirmation that a distributor advertises availability of such content from an ip address . it is an advantageous aspect of the present disclosure that the several different crawler nodes 103 can have several different connections to several different file sharing networks 104 , web sites ( via spidering ), irc nodes and / or other distribution nodes simultaneously . optionally , an alert message is issued upon determining that a designated piece of digital content is found to be advertised as available on any one of the file sharing networks 104 to which one or more of the crawler nodes 103 are connected . the alert functionality enables a user to dynamically create and / or edit a “ watch list ” comprising one or more pieces of digital content , wherein an alert is issued if any piece of digital content on the watch list is suspected to be available on a file sharing network 104 . in addition to identifying and tracking suspected content distributors , the present disclosure optionally emulates a file sharing network 104 client application 113 on a file sharing network 104 by executing a native file sharing client application 113 appropriate for the file sharing network 104 . fig6 is a diagram showing a “ slow server ” 110 emulating a file sharing network 104 client application 113 , according to an embodiment of the present disclosure . the slow server 110 attempts to serve file requests from peers 111 on the file sharing network 104 , with the exception that the service is interrupted at the operating system level by intercepting tcp / ip packets transmitted to and / or from the emulated native client application 113 in order to drop and / or ignore every p packets by not sending an acknowledgement back to the requesting peer 111 , thereby causing the tcp stack to fall into “ slow packet mode ”. the number p is tunable and may be initially set for example to drop one out of every three packets , such that enough packets are ignored and / or unacknowledged in order to disrupt content transmission while still responding to system packets and / or status packets in order to have the connection appear intact to requesting peers 111 . this arrangement makes it difficult for a peer 111 requesting digital content to obtain the content from the file sharing network 104 . in an alternative embodiment of the present disclosure , distributors participating in an ip telephony protocol are targeted . crawler node 103 initiates a connection with an ip telephony network ( which may be part of a file sharing network 104 ), searches for any users and / or peers who advertise their presence in an ip telephony directory , and stores any information provided by the ip telephony network and / or file sharing network 104 about such users into primary database 101 , analogous to above description for other protocols on wide area networks . the foregoing described embodiments are provided as illustrations and descriptions . they are not intended to limit the disclosure to precise form described . in particular , it is contemplated that functional implementation of disclosure described herein may be implemented equivalently in hardware , software , firmware , and / or other available functional components or building blocks , and that networks may be wired , wireless , or a combination of wired and wireless . other variations and embodiments are possible in light of above teachings , and it is thus intended that the scope of disclosure not be limited by this detailed description , but rather by claims following . | 7 |
the present invention will now be described with reference to the attached drawings , wherein like reference numerals are used to refer to like elements throughout . exemplary processes comprising series of acts and events are provided . the present invention is not limited by the ordering of the acts and events in these examples as some acts may occur in different orders and / or concurrently with other acts or events . in addition , not all illustrated acts or events are required to implement a methodology in accordance with the present invention . fig1 illustrates an exemplary process 100 for forming a p - n junction within a semiconductor substrate according to one aspect of the present invention . the process 100 includes gate formation 101 , forming sidewall spacers 102 , forming deep source / drain implants 103 , and etching away the sidewall spacer 104 . the process further includes forming a source / drain extension region tail implant 105 , annealing to activate the dopants 106 , forming a doped amorphous layer 107 , forming low temperature spacers 108 , forming a thicker doped amorphous layer for the source / drain regions 109 , and annealing at low temperature to induce solid phase epitaxial re - growth ( sper ) within the doped amorphous layers 110 . the gates are formed over a semiconductor substrate . the semiconductor substrate includes a semiconductor crystal , typically silicon . other examples of semiconductors include gaas , sige and inp . in addition to a semiconductor crystal , the substrate may include various elements therein and / or layers thereon . these can include metal layers , barrier layers , dielectric layers , device structures , active elements and passive elements including word lines , source regions , drain regions , bit lines , bases , emitters , collectors , conductive lines , conductive vias , etc . act 101 is forming gates on the semiconductor substrate . forming gates generally involves forming isolation regions , providing a threshold implant into the substrate for the gate channels , forming a gate oxide layer , forming a gate electrode layer , and lithographically patterning the gates from the resulting gate stack . lithographically patterning the gates generally involves forming a resist coating , patterning the resist , using the patterned resist to pattern the gate stacks , and then removing the resist . act 102 is forming sidewall spacers . sidewall spacers are generally formed from a silicon nitride or other dielectric materials . the silicon nitride is deposited and then etched to expose the source / drain regions except immediately adjacent the gates , whereby the sidewall spacers provide a mask for subsequently performed deep source / drain implants . act 103 is performing a deep source / drain tail implant . act 104 is etching to remove the sidewall spacers and expose the semiconductor surface adjacent the gates where the source / drain extension regions will be formed . act 105 comprises a non - amorphizing tail implant for the source / drain extension regions . this is a relatively light and shallow implant . although the implant is shallow , it changes the conductivity type of the substrate to a depth greater than the depth of a subsequently provided amorphous layer created during act 107 . the non - amorphizing implant provides contact between the channel regions and the source / drain extension regions but is not so deep or heavy as to cause short channel effects . preferably , the implant alters the conductivity type of the substrate to a depth of about 500 å or less , more preferably about 300 å or less , most preferably about 200 å or less . act 106 is a spike anneal to activate the dopants associated with the deep source / drain tail implant and the source / drain extension region tail implant . the temperature is raised briefly , but not so long as to cause excessive diffusion of the dopants . spike anneals can be carried out with peak temperatures up to about 1100 ° c . act 107 comprises forming a doped amorphous layer . generally this comprises amorphizing a layer of the substrate by ion bombardment . the amorphizing ions can be the dopant ions , however , where the dopant ions are light , as in boron ions , neutral ions can be used for amorphization prior to implanting the dopant . an amorphous layer in the range from about 10 to about 100 nm thick ( or deep ) can be formed by bombarding the surface with from about 1 × 10 13 to about 1 . 5 × 10 15 atom s / cm 2 or more at an energy from about 2 to about 100 kev . for example , an amorphous layer from about 15 to about 20 nm thick ( or deep ) in silicon can be produced using about 1 × 10 14 to about 2 × 10 14 atoms / cm 2 ge at an energy of about 15 kev , or alternatively with about 4 × 10 13 to about 5 × 10 13 atoms / cm 2 in or sb at an energy of about 25 kev . where doping and amorphization are two separate steps , amorphization takes place first in order to prevent dopant channeling during implantation . act 108 is forming low temperature spacers . the purpose of these spacers is to mask the source / drain extension regions while forming a deep doped amorphous layer for the source / drain regions during step 109 . low temperatures are used , because high temperatures are avoided during all steps following the formation of the doped amorphous layer for the source drain extension regions . this is done to ensure that the epitaxial re - growth of the extensions is simultaneous or concurrent with that of the deep source / drain regions . if the extension regions re - grow during the spacer formation , then the subsequent thermal treatment to activate / re - grow the deep source / drain regions may cause deactivation as well as diffusion of the dopants in the extensions regions . act 109 comprises forming a doped amorphous layer in the source / drain regions . this layer is deeper than the implant of act 107 , however , it is shallower than the implant act of 103 . act 110 comprises heating the substrate to cause solid phase epitaxial re - growth ( sper ) in the doped amorphous layers ( in both the extension and deep source / drain regions ). mild heating , such as in the temperature range from about 550 ° c . to about 700 ° c . for about 10 minutes to about an hour , generally brings about crystal re - growth . for example , a silicon crystal can generally be re - grown by maintaining it at a temperature of about 600 ° c . for about half an hour . crystals grow from the intact portion of the substrate beneath the amorphized layer . preferably , the dopants within the amorphous layer substantially maintain their as - implanted concentration profiles during the sper process . sper incorporates the dopants into the re - grown crystal structure in substitutional sites . the resulting active dopant concentrations can exceed about 2 . 0 × 10 20 atoms / cm 3 , and preferably exceed about 2 . 5 × 10 20 atom s / cm 3 . fig9 is a plot showing the typical dopant concentration profiles resulting from the acts 105 through 107 of the process 100 . the y - axis is the dopant concentration in atoms / cm 3 and the x - axis is depth in angstroms . the tail implant provided by act 105 and indicated by the line 122 with diamond - shaped points is deeper than the region formed by act 107 and indicated by the line 120 with square points . the region identified as amorphous is re - crystallized by act 110 . end - of - range defects remain at the boundary of the amorphous region after crystallization , however , due to the tail implant these defects advantageously are not at the boundary of the doped region , which is where the depletion region occurs . fig2 illustrates another exemplary process 200 for forming a p - n junction within a semiconductor substrate according to one aspect of the present invention . the process 200 includes gate formation 201 , forming sidewall spacers 202 , forming deep source / drain implants 203 , and etching away the sidewall spacer 204 . the process further includes forming a source / drain extension region tail implant 205 , annealing to activate the dopants 206 , forming a doped amorphous layer 207 , and annealing at low temperature to induce solid phase epitaxial re - growth ( sper ) within the doped amorphous layers 208 . act 201 is forming gates on the semiconductor substrate , which is illustrated in one example with device 400 in fig3 - 5 . the device 400 includes semiconductor substrate 401 and field oxide islands 403 . the field oxide can comprise any suitable insulator , including for example silicon dioxide or tetraethyl orthosilicate ( teos ). the field oxide islands 403 can be formed by any suitable process , for example locos ( local oxidation of silicon ) or sti ( shallow trench isolation ), and can be formed in any type of pattern . in fact , in many instances the isolation is formed in rings or other patterns to surround various different active regions . act 201 further includes providing a threshold implant to the semiconductor of the substrate . this implant provides a first conductivity type within a layer of the semiconductor adjacent a surface of the substrate . act 201 also comprises providing a gate layer . generally , gate layers are formed with silicon dioxide and are referred to as gate oxide layers . however , for very small devices , it is often desirable to use a material that has a lower electrical resistance than silicon dioxide and can be provided in greater thickness than an equivalent silicon dioxide layer . such materials are referred to as high - k dielectrics and include , for example , silicates , aluminates , titanates , and metal oxides . examples of silicate high - k dielectrics include silicates of ta , al , ti , zr , y , la and hf , including zr and hf doped silicon oxides and silicon oxynitrides . examples of aluminates high - k dielectrics include transition metal aluminates , such as compounds of zr and hf . examples of titanate high - k dielectrics include batio 3 , srtio 3 , and pdzrtio 3 . examples of metal oxide high - k dielectrics include oxides of refractory metals , such as zr and hf , and oxides of lanthanide series metals , such as la , lu , eu , pr , nd , gd , and dy . additional examples of metal oxide high - k dielectrics include al 2 o 3 , tio 2 , ta 2 o 5 , nb 2 o 5 and y 2 o 3 . the gate layer is formed by any suitable process including , for example , oxidation , spin coating , or cvd . in one embodiment , the layer is from about 1 nm to about 100 nm thick . in another embodiment , the layer is from about 3 nm to about 50 nm thick . in a further embodiment , the layer is from about 5 nm to about 30 nm thick . act 201 still further includes forming a gate electrode layer over the gate oxide layer . the gate electrode layer is typically a poly layer . fig4 illustrates a cross - section of the substrate 400 , taken along the line a - a ′ of fig3 after formation of a gate layer 405 and a poly layer 407 . a poly layer is one containing either amorphous silicon or polysilicon . in one embodiment , the poly layer has a thickness of about 40 nm to about 120 nm . in another embodiment , the poly layer has a thickness of about 50 nm to about 1000 nm . in a further embodiment , the poly layer has a thickness of about 60 nm to about 90 nm . act 201 also includes patterning the poly layer . the first step in patterning is generally forming a resist coating over the poly layer . any suitable resist may be used . the resist is lithographically patterned and the pattern is transferred by etching the exposed portion of the underlying poly and gate layers . fig5 illustrates the substrate 400 after patterning with resist coating 409 . after patterning the gate stacks , the resist is stripped the pattern includes gaps that have any suitable size or shape . in one embodiment , the pattern includes gaps having widths within the range from about from 0 . 01 to about 10 μm . in another embodiment , the pattern includes gaps having widths within the range from about from 0 . 01 to about 1 . 0 μm . in a further embodiment , the pattern includes gaps having widths within the range from about from 0 . 01 to about 0 . 045 μm . act 202 is forming the sidewall spacers 419 . this comprises depositing a spacer material and anisotropically etching the material . the spacer material remains only adjacent the gate stacks , as illustrated for the device 400 in fig6 . act 203 comprises a source / drain implant . fig6 illustrates the device 400 provided with source / drain regions 421 . the spacer material 419 creates a separation between the source / drain regions 421 and the gate stacks . act 204 is etching to remove the sidewall spacers . after the sidewall spacers are removed , the source / drain tail implants are formed by act 205 . act 206 is a spike anneal to activate the implants . the resulting structure is illustrated in fig7 . the source / drain regions 421 have expanded to include extension regions 423 . act 207 is an amorphizing implant for the source / drain extension regions . this provides a doped amorphous layer across the entirety of the source / drain regions including the source / drain extension regions . in this example , a deeper doped amorphous layer for the deep source / drain regions is not provided . act 208 is an sper anneal to re - crystallize the amorphous layer and form the shallow highly conductive region 425 illustrated in fig8 . if contacts are placed in the source and drain regions , the resistances between the contacts include a resistance across the channel , a resistance through source / drain extension regions beyond the shallow highly conductive region 425 , a resistance through the shallow highly conductive region 425 , and a resistance through the deeper part of the source drain regions 421 . the source / drain extension regions beyond the shallow highly conductive region have a small conductive cross - section and a relatively low conductivity , but are very short and therefore do not substantially increase the overall resistance . the shallow highly conductive regions 425 are the dominant conductive element of the source / drain extension regions and greatly reduce the resistivity of these regions relative to the tail implant alone . the deep source / drain implants provide a much larger cross sectional area for conduction and can maintain low resistance over comparatively long distances . the invention is particularly useful for semiconductor devices that are not stable at high temperatures . examples of such devices include devices using sige semiconductor crystals and devices that use high - k dielectics . highly conductive shallow junctions and source / drain regions can be formed with a minimum of high - temperature processing . although the invention has been illustrated and described with respect to one or more implementations , equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings . in particular regard to the various functions performed by the above described components ( assemblies , devices , circuits , systems , etc . ), the terms ( including a reference to a “ means ”) used to describe such components are intended to correspond , unless otherwise indicated , to any component which performs the specified function of the described component ( e . g ., that is functionally equivalent ), even though not structurally equivalent to the disclosed structure which performs the function in the herein illustrated exemplary implementations of the invention . in addition , while a particular feature of the invention may have been disclosed with respect to only one of several implementations , such feature may be combined with one or more other features of the other implementations as may be desired and advantageous for any given or particular application . furthermore , to the extent that the terms “ includes ”, “ having ”, “ has ”, “ with ”, or variants thereof are used in either the detailed description and the claims , such terms are intended to be inclusive in a manner similar to the term “ comprising .” | 7 |
referring to the drawings wherein identical reference numerals denote the same elements throughout the various views , fig1 illustrates an exemplary pit 10 excavated into the earth 12 in order to construct a swimming pool or similar structure . the pit 10 has a perimeter wall 14 extending downward from the ground surface 18 , and a floor 19 . a form 16 is placed on the ground surface 18 surrounding all or a portion of the pit 10 . in the illustrated example , the form 16 comprises a thin flexible sheet material such as formica secured in place with stakes 20 . the form 16 is typically offset laterally from the perimeter wall 14 by a specified dimension , for example about 30 cm ( 12 inches ). as seen in fig2 , prior to applying concrete , a reinforcing structure 22 is placed into the pit 10 adjacent the perimeter wall 14 . typically , the reinforcing structure 22 comprises a plurality of lengths of rebar . the rebar is configured in a grid pattern of horizontal rails 24 and uprights 26 which are tied to each other at their intersections using wire ties or other similar conventional structure . it will be understood that it is desirable for the rails 24 to be placed in a true level orientation relative to the earth , i . e . each complete rail lies in a single horizontal plane . it will be further understood that the floor 19 of the pit 10 will likely not be completely level , either intentionally or unintentionally . accordingly , it is generally necessary to use the form 16 as a level reference for the uppermost rail 24 ( the top of the form 16 would typically be set level to the earth during installation ). more specifically , multiple measurements are taken along the length of the rail 24 to ensure that the rail 24 is a constant vertical distance from the form everywhere around its perimeter . unfortunately , making these measurements is complicated by the fact that the form is offset from the perimeter wall 14 . this means that a single measuring instrument cannot easily be used to obtain an accurate measurement . additionally , even if all measurements are correct , the rail 24 must be held in the proper position until the complete reinforcing structure 22 is complete . in the prior art , this generally entails the use of pins or rods driven into the perimeter wall 14 of the pit 10 . for various reasons , these cannot be left in place and thus require additional labor to remove before the concrete can be applied . fig3 illustrates a tool or fixture 28 which may be used to set the rebar while avoiding the above - noted problems . the fixture is generally l - shaped and includes a first or vertical leg 30 and a second or horizontal leg 32 which meet at mutual proximal ends 34 , 36 . a hook 38 extends downward from the distal end 40 of the second leg 32 . an angle adjustment device 44 is disposed at or near the distal end 42 of the first leg 30 . in the illustrated example , the angle adjustment device 44 comprises a first threaded element 46 ( such as a nut ) affixed to or integral with the first leg 30 , and a second threaded element 48 ( such as a threaded rod or bolt ) which engages the first threaded element 46 . the second threaded element 48 includes a foot 50 ( such as a flat plate ) at one end , and a head 51 at the opposite end configured to be engaged by a wrench or other similar tool . for example , the head 51 may have a hexagonal shape . rotation of the second threaded element 48 in one direction moves the foot 50 towards the first leg 30 , and rotation of the second threaded element 48 and the opposite direction moves the foot 50 away from the first leg 30 . for the purposes of the present invention , any mechanism which provides a foot that can move inward and outward relative to the first leg 30 ( or in other words along an axis generally parallel to the second leg 32 ) may be used in place of the two threaded elements described above . a support bracket 52 is affixed to or integral with the first leg 30 and is located a predetermined vertical offset distance “ v ” from the second leg 32 . in the illustrated example , the support bracket 52 comprises a short section of l - shaped stock defining an upward - facing hook . if desired , multiple support brackets 52 may be provided at preselected distances along the first leg 30 , as shown . optionally , the support bracket 52 or brackets may be made movable or adjustable . for example , the first leg 30 could be provided with a plurality of spaced - apart holes , and the support bracket 52 could be attached using a fastener passing through a selected one of the holes . alternatively , the vertical leg could be attached to the first leg 30 using a sliding connection . optionally , the fixture 28 may be provided with means for measuring its inclination , such as a known type of mechanical or electronic level . for example , in fig3 a conventional bubble level 33 is shown attached to the second leg 32 . the fixture 28 and its constituent components may be constructed from any suitable material that will maintain its rigidity and dimensional stability in use . nonlimiting examples of suitable materials include wood , plastics , composite materials , and metals . in the illustrated example , the fixture 28 is fabricated from sections of steel tubing and steel angle stock welded together . fig4 illustrates an alternative fixture 128 which is generally similar in construction to the fixture 28 described above . elements of the fixture 128 not explicitly described may be considered to be identical to those of the fixture 28 described above . the fixture 128 includes a vertical leg 130 and a horizontal leg 132 which meet at mutual proximal ends 134 , 136 . a hook 138 extends downward from a distal end 140 of the horizontal leg 132 . an angle adjustment device 144 is disposed at or near a distal end 142 of the vertical leg 130 . at least one support bracket 152 is affixed to or integral with the vertical leg 130 and is located a predetermined vertical offset distance “ v ” from the horizontal leg 132 . the fixture 128 further includes a clamping mechanism 154 . in illustrated example , the clamping mechanism 154 comprises a first threaded element 156 affixed to or integral with the vertical leg 130 , near the proximal end 134 of the vertical leg 130 , and a second threaded element 158 which engages the first threaded element 156 . the second threaded element 158 includes a jaw 160 at one end ( for example a flat plate ), and a head 162 at the opposite end configured to be engaged by a wrench or other similar tool . for example , the head 162 may have a hexagonal shape . rotation of the second threaded element in one direction moves the jaw 160 towards the hook 138 , and rotation of the second threaded element 158 in the opposite direction moves the jaw 160 away from the hook 138 . the use of the fixture 28 will now be described with reference to fig5 . initially , a pit 10 is formed as described above , and the form 16 is installed . next , the fixture 28 is set into place adjacent the perimeter wall 14 with the hook 38 abutting the form 16 . this sets the first leg 30 at a fixed , predetermined lateral distance “ l ” ( fig3 ) away from the form 16 . the hook 38 is then secured to the form 16 to prevent the fixture 28 from moving . in the example shown in fig5 , the hook 38 is secured by using a conventional c - clamp 39 . alternatively , using the fixture 128 , the built - in clamping mechanism 154 would be used to secure the hook 138 to the form 16 . as another alternative , any conventional clamping or fastening means may be used . for example , a mechanical fastener such as a screw or bolt could be driven through the hook 38 and the form 16 . once the fixture 28 is secured , it is adjusted to ensure that the first leg 30 is in fact vertical or “ plumb ” to the earth . this may be done by using a conventional bubble level ( not shown ) placed abutting the second leg 32 or the first leg 30 , or by using the built - in inclination measuring means , if present . the foot 50 bears against the perimeter wall 14 . therefore , using the angle adjusting device 44 to move the foot 50 towards or away from the first leg 30 will cause the fixture 28 to pivot . once the fixture 28 is set with the first leg 30 plumb to the earth , the support bracket 52 will be positioned at a specific lateral distance l from the form 16 , and a specific vertical distance v as described above . the same procedure is repeated using a plurality of identical fixtures 28 around the entire perimeter of the pit 10 . once all the fixtures 28 are set , a length of rebar may then be set into each of the support brackets 52 , thus forming a rail 24 which is substantially in a single plane at a fixed distance below the ground surface 18 . this result is obtained without the need for any measuring . the process may be continued by placing additional rails below the first rail 24 . because the first rail 24 lies in a single plane , it is possible to set the next rail 24 by using simple offset measurements from the first rail 24 . alternatively , if the fixture 28 incorporates multiple support brackets 52 as described above , then the additional rails 24 may be formed by placing additional lengths of rebar into the additional support brackets 52 . the uprights 26 described above may then be set in place and connected to the rails 24 . once the support structure is in place , it is a self - supporting and the fixtures 28 are no longer required . accordingly , the fixtures 28 may be removed prior to the application of concrete . fixtures 28 may be reused indefinitely . the apparatus and method described herein has numerous benefits compared to the prior art . a primary benefit is a large reduction in the time required to set the reinforcing structure . another benefit is the ease of removal of the fixtures after use . the foregoing has described apparatus and methods for supporting a reinforcing structure . all of the features disclosed in this specification , and / or all of the steps of any method or process so disclosed , may be combined in any combination , except combinations where at least some of such features and / or steps are mutually exclusive . each feature disclosed in this specification may be replaced by alternative features serving the same , equivalent or similar purpose , unless expressly stated otherwise . thus , unless expressly stated otherwise , each feature disclosed is one example only of a generic series of equivalent or similar features . the invention is not restricted to the details of the foregoing embodiment ( s ). the invention extends , or to any novel one , or any novel combination , of the steps of any method or process so disclosed . | 4 |
fig1 is a phantom view of a vertebral body showing a transverse cavity 18 and a coordinate system 16 . this figure shows a vertebral body 10 in isolation . two possible surgical entry points into the vertebral body contemplated within the scope of the invention are illustrated . one entry point is “ transpedicular .” this approach is indicated by the physical location of tube 12 , traveling through the pedicle into the vertebral body 10 . another approach is “ extra - pedicular .” this access approach is illustrated by tool 14 entering the vertebral body at a location lateral of the transpedicular approach on the posterolateral corner of the vertebral body . the typical surgery will include a small incision in the back adjacent to the vertebral body . next , a small gauge needle or guide - wire is introduced to confirm proper positioning under fluoroscopy . physicians typically utilize an 11 - gauge needle for the transpedicular approach and a larger needle or tube ( up to 6 mm id ) for the extra - pedicular approach . many physicians advance cannulated tools over a small gauge needle to successively increase the size of the working channel . other physicians may prefer to place a guide catheter at the site and to introduce tools though the lumen of the guide catheter . in general , the tools described herein can be used either over the wire or through a guide catheter or alone at the election of the physician . in this figure , a coordinate system 16 identifies a vertical direction z , which points along the spine . the y - direction is generally anterior . it is the purpose of the invention to create a cavity with a fixed and controlled vertical extent ( z - axis height ) and a controlled shape in the x - y plane . for the purposes of this disclosure , the term transverse cavity will be used interchangeably with a cavity created parallel to the surface that is to be reduced or restored to its normal anatomic position , and generally normal to the force applied . the surface that is reduced or displaced defines the x - y plane . this definition holds for other procedures performed with the invention . returning to the figure , the cavity 18 is typically ovaloid in shape as projected in the x - y plane . the ovaloid shape has an approximately uniform height in the z direction . this “ shape ” is referred to throughout the specification as a “ transverse cavity ” for the vertebral body application illustrated in these figures . therefore the x - y plane is defined as the “ transverse plane ” and the z - axis direction may be referred to as the “ vertical axis .” it is a characteristic of all the embodiments of the tools shown in the application that the cross sectional area of the tool at the entry point into the bone is smaller than the transverse cavity created with the tool . to facilitate description of the invention , the distal “ working ” structures of the cavity creation tools are illustrated in isolation while the proximal manipulation handles as contemplated are shown generically as handle 20 and finger loop 21 . in each embodiment , a handle structure 20 can be moved with respect to the tool sheath or tool body 14 . in each embodiment , the relative motion between handle 20 and sheath 14 activates the distal working surfaces of the device . the handle 20 or the finger loop 21 is indexed to the distal working surfaces to provide confirmation of the orientation of the working surfaces with respect to the bone structures . it is contemplated that in addition to direct manual manipulation , other power sources can be used to actuate the working surfaces , including hydraulic or pneumatic cylinders and electromechanical actuators shown generically in fig1 as power source 23 . in general , purely manual mechanical mechanisms are preferred because they improve tactile feedback to the physician . the tools may be made of conventional materials , with stainless steel preferred for “ blade ” embodiments and nitinol or other super elastic alloys adopted for the flexible arm embodiments . the tools may be reusable or disposable . materials choices do not appear critical for carrying out the invention . the overall length of the cavity creation tool from the handle structures 20 and 21 to the working distal tip may vary to facilitate the particular surgical procedure . for example , a length of 220 cm is useful for the vertebral application , while a length of 60 cm is a practical value for a tibial plateau procedure . fig2 shows an embodiment of the cavity creation tool 30 that includes a blade 38 mounted on the tool body 14 for rotational motion around the pivot 34 . the rod 32 is coupled to a proximal handle 20 ( fig1 ) and a push - pull motion between the handle and the finger loop 21 ( fig1 ) causes the blade to sweep out an arc 40 . the blade may be blunt or it may include a cutting surface 42 . in operation , the blade 38 laterally loads cancellous bone , breaking or cutting the bone in the x - y plane of the cavity . the pivot and blade are confined to a transverse plane so this action creates the transverse cavity . by advancing the tool along the axis 36 , the cavity may take an approximately oval shape in the x - y plane . fig3 shows a cavity creation tool 62 having a distal end that is positioned in a vertebral body . the distal end includes two arms . a first arm 52 is anchored to the tube 14 with a hinge point mechanism 56 at a first end . the second end of the arm 52 is coupled to the pull rod 64 . relative motion between the tube 14 and the pull rod 64 expands the first arm in a transverse plane . this particular embodiment of the tool is asymmetric and the tool includes a second arm 58 that is anchored to the tube 14 with a hinge mechanism 60 . the first and second arms define a plane for the operation of the device in the transverse plane . fig4 shows a cross section of the tool body 14 having a notch or groove 15 for locating and restraining a pull rod 32 . the tool body cross section defines the tool body area for the cavity creation tool . in general , the tool may be inserted into a bone through a hole of the size of the tool body area . this parameter or area is always smaller than the “ footprint ” of the transverse cavity in the x - y plane . the cross section of this portion of the tool defines the tool body area . fig5 shows a pull rod 32 is constrained in a groove in the tool body 14 . in this embodiment the pull rod actuates a blade or other structure . the cross section of this portion of the tool defines the tool body area . fig6 shows an embodiment of the tool that has two pull or push rods 100 and 106 . pull rod 106 operates a first arm 108 while the second arm 102 is activated by the independent pull rod 102 . the asymmetrical operation of the two independent arms can be used to control the shape of the cavity by directing expansion of the cavity to preferred areas within the vertebral body . fig7 shows an embodiment of the tool 70 where a container 72 surrounds a pair of arms 52 and 58 . the container interacts with the cancellous bone as the pull rod activates the arms and moves them against the cancellous bone . the container prevents debris from interfering with the retraction of the arms . the container 72 can be subsequently inflated to reduce the fracture and restore the natural anatomy . finally , the container may be detached and left behind . in this particular embodiments the first and second arms are identical , and will normally create a symmetric cavity . the container 72 is optional and the arms can be used alone in a fashion analogous to other versions of the tool . in this particular embodiment , the first and second arms have blunt dissection surfaces on the exterior of the arms to interact with cancellous bone . in this embodiment , the first and second arms may also have different mechanical properties for the creation of an asymmetric cavity . fig8 shows an embodiment of the cavity creation tool 80 that includes saw - like teeth on the first arm 88 and the second arm 82 . once again , traction on the pull rod 64 causes the teeth on the arms to cut through the cancellous bone . in a fashion similar to related embodiments , the arms lie in and define a cutting plane that creates a transverse cavity . the saw teeth typified by tooth 90 can be moved by manipulating both the pull rod and the tube . fig9 shows a cable - actuated device with a cable 200 wrapping a spindle or axle 202 mounted on the tool body 214 . cable motion results in sweeping out an arc 210 as seen in fig1 . fig1 shows the blade 38 can sweep through 360 degrees because of cable actuation . an arc of less than 360 degrees may be used when a non - circular cavity is required . fig1 is a cable - operated version with the pull rod 232 coupled to cable 200 . in this device , the pull on the cable forces the flex arms 202 and 208 in an outward direction to form the transverse cavity . fig1 shows the cable - operated version of fig9 with the arms deployed , creating a transverse cavity . fig1 which represents the prior art is a schematic of a balloon or other hydraulic lifting device as it is initially inserted into the vertebral body . fig1 is a schematic of the increased lifting force generated by a balloon or other hydraulic lifting device which immediately reaches a broad surface area because of the transverse cavity that has been prepared before deploying the balloon or hydraulic lifting device . although the invention has been illustrated in one context , it should be apparent that the device features maybe modified or combined in alternate configurations . | 0 |
the principles and operation of a system and a method for virtual hyperlinking according to the present invention may be better understood with reference to the drawings and accompanying description . in this document , the term to “ virtual hyperlinking ” or “ virtual hyperlink ” refers to a hyperlink from a first web - page to a second web - page wherein at least a part of the content of the second web - page is “ computer generated content ”. the term “ computer generated content ” refers to content generated for the associated web - page “ on - the - fly ”, typically in response to input data provided by a user . in the virtual hyperlinking system and method described herein , the input data to generate the content within the second web - page is provided by the virtual hyperlink embedded within the first web - page . before explaining at least one embodiment of the invention in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments or of being practiced or carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting . in this document , an element of a drawing that is not described within the scope of the drawing and is labeled with a numeral that has been described in a previous drawing has the same use and description as in the previous drawings . similarly , an element that is identified in the text by a numeral that does not appear in the drawing described by the text has the same use and description as in the previous drawings where it was described . reference is now made to fig1 , which is a simplified illustration of a virtual hyperlinking system 10 connecting a visual element in a first web - page to a second web - page that is generated on - demand . according to an embodiment of the present invention . as seen in fig1 the virtual hyperlinking system 10 preferably contains the following elements : a first information server 11 containing a first web - page 12 containing computer - generated content 13 ; a second information server 14 containing a second web - page 15 containing one or more virtual hyperlinks 16 to the computer - generated content 13 ; a network display device 17 , such as a desktop computer , a laptop computer , a pda , a cellular telephone , etc ., communicating via a communication network 18 with the first information server 11 and via a communication network 19 with the second information server 14 ; it is appreciated that the communication networks 18 and 19 can be the same network . it is also appreciated that the communication networks 18 and / or 19 can be any type of communication network such as a wired communication network and / or a wireless communication network , such as wan , man , lan or pan communication networks , such as telephone network , cellular network , ip network , wimax , wifi or bluetooth networks . preferably , the communication networks 18 and / or 19 use the internet , and particularly the world - wide - web ( www ). it is appreciated that the first web - page 12 and the second web - page 15 contain displayable content and that the network display device 17 can display the displayable content . typically , the network display device 17 use a regular internet browser and the first web - page 12 and the second web - page 15 contains content displayable by an internet browser . the first information server 11 typically generates the computer - generated content 13 on - the - fly in response to data input and instructions from a user . the computer - generated content 13 is therefore typically not present on the first information server 11 as a fixed web - page , but is presented on - demand , in response to the user &# 39 ; s request , and / or query , and / or input and / or instructions . for example , a map is presented by the first information server 11 after a user has entered the required location , typically by entering text such as the name of a city , the name of a street , the name of a geographical location or entity such as a mountain or a lake , etc . when the map is presented the user can zoom in or zoom out and / or pan the image to arrive at the most useful view of the area . the user may also request the first information server 11 to add or remove details such as hotels , petrol stations , restaurants , etc . this type of content is typically available at the first information server 11 but presented to each user upon user &# 39 ; s request . if the computer - generated content 13 contains a three - dimensional view of a three - dimensional model the user can further manipulate the computer - generated content 13 according , for example to the preferred viewing orientation . in other types of computer - generated content 13 the user can add elements to the image , such as visual marks , annotations , etc . the first information server 11 can save the added elements and display them to the user when the user requests the appropriate computer - generated content 13 . however , these elements are not available to other users . as seen in fig1 , the second information server 14 preferably contains the second web - page 15 that is communicated to , and displayed by , the network display device 17 . the second web - page 15 preferably contains one or more virtual hyperlinks 16 . the virtual hyperlinks 16 can take the form of an icon , such as the virtual hyperlink 16 designated by numeral 20 , or as a text , preferably designated by a different color , underlined fonts , different font type , highlighting , etc ., such as the virtual hyperlink 16 designated by numeral 21 . the virtual hyperlink 16 preferably contains web address 22 of the first web - page 12 , or , alternatively , web address of the first information server 11 , and context information 23 required to cause the first information server 11 to generate a specific computer - generated content 13 . thus , when a user accesses the second web - page 15 and invokes a virtual hyperlink 16 the network display device 17 preferably instructs the first information server 11 to generate a specific computer - generated content 13 as designated by a programmer of the second web - page 15 . to enable the programmer of the second web - page 15 to create the virtual hyperlink 16 and to embed in it the context information 23 , the second information server 14 preferably contains a hyperlinking program 24 . alternatively , the hyperlinking program 24 resides on a third information server 25 , also connected to the communication network 19 . when creating the virtual hyperlink 16 , the programmer accesses the first information server 11 and invokes a recording process of the hyperlinking program 24 . the programmer accesses the first web - page 12 and performs all the user activities required to generate the computer - generated content 13 . the recording process records these user activities . preferably , the recorded activities include actions such as text entries , check - box selections , radio - button selections , zoom , pan and similar image manipulations , etc . the recorded activities are then packed by the hyperlinking program 24 as the context information 23 and embedded in the virtual hyperlink 16 . alternatively , the programmer accesses the first web - page 12 and performs all the user activities required to generate the computer - generated content 13 . then the programmer invokes the hyperlinking program 24 that sends a link request 26 to the first web - page 12 . in response to the link request 26 , the first web - page 12 sends to the hyperlinking program 24 all the information ( element 27 of fig1 ) required to generate the computer - generated content 13 as specified by the user . the hyperlinking program 24 packs this information in the form of the context information 23 and embeds it in the virtual hyperlink 16 . the network display device 17 preferably includes a virtual hyperlinking routine 28 , typically implemented as an add - on ( plug - in ) module for the web - browser software . when the user invokes the virtual hyperlink 16 the virtual hyperlinking routine 28 accesses the first information server 11 ( or the first web - page 12 ) and sends it the context information 23 to generate the required computer - generated content 13 ( element 29 of fig1 ). thereafter , the first information server 11 generates the computer - generated content 13 according to the context information 23 and the computer - generated content 13 is communicated to the network display device 17 , which then preferably displays the computer - generated content 13 to the user . alternatively , the context information 23 is communicated from the network display device 17 to the first information server 11 via the third information server 25 , and the responsive computer - generated content 13 is communicated from the first information server 11 to the network display device 17 via the third information server 25 . the third information server 25 additionally maintains a database of collateral information , such as advertising , that is indexed according to parameters that are common in the context information 23 . the third information server 25 uses the communicated context information 23 to search and retrieve appropriate collateral information 30 and add it to the computer - generated content 13 communicated back to the network display device 17 . it is expected that during the life of this patent many relevant communication technologies will be developed , and the scope of the terms herein , such as link , hyperlink , map server , geographical information system and three - dimensional model display , is intended to include all such new technologies a priori . it is appreciated that certain features of the invention , which are , for clarity , described in the context of separate embodiments , may also be provided in combination in a single embodiment . conversely , various features of the invention , which are , for brevity , described in the context of a single embodiment , may also be provided separately or in any suitable sub - combination . although the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of the appended claims . all publications , patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification , to the same extent as if each individual publication , patent or patent application was specifically and individually indicated to be incorporated herein by reference . in addition , citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention . | 6 |
the present invention includes a septic system including a riser system that is used to provide access to the septic tank wherein the septic tank and riser system are manufactured utilizing a blow - molding technology . the utilization of blow - molding technology allows for the easy incorporation of innovative and useful features over a typical septic tank system . the general blow molding manufacturing process is well known . the manufacturing process for the various components of the septic tank system involves the same machine components as an injection molding process for the components of septic tank systems except for two variations . the first variation includes the gathering of the plastic material in an “ accumulator head ” which is located directly above a mold . the mold &# 39 ; s head is filled with plastic and before the mold closes , a hollow plastic tube , referred to as the parison , is forced out of the head and held in place while the mold closes on it . the plastic in its molten state has a consistency similar to bubble gum . the second variation in the blow molding process versus the injection molding process lies in the clamp , or “ platen ,” that holds the mold closed during the blow - molding process . once the mold closes ( and in some applications , as described below , before the mold completely closes ), the soft parison is pierced with a needle prior to the introduction of air under pressure , typically about 100 psi air . in some cases , rather than using a piercing needle , there is a channel in the mold through which the air is introduced . with the introduction of pressurized air , the part is biased against the mold cavity and takes the shape of the mold . another advantage of the blow - molding process for the formation of the septic tank system is that it allows for the formation of irregular shaped parts that have a plurality of layers , because it uses a multi - layer co - extrusion process . this allows for the manufacture of a septic tank system wherein the material of each layer can be selected for it &# 39 ; s specific performance qualities . this allows for the cost - effective construction of a watertight and corrosion resistant system . material for each layer can be selected to provide different mechanical , chemical or aesthetic properties . the material for the exterior layer , for example , can be selected from a plastic material that confers rigid properties , such as a high molecular weight plastic . it can also include uv stabilizers and colorants for marketing purposes . multi - layer blow molding techniques are more cost - effective than rotational molding , for example , because the use of such additives , which can be expensive , is limited to the layers in which they are necessary and most effective . similarly , material for other layers can be selected based on its resistance to chemical activity , its food grade characteristics or for its relative cost or availability . one skilled in the art would recognize that there are numerous plastics materials that could be chosen for both the interior and exterior layers of the system . referring now to fig1 , there is shown a septic tank 10 that is formed using the blow molding technique . the tank 10 includes inlet and outlet ports 11 . the ports 11 are positioned at various locations about the tank 10 in order to provide for ease on installation . the tank 10 is formed using ribs 12 to provide reinforcement to the overall structure . the tank 10 includes anti - flotation winglets 14 along the outer periphery of the tank 10 . the winglets 14 help to stabilize the tank 10 when the tank 10 is buried in soil . the winglets 14 may be parallel to the soil surface or , more preferably , are inclined off of parallel in relation to the soil surface in order to provide greater stability to the tank 10 . the winglets 14 may include holes 15 ( fig2 ) that can be used to provide an attachment point for securing tank 10 to an anchor ( not shown ) when a tank 10 is installed in conditions that require additional anti - flotation measures . during shipment of tanks 10 , holes 15 provide a means of connecting a number of tanks 10 together ( bundling ) and also provide a means of securing tanks 10 to the shipment vehicle . the ability to bundle the tanks allows for ease of loading at the manufacturing site , ease and safety of unloading at the customer &# 39 ; s yard with the standard forklift equipment normally found at a distributors location , and allows for use of commercially standard open deck flat or step - deck trailers ( does not require specialized basket or racked trailers ). referring now to fig3 , the tank 10 also includes flange segments 13 around the periphery of the tank 10 , located between each adjacent pair of ribs 12 . the flange segments 13 are in the same plane as the anti - flotation winglets 14 . the flange segments 13 and winglets 14 form a continuous stiffening structure around the perimeter of the tank 10 , which prevents the present invention from suffering from “ creep .” as described in more detail below , the flange segments 13 and winglets 14 are formed from compression molding techniques as part of the molding process of tank 10 . referring now to fig4 , the bottom and top surfaces of the septic tank 10 include paths defined on the interior of the tank 10 by the terminal portions of the ribs 12 . the liquid pass - through on the bottom surface of the tank 10 entails a path defined by gaps 18 formed between the interior terminal portions of the ribs 12 . the liquid pass - through allows for the liquids that are present in the tank 10 to have a free flow path unobstructed by the solids or sludge layers that may form in the septic tank during use , or by the ribs 12 . the tank 10 also includes a gas pass - through in the top surface of the tank 10 , which is shaped in the same fashion as the liquid pass - through and similarly allow gas to pass from one end of the tank 10 to the other end in an unobstructed fashion . the gaps 18 are formed in the full height of the ribs 12 . this is possible in the present invention because the flange segments 13 and circumferential profile ( described below ) of the tank provide sufficient structural rigidity that it is not necessary to maintain any portion of ribs 12 through the gaps 18 . it is also possible because the gaps 18 in adjacent ribs 12 are offset from each other . the liquid pass - through and gas pass - through are serpentine because the gaps 18 in each adjacent rib 12 are offset from each other . the gaps 18 are offset to provide additional structural strength to the tank 10 . a series of aligned gaps 18 would provide similar gas and liquid pass - through capability , but would create a line of structural weakness in tank 10 . by offsetting the gaps 18 to form serpentine paths for liquid pass - through and gas pass - through , liquid and gas flow is permitted without substantially weakening the structural integrity of the tank 10 . each rib 12 is approximately 2½ to 3 inches in height . those skilled in the art will recognize that other dimension are within the scope of this disclosure . the relative height of each rib 12 varies throughout the tank . specifically , ribs 12 near the ends of tank 10 approximate the ovo - rectangular profile of tank 10 when viewed from either end . approaching the mid - portion of tank 10 , the ribs 12 become more circular , which enhances their structural strength . thus tank 10 has a modified hourglass shape . fig5 depicts for comparison the profile of a rib 12 a that is located near one end of a tank 10 ( fig5 a ) and the profile of a rib 12 b that is located near the mid point of tank 10 ( fig5 b ). the tank 10 includes access openings 16 to allow access for service and maintenance . referring to fig6 , the access openings 16 in the preferred embodiment include threads , which interface with either a secure cover 30 or a riser system 40 . it is the blow molding process that allows for the manufacture of parts with much higher precision than in the prior art methods of septic tank system manufacturing . this higher level of precision allows for the manufacture of a threaded opening 16 in the tank 10 . the threaded openings 16 can then be closed and secured with a either a cover 30 or riser system 40 , both of which are manufactured with threaded connections . covers 30 and riser systems 40 preferably are manufactured using blow molding techniques . the cover 30 is also manufactured to include a gasket 32 that is biased by the mechanism of the mutually engaged threads . the cover 30 also includes an additional advantage of the use of threaded connections in the riser system 40 is the easy retrofit of a riser system 40 into an existing concrete septic system 42 . cover 30 is hollow , and includes one or more ports 34 that communicate to the interior of the cover 30 , which allows the installer to put insulation , ballast ( such as sand or water ), or other material into the cover 30 . cover 30 preferably is formed with standoff pillars 36 to provide additional structural rigidity . in some instances , it is preferable to supply a cover that fits into standard size openings such as a standard 24 ″ corrugated pipe . typical corrugated pipe does not have a threaded connection . referring to fig3 , there is shown a cover 50 that is manufactured with a very rigid flat top surface 52 , a gasket 54 , and a frustoconical lower section 56 that fits into the corrugated pipe 60 ( fig4 ). because corrugated pipe is typically not manufactured to exacting specifications , the size of the opening in the pipe often varies . in the present invention , the shape of the lower section 56 allows for a slip fit into the pipe 60 . cover 50 is manufactured using blow molding techniques , which allows for the easy incorporation of additional features into the cover 50 . the cover 50 includes security features 57 that provide the ability to secure the cover 50 to the pipe 60 . the cover 50 can also have ports 59 that communicate to the interior of the cover 50 , which allows the installer to put ballast , such as sand or water , into the cover 50 . port 59 preferably is located on the bottom surface of cover 50 , but can be located anywhere that provides communication with the interior of cover 50 . the use of the security features 57 and ports 59 provide many benefits to the end user . cover 50 preferably is formed with standoff pillars 58 to provide additional structural rigidity . the process of manufacturing tanks 10 according to the present invention includes the steps of preparing a parison , placing the parison in a mold , pinching one end of the parison to form a “ bottle ”, and introducing gas into the bottle to cause it to conform to the shape of the mold . preferably , the mold for a tank 10 according to the present invention comprises two pieces , each of which includes a mating face . when the parison is placed in the mold , the two pieces are separated to allow insertion of the parison . according to the present invention , the two pieces of the mold initially are only partially closed . that is , a gap sufficient to allow the parison to pass partially between the mating faces of the mold pieces is maintained initially between the mating faces of the pieces of the mold after one end of the parison has been pinched to form a bottle . at this point gas , preferably atmospheric air , is introduced into the bottle , causing it to expand . the natural expansion of the bottle causes it to force molten plastic material into the gap between the mating faces of the two pieces of the mold . at this point the pieces of the mold are closed together to compress the molten plastic between the mating faces of the mold pieces . this compression molds the portion of the bottle that is between the mating faces of the mold pieces . the flange portions 13 and winglets 14 according to the present invention are formed by this compression molding step . in this way , the present invention provides flange portions 13 and winglets 14 that have substantially more structural strength than can be achieved using rotational molding techniques . as gas is injected into the balloon , the portions of the balloon that are not compressed between the mold pieces thin slightly and consistently relative to the portion of the bottle in the area of the mold pieces mating faces . the wall thickness of tanks 10 thus varies in a consistent fashion so that the wall thickness in the area of the flange portions 13 is approximately 2 – 3 times the average wall thickness of the tank 10 . this provides additional structural rigidity to prevent installed tanks 10 from experiencing creep . | 1 |
the invention door handle assembly 10 is seen in fig1 in association with a fragmentarily shown motor vehicle 12 including a windshield 14 , a front quarter panel 16 , a hood 18 , an a pillar 20 , a sill 22 , a b pillar 24 , and a door 26 positioned in the door opening defined by the a pillar 20 , front quarter panel 16 , sill 22 , and b pillar 24 . door 26 ( fig2 ) includes an inner skin 26 a , an outer skin 26 b , and a latch 28 mounted on a shut face 26 c of the door and arranged for coaction in known manner with a bolt or striker 30 mounted on the b pillar 24 . motor vehicle door handle assembly 10 ( see also fig3 ) includes an outside door handle assembly 32 , an outside door handle linkage 34 , an inside door handle assembly 36 , an inside door handle linkage 38 , and a common latch actuator assembly 40 . outside door handle assembly 32 ( fig3 and 5 ) includes a handle 42 and a housing or escutcheon 44 . housing 44 is mounted in a suitable opening in the outer skin 26 b of the door and has a generally oval configuration . housing 44 includes a peripheral rim portion 44 a surrounding a central recessed bowl portion 44 b . the inner face 44 c of the housing defines an inwardly projecting hollow guide portion 44 d and spaced pillar portions 44 e and 44 f . handle 42 has an elongated configuration and includes a main body grip portion 42 a and an arm portion 42 b extending inwardly from a rear end 42 c of the handle . front end 42 d of the handle includes a pivot portion 42 e for pivotally mounting the handle in known manner to the front end 44 g of the housing , and the arm 42 b extends inwardly and slidably through guide portion 44 d of the housing to dispose an opening 42 f at the free end of arm portion 42 b within the interior of the door . outside door handle linkage 34 ( fig6 , 9 and 10 ) comprises a lever 46 and a pin 48 . lever 46 is pivotally mounted at one end 46 a thereof on a pivot pin 47 extending between the inner ends of housing pillars 44 e and 44 f . the end 46 a of lever 46 is configured to define a through bore 46 b receiving pivot pin 47 , a hub or journal portion 46 c centered on bore 46 b , and an arcuate driver portion 46 d centered on bore 46 b outwardly of hub 46 e . arcuate driver portion 46 f may have an arcuate extent of , for example , 110 ° and has an axial extent exceeding the axial extent of hub portion 46 b so that arcuate driver portion 46 d overhangs hub portion 46 c . pin 48 is fixedly secured to the other end 46 e of lever 46 and extends in a direction opposite to the extent of hub portion 46 c and driver portion 46 d . pin 48 is received in the opening 42 f of arm portion 42 b of handle 42 so that pivotal movement of the handle about its front end 42 d has the effect , via the driving interconnection between pin 48 and opening 42 e , of pivoting lever 46 about the fixed axis 49 defined by pin 47 . inside door handle assembly 36 ( fig2 and 3 ) includes a handle 50 and a housing or escutcheon 52 . housing 52 is fixedly secured in a suitable opening in the inner skin 26 a of the door and defines a main body portion 52 a , defining a central concavity 52 b , and a cable mounting portion 52 c . handle 50 is suitably mounted in the concavity 52 b of main body housing portion 52 a for pivotal movement about a pivot pin 53 carried by housing 52 and includes a gripping portion 50 a for grasping by the vehicle operator and a cable attachment end portion 50 b . inside door handle linkage 38 ( fig2 and 6 ) includes a cable assembly 54 and a bracket 56 . cable assembly 54 is of the bowden type and includes a central core or cable 58 , an outer sheath 60 , and a fitting 62 . bracket 56 is fixedly secured to the inner skin 26 a of the door at a location proximate the outside door handle assembly and fitting 62 is fixedly secured at the outboard end of the bracket and extends downwardly from the bracket . sheath 60 is fixedly secured at one end in the lower end of fitting 62 and at its other end in the mounting portion 52 c of the inside door handle housing 52 . cable 58 is connected at one end to inside handle cable attachment portion 50 b and extends through housing mounting portion 52 c , through sheath 60 , and through fitting 62 to define an upper cable end 58 a extending upwardly from fitting 62 and defining a head 58 b at its upper free end . it will be seen that pivotal opening and closing movement of inside door handle 50 has the effect of sliding cable free end 58 a upwardly and downwardly within fitting 62 . common latch actuator assembly 40 ( fig6 , 8 , 9 and 11 ) includes a latch actuator lever 64 , a spring element 66 , and a damper mechanism 68 . latch actuator lever 64 includes an inner end 64 a and an outer end 64 b . outer end 64 b includes an aperture 64 c for receipt of the upper end 70 a of a latch actuator rod or linkage 70 . the inner end 64 a of the lever is configured to define a central bore 64 d for receipt of pivot pin 47 , a hub or journal portion 64 e centered on central bore 64 d , and an arcuate driver portion 64 e centered on hub portion 64 d outwardly of hub portion 64 e , and a gear segment 64 f centered on bore 64 d at a location circumferentially removed from driver portion 64 e . driver portion 64 e may have an arcuate extent , for example , of 180 ° and has an axial extent exceeding the axial extent of hub portion 64 e so that the arcuate driver portion extends axially beyond the hub portion . lever 64 further defines a spring mount hub portion 64 g concentric with bore 64 d and through which pivot pin 47 extends for mounting in housing pillar 44 f . lever 64 further includes a mounting structure 64 h positioned between inner and outer ends 64 a and 64 b and having a central bore sized to slidably receive the upper end 58 a of cable 58 . the headed end 58 b of the cable precludes separation of the cable from the mounting portion 64 h , provides a driving connection between the cable and the lever 64 , and allows lost motion between the cable and the lever 64 . in the assembled relation of levers 46 and 64 , pivot pin 47 passes centrally through aligned bores 46 b and 64 d , hub portions 46 c and 64 e slidably interface , and arcuate driver portion 46 d is located circumferentially within the missing arcuate portion of arcuate driver portion 64 e . it will be seen that driver portions 46 d and 64 e allow driving movement of lever 46 with respect to lever 64 in one direction while allowing lost motion movement between lever 64 and 46 in the opposite direction . spring element 66 comprises a coil spring and is mounted on spring mount portion 64 g of lever 64 with one end 66 a of the spring hooked under the lower edge of lever 64 and the other end 64 b of the spring suitably anchored with respect to outer door handle housing 44 . spring 66 acts to resist downward pivotal movement of lever 64 about axis 49 and returns lever 64 upwardly to a rest position in the absence of forces pivoting the lever downwardly . damper mechanism 68 includes a cylindrical housing 72 fixedly secured to pillar 44 f ; a shaft 74 centrally mounted within the housing ; a vane structure 76 mounted on the shaft for rotary movement with the shaft within the housing , a gear 78 mounted on a free end of shaft 74 exteriorly of the housing 72 and meshingly engaging with gear segment portion 64 f of lever 64 , and a viscous fluid 80 positioned within the housing in surrounding relation to vane 76 . it will be seen that pivotal movement of lever 64 about axis 49 has the effect of rotating gear 78 whereby to rotate vane 76 within housing 72 against the viscous resistance of fluid 80 so as to provide a viscous damping resistance to the pivotal movement of lever 64 . in the operation of the invention door handle assembly , either the outside door handle may be pivoted to unlatch the latch 28 or the inside door handle may be pivoted to unlatch the latch 28 , the opening movement of the respective handle in each case not disturbing the other handle by virtue of the lost motion connections provided at the common latch actuator assembly 40 . specifically , as the outside door handle is pivoted outwardly to an unlatching position , handle arm 42 b engages pin 48 to pivot lever 46 about axis 49 . as lever 46 is pivoted about axis 49 , arcuate driver portion 46 d of lever 46 engages an end face 64 h of arcuate driver portion 64 e of lever 64 to pivot lever 64 downwardly and move rod 70 downwardly in a manner to unlatch latch 28 . as the lever 64 is pivoted downwardly , the upper end 58 a of cable 58 slides in a lost motion manner in mounting structure 64 h so as not to disturb the inside door handle assembly . conversely , when inside door handle 50 is pivoted outwardly to unlatch the latch , cable 58 pulls lever 64 downwardly by virtue of cable head end 58 b to move rod 70 downwardly in an unlatching direction . as the lever moves downwardly the leading face 64 i of arcuate driver 64 e moves in an idling , lost motion manner within the gap 80 defined between the trailing face 46 f of driver segment 46 d and the leading face 64 i of arcuate driver 64 e to ensure that the opening movement of the inner door handle does not disturb the outer door handle . as lever 64 is pivoted downwardly to unlatch the latch in response to either opening movement of the outside door handle or opening movement of the inside door handle , spring 66 resiliently resists the downward movement to provide a positive “ feel ” for the opening movement of the respective handle and the spring acts in response to release of the respective handle to positively return the handle to its rest position by exerting an upward pivotal force against lever 64 . further , as lever 64 is pivoted downwardly or upwardly about axis 49 , damper mechanism 68 acts to provide a damping force resisting the latching or unlatching movement of the mechanism , thereby to cushion the latching and unlatching movement of the mechanism and in particular to mollify the return movement of the inside door handle and the outside door handle upon release of the handle to preclude objectionable slapping noises as the handle resumes its rest position with respect to the respective housing . the invention door handle assembly , by providing many common elements in the outside door handle linkage assembly and the inside door handle linkage assembly , significantly reduces the cost of the system without any sacrifice in the performance of the system . specifically , the use of a common latch actuator assembly allows the use of a common spring to provide spring biased movement of both the inside and outside door handles and the common latch actuator arrangement further allow the provision of a common damping mechanism to provide a damping action with respect to the closing movement of both the inside and outside door handles . the overall effect of the invention is to provide a total inside / outside door handle assembly for a motor vehicle having performance equal to or superior to prior art systems employing individual inside and outside linkages and at a price that is significantly less than the combined price of the inside and outside door handle assemblies by virtue of both reduced parts costs and reduced labor costs . whereas a preferred embodiment of the invention has been illustrated and described in detail , it will be apparent that the various changes may be made in the disclosed embodiment without departing from the scope or spirit of the invention . | 8 |
the present invention comprises a training tourniquet that can be used to practice and / or train how to use a real tourniquet . the training tourniquet allows a person to practice how to use a real tourniquet , but with the benefit of not actually applying a compressive force to the appendage via the tensioning mechanism , because in the training tourniquet the tensioning mechanism is actually a non - functioning tension mechanism . to understand different embodiments of the training tourniquet , real versions of tourniquets are also illustrated and described . referring now to fig1 , an actual functioning or real tourniquet 10 is shown . the real tourniquet 10 comprises a first elongated member or an outer sleeve 14 , a second elongated member , inner tightening member or inner strap 18 , a tightening mechanism 22 and a securing mechanism 26 . as shown in fig1 , the real tourniquet 10 can be applied to an appendage , as for example , leg l , and then tightened to restrict the flow of blood to the leg l . referring now to fig2 , the real tourniquet 10 is shown prior to use , or in a stretched - out orientation . the outer sleeve 14 comprises a longitudinally extensive material having a first end 30 and a second end 34 . the second end 34 includes a restraining mechanism comprising a buckle 38 . when the real tourniquet 10 is applied to a limb , such as leg l shown in fig1 , the first end 30 is looped through the buckle 38 and pulled tight around the appendage , thus providing a means for circumferentially surrounding or encircling the limb . fig3 depicts the real tourniquet 10 after the first end 30 has been looped through the buckle 38 . referring now to fig4 , the outer sleeve 14 may be formed of two panels comprising an upper or first panel 42 and a lower or second panel 46 . the edges of the panels 42 and 46 are connected , as for example , by sewing , gluing , stapling , clamping , or heat / ultra - sound ( sonic ) welding , or combinations thereof . outer sleeve 14 includes a pocket , interior area or inner space 44 between the panels 42 and 46 . the first panel 42 comprises an outer surface 50 that includes hook and loop structures , or both hook structures and loop structures along substantially the entire length of the outer sleeve 14 between the first end 30 and an opening 54 where the inner strap 18 is exposed between the first panel 42 and second panel 46 of the outer sleeve 14 . thus , when the first end 30 of the outer sleeve 14 is looped through the buckle 38 , the outer surface 50 may be applied to itself , thereby securing the position of the outer sleeve 14 . the first panel 42 may comprise a length of omni - tape ® ( velcro industries b . v ., amsterdam , netherlands ), wherein the fastening surface comprises both hook and loop structures on the outer surface 50 as depicted in fig4 . the use of a combination of both hook and loop structures on the outer surface 50 of the outer sleeve 14 provides the advantage of the tourniquet being quickly adjustable when in use to accommodate a variety of size appendages , as for example , from a person &# 39 ; s thigh to a person &# 39 ; s forearm . in use , to size the tourniquet to the appendage , the user simply wraps the tourniquet around the subject appendage , loops the first end 30 of the outer sleeve 14 through the buckle 38 , pulls the tourniquet reasonably tight , and then presses the outer surface 50 together detachably interlocking first and second portions of the outer surface 50 together to interlock the hook and loop structures of the outer surface 50 within the region where the outer surface 50 overlaps beyond the buckle 38 . referring still to fig4 , the inner strap 18 is shown between the first panel 42 and the second panel 46 of the outer sleeve 14 . the inner strap 18 comprises a length of nylon binding strap ( also known as nylon binding tape ) that extends from first end 30 of the outer sleeve 14 to the buckle 38 and returns to the first end 30 such that the inner strap 18 comprises a loop . the ends of the inner strap 18 are anchored only at the tip 58 of the first end 30 of outer sleeve 14 , as for example , by sewing , gluing , stapling , clamping , or heat / ultra - sound ( sonic ) welding , or combinations thereof . thus , the inner strap 18 can slide within the interior space 44 of the outer sleeve 14 . accordingly , the inner strap 18 comprises a material that has frictional characteristics allowing it to slide within the interior space 44 of the outer sleeve 14 when a tensile force is applied to the inner strap 18 . the real tourniquet 10 may be configured such that a single layer ( i . e ., not a loop ) of material is used to form the inner strap 18 . here , a first end of the inner strap 18 is anchored at or near the tip 58 of the first end 30 of the outer sleeve 14 , and a second end of the inner strap 18 is anchored at or near the buckle 38 , with the middle portion not anchored to the outer sleeve 14 , and thereby able to slide within the outer sleeve 14 . the tensioning mechanism 22 can be used to tighten the inner strap 18 , such as by winding the windlass 74 to develop a tension force in the inner strap 18 . referring still to fig4 , the real tourniquet 10 includes a base member 62 . a first end 66 of base member 62 includes a securing mechanism 26 , as will be discussed below . the second panel 46 of the outer sleeve 14 extends over at least a portion of the base member 62 , passes through a means for looping , such as buckle 38 , and folds back to a second end 70 of the base member 62 . the inner strap 18 emerges from the outer sleeve 14 at opening 54 where it is connected to the tightening mechanism 22 . the tightening mechanism 22 comprises a windlass 74 that is shown in an unwound position . the inner strap 18 passes through a slot or aperture 78 in the windlass 74 , and as described above , the inner strap 18 extends to and around the buckle 38 . referring to fig7 , a plan view of the second end 34 of the outer sleeve 14 is shown . here , the outer sleeve 14 has been looped through buckle 38 ; however , the tension mechanism 22 , comprising a windlass 74 , as will be described below , has not been wound to tighten the inner strap 18 . referring now to fig8 , a plan view of the second end 34 of the outer sleeve is shown . here , the outer sleeve 14 has been looped through buckle 38 and the windlass 74 has been partially wound , thereby applying a tensile force to the inner strap 18 . since the end of the inner strap 18 is secured to the tip 58 of the outer sleeve 14 , when the windlass 74 is rotated , the inner strap 18 slides within the outer sleeve 14 , essentially scrunching the outer sleeve 14 relative to the inner strap 18 as the inner strap 18 is increasingly tightened . the tightened inner strap 18 provides a substantially even radial compressive pressure to the limb to which the real tourniquet 10 is being applied . referring now to fig5 , a cross sectional view of the real tourniquet 10 is shown , including the second end 34 of real tourniquet 10 with the windlass 74 in a partially wound position . more particularly , in use , after the first end 30 of the outer sleeve 14 is passed through the buckle 38 and secured around an appendage or limb , such as leg l shown in fig1 , the windlass 74 is rotated , such as in the direction of arrows a 1 and a 2 , to apply a tensile force to at least a portion of the inner strap 18 . since the inner strap 18 is secured to the tip 58 of first end 30 of the outer sleeve 14 , the inner strap 18 slides in the direction of arrows a 3 and a 4 within the outer sleeve 14 as the windlass 74 is rotated , thereby pulling the inner strap and providing a circumferentially applied compression force to the appendage . after the windlass 74 is tightened , the tourniquet restricts the blood flow in the appendage . referring now to fig6 , a cross sectional view of the second end 34 of real tourniquet 10 is shown with the windlass 74 in a wound position . after the windlass 74 has been sufficiently tightened to restrict the arterial blood flow in the appendage , the windlass 74 may be secured using securing mechanism 26 . the securing mechanism 26 provides a means for securing or preventing the windlass 74 from unwinding . thus , the securing mechanism 26 maintains the wound position of the windlass 74 , and thereby maintains the tension in the inner strap 18 . as best seen in fig1 , 7 , and 8 , the securing mechanism 26 comprises a pair of opposing hooked catches 82 set substantially transverse to the longitudinal axis la - la of the real tourniquet 10 . more particularly , the hooked catches 82 are sized to cup or hold the windlass , or a portion thereof , and prevent it from unwinding . two opposing catches 82 allows the user to rotate the windlass 74 in either direction , with one of the two catches 82 always able to prevent the windlass 74 from unwinding . the securing mechanism 26 may comprise a securing strap positioned transversely to a longitudinal axis la - la of the outer sleeve 14 . as for example , a transversely oriented strap having hook and loop fastening portions , or an elastic band engaging a hook or button may be provided to secure the windlass 74 in its wound position . a transversely oriented strap 86 may be used in combination with the hooked catches 82 . such a combination of structures allows the user to secure the windlass 74 and move about ( or be moved by another person ) with less concern of the windlass 74 dislodging from the hooked catches 82 and unwinding . the outer surface of the hooked catches may comprise a hook or loop material , and a surface of the strap 86 may comprise a complementary hook or loop material to interlock with the material on the hooked catches 82 . referring now to fig9 - 16 , and in accordance with an embodiment of the present invention , a training tourniquet 900 is shown that includes a number of structures of real tourniquet 10 ; however , training tourniquet 900 features a non - functioning tension mechanism 904 . the non - functioning tension mechanism 904 includes a base portion 908 that is interconnected to another portion of the training tourniquet 900 , such as the base member 62 or the inner strap 18 . for the embodiment of the training tourniquet 900 shown in fig9 - 16 , the base portion 908 includes apertures 912 and inner strap 18 passes through apertures 912 . alternatively , the base portion 908 may be stapled , glued , welded , or otherwise affixed to the inner strap 18 . an inoperative windlass 916 is interconnected to the base portion 908 , such as by a stem 920 . as used herein , the term “ inoperative windlass ” means a windlass that does not tighten a strap of the training tourniquet 900 . the inoperable windlass may be rotatable or not . even in embodiments in which it is rotatable , however , it does not tighten a strap of the trainer tourniquet . thus , for the embodiment shown in fig9 - 16 , the inoperative windlass 916 can rotate to simulate tightening of the inner strap 18 , however , the rotational action of the inoperative windlass 916 does not actually tighten the inner strap 18 . more particularly , the stem 920 either rotates and / or allows rotation of the inoperative windlass 916 such that the inoperative windlass 916 essentially spins without winding the inner strap 18 . in one embodiment , and as shown in fig9 - 16 , the stem 920 includes a shaft 924 that extends into a bore 928 within the inoperative windlass 916 , and when the inoperative windlass 916 is rotated , the stem 920 is substantially stationary and the inoperative windlass 916 spins around the shaft 924 . thus , the base portion 908 allows the inoperative windlass 916 to rotate and not transfer any tension to the training tourniquet 900 . as shown in fig9 , 10 , 15 , and 16 , the bore 928 may reside within a slot or aperture 78 of the windlass 916 , where the slot or aperture is present to reflect where the inner strap 18 may reside , at least for some versions of a working tourniquet , such as real tourniquet 10 . referring now to fig1 - 24 , a separate embodiment of a training tourniquet is illustrated that is a modification of the training tourniquet 900 . similar to training tourniquet 900 , training tourniquet 900 ′ includes a non - functioning tensioning mechanism 904 ′. the non - functioning tensioning mechanism 904 ′ includes an inoperative windlass 916 ′ that is fixedly attached to stem 920 ′ such that the inoperative windlass 916 ′ and the stem 920 ′ rotate together . more particularly , base portion 908 ′ includes structure for allowing the stem 920 ′ and the inoperative windlass 916 ′ to rotate together . in one embodiment of the invention , the bottom of stem 920 ′ extends into base portion 908 ′, where the base portion 908 ′ includes a flange 2000 for rotatably holding the flared bottom 2004 of stem 920 ′. the stem 920 ′ is thus rotatable within the bottom portion 908 ′. in summary , training tourniquets 900 and 900 ′ illustrate different ways of allowing the inoperative windlass 916 and 916 ′ to rotate to allow a trainee to model how to apply a tensile force to the inner strap 18 , while not actually applying a tensile force to the inner strap 18 , thereby avoiding the application of a compressive force to an appendage as a result of practicing the operation of the non - functioning tensioning mechanism 904 and 904 ′. in another embodiment of the invention ( not shown ), a trainer tourniquet comprises an inoperative windlass that is operatively associated with a deformable elastomeric member ( not shown ) or similar material that allows the rotation of the inoperative windlass without applying a tension to the inner strap . more particularly , the deformable elastomeric member may comprise a plastic or synthetic material , such as a relatively soft plastic , that extends between the windlass and the base portion of the windlass so that the trainee can rotate the inoperative windlass without applying a tension to the inner strap . in still another embodiment of the invention ( not shown ), the inner strap is provided with an excessive length of material such that it can be wound , but wherein it is too long to allow the strap to be tensioned by rotating the windlass . here , the inner strap may pass through the windlass , but because of its length , the windlass is unable to gather the inner strap to provide a tensile force that causes compression of an appendage when used to practice use of the trainer tourniquet . in still another embodiment of the invention ( not shown ), the inner strap comprises a stretchable material that is deformable and can be wound by the windlass , but that develops an ineffective amount of tension so that the trainer tourniquet does not effectively apply a significant compressive force sufficient to occlude blood flow to an appendage during a practice use of the trainer tourniquet . in still yet another embodiment of the invention ( not shown ), the stem of the non - functioning tensioning mechanism comprises a safety clutch or slip device . for this embodiment , the strap may also pass through the windlass to more closely model the actual working tourniquet , however , once a relatively small amount of tension is developed in the inner strap , the safety clutch then effectively prevents additional tension from being applied to the inner strap . that is , the safety clutch can be set to limit the amount of tension that can be applied to the inner strap , such that the windlass can rotate and can also apply a tensile force to the inner strap , but wherein the tensile force is limited such that tissue damage cannot occur when practicing or training with the subject training tourniquet . the above - described alternatives are encompassed by the scope of the present invention . in accordance with one or more embodiments of the present invention , the training tourniquet may include a safety mechanism , such as a breakaway strap component . in one embodiment of the invention , the inner strap includes a weakened portion such that if a modest tensile force is applied to the inner strap , such as by reconfiguring the non - functioning tensioning mechanism , then the strap breaks so that no damaging compressive forces can be applied to an appendage . in accordance with embodiments of the present invention , training tourniquets described herein may comprise visual indicator that the device is a training tourniquet and not an actual tourniquet for applying a compressive force to an appendage . in at least one embodiment of the invention , one or more components of the training tourniquet are the color blue . in one or more embodiments of the present invention , the training tourniquet comprises indicia such as “ training device ,” “ training touriquet ,” “ inoperative ,” “ for training only ,” “ warning : non - operative ,” “ do not wind straps ,” and the like , including combinations of the foregoing , and further optionally including one or more components of the training tourniquet that are blue in color . non - windlass - types of tourniquets are used , and one such device uses a ratchet as the tensioning mechanism . in accordance with at least one embodiment of the present invention , a training tourniquet comprises an inoperative ratchet ( not shown ) that can be manipulated by will not apply a tensile force to the inner strap . embodiments of the one or more present inventions are also directed to methods of using a training tourniquet . in at least one embodiment , a method for training a person how to restrict a flow of blood to a body part is provided , the method comprising : ( a ) wrapping a first elongated member around the body part and looping a first portion of the first elongated member through a buckle connected to the first elongated member ; ( b ) detachably attaching the first portion of the elongated member to a second portion of the elongated member ; ( c ) operating a non - functioning tensioning mechanism connected to a second elongated member slidably positioned relative to the first elongated member , wherein the non - functioning tensioning mechanism models and does not develop a tensile force in the second elongated member , wherein substantially no compressive force is applied to the body part restricting the flow of blood in the body part by operating the non - functioning tensioning mechanism . the method may further comprise securing the tensioning mechanism using at least one of a hooked catch and a securing strap . embodiments of the one or more present inventions also allow a person , such as a soldier , to practice using a tourniquet without actually applying restrictive force to one of their appendages . accordingly , in at least one embodiment , a method of practicing how to restrict a flow of blood to a body part is provided , the method comprising : ( a ) placing a first elongated member for contacting the body part around the body part , and positioning at least a portion of the first elongated member through a restraining mechanism connected to the first elongated member ; and ( b ) operating a non - functioning tensioning mechanism for modeling the application of a tensile force to a second elongated member , the second elongated member not contacting the body part , the second elongated member adapted for slidably engaging the first elongated member , wherein the non - functioning tensioning mechanism does not induce a tensile force in any portion of the second elongated member , wherein substantially no compressive force is applied to the body part restricting the flow of blood in the body part when operating the non - functioning tensioning mechanism . the method may further comprise securing the non - functioning tensioning mechanism using at least one of a hooked catch and a securing strap . the present invention has application for use in training emergency medical personnel . in addition , the invention also has application for use in veterinary medicine to practice the application of a tourniquet to a body part or limb of an animal . the present invention , in various embodiments , includes components , methods , processes , systems and / or apparatus substantially as depicted and described herein , including various embodiments , subcombinations , and subsets thereof . those of skill in the art will understand how to make and use the present invention after understanding the present disclosure . the present invention , in various embodiments , includes providing devices and processes in the absence of items not depicted and / or described herein or in various embodiments hereof , including in the absence of such items as may have been used in previous devices or processes , e . g ., for improving performance , achieving ease and \ or reducing cost of implementation . the foregoing discussion of the invention has been presented for purposes of illustration and description . the foregoing is not intended to limit the invention to the form or forms disclosed herein . in the foregoing detailed description for example , various features of the invention are grouped together in one or more embodiments for the purpose of streamlining the disclosure . this method of disclosure is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim . rather , as the following claims reflect , inventive aspects lie in less than all features of a single foregoing disclosed embodiment . thus , the following claims are hereby incorporated into this detailed description , with each claim standing on its own as a separate preferred embodiment of the invention . moreover though the description of the invention has included description of one or more embodiments and certain variations and modifications , other variations and modifications are within the scope of the invention , e . g ., as may be within the skill and knowledge of those in the art , after understanding the present disclosure . it is intended to obtain rights which include alternative embodiments to the extent permitted , including alternate , interchangeable and / or equivalent structures , functions , ranges or steps to those claimed , whether or not such alternate , interchangeable and / or equivalent structures , functions , ranges or steps are disclosed herein , and without intending to publicly dedicate any patentable subject matter . | 6 |
below , an explanation will be made of a digital data recorder according to an embodiment of the present invention . this digital data recorder adopts the d1 system for performing the recording and playback of the component signal . in the recording system , the recording data is subjected to two types of error correction coding by the outer code and inner code , randomization , 8 / 9 coding , nrzi ( 1 ) modulation , magnetization , and optimization of recording and then recorded on the recording medium . at this time , in the error correction coding , the recording data is divided into blocks of a predetermined length , and a parity code for the outer code is generated by using reed solomon coding . next , a predetermined number of outer codes are collected , words at the same position in these blocks are gathered , and a parity code for the inner code is generated with respect to this . then , two inner codes are combined , the id code and the synchronization code are added to this , and the result is defined as one synchronization code block . here , exactly 320 synchronization code blocks are collected and are defined as one track &# 39 ; s worth of the recording video code . the recording video code is divided into two in one track . each part is referred to as a &# 34 ; sector &# 34 ;. next , special codes which are respectively referred to as a preamble and postamble are allocated to the head and tail of each sector . further , in the randomization , sector data regions of an id code , an auxiliary data , a source information , the inner code , etc . are subjected to randomization , but the preamble , run - up sequence , sync pattern , etc . are not randomized . below , a detailed explanation will be made of the 8 / 9 coding apparatus used in the digital data recorder of the present embodiment . fig4 is a view of the configuration of an 8 / 9 coding apparatus 11 of the present embodiment . the 8 / 9 coding apparatus 11 has the data table 2 , a polarity table 3 , a cdsc table 14 , a polarity register 5 , a converter 6 , a dsvc adder 17 , and a table selector 18 . the data table 2 is a table for converting the randomized serial byte stream , that is , the input data s0 , into a 9 - bit nrzl word stream and has a data table (+) 2a and a data table (-) 2b which are selectively used by the switching of the selector 2c according to the conditions at the time of conversion . the polarity table 3 defines the rules indicating whether or not the signal is to be inverted after the 8 / 9 coding and has a polarity table (+) 3a and a polarity table (-) 3b which are selectively used by the switching of the selector 3c according to the conditions at the time of conversion . the cdsc table 14 is a table storing the cdsc values of the data after the 8 / 9 coding and has a cdsc table (+) 14a and a cdsc table (-) 14b which are selectively used by the switching of the selector 14c according to the conditions at the time of the conversion . here , cdsc is the data of the complement of 2 of the cds . the value of the cdsc is within the range of - 8 to + 6 , so can be expressed by a 4 - bit binary value . therefore , compared with the cds table , the cdsc table can be reduced to 4 / 5 the size . the polarity register 5 is a register holding the polarity of the current signal and records the polarity inversion data s3 from the polarity table 3 . the converter 6 converts the input signal from nrzl to nrzi . the dsvc adder 17 calculates the dsvc value for a period from the head of the sector to the present time as shown in the following table 3 by using the sector start indication signal s10 , the cdsc data s14 , and the polarity inversion data s5 and holds the result of the calculation . here , dsvc is the data of the complement of 2 of the dsv -- which is the cumulative value of the bits for one sector . table 3______________________________________previous polarity next dsvc______________________________________ + dsvc - cdsc - dsvc + cdsc______________________________________ the table selector 18 receives as its inputs the polarity inversion data s5 from the polarity register 5 and the msb data s17 of the dsvc data from the dsvc adder 17 , determines which of the tables (+) or (-) should be selected based on these data , and outputs the table switching signals s18 to the selectors 2c , 3c , and 14c . at this time , the relationship of the polarity inversion data s5 and dsvc data s17 with the tables to be selected next is shown in the following table 4 . table 4______________________________________previous statedsvc polarity table to be selected next______________________________________ - + table (+)- - table (-)+ or 0 + table (-)+ or 0 - table (+) ______________________________________ in table 4 , table (+) indicates that the data table (+) 2a , the polarity table (+) 3a , and the cdsc table (+) 14a are to be selected . further , table (-) indicates that the data table (-) 2b , the polarity table (-) 3b , and the cdsc table (-) 14b are to be selected . here , when the table selector 18 selects the tables under the conditions shown in the above table 4 , it is decided which of the conditions of c or d shown in the following expression ( 6 ) stand . here , where the complement binary value of 2 or offset binary expression is used , the relationship between the conditions of the dsvc and the most significant bit ( msb , code bit ) of dsvc becomes as shown in following table 5 . table 5______________________________________ msb of dsvcdsv c complement of 2 offset______________________________________ - 1 0 + or 0 0 1______________________________________ as seen from table 4 and table 5 , in the 8 / 9 coding apparatus 11 , in both of the case of adopting the complement binary value of 2 of cds and the case of adopting the offset binary expression , if the most significant bit of dsvc changes to 1 or 0 , the dsvc will change to the condition of c or d shown in the above expression ( 6 ) in correspondence with this . therefore , if the rules for selection of the table selector 18 are made the conditions shown in table 4 , it is possible to omit the circuit relating to the dsvc of table 4 . fig5 is a view of the configuration of the circuit of the table selector 18 where the dsvc data is expressed by using the complement binary value of 2 . as shown in fig5 the table selector 18 receives as its inputs the 1 - bit msb data s17 of the dsvc data and the polarity inversion data s5 , calculates the exclusive logical or of them , and outputs the result of this calculation as the table selecting signal s18 . at this time , the polarity inversion data s5 becomes &# 34 ; 0 &# 34 ; when (+) is indicated and becomes &# 34 ; 1 &# 34 ; when (-) is indicated . by this , the table selecting signal s18 becomes &# 34 ; 1 &# 34 ; when the table (+) is to be selected and becomes &# 34 ; 0 &# 34 ; when the table (-) is to be selected : next , an explanation will be made of the processing of the 8 / 9 coding apparatus 11 shown in fig4 . step s11 : first , when the sector start indication signal s10 indicates the head of the sector , the polarity register 5 and the dsvc adder 17 initialize these values . step s12 : next , the table selector 18 outputs the table selecting signal s18 found under the conditions shown in table 4 by using the input polarity inversion data s5 and msb data s17 of the dsvc data to the selectors 2c , 3c , and 14c . by this , the selection of tables is carried out in the data table 2 , the polarity table 3 , and the cdsc table 14 . step s13 : then , in the data table 2 , based on the selected data tables 2a and 2b , the 9 - bit nrzl data s2 is found from the 8 - bit input data s0 . this nrzl data s2 is converted to the 9 - bit nrzi data s1 at the converter 6 . step s14 : based on the selected cdsc table , the cdsc data s14 corresponding to the input data s0 is output from the cdsc table 14 to the dsvc adder 17 . then , at the dsvc adder 17 , the dsvc data is generated from the polarity inversion data s5 , the cdsc data s14 , and the sector start indication signal s10 based on table 3 , and the msb data s18 is output to the table selector 18 . further , based on the selected polarity table , the polarity inversion data s3 corresponding to the input data s0 is output from the polarity table 3 to the polarity register 5 . the value of the polarity register 5 is updated by this polarity inversion data s3 . step s15 : returning to step s12 again , the processing for the next input data s0 is carried out . as explained above , according to the 8 / 9 coding apparatus 11 , the configuration of the table selector 18 can be simplified as shown in fig5 . further , since the dsvc adder 17 handles 4 - bit cdsc data s14 , it is possible to simplify the configuration and shorten the signal transmission path . as a result , a reduction of the production costs and an improvement of the processing speed can be achieved . first , an explanation will be made of an 8 / 9 coding apparatus not having a cds table . fig3 is a view of the configuration of an 8 / 9 coding apparatus 21 not having a cds table . as shown in fig3 the 8 / 9 coding apparatus 21 is not provided with the polarity table and the cdsc table unlike the 8 / 9 coding apparatus 1 shown in fig1 and generates the cds data inside the apparatus . as opposed to this , the 8 / 9 coding apparatus 41 shown in fig6 has the data table 2 , a converter 46 , a cdsc calculator 45 , a dsvc adder 47 , and a table selector 48 . the cdsc calculator 45 uses the 9 - bit nrzi format output data s41 output from the converter 46 to calculate the 4 - bit cdsc data s45 . the cdsc calculator 45 calculates the cds with respect to the pattern obtained by inverting the 0 or 1 of the bit pattern of for example the output data s41 to calculate the cdsc data . further , the converter 46 generates the polarity inversion data from the nrzl data s2 and feeds back this polarity inversion data s46 again and , at the same time , outputs the same to the table selector 48 . the dsvc adder 47 generates the dsvc data based on table 3 explained in the first embodiment by using the cdsc data s45 and the sector start indication signal s10 and outputs the msb data s47 of this dsvc data to the table selector 48 . the table selector 48 generates the table selecting signal based on the msb data s47 and the polarity inversion data s46 and outputs this table selecting signal s48 to the selector 2c of the data table 2 . the processing in the table selector 48 is the same as the processing of the table selector 18 of the first embodiment mentioned above . according to the 8 / 9 coding apparatus 41 , in addition to the effect of the 8 / 9 coding apparatus 11 of the above first embodiment , the configuration of the apparatus can be further simplified since it is not provided with the polarity table 3 and the cds table 4 . fig7 is a view of the configuration of an 8 / 9 coding apparatus 51 of the third embodiment . as shown in fig7 the 8 / 9 coding apparatus 51 has the data table 2 , a polarity table 3 , a cds table 4 , a cdsc table 14 , a polarity register 5 , a converter 6 , a selector 55 , a dsv adder 57 , and a table selector 58 . the 8 / 9 coding apparatus 51 is configured provided with the cdsc table 14 in addition to the cds table 4 and selectively uses the cds data s4 and the cdsc data s14 in the dsv adder 57 by the selection processing by the selector 55 . the configuration of the cds table 4 is the same as that of the cds table 4 of the 8 / 9 coding apparatus 1 shown in fig1 mentioned above . the selector 55 outputs the cds data s4 as the selection data s55 to the dsv adder 57 when the polarity inversion data s5 indicates &# 34 ;-&# 34 ;. further , the selector 55 outputs the cdsc data s14 as the selection data s55 to the dsv adder 57 when the polarity inversion data s5 indicates &# 34 ;+&# 34 ;. the dsv adder 57 adds the dsv data heretofore and the selection data s55 and outputs the result of the addition as the dsv data s57 to the table selector 58 . namely , by the relationship with the selection in the selector 55 , the operation shown in the following table 6 is carried out in the dsv adder 57 . table 6______________________________________previous polarity next dsvc______________________________________ + dsv - cdsc - dsv + cds______________________________________ namely , the 8 / 9 coding apparatus 51 is provided with only the addition , initialization , and sync processing functions of the dsv adder 57 by utilizing the fact that the relationship indicated by the following expression ( 7 ) is established between the cds data and the cdsc data and selectively using the cds data s4 and the cdsc data s14 : as explained above , in the 8 / 9 coding apparatus 51 , the necessity of providing the subtraction function in the dsv adder 57 is eliminated , and the functions of the dsv adder can be simplified in comparison with the dsv adder 7 of the 8 / 9 coding apparatus 1 mentioned above . the 8 / 9 coding apparatus of the fourth embodiment has the configuration of the 8 / 9 coding apparatus 51 of the third embodiment mentioned above without the cds table . fig8 is a view of the configuration of an 8 / 9 coding apparatus 61 of the present embodiment . as shown in fig8 the 8 / 9 coding apparatus 61 has the data table 2 , a converter 66 , a cds calculator 64 , a cdsc calculator 65 , a selector 69 , a dsv adder 67 , and a table selector 68 . the cds calculator 64 uses the 9 - bit nrzi format output data s61 to calculate the 5 - bit cds data s64 . the cdsc calculator 65 uses the output data s61 from the converter 66 to calculate the 4 - bit cdsc data s65 . the cdsc calculator 65 calculates the cds with respect to for example the pattern obtained by inverting the 0 and 1 of the bit pattern of the output data s61 and calculates the cdsc data . the selector 69 outputs the cds data s64 as the selection data s69 to the dsv adder 67 when the polarity inversion data s66 from the converter 66 indicates &# 34 ;-&# 34 ;. further , the selector 69 outputs the cdsc data s65 as the selection data s69 to the dsv adder 67 when the polarity inversion data s66 indicates &# 34 ;+&# 34 ;. the converter 66 generates the polarity inversion data from the nrzl data s2 , feeds back this polarity inversion data s66 again and , at the same time , outputs the same to the selector 69 and the table selector 68 . the dsv adder 67 generates the 5 - bit dsv data based on the selection data s69 and the sector start indication signal s10 and outputs this dsv data s67 to the table selector 68 . at this time , by the relationship with the selection at the selector 69 , the operation shown in above table 6 is carried out in the dsv adder 67 . the table selector 68 generates the table selecting signal based on the dsv data s67 and the polarity inversion data s66 and outputs this table selecting signal s68 to the selector of the data table 2 . according to the 8 / 9 coding apparatus 61 , in addition to the effect of the 8 / 9 coding apparatus 51 of the third embodiment mentioned above , the configuration of the apparatus can be further simplified since it is not provided with the polarity table and cds table . an 8 / 9 coding apparatus of the fifth embodiment is obtained by simultaneously applying the 8 / 9 coding apparatus 11 of the first embodiment and the 8 / 9 coding apparatus 51 of the third embodiment . fig9 is a view of the configuration of an 8 / 9 coding apparatus 71 of the present embodiment . as shown in fig9 the 8 / 9 coding apparatus 71 has a data table 2 , a polarity table 3 , a cds table 4 , a cdsc table 14 , a polarity register 5 , a converter 6 , a selector 76 , a dsvc adder 77 , and a table selector 78 . namely , the 8 / 9 coding apparatus 71 is configured with the selector 55 and the dsv adder 57 of the 8 / 9 coding apparatus 51 shown in fig7 replaced by the selector 76 and the dsvc adder 77 . the selector 76 outputs the cds data s4 as the selection data s76 to the dsvc adder 77 when the polarity inversion data s5 from the polarity register 5 indicates &# 34 ;+&# 34 ;. further , the selector 76 outputs the cdsc data s14 as the selection data s76 to the dsvc adder 77 when the polarity inversion data s5 from the polarity register 5 indicates &# 34 ;-&# 34 ;. the dsvc adder 77 calculates the dsvc value of the period from the head of the sector to the present time as shown in the following table 10 by using the sector start indication signal s10 , the selection data s76 , and the polarity inversion data s5 and holds the result of the calculation . further , the dsvc adder 77 outputs the msb data s77 as the result of this calculation to the table selector 78 . table 7______________________________________previous polarity next dsvc______________________________________ + dsvc - cds - dsvc + cdsc______________________________________ the table selector 78 performs the same processing as that of the table selector 18 shown in fig4 . according to the 8 / 9 coding apparatus 71 , the dsvc adder 77 performs only addition , therefore the configuration of the dsvc adder 77 can be simplified in comparison with the dsvc adder 17 of the first embodiment having functions of both of addition and subtraction . fig1 is a view of the configuration of an 8 / 9 coding apparatus 81 of the sixth embodiment . as shown in fig1 , the 8 / 9 coding apparatus 81 has a data table 2 , a converter 66 , a cds calculator 64 , a cdsc calculator 65 , a selector 89 , a dsvc adder 87 , and a table selector 88 . the cds calculator 64 uses the 9 - bit nrzi format output data s81 output from the converter 66 to calculate the 5 - bit cds data s64 . the cdsc calculator 65 uses the output data s81 from the converter 66 to calculate the 4 - bit cdsc data s65 . the cdsc calculator 65 calculates the cds with respect to for example the pattern obtained by inverting the 0 and 1 of the bit pattern of the output data s81 and calculates the cdsc data . the selector 89 outputs the cds data s64 as the selection data s89 to the dsvc adder 87 when the polarity inversion data s66 from the converter 66 indicates &# 34 ;+&# 34 ;. further , the selector 89 outputs the cdsc data s65 as the selection data s89 to the dsv adder 87 when the polarity inversion data s66 indicates &# 34 ;-&# 34 ;. the converter 66 generates the polarity inversion data from the nrzl data s2 , feeds back this polarity inversion data s66 again and , at the same time , outputs the same to the selector 89 and the table selector 88 . the dsvc adder 87 generates the dsvc data based on the selection data s89 and the sector start indication signal s10 and outputs the msb data s87 of this dsvc data to the table selector 88 . at this time , by the relationship with the selection at the selector 89 , the operation shown in above table 7 is carried out in the dsvc adder 87 . the table selector 88 generates the table selecting signal based on the msb data s87 and the polarity inversion data s86 and outputs this table selecting signal s88 to the selector of the data table 2 . the processing at the table selector 88 is the same as the processing of the table selector 18 of the first embodiment mentioned above . according to the 8 / 9 coding apparatus 81 , in addition to the effect of the 8 / 9 coding apparatus 71 of the fifth embodiment mentioned above , the configuration of the apparatus can be further simplified since it is not provided with the polarity table and cds table . the present invention is not limited to the above embodiments . in the embodiments , the explanation was made with reference to the cdsc of the complement of 2 of the cds and the dsv calculated from the cdsc as the dsvc . as explained in the third embodiment , the relationship of stands , so it is clear that exactly the same effects as all of the embodiments of the invention explained above can be obtained even if the value of cds multiplied by minus 1 is used as cdsn and the dsv calculated from cdsn is used as dsvn . in addition , in the 8 / 9 coding apparatus 11 shown in fig4 it is also possible to adopt a configuration in which the polarity table 3 is not provided and the polarity data s5 is generated from the output data s11 of the converter 6 . as explained above , according to the 8 / 9 coding apparatus of the present invention and the method of same , the bit length of data to be handled can be reduced , and the simplification of the circuit structure and the faster speed of processing can be achieved . | 6 |
example embodiments will now be described more fully with reference to the accompanying drawings . fig1 through 5 show one contemplated embodiment of the geometric end effector system 10 according to the present invention . the end effector system 10 includes a platform 12 that is preferably made of steel , however it should be noted that any other type of metal , plastic , ceramic , or composite may be used for the platform 12 . the platform 12 will have a variety of orifices therethrough to mate with any of the known robotic arms , robotic wrists or the like . the platform 12 may be of any known shape , such as a plate with the orifices therethrough , a circular , square , triangular , or any other shaped plate or any other type of platform known to connect to the end of a robot . the platform 12 is attached by any known fastening technique , i . e ., chemical , mechanical or the like to a frame 14 which is preferably made of a steel material . however , it should be noted that the frame 14 may be made of any other known material such as any other known metal , plastic , ceramic , composite , natural material or the like . the frame 14 may have any known shape . the shape will depend on the environment in which the robotic cell will be used . the frame 14 will allow for a plurality of components to be connected thereto such that one robot arm may perform several functions or hold complex geometric parts for operations thereon or movement between stations in a manufacturing environment . each frame 14 will have a plurality of base members 16 secured thereto . the base members 16 are secured to the frame 14 by any known mechanical or chemical bonding technique such as welding , fastening or the like . each of the base members 16 will have a plurality of orifices 18 arranged at predetermined positions thereon . in the embodiment shown the orifices 18 are arranged along near or at each end thereof . some of the orifices 18 may be threaded while some of the orifices may not be threaded . however , in some embodiments all orifices 18 may be threaded and in some other embodiments none of the orifices 18 are threaded . the base 16 generally has a rectangular shape with a predetermined thickness . in the embodiment shown three orifices 18 are arranged at or near each end of the base 16 . it should be noted that any known shape can be used for the base members 16 depending on the design requirements and space available for the base members 16 on the frame 14 . the base members 16 are generally made of a steel material , however it should be noted that any other metal , plastic , ceramic , composite or the like may be used for the base members 16 depending on the robotic cell and the environment such robot will be used in . secured to the base member 16 is an anchor mount 20 . it should be noted that the anchor mount 20 may be secured to all base members 16 on a robot end effector system frame 14 or on just selected base members 16 depending on the components to be connected to the frame 14 of the robot end effector system 10 . the anchor mount 20 generally has a base 22 that mimics the shape of the base member 16 . the anchor mount base 22 in the present embodiment generally has a rectangular shape with a predetermined thickness . a plurality of orifices 24 are arranged through the thickness of the anchor mount base 22 to align with and mate with the orifices 18 in the frame base member 16 . extending from generally a midpoint of the anchor mount base 22 on one side thereof is a cylindrically shaped member 26 extending therefrom . the cylindrical member 26 is fastened to the face of the anchor mount base 22 via any known fastening technique , such as welding or the like , or it is also contemplated to have cylindrical member 26 cast with the base 22 as one member , or made as an extrusion or machined . arranged at an end of the cylindrical member 26 is a circumferential coupling flange 28 . the flange 28 has a predetermined diameter with a predetermined sized bore or orifice through a midpoint thereof . a plurality of slots 30 are arranged on the end face of the coupling flange 28 . the slots 30 extend a predetermined distance into the face of the flange 28 . the slots 30 are arranged on the face such that any number of degrees are located between the slots 30 . in the embodiment shown four slots 30 are positioned within the face of the flange 28 . the slots 30 are arranged at 90 ° intervals around the ring like face of the flange 28 . the anchor mount 20 is designed such that a breakaway point 32 occurs generally to where the flange 28 and cylindrical member 26 intersect . this intersectional point 32 between the flange 28 and cylindrical member 26 may be designed by either increasing or decreasing the thickness of the material used at the breakaway point 32 for the anchor mount 20 . the reduction of material will create a breakaway point 32 that will fail at a lower force than that of a breakaway point 32 that has a thicker material cross section therethrough . other methods of creating a breakaway point 32 are also contemplated such as scoring the intersection between the flange 28 and cylindrical member 26 , pre - stressing , placing a plurality of notches there along , arranging a plurality of orifices therearound , using a different material , or any other contemplated and known method of creating a breakaway point 32 that will fail at a particular lower force in comparison to other components connected to the anchor mount 20 and within the end effector system 10 . the breakaway point 32 will create a specific point at which a predetermined force will break the anchor mount 20 in relation to all other components connected to the anchor mount 20 between the robot and the components being held by the end effector system 10 . a boom 36 and / or junction member 38 may be secured to the anchor mount 20 via a collar assembly 40 . the boom 36 which generally has a cylindrical shape with a bore through an entire longitudinal length thereof . the boom 36 will include a generally circular coupling flange 42 on both ends thereof . the boom 36 can be of any length or incremental length needed within the end effector system 10 . the boom 36 will also include a plurality of orifices 44 prearranged at predetermined positions such that accessories may be mounted to the boom 36 or the booms 36 may be connected to components connected thereto or to an anchor mount 20 via a safety harness or the like . the orifices 44 are predetermined size and arranged at predetermined intervals along the boom 36 depending on the design requirements and the components being held . the coupling flange 42 located at each end of the boom 36 have a plurality of slots 46 therein to align with the slots 30 on the anchor mount 20 , other junction members 38 or any other components . the slots 46 will have the same positioning around the end of the flange 42 and will have the same predetermined depth as that of the anchor mount flange 28 . the boom 36 may have a predetermined thickness thus creating a part that will be able to absorb forces greater than that at the breakaway point 32 of the anchor mount 20 . the junction members 38 generally will have at least one circumferential coupling flange 42 thereon but may have any number of coupling flanges 42 and faces thereon such as two face junction members , three face , four face , five face , or the like . these junction members 38 may allow for a connection to the anchor mount 20 at various angles , or with other various components connected thereto . each of the faces of the junction members 38 will include a generally circumferential coupling flange 42 having slots 46 that are arranged in the same manner as those discussed for the anchor mount flange 28 . other edge accessory members 48 may also be connected to or used as an end member which connects to a clamp or other component being held by the end effector system 10 . generally , the edge accessory members 48 will have one circumferential coupling flange 42 arranged thereon but more than one may also be used . the flange 42 will include the same slots 46 arranged at the same intervals as those for the anchor mount flange 28 . the edge accessory components 48 will be capable of holding parts at predetermined angles and / or straight as shown in fig1 . the boom 36 , junction members 38 , edge accessory members 48 , other components and anchor mounts 20 are all interconnected with each other and fastened to one another in a multitude of combinations . the connections are created via a collar assembly 40 . the collar assembly 40 includes a first and second collar member 50 and a cross key 52 . the cross key 52 generally has an x - shape with a predetermined thickness . the predetermined thickness will be such that approximately half of the cross key 52 will extend into a slot 30 , 46 on any of the coupling flanges 28 , 42 while the other half of the cross key 52 will extend into an adjacent coupling flange 28 , 42 of the other component being connected thereto the cross key 52 is arranged within all four of the slots 30 , 46 and thus will secure the components being connected to one another such that no rotation can occur between the components after they are secured to one another with the collar assembly 40 . the body 60 of the boom 36 is manufactured from a carbon fiber material 62 . additionally , any type of fiber reinforced material may be utilized . a feedback sensing element 70 is molded into the fiber reinforced material 62 . the sensing element 70 may be an electric strain gauge , fiber optic cable 74 or the like . the sensing feedback device 70 provides accurate real time information of what is occurring at the jig 76 , fixture 78 , or end effector 80 . this sensing feedback device 70 provides stress and strain of the boom 36 that indicates the deflection and force on the jig , fixture or end effector . this real time determination helps to improve the control of the system 10 . thus , the fiber reinforced boom 36 enables the jigs , fixtures or end effectors to become add - on systems that determine the process and whether or not the operation are functioning satisfactory or if they are out of control . a plurality of wires 72 are connected with the sensing feedback device 70 . the wires 72 are coupled with the controller ( not shown ). the foregoing description of the embodiments has been provided for purposes of illustration and description . it is not intended to be exhaustive or to limit the disclosure . individual elements or features of a particular embodiment are generally not limited to that particular embodiment , but , where applicable , are interchangeable and can be used in a selected embodiment , even if not specifically shown or described . the same may also be varied in many ways . such variations are not to be regarded as a departure from the disclosure , and all such modifications are intended to be included within the scope of the disclosure . | 1 |
the terms “ functional group ”, “ active moiety ”, “ activating group ”, “ reactive site ”, “ chemically reactive group ” and “ chemically reactive moiety ” are used in the art and herein to refer to distinct , definable portions or units of a molecule . the terms are somewhat synonymous in the chemical arts and are used herein to indicate portions of molecules that perform some function or activity and are reactive with other molecules . the term “ active ,” when used in conjunction with “ functional groups ”, is intended to include those functional groups that react readily with electrophilic or nucleophilic groups on other molecules , in contrast to those groups that require strong catalysts or highly impractical reaction conditions in order to react . for example , as would be understood in the art , the term “ active ester ” would include those esters that react readily with nucleophilic groups such as amines . typically , an active ester will react with an amine in aqueous media in a matter of minutes , whereas certain esters , such as methyl or ethyl esters , require a strong catalyst in order to react with a nucleophilic group . the term “ linkage ” or “ linker ” is used herein to refer to groups or bonds that normally are formed as the result of a chemical reaction and typically are covalent linkages . “ hydrolytically stable linkages ” means that the linkages are substantially stable in water and do not react with water at useful phs , e . g ., under physiological conditions for an extended period of time , perhaps even indefinitely . “ hydrolytically unstable ” or “ hydrolytically degradable ” linkages means that the linkages are degradable in water or in aqueous solutions , including for example , blood . “ enzymatically unstable ” or “ enzmatically degradable ” linkages means that the linkage can be degraded by one or more enzymes . as understood in the art , peg and related polymers may include degradable linkages in the polymer backbone or in the linker group between the polymer backbone and one or more of the terminal functional groups of the polymer molecule . the term “ biologically active molecule ”, “ biologically active moiety ” or “ biologically active agent ” when used herein means any substance which can affect any physical or biochemical properties of a biological organism , including but not limited to viruses , bacteria , fungi , plants , animals , and humans . in particular , as used herein , biologically active molecules include any substance intended for diagnosis , cure mitigation , treatment , or prevention of disease in humans or other animals , or to otherwise enhance physical or mental well - being of humans or animals . examples of biologically active molecules include , but are not limited to , peptides , proteins , enzymes , small molecule drugs , dyes , lipids , nucleosides , oligonucleotides , cells , viruses , liposomes , microparticles and micelles . classes of biologically active agents that are suitable for use with the invention include , but are not limited to , antibiotics , fungicides , anti - viral agents , anti - inflammatory agents , anti - tumor agents , cardiovascular agents , anti - anxiety agents , hormones , growth factors , steroidal agents , and the like . the invention provides a method for the preparation of a 1 - benzotriazolylcarbonate ester ( also referred to as a btc ester ) of a water - soluble and non - peptidic polymer , wherein a terminal hydroxyl group of a water - soluble and non - peptidic polymer is reacted with di ( 1 - benzotriazolyl ) carbonate , the structure of which is shown below , to form the 1 - benzotriazolylcarbonate ester . di ( 1 - benzotriazolyl ) carbonate , which should not pose significant safety or handling problems as a reagent and should not cause degradation of the polymer backbone , can be purchased as a 70 % ( w / w ) mixture with 1 , 1 , 2 - trichloroethane from fluka chemical corporation of milwaukee , wis . the polymer backbone of the water - soluble and non - peptidic polymer can be poly ( ethylene glycol ) ( i . e . peg ). however , it should be understood that other related polymers are also suitable for use in the practice of this invention and that the use of the term “ peg ” or “ poly ( ethylene glycol )” is intended to be inclusive and not exclusive in this respect . the term , “ peg ”, includes poly ( ethylene glycol ) in any of its forms , including alkoxy peg , difunctional peg , multi - armed peg , forked peg , branched peg , pendent peg ( i . e . peg or related polymers having one or more functional groups pendent to the polymer backbone ), or peg with degradable linkages therein . peg is typically clear , colorless , odorless , soluble in water , stable to heat , inert to many chemical agents , does not hydrolyze or deteriorate , and is generally non - toxic . poly ( ethylene glycol ) is considered to be biocompatible , which is to say that peg is capable of coexistence with living tissues or organisms without causing harm . more specifically , peg is substantially non - immunogenic , which is to say that peg does not tend to produce an immune response in the body . when attached to a molecule having some desirable function in the body , such as a biologically active agent , the peg tends to mask the agent and can reduce or eliminate an immune response so that an organism can tolerate the presence of the agent . peg conjugates tend not to produce a substantial immune response or cause clotting or other undesirable effects . peg , having the formula — ch 2 ch 2 o —( ch 2 ch 2 o ) n — ch 2 ch 2 —, where n is from about 3 to about 4000 , typically from about 3 to about 2000 , is one useful polymer in the practice of the invention . pegs having a molecular weight of from about 200 da to about 100 , 000 da are particularly useful as the polymer backbone . the polymer backbone can be linear or branched . branched polymer backbones are generally known in the art . typically , a branched polymer has a central branch core moiety and a plurality of linear polymer chains linked to the central branch core . peg is commonly used in branched forms that can be prepared by addition of ethylene oxide to various polyols , such as glycerol , pentaerythritol and sorbitol . the central branch moiety can also be derived from several amino acids , such as lysine . the branched poly ( ethylene glycol ) can be represented in general form as r (— peg - oh ) m in which r represents the core moiety , such as glycerol or pentaerythritol , and m represents the number of arms . multi - armed peg molecules , such as those described in u . s . pat . no . 5 , 932 , 462 , which is incorporated by reference herein in its entirety , can also be used as the polymer backbone . many other polymers are also suitable for the invention . polymer backbones that are non - peptidic and water - soluble , with from 2 to about 300 termini , are particularly useful in the invention . examples of suitable polymers include , but are not limited to , other poly ( alkylene glycols ), such as poly ( propylene glycol ) (“ ppg ”), copolymers of ethylene glycol and propylene glycol and the like , poly ( oxyethylated polyol ), poly ( olefinic alcohol ), poly ( vinylpyrrolidone ), poly ( hydroxypropylmethacrylamide ), poly ( α - hydroxy acid ), poly ( vinyl alcohol ), polyphosphazene , polyoxazoline , poly ( n - acryloylmorpholine ), such as described in u . s . pat . no . 5 , 629 , 384 , which is incorporated by reference herein in its entirety , and copolymers , terpolymers , and mixtures thereof . although the molecular weight of each chain of the polymer backbone can vary , it is typically in the range of from about 100 da to about 100 , 000 da , often from about 6 , 000 da to about 80 , 000 da . those of ordinary skill in the art will recognize that the foregoing list of substantially water soluble and non - peptidic polymer backbones is by no means exhaustive and is merely illustrative , and that all polymeric materials having the qualities described above are contemplated . for purposes of illustration , a simplified reaction scheme for the method of the invention is shown below . in one embodiment , the reaction between the polymer and dibtc takes place in an organic solvent and in the presence of a base . examples of suitable organic solvents include methylene chloride , chloroform , acetonitrile , tetrahydrofuran , dimethylformamide , dimethyl sulfoxide , and mixtures thereof . amine bases , such as pyridine , dimethylaminopyridine , quinoline , trialkylamines , including triethylamine , and mixtures thereof , are examples of suitable bases . in one aspect of the invention , the molar ratio of di ( 1 - benzotriazolyl ) carbonate to the water - soluble and non - peptidic polymer is about 30 : 1 or less . in one embodiment , the water - soluble and non - peptidic polymer has the structure r ′- poly - oh and the 1 - benzotriazolylcarbonate ester of the water - soluble and non - peptidic polymer has the structure : wherein poly is a water - soluble and non - peptidic polymer backbone , such as peg , and r ′ is a capping group . r ′ can be any suitable capping group known in the art for polymers of this type . for example , r ′ can be a relatively inert capping group , such as an alkoxy group ( e . g . methoxy ). alternatively , r ′ can be a functional group . examples of suitable functional groups include hydroxyl , protected hydroxyl , active ester , such as n - hydroxysuccinimidyl esters and 1 - benzotriazolyl esters , active carbonate , such as n - hydroxysuccinimidyl carbonates and 1 - benzotriazolyl carbonates , acetal , aldehyde , aldehyde hydrates , alkenyl , acrylate , methacrylate , acrylamide , active sulfone , protected amine , protected hydrazide , thiol , protected thiol , carboxylic acid , protected carboxylic acid , isocyanate , isothiocyanate , maleimide , vinylsulfone , dithiopyridine , vinylpyridine , iodoacetamide , epoxide , glyoxals , diones , mesylates , tosylates , and tresylate . the functional group is typically chosen for attachment to a functional group on a biologically active agent . as would be understood in the art , the term “ protected ” refers to the presence of a protecting group or moiety that prevents reaction of the chemically reactive functional group under certain reaction conditions . the protecting group will vary depending on the type of chemically reactive group being protected . for example , if the chemically reactive group is an amine or a hydrazide , the protecting group can be selected from the group of tert - butyloxycarbonyl ( t - boc ) and 9 - fluorenylmethoxycarbonyl ( fmoc ). if the chemically reactive group is a thiol , the protecting group can be orthopyridyldisulfide . if the chemically reactive group is a carboxylic acid , such as butanoic or propionic acid , or a hydroxyl group , the protecting group can be benzyl or an alkyl group such as methyl or ethyl . other protecting groups known in the art may also be used in the invention . in another embodiment , the water - soluble and non - peptidic polymer has the structure ho — poly a - r ( poly b - x ) q and the 1 - benzotriazolylcarbonate ester of the water - soluble and non - peptidic polymer has the structure wherein poly a and poly b are water - soluble and non - peptidic polymer backbones , such as peg , that may be the same or different ; r is a central core molecule , such as glycerol or pentaerythritol ; q is an integer from 2 to about 300 ; and each x is a capping group . the x capping groups may be the same as discussed above for r ′. in another aspect , a difunctional or higher functional btc ester of the water - soluble and non - peptidic polymer is reacted with at least two amino groups of a second polymer having a plurality of primary amino groups , such as amino pegs or other multifunctional amine polymers , such as proteins , aminocarbohydrates , or poly ( vinylamine ), to form cross - linked polymers . the amine polymer will generally have three or more available amino groups . such polymers form hydrogels ; that is , they become highly hydrated in aqueous media , but do not dissolve . since these hydrogels are commonly biocompatable and may be degradable , many biomedical applications are possible in the areas of drug delivery , wound covering , and adhesion prevention . a further embodiment of the invention involves the reaction of btc esters of water - soluble and non - peptidic polymers with amino acids to form amino acid derivatives . in one embodiment , a peg - btc ester is reacted with lysine to form a polymeric lysine derivative . for example , one such lysine derivative is a doubly pegylated lysine , wherein the two pegs are linked to the lysine amines by carbamate bonds , as shown below . wherein peg is poly ( ethylene glycol ) and z is selected from the group consisting of h , n - succinimidyl , or 1 - benzotriazolyl . such peg derivatives of lysine are useful as reagents for preparation of peg derivatives of proteins . these peg derivatives often offer advantages over non - pegylated proteins , such as longer circulating life - times in vivo , reduced rates of proteolysis , and lowered immunogenicity . in another aspect , peg btc derivatives are used directly in attaching peg to proteins through carbamate linkages and may offer advantages similar to those described for the lysine peg derivatives . btc esters of water - soluble and non - peptidic polymers can also be reacted with biologically active agents to form biologically active polymer conjugates . examples of biologically active agents include peptides , proteins , enzymes , small molecule drugs , dyes , lipids , nucleosides , oligonucleotides , cells , viruses , liposomes , microparticles and micelles . the invention also includes 1 - benzotriazolylcarbonate esters of water - soluble and non - peptidic polymers prepared according to the above - described process . as noted above , it is believed that polymer derivatives prepared according to the invention exhibit higher quality because degradation of the polymer backbone caused by phosgene is avoided . further , since the method of the invention requires only one step and fewer reactants , process efficiency is enhanced and cost is reduced . the following examples are given to illustrate the invention , but should not be considered in limitation of the invention . a solution of mpeg 5000 - oh ( mw 5000 , 15 g , 0 . 003 moles ), di ( 1 - benzotriazolyl ) carbonate ( 4 . 0 g of 70 % mixture , 0 . 000945 moles ), and pyridine ( 2 . 2 ml ) in acetonitrile ( 30 ml ) was stirred at room temperature under nitrogen overnight . the solvent was removed by distillation , the residue was dissolved in 80 ml of methylene chloride , and the resulting solution was added to 850 ml of ethyl ether . the mixture was cooled to 0 - 5 ° c . and the precipitate was collected by filtration . the precipitation process was then repeated to obtain a white solid which was dried under vacuum at room temperature to yield 13 . 5 g of product which was shown by 1 h nmr to be 100 % substituted . 1 h nmr ( dmso d - 6 ): 3 . 23 ppm , ch 3 o ; 3 . 51 ppm , o — c h 2 c h 2 — o ; 4 . 62 ppm , m , mpeg - o — c h 2 — oco 2 —; 7 . 41 - 8 . 21 , complex mult ., benzotriazole protons . a solution of mpeg 20 , 000 - oh ( mw 20 , 000 , 20 g , 0 . 001 moles ), di ( 1 - benzotriazolyl ) carbonate ( 3 . 4 g of 70 % mixture , 0 . 00803 moles ), and pyridine ( 3 . 0 ml ) in acetonitrile ( 40 ml ) was stirred at room temperature under nitrogen overnight . the solvent was removed by distillation and the residue was dissolved in 80 ml of methylene chloride and the resulting solution was added to 800 ml of ethyl ether . the precipitate was collected by filtration and was dried under vacuum at room temperature to yield 16 . 8 g of product which was shown by 1 h nmr to be 100 % substituted . 1 h nmr ( dmso d - 6 ): 3 . 23 ppm , ch 3 o ; 3 . 51 ppm , o — c h 2 c h 2 — o ; 4 . 62 ppm , m , mpeg - o — c h 2 — oco —; 7 . 41 - 8 . 21 , complex mult ., benzotriazole protons . lysine . hcl ( 0 . 0275 g , 0 . 000151 moles ) was dissolved in 26 ml of 0 . 1 m borate buffer and the ph was adjusted to 8 . 0 with 0 . 1 m naoh . to the resulting solution was added mpeg 20 , 000 btc ( 7 . 0 g , 0 . 00350 moles ) over 15 minutes and the ph was kept at 8 by addition of 0 . 1 m naoh . after stirring the resulting solution for 3 h , 15 g of h 2 o and 4 g of nacl were added and the ph was adjusted to 3 . 0 with 10 % phosphoric acid . the product was extracted with methylene chloride and the extract dried over mgso 4 . after concentrating the solution to 30 ml , the solution was poured into 300 ml of ethyl ether and the product collected by filtration and dried under vacuum at room temperature to yield 5 . 9 g of product as a white solid . analysis by gel permeation chromatography ( ultrahydrogel 250 , column temperature 75 ° c ., aqueous buffer ph 7 . 2 ) showed the product to be a mixture of di - n - pegylated lysine ( mw ˜ 40 kda , 63 . 05 %), mono - n - pegylated lysine ( mw ˜ 20 kda , 36 . 95 %), and mpeg 20 , 000 . to 4 ml of lysozyme solution ( 3 mg / ml in 50 mm sodium phosphate buffer , ph 7 . 2 ) was added 20 . 3 mg of mpeg 5000 btc ( 5 - fold excess of mpeg5000 btc ) and the mixture was continually mixed at room temperature . analysis by capillary electrophoresis ( 57 cm × 76 um column ; 30 mm phosphate buffer ; operating voltage 25 kv ) after 4 hours showed that 6 . 94 % of unreacted lysozyme remained , while 33 . 99 % of mono - pegylated lysozyme , 43 . 11 % di - pegylated lysozyme , 13 . 03 % tri - pegylated lysozyme , and 2 . 92 % of tetra - pegylated lysozyme had formed . to a solution of peg 2kda - α - hydroxy - ω - propionic acid ( 10 g , 0 . 0050 moles ) ( shearwater corp .) in anhydrous methylene chloride ( 100 ml ), 1 - hydroxybenzotriazole ( 0 . 30 g ), 4 -( dimethylamino ) pyridine ( 1 . 0 g ), benzyl alcohol ( 10 . 8 g , 0 . 100 moles ) and 1 , 3 - dicyclohexylcarbodiimide ( 1 . 0 m solution in methylene chloride , 7 . 5 ml , 0 . 0075 moles ) were added . the reaction mixture was stirred overnight at room temperature under argon . the mixture was then concentrated to about 50 ml , filtered and added to 800 ml cold diethyl ether . the precipitated product was filtered off and dried under reduced pressure . yield 8 . 2 g . nmr ( d6 - dmso ): 2 . 60 ppm ( t , — ch 2 — coo —), 3 . 51 ppm ( s , peg backbone ), 4 . 57 ppm ( t , — oh —), 5 . 11 ppm ( s , — ch 2 — ( benzyl )), 7 . 36 ppm ( m , — c 6 h 5 ( benzyl )). to a solution of peg 2kda - α - hydroxy - ω - propionic acid , benzyl ester ( 8 . 2 g , 0 . 0025 moles ) in acetonitrile ( 82 ml ), pyridine ( 0 . 98 ml ) and di ( 1 - benzotriazolyl ) carbonate ( 1 . 48 g ) were added and the reaction mixture was stirred overnight at room temperature under argon atmosphere . the mixture was then filtered and solvent was evaporated to dryness . the crude product was dissolved in methylene chloride and precipitated with isopropyl alcohol . the wet product was dried under reduced pressure . yield 6 . 8 g . nmr ( d6 - dmso ): 2 . 60 ppm ( t , — ch 2 — coo —), 3 . 51 ppm ( s , peg backbone ), 4 . 62 ppm ( m , — ch 2 — o ( c ═ o )—), 5 . 11 ppm ( s , — ch 2 -( benzyl )), 7 . 36 ppm ( m , — c 6 h 5 ( benzyl )), 7 . 60 - 8 . 50 ppm ( 4 m , aromatic protons of benzotriazole ). | 0 |
an apparatus embodying the invention is shown in fig1 and generally designated 10 . it comprises a handpiece 12 and a powerdrive unit or turbine 14 . in use , the power unit is positioned on the bottom wall of a sink s , whereas the handpiece 12 may be freely manipulated so that its brush 18 can be brought in contact with the teeth . a flexible drive shaft 20 and a flexible conduit tube 22 connect the power unit and the handpiece . supply water is delivered to the power unit through a tube 24 coupled to the blender b between the hot and cold water controls h and c , preferably by snap - on coupling means 26 , not a part of the invention . as shown in fig2 the handpiece comprises a hollow housing formed from a pair of molded halves generally having identical but opposite shapes ( fig3 ). molded into one end of the housing is a journal 28 for a brush shaft 30 . as shown , the upper end of the brush shaft 30 carries a bevel gear 32 and the lower end is fitted with a removable , generally cone - shape bristle brush 34 . the bristle brush is pressed on to the bottom of the shaft 30 and may be readily removed for replacement . at right angles to journal 28 is journal 36 , mounting for rotation an intermediate shaft 38 , the forward end of which is formed with a bevel gear 40 meshing with gear 32 . the rearward end of shaft 38 is formed with a coupling 42 presenting a rearwardly facing opening having preferably a square cross sectional contour . at the rear end of the handpiece a b . n . c . coupling 44 is connected to a female element 46 having diametrically opposed outward lugs molded about the rear end of the handpiece . coupled to the opposite side of the ferrule in swivel fashion is the nylon casing 48 of the flexible drive . as shown , the casing snugly surrounds the drive wire 52 , still permitting it to turn . in the rear end of the handpiece , a third journal 53 mounts for rotation the drive wire 52 of the flexible shaft . the forward end of the wire is formed with a square male coupling element 54 which is recessed into the opening in the coupling 42 so that rotation of the wire 52 will drive the brush , through the pair of bevel gears as shown . a nozzle 56 is mounted in an opening 58 on the underside of the handpiece adjacent the brush 34 , and is directed toward the center of the brush . the nozzle element extends rearwardly inside the handpiece in the form of a nipple 60 . at the opposite end of the handpiece on the underside is a fitting 62 which includes a rearward spud 64 and an inward nipple 66 . a plastic tube 68 extends between the two nipples 60 and 62 and has its ends telescoped thereover . as a result , the flexible conduit 22 is connected through the tube 68 to the nozzle 56 which directs water toward the center of the brush . an opening 70 is formed on an inclined wall 72 in the bottom of the housing 12 of the handpiece . arcuate guides 74 extend upward at an angle from the opening 70 and house a button 76 , which has a cross bar 78 disposed across its inner end . a spring 80 urges the button outward so that the cross bar 78 pinches the tube 68 against a stationary stop 82 to close off the water supply therethrough . thus , flow of water through the tube 68 and out the nozzle 56 may be controlled by pressing or releasing the button 76 . the drive unit 14 is disclosed in fig4 . it comprises a shallow cup 84 having a central recess 86 ( fig5 ) which receives the hub 88 of an impeller 90 . preferably , as shown , the impeller is of the bucket - type having buckets 90a , and it is shaped more or less like a bicycle sprocket , but having substantial width . with the cover 92 bolted in place on the cup 84 the upper end of the hub 88 fits into the recess 94 . in its center the impeller is formed with a coupling 96 similar to coupling 42 in the handpiece and presenting a square opening 98 receiving the square driving end 100 of the wire 52 of the flexible drive 20 . a second swivelling b . n . c . coupling 102 secures the end of the nylon casing 48 of the flexible drive to the molded female tubular end 104 of the cover 92 . end 104 has outward lugs as with element 46 . a tapered inlet 106 directs the incoming water through tube 24 tangentially into the power unit . on the opposite side of the unit is a tangential outlet 108 which permits the spent water to drain into the sink . the housing of the power unit is designed so that a space 110 is provided between the extremities of the impeller 90 and the inside of the wall of the cup 84 . this permits the continuous flow of water through the unit and makes the stalling of the impeller much less likely than it would be were the parts relatively close fitting . intermediate the inlet 106 and outlet 108 is a tangential tap 112 . this connects to the flexible hose 22 and supplies hot water eventually to the nozzle 56 of the handpiece . a proper balance must be achieved between the size of the openings in the tangential inlet 106 , the tap 112 and outlet 108 , so that the passage in outlet 108 will not be so small to create back pressure which would limit the power of the impeller 90 , but yet narrow enough to assure proper flow through the tap 112 to provide ample water to the nozzle 56 . rubber feet 114 may be provided on the unit to make the unit more stable in the event the sink has sloping walls . the feet 114 also reduce vibration . a pass - through analog thermometer 116 is provided . illustratively it is shown on the exhaust 108 . it may be mounted anywhere along the flow of water , preferably on the outlet side of the power unit . the materials of which the drive unit parts are made must be selected in a way that will avoid any impairment of the operation due to the expansion of parts . preferably the impeller and its housing are all of the same material , a plastic such as celcon , a product of the celanese corporation , being a preferred choice . from the above , the use of the apparatus should be clear . the faucet f is turned on to deliver heated water at a temperature at above 40 ° c . and preferably in the range 40 ° c . to 50 ° c ., to the power unit 14 through hose 24 . this will cause the impeller 90 and brush 18 to rotate along with wire 52 . water travels from tap 112 through the flexible conduit 22 to the handpiece . when the brush 18 is subsequently applied to the teeth , button 86 may be depressed , causing heated water to discharge out nozzle 56 . by the handpiece the brush 18 along with the heated water from nozzle 56 may be manipulated along the teeth , causing the aforesaid removal of placque . while the invention has been described and illustrated showing a single embodiment of apparatus , the invention is not so limited but may be defined by the following claim language including appropriate equivalents thereof . | 0 |
referring to fig1 a , 1 b , and 2 , a burner system 1 for burning waste material , particularly waste plastic , has a feed mechanism 2 defined by an elongated transport or conveyor screw 4 provided with a central lumen 6 extending substantially through the entire length of the conveyor screw 4 . the conveyor screw 4 is situated below an intake opening 8 of the feed mechanism and extends forwardly ( to the right as seen in fig1 a and 2 ) to a combustion unit 10 . the combustion unit 10 that is defined by a plurality of concentric combustion chambers , indicated generally at 11 , include , for example , a first combustion chamber 12 , a second combustion chamber 14 , and a third combustion chamber 16 . the plurality of combustion chambers 11 is coaxially disposed about conveyor screw 4 at increasing radial distances from the conveyor screw 4 . the downstream end of the third combustion chamber 16 is in fluid communication with a discharge section 18 of the burner system 1 , which receives smoke and incombustible particulates from the plurality of combustion chambers 11 and discharges these materials from the burner system 1 into the atmosphere , via a nose cone 30 ′. a double walled outer housing 20 defines an air passage 48 , which surrounds a portion of the conveyor screw 4 , the combustion unit 10 and the discharge section 18 . feed mechanism 2 of burner system 1 includes the earlier mentioned conveyor screw 4 with spiral windings 5 and a generally tubular , double walled conveyer housing 22 , which partially encloses the rotating screw 4 . a motor 24 drives a shaft 28 of the screw 4 via a chain 26 . other suitable drives such as a gear drive , a belt drive or the like can be employed , so there is no intention of limiting the disclosed invention to only a chain driven shaft . intake opening 8 is arranged proximate to an upstream end of the screw 4 ( on the left as seen in fig2 ) through which plastic waste or other material is entrained for conveyance in a downstream direction ( to the right as seen in fig2 ) towards combustion unit 10 . the downstream end of shaft 28 of screw 4 is free of spiral windings and extends into the combustion unit 10 where it is suitably journaled . combustion unit 10 , as already described , is formed by the three concentric combustion chambers 12 , 14 , 16 , each of which has inner and outer radial boundaries that are concentric with the axis of shaft 28 and interconnected by radially extending walls . in particular , the inside radial boundary of first combustion chamber 12 is defined by the area bounded by the outer surface circumference area of conveyor shaft 28 . the outside radial boundary of first combustion chamber 12 is defined by an interior surface area of an extension 30 of the tubular housing portion 20 surrounding the conveyor screw 4 . the inside radial boundary of second combustion chamber 14 is defined by the exterior surface area of the extension 30 . the outside boundary of the second chamber 14 is defined by a tubular wall 34 that is coaxial with and spaced apart from extension 30 . an end wall 32 that is connected to and substantially perpendicular to tubular wall 34 is fixed to conveyor shaft 28 and is axially spaced from a downstream end of extension 30 , so as to form a transition space between the first and second combustion chambers 12 , 14 . finally , an exterior surface of tubular wall 34 defines the inside radial boundary of third combustion chamber 16 , while the outside radial boundary of the third combustion chamber is formed by a portion of the inside interior surface area of housing 20 , as best seen in fig1 a and 2 . the transition space between the second combustion chamber 12 and third combustion chamber 16 is provided by radial air passage 47 of housing 20 . the downstream end of the third combustion chamber 16 opens to the discharge section 18 of the burner system 1 . as is illustrated in fig1 a , gaseous material , particulates and the like from first combustion chamber 12 move along an s - shaped line 38 , past the second combustion chamber 14 and the third combustion chamber 16 , and into discharge section 18 . as best seen in fig1 b , to facilitate movement of the materials through the plurality of combustion chambers 11 , a plurality of sets of auger plates 40 , which are preferably inclined relative to the axis of shaft 28 to help advance the materials in a downstream direction , are suitably arranged on the inner radial surfaces of the first through third combustion chambers 12 , 14 , 16 . in the embodiment illustrated in fig2 , the auger plates for the first and third combustion chambers 12 , 16 rotate with shaft 28 , while the set of auger plates 40 for the second combustion chamber 14 are stationary . alternatively , the plates for the second combustion chamber 14 can be mounted on the inside of tubular wall 34 so that they , too , rotate with the shaft 28 . waste fuel , in particular , waste plastic fuel , introduced through intake opening 8 , is moved in a downstream direction ( to the right as seen in fig1 a and 2 ) and it enters first combustion chamber 12 . auger plates 40 in the first combustion chamber 12 distribute the material relatively evenly where it is liquefied , gasified and ignited by heat generated by flames and friction or heat transfer via tubular wall 34 . the resulting partially combusted waste plastic together with flames , smoke and other particulates generated in the first combustion chamber 12 propagates in a downstream direction through second and third combustion chambers 14 , 16 where the waste plastic burns so that substantially only smoke , gaseous matter and non - combustible particulates are then discharged into the discharge section 18 of the burner system 1 . rotational discharge blades 19 swirl the exhaust gas flow , thus improving a flush - out of the incombustible materials from the burner system 1 . the discharge blades 19 which provide a sufficient swirling of the incombustibles may be made in different shapes . one example is a substantially propeller shaped discharge blade . a particular advantage provided by the waste burner system 1 of the present invention is that fresh combustion air is provided just upstream of each of the combustion chambers 12 , 14 , 16 . complete incineration of all the waste plastic takes time , thus feeding just sufficient air at the upstream end of each chamber helps to sustain optimal combustion therein . optimal combustion , in turn , helps to maintain maximum temperature in each chamber 12 , 14 , 16 , because combustion air that is needed further downstream in the process , namely in the second and third combustion chambers 14 , 16 , does not travel through the combustion chamber 12 where it is not needed and need not be heated . in addition , the flow of relatively cool combustion air along the outside of the housing 20 enhances energy efficiency because the air flow reduces heat losses from the combustion unit 10 to the atmosphere , while at the same time preheating the air needed for the combustion in the combustion chamber . referring now to fig2 , according to a second embodiment , air for incinerating waste plastics is supplied from a suitable source ( or sources ) at an air inlet 44 , like , for example , a fan or a blower ( not shown ) used to enhance the air intake . air next enters inner air passage 46 defined by tubular double - walled housing portion 22 . some of the air in passage 46 is released into the space for conveyor screw 4 from an orifice 50 , enters shaft lumen 6 via inlets 52 , and continues to flow in the direction of combustion unit 10 , while simultaneously cooling the conveyor screw 4 , thus increasing the reliability of the conveyor screw 4 and its bearings . the remainder of the air in the annular inner air passage 46 continues in a downstream direction and partially encircles first combustion chamber 12 . a radial air passage 47 fluidically connects axially extending inner air passage 46 with axially extending outer air passage 48 , which surrounds combustion unit 10 and discharge section 18 of the burner . as shown in fig2 , air from the lumen 6 is discharged via first , second and third sets of orifices 54 arranged , respectively , in the transition space between the first and second combustion chambers 12 and 14 and into discharge section 18 of the burner , as is further described below . additionally , the air needed for burning the waste plastic is separately introduced into each of the three combustion chambers . air flowing along air passage 46 is discharged into an upstream portion of first combustion chamber 12 via orifices 56 . a further set of housing orifices 58 is arranged upstream of third combustion chamber 16 and extends from air passage 46 into the transition space between the second and third combustion chambers 14 , 16 . instead of or in addition to orifices 58 , radial air passage 47 can be provided with additional orifices such as , for example , orifices 60 located just upstream of third combustion chamber 16 , as shown in fig2 . air for the second combustion chamber 14 is introduced by the first set of orifices 54 ( located on screw 4 ) into the transition space between the first and second combustion chambers 12 , 14 and therefore also upstream of the second combustion chamber . the air flow through orifices 54 , 56 , 58 and 60 is suitably modulated to match the air flow rate to the amount of waste plastics introduced through intake opening 8 . to facilitate the incineration of waste plastic , particularly during startup operations , an auxiliary burner 62 in the transition space between the second and third combustion chambers 14 , 16 for heating all three chambers , either directly ( chamber 16 ) or indirectly ( chamber 12 via housing section 30 extending into the combustion unit and chamber 14 via tubular wall 34 ). the auxiliary burner 62 may be oil burner , gas burner , solid fuel burner , or electrical heater . the inventors have found that using the auxiliary burner for about 5 minutes preheats the waste plastic sufficiently to efficiently start the combustion . referring now to fig3 , a waste plastic supply unit 150 can be attached to the intake opening 8 . waste plastic is deposited in a fuel hopper 151 , wherefrom it is gravitationally fed into rotator housing 153 . a granular waste plastic gwp is illustrated in the fuel hopper 151 , but other constitutions of the waste plastic are possible . rotation of a rotator 154 directs waste plastic towards the intake opening , and further toward the conveyor screw 4 . the inventors have found that the rotator protrusions 155 having a triangle or a semi - circular shape work well , but other rotator protrusion shapes can also be used . the inventors have also found that inclining the rotator protrusions 155 in the direction opposite from the direction of their rotation minimizes sticking of the waste plastic against the rotator housing 153 . referring to fig4 and 5 , there is shown an alternative or third embodiment of another burner system , generally referred to as 160 . the burner system 160 includes another embodiment of a combustion unit , generally referred to as 170 . in this embodiment of combustion unit 170 , nose cone 30 is eliminated . elimination of nose cone 30 increases air flow within and exiting combustion unit 170 . the increased air flow and exhaust allows combustion of substantially all solid fuels moved into combustion unit 170 by conveyor screw 4 . this ability to obtain substantially complete combustion of solid fuels substantially increases energy output of burner system 160 while reducing energy consumption and therefore improving overall financial performance of burner system 160 by about 50 %. referring again to fig4 and 5 , a variable frequency drive ( hereinafter , vfd ) motor , such as variable speed , direct drive motor 180 is coupled to conveyor screw 4 for revolving or rotating conveyor screw 4 . the previously mentioned second embodiment burner 1 includes motor 24 that drives shaft 28 of conveyor screw 4 by means of a chain 26 . however , this alternative or third embodiment burner system 160 includes variable speed , direct drive motor 180 , rather than motor 24 of burner 1 . the direct drive and variable speed capability of motor 180 that belongs to alternative embodiment burner system 160 allows burner system 160 to accommodate variable size and density of solid fuels . accommodating variable size and density of solid fuels , in turn , increases capacity of burner system 160 and reduces energy consumption of burner system 160 . more specifically , direct drive motor 180 increases overall efficiency by reducing energy consumption and allows for increased variances in fuel types , sizes and feed rates which , in turn , substantially increases overall energy output of burner system 160 by over approximately 50 %. in addition , direct drive motor 180 provides more power to auger shaft 28 and therefore aids in releasing fuel that might otherwise stick or adhere to shaft 28 . also , the increased power of direct drive motor 180 can increase speed of fuel feeding . moreover , the increased power of direct drive motor 180 increases the capability of burner system 160 to efficiently accept dual fuel compositions , such as waste plastic combined with liquid oil . as best seen in fig4 , a second igniter or auxiliary burner 190 is provided in addition to the first igniter or auxiliary burner 62 . in a manner similar to location of auxiliary burner 62 , second auxiliary burner 190 is provided in the transition space between the second and third combustion chambers 14 , 16 for heating all three chambers , either directly or indirectly . a purpose of second auxiliary burner 190 is to decrease time needed to preheat combustion unit 170 and for the introduction of a larger volume of liquid fuel that can be used in conjunction with solid plastic fuels . decreasing time needed to preheat combustion unit 170 and introducing a larger volume of liquid fuel increases overall efficiency of combustion unit 170 by about 50 %. as best seen in fig4 , a pair of fuel injectors 65 and 165 is also provided in the transition space between the second and third combustion chambers 14 , 16 for amplifying the burning of the waste fuel to facilitate increasing the energy output of the combustion unit 170 . in this regard , a fuel , such as oil , or gas , is directly injected into the combustion chambers to increase the burn rate of the waste fuel as it passes through the third chamber 16 . the fuel is supplied through fuel lines from a secondary fuel source . referring to fig5 a and 5b , there is shown an alternative or fourth embodiment of the burner system , generally referred to as 191 . burner system 191 is substantially similar to third embodiment burner system 160 , except a boiler 192 is included to heat a fluid , such as water and / or oil , for any process requiring fluid of elevated temperature , such as in the case of district heating . in the case of district heating , fluid ( e . g ., water ) in boiler 192 will be heated by burning waste fuel , such as waste plastic , and then pumped through insulated , underground or above - ground plumbing / pipes ( not shown ) to homes and businesses for use in space heating , water heating and industrial processes . once energy from the heated fluid is used by the home or business , the fluid can be returned to boiler 192 by means of underground or above - ground plumbing / pipes . thus , such a piping system will be a closed - loop piping system ( not shown ). as an example of another application , boiler 192 may be configured to produce steam for uses such as generating electricity by passing the steam through a suitable turbine - generator ( not shown ). alternatively , high pressure oil ( e . g ., thermal oil ) for use in driving single or multiple turbines that generate electricity . in one configuration , boiler 192 is coupled to combustion unit 170 and is an annular cylinder defining a central longitudinal cavity 193 in which combustion unit 170 is disposed . boiler 192 and combustion unit 170 are coaxially aligned , as shown . an annular fluid chamber 194 is formed in boiler 192 and extends longitudinally substantially the entire length of boiler 192 . a fluid inlet pipe p 1 is coupled to boiler 192 and is in fluid communication with fluid chamber 194 for supplying the fluid to fluid chamber 194 . in addition , a fluid outlet pipe p 2 is coupled to boiler 192 for exit of heated fluid ( e . g ., water , water and / or oil , steam ), as the case may be , from fluid outlet pipe p 2 . it should be appreciated that the boiler 192 configuration that is described herein comprises only one exemplary configuration for boiler 192 , there being many possible configurations for boiler 192 . for example , boiler 192 is shown as horizontally oriented . alternatively , boiler 192 may be vertically oriented , if desired . vertical orientation of boiler 192 may be desirable when horizontal space is limited . it will be appreciated by a person of ordinary skill in the art of power generation that it is important to control operation of burner systems 160 , 191 , so that burner systems 160 , 191 perform at optimum efficiency , safely and with minimum operator intervention . therefore , in order to suitably control burner systems 160 , 191 , a computer apparatus 195 includes an intelligent control system , generally referred as 200 , as described in detail hereinbelow . intelligent control system 200 includes a plurality of sensors 205 ( only one of which is shown ) disposed in burner systems 160 , 191 for sensing or measuring the operational parameters of burner systems 160 , 191 , such as pressure , temperature , boiler fluid level , power generated , as well as other operational parameters of burner systems 160 , 191 . with reference to fig4 and 5 , burner system 160 does not include boiler 192 , it being understood that burner system 160 may include boiler 192 as an option , if desired . sensing these operational parameters will allow an operator of burner systems 160 , 191 to monitor the operational parameters and take appropriate corrective action should any one of the operational parameters fall outside a permissible predetermined range of values . however , it will be appreciated that intelligent control system 200 will be capable of automatically taking any necessary corrective action with minimum operator interaction . in addition , intelligent control system 200 , which will use a computerized software platform with an open architecture , is adapted to integrate therewith off - the - shelf , commercially available boiler vessel management systems . such a commercially available boiler vessel management system may be of a type such as may be available from tru - steam boilers & amp ; services pty ltd , located in chipping norton , australia . in addition , intelligent control system 200 will provide substantially complete control and monitoring of all burner mechanical and electrical components , so that burner systems 160 , 191 perform at optimum efficiency , safely and with minimum operator intervention . intelligent control system 200 will provide redundant safety capability for substantially all functional components of burner systems 160 , 191 . a control panel ( not shown ) will also substantially enhance performance of burner systems 160 , 191 by providing operator or automatic control of each function of burner systems 160 , 191 . integration and interface design for boiler safety systems will virtually ensure burner systems 160 , 191 operate within predetermined and safe parameter ranges for a preselected boiler vessel , such as boiler 192 . also , intelligent control system 200 will assist in enabling use of burner systems across a broad spectrum of applications including the ability to manage energy output and use of various fuel types . it is believed that use of intelligent control system 200 will increase overall performance of burner systems 160 , 191 by about 75 %. the method of operation of intelligent control system 200 is described hereinbelow . therefore , referring to fig6 , 7 and 8 , there is shown a flow chart illustrating the methods by which intelligent control system 200 controls burner systems 160 , 191 . for purposes of brevity , the methods by which intelligent control system 200 controls burner systems 160 , 191 will be described only with reference to burner system 191 , it being understood that the methods may apply to burner system 160 , as well . the method of intelligent control system 200 starts at a step 1200 by the operator of burner system 191 activating a power - on system step 1202 . activating power - on system step 1202 supplies electrical power to intelligent control system 200 and begins operation of burner system 191 . it should be appreciated by a person of ordinary skill in the art of power generation that power - on system step 1202 may include a “ toggle switch ” ( not shown ) that energizes intelligent control system 200 when placed in a first position and de - energizes intelligent control system 200 when placed in a second position . as best seen in fig6 , power - on system step 1202 generates a signal that is received by a decision step 1204 . the decision step 1204 determines whether an emergency stop ( hereinafter “ estop ”) circuit has been energized . the estop circuit ( not shown ) must be energized for motion devices to be powered and operational , such as previously mentioned variable frequency drive motor 180 ( i . e ., vfd 180 ). the estop circuit may be either manually or automatically operated to shut - down burner system 191 in an emergency , such as might occur during boiler overpressure , based on a signal output from previously mentioned sensor 205 ( see fig4 ). referring to fig6 , the estop circuit at step 1204 is enabled by a programmable logic circuit ( hereinafter “ plc ” circuit , not shown ) output and preferably by two maintained pushbuttons ( not shown ). plc instructions may be loaded into the plc from a pre - programmed erasable programmable read only memory ( eprom , not shown ) or an electrically erasable programmable read only memory ( eeprom , also not shown ) included in the plc . also , one of the maintained pushbuttons turns - on the estop circuit to energize the estop circuit and the other maintained pushbutton turns - off the estop circuit to de - energize the estop circuit . if the estop circuit is not energized , then a “ false ” output signal ( hereinafter a “ no ” output signal ) is generated by decision step 1204 . the “ no ” output signal activates an estop alarm at a step 1205 . an output signal from the estop alarm activated at step 1205 continuously loops back to decision step 1204 , whereupon decision step 1204 again tests whether the estop circuit has been energized . it should be appreciated by a person of ordinary skill in the art of power generation that if the estop circuit is de - energized ( i . e ., output from decision step 1204 is “ no ”), the plc in the estop circuit will detect the condition and display the appropriate alarm message on a human machine interface panel ( i . e ., “ hmi panel ”, not shown ) that may be located in an operator control room ( also not shown ) associated with burner 160 . however , if the estop circuit is energized , then a “ true ” output signal ( hereinafter “ yes ” output signal ) is generated by decision step 1204 . the estop alarm is in an “ on ” state only upon depressing of the previously mentioned estop push buttons or failure of plc output . at a step 1206 , the “ yes ” output signal from the estop circuit ( i . e ., from step 1204 ) is used to initiate a call subroutine step 1206 , which calls the “ boiler ready ” subroutine 1400 to verify that the boiler ( see fig5 a ) belonging to burner 160 is ready to start operation . after the call step 1206 has been executed , the program advances to an end step 1208 , since the boiler ready subroutine 1400 is now being executed by the program . the boiler ready subroutine 1400 is best seen on fig6 . referring again to fig6 , when power is supplied to intelligent control system 200 by activating the power - on system at step 1202 , a continuous check subroutine 1300 is initiated which begins with a start step 1301 . the system parameters comprise at least auger vfd , blower vfd , fuel feeder vfd , safety controller alarm active , and fluid pump failed , which parameters are detected , sensed or measured by previously mentioned plurality of sensors 205 ( see fig4 ). as shown in fig6 , when the continuous check of system parameters starts at step 1301 , auger vfd faulted is checked at decision step 1302 . if auger vfd faulted is not active , then a “ no ” signal is generated at decision step 1302 and the fault condition is checked again . the continuous check method does not proceed further , until a fault condition is detected at decision step 1302 which , in turn , results in a “ yes ” signal and the method proceeds to a set alarms exist command step 1313 . the program then advances to a stop heat command step 1315 which disables the burner system 191 . next the system proceeds to a decision step 1317 to determine whether the burner system 191 has been disabled for a predetermined number of minutes , where the predetermined number of minutes is a sufficient number of minutes to allow the burner system 191 to cool down . the program will loop at this decision step 1317 until the predetermined number of minutes has elapsed . once the predetermined number of minutes has elapsed , a yes condition exists and the program then proceeds to the decision step 1204 and proceeds as previously described relative to that decision step 1204 . in fig6 , when the call boiler ready subroutine step 1206 is executed , the boiler verification subroutine 1400 begins at a start step 1401 to verify the boiler 192 is ready for operation . in this regard , the system proceeds to a set of boiler ready decision steps 1402 , 1404 , 1406 , 1408 , and 1410 that will be described hereinafter in greater detail . the verification begins at a pressure verification decision step 1402 , and if the pressure of the boiler is not within a correct range , a “ no ” signal is generated which causes the program to advance to the command step 1313 where the program proceeds as previously described with a set alarms exist . if instead , the pressure is within range , a “ yes ” signal is generated allowing the program to advance to a boiler over temperature decision step 1404 . if the boiler 192 has an over temperature condition , a “ no ” signal is generated which causes the program to advance to the command step 1313 where the program proceeds as previously described with a set alarms exist . if instead , the boiler temperature is within range , a “ yes ” signal is generated to permit the program to jump to the next decision step 1406 to verify that the first boiler water level is sufficient . the terminology “ water level ” is intended to include “ water and / or oil level ” because the fluid in the boiler can be water alone or a combination of water and oil . if the first boiler water level is not sufficient , a “ no ” signal is generated which causes the program to advance to the command step 1313 where the program proceeds as previously described with a set alarms exist . if instead , the first boiler water level is sufficient , a “ yes ” signal is generated and the program goes to the next decision step 1408 to verify that the second boiler water level is sufficient . if the second boiler water level is not sufficient , a “ no ” signal is generated which causes the program to advance to the command step 1313 where the program proceeds as previously described with a set alarms exist . if the second boiler water level is sufficient , a “ yes ” signal is generated and the program advances to a decision step 1410 . next , at the decision step 1410 , the program detects whether the “ disable heat sensor ” is active . if it is active , a “ yes ” signal is generated and the system goes to the command step stop heat at step 1315 , where the system proceeds as described previously . if the disable heat active sensor is not active at decision step 1410 , the program advances to a call command to call the water ready subroutine 1600 that will be described hereinafter in greater detail . after the call command 1412 is executed the program proceeds to an end step 1414 as the water ready subroutine 1600 will not be executed . turning now to fig7 , at a step 1601 , the water ready call signal from step 1412 ( see fig6 ) is provided to a decision step 1602 that tests whether a call for heat signal is true or is energized . if the call for heat signal is not energized , then a “ no ” output signal is generated at decision step 1602 and the decision step 1602 loops to again test whether the call for heat is energized . if the call for heat signal is energized , a “ yes ” output signal is generated . similarly , in a logical or other fashion with decision step 1602 , another decision step 1603 tests presence of whether the manual cfh (“ call for heat ”) signal is true . if the manual cfh signal is not true , then a “ no ” output signal is generated at decision step 1603 and the decision step 1603 loops back and again tests for manual cfh signal . if the manual cfh signal is true , a “ yes ” output signal is generated at decision step 1603 . the “ yes ” output signals from both the cfh signal energized at decision step 1602 and manual cfh signal at decision step 1603 are passed to a decision step 1604 that determines whether water flow rate is acceptable . referring again to fig7 , if the water flow acceptable decision step 1604 outputs a “ no ” signal , then a “ watchdog ” routine at step 1606 generates a water pump failed alarm signal . a “ watchdog ” routine is a computer software routine combined with sensor instrumentation that performs a timer action wherein multiple conditions are monitored . if the monitored conditions are not valid for more than the timer duration , then the watchdog times - out and an alarm is activated . in this specific case , an output signal from the watchdog routine at step 1606 that generates the water pump failed alarm is passed to a call command 1608 which calls the set alarms exist subroutine 1500 as best seen in fig6 . the program then proceeds to an end step 1610 since the set alarms exist subroutine 1500 will have been executed via a start set alarms exist step 1501 . the start alarms exist step 1501 advances the program to the set alarms exists command 1313 where the program proceeds as previously described . if the water flow acceptable decision step 1604 outputs a “ yes ” signal , then a set output to start blower vfd step is started at a step 1607 to facilitate combustion . the process then advances from the command step 1607 to a decision step 1609 to test whether a desired air flow is detected in burner 160 . if desired air flow is not detected , then a “ no ” signal is output from decision step 1609 . the “ no ” signal is received by a watchdog routine 1611 . this watchdog routine 1611 generates a blower failed to start alarm signal that is passed to the previously mentioned call command 1608 where the program proceeds as previously described . however , if the output signal from the air flow detected decision step 1609 is “ yes ”, then the “ yes ” output signal causes the program to advance to a command step 1615 that sets an output to start a liquid fuel pump . the liquid fuel may be oil or kerosene and is used to aid combustion . the output signal from command step 1615 is received at a command step 1617 that , in turn , causes the output to generate an output signal to enable a safety controller ( not shown ). the program then advances to a call step 1619 which calls the safety controller subroutine 1800 as best seen in fig8 . when the safety controller subroutine 1800 has completed its execution , the program will return to this point advancing to a decision step 1621 to determine whether the safety controller output signal is active as will be described hereinafter in greater detail . considering now the decision step 1621 , when the safety controller subroutine 1800 has been successfully executed and a safety controller active signal is generated , the call safety controller command 1619 advances to the decision step 1621 via the return step 1815 enabling the program to advance . a safety controller active decision step 1621 tests whether the safety controller has started . if the output from safety controller active decision step 1621 is “ no ”, then a watchdog routine at a step 1623 produces the safety failed to start alarm and the method of the intelligent control system 200 then advances to step 1625 and ends . on the other hand , if the output signal from safety controller active decision step 1621 is “ yes ”, then an instruction is generated at a step 1627 to go to a step 1631 . from step 1631 , the program advances to a command step 1631 which initiates a burner startup timer ( not shown ). the system then proceed to a decision step 1633 to determine whether the delayed rotation of previously mentioned auger shaft 28 has elapsed for a predetermined time that is selected by the operator of burner 160 . if output from decision step 1633 is “ no ”, then decision step 1633 continuously loops and again tests whether the predetermined period of time has elapsed . if the time period has elapsed , then decision step 1633 passes a “ yes ” signal to a command step 1635 to set the output to “ start rotation of auger shaft ” routine at a step 1635 . after the auger shaft 28 starts rotating , the start rotation of auger shaft routine step 1635 passes an output signal to a waste plastic fuel start decision step 1637 that determines whether plastic fuel feed has started to feed fuel along auger shaft 28 by means of previously mentioned auger plates 40 . the decision step 1637 will cause the program to loop at this decision step until the waste plastic fuel feed starts . in this regard , when a “ yes ” signal is generated at decision step 1637 , the system proceeds to a command step 1639 that sets the output to start the plastic feeder vfd modulus or subroutine . once the command step 1639 has been executed , the program proceeds to a command step 1641 which will set the plastic fuel feeder vhf speed to a “ transition speed ”. the program then goes to a decision step 1643 . at decision step 1643 , a determination is made by the system as to whether a liquid fuel bypass time delay has ended . the time delay in starting the liquid fuel pump is provided to ensure that auger shaft 28 is in fact rotating before starting the liquid fuel pump . if the liquid fuel bypass time delay has not ended , then a “ no ” output signal is produced by decision step 1643 . decision step 1643 loops and then again tests whether liquid fuel bypass time delay has ended . if the liquid fuel bypass time delay has ended , the method of intelligent control system 200 executes a go to command step 1645 that advances the program to step 1647 as best seen in fig8 . referring to fig8 , after the liquid fuel time delay that is tested at decision step 1643 ends with a “ yes ” signal being generated , the program proceeds to a go to step 1645 that takes the routine to step 1647 as best seen in fig8 . from step 1647 , the program goes to a command step 1649 , which causes the system to set output to start a liquid fuel pump . however , operation of the liquid fuel pump is stopped at a command step 1651 after the liquid fuel pump is started at step 1649 . stopping the liquid fuel pump after starting the liquid fuel pump confirms that the liquid fuel pump is operational . an output signal from the stop liquid fuel pump step 1651 is provided to initiate a plastic fuel feeder variable frequency drive ( vfd ) motor at a command step 1653 . the speed of the vfd motor is set to a predetermined “ lean rate ” for feeding the plastic fuel at a predetermined , lower non - operational rate . the plastic fuel is fed at the lean rate for a predetermined time selected by the operator of burner 160 . during this time , the normal operating plastic fuel feed rate or “ run rate ” is delayed . the routine advances to a decision step 1655 that determines whether this time delay has ended before feeding the plastic fuel at the run rate . if the time delay for feeding the plastic fuel at the lean rate has ended , then the plastic fuel vfd motor speed is set to the operational “ run ” rate at command step 1702 via a go to step 1657 that advances the program to step 1700 , from where the program proceeds to the command step 1702 . referring again to fig8 , an output signal from step 1702 is provided to a decision step 1704 to determine whether there is a “ call for heat ”. the call for heat is a plc input point that is connected to a temperature switch , such as a thermostat . if the call for heat at decision step 1704 is true , then a “ yes ” output signal is generated . this “ yes ” output signal is provided to a decision step 1706 that determines whether an automatic stopping of a plant demonstration has completed . in this regard , operation of burner system 191 occasionally may need to be demonstrated to interested parties , such as government regulators , investors and members of the public . when demonstration of burner system 191 in an operating state is required , burner system 191 is run only for a predetermined time . the predetermined time is set for the time allowed for the demonstration . therefore , burner system 191 is operated until decision step 1706 determines that the allotted demonstration time has elapsed . at that point , intelligent control system 200 automatically stops operation of burner system 191 if the demonstration time has elapsed by advancing to the stop heat command 1315 as best seen in fig6 . alternatively , if the call for heat at decision step 1704 is false , then a “ no ” output signal is generated . this “ no ” output signal is not provided to the “ demonstration ” decision step 1706 . rather , this “ no ” output signal is provided to previously mentioned stop heat step 1315 . referring to fig4 , 7 and 8 , when the safety controller subroutine 1800 is called at the previously mentioned call step 1619 ( see fig6 ), the safety controller subroutine 1800 begins at a start routine step 1801 . from the start step 1801 , the operation of igniters 62 , 190 ( see fig4 ) are initiated at a command step 1802 , that produces an igniter output signal indicating that igniters 62 , 190 are operating . it should be appreciated that the disclosure herein recites two igniters 62 , 190 ; however , any number of suitable igniters may be used to initiate a flame . next , the igniter output signals are received by an open liquid fuel solenoid ( not shown ) instruction at a command step 1804 . the igniter output signal of step 1802 in combination with the open liquid fuel solenoid instruction from step 1804 are passed to a decision step 1806 to determine whether a flame is detected by an appropriate sensor 205 ( see fig4 ), such as an ultraviolet photoeye and amplifier board combination ( not shown ). the ultraviolet photoeye and amplifier board combination may be of a type , such as a “ c7027a1023 ultraviolet minipeeper flame sensor ”, that may be available from honeywell international , incorporated , located in morristown , n . j ., u . s . a . in this regard , the “ c7027a1023 ultraviolet minipeeper flame sensor ” is a compact flame detector for use with flame safeguard controls having ultraviolet amplifiers and detects ultraviolet radiation in flames . the “ c7027a1023 ultraviolet minipeeper flame sensor ” is used with honeywell flame safeguard primary safety controls for burners requiring ultraviolet flame detection . suitable operation of igniters 62 , 190 in combination with the proper operation of the liquid fuel solenoid should produce a flame . however , if the flame is not detected within a “ flame proving ” time period , then the safety controller turns off its “ valve ” output signals in order to close the liquid fuel valves and turns on its alarm output . if no flame is detected at decision step 1806 , a “ no ” output signal is generated by decision step 1806 . the “ no ” output signal generated by decision step 1806 is passed to decision step 1808 that tests whether the previously mentioned flame proving timing period has elapsed . if the output signal from decision step 1808 is “ no ”, then the output signal from decision step 1808 is passed back to decision step 1806 and the presence of the flame is again tested . however , if the flame proving timing period has elapsed without presence of a flame , then decision step 1808 outputs a “ yes ” signal that is provided to a safety controller alarm at a step 1810 . from the set safety controller alarm output step 1810 , the program advances to the return step 1813 , where the program proceeds as previously described . referring again to fig8 , if a flame is detected at decision step 1806 , the decision step 1806 outputs a “ yes ” signal that is provided to a command step 1809 which sets a main valve out to enable solid fuel feed . output from step 1809 is provided to a command step 1811 that sets a safety controller “ active ” input value that is supplied to previously mentioned return step 1813 which returns the program to step 1621 via step 1815 as described previously ( see fig7 ). the pollution emission of one embodiment of the invention was tested by the ktl ( korean testing laboratory , located in seoul , korea ) by measuring harmful gas emissions during the waste fuel burning . according to the tests , the dioxin level was 0 . 119 ng - teq / sm3 , the hydrogen chloride level was 0 . 78 ppm , and the sulfur oxides level was 6 . 60 ppm . thus , these harmful gas emission levels were significantly below the korean emission standard levels ( dioxine : 5 ng - teq / sm3 , hydrogen chloride : 50 ppm , and sulfur oxides : 6 . 60 ppm ), rendering the invention environmentally friendly . the above description is illustrative and is not restrictive , and , as it will become apparent to those skilled in the art upon review of the disclosure , the present invention may be embodied in other specific forms without departing from the essential characteristics thereof . for example , while the above invention is described in conjunction with plastic waste fuel , the embodiments of the present invention can also be used with other solid fuels , waste or not , like , for example , coal , saw dust , wood chips , or a mixture of solid fuels . furthermore , while three combustion chambers are described , a different number of combustion chambers may be used . these other embodiments are intended to be included within the spirit and scope of the present invention . the scope of the invention should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the following and pending claims along with their full scope of equivalents . | 5 |
as shown in fig1 current drilling practices depend on a string sp composed of drill pipe segments ps connected end - to - end to turn a cutting tool ct mounted on the lower string end . in the course of such turning the tool ct grinds and penetrates through the bottom of the well bore wb with the particulates continuously brought out to the surface by a circulating flow of drilling mud dm pumped into the bore to equalize bore pressures . as readily available formations are depleted these drilling projects now extend to much greater depth , and / or greater lateral reach , with the weight of the pipe string sp and / or its friction load in the well bore setting the practical exploration limits . the complexity of a drilling rig rg conformed for such long reach drilling is enormous and the logistics of its movement , alone , encourage directional capability along with an increasing pipe string . this same complexity of the rig also determines the manipulation convenience of each of the pipe segments ps , again resulting in its own logistic and mechanical constraints resolved by the size of the rig ( or off - shore platform ) that can be effectively implemented at the well site , thereby limiting the length of each segment ps and multiplying the number of required joints jt that need to be made to extend the string to the desired depth . the combined weight of the string , including all the down hole joints and any wear knots or pipe protectors pp shielding the pipe from wall contact , along with the friction load resulting from this wall contact , are thus resolved at the last surface joint which sets the design limit . it is within this limit that the rig operator tries to discover oil by periodic insertion of instruments down the bore , or simply by inspecting the drilling debris brought to the surface . in addition to the above physical concerns there are also those imposed by various laws and ordinances dealing with the environment . there is currently substantial public resistance to the equipment clutter associated with crude oil production appearing in one &# 39 ; s neighborhood , further promoting directional drilling , a technique that compounds torsional loading as very long drill pipe strings are turned while resting on the wall of the well . this same technique also demands shorter radius turns , or a more flexible pipe , and also accurate instrumentation to inform the operator of the actual direction that is being drilled and of any formation details that are encountered . for all these reasons light weight , high strength , but elastic pipe is desired , particularly if signal and power conductors can be combined therewith . all these concerns are now substantially resolved in the inventive structure and process described by reference to fig2 - 7 . by particular reference to fig2 - 4 the inventive pipe assembly , generally designated by the numeral 10 , comprises a tubular composite pipe segment 11 , formed by laying up reinforcing fiber , such as carbon fiber , preferably laid in stress determined orientation patterns between plies of interleaved wrapping of generally impervious elastic sheets , all bonded together by resinous filler to form a cylindrical structure of a generally uniformed wall thickness over most of its length . a selected portion of each end of pipe segment 11 is tapered along a generally uniform taper to a reducing wall thickness , illustrated as a first tapered end 12 - 1 and a second tapered end 12 - 2 , each defined by an inner frustoconical surface 12 i and an oppositely aligned exterior frustoconical surface 12 e that cooperatively form the tapered ends that are then received within conforming circular cavities formed between a set of nested high strength steel end coupler pieces shown as an inner end piece 20 - 1 nested in an outer end piece 30 - 1 to form an annular cavity therebetween for receiving tapered end 12 - 1 and a similarly nested set of end pieces 20 - 2 and 30 - 2 forming a similar cavity to receive the other tapered end . like numbered parts functioning in like manner , each of the annular cavities are formed by axially aligning an exterior tapered surface 22 e formed on the exterior of a skirt 23 included in both the end pieces 20 - 1 and 20 - 2 adjacent an oppositely tapered surface 32 i on the interior of a skirt 33 included in end pieces 30 - 1 and 30 - 2 . surfaces 22 e and 32 i are each closely matched to the respective dimensions and tapers of the interior and exterior surfaces 12 i and 12 e of each of the ends 12 - 1 and 12 - 2 , thereby providing a self - centralizing assembly with closely held bonding interface that can then be effected by any well known high temperature epoxy resin . the close fit of this bonding process is further enhanced by axial advancement and close dimensional matching between the coaxially nested exterior and interior pieces so that the exterior piece forms a peripheral support for the tapered end as the interior piece is slid into its position . each of the skirts 23 and 33 , moreover , include a radially matched set of lateral openings 24 and 34 dimensioned for press fit , or interference receipt , of corresponding pins 45 that also pass through corresponding circular openings 15 formed in the tapered ends 12 - 1 and 12 - 2 once the ends are fully received , bonded and indexed within their receiving cavities . this same indexed alignment orients the exposed ends 18 of conductor leads 17 that are woven into the filament matrix of the pipe segment 11 into alignment with longitudinal drillings 37 formed in skirts 33 to effect an electrical connection across the pipe joint herein described . beyond this bonding receipt each of the pieces is formed as a closely dimensioned telescoping cylindrical segments 26 and 36 which are each provided with corresponding exterior flanges 29 and 39 aligned next to each other when the skirts are properly positioned . of course , the same drillings 37 extend through the flange 36 on the exterior to convey the lead ends 18 therethrough . those skilled in the art will appreciate that while pieces 20 - 1 and 20 - 2 , and also pieces 30 - 1 and 30 - 2 , are described above by identical descriptions , in application one of the nested end piece sets serves as the male portion of the threaded joint , otherwise referred to as the ‘ pin end ’, and the other end piece set serves as the female threaded , or the ‘ box end ’. accordingly , those parts of the inner end pieces 20 - 1 and 20 - 2 that are exterior of flanges 29 are of necessity different depending on the joint function that is formed . thus interior end piece 20 - 1 includes a threaded boss 51 - 1 extending beyond the exterior shoulder 29 - 1 of the flange 29 that is conformed for threaded receipt in a threaded cavity 51 - 2 formed in the other exterior shoulder 29 - 2 of the other flange 29 on the interior end piece 20 - 2 . each of the flanges 29 , moreover , includes drilling continuations shown as drillings 27 - 1 and 27 - 2 aligned with drillings 37 , drilling 27 - 1 conveying the conductor end 18 into a circular recess 53 - 1 formed in the flange shoulder surface 29 - 1 where the lead is connected to one of several insulated rings 54 - 1 conformed for receipt within the interior of recess 53 - 1 . at the other end piece 20 - 2 a similar drilling 27 - 2 is indexed with drilling 37 in the exterior piece 30 - 2 to convey the other lead end 18 into a manifold 56 formed in flange 29 and terminating in one or more openings 57 through shoulder surface 29 - 2 opposing the recess 53 - 1 when the ends are threadably mated . opening 57 , in turn , is provided with a spring biased piston 58 carrying a bayonet point 59 . once the end fittings are joined a pressure fitting 56 p in manifold 56 is then useful to pressurize the manifold interior , advancing piston 58 against the spring bias to drive the bayonet point 59 through the insulation on the opposingly aligned contact ring 54 - 1 . in this manner circuit continuity is effected between the conductors 17 imbedded in the joined segments regardless of their relative orientation . it will be appreciated that each of the conductive filaments 17 may be variously effected either as an electrical power lead , a signal lead or even a fiberoptic filament . of course , known techniques of signal superposition , frequency and / or pulse modulation or other signaling formats can then be effected by these leads to bring out down hole information directly to the rig operator as the drilling is taking place which can then be used to modify , in known techniques , the drilling direction and the cutting rate , commonly referred to as lwd or ‘ logging while drilling ’ and mwd or ‘ measurnig whilr drilling .’ in this manner all the control and pipe compliance conditions can be conveniently accommodated in a pipe string that , because of its light weight , is particularly suited for ultra deep and / or extended reach drilling . those in the art will further appreciate that the foregoing arrangement is particularly suited for custom forming of composite pipe segments 10 by way of the nested end fittings described herein . by particular reference to fig5 - 7 the inner end pieces 20 - 1 and 20 - 2 may be combined with a forming mandrel effected by an inner sleeve 111 , to form the turning core for the subsequent winding of fiber plies fp and the remaining interleaved layers ll forming the composite pipe 11 , in step 201 . in this step the winding pitch , fiber density and the selection of any sealing wraps may also be determined by the particular parameters of the well and the mandrel structure may be further stiffened and assisted by internal pressurizatioin while the fiber lay - up tension is controlled . of course , conductive leads 17 may be concurrently also imbedded into the wrap , again in accordance with the type and nature of the signals and / or power that may be conveyed thereon . once the structural conditions are met the inner end pieces are withdrawn from the core layer 111 and thereafter nested in the exterior pieces 30 - 1 and 30 - 2 in step 202 . a bonding agent , such as a high temperature epoxy resin is then applied to the pipe ends 12 - 1 and 12 - 2 and the ends are then re - positioned into the interiors of pieces 30 - 1 and 30 - 2 with the inner pieces 20 - 1 and 20 - 2 then pressed into their common interiors , shown as the self - centralizing step 203 . in the course of this same step the exposed conductor ends 18 are conveyed into their appropriate drillings to be thereafter connected either to the bayonet contact 59 or the contact ring 54 - 1 . in step 204 the foregoing assembly is then brought into a spray cooled welding fixture illustrated in fig5 in which a weld ww is applied by a welding device 151 to join the exterior flanges of the nested end pieces 20 - 1 and 30 - 1 to each other ( and by the same example also the nested end pieces 20 - 2 and 30 - 2 ) while water spray heads 152 and 153 cool the adjacent structure . once thus fixed by their flanges the inner and outer end pieces with the ends 12 - 1 and 12 - 2 captured therebetween are then drilled , in step 205 , with perforations 34 which thereafter receive press fit pins 45 . in this manner a self - centralized end arrangement is useful both in the manufacture and also in effecting a closely held bond interface between the high strength metal end pieces and the composite pipe segment with the interface further stabilized and fixed by welding and press fit pins . the resulting high strength joint is then further complemented by the appropriately selected lay - up pitch , weave density and interleaving that are selected for the particular task . thus both the fabrication and the ending structure are rendered both highly effective and convenient . obviously , many modifications and variations can be effected without departing from the spirit of the invention instantly disclosed . it is therefore intended that the scope of the invention be determined solely by the claims appended hereto . | 4 |
fig1 illustrates a novel rearview mirror assembly 20 which can be rotated between an inboard position and an extended , outboard position . the outboard position provides better viewing when the vehicle is pulling a trailer , camper or other towed item . the construction of the rearview mirror assembly 20 , particularly the mounting of a generally rectangular mirror 26 and a mirror frame 28 in a mirror frame 28 of the rearview mirror assembly 20 , is secure and resists typical vibrational forces exerted on rearview mirror assembly 20 during operation of the vehicle . therefore , the rearview mirror assembly 20 provides improved rearward viewing without distortion in the mirror image . as shown in fig2 , the rearview mirror assembly 20 includes an attachment member 22 for mounting a mirror shell 24 to an exterior panel of a vehicle . the mirror 26 is centrally mounted on the mirror frame 28 which is received in mirror shell 24 . a mounting post 30 extends along a longitudinal horizontal axis of the mirror shell 24 which is laterally offset from the central vertical axis c of the mirror shell 24 . the mirror frame 28 is mounted on post 30 and held in place by a nut or retainer ring 34 , which is received over and fixed to post 30 . as shown , there is slight clearance between post 30 and the mirror frame 28 such that the mirror frame 28 may rotate relative to post 30 . alternatively , the two may be fixed for common rotation . spring 32 , with nut or retainer ring 34 , biases mirror frame 28 rearwardly against a plate or backing 44 , which is fixed to mirror shell 24 . mirror frame 28 includes detents 40 and 41 , one of which is selectively received in a notch 42 disposed in backing 44 and the other of which is received in notch 43 . backing 44 may preferably contain a reflective mirror surface 46 , which provides additional rearward viewing for an operator of the vehicle when the mirror 26 is in the outboard position . in an inboard position , a lateral edge 36 of mirror 26 is disposed adjacent the vehicle , detent 41 is received in notch 42 , detent 40 is received in notch 43 , and the reflective mirror surface 46 remains unexposed behind the lateral edge 36 of mirror 26 and mirror frame 28 . the mirror frame 28 and mirror 26 are disposed in the mirror shell 24 such that the circumference of the mirror frame 28 is aligned with the circumference of the mirror shell 24 . the spring 32 biases mirror frame 28 rearwardly against backing 44 , thereby maintaining the mirror frame 28 and mirror 26 in its inboard position and resisting vibrational forces on the mirror 26 . the mirror frame 28 , and hence mirror 26 , can be rotated about the central axis of the post 30 to an outboard position , which is shown in phantom lines in fig1 , as descried below . as shown in fig3 , in an outboard position , the lateral edge 36 of mirror 26 is disposed remote from the vehicle , detent 40 is received in notch 42 , detent 41 is received in notch 43 , and the reflective mirror surface 46 is exposed for additional rearward viewing . the mirror 26 defines a plane . the mirror 26 and mirror frame 28 rotates about a longitudinal horizontal axis which extends through the mirror plane , and is generally perpendicular to the plane of the mirror 26 . in this embodiment , the central axis of the post 30 defines the longitudinal horizontal axis which travels through the plane of the mirror 26 about which the mirror 26 rotates . preferably , the longitudinal horizontal axis is disposed midway between the central vertical axis and the outer lateral edge 38 of the mirror frame 28 . as shown in fig4 , the operator of the vehicle can easily and quickly rotate the mirror 26 from an inboard to an outboard position for improved rearward viewing . first , the operator of the vehicle pulls the mirror frame 28 and mirror 26 outwardly along the longitudinal horizontal axis to move detent 41 outwardly from notch 42 and detent 40 out of notch 43 . this is shown in phantom line in fig2 . mirror frame 28 and mirror 26 are then rotated 180 ° about the central axis of the post 30 . the spring 32 biases mirror frame 28 back rearwardly against mirror shell 24 . in an outboard position , the lateral edge 36 of the mirror 26 and mirror frame 28 , previously adjacent the vehicle , is disposed in a position remote from the vehicle . the distal or outer ( in the inboard position ) lateral edge 36 of the mirror 26 is rotated 180 ° to a position adjacent the vehicle . detent 40 is now disposed in notch 42 , and detent 41 is now disposed in notch 43 . at the outboard position , the rearview mirror assembly 20 provides additional rearward viewing to an operator of a vehicle by positioning the mirror 26 farther laterally outwardly than it was in the inboard position . this outboard position is particularly helpful when the operator of a vehicle is pulling a trailer , camper or other towed item . because of the mounting design , mirror 26 and mirror frame 28 are securely biased against the mirror shell 24 . the rearview mirror assembly 20 is thus able to resist the vibrational forces typically experienced by a rearview mirror assembly during operation of the vehicle . as shown in fig5 , an alternative rearview mirror assembly 60 , which may be particularly useful in a heavy truck or camper - type vehicle , includes an l - shaped post 62 which has a lateral portion that attaches to the side of a vehicle 50 and a horizontal portion that attaches to the mirror shell 66 . a mirror 64 is centrally mounted on the mirror shell 66 in any known manner . in this alternative embodiment , the operator of the vehicle 50 is able to easily and quickly rotate the entire mirror 64 and the mirror shell 66 from an inboard position to an outboard position ( shown in phantom lines ) to provide improved rearward viewing . as shown in fig6 , mirror shell 66 contains a slot or groove 68 which runs the length of the mirror shell 66 , and includes a pivot slot 70 . preferably , the slot or groove 68 is triangular in cross - section , thus providing two contact lines , even if there is dirt on post 62 or in the slot or groove 68 . the pivot slot 70 receives a pivot member 72 . pivot member 72 has a shaft 74 which is axially received in a bore 76 of pivot slot 70 . pivot member 72 is rotatably mounted in pivot slot 70 by sliding shaft 74 through bore 76 . coil spring 78 and a retainer ring 80 are axially received from the mirror side of mirror shell 66 onto shaft 74 of pivot member 72 . pivot member 72 also includes a channel 82 on the opposed end to shaft 74 which is received on a portion of post 62 . channel 82 is aligned with the slot or groove 68 such that post 62 is received in both . pivot cap 84 also has a channel 86 , which , together with channel 82 , secures the pivot assembly on post 62 . pivot cap 84 and pivot member 72 are securely mounted onto post 62 with screws 88 . a pair of alternative grooves 68 a allow further rotation positions for the mirror 26 . when post 62 is received in the alternative grooves 68 a , the mirror 26 will extend generally vertically , thus protecting the mirror . that is , when the post 62 is received in the alternative groove 68 a , the mirror 26 has rotated approximate 90 ° from the inboard position . the mirror 26 has a generally rectangular shape that is defined by a longer dimension and a smaller dimension . the longer dimension extends generally parallel to a horizontal plane when the mirror 26 is in the inboard position , and the longer dimension extends generally vertical when the mirror 26 is in the outboard position . the outboard position is pivoted in a direction away from the vehicle from the inboard position . as shown in fig7 , post 62 is disposed between pivot member 72 and pivot cap 84 in channels 82 and 86 . post 62 is also disposed in slot or groove 68 for a substantial length of the horizontal portion of post 62 . because pivot member 72 is spring loaded onto mirror shell 66 by the coil spring 78 and retainer ring 80 , and pivot member 72 is securely mounted onto post 62 , the mirror shell 66 is biased against post 62 with slot or groove 68 received on the post 62 , along the horizontal length of mirror shell 66 . the biasing of mirror assembly 60 against post 62 , allows the mirror assembly 60 to resist the vibrational forces typically experienced by mirror assemblies during operation of the vehicle . the pivot axis of the mirror assembly 60 is aligned with the central axis of the pivot cap 84 , pivot member 72 and pivot slot 70 , which travels through the plane defined by mirror 64 . this axis defines a longitudinal horizontal axis about which the mirror 26 rotates and is laterally off - set from the central vertical axis c ( see fig6 ) of the mirror shell 66 and mirror 64 . the mirror 64 and mirror shell 66 can be selectively rotated between inboard and outboard positions about the longitudinal horizontal axis . in the inboard position of the mirror assembly 60 , a lateral edge 90 ( see fig5 ) of the mirror shell 66 is disposed adjacent the vehicle 50 and the post 62 is disposed in the slot or groove or slot 68 . when , for example , an operator is pulling a trailer , the operator may rotate the mirror shell 66 and mirror 64 to an outboard position by , first , pulling the mirror shell 66 and mirror 64 along the longitudinal horizontal axis defining the pivot axis away from post 62 , thereby displacing post 62 from the slot or groove 68 . then , the mirror shell 66 and mirror 64 are rotated 180 °, until post 62 is again aligned with the slot or groove 68 . mirror shell 66 is then released and biased back to position the mirror shell 66 against the post 62 in an outboard position . because the pivot axis is offset from the central vertical axis of the mirror shell 66 and mirror 64 , the lateral edge ( 90 a in fig5 ) of the mirror shell 66 and mirror 64 is now disposed farther outwardly than a lateral edge 92 of the mirror 64 and mirror shell 66 in the inboard position . preferably , the longitudinal horizontal axis is disposed midway between the central vertical axis and the lateral edge 92 of the mirror shell 66 . as shown in fig8 , another alternative rearview mirror assembly 100 comprises a mirror 102 disposed in a mirror frame 104 which can be extended from an inboard position to an outboard position to provides improved lateral rearward viewing to the operator of a vehicle . the mirror assembly 100 includes a mirror housing comprising a mirror shell 106 and a rim 108 which form a groove 110 . the mirror frame 104 is disposed in groove 110 and is slidable between an inboard position and an outboard position ( shown in phantom lines ). as shown in fig9 , the mirror assembly 100 also includes an attachment member 112 ( e . g ., a post ) which attaches the mirror frame 104 to an exterior panel of a vehicle . at the other end , the attachment member 112 slides into a sleeve 113 disposed in mirror shell 106 and is securely attached thereto to resist the vibrational forces experienced by the mirror assembly 100 during operation of the vehicle . alternatively , the mount might extend through a bottom opening 113 a , depending on the vehicle . mirror assembly 100 also includes a spring plate 120 and a bracket 122 which are disposed in mirror shell 106 . bracket 122 is received on bosses 123 disposed in mirror shell 106 and over sleeve 113 . bracket 122 is securely fixed in mirror shell 106 by tightening self - tapping screws 125 into bosses 123 in mirror shell 106 . bracket 122 contains a channel 126 which receives sleeve 113 and also contains end posts 127 , which receive and support spring plate 120 . the spring plate 120 is securely attached to bracket 122 by heat staking the end posts 127 in openings 129 in the spring plate 120 . as shown in fig1 , the mirror frame 104 contains a detent 114 disposed in a lateral edge adjacent the vehicle which is received in a notch 116 of the rim 108 when the rearview mirror assembly 100 is in the inboard position . the detent 114 and the notch 116 are biased into the mirror frame 104 at the inboard position and prevent the mirror frame 104 from sliding out of the inboard position without a predetermined pulling force being applied to the mirror frame 104 . a reflective mirror surface 115 is disposed in the mirror shell 106 adjacent the vehicle and concealed behind the mirror frame 104 in an inboard position . as shown in fig1 , mirror frame 104 also contains a stop 118 which prevents the mirror frame 104 from completely sliding out of groove 110 and the mirror shell 106 when a pulling force is applied to the mirror frame 104 . when a pulling force is applied to the mirror frame 104 , detent 114 rides out of notch 116 from an inboard position toward an outboard position , until stop 118 prevents further movement of mirror frame 104 . spring plate 120 , which is attached to bracket 122 , provides a bias force against mirror frame 104 to provide a secure mount at either position . it is envisioned that the inventive mirrors could be provided with and adjustment motor by having the motor push against the mirror shell , rather than the mirror plate . in such an embodiment , the mirror would be mounted to the vehicle such that movement of the entire mirror shell relative to its mounting bracket would be affected to adjust mirror positioning . another mirror embodiment 150 as shown in fig1 , and is particularly useful in original equipment applications . the outer housing 152 has a mirror surface 154 and pivots relative to an inner housing 158 . a second mirror surface 156 is provided behind the outer housing 152 , such that when the outer housing 152 is in its extended position the second mirror surface 156 is visible . the vehicle body 160 mounts the inner housing 158 in any known fashion . fig1 is a rear view of the mirror embodiment 150 , showing the outer housing 152 in its extended position . the inner housing 158 carries a reflector 162 . a second reflector 164 may be mounted on the outer housing 152 . fig1 is a cross - sectional view through the embodiment 150 . as shown , the outer housing 152 may carry generally cylindrical boss 165 which is mounted in a cylindrical member 167 fixed to the inner housing 158 . the boss 165 rotates in the cylindrical member 167 , and defines an axis of rotation for the outer housing 152 . o - rings 157 may seal between cylindrical member 167 and boss 165 . as in the earlier embodiments , this axis of rotation is off center relative to the center of the mirror surface 154 , and thus by pivoting the outer housing 152 once achieves the extended position as shown in fig1 and 13 . a motor power pack 166 is provided which may adjust the mirror surface 154 as is know . power packs having the ability to adjust the mirrors are incorporated in may vehicles , and may be of conventional structure and function . the boss 165 may be provided with gear teeth 169 at a portion of its outer periphery . a gear 168 may be driven by a motor 170 such that the housing 152 may be power driven between its inboard and outboard position . alternatively , this embodiment may also be manually moved between the inboard position and the outboard positions . a retainer clip and spring combination 182 are secured on an end 174 of the boss 165 , and biases the boss 165 against an inner ledge 175 of the cylindrical member 167 . this thus secures the outer housing 152 within the inner housing 158 . a preferred description of this invention has been disclosed ; however , a worker of ordinary skill in the art would recognize that certain modifications would come within the scope of this invention . for that reason , the following claims should be studied in order to determine the true scope and content of this invention . | 1 |
the present invention is related to logic devices , and more particularly to differential logic devices . turning to fig3 , a two input differential and / or gate 300 in accordance with various embodiments of the present invention is shown . as will be discussed more fully below , determination of whether gate 300 operates as an and gate or as an or gate is determined by proper selection of values for a resistor 302 and a resistor 304 . as shown , gate 300 includes two differential input pairs 307 , 311 in parallel with each other . one set of differential inputs 332 , 334 is applied to the respective bases of a transistor 306 and a transistor 308 of differential pair 307 . another set of differential inputs 336 , 338 is applied to the respective bases of a transistor 310 and a transistor 312 of differential pair 311 . differential pair 307 is biased separate from differential pair 311 . in particular , differential pair 307 is biased by a current source generated by applying a bias voltage 340 to a transistor 320 that is electrically coupled to ground ( vss 342 ) via a resistor 341 , and differential pair 311 is biased by a current source generated by applying bias voltage 340 to a transistor 322 that is electrically coupled to vss 342 via a resistor 343 . the collector of transistor 306 and the collector of transistor 310 are electrically coupled to vdd 330 via a resistor 302 , and to the base of an emitter follower transistor 331 . the collector of transistor 308 and the collector of transistor 312 are electrically coupled to vdd 330 via a resistor 304 , and to the base of an emitter follower transistor 329 . emitter follower transistor 331 is biased by a transistor 326 and a resistor 347 , and emitter follower transistor 329 is biased by a transistor 324 and a resistor 345 . only a single set of differential outputs ( yef 384 and yefz 386 ) are provided from gate 300 . resistor 302 and resistor 304 create an input dependent ir voltage drop ( i . e ., current multiplied by load resistance ) from vdd 330 . to create an and gate from and / or gate 300 , resistor 302 and resistor 304 are purposely mismatched ( or scaled ) such that the following conditions must both be true in order for yef 384 & gt ; yefz 386 : due to the parallel nature of the logic architecture , three states exist at the output ( yef 384 , yefz 386 ). the three states are set forth in table 1 below where it is assumed that the current ( i t ) sourced via transistor 320 ( i t1 ) is the same as the current sourced via transistor 322 ( i t2 ): using the above mentioned equations , values for resistor 302 and resistor 304 can be tabulated where an appropriate tail current ( i t ) is assumed . for example , where the tail current is set at twenty microamperes , values of 4 kohm for resistor 302 and 12 kohm for resistor 304 satisfy the equations of table 1 above . table 2 below demonstrates this by solving each of the equations of table 1 using the aforementioned values : as can be seen , the conditions for an and gate are satisfied where v yef − v yefz is only greater than zero where both v input 332 − v input 334 & gt ; 0 and v input 336 − v input 338 & gt ; 0 are true . it should be noted that other combinations of values for resistor 302 , resistor 304 and i t may be used to create an and gate in accordance with embodiments of the present invention . in operation when an and gate is created as set forth above , when input 332 is asserted high relative to input 334 and input 336 is asserted high relative to input 338 , output yef 384 is asserted high relative to output yefz 386 . in this case , transistor 306 and transistor 310 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 and the tail current ( i t2 ) sourced by transistor 322 both traverse resistor 302 , and no current traverses resistor 304 . thus , the voltage at the base of emitter follower transistor 331 [ vdd −( i t1 + i t2 )* r 302 ] is lower than the voltage at the base of emitter follower transistor 329 [ vdd ], and yef 384 is at a higher voltage than yefz 386 . in contrast , when input 332 is asserted low relative to input 334 and input 336 is asserted low relative to input 338 , output yef 384 is asserted low relative to output yefz 386 . in this case , transistor 308 and transistor 312 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 and the tail current ( i t2 ) sourced by transistor 322 both traverse resistor 304 , and no current traverses resistor 302 . thus , the voltage at the base of emitter follower transistor 331 [ vdd ] is higher than the voltage at the base of emitter follower transistor 329 [ vdd −( i t1 + i t2 )* r 304 ], and yefz 386 is at a higher voltage than yef 384 . in another condition , when input 332 is asserted high relative to input 334 and input 336 is asserted low relative to input 338 , output yef 384 is asserted low relative to output yefz 386 . in this case , transistor 306 and transistor 312 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 traverses resistor 302 , and the tail current ( i t2 ) sourced by transistor 322 traverse resistor 304 . thus , the voltage at the base of emitter follower transistor 331 [ vdd − i t1 * r 302 ] is higher than the voltage at the base of emitter follower transistor 329 [ vdd − i t2 * r 304 ], as the value of resistor 302 is less than the value of resistor 304 , and yefz 386 is at a higher voltage than yefz 384 . the same condition occurs in the opposite condition where input 332 is asserted low relative to input 334 and input 336 is asserted high relative to input 338 . at this point , it should be noted that an or gate can be similarly created by appropriately selecting values for resistor 302 , resistor 304 and the tail current as before , but to satisfy the conditions of an or gate . in particular , to create an or gate from and / or gate 300 , resistor 302 and resistor 304 are purposely mismatched ( or scaled ) such that the following conditions must both be true in order for yef 384 & lt ; yefz 386 : again , due to the parallel nature of the logic architecture , three states exist at the output ( yef 384 , yefz 386 ). the three states are set forth in table 3 below where it is assumed that the current ( i t ) sourced via transistor 320 ( i t1 ) is the same as the current sourced via transistor 322 ( i t2 ): using the above mentioned equations , values for resistor 302 and resistor 304 can be tabulated where an appropriate tail current ( i t ) is assumed . for example , where the tail current is set at twenty microamperes , values of 12 kohm for resistor 302 and 4 kohm for resistor 304 satisfy the equations of table 3 above . table 4 below demonstrates this by solving each of the equations of table 3 using the aforementioned values : as can be seen , the conditions for an or gate are satisfied where v yef − v yefz is always greater than zero where either v input 332 − v input 334 & gt ; 0 or v input 336 − v input 338 & gt ; 0 are true . it should be noted that other combinations of values for resistor 302 , resistor 304 and i t may be used to create an or gate in accordance with embodiments of the present invention . in operation when an or gate is created as set forth above , when input 332 is asserted high relative to input 334 and input 336 is asserted high relative to input 338 , output yef 384 is asserted high relative to output yefz 386 . in this case , transistor 306 and transistor 310 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 and the tail current ( i t2 ) sourced by transistor 322 both traverse resistor 302 , and no current traverses resistor 304 . thus , the voltage at the base of emitter follower transistor 331 [ vdd −( i t1 + i t2 )* r 302 ] is lower than the voltage at the base of emitter follower transistor 329 [ vdd ], and yef 384 is at a higher voltage than yefz 386 . in contrast , when input 332 is asserted low relative to input 334 and input 336 is asserted low relative to input 338 , output yef 384 is asserted low relative to output yefz 386 . in this case , transistor 308 and transistor 312 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 and the tail current ( i t2 ) sourced by transistor 322 both traverse resistor 304 , and no current traverses resistor 302 . thus , the voltage at the base of emitter follower transistor 331 [ vdd ] is higher than the voltage at the base of emitter follower transistor 329 [ vdd −( i t1 + i t2 )* r 304 ], and yefz 386 is at a higher voltage than yef 384 . in another condition , when input 332 is asserted high relative to input 334 and input 336 is asserted low relative to input 338 , output yef 384 is asserted high relative to output yefz 386 . in this case , transistor 306 and transistor 312 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 traverses resistor 302 , and the tail current ( i t2 ) sourced by transistor 322 traverse resistor 304 . thus , the voltage at the base of emitter follower transistor 331 [ vdd − i t1 * r 302 ] is lower than the voltage at the base of emitter follower transistor 329 [ vdd − i t2 * r 304 ], as the value of resistor 302 is greater than the value of resistor 304 . thus , yef 384 is at a higher voltage than yefz 384 . the same condition occurs in the opposite condition where input 332 is asserted low relative to input 334 and input 336 is asserted high relative to input 338 . turning now to fig4 , the logic gate of fig3 is extended to be a three input differential and / or gate 400 in accordance with various embodiments of the present invention . based on the description of gate 400 , one of ordinary skill in the art will appreciate the extensibility of the logic architecture of the present invention . based on this , one of ordinary skill in the art will recognize that logic gates of four or more differential inputs may be created without impacting the head room available through the selection of vdd . gate 400 includes three differential input pairs 307 , 311 , 415 in parallel with each other . one set of differential inputs 332 , 334 are applied to the respective bases of transistor 306 and transistor 308 of differential pair 307 . another set of differential inputs 336 , 338 are applied to the respective bases of transistor 310 and transistor 312 of differential pair 311 ; and yet another set of differential inputs 440 , 442 are applied to the respective bases of a transistor 414 and a transistor 416 of differential pair 415 . differential pair 307 is biased by a current source generated by applying bias voltage 340 to transistor 320 that is electrically coupled to ground ( vss 342 ) via resistor 341 ; differential pair 311 is biased by a current source generated by applying bias voltage 340 to transistor 322 that is electrically coupled to vss 342 via resistor 343 ; and differential pair 415 is biased by a current source generated by applying bias voltage 340 to a transistor 426 that is electrically coupled to vss 342 via a resistor 449 . the collector of transistor 306 , the collector of transistor 310 and the collector of transistor 414 are electrically coupled to vdd 330 via resistor 302 , and to the base of emitter follower transistor 331 . the collector of transistor 308 , the collector of transistor 312 and the collector of transistor 416 are electrically coupled to vdd 330 via resistor 304 , and to the base of emitter follower transistor 329 . emitter follower transistor 331 is biased by transistor 324 and resistor 347 , and emitter follower transistor 329 is biased by transistor 324 and resistor 345 . only a single set of differential outputs ( yef 384 and yefz 386 ) are provided from gate 300 . as with the two input gate of fig3 , resistor 302 and resistor 304 create an input dependent ir voltage drop from vdd 330 . to create an and gate from and / or gate 400 , resistor 302 and resistor 304 are purposely mismatched ( or scaled ) such that the following conditions must both be true in order for yef 384 & gt ; yefz 386 : again , due to the parallel nature of the logic architecture , five states exist at the output ( yef 384 , yefz 386 ). the five states are set forth in table 5 below where it is assumed that the current ( i t ) sourced via transistor 320 ( i t1 ) is the same as the current sourced via transistor 322 ( i t2 ) and that ( i t3 ) sourced via transistor 426 : using the above mentioned equations , values for resistor 302 and resistor 304 can be tabulated where an appropriate tail current ( i t ) is assumed . for example , where the tail current is set at fifteen microamperes , values of 4 kohm for resistor 302 and 12 kohm for resistor 304 satisfy the equations of table 5 above to yield a logical and function . table 6 below demonstrates this by solving each of the equations of table 5 using the aforementioned values : as can be seen , the conditions for an and gate are satisfied where v yef − v yefz is only greater than zero where all of v input 332 − v input 334 & gt ; 0 , v input 336 − v input 338 & gt ; 0 and v input 440 − v input 442 & gt ; 0 are true . it should be noted that other combinations of values for resistor 302 , resistor 304 and i t may be used to create an and gate in accordance with embodiments of the present invention . in operation when an and gate is created as set forth above , when input 332 is asserted high relative to input 334 , input 336 is asserted high relative to input 338 , and input 440 is asserted high relative to input 442 , output yef 384 is asserted high relative to output yefz 386 . in this case , transistor 306 , transistor 310 and transistor 414 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 , the tail current ( i t2 ) sourced by transistor 322 , and the tail current ( i t3 ) sourced by transistor 426 all traverse resistor 302 , and no current traverses resistor 304 . thus , the voltage at the base of emitter follower transistor 331 [ vdd −( i t1 + i t2 + i t3 )* r 302 ] is lower than the voltage at the base of emitter follower transistor 329 [ vdd ], and yef 384 is at a higher voltage than yefz 386 . in contrast , when all of input 332 is asserted low relative to input 334 , input 336 is asserted low relative to input 338 , and input 440 is asserted low relative to input 442 , output yef 384 is asserted low relative to output yefz 386 . in this case , transistor 308 , transistor 312 and transistor 416 are turned on . in such a condition , the tail current ( i t1 ) sourced by transistor 320 , the tail current ( i t2 ) sourced by transistor 322 , and the tail current ( i t3 ) sourced by transistor 426 all traverse resistor 304 , and no current traverses resistor 302 . thus , the voltage at the base of emitter follower transistor 331 [ vdd ] is higher than the voltage at the base of emitter follower transistor 329 [ vdd −( i t1 + i t2 + i t3 )* r 304 ], and yefz 386 is at a higher voltage than yefz 384 . in all other conditions , output yef 384 is asserted low relative to output yefz 386 . in this case , one or two of transistor 306 , transistor 310 and transistor 414 are turned on , while one or two of transistor 308 , transistor 312 and transistor 416 are turned off . in such a condition , one or two of the tail currents ( i t1 , i t2 , i t3 ) traverse resistor 302 and one or two of the tail currents ( i t1 , i t2 , i t3 ) traverses resistor 304 . thus , where it is assumed that each of the tail currents are equal , the voltage at the base of emitter follower transistor 331 [ vdd − i t1 * r 302 , or vdd − 2 * i t1 * r 302 ] is higher than the voltage at the base of emitter follower transistor 329 [ vdd − i t1 * r 304 , or vdd − 2 * i t1 * r 304 ], as the value of resistor 302 is less than half the value of resistor 304 , and yefz 386 is at a higher voltage than yefz 384 . the same condition occurs in the opposite condition where input 332 is asserted low relative to input 334 and input 336 is asserted high relative to input 338 . at this point , it should be noted that an or gate can be similarly created by appropriately selecting values for resistor 302 , resistor 304 and the tail current as before , but to satisfy the conditions of an or gate similar to that discussed above in relation to fig3 . based on the disclosure provided herein , one of ordinary skill in the art will appreciate a variety of advantages that may be had through implementing logic using the architecture of the present invention . for example , using the present architecture , stacked devices are eliminated which enabled operation from lower supply voltages and the resulting power reductions . in addition , a purely differential logic family may be developed , as opposed to a single ended emitter coupled logic family that trades off noise margins . yet further , more complex logic functions may be implemented at a given supply voltage . for example , a four or more input device may be implemented which may not be possible using the same supply voltage level in a stacked architecture . yet further , the input common - mode range is increased because the transistors are not stacked . as such , a designer need only maintain saturation in the tail devices . each differential pair exhibits increased common - mode range compared to having any cascoded devices between the differential pair and a resistive load . yet further , all input common - modes are decoupled from one another , thus there is no need to level shift outputs up or down to accommodate downstream logic . in addition , the typical speed for a given level of current consumption can be greater since fewer level shifters equals less loading . also , for some cases of fully differential ecl designs , emitter followers cannot be used which dramatically slows down operation . one or more of the aforementioned advantages , or other unlisted advantages may be had in accordance with one or more embodiments of the present invention . while only a two input and / or gate and a three input and / or gate have been presented herein , based on the disclosure provided herein , one of ordinary skill in the art will recognize a variety of other gate types that may be implemented consistent with the architecture disclosed herein , and in accordance with various embodiments of the present invention . as an example , the architecture set forth herein may also be used for , but is not limited to , creating differential nand and nor gates . in conclusion , the present invention provides novel systems , devices , methods for implementing and using parallel emitter coupled logic . while detailed descriptions of one or more embodiments of the invention have been given above , various alternatives , modifications , and equivalents will be apparent to those skilled in the art without varying from the spirit of the invention . therefore , the above description should not be taken as limiting the scope of the invention , which is defined by the appended claims . | 7 |
referring now to fig1 there is shown a device generally designated 20 for compressing a patient &# 39 ; s limb , such as the leg , as shown . the compression device 20 has a controller generally designated 22 and a pair of elongated sleeves 26 for covering the patient &# 39 ; s limbs . the controller 22 , which per se comprises no part of this invention , may be of the type disclosed , for example , in u . s . pat . nos . 4 , 013 , 069 and 4 , 030 , 488 , incorporated herein by reference , and the controller 22 sequentially passes fluid through a pair of conduits 34 and 35 to the sleeves 26 in order to inflate chambers in the sleeves , as will be discussed below , from a source of fluid through a conduit 28 communicating with the controller 22 , and the controller 22 may intermittently connect the inflated chambers of the sleeves 26 to an exhaust or conduit 30 . with reference to fig2 - 4 , the sleeves 26 have a leg portion 40 for covering the leg from the region of the ankle to the thigh , and a foot portion 42 for covering the foot of a patient . the sleeves 26 have a pair of inner fluid impervious sheets 44 and 46 which are joined together along lines 48 by suitable means , such as by heat sealing in order to form chambers in the sleeves 26 . thus , the foot portion 42 has a laterally extending chamber 50 at a location for covering the plantar arch intermediate the ball and the heel of the foot at a location underneath the foot , although the foot chamber 50 may extend partially or entirely around the upper portion of the foot after placement of the sleeve 26 , if desired . as shown , the leg portion 40 of the sleeve 26 has a plurality of progressively located chambers 52a , 52b , 52c , 52d , 52e , and 52f extending laterally in the sleeve 26 such that they are raised to cover the ankle , calf and thigh of the leg at a location extending from the ankle to the thigh region of the leg . in a preferred form , the leg chamber 52a - f extend completely around the limb after placement of the sleeve 26 . as shown , in a preferred form , the foot portion 42 is of 1 - piece construction with a leg portion 40 and sleeve 26 to provide sleeve 26 of simplified construction and reduce cost . the conduits 34 and respective foot chambers 50 and the leg chambers 52a - f in a suitable manner ( not shown ), such as by the connectors disclosed in u . s . pat . no . 4 , 320 , 746 , incorporated herein by reference . if desired , the sleeves 26 may have an inner sheet of suitable flexible material ( not shown ) covering an inner surface of the sheets 44 and 46 to provide comfort to the limb during the use of the device 20 after placement of the sleeve 26 , and may have an outer sheet 58 of a loop material , such as a knit fabric covering an outer surface of the sheets 44 and 46 . the sleeves 26 may have elongated strips 62 of a hook material extending along a side of the foot portion 42 and leg portion 40 of the sleeve 26 for a purpose which will be described below . the conduits 34 and 35 may be covered with a suitable tube 64 for the leg portion 40 of the sleeve 26 and the tube 66 of fabric for the foot portion 42 in a manner as disclosed in u . s . pat . no . 4 , 320 , 746 , incorporated herein by reference . while not necessary to the practice of this invention , as in prior compression devices of the general description , sleeve 26 may have an elongated opening 32 extending through a knee region 36 of the sleeve , defined by peripheral edges 38 around the opening 32 . in addition , as shown , the sleeve 26 may have an elongated opening or cut - out 54 in the knee region 36 extending from one side edge toward a lateral central portion of the sleeve , with the cut - out 54 being defined by peripheral edges 60 . as is described with more particularity in u . s . pat . no . 4 , 207 , 875 issued to edward j . arkans , the purpose of these openings is to enhance the flexibility of the sleeve in the knee region . preparatory to use , the sleeves 26 are placed over the limbs of the patient , with the foot portion 42 located over the patient &# 39 ; s foot , and the leg portion 40 over the patient &# 39 ; s leg . the sleeves 26 are wrapped about the foot and leg , such that the foot portion 42 of the sleeve 26 encompasses the foot , and the leg portion 40 of the sleeve 26 encompasses the leg . in this configuration , the strips 62 of the sleeve 26 may be placed in contact with the outer loop sheet 58 in order to engage the hook strip 62 at an adjustable position on the sheet 58 of loop material in order to secure both the foot portion 42 and leg portion 40 of the sleeve in place in a comfortable and snug position about the patient &# 39 ; s limbs . in use , the controller 22 is operated in order to sequentially inflate the foot chamber 50 and leg chambers 52a - f , in an order with the foot chamber being inflated first and the remaining chambers of the leg subsequently in an arrangement from a distal portion of the leg towards a proximal portion of the leg relative to the heart while the foot chamber remains inflated . thus , the foot chamber 50 is inflated first in order to enhance circulation of blood from the foot into the leg , after which the leg portion 40 of the sleeve is operated in order to sequentially inflate the leg chambers in order with the ankle being inflated first , the calf portion being inflated after the ankle portion , and then the thigh portion being inflated after the calf portion . in this manner , the leg portion 40 of the sleeve 26 enhances the movement or circulation of blood through the legs after the blood from the foot has been circulated into the legs , thereby preventing trapping of blood in the foot , and enhancing blood circulation through the legs in a direction toward the heart . during the sequential inflation of the leg chambers 52a - f of the sleeves 26 , the foot chamber 42 remains inflated , and , in a preferred form , each of the more distal chambers of the leg portion 40 also remains inflated during subsequent inflation of more proximal chambers of the leg portion 40 of the sleeves 26 , such that each of the chambers of the sleeves 26 remain inflated during compression cycles of device 20 . in this manner , the device maintains pressures in the respective chambers during periodic compression cycles , after which cycles the chambers are then deflated . further , a preferred form the controller 22 controls the maximum pressure in each chamber such that at least some of the pressure is decreased toward the proximal portion of the leg . thus , according to the present invention , the foot chamber 50 of the foot portion 42 is initially inflated during a compression cycle in order to enhance movement of the blood into the leg of the patient after which the leg chambers 52a - f are sequentially inflated in order to propel the blood from the limbs toward the patient &# 39 ; s heart . in this manner , the device 20 prevents trapping of fluid in the patient &# 39 ; s limb while materially increasing the rate of blood flow through the limb during operation of the device 20 . stated another way , device 20 of the present invention maximizes the movement of fluid while minimizing the trapping of fluid in the limb in an improved manner . according to the present invention , in a preferred form , the controller sequentially inflates the chambers of the sleeves 26 and retains dynamic control during inflation in order to maintain the chambers inflated in a desired pattern during operation of the device . in this manner , control may be maintained over the inflation pressures in each of the chambers individually during inflation . it will be appreciated that various changes and additions may be made in the device shown in the illustrative drawing without departing from the scope of the invention herein contemplated . for example , while the device has been illustrated to be a unitary sleeve 26 having a leg portion 40 and a foot portion 42 , it will be apparent that the leg and foot portions may instead be separate sleeves encompassing the respective limb portions where compression is to be applied . further , while the preferred compression devices , i . e . the &# 34 ; scd &# 34 ; device manufactured and sold by the kendall company , assignee of the present invention , provide a pressure gradient , it is within the scope of this invention to provide compression patterns which do not . it is also within the scope of this invention to maintain a minimum or base pressure in each of the compression chambers throughout the entire inflation and deflation cycles . this base pressure may be the same in each of the chambers in the sleeve , e . g . on the order of about 10 mm of mercury or , alternatively , it may be the greatest in the foot chamber and then become progressively lower in each successive chamber . for example , the foot chamber may be on the order of 10 mm ; the ankle chamber on the order of 8 mm ; the calf on the order of 6 mm ; and thigh 4 mm . as heretofore alluded to , the patent literature is replete with references to sequential compression devices . in general , any of the modifications described and claimed in these prior patents may be incorporated into the novel device of this invention . for instance , a ventilation chamber may be included , as disclosed in u . s . pat . nos . 4 , 091 , 804 of james h . hasty or 4 , 481 , 937 of edward j . arkans . other modifications which may be made included , but are not limited to the following : providing concurrent rather than sequential inflation ( compression ) from a single pulse to apply a gradient from ankle to thigh , as described in u . s . pat . no . 4 , 030 , 488 of james h . hasty ; providing means for monitoring the pressure in the sleeves , as disclosed in u . s . pat . no . 4 , 331 , 133 of edward j . arkans ; sensing the pressure in the chambers and then venting to prevent over - pressurizing , as taught in u . s . pat . no . 4 , 396 , 010 of arkans ; and including an arterial thrombosis detection system , as disclosed in u . s . pat . no . 4 , 574 , 812 of arkans . other changes and additions will be readily suggested to those skilled in the art in the light of the foregoing description . while the present invention is primarily directed to preventing deep vein thrombosis which can occur while a patient is bedridden , e . g . following surgery , it also may find utility in inhibiting edema , particularly lymphedema , a chronic unilateral or bilateral edema of the legs due to accumulation of interstitial fluid as a result of stasis of lymph , which is secondary to obstruction of lymph vessels or disorders of the lymph nodes . it may also be used for the treatment of chronic venous disease , one consequence of which is venous stasis ulceration of the leg . by way of recapitulation , it will be seen that the present invention provides an improved compression device for the limb in that it permits a more complete venous return or emptying of the leg since it includes compression to the plantar venous plexus . for this reason , trapping of venous blood in the foot veins during compression is obviated . this advantage distinguishes the present invention over the foot pumps of the prior art such as those described in the aforementioned u . s . pat . nos . 4 , 702 , 232 and 4 , 841 , 956 of gardner and fox in that the present invention provides a more complete emptying of the limb veins , particularly at the valve cusp , a locus particularly susceptible to stasis . the foregoing detailed description is given for clearness of understanding only and no unnecessary limitations should be understood therefrom , as modifications will be obvious to those skilled in the art . | 0 |
in the following description of the figures , the same reference numerals are used for the same or similar elements . the representations in the figures are schematic and not to scale . fig1 a shows a schematic cross - sectional representation of an energy absorber according to an exemplary embodiment of the present invention . the energy absorber 100 has a lower housing region 101 and an upper housing region 102 , between which the energy absorber element is mounted . the energy absorber 100 , in which this energy absorber elements 1 are installed , is subdivided basically into so - called single deckers with a sheet or with multiple sheets placed in one another and so - called multiple deckers with two or more sheets running opposite to one another ( which can comprises respectively again multiple sheets placed in one another ). thus , multiple sheets can be nested in one another , in order to achieve for example an optimization of the cover layer load , better volume use or increased force level . in addition , the energy absorber 100 includes a fixed support 103 for the energy absorber element 1 and force impact points 105 - 112 , 115 . fig1 b shows the energy absorber of fig1 a in a representation rotated at 90 °. the upper housing part or double - decker sheet 102 has a bore 113 for attachment , for example , to the primary structure of the aircraft . the energy absorber element 1 has a bore 114 for attachment , for example , to an inboard device part of the aircraft . if a force acts now on the housing in the direction of the arrow 116 and a force acts on the absorber element 1 in the opposite direction 117 , then the absorber element is pulled out from the housing by plastic deformation upon exceeding a known minimal force . thus , energy is absorbed . the absorption functions also in the reverse direction , as specifically the energy absorber element 1 is pressed into the housing . the first impact points 105 to 112 and 115 serve on the one hand for connection of the cover sheets 101 , 102 and for distribution of the occurring forces ( symbolized by force line 118 and arrows 119 , 120 ). the structure shown in fig1 represents the basic form o the single decker . here , the energy absorber element 1 is braced against the cover layers 101 , 102 and is transformed upon reaching the trigger force . fig2 a , 2 b shows cross - sectional representations of an energy absorber according to a further exemplary embodiment of the present invention . this structure is principally designed like the structure in fig1 . by means of the slots of the sheet 1 and the subdivision of the housing 102 , 101 made possible in this manner by intermediate walls 202 into multiple chambers , the forces may be greatly reduced or uniformly distributed . reference numeral 201 represents a slot in the sheet , in which an intermediate wall 202 runs . fig3 a , 3 b show a further energy absorber according to a further exemplary embodiment of the present invention in two cross - sectional representations . this structure can be viewed as an independent deformation principle . since here , however , preferably only one energy absorber element 1 is deformed , this structure is attributed likewise to the single - decker . the sheet is passed around multiple times around rollers 301 , 302 , 303 , 304 , 305 , 306 , 307 . the rollers should be designed to be rotatable , in order to hold the frictional effect at a minimum . fig4 a , 4 b show an energy absorber according to a further exemplary embodiment of the present invention , which belongs to the structure “ double deck ”. here , the first energy absorber element 1 is braced on one side against the cover layer 102 . a second energy absorber element 3 is provided , which is braced on the other side against the lower cover layer 101 . the energy absorber elements 1 , 3 are deformed upon reaching the tripper force and roll against one another . fig5 a , 5 b shows an energy absorber according to a further exemplary embodiment of the present invention . this structure is designed principally like the structure of fig4 . by the placement of two or more sheets 1 , 2 or 3 , 4 , the force level can be increased . for example , larger loads can therefore be absorbed . at the same time , one uses the space better and the differently positioned sheets affect a favorable force distribution on the cover layers or cover plates 101 , 102 through the now existing two force lines 118 . fig6 a , 6 b , 6 c shows a further embodiment of the energy absorber . here , respectively , two ( or more ) sheets are placed in one another ( 1 , 2 or 3 , 4 or 5 , 6 or 7 , 8 ). in addition , the different groups of inlaid sheets are placed respectively over one another . the sheet pair 1 , 2 is braced with a rolling motion against the sheet pair 3 , 4 and the sheet pair 5 , 6 , is braced with a rolling motion against the sheet pair 7 , 8 . the structural space here is used very favorably . the multiple sheets lying over one another acts by their arrangement itself like cover sheets and reduced therefore the forces acting on the cover layers 101 , 102 . in addition , through the adjacent placement of such sheets , the thickness of the energy absorber 100 ( that is , the spacing of both cover sheets 101 , 102 ) with constant force progression may be reduced . this could enable an integration of the energy absorber in a sandwich palette , for example , which can result in turn in reduction of the housing . fig7 a , 7 b show an energy absorber according to a further exemplary embodiment of the present invention . this structure is designated by a slim design . here , the individual energy absorber elements 1 , 2 , 3 , 4 , 9 , 10 are connected to one another via a central tension rod 701 . the differently positioned sheets affect a favorable force distribution on the cover layers 101 , 102 through the now existing three force lines 1181 , 1182 , 1183 . fig8 a through 9d show an energy absorber with an adjustment element according to a further exemplary embodiment of the present invention . the force progression may be adjusted freely by continuous change of the cover plate distance . this adjustment element system can be used for the single decker principle as well as for the double or multiple decker principle . the adjustment element system includes a first adjustment element 801 , a second adjustment element 802 , and a cover plate 803 , which can be displaced by actuation of both adjustment elements 801 , 802 . by actuation of the adjustment elements 801 , 802 , the cover plate 803 can be displaced , such that the energy absorber element 1 is squeezed together more or less intensely . in the configuration shown in fig8 a , 8 b , the uniform , substantially constant force - path - progression of fig8 c is provided . in the position shown in fig8 d ( here the adjustment elements 801 , 902 are screwed in more strongly , so that the cover plate 803 presses together the energy absorber element 1 more strongly ), the force - path - progression shown in fig8 d is provided ( at higher level than in fig8 c ). in the position shown in fig9 a , in which the cover plate 803 is positioned inclined , the force progression shown in fig9 b is provided . here , after expenditure of a minimal force , the force progression is not constant , rather decreases upon pulling out of the strip 1 . on the contrary , the force progression increases upon pushing in of the strip . the cover plate 803 also can have a different form , for example , a hump or bulge 808 , which leads to bending of the sheet 1 still further in the region 809 , thereby changing the force - path - progression accordingly . in the configuration shown in fig9 c , a reverse force progression ( see fig9 d ) is provided , in which upon pulling out of the sheet or plate 1 , the force expended therefore increases ( and vice versa ). fig1 a through 11d show a double decker system with adjustment elements 801 , 802 , 805 , 806 and cover plates 803 , 807 . the force progression resulting from the configuration of fig1 a , 10 b is shown in fig1 c . the force progress constantly here upon pulling out or pushing in of the sheet 1 , 3 . if the adjustment elements 801 , 802 , 805 , 806 are screwed in ( see fig1 d ), an increased force progression is provided ( see fig1 e ). if the adjustment elements are screwed in strongly in a different manner , as shown in fig1 a , a force progression that decreases upon pulling out is provided ( see fig1 b ). if in contrast the adjustment elements are screwed opposite to the configuration of fig1 a ( see fig1 c ), an increased force progression is provided upon pulling out of the strip 1 , 2 ( see fig1 d ). the adjustment elements can be positioned also via hydraulic tappet rods , eccentric disks or electric adjustment drive instead of by screws ( see fig1 a and 11c ). thus , the force level of the absorption can be adjusted also very quickly and / or by automation to the individual situation . naturally , also the use of other materials is possible , for example flexible , deformable plastics or other flexible , deformable materials / material mixtures . the shown energy absorber can also be used as an energy absorber in so - called tie - rods . further applications are , for example : energy absorber in tie rods of hatrack chains . a particular effect is the transfer of forces of the released holder onto the hatrack arranged in front of it and therewith a redundancy potential of this retaining concept . essentially , these principles are useable where a permanent , positive force - fit connection ( defined kinematically ) is required . energy absorber in rudder linkage for large landing flaps and rudders . energy absorber for apus , in particular for attachment of the apu (“ auxiliary power unit ”). by changing the geometry of the absorber elements , the bending radius and the material properties , the force levels may be varied . in addition , the force level is adjustable by changing spacing of the cover plates . a permanent frictional connection may exist . the system may be impervious to environmental conditions . in addition , the system may be insensitive to diagonal pull ( that is , for example , diagonal with reference to the arrow in fig9 a ), which can occur for example with a crash by deformation of the primary structure . here , a relative displacement of elements / components can occur , which could have as a result a deviation in the pullout direction . it should be noted that the term “ comprising ” does not exclude other elements or steps and the “ a ” or “ an ” does not exclude a plurality . also elements described in association with different embodiments may be combined . it should also be noted that reference signs in the claims shall not be construed as limiting the scope of the claims . | 1 |
with reference to the drawings , the invention will now be described in detail with regard for the best mode and the preferred embodiment . the invention is in the most general sense a sternal closure device used to close , secure and support a sternum post - operatively , the sternum having been longitudinally severed or bisected into left and right lateral halves to provide access to the interior of the chest . for ease of reference , the terms left and right as used herein shall mean the directions as seen by an observer facing the sternum of the patient , such that the right brace assembly and the right sternal half are disposed to the patient &# 39 ; s sinistral side , while the left brace assembly and the left sternal half are disposed to the patient &# 39 ; s dextral side . a first embodiment of the invention is illustrated in fig1 through 6 . the sternal closure device 10 comprises two sets of laterally disposed brace assemblies 20 and 30 , with left brace assembly 20 comprising a longitudinally extended top or anterior brace member 21 and a longitudinally extended bottom or posterior brace member 22 joined by brace joining means 40 , and with right brace assembly 30 comprising a longitudinally extended top or anterior brace member 31 and a longitudinally extended bottom or posterior brace member 32 joined by brace joining means 40 . brace joining means 40 comprise members adapted to be positioned within apertures or bores provided in the sternal halves 91 / 92 , such that the brace joining means 40 pass through the sternal halves 91 / 92 . preferably , the brace joining means 40 are such that the separation distance between the anterior brace members 21 / 31 and the posterior brace members 22 / 32 is adjustable to account for differences in the thickness of various sternums 90 , such that the sternal half 91 is compressed between the anterior and posterior brace members 21 / 22 , and such that the sternal half 92 is compressed between the anterior and posterior brace members 31 / 32 . preferably , the brace joining members 40 comprise internally threaded sleeve or post members 41 extending anteriorly from the posterior brace members 22 / 32 , with the sleeve members 41 receiving threaded fasteners 42 that are disposed through fastener receiving apertures 11 correspondingly positioned in the anterior brace members 21 / 31 . in this manner the securing forces are not concentrated in localized points or areas , such as would occur with bone anchor screws or the like , but instead are dispersed along the lengths of the brace assemblies 20 / 30 . likewise , no stresses are imparted to the ribs 93 . the anterior brace members 21 / 31 and the posterior brace members 22 / 32 are composed of a relatively rigid , bio - compatible metal or similar material such that support and rigidity are imparted to the sternal halves 91 / 92 . the laterally disposed left and right brace assemblies 20 / 30 are connected to each other by transverse bridging means 50 , whereby the longitudinal juxtapositioning of the two brace assemblies 20 / 30 is held in fixed relation , while the lateral distance between the two brace assemblies 20 / 30 is variable , such as in a sliding or telescoping manner . as shown in the embodiment of fig1 through 6 , the transverse bridging means 50 may comprise overlapping , telescoping arm members 51 a and 51 b , each arm member 51 a / 51 b comprising a hook end 52 that interlocks with bridging member receiving apertures or slots 12 disposed in the anterior brace members 21 / 31 . the bridging member receiving slots 12 are preferably provided - with projections , teeth , ridges or similar mechanical interlocking members 13 that correspond to and mate with cooperating projections , teeth , ridges or similar mechanical interlocking members 53 disposed on the inner side of the hook ends 52 , as illustrated in fig4 through 6 , in order to preclude relative movement between the bridging means 50 to the anterior brace members 21 / 31 . the sternal closure device 10 is further provided with locking or securing means 60 , preferably releasable in the event the sternum 90 needs to be separated in the future , whereby the left and right brace assemblies 20 / 30 can be brought together and locked or secured in a desired position laterally , typically such that the edges of the sternal halves 91 / 92 are in abutting relation with the longitudinal sternal incision or kerf 99 closed . in the embodiment of fig1 through 6 , the securing means 60 comprises a threaded bolt 61 mounted in a threaded aperture 63 disposed in the lowermost arm member 51 b , with the shaft of the bolt 61 positioned in a slot 62 disposed in the uppermost arm member 51 a . a washer flange member 64 is positioned atop the uppermost arm member 51 a . tightening of the bolt 61 forces the two arm members 51 a / 51 b together to preclude lateral movement . preferably the mutually facing surfaces of the arm members 51 a / 51 b are provided with projections , teeth , ridges or other mechanically interlocking members 54 to further preclude relative lateral movement . most preferably , the interlocking members 54 are configured in a ratchet - like manner , whereby movement of the arm members 51 a / 51 b to shorten the separation distance between the brace assemblies 20 / 30 is more readily accomplished than movement to separate the brace assemblies 20 / 30 . alternatively , the ratcheting interlocking members 54 may be structured such that separation of the brace assemblies 20 / 30 is completely precluded , in which instance additional bolts 61 , threaded apertures 63 and the like are not necessary . to utilize the device , bores are cut into the sternal bone material in each sternal half 91 / 92 . a guide template or the anterior brace members 21 / 31 themselves may be used to properly position the bores . the posterior brace plates 22 / 32 are then positioned beneath the sternal halves respectively with the sleeve members 41 inserted up into the bores . the anterior brace plates 21 / 31 are then positioned on top of the sternal , halves 91 / 92 and the threaded fasteners 42 are threaded into the sleeve members 41 , thus defining the two brace assemblies 20 / 30 such that they are rigidly affixed to the respective sternal halves 91 / 92 . the transverse bridging means 50 are then positioned between the anterior brace members 21 / 31 . the sternal halves 91 / 92 and the brace assemblies 20 / 30 are then brought together such that the sternal halves 91 / 92 abut each other . the securing means 60 is then locked to prevent separation of the brace assemblies 20 / 30 and the sternal halves 91 / 92 . should it be necessary to reopen the sternum , the securing means 60 can be released and the transverse bridging means 50 removed . a view of an embodiment showing the sternal closure device 10 in position on the sternum 90 is shown in fig1 . an alternative embodiment for the sternal closure device 10 is illustrated in fig7 through 10 . in this embodiment , at least one of the anterior brace members 21 / 31 has a different configuration , in that the transverse bridging means 50 comprises lateral arm members 55 affixed rigidly to or formed as an integral component of the anterior brace member 21 or 31 . the securing means 60 comprises arm brackets 65 that are secured to the anterior brace member 21 or 31 to receive the lateral arm members 55 . the arm brackets 65 are provided with bracket bolts or similar fasteners 66 that are mated with threaded apertures in the anterior brace member 21 or 31 , whereby tightening of the bracket bolt 66 forces the arm bracket 65 against the lateral arm member 55 to fix the relative lateral positions of the two brace assemblies 20 / 30 . preferably , the lateral arm members 55 and either the arm brackets 65 or the upper surface of the anterior brace member 21 or 31 are provided with lateral arm interlocking members 56 , such as projections , teeth , ridges or the like . while the illustrations show all lateral arm members 55 extending from only one of the anterior brace members 21 / 31 , i the lateral arm members 55 could extend in opposing directions from both anterior brace members 21 / 31 , with the securing means 60 correspondingly disposed on both anterior brace members 21 / 31 . the brace assemblies 20 / 30 of the sternal closure device 10 of this embodiment are affixed to the sternal halves as previously described . when the brace assemblies 20 / 30 and sternal halves have been brought together , the securing means 60 are locked by tightening the bracket bolts 66 , thereby affixing the relative positions of the sternal halves 91 / 92 and the brace assemblies 20 / 30 . it is contemplated that equivalents and substitutions to certain elements set forth above may be obvious to those skilled in the art , and therefore the true scope and definition of the invention is to be as set forth in the following claims . | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.