Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
a more complete understanding of the components , processes and apparatuses disclosed herein can be obtained by reference to the accompanying drawings . these figures are merely schematic representations based on convenience and the ease of demonstrating the present disclosure , and are , therefore not intended to indicate relative size and dimension of the devices or components thereof and / or to define or limit the scope of the exemplary embodiments . although specific terms are used in the following description for the sake of clarity , these terms are intended to refer only to the particular structure of the embodiments selected for illustration in the drawings , and are not intended to define or limit the scope of the disclosure . in the drawings and the following description below , it is to be understood that like numeric designations refer to components of like function . the term “ room temperature ” refers to a temperature of about 23 degrees celsius . the modifier “ about ” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context ( for example , it includes at least the degree of error associated with the measurement of the particular quantity ). when used in the context of a range , the modifier “ about ” should also be considered as disclosing the range defined by the absolute values of the two endpoints . for example , the range “ from about 2 to about 4 ” also discloses the range “ from 2 to 4 .” the term “ about ” may refer to plus or minus 10 % of the indicated number . the use of the singular terms “ a ”, “ an ”, and “ the ” should be construed to include plural referents as well , unless clearly indicated otherwise by the context . put another way , these singular terms should be construed as “ at least one .” the term “ layer ” means a single continuous sheet of material covering a surface . “ chemical etching ” is defined to mean any chemical process that reduces the conductivity of the exposed area to a level low enough that the conductivity difference between the exposed and non - exposed areas is sufficient to make the film effective for the given application . etching can be achieved by either removing the conductive film in desired areas or by chemically modifying the film in desired areas to cause it to be sufficiently non - conductive for the intended application . the present disclosure relates to the use of solid ink as a mask on selected portions of a flexible substrate . the ink mask can be used to protect the covered portions of the substrate against a change in property , or against addition of layers on top of that covered area . for example , the ink mask could be applied to protect against a change in color , surface energy , or roughness of the covered portions , or to permit the deposition of a new layer of material ( e . g . paint , silicone , insulation , etc .) upon only the uncovered portions of the substrate . in particular , the solid ink mask can be used for making conductive circuits / pathways on a conductive film , and the subsequent removal of the solid ink mask . in this regard , a solid ink is solid at room temperature , and is generally applied to the substrate at elevated temperatures . such inks can be referred to as solid inks , hot melt inks , or phase change inks . solid inks are usually formed from a blend of polymeric resins with waxes and pigments / dyes . in the present disclosure though , pigments / dyes do not need to be present , as the color of the solid ink is not required for the processes of the present disclosure . solid ink can be used as a mask material for making conductive circuits / pathways . inkjet printing in particular allows for the application of a high resolution mask for high resolution circuitry . the solid ink may be applied over the surface of a substrate in a desired pattern to protect certain areas of the substrate from being exposed , while permitting the uncovered areas to be exposed . solid ink can also be used as a mask on a flexible conductive film . conductive films are lower cost alternatives to indium tin oxide ( ito ) films and can further enable invisible electronics ( e . g ., transparent circuits for new devices in printable electronics and projective capacitive sensors ) and flexible form factors ( e . g ., flexible designs with disruptive touch features in bendable , conformable devices ). solid ink masks may be patterned and used to protect printed electronics on flexible conductive films such as poly ( 3 , 4 - ethylenedioxythiophene polystyrene sulfonate ) ( pedot - pss ). pedot - pss is a conductive film that can be rendered non - conductive by treatment with a sodium hypochlorite solution ( i . e . etching ). the solid ink mask protects the pedot - pss film , enabling the digital design of printed electronics . the solid ink mask is digitally rendered and printed by inkjet printer onto the conductive film in the desired pattern . past and presently applied removal processes employ solvents to remove the solid ink , taking significant time to do so . in the present disclosure , one promising direction is to physically peel or flake the solid ink off , which takes less time , and then removing any residual flakes by either streams of water or air or mechanically with brushes or sticky surfaces . this approach simplifies and improves performance over previous methods , improving efficiency while reducing costs . fig1 illustrates an exemplary embodiment of a solid ink mask removal process . as illustrated here , the removal process is applied to a flexible conductive film having a surface upon which the solid ink mask is applied in the desired pattern . not shown here is the solid ink mask being applied to the conductive film , which can be , for example , pedot - pss . also not shown here is the sodium hypochlorite being applied to the pedot - pss conductive film to render the exposed parts of the film non - conductive ( i . e . the solid ink mask covers the conductive traces ). it is noted that the conductive film itself may be applied upon a flexible base substrate before the solid ink mask is applied . in other words , the substrate or film can be made up of multiple layers . the flexible conductive film 110 is seen here in a vertical orientation traveling downwards on the right - hand side of fig1 . the flexible conductive film is pulled against a bar 120 with a tight radius 125 . in other words , the bar has a curved edge with a radius of curvature of about 0 . 1 mm to about 100 mm , including from about 1 mm to about 10 mm , and in more particular embodiments the bar has a radius of about 3 mm . the solid ink mask 115 is present on the surface 112 of the film that does not contact the bar 120 . the bar is illustrated here as a primary roller with a cylindrical shape . as illustrated here , the roller also rotates to move the film along its path , if desired . it is noted that the bar does not have to have a cylindrical shape , just a curved edge . for example , a stationary bar having the cross - section of a square with rounded corners could be used as well . a small radius for the bar 120 is preferred , but a radius too small will result in film deformation . the radius to be used may depend upon the amount of ink originally laid down , process conditions , and the conductive film surface itself . the substrate / conductive film itself need not be made of any particular material or have any particular properties . the required bar curvature is related to the film thickness where the thicker the film is , the larger the radius of curvature can be , and the thinner the solid ink mask can be to be effective . the thickness 117 of the solid ink mask is important . thin masks peel poorly . thicker layers are preferred . in one embodiment , each individual layer may be about 15 microns to about 150 microns thick . in preferred embodiments , the mask has a thickness of six layers , each layer having a thickness of about 14 microns . in other embodiments , the mask has a thickness of at least 80 microns . the solid ink can be any suitable ink . if the solid ink mask is too thick , it may be ( unintentionally ) too robust and the flaking - off action described above will be compromised . as the film runs over the bar , the solid ink mask will flake off . in this vertical orientation , the mask flakes can fall away from the film . however , the conductive film 110 can pass the bar 120 in any orientation for peeling . as the film traverses the bar 120 , the solid ink mask can also be abraded with additional ink removal mechanisms . as depicted here , a spinning brush 130 located beneath the bar 120 can come into physical contact with the solid ink mask while the mask is being flaked , enhancing flake removal . the spinning brush 130 may be either dry or wet , as desired . alternatively , the solid ink mask / ink flakes can be abraded with air jets , or water or solvent fluid jets , other mechanical agitators , or combinations thereof . as another alternative , the flakes can be removed with the aid of a sticky roll or belt that the flakes adhere to and pulls them away from the film / substrate . a catch basin 135 is present beneath the bar 120 and the spinning brush 130 , to collect the ink flakes and any water / solvent . the solid ink flakes are then disposed of using streams of water or air . the water or air can be filtered to remove any flakes . after the solid ink flakes are removed , there may still be some residual ink or ink chemical components left on the film . that residual can be removed using a solvent , either by simply soaking the film therein or with the help of some mechanical wiping or agitation or ultrasonics , etc . for example , as illustrated here , secondary roller 140 includes a cloth that is impregnated with solvent to wipe the conductive film clean . any residue can be rapidly removed with solvent . suitable solvents include isobutyl acetate , isobutyl alcohol , isobutyl isobutyrate , methyl n - propyl ketone , toluene , xylene , mesitylene , ethylbenzene , diethylbenzene , trimethyl benzene , methyl ethyl benzene , tetrahydronaphthalene , chlorobenzene , dichlorobenzene , trichlorobenzene , chlorotoluene , methyl isobutyl ketone , methyl benzoate , benzyl benzoate , anisole , cyclohexanone , acetophenone , and the like , or mixtures thereof . plant - based “ bio solvents ” may also be used , which can be safer and more environmentally friendly than toluene , e . g ., bio - solv ™, which is an ethyl lactate blend ( distributed under license from phoenix resins , inc .). the present system permits faster removal of solid ink masks compared to removal via solvent washing alone . additionally , if the majority of the ink can be removed before a final solvent cleaning , the entire process will consume significantly less solvent . the arrow inside bar 120 indicates the process direction . it is noted that if the solid ink mask was applied using an inkjet printer , or the substrate has any corrugation ribbing , the substrate should be oriented so that the substrate is traveling and bending in the same direction of the printing / ribbing . especially with corrugated substrates , the solid ink mask will flake off more efficiently if the bending motion of the bar is in the direction of the ribbing lines rather than against it . in other words , the corrugated ribbing lines are parallel to the process direction . fig2 illustrates the process and the resulting changes to the conductive film . as seen in the left - most picture , there is a substrate 105 upon which a conductive film 110 is laid . a solid ink mask 115 is present in a desired pattern upon the conductive film , leaving exposed areas indicated by reference numeral 118 . as indicated in the middle picture , after exposure to sodium hypochlorite , the conductive film contains conductive areas 114 and non - conductive areas 116 . then , in the right - most picture , the solid ink mask has been removed by flaking to expose the conductive areas 114 . in most applications , there will be a support substrate upon which a functional coating is applied . the solid ink mask is used to cover selected portions of the functional coating . fig3 illustrates one variation of the general concept . multiple sequential stages of bending can be implemented as well . as illustrated here , the film 110 has a solid ink mask 115 . the film is pulled over bar 120 having a tight radius 125 . a spinning brush 130 also abrades the solid ink mask 115 . the film then travels over second bar 220 having a tight radius 225 , and is abraded by another spinning brush 150 . the film then passes by secondary roller 140 , which wipes any residual ink off of the film 110 . it is not required that the bar with the right radius be perpendicular to the process direction . thus , three or more passes could be implemented by bending of the film in three dimensions . the present disclosure has been described with reference to the preferred embodiments . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the exemplary embodiment be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .	7
to develop cultures of bone marrow stromal cells that can be used for transplantation , bone marrow was obtained from humans or dogs and grown in specially prepared tissue culture flasks . in addition , the medium was modified with acidic fibroblast growth factor ( afgf ) and heparin and was renewed according to a particular regimen . using this novel method , a large number of bone marrow stromal cells were established in culture and expanded to yield an unprecedented number of cells , which would be required for effective gene therapy with stromal cells . there now follows a description of the method for culturing bone marrow stromal cells as well as a description of the secretion of human growth hormone ( hgh ) by transfected canine bone marrow stromal cells in vitro . dogs were fully anesthetized and whole bone marrow was aspirated aseptically from the iliac crest . the aspirate syringes contained heparin to prevent clotting . the bone marrow was transferred from the syringe to a 50 ml conical tube containing 15 mls of a chilled tissue culture medium , such as rpmi or dmem , containing anti - fungal and antibiotic agents ( 50 μg / ml fungizone ™ ( amphotericin b ) ; 50 μg / ml gentamicin ; 100 units / ml penicillin ; 100 μg / ml streptomycin sulfate ). approximately 10 - 15 mls of bone marrow aspirate was added to each tube of medium and the mixture was kept on ice . nucleated cells were prepared from the bone marrow samples by standard ficoll cushion technique . briefly , 15 ml of ficoll - paque ™ ( pharmacia biotech ) was placed in a 50 ml conical tube and one half of each of the marrow - medium samples was carefully layered on top of the ficoll . the samples were centrifuged at 400 × g for 30 minutes at 18 ° c . with the brake off so that the centrifuge head decelerated slowly after the elapsed time . the top layer of the resultant preparation , which contained cell - free medium , was removed and discarded . the middle layer , which contained nucleated cells , was carefully collected and placed into a fresh 50 ml tube containing 20 ml of tissue culture medium , as described above . additional medium was added to bring the final volume to 50 ml . the nucleated cells include the bone marrow stromal cells . however , the stromal cells represent only a small fraction , i . e ., about one in one thousand , of the total number of nucleated bone marrow cells obtained in a bone marrow aspirate . the nucleated cells were collected in a pellet by centrifugation at 100 × g for 10 minutes . the cell pellet was washed with tissue culture medium ( rpmi or dmem with fungizone ™ ( amphotericin b ) ( 25 μg / ml ), gentamicin ( 25 μg / ml ), penicillin ( 100 units / ml ) and streptomycin sulfate ( 100 μg / ml )), and resuspended in 5 - 10 ml of &# 34 ; complete bone marrow stromal cell medium &# 34 ; (&# 34 ; complete medium &# 34 ;). after resuspension the cells were counted . generally , the complete bone marrow stromal medium contains the following ingredients in the following ranges of amounts or concentrations . dmem with 1 to 50 % fetal bovine serum ( fbs ) ( preferably greater than 12 . 5 %); 0 . 01 to 100 ng / ml of an afgf polypeptide , e . g ., recombinant afgf ; 0 . 05 to 100 units / ml of a heparin polypeptide , e . g ., sodium heparin ; 0 . 25 to 250 μg / ml of fungizone ™ ( amphotericin b ) ; 0 . 25 to 250 μg / ml of gentamicin ; 1 to 1000 units / ml penicillin ; and 1 to 1000 μg / ml of streptomycin sulfate . as used in the experiments described below , the complete medium contained dmem with 16 percent by volume heat - inactivated fbs , afgf ( 1 ng / ml ), heparin ( 5 units / ml ), fungizone ™ ( amphotericin b ) -( 25 μg / ml ), gentamicin ( 25 μg / ml ), penicillin ( 100 units / ml ), and streptomycin sulfate ( 100 μg / ml ). tissue culture flasks ( t150 cm 2 ) are preferably coated initially with gelatin and fbs . specifically , a solution of gelatin ( sigma ; 1 % in water ) was added to each flask until the bottom of the flask was just covered . the excess was removed and the flasks were left undisturbed , bottom side down , at room temperature for at least 30 minutes . the flasks can be refrigerated at this point for later use . heat - inactivated fbs was then added to the gelatinized flasks . as before , the excess solution was removed and the flasks were left , bottom side down , at room temperature for at least 30 minutes . the flasks can be used at this point or refrigerated . the nucleated cells of the bone marrow , prepared as described above , were added to the prepared flasks at approximately 1 × 10 8 cells / t150 flask . the cells were incubated in 15 mls of complete bone marrow medium , at 33 ° c ., in the presence of 5 % co 2 . after 3 - 4 days , or when the stromal cells have adhered to the inner surface of the tissue culture vessel , 15 ml of fresh complete medium was added to the cultures , dropwise , so the cells were not disturbed . one week later , before vital components within the medium are depleted , the so - called &# 34 ; conditioned medium ,&# 34 ; i . e ., the medium in the flask which contains non - adherent cells , was removed , and 15 ml of fresh complete medium was added to the flask . the non - adherent cells were pelleted by centrifugation at 500 × g for 5 minutes , resuspended in 15 ml of conditioned medium and returned to the original flask . thus , the non - adherent cells were returned to the flask and the medium was changed in such a way that it contained one part fresh medium and one part conditioned medium . in general , the key to this regimen of cell culture is to : ( 1 ) coat the inner surface of the tissue culture vessel with a solution of gelatin , ( 2 ) keep returning the non - adherent cells to the culture when exchanging the medium , ( 3 ) add medium that contains sufficient nutrients to sustain growth without removing all of the substances secreted by the bone marrow cells , which enhance their growth , ( 4 ) supplement the tissue culture medium with afgf , and ( 5 ) supplement the tissue culture medium with heparin . this process , where the non - adherent cells are removed , pelleted , and returned to the culture with equal parts of fresh and conditioned medium , is repeated once a week , for 2 to 3 weeks , or until a monolayer of adherent cells has formed . once the monolayer of bone marrow stromal cells developed , the cells were passaged by splitting them 1 : 2 or 1 : 3 into fresh flasks . at this point , and from this point on , the flasks for additional passages were coated with gelatin , but not with fbs . it is also no longer necessary to feed the established stromal cells with conditioned medium or to return non - adherent cells to the culture . the cells can be passaged in this manner at least 8 times or more . this method can be used to select and expand canine or human ( or other vertebrate ) bone marrow stromal cells , to develop a total cell number of more than 10 8 , and even more than 3 × 10 9 in vitro , from bone aspirates of individual subjects . other techniques for obtaining bone marrow can also be used . the bone marrow stromal cells obtained from dogs by this method exhibit the characteristic appearance of fibroblast - like bone marrow stromal cells . given that the success of gene therapy depends on the cellular production of adequate levels of the transgene product , which can be quite low , the ability to expand stromal cells in culture to 10 8 to 10 9 or more represents a substantial improvement . although stromal cells from primary canine bone marrow aspirates could establish themselves in culture at p0 ( passage 0 ), whether or not afgf and heparin were present , only cells grown in the presence of these two factors continued to grow well after the first or second passage . in addition , the cells grown with afgf and heparin maintained the fibroblast - like stromal cell morphology longer than stromal cells grown without these factors . iliac crest bone marrow aspirates were prepared as described from a dog designated alg - 5 , and divided into two portions so that half of the cells could be grown with afgf and heparin , and the other half could be grown without . tissue culture flasks were seeded with 2 . 75 × 10 7 primary bone marrow cells and cultured by the methods described above , where stromal cell - conditioned medium and non - adherent cells were returned to the flasks at the first passage . when all flasks contained a confluent layer of stromal cells , the cells were trypsinized and t75 flasks ( passage 1 , p1 ) were seeded with 2 . 5 × 10 6 cells derived from each of the p0 flasks . these cells were harvested one week later , and 2 × 10 6 cells from each flask were passaged ( p2 ), still in either the presence or absence of afgf and heparin . similarly , p2 cells were harvested 8 days after seeding , and 1 × 10 6 cells were passaged into p3 flasks . the number of cells passaged was reduced at this point because the number of cells cultured in the absence of afgf and heparin was limiting ; only 1 × 10 6 cells were available for re - seeding . all flasks were re - seeded with this number of cells so that each flask continued to hold a comparably sized population . passage 3 ( p3 ) cells were harvested 8 days after seeding and 1 × 10 6 cells were seeded into p4 flasks . the cells continued to be passaged and were counted carefully each time they were harvested and re - seeded . after the fourth passage , the cells that were cultured in the presence of afgf and heparin reached confluence much more quickly ( 7 days ) than the cells that were grown without these factors ( 14 days ). by comparing the number of cells obtained when the cells were harvested at the end of each passage with the number of cells seeded into the flasks at the beginning of each passage , a percentage change in cell number was determined . a positive number indicates an increase in cell number , a negative number indicates a decrease in cell number , and a zero value indicates no change in cell number . adherent stromal cells were established in all flasks of primary cultures ( p0 ). a higher cell count was found at the end of p0 in flasks lacking afgf and heparin ( fig1 ). although both groups of cells expanded during p1 , the growth of cells cultured in the presence of afgf and heparin was 2 . 5 - fold greater than cells grown in the absence of afgf and heparin . perhaps more importantly , cells cultured with afgf and heparin continued to grow in number during passages 2 , 3 , 4 , and 5 while cells cultured without afgf and heparin grew very poorly or not at all during these passages . the negative numbers in fig1 for all flasks during p0 reflect the fact that bone marrow stromal cells are only a small fraction of the total population of nucleated cells in the primary bone marrow aspirate , and further demonstrate that afgf and heparin have significant positive effects on the growth of canine bone marrow stromal cells in vitro . the total growth of bone marrow stromal cells obtained from dog alg - 5 was also calculated in the presence and absence of afgf and heparin . this figure ( total growth ) was determined by multiplying the total number of stromal cells in each flask (+/- afgf and heparin ) at the end of the period of establishment by the average percentage change in cell number for the first passage . total growth was similarly calculated for each subsequent passage ( fig2 ). as shown in the graph in fig2 the culture without afgf and heparin showed essentially no growth . on the other hand , the culture supplemented with afgf and heparin showed a significant calculated growth to over 60 × 10 7 cells by p6 . cells derived from dog alg - 5 were also inspected visually at the end of each passage , just before they were trypsinized and harvested . the cells grown with afgf and heparin maintained a fibroblast - like morphology over a number of passages while the cells cultured without afgf and heparin changed to a flattened morphology after the first or second passage . taken together , these results demonstrate that afgf and heparin clearly enhance the growth of canine bone marrow stromal cells and maintain the characteristic fibroblast - like morphology of these cells in culture . human bone marrow was removed from femoral heads that were discarded during hip replacement surgeries . other techniques for obtaining bone marrow can also be used . the bone marrow was put into tubes containing tissue culture medium , such as rpmi or dmem containing 50 μg / ml fungizone ™ ( amphotericin b ) and 50 μg / ml gentamicin . the bone and tissue suspended in the medium were finely minced using sterile scissors , centrifuged at 500 × g for 10 minutes and resuspended in tissue culture medium containing 16 % heat - inactivated fbs by gently inverting the tube . larger bone and tissue fragments were then allowed to settle to the bottom of the tube over the course of about 1 minute . the supernatant containing suspended cells was carefully removed and centrifuged at 500 × g for 10 minutes . the cell pellet was washed once by centrifugation in complete bone marrow stromal cell medium , resuspended in fresh complete medium , and the cells were counted . these primary bone marrow cells were initially cultured in flasks that were pretreated with gelatin and fbs , as described above for dog bone marrow stromal cell cultures , at 1 × 10 8 cells / t150 flask . human bone marrow stromal cells were selected and expanded in vitro using the same techniques and complete medium that are described above . in addition , small fragments of the human femoral bones were introduced into prepared tissue culture flasks that contained complete medium . bone marrow stromal cells grew out of these fragments , adhered to the flasks , and were treated subsequently in the same way as other bone marrow stromal cells . human bone marrow stromal cells were selected and expanded from primary marrows derived from several individuals and cells were expanded to at least 2 × 10 8 cells . to determine whether bone marrow stomal cells that were grown according to the methods described above could be transfected , the plasmid expression vector petkhgh was prepared and transfected into canine stromal cells using standard techniques . the dog model is an accepted animal model of the human bone marrow system , and results in dog studies are reasonably predictive of efficacy in human patients . the vector was constructed from plasmid ptkgh ( selden et al ., 1986 , mol . cell biol ., 6 : 3173 - 3179 ), which is comprised of the human growth hormone ( hgh ) gene , including introns , under the transcriptional regulation of hsv thymidine kinase ( tk ) promoter sequences ( nichols institute diagnostics , san juan capistrano , calif .). in addition , a 179 base pair foki - pvuii restriction enzyme fragment from the sv40 enhancer was tailed with hindiii sites by pcr using a derivative of the psv ( e )- mlp plasmid ( hurwitz et al ., 1987 , nuc . acids res . 15 : 7137 - 7153 ) as a template , and cloned into the hindiii site of ptkgh just upstream of the tk promoter . the petkhgh plasmid lacks a eukaryotic origin of replication and does not integrate into the host cell genome . as such , the vector expresses hgh transiently . canine bone marrow stromal cells were transfected with petkhgh by either the capo 4 - dna coprecipitation method , using the mbs mammalian transfection kit ( stratagene cloning systems , la jolla , calif . ), or the cationic lipid - dna complex method using lipofectamine ® reagent and opti - mem ® i reduced - serum medium ( life technologies ) according to the manufacture &# 39 ; s instruction . the capo 4 method was used to transfect cells obtained from dog alg - 3 and the lipofection method was used to transfect cells obtained from dog alg - 9 . dna was transfected by the capo 4 method into 3 . 2 × 10 6 cells one day after they were seeded into a t150 flask at p2 . the cells were transfected with 150 μg of petkhgh plasmid for 24 hours . these cells were growing actively and displayed a fibroblast - like morphology . dna was transfected by lipofection into 1 . 2 × 10 6 cells one day after they were seeded into a t150 flask at p6 . the growth rate of these cells was reduced from that seen in earlier passages and the cellular morphology had changed so that the cells appeared more flattened and spread out . these cells were transfected for six hours with 40 μg of petkhgh plasmid in a total volume of 4 . 28 ml of opti - mem ® containing 0 . 24 ml of lipofectamine ® reagent . levels of hgh secretion were determined by radioimmunoassay ( ria ) using hgh - tges kits ( nichols institute diagnostics ). the results are expressed as the mean of duplicate measurements . both early ( p2 ) and late ( p6 ) passage canine stromal cells expressed and secreted high levels of the hgh transgene product after transfection with the expression plasmid petkhgh ( fig3 ). the absolute levels of hgh expression varied , depending on the individual animal tested , the number of times the cells had been passaged , and the method of transfection . as shown in fig3 the absolute level of hgh expressed by the cells from dog alg - 3 varied from over 1 to about 2 . 5 μg / 24 hr / 10 6 cells . the absolute level of hgh expressed by the cells from dog alg - 9 varied from almost 3 to about 5 μg / 24 hr / 10 6 cells from p6 to p7 , and then dropped to about 0 . 5 , and then down to almost zero in p8 and p9 , respectively . in other embodiments of the invention , bone marrow stromal cells can be cryopreserved either before or after expansion in tissue culture . to cryopreserve primary aspirates of bone marrow , nucleated cells are prepared using the ficoll gradient technique described above , and suspended in 50 % medium , 50 % fbs at a density of , e . g ., 2 to 5 × 10 7 cells / ml . an amount , e . g ., 900 μl , of this suspension is aliquoted into vials , e . g ., 2 ml sterile cryogenic vials ( corning # 25704 ), with 100 μl of dmso . the vials are stored at - 80 ° c . for 24 hours , and then transferred to a - 150 ° c . freezer or to liquid nitrogen tanks for long - term storage . to cryopreserve stromal cells growing in culture , the media is aspirated from the tissue culture vessel , and the cells are rinsed once with dulbecco &# 39 ; s phosphate buffered saline ( gibco 14190 - 144 ). the cells are then detached from the surface of the flask or plate with a solution of trypsin - edta ( 0 . 05 % trypsin , 0 . 53 mm edta ; gibco 25300 - 062 ). the trypsinization is stopped by adding an equal volume of medium , and the cell suspension is centrifuged at 500 × g until the cells are pelleted . the pelleted cells are resuspended in medium , e . g ., 3 ml , and counted . the cell density is adjusted to 1 × 10 6 cells / ml with medium containing 10 % dimethyl sulfoxide ( dmso ; sigma d - 8779 ). the cells are aliquoted , e . g ., by 1 ml volumes , into sterile cryogenic vials ( corning # 25704 ), and immediately stored at - 80 ° c . overnight . after 24 hours , the vials are transferred to liquid nitrogen tanks or to a - 150 ° c freezer for long - term storage . procedures have also been developed to cryopreserve large numbers of cultured stromal cells . for example , after harvesting the cells as described above , 200 ml of cell suspension is placed in a 250 ml centrifuge tube and centrifuged at 500 × g in order to pellet the cells . the pelleted cells are resuspended in 10 - 20 ml of medium and counted . the suspension is then brought to a volume of 45 ml with medium and added to a transfer pack container ( baxter fenwal , 4r2001 ) with a sterile syringe fitted with an 18 gauge needle . five ml of dmso is then added , and the pack is stored at - 80 ° c . overnight . after 24 hours , the pack is transferred to liquid nitrogen tanks or to a - 150 ° c . freezer for long - term storage . all of these cryopreservation methods can be used for stromal cells from human patients as well as from primates , dogs , cows , and other animals . it is to be understood that while the invention has been described in conjunction with the detailed description thereof , that the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the scope of the following claims .	2
referring to fig1 , a processor based system as shown may include one or more processors 105 coupled to a bus 110 . alternatively the system may have a processor that is a multi - core processor , or in other instances , multiple multi - core processors . in some embodiments the processor may be hyperthreaded , or able to perform in a manner as if it were a multi - core processor despite having only a single core . in a simple example , the bus 110 may be coupled to system memory 115 , storage devices such as disk drives or other storage devices 120 , peripheral devices 145 . the storage 120 may store various software or data . the system may be connected to a variety of peripheral devices 145 via one or more bus systems . such peripheral devices may include displays and printing systems among many others as is known . in one embodiment , a processor system such as that depicted in the figure adds a transactional memory system 100 that allows for the execution of lock free transactions with shared data structures cached in the transactional memory system , as described in herlihy and moss . the processor ( s ) 105 may then include an instruction set architecture that supports such lock free or transactional memory based transactions . in such an architecture , the system in this embodiment supports a set of instructions , including an instruction to begin a transaction ; an instruction to terminate a transaction normally ; and an instruction to abort a transaction . the system of fig1 is only an example and the present invention is not limited to any particular architecture . variations on the specific components of the systems of other architectures may include the inclusion of transactional memory as a component of a processor or processors of the system in some instances ; in others , it may be a separate component on a bus connected to the processor . in other embodiments , the system may have additional instructions to manage lock free transactions . the actual form or format of the instructions in other embodiments may vary . additional memory or storage components may be present . a large number of other variations are possible . software transactional memory systems ( stm systems ) are known in the art . for clarity and concreteness in describing embodiments , a specific simple implementation of software transactional memory is provided below . this description is based extensively on language support for lightweight transactions , tim harris and keir fraser , in proceedings of oopsla 2003 ( harris style stm ). the harris style stm system provides runtime support in software for basic transactions such as those implemented by a well - known concurrency control protocol : conditional critical regions ( ccrs ). as is known in the art , ccrs have the general form which defines a ccr that waits if necessary until condition is true and then executes statements . to implement the basic functionality of a ccr , the harris style stm provides the following primitives : using these primitives , a stm may be used to implement an atomic statement written in source code language as in the following atomic increment example : the above would be replaced by the following underlying code following compilation : boolean done = false ; while (! done ) { stmstart ( ); try { temp = stmread (& amp ; x ); stmwrite (& amp ; y , temp + 1 ); done = stmcommit ( ); } catch ( throwable t ) { done = stmcommit ( ); if ( done ) { throw t ; } } } the code segment above implements an stm - defined critical section version of the atomic increment listed using pseudocode . the stmstart call creates a software - based transaction within which the process attempts to read the value of x and write the value of x + 1 into variable y atomically . when the transaction succeeds , a commit ( stmcommit ) is performed thereby closing the critical section . even if an error does occur , for example , if the try section fails because a data conflict is detected , the transaction is closed out and the atomic increment is retried : the entire process is enclosed in a while loop in the standard manner to repeatedly attempt the access until a successful commit is achieved , thereby setting the variable done to true . to implement the functionality provided by the primitives of the harris style stm , the implementation described in the above referenced paper uses three types of data structures , as indicated in fig2 . the first data structure is the application heap 240 in which the data itself is held . the application heap maps addresses such as address a 1 at 205 , to values stored in the heap such as the value 10 stored at 225 . the second kind of structure is the set of ownership records 250 which are used to co - ordinate transactions . an ownership function such as a hashing function 210 maps each address in the application heap to an associated ownership record indicating which transaction owns the variable associated with that address at the present time . for example , the variable at 225 is matched to an ownership record at 215 via the mapping 210 . there need not be a one - to - one correspondence between addresses and records . each ownership record in the structure 250 holds either a version number or a current owner for the addresses that associate with it , for example , the record 245 is associated with the variable at address a 4 and includes its version number which is 8 . each time a location in the application heap is updated , the version number must be incremented . version numbers are used to detect whether a transaction may be committed . the record at 230 is associated with the variable at address a 2 , which is part of an active transaction . the record references a transaction descriptor which includes accesses to the variable a 2 . the third kind of structure at 255 holds transaction descriptors which set out the current status of each active transaction and the accesses that it has made to the application heap . each access is described by a transaction entry specifying the address in question , the old and new values to be held there , and the old and new version numbers of those values . the status field indicates that the transaction is either active ( able to have stmabort , stmwait , stmcommit , stmread and stmwrite operations invoked for it ), committed , aborted or asleep . descriptors are initially active and move through the other states while attempting to commit , to abort or to wait . thus for example the transaction descriptor associated with the variable a 1 at 222 indicates that the status of that transaction which is identified by identifier tid 1 , is active based on the value of field 235 . the transaction descriptor also indicates at 220 that the transaction is attempting to change the value of the variable at a 1 from 10 to 45 and to change its version number from 7 to 8 . similarly the transaction descriptor associated with transaction variable a 2 at a 247 indicates that the variable is about to be updated from the value to 223 to the value 34 and its version number incremented from the value 3 to the value 4 . however this transaction descriptor indicates that the transaction tid 2 corresponding to descriptor 247 is not active as its status is asleep . at run time , the logical state of a variable at an address can be determined from a consistent snapshot of the locations on which its value depends : the address itself , its ownership record , and the status of an owning descriptor and information from entries in that descriptor . a process can directly compute the logical state by reading the relevant fields in the data structures described above . while further details of the implementation of the primitives of the harris style stm may be found in the paper referenced above , it should be clear from the preceding outline to one in the art that because all of the operations required to maintain and implement the various data structures occur in software , several operations and many memory references are required in order to implement an atomic transaction using an stm . this characteristic is also likely to be found in most other types of stms and most other implementations of stms . when using multi - threaded code that relies on an underlying stm to achieve atomicity , correctness , and critical sections , it is possible , for example , through inadvertent programmer error , that a variable that is being used atomically in one portion of the code is referenced outside a critical section in another portion of the code . this may cause problems if a thread with an unprotected reference to the shared variable executes concurrently with a thread where the shared variable is referenced in a critical section , due to unexpected data conflicts that may occur and may even remain undetected despite the programmer &# 39 ; s expectation that the variable will be atomically accessed . a simplistic solution to this problem is to have a compiler insert an stm based critical section around any access to a shared variable that is found in an unprotected section of the code . however as explained above , because of the overhead involved in doing so , this may prove prohibitively expensive in terms of performance . in one embodiment it is possible to prevent errors occurring due to variables accessed atomically using underlying stm functionality , and also accessed in an unprotected manner outside atomic regions , and by augmenting the runtime implementation of the software transactional system with functionality from a hardware - based transactional memory system . in this hybrid embodiment , errors caused by inadvertent access to protected shared variables outside critical sections of code would be detectable , in general , without incurring the same level of performance penalty that would be required in order to implement such protection in a purely stm based system . at a high level , fig3 shows the processing used in one embodiment to achieve such protection . in the embodiment , a compiler processes stm based code , and modifies each unprotected access to a shared variable . the compiler may use various static or dynamic algorithms to detect shared variables . the execution of the modified code following this processing , at runtime , is shown in the figure . first the system checks if the memory access is actually inside an stm defined critical section at 305 . if it is , a hardware transaction is not necessary , and execution continues at 310 by using conventional stm read and write barriers . if however the memory access is not inside an stm defined critical section or atomic region , the process starts a hardware transaction at 315 . within this hardware transaction , at 325 , the process checks the ownership record for the variable whose access is being protected . if the ownership record is free this means that no other transaction owns this particular memory address . therefore the hardware - based transaction may perform the requested memory operation at 340 , and then commit the transaction at 350 . if on the other hand the ownership record is not free it means that another transaction is accessing the same memory location , thereby producing a potential data race . the process then raises an exception at 345 . alternative embodiments are possible wherein the process may decide to wait for the ownership record to be free before restarting at block 305 . furthermore , at any point after the check at 325 , if another process creates a possible data conflict by accessing any of the memory locations within the hardware transaction such as the ownership record or the variable itself , then an interrupt event is generated in hardware at 335 . the abort handler for the transaction then takes over at 320 and aborts the transaction with the data race exception at 330 . alternative embodiments are possible , for example the abort handler may cause the memory operation to be retried by restarting execution at block 305 . thus all potential previously undetectable data races which may have occurred because of unprotected accesses to shared variables in a stm system are now protected in each case . furthermore because of the relative efficiency of the hardware - based transaction system , as compared to an stm in general , this protection is achieved with a relatively low performance overhead . table 1 lists pseudocode in an embodiment used to protect accesses to shared variables occurring outside stm defined critical sections . the pseudocode used to replace a load instruction ( i . e a read operation ) referencing such a shared variable is presented at lines 1 through 8 . this pseudocode corresponds to the processing flow earlier described with reference to fig3 , specifically , the path 315 , and either 325 , 340 , 350 or , 325 , 345 . after starting the hardware transaction at line 1 in table 1 the process first checks if the ownership record associated with the address for the shared variable is free at line 2 . if the ownership record is not free , then the check at line 2 will fail . the code then executes a commit to close out the hardware transaction at line 7 and raises a data race exception at line 8 . if however , the ownership record is free at line 2 , then the load may proceed and lines 3 and 4 complete the load , commit the transaction , and the process returns at line 5 with the value of the variable . the corresponding code for a store of a value ( corresponding to a write operation ) to a variable and lines 9 - 16 is identical to that used earlier in the case of the load except for lines 11 and 13 . at line 11 the store is accomplished by storing the provided value at the address of the variable ; and the return at line 13 is unaccompanied by a value , unlike the load , because no value is returned by the store operation . it should be noted that the above is a description of only one embodiment . in general many different types of software transactional memory systems are available and are known in the art . the protection of access to shared variables occurring outside software transactional memory sections described above only relies on there being some implementation of an ownership record associated with the variable . it should be noted that the other particulars of the harris style stm are only provided for concreteness and clarity of presentation . in other embodiments many variations of the processing flow depicted in fig3 and the corresponding code as depicted in table 1 may be present . for one example , the exact procedure calls used to control the hardware transaction system may vary . similarly access to the ownership record for a variable will depend on the exact syntax required for a specific stm . for clarity the details of an abort handler are not presented in the figure or the table but will be apparent to one in the art . furthermore , as should be clear to one in the art , the tables above are merely exemplary code fragments in one embodiment . in other embodiments , the implementation language may be another language , e . g . c or java ; the variable names used may vary , and the names of all the functions defined or called may vary . structure and logic of programs to accomplish the functions accomplished by the programs listed above may be arbitrarily varied , without changing the input and output relationship , as is known . in the preceding description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the described embodiments , however , one skilled in the art will appreciate that many other embodiments may be practiced without these specific details . some portions of the detailed description above are presented in terms of algorithms and symbolic representations of operations on data bits within a processor - based system . these algorithmic descriptions and representations are the means used by those skilled in the art to most effectively convey the substance of their work to others in the art . the operations are those requiring physical manipulations of physical quantities . these quantities may take the form of electrical , magnetic , optical or other physical signals capable of being stored , transferred , combined , compared , and otherwise manipulated . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that all of these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise as apparent from the description , terms such as “ executing ” or “ processing ” or “ computing ” or “ calculating ” or “ determining ” or the like , may refer to the action and processes of a processor - based system , or similar electronic computing device , that manipulates and transforms data represented as physical quantities within the processor - based system &# 39 ; s storage into other data similarly represented or other such information storage , transmission or display devices . in the description of the embodiments , reference may be made to accompanying drawings . in the drawings , like numerals describe substantially similar components throughout the several views . other embodiments may be utilized and structural , logical , and electrical changes may be made . moreover , it is to be understood that the various embodiments , although different , are not necessarily mutually exclusive . for example , a particular feature , structure , or characteristic described in one embodiment may be included within other embodiments . further , a design of an embodiment that is implemented in a processor may go through various stages , from creation to simulation to fabrication . data representing a design may represent the design in a number of manners . first , as is useful in simulations , the hardware may be represented using a hardware description language or another functional description language . additionally , a circuit level model with logic and / or transistor gates may be produced at some stages of the design process . furthermore , most designs , at some stage , reach a level of data representing the physical placement of various devices in the hardware model . in the case where conventional semiconductor fabrication techniques are used , data representing a hardware model may be the data specifying the presence or absence of various features on different mask layers for masks used to produce the integrated circuit . in any representation of the design , the data may be stored in any form of a machine - readable medium . an optical or electrical wave modulated or otherwise generated to transmit such information , a memory , or a magnetic or optical storage such as a disc may be the machine readable medium . any of these mediums may “ carry ” or “ indicate ” the design or software information . when an electrical carrier wave indicating or carrying the code or design is transmitted , to the extent that copying , buffering , or re - transmission of the electrical signal is performed , a new copy is made . thus , a communication provider or a network provider may make copies of an article ( a carrier wave ) that constitute or represent an embodiment . embodiments may be provided as a program product that may include a machine - readable medium having stored thereon data which when accessed by a machine may cause the machine to perform a process according to the claimed subject matter . the machine - readable medium may include , but is not limited to , floppy diskettes , optical disks , dvd - rom disks , dvd - ram disks , dvd - rw disks , dvd + rw disks , cd - r disks , cd - rw disks , cd - rom disks , and magneto - optical disks , roms , rams , eproms , eeproms , magnet or optical cards , flash memory , or other type of media machine - readable medium suitable for storing electronic instructions . moreover , embodiments may also be downloaded as a program product , wherein the program may be transferred from a remote data source to a requesting device by way of data signals embodied in a carrier wave or other propagation medium via a communication link ( e . g ., a modem or network connection ). many of the methods are described in their most basic form but steps can be added to or deleted from any of the methods and information can be added or subtracted from any of the described messages without departing from the basic scope of the claimed subject matter . it will be apparent to those skilled in the art that many further modifications and adaptations can be made . the particular embodiments are not provided to limit the claimed subject matter but to illustrate it . the scope of the claimed subject matter is not to be determined by the specific examples provided above but only by the claims below .	6
heretofore , bicycle pedals have been attached to the crank by means of a threaded connection . threaded connections are designed to tighten as the pedal is pressured in the forward direction of pedaling . this results in a pedal that is very securely fastened and one that is not removed without the use of a tool such as a wrench designed to fit narrow flats on opposite sides of the pedal axle and application of much force . the bicycle pedal of the instant invention is based on the design and connectivity of the mounting end of the pedal axle . the mounting end is shaped so that it plugs into a matching opening in the crank and is locked into place by a locking means . such plug and matching opening designs are not themselves unique , however , in this application , unique solutions to several problems are provided . as used herein , the mounting end ( 1 ) is the end of the pedal axle ( 5 ) that serves as the connector between the pedal and crank ( 3 ). as used herein , the crank is a portion of the crank set that gives extension to the pedal from the bottom bracket . the crank set is one piece as in children &# 39 ; s bicycles or multi - piece as in adult bicycles . the nature of the instant invention is better understood by reference to the drawings . as illustrated in fig1 , the mounting end ( 1 ) of the pedal axle ( 5 ) is designed to have polygonal ( 1 b ) and / or spline ( 1 a ) elements so as to resist rotation of the pedal axle as the pedal is pressured in either the forward or backward direction . such designs are common in tool and gear designs . their strength and resistance to rotation are well established . the splines and / or polygonal faces of the mounting end engage the corresponding surfaces of the opening to make a simple plug fitting . fig1 a , 1 b , 1 c and 1 d illustrate polygonal , spline , combined polygonal ( 1 b ) with spine ( 1 a ) elements , and combined round ( 1 c ) with polygonal elements respectively . it is contemplated that other more complicated plug and opening designs are possible , but the designs herein are well known to be strong and easy to manufacture . in one embodiment , the mounting end ( 1 ) of the pedal axle ( 5 ) has a polygonal shape that aligns with a corresponding polygonal opening ( 2 ) in the crank ( 3 ). for example , the polygonal shape has three , four , five , six , seven or eight flat surfaces or more , but too many flat surfaces results in rounding and decreased resistance to turning in the crank . in another embodiment , the mounting end ( 1 ) of the axle ( 5 ) has splines ( 1 a ) that align with corresponding slots ( 2 a ) in the opening ( 2 ) in the crank ( 3 ). the number and depth of the splines is limited by the space in the end of the crank . in another embodiment , the mounting end ( 1 ) comprises a combination of spline ( 1 a ) and polygonal ( 1 b ) elements . in yet another embodiment , the mounting end comprises spline ( 1 a ), and / or polygonal ( 1 b ) elements combined with round ( 1 c ) elements . however , round elements must be minimized to obtain maximum resistance to rotation in the crank . in another embodiment , the mounting end comprises a stopping means to control the depth and positioning of the mounting end in the matching opening so that reversible symmetry of the insertion is obtained and the engagement of a locking means is facilitated . a stopping means is used to control the depth of insertion of the mounting end into the matching opening . this facilitates the alignment of the locking means and the mounting end engagements . several ways of creating a stopping means are known in the art such as , but not limited to , an annular ring , a step up in axle diameter , a pin , a spring loaded bearing that engages a groove or indent , or simply that the shapes of the mounting end come to an abrupt stop where desired such that the mating point of the mounting end with the rest of the axle is the stopping means ( 6 ) ( fig2 ). simply plugging the mounting end of the pedal into the opening in the crank without securing the two together is not sufficient . the mounting end must be locked into the opening for several reasons . the pedal would simply fall out of the opening without being secured . the pedal could be easily removed by thieves and stolen . the other anti - theft advantages of the instant invention would not be realized . the typical socket wrench has a square opening with an indent within the opening that engages a spring loaded bearing of the corresponding square connector on the ratchet arm . when the bearing engages the indent the socket is held firmly but removably from the ratchet arm connector . this simple connection solution does not lock the socket onto the ratchet arm , and , indeed , locking the socket onto the ratchet arm is not normally desirable . such a solution in the case of a bicycle pedal , while it would provide an attachment , would make it too easy for a thief to remove the pedal and simply walk away with it . further , it is possible for the pedal to pop off the crank during strenuous use . additionally , the other anti - theft advantages of the instant invention would not be realized . the various advantages of the instant invention are obtained by the combination of three elements : plug and matching opening mounting , a simple locking means to secure the pedal to the crank , and the symmetry of the locking means and plug . this allows the pedal to be reversibly mounted and locked into the crank . the addition of a stopping means to control the depth of insertion of the mounting end into the crank further facilitates the ease of use . the locking engagement does not need to resist the force applied to the pedal during use ; the rotational resistance comes from the splines and / or polygonal faces of the mounting end . the locking means need merely resist the pedal being prized out of the opening in the crank so that the pedal remains attached to the crank unless the locking means is disengaged . many different locking means may be used . a simple means is to have one or more orthogonal grooves and / or one or more indents in the mounting end . a single groove ( 4 ) as shown in fig2 is engaged by a locking means ( 7 ) such as illustrated in fig3 b . when more than one groove and / or indent is used , they can be different depths much like a key for even more security against removal . the number and width of the grooves and / or indents is dictated by matters of strength of the mounting end and available material . the one or more grooves and / or indents must be symmetrically arranged along the axis of the mounting end ( 1 ) to maintain the reversibility of the pedal . because the locking means is in a small area on the crank and is limited to the width and thickness of the crank , a simple efficient locking means is needed . one non - limiting example is a circular cylinder . a circular locking means allows multiple pins to defeat picking and is quite well known in the art . a simple way to engage the one or more groove and / or one or more indents is for the lock to engage one or more deadbolt - like pins ( 8 ) into the one or more grooves ( 4 ) and / or one or more indents thereby engaging and locking the mounting end ( 1 ) of the pedal axle ( 5 ) to the crank ( 3 ) ( fig3 b ). in another embodiment , a locking means is installed on the outboard end of the crank , and pushed in to engage the mounting end . in another embodiment the locking means engages the mounting end of the pedal outside of the crank . for example , as shown in fig4 , the locking means ( 9 ) could fit over the outboard end of the crank and engage a retainer of one or more grooves and / or indents on the mounting end that are not inside the opening . when an outside locking means is combined with a threaded adaptor of fig6 , a threaded crank can be used with the pedal of the instant invention . many different configurations of lock and retainer can be used in this manner . several of the different elements described above can be combined in different ways to obtain different embodiments of the pedal . in practice , the pedal of the instant invention is used in the following manner . an unlocking agent , typically a key , is engaged with the locking means and used to change the lock into the unlocked state . the mounting end of the pedal is plugged into or removed from the matching opening on the outboard end of the crank and the unlocking agent is used to change the locking means to the locked state . because the mounting end is symmetrically arranged across the thickness of the crank , the pedal can be reversibly mounted on the crank . the pedal faces outward from the bicycle frame in normal usage . the pedal faces inward , reversed , towards the bicycle frame when stored , transported , or for anti - theft reasons . on many , if not most bicycles , it will be possible to engage the inward mounted , reversed , pedal base ( 10 ) with the spokes ( 11 ) of the rear wheel ( 12 ) ( fig5 ) thereby increasing the anti - theft security as the bicycle will not roll . when walking a bicycle along after a flat tire , it will not be desirable to stow the inward mounted pedal such that it is engaged with the spokes . the user can either mount the pedal so that the bicycle can still roll , or simply remove the pedal completely from the crank . the instant pedals can be used in combination with any pedal driven machine such as but not limited to stationary or moving bicycles , motorized bicycles , unicycles , tricycles , quadracycles , aircraft and watercraft . the pedals can be hand or foot powered . it is recognized that the bicycle pedal of the instant invention may require replacement of the crank with one that matches the instantly designed pedal mounting end . alternatively , a threaded adaptor could be used to connect the pedal of this invention to an existing crank when combined with an outside mounted locking means . it is also recognized that there will be advantages for pedal and crank set designers to agree upon a particular mounting end design to maximize interchangeability of pedals and cranks . more than one locking means or crank design will accommodate a single pedal mounting end design . it also may be desirable for high end designers to maintain control of pedal to crank connections so as to provide their own specific combination of mounting end to crank opening pattern for brand identity . while only selected embodiments have been chosen to illustrate the present invention , it will be apparent to those skilled in the art from this disclosure that various changes and modifications can be made herein without departing from the scope or spirit of the invention as defined in the appended claims . furthermore , the foregoing description of the embodiments according to the present invention is provided for illustration only , and not for the purpose of limiting the invention as defined by the appended claims and their equivalents .	1
before describing the present invention in detail , it is to be understood that this invention is not limited to particularly exemplified systems or process parameters that may , of course , vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only , and is not intended to limit the scope of the invention in any manner . all publications , patents and patent applications cited herein , whether supra or infra , are hereby incorporated by reference in their entirety to the same extent as if each individual publication , patent or patent application was specifically and individually indicated to be incorporated by reference . it must be noted that , as used in this specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural referents unless the content clearly dictates otherwise . thus , for example , reference to a “ surfactant ” includes two or more such surfactants . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains . although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention , the preferred materials and methods are described herein . in the application , effective amounts are generally those amounts listed as the ranges or levels of ingredients in the descriptions , which follow hereto . unless otherwise stated , amounts listed in percentage (“%&# 39 ; s ”) are in weight percent ( based on 100 % active ) of the cleaning composition alone , not accounting for the substrate weight . each of the noted cleaner composition components and substrates is discussed in detail below . the term “ cleaning composition ”, as used herein , is meant to mean and include a cleaning formulation having at least one surfactant . the term “ surfactant ”, as used herein , is meant to mean and include a substance or compound that reduces surface tension when dissolved in water or water solutions , or that reduces interfacial tension between two liquids , or between a liquid and a solid . the term “ surfactant ” thus includes anionic , nonionic and / or amphoteric agents . the cleaning compositions contain alkyl polyglucoside surfactant . the cleaning compositions preferably have an absence of other nonionic surfactants , expecially synthetic nonionic surfactants , such as ethoxylates . the cleaning compositions preferably have an absence of other surfactants , such as anionic , cationic , and amphoteric surfactants . suitable alkyl polyglucoside surfactants are the alkylpolysaccharides that are disclosed in u . s . pat . no . 5 , 776 , 872 to giret et al . ; u . s . pat . no . 5 , 883 , 059 to furman et al ; u . s . pat . no . 5 , 883 , 062 to addison et al . ; and u . s . pat . no . 5 , 906 , 973 to ouzounis et al ., which are all incorporated by reference . suitable alkyl polyglucosides for use herein are also disclosed in u . s . pat . no . 4 , 565 , 647 to llenado describing alkylpolyglucosides having a hydrophobic group containing from about 6 to about 30 carbon atoms , or from about 10 to about 16 carbon atoms and polysaccharide , e . g ., a polyglycoside , hydrophilic group containing from about 1 . 3 to about 10 , or from about 1 . 3 to about 3 , or from about 1 . 3 to about 2 . 7 saccharide units . optionally , there can be a polyalkyleneoxide chain joining the hydrophobic moiety and the polysaccharide moiety . a suitable alkyleneoxide is ethylene oxide . typical hydrophobic groups include alkyl groups , either saturated or unsaturated , branched or unbranched containing from about 8 to about 18 , or from about 10 to about 16 , carbon atoms . suitably , the alkyl group can contain up to about 3 hydroxy groups and / or the polyalkyleneoxide chain can contain up to about 10 , or less than about 5 , alkyleneoxide moieties . suitable alkyl polysaccharides are octyl , nonyldecyl , undecyldodecyl , tridecyl , tetradecyl , pentadecyl , hexadecyl , heptadecyl , and octadecyl , di -, tri -, tetra -, penta -, and hexaglucosides , galactosides , lactosides , glucoses , fructosides , fructoses and / or galactoses . suitable mixtures include coconut alkyl , di -, tri -, tetra -, and pentaglucosides and tallow alkyl tetra -, penta -, and hexaglucosides . suitable alkylpolyglycosides ( or alkylpolyglucosides ) have the formula : r 2 o ( c n h 2n o ) t ( glucosyl ) x wherein r 2 is selected from the group consisting of alkyl , alkylphenyl , hydroxyalkyl , hydroxyalkylphenyl , and mixtures thereof in which the alkyl groups contain from about 10 to about 18 , preferably from about 12 to about 14 , carbon atoms ; n is about 2 or about 3 , preferably about 2 ; t is from 0 to about 10 , preferably 0 ; and x is from about 1 . 3 to about 10 , preferably from about 1 . 3 to about 3 , most preferably from about 1 . 3 to about 2 . 7 . the glycosyl is preferably derived from glucose . to prepare these compounds , the alcohol or alkylpolyethoxy alcohol is formed first and then reacted with glucose , or a source of glucose , to form the glucoside ( attachment at the 1 - position ). the additional glycosyl units can then be attached between their 1 - position and the preceding glycosyl units 2 -, 3 -, 4 - and / or 6 - position , preferably predominantely the 2 - position . a group of alkyl glycoside surfactants suitable for use in the practice of this invention may be represented by formula i below : ro —( r 2 o ) y -( g ) x z b formula i wherein r is a monovalent organic radical containing from about 6 to about 30 ( preferably from about 8 to about 18 ) carbon atoms ; r 2 is a divalent hydrocarbon radical containing from about 2 to about 4 carbon atoms ; 0 is an oxygen atom ; y is a number which has an average value from about 0 to about 1 and is preferably 0 ; g is a moiety derived from a reducing saccharide containing 5 or 6 carbon atoms ; and x is a number having an average value from about 1 to 5 ( preferably from 1 . 1 to 2 ); z is o 2 m 1 , o 2 cr 3 , o ( ch 2 ), co 2 m 1 , oso 3 m 1 , or o ( ch 2 ) so 3 m 1 ; r 3 is ch 2 ) co 2 m 1 or ch ═ chco 2 m 1 ; ( with the proviso that z can be o 2 m 1 only if z is in place of a primary hydroxyl group in which the primary hydroxyl - bearing carbon atom , — ch 2 oh , is oxidized to form a — co 2 m 1 group ); b is a number from 0 to 3x + 1 preferably an average of from 0 . 5 to 2 per glycosal group ; p is 1 to 10 , m 1 is h + or an organic or inorganic cation , such as , for example , an alkali metal , ammonium , monoethanolamine , or calcium . as defined in formula i , r is generally the residue of a fatty alcohol having from about 8 to 30 or 8 to 18 carbon atoms . suitable alkylglycosides include , for example , apg 325 ® ( g ( a c 9 - c 11 alkyl polyglycoside available from cognis corporation ), apg 625 ® ( a c 10 - c 16 alkyl polyglycoside available from cognis corporation ), dow triton ® cg110 ( a c 8 - c 10 alkyl polyglycoside available from dow chemical company ), ag6202 ® ( a c 8 alkyl polyglycoside available from akzo nobel ) and alkadet 15 ® ( a c 8 - c 10 alkyl polyglycoside available from huntsman corporation ). a c6 to c10 alkylpolyglucoside includes alkylpolyglucosides wherein the alkyl group is substantially c6 alkyl , substantially c8 alkyl , substantially c10 alkyl , or a mixture of substantially c6 , c8 and c 10 alkyl . a c8 to c 10 alkylpolyglucoside includes alkylpolyglucosides wherein the alkyl group is substantially c8 alkyl , substantially c10 alkyl , or a mixture of substantially c8 and c10 alkyl . suitably , the alkyl polyglycoside is present in the cleaning composition in an amount ranging from about 0 . 01 to about 5 weight percent , or 0 . 1 to 5 . 0 weight percent , or 0 . 5 to 5 weight percent , or 0 . 5 to 4 weight percent , or 0 . 5 to 3 weight percent , or 0 . 5 to 2 weight percent , or 0 . 1 to 0 . 5 weight percent , or 0 . 1 to 1 . 0 weight percent , or 0 . 1 to 2 . 0 weight percent , or 0 . 1 to 3 . 0 weight percent , or 0 . 1 to 4 . 0 weight percent . the cleaning compositions contain the organic solvent ethanol , either absolute , various dilutions with water or denatured alcohol , for example denatured with isopropanol . natural forms of ethanol can be derived from the fermentation of biomass or the hydrolysis of cellulose . synthetic ethanol can be derived from the catalytic hydration of ethylene . the compositions suitably do not contain additional solvents , especially synthetic solvents such as glycol ethers . suitably , the ethanol is present in the cleaning composition in an amount ranging from about 0 . 01 to about 5 weight percent , or 0 . 1 to 5 . 0 weight percent , or 0 . 1 to 4 . 0 weight percent , or 0 . 1 to 3 . 0 weight percent , or 0 . 1 to 2 . 0 weight percent , or 0 . 1 to 1 . 0 weight percent , or 0 . 5 to 5 . 0 weight percent , or 0 . 5 to 4 . 0 weight percent , or 0 . 5 to 3 . 0 weight percent , or 0 . 5 to 2 . 0 weight percent , or 0 . 5 to 1 . 0 weight percent . the cleaning compositions can optionally contain glycerol , or glycerin . the glycerol may be natural , for example from the saponification of fats in soap manufacture , or synthetic , for example by the oxidation and hydrolysis of allyl alcohol . the glycerol may be crude or highly purified . the glycerol can serve to compatibilize the alkyl polyglucoside , the ethanol and the lemon oil or d - limonene . proper compatibilization of these components in suitable ratios , such as demonstrated in the examples below , allow these limited components to perform as well as complex formulated conventional synthetic cleaning compositions . suitably , the glycerol is present in the cleaning composition in an amount ranging from about 0 . 01 to about 2 weight percent , or 0 . 05 to 2 . 0 weight percent , or 0 . 05 to 1 . 0 weight percent , or 0 . 05 to 0 . 5 weight percent , or 0 . 05 to 1 . 0 weight percent , or 0 . 10to 2 . 0 weight percent , or 0 . 10 to 1 . 0 weight percent , or 0 . 10 to 0 . 5 weight percent . the cleaning compositions can optionally contain natural essential oils or fragrances containing d - limonene or lemon oil or d - limonene . lemon oil or d - limonene helps the performance characteristics of the cleaning composition to allow suitable consumer performance with natural ingredients and a minimum of ingredients . lemon oil and d - limonene compositions which are useful in the invention include mixtures of terpene hydrocarbons obtained from the essence of oranges , e . g ., cold - pressed orange terpenes and orange terpene oil phase ex fruit juice , and the mixture of terpene hydrocarbons expressed from lemons and grapefruit . the essential oils may contain minor , non - essential amounts of hydrocarbon carriers . suitably , lemon oil , d - limonene , or essential oils containing d - limonene are present in the cleaning composition in an amount ranging from about 0 . 01 to about 0 . 50 weight percent , or 0 . 01 to 0 . 40 weight percent , or 0 . 01 to 0 . 30 weight percent , or 0 . 01 to 0 . 25 weight percent , or 0 . 01 to 0 . 20 weight percent , or 0 . 01 to 0 . 10 weight percent , or 0 . 05 to 0 . 40 weight percent , or 0 . 05 to 0 . 30 weight percent , or 0 . 05 to 0 . 25 weight percent , or 0 . 05 to 0 . 20 weight percent , or 0 . 05 to 0 . 10 weight percent . essential oils include , but are not limited to , those obtained from thyme , lemongrass , citrus , lemons , oranges , anise , clove , aniseed , pine , cinnamon , geranium , roses , mint , lavender , citronella , eucalyptus , peppermint , camphor , sandalwood , rosmarin , vervain , fleagrass , lemongrass , ratanhiae , cedar and mixtures thereof . preferred essential oils to be used herein are thyme oil , clove oil , cinnamon oil , geranium oil , eucalyptus oil , peppermint oil , mint oil or mixtures thereof . actives of essential oils to be used herein include , but are not limited to , thymol ( present for example in thyme ), eugenol ( present for example in cinnamon and clove ), menthol ( present for example in mint ), geraniol ( present for example in geranium and rose ), verbenone ( present for example in vervain ), eucalyptol and pinocarvone ( present in eucalyptus ), cedrol ( present for example in cedar ), anethol ( present for example in anise ), carvacrol , hinokitiol , berberine , ferulic acid , cinnamic acid , methyl salycilic acid , methyl salycilate , terpineol and mixtures thereof . preferred actives of essential oils to be used herein are thymol , eugenol , verbenone , eucalyptol , terpineol , cinnamic acid , methyl salycilic acid , and / or geraniol . other essential oils include anethole 20 / 21 natural , aniseed oil china star , aniseed oil globe brand , balsam ( peru ), basil oil ( india ), black pepper oil , black pepper oleoresin 40 / 20 , bois de rose ( brazil ) fob , borneol flakes ( china ), camphor oil , camphor powder synthetic technical , canaga oil ( java ), cardamom oil , cassia oil ( china ), cedarwood oil ( china ) bp , cinnamon bark oil , cinnamon leaf oil , citronella oil , clove bud oil , clove leaf , coriander ( russia ), coumarin ( china ), cyclamen aldehyde , diphenyl oxide , ethyl vanilin , eucalyptol , eucalyptus oil , eucalyptus citriodora , fennel oil , geranium oil , ginger oil , ginger oleoresin ( india ), white grapefruit oil , guaiacwood oil , gurjun balsam , heliotropin , isobomyl acetate , isolongifolene , juniper berry oil , l - methyl acetate , lavender oil , lemon oil , lemongrass oil , lime oil distilled , litsea cubeba oil , longifolene , menthol crystals , methyl cedryl ketone , methyl chavicol , methyl salicylate , musk ambrette , musk ketone , musk xylol , nutmeg oil , orange oil , patchouli oil , peppermint oil , phenyl ethyl alcohol , pimento berry oil , pimento leaf oil , rosalin , sandalwood oil , sandenol , sage oil , clary sage , sassafras oil , spearmint oil , spike lavender , tagetes , tea tree oil , vanilin , vetyver oil ( java ), and wintergreen . each of these botanical oils is commercially available . the cleaning compositions contain less than 0 . 2 % builder , or no builder . suitably , the builder is present in the cleaning composition in an amount ranging from about 0 . 01 to about 0 . 2 weight percent , or 0 . 01 to less than 0 . 2 weight percent , or 0 . 01 to 0 . 15 weight percent , or 0 . 01 to 0 . 10 weight percent , or 0 . 01 to 0 . 05 weight percent . the builder can be selected from inorganic builders , such as alkali metal carbonate , alkali metal bicarbonate , alkali metal hydroxide , alkali metal silicate and combinations thereof . these builders are often obtained from natural sources . the cleaning composition can include a builder , which increases the effectiveness of the surfactant . the builder can also function as a softener , a sequestering agent , a buffering agent , or a ph adjusting agent in the cleaning composition . a variety of builders or buffers can be used and they include , but are not limited to , phosphate - silicate compounds , zeolites , alkali metal , ammonium and substituted ammonium polyacetates , trialkali salts of nitrilotriacetic acid , carboxylates , polycarboxylates , carbonates , bicarbonates , polyphosphates , aminopolycarboxylates , polyhydroxy - sulfonates , and starch derivatives . builders , when used , include , but are not limited to , organic acids , mineral acids , alkali metal and alkaline earth salts of silicate , metasilicate , polysilicate , borate , hydroxide , carbonate , carbamate , phosphate , polyphosphate , pyrophosphates , triphosphates , tetraphosphates , ammonia , hydroxide , monoethanolamine , monopropanolamine , diethanolamine , dipropanolamine , triethanolamine , and 2 - amino - 2methylpropanol . preferred buffering agents for compositions of this invention are nitrogen - containing materials . some examples are amino acids such as lysine or lower alcohol amines like mono -, di -, and tri - ethanolamine . other preferred nitrogen - containing buffering agents are tri ( hydroxymethyl ) amino methane ( tris ), 2 - amino - 2 - ethyl - 1 , 3 - propanediol , 2 - amino - 2 - methyl - propanol , 2 - amino - 2 - methyl - 1 , 3 - propanol , disodium glutamate , n - methyl diethanolarnide , 2 - dimethylamino - 2 - methylpropanol ( dmamp ), 1 , 3 - bis ( methylamine )- cyclohexane , 1 , 3 - diamino - propanol n , n ′- tetra - methyl - 1 , 3 - diamino - 2 - propanol , n , n - bis ( 2 - hydroxyethyl ) glycine ( bicine ) and n - tris ( hydroxymethyl ) methyl glycine ( tricine ). other suitable buffers include ammonium carbamate , citric acid , and acetic acid . mixtures of any of the above are also acceptable . useful inorganic buffers / alkalinity sources include ammonia , the alkali metal carbonates and alkali metal phosphates , e . g ., sodium carbonate , sodium polyphosphate . for additional buffers see wo 95 / 07971 , which is incorporated herein by reference . other preferred ph adjusting agents include sodium or potassium hydroxide . the term silicate is meant to encompass silicate , metasilicate , polysilicate , aluminosilicate and similar compounds . the ph of the cleaning composition is measured directly without dilution . the cleaning compositions can have a ph or 7 or above , or 7 . 5 or above , or 8 or above , or 9 or above , or 10 or above , or from 7 . 5 to 11 , or from 8 to 11 , or from 9 to 11 . the cleaning compositions optionally contain dyes , colorants and preservatives , or contain one or more , or none of these components . these dyes , colorants and preservatives can be natural ( occurring in nature or slightly processed from natural materials ) or synthetic . natural preservatives include benzyl alcohol , potassium sorbate and bisabalol ; sodium benzoate and 2 - phenoxyethanol . preservatives , when used , include , but are not limited to , mildewstat or bacteriostat , methyl , ethyl and propyl parabens , short chain organic acids ( e . g . acetic , lactic and / or glycolic acids ), bisguanidine compounds ( e . g . dantagard and / or glydant ) and / or short chain alcohols ( e . g . ethanol and / or ipa ). the mildewstat or bacteriostat includes , but is not limited to , mildewstats ( including non - isothiazolone compounds ) including kathon gc , a 5 - chloro - 2 - methyl - 4 - isothiazolin - 3 - one , kathon icp , a 2 - methyl - 4 - isothiazolin - 3 - one , and a blend thereof , and kathon 886 , a 5 - chloro - 2 - methyl - 4 - isothiazolin - 3 - one , all available from rohm and haas company ; bronopol , a 2 - bromo - 2 - nitropropane 1 , 3 diol , from boots company ltd ., proxel crl , a propyl - p - hydroxybenzoate , from ici plc ; nipasol m , an o - phenyl - phenol , na + salt , from nipa laboratories ltd ., dowicide a , a 1 , 2 - benzoisothiazolin - 3 - one , from dow chemical co ., and irgasan dp 200 , a 2 , 4 , 4 ′- trichloro - 2 - hydroxydiphenylether , from ciba - geigy a . g . dyes and colorants include synthetic dyes such as liquitint ® yellow or blue or natural plant dyes or pigments , such as a natural yellow , orange , red , and / or brown pigment , such as carotenoids , including , for example , beta - carotene and lycopene . compositions according to the invention may comprise substances generally recognized as safe ( gras ), including essential oils , oleoresins ( solvent - free ) and natural extractives ( including distillates ), and synthetic flavoring materials and adjuvants . compositions may also comprise gras materials commonly found in cotton , cotton textiles , paper and paperboard stock dry food packaging materials ( referred herein as substrates ) that have been found to migrate to dry food and , by inference may migrate into the inventive compositions when these packaging materials are used as substrates for the inventive compositions . suitable gras materials are listed in the code of federal regulations ( cfr ) title 21 of the united states food and drug administration , department of health and human services , parts 180 . 20 , 180 . 40 and 180 . 50 , which are hereby incorporated by reference . these suitable gras materials include essential oils , oleoresins ( solvent - free ), and natural extractives ( including distillates ). the gras materials may be present in the compositions in amounts of up to about 10 % by weight , preferably in amounts of 0 . 01 and 5 % by weight . prefered gras materials include oils and oleoresins ( solvent - free ) and natural extractives ( including distillates ) derived from alfalfa , allspice , almond bitter ( free from prussic acid ), ambergris , ambrette seed , angelica , angostura ( cusparia bark ), anise , apricot kernel ( persic oil ), asafetida , balm ( lemon balm ), balsam ( of peru ), basil , bay leave , bay ( myrcia oil ), bergamot ( bergamot orange ), bois de rose ( aniba rosaeodora ducke ), cacao , camomile ( chamomile ) flowers , cananga , capsicum , caraway , cardamom seed ( cardamon ), carob bean , carrot , cascarilla bark , cassia bark , castoreum , celery seed , cheery ( wild bark ), chervil , cinnamon bark , civet ( zibeth , zibet , zibetum ), ceylon ( cinnamomum zeylanicum nees ), cinnamon ( bark and leaf ), citronella , citrus peels , clary ( clary sage ), clover , coca ( decocainized ), coffee , cognac oil ( white and green ), cola nut ( kola nut ), coriander , cumin ( cummin ), curacao orange peel , cusparia bark , dandelion , dog grass ( quackgrass , triticum ), elder flowers , estragole ( esdragol , esdragon , estragon , tarragon ), fennel ( sweet ), fenugreek , galanga ( galangal ), geranium , ginger , grapefruit , guava , hickory bark , horehound ( hoarhound ), hops , horsemint , hyssop , immortelle ( helichrysum augustifolium dc ), jasmine , juniper ( berries ), laurel berry and leaf , lavender , lemon , lemon grass , lemon peel , lime , linden flowers , locust bean , lupulin , mace , mandarin ( citrus reticulata blanco ), marjoram , mate , menthol ( including menthyl acetate ), molasses ( extract ), musk ( tonquin musk ), mustard , naringin , neroli ( bigarade ), nutmeg , onion , orange ( bitter , flowers , leaf , flowers , peel ), origanum , palmarosa , paprika , parsley , peach kernel ( persic oil , pepper ( black , white ), peanut ( stearine ), peppermint , peruvian balsam , petitgrain lemon , petitgrain mandarin ( or tangerine ), pimenta , pimenta leaf , pipsissewa leaves , pomegranate , prickly ash bark , quince seed , rose ( absolute , attar , buds , flowers , fruit , hip , leaf ), rose geranium , rosemary , safron , sage , st . john &# 39 ; s bread , savory , schinus molle ( schinus molle l ), sloe berriers , spearmint , spike lavender , tamarind , tangerine , tarragon , tea ( thea sinensis l . ), thyme , tuberose , turmeric , vanilla , violet ( flowers , leaves ), wild cherry bark , ylang - ylang and zedoary bark . suitable synthetic flavoring substances and adjuvants are listed in the code of federal regulations ( cfr ) title 21 of the united states food and drug administration , department of health and human services , part 180 . 60 , which is hereby incorporated by reference . these gras materials may be present in the compositions in amounts of up to about 1 % by weight , preferably in amounts of 0 . 01 and 0 . 5 % by weight . suitable synthetic flavoring substances and adjuvants that are generally recognized as safe for their intended use , include acetaldehyde ( ethanal ), acetoin ( acetyl methylcarbinol ), anethole ( parapropenyl anisole ), benzaldehyde ( benzoic aldehyde ), n - butyric acid ( butanoic acid ), d - or l - carvone ( carvol ), cinnamaldehyde ( cinnamic aldehyde ), citral ( 2 , 6 - dimethyloctadien - 2 , 6 - al - 8 , gera - nial , neral ), decanal ( n - decylaldehyde , capraldehyde , capric aldehyde , caprinaldehyde , aldehyde c - 10 ), ethyl acetate , ethyl butyrate , 3 - methyl - 3 - phenyl glycidic acid ethyl ester ( ethyl - methyl - phenyl - glycidate , so - called strawberry aldehyde , c - 16 aldehyde ), ethyl vanillin , geraniol ( 3 , 7 - dimethyl - 2 , 6 and 3 , 6 - octadien - 1 - ol ), geranyl acetate ( geraniol acetate ), limonene ( d -, l -, and dl -), linalool ( linalol , 3 , 7 - dimethyl - 1 , 6 - octadien - 3 - ol ), linalyl acetate ( bergamol ), methyl anthranilate ( methyl - 2 - aminobenzoate ), piperonal ( 3 , 4 - methylenedioxy - benzaldehyde , heliotropin ) and vanillin . suitable gras substances that may be present in the inventive compositions that have been identified as possibly migrating to food from cotton , cotton textiles , paper and paperboard materials used in dry food packaging materials are listed in the code of federal regulations ( cfr ) title 21 of the united states food and drug administration , department of health and human services , parts 180 . 70 and 180 . 90 , which are hereby incorporated by reference . the gras materials may be present in the compositions either by addition or incidentally owing to migration from the substrates to the compositions employed in the invention , or present owing to both mechanisms . if present , the gras materials may be present in the compositions in amounts of up to about 1 % by weight . suitable gras materials that are suitable for use in the invention , identified as originating from either cotton or cotton textile materials used as substrates in the invention , include beef tallow , carboxymethylcellulose , coconut oil ( refined ), cornstarch , gelatin , lard , lard oil , oleic acid , peanut oil , potato starch , sodium acetate , sodium chloride , sodium silicate , sodium tripolyphosphate , soybean oil ( hydrogenated ), talc , tallow ( hydrogenated ), tallow flakes , tapioca starch , tetrasodium pyrophosphate , wheat starch and zinc chloride . suitable gras materials that are suitable for use in the invention , identified as originating from either paper or paperboard stock materials used as substrates in the invention , include alum ( double sulfate of aluminum and ammonium potassium , or sodium ), aluminum hydroxide , aluminum oleate , aluminum palmitate , casein , cellulose acetate , cornstarch , diatomaceous earth filler , ethyl cellulose , ethyl vanillin , glycerin , oleic acid , potassium sorbate , silicon dioxides , sodium aluminate , sodium chloride , sodium hexametaphosphate , sodium hydrosulfite , sodium phospho - aluminate , sodium silicate , sodium sorbate , sodium tripolyphosphate , sorbitol , soy protein ( isolated ), starch ( acid modified , pregelatinized and unmodified ), talc , vanillin , zinc hydrosulfite and zinc sulfate . when the composition is an aqueous composition , water can be , along with the solvent , a predominant ingredient . the water should be present at a level of less than 99 . 9 %, more preferably less than about 99 %, and most preferably , less than about 98 %. deionized water is preferred . where the cleaning composition is concentrated , the water may be present in the composition at a concentration of less than about 85 wt . %. the cleaning composition may be part of a cleaning substrate . a wide variety of materials can be used as the cleaning substrate . the substrate should have sufficient wet strength , abrasivity , loft and porosity . examples of suitable substrates include , nonwoven substrates , wovens substrates , hydroentangled substrates , foams and sponges and similar materials which can be used alone or attached to a cleaning implement , such as a floor mop , handle , or a hand held cleaning tool , such as a toilet cleaning device . the terms “ nonwoven ” or “ nonwoven web ” means a web having a structure of individual fibers or threads which are interlaid , but not in an identifiable manner as in a knitted web . nonwoven webs have been formed from many processes , such as , for example , meltblowing processes , spunbonding processes , and bonded carded web processes . the present invention is directed to method for cleaning a hard surface with a natural composition . a “ natural composition ” is generally defined where at least 95 % ( more preferred , at least 97 %, even more preferred 98 % and most preferred at least 99 %) of the components of the composition come from natural sources . in one embodiment , the present invention involves contacting the hard surface with a natural composition wherein the composition consists essentially of : 0 . 5 - 5 % alkyl polyglucosde , 0 . 5 - 5 . 0 % ethanol , 0 . 05 - 0 . 4 % d - limonine or lemon oil , no less 0 . 2 % builder , water , and optionally dyes , presevatives or colorants . the method of use may work with any of the compositions disclosed in the present invention . the compositions are simple , natural , high performance cleaning formulations with a minimum of essential natural ingredients . competitive cleaners are either natural and inferior in performance or contain additional ingredients that make them non - natural , such as synthetic components . because preservatives , dyes and colorants are used in such small amounts , these may be synthetic and the entire composition may still be characterized as natural . preferably , the compositions contain only natural preservatives , dyes , and colorants , if any . table i illustrates all purpose cleaners of the invention . table ii illustrates glass cleaners of the invention . table iii illustrates additional cleaning compositions of the invention . table iv shows that the compositions of the invention give equivalent performance to commercial non - natural , or synthetic cleaning compositions , and superior performance to commercial natural cleaning compositions . table v illustrates additional cleaning compositions of the invention . without departing from the spirit and scope of this invention , one of ordinary skill can make various changes and modifications to the invention to adapt it to various usages and conditions . as such , these changes and modifications are properly , equitably , and intended to be , within the full range of equivalence of the following claims .	2
referring now to the drawings in detail , and initially to fig1 , an exemplary hydraulic circuit 10 generally comprises a pump 14 , a coupler system 16 , and an attachment 22 . in the illustrated embodiment , which is particularly suited for use in a mini - excavator , skid - steer loader , or similar type of machinery , there is a directional control valve 26 that directs pressurized fluid from the pump 14 , which draws fluid from a tank 28 , to either hydraulic line 30 a or 30 b depending on the desired direction of operation of the attachment 22 . hydraulic lines 30 a and 30 b are connected to the coupler system 16 which includes a manifold 18 . more particularly , the lines 30 a and 30 b are connected to manifold ports 34 a and 34 b , respectively . manifold ports 34 a and 34 b are connected internally via the manifold 18 to manifold coupler halves 38 a and 38 b , respectively . in the illustrated embodiment , coupler half 38 a is a male coupler half and coupler half 38 b is a female coupler half , this being in accordance with conventional practice . mating attachment coupler halves 42 a and 42 b connect hydraulic lines 46 a and 46 b of the attachment 22 to the manifold coupler halves 38 a and 38 b . a motor case drain port 50 in the manifold 18 is connected internally with a motor case drain line coupler half 54 . the motor case drain line coupler half 54 is coupled to a mating motor case drain line coupler half 55 and motor case drain line 56 . the motor case drain port 50 is connected to the tank 28 via line 58 . as will be described in further detail herein , the motor case drain port 50 also is connected internally with the coupler manifold ports 34 a and 34 b and coupler halves 38 a and 38 b for releasing pressure from the system 10 . in operation , the pump 14 provides pressurized fluid from the tank 28 to the directional control valve 26 . depending on the desired direction of operation , the directional control valve 26 directs the pressurized fluid to either hydraulic line 30 a or 30 b . by directing the fluid to one or the other of the hydraulic lines 30 a and 30 b the direction of operation of the attachment 22 can be reversed . thus , either hydraulic line 30 a or 30 b can supply fluid to the attachment 22 while the other hydraulic line not supplying fluid acts as a return line to return the fluid to the tank 28 . the motor case drain is provided for use with auxiliary equipment that require a low pressure return , such as for draining fluid from a motor case in the auxiliary equipment . however , as will become apparent from the following description , the motor case drain port 50 and line 58 serve a further function of providing a low pressure return path to the tank 28 for fluid bled from the high pressure flow lines by means of the herein described decompression valve assembly . consequently , the port 50 is herein also referred to as a release , bleed or vent port , and although undesired , the port 50 could be open to the atmosphere or otherwise , as long as a path is provided for bleed flow from the manifold 18 . as previously mentioned , a common practice is to use a variety of interchangeable attachments 22 with an auxiliary hydraulic system 10 of a skid - steer loader or similar type of machinery . thus , the manifold 18 of the auxiliary hydraulic system 10 , which functions as a coupling system , provides a convenient interface for changing attachments 22 by providing a single location for connecting and disconnecting the hydraulic lines of the attachment 22 to the auxiliary hydraulic system 10 . residual pressure , however , often remains in the system 10 after an attachment 22 is operated , and this can make it difficult to disconnect and / or connect the attachment 22 . further , thermal pressure buildup in the attachment 22 and / or auxiliary hydraulic system 10 can be an impediment to connecting an attachment 22 . as previously noted , pressure relieving couplers can be used to allow connection under pressure , or the pressure might be relieved to the environment . however , pressure - relieving couplers can be costly and may require operator training , and relieving the pressure to the environment is usually not a viable option . in accordance with the present invention and with reference to fig2 - 6 , the manifold 18 further includes decompression valve assembly 62 . in the illustrated embodiment , the decompression valve assembly 62 includes a push - button 64 ( or other manually manipulable device ) for manually opening the decompression valve assembly 62 to allow any internal hydraulic pressure in the high pressure circuits to be released to the motor case drain port 50 and line 58 for return to the tank 28 . the decompression valve assembly 62 allows standard couplers to be used without the aforementioned difficulties of connecting under pressure with such couplers . further , once the pressure in the system 10 is released , the decompression valve assembly 62 remains open thereby continually venting the system 10 and preventing pressure buildup . the decompression valve assembly 62 further includes a velocity fuse that automatically closes the decompression valve assembly 62 when flow through the decompression valve assembly 62 exceeds a predetermined level . referring to fig2 - 4 , the illustrated manifold 18 includes a manifold body 66 ( or block ) that , as shown , may be provided with mounting holes 70 for securing the manifold 18 to machinery , such as a skid - steer loader , mini - excavator , or other equipment . the manifold block 66 has attached thereto the two auxiliary circuit coupler halves 38 a and 38 b for coupling to mating coupler halves on the hydraulic lines of the attachment . as desired and conventional , the manifold coupler halves 38 a and 38 b can be male and female , although they could be both male or both female . the coupler halves 38 a and 38 b can be of any suitable type , such as quick - disconnect couplers . the male and female coupler halves 38 a and 38 b are connected internally via flow passages in the manifold body 66 to the auxiliary hydraulic system manifold flow ports 34 a and 34 b which can be connected to the hydraulic lines of an auxiliary hydraulic system . the motor case drain line coupler half 54 is connected internally via flow passages to the pressure bleed port 50 . although separate decompression valve assemblies 62 could be provided to release pressure separately from each of the high pressure flow lines , as seen in fig5 and 6 , pilot pressure ports 74 a and 74 b interconnect passages 78 a and 78 b with a common chamber 82 facilitating the use of a single decompression valve assembly 62 to release pressure from both high pressure passages 78 a and 78 b . to prevent cross - flow between the high pressure passages 78 a and 78 b , the common chamber 82 is sealed from the passages 78 a and 78 b by hard seat check valves 86 a and 86 b that block flow from the common chamber 82 back into the passages 78 a and 78 b . turning to fig7 , the interconnection of the manifold coupler halves 38 a and 38 b , passages 74 a and 74 b , and auxiliary circuit manifold ports 34 a and 34 b with the common chamber 82 will be described . it will be appreciated that this description is equally applicable to the interconnection of either set of such elements with the common chamber 82 . in fig7 , the male coupler half 38 a is shown connected to the manifold body 66 . the male coupler half 38 a can be provided with threads 98 on an outer circumference thereof and can be screwed into mating threads of the passage 78 a for attachment thereto . a sealing member 102 , such as an o - ring , can be provided to ensure a proper seal between the male coupler half 38 a and the manifold body 66 . pilot pressure port 74 a extends perpendicularly from the passage 78 a and connects the passage 78 a to check valve 86 a . the check valve 86 a includes a valve chamber 106 , a sealing member 110 , and valve seat 114 . the check valve chamber 106 connects the pilot pressure port 74 a to the common chamber 82 . as mentioned , the check valve 86 a blocks flow from the common chamber 82 back into the pilot pressure port 74 a to prevent excess pressure in the common chamber 82 from entering the passage 78 a . however , the check valve 86 a allows excess pressure in the passage 78 a to be released to the common chamber 82 and ultimately to the tank 28 via the motor case drain port 50 and line 58 . as shown in fig6 , the decompression valve assembly 62 is located in an upper portion of the common chamber 82 . as discussed further below , the decompression valve assembly 62 has a push button 64 that can be depressed to bleed off pressure from the chamber 82 through a bleed passage 94 . the bleed passage 94 is connected to a passage 96 that connects the motor case drain port 50 to the motor case drain line coupler half 54 . turning now to fig8 and 9 , the decompression valve assembly 62 includes a valve body 118 including a valve passage 120 , a check valve 122 , and an actuator , e . g ., a plunger 124 , to which the push - button 64 or other manually activated device is attached . in fig8 , the decompression valve assembly 62 is in an open state with the push - button 64 depressed and the check valve 122 open . in the illustrated embodiment , the decompression valve assembly 62 is configured as an insert that can be threaded into a valve port 130 in the manifold body 18 . o - rings 134 or other suitable sealing members may be provided to seal an outer circumference of the valve body 118 to the valve port 130 of the manifold as shown . the check valve 122 is preferably a hard seat check valve . the check valve 122 includes a valve sealing member , such as a ball valve 138 , and a valve seat 142 . the ball valve 138 is biased closed by a spring 146 or other suitable biasing means . the valve plunger 124 is supported for axial movement within the valve body 118 . the valve plunger is biased by a spring 154 or other biasing means from a valve closed position ( fig9 ) to a valve open position ( fig8 ). in its valve open position , the inner end of the plunger 124 extends through the valve seat 142 to unseat the ball valve 138 . the force exerted by the spring 154 on the plunger 124 is greater than the force exerted by the spring 146 on the ball valve 138 , whereby the check valve 122 is normally held open in the absence of fluid pressure . the inner end face of the valve plunger 124 is exposed to fluid pressure in the valve passage 120 . when fluid pressure in the valve passage 120 exceeds the biasing force acting on the plunger 124 , the plunger 124 will shift to its valve closed position , allowing the valve ball 138 to seal against the valve seat 142 , thereby blocking flow from the chamber 82 to the bleed passage 94 . the valve ball 138 will remain seated as long as the pressure exceeds the spring force . the pressure at which the check valve 122 closes can be varied as desired by changing either one or both of the springs 146 and 154 . if either of the high pressure supply / return lines is pressurized , the valve ball 138 will be forced close thereby to route full fluid flow to the attachment . to facilitate connection and disconnection of an attachment , the pressure in the supply / return lines can be bled off by depressing the push - button 64 , thereby moving the plunger 124 to its valve open position , thereby unseating the check valve 122 and allowing fluid to flow into the passage 120 which is connected to the bleed passage 94 . the bleed passage 94 preferably is provided with a flow restrictor , such as orifice 162 . the orifice 162 functions to meter or throttle flow through the bleed passage 94 thereby to avoid a rapid discharge of fluid from the high pressure flow passages 78 a and 78 b . the orifice 162 also provides a velocity fuse function . if the flow rate surges or otherwise exceeds a desired level , back pressure generated by the orifice flow acts on the plunger 124 and if sufficiently great will cause the plunger 124 to shift to its valve closed position , thereby allowing the ball valve 138 to close against the seat 142 and stop the flow of fluid from either high pressure passage 78 a and / or 78 b . the check valve 122 will remain closed by the trapped pressure in the chamber 82 until the plunger button 64 is again depressed . the size of the orifice 162 and the force applied to the valve plunger 124 by the valve plunger spring 154 can be adjusted as desired to set the flow rate at which the check valve 122 will automatically close . as should now be apparent , the manifold / coupling system 18 can be used to release pressure from the high pressure lines of the system 10 to facilitate connection and disconnection of an attachment . in general , connecting and disconnecting of attachments is done with the pump deactivated or otherwise off - line . to release pressure from the hydraulic system 10 , the push - button 64 of the decompression valve assembly 62 is depressed . the check valve 122 is thereby forced open allowing flow from the common chamber 82 to the bleed passage 94 . the directional nature of the check valves 86 a and 86 b in the pilot pressure ports 74 a and 74 b allow pressure in either of the high pressure lines to be vented to the common chamber 82 and further into the bleed line 58 . once the pressure in the common chamber 82 drops to a level less than the plunger spring bias load , the plunger spring 154 will maintain the check valve 122 in its open position without assistance from the operator , thereby freeing the operator &# 39 ; s hands to disconnect and / or connect the hydraulic lines . once the auxiliary circuit is depressurized , the existing attachment &# 39 ; s hydraulic lines can be easily disconnected and a new attachment &# 39 ; s hydraulic lines can be connected . as pressure is being vented , the orifice 162 will serve to meter the rate of flow of fluid from the high pressure lines . this can prevent undesirable rapid release of pressure that may cause damage to the attachment 22 and / or system 10 . for example , when the coupling system 16 is used with a top loader attachment and the top loader attachment is in a raised position , the bucket will drop at a controlled rate as pressure in the auxiliary circuit is bled away . in addition to providing metered bleed flow , the system 16 also has a velocity fuse feature . if the flow velocity exceeds a predetermined level which could allow the bucket to drop abruptly and cause damage to the attachment and / or surrounding objects , back pressure generated upstream of the orifice 162 will cause the plunger 124 to move to its valve closed position , thereby allowing the check valve 122 to close and shut off bleed flow . this will stop further descent of the bucket until the push - button 64 is again depressed . it will also be appreciated that the coupling system 18 can also automatically release pressure from the auxiliary circuit 10 . when the pressure in the chamber 120 drops below a predetermined level , the valve plunger spring 154 forces the valve plunger 124 to its open position thereby opening the check valve 122 . pressure from the high pressure supply / return passages and lines is thereby automatically released therefrom . the decompression valve assembly 62 will continue to vent the high pressure hydraulic lines to the bleed line , thereby preventing pressure buildup in the auxiliary circuit . consequently , any pressure increase arising from thermal or other expansion of the fluid in the auxiliary circuit will be dissipated . it will be appreciated that the automatic venting feature of the decompression valve assembly 62 can allow an operator to connect and disconnect lines of an attachment without manually operating the decompression valve assembly 62 . for example , in some applications it is possible to configure the decompression valve assembly 62 to automatically open at a pressure corresponding to a particular position of an attachment . in the case of a top loader attachment , the decompression valve 62 can be configured to automatically open at a pressure corresponding to the bucket of the attachment being in a fully lowered position . thus , an operator can lower the attachment to the fully lowered position whereat the decompression valve assembly 62 automatically releases pressure from the lines and the attachment can be disconnected from the auxiliary circuit . after disconnecting an attachment and reconnecting a new attachment , the pump 14 can be activated or otherwise brought online to once again supply high pressure fluid to the high pressure lines . when the auxiliary hydraulic system 10 is re - pressurized , the high pressure flow from the pump 14 surges past the check valves 86 a and 86 b in the pilot pressure ports 74 a and 74 b and into the common chamber 82 and decompression valve passage 120 . as the fluid flows from the decompression valve passage 120 to the bleed passage 94 , back pressure generated by the orifice 162 will cause the valve plunger 124 to shift away from the ball valve 138 and allow the ball valve to seal against the valve seat 142 . once the check valve 122 is closed , the bleed passage 94 is isolated from the high pressure supply / return passages , thereby preventing system energy losses . although the invention has been shown and described with respect to a certain preferred embodiment or embodiments , it is obvious that equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings . in particular regard to the various functions performed by the above described elements ( components , assemblies , devices , compositions , etc . ), the terms ( including a reference to a “ means ”) used to describe such elements are intended to correspond , unless otherwise indicated , to any element which performs the specified function of the described element ( i . e ., that is functionally equivalent ), even though not structurally equivalent to the disclosed structure which performs the function in the herein illustrated exemplary embodiment or embodiments of the invention . in addition , while a particular feature of the invention may have been described above with respect to only one or more of several illustrated embodiments , such feature may be combined with one or more other features of the other embodiments , as may be desired and advantageous for any given or particular application .	8
hereinafter , an embodiment of the invention is described with reference to fig1 to 4 . referring first to fig1 to 3 , the configuration of an electronic apparatus according to an embodiment is described . this electronic apparatus can be implemented as , e . g ., a portable notebook personal computer , a tablet terminal , and other various types of information processing apparatuses . fig1 is a perspective diagram taken from a front side of a notebook computer 10 in a state of opening a display unit thereof . this computer 10 is configured to receive electric - power from a battery 20 . this computer 10 includes a computer main - unit 11 and a display unit 12 . a display device such as a liquid crystal display unit ( lcd ) 31 is incorporated into the display unit 12 . moreover , a camera ( web camera ) 32 is arranged on a top end portion of the display unit 12 . the display unit 12 is mounted on the computer main - unit turnably between an open position in which the top surface of the computer main - unit 11 is exposed , and a closed position in which the top surface of the computer main - unit 11 is covered by the display unit 12 . the computer main - unit 11 has a thin box - shaped casing on the top surface of which a keyboard 13 , a touch pad 14 , a power - supply switch 16 for power - on / off of this computer 10 , several function buttons 17 , and speakers 18 a and 18 b are arranged . a power - supply connector 21 is also provided on the computer main - unit 11 . the power - supply connector 21 is provided on a side surface , e . g ., a left - side surface of the computer main - unit 11 . an external power - supply is detachably connected to the power - supply connector 21 . an alternating - current ( ac ) adapter can be used as an external power - supply . the ac adapter is a power supply that converts commercial electric - power ( ac electric - power ) to direct - current ( dc ) electric - power . the battery 20 is detachably attached to , e . g ., a rear - end portion of the computer main - unit 11 . the battery 20 may be a battery built - into this computer 10 . this computer 10 is driven by electric - power from an external power - supply or the battery 20 . if an external power - supply is connected to the power - supply connector 21 of this computer 10 , this computer 10 is driven by electric - power from the external power - supply . electric - power from the external power - supply is also used to charge the battery 20 . while the external - power supply is not connected to the power - supply connector 21 of this computer 10 , this computer 10 is driven by electric - power from the battery 20 . moreover , several universal serial bus ( usb ) ports 22 , high - definition multimedia interfaces ( hdmi ) output terminals 23 , and a red - green - and - blue ( rgb ) port 24 are provided in the computer main - unit 11 . fig2 illustrates the system configuration ( i . e ., the configuration of power - feeding targets ) of this computer 10 . this computer 10 includes a central processing unit ( cpu ) 111 , a system controller 112 , a main memory 113 , a graphic processing unit ( gpu ) 114 , a sound codec 115 , basic - input - output - system read - only memory ( bios - rom ) 116 , a hard disk drive ( hdd ) 117 , an optical disk drive ( odd ) 118 , a bluetooth ( bt ) module ( bluetooth is a registered trademark ) 120 , a wireless local area network ( lan ) module 121 , a secure digital ( sd ) card controller 122 , a peripheral component interconnect ( pci ) express card controller 123 , an embedded - controller / keyboard - controller integrated circuit ( ec / kbc ic ) 130 , a keyboard backlight 13 a , a power - supply controller ( psc ) 141 , a power - supply circuit 142 , and so on . the cpu 111 is a processor that controls each component of this computer 10 . the cpu 111 executes various software - programs loaded into the main memory 113 from the hdd 117 . the software - programs include an operating system ( os ) 201 , a setting application program 202 whose description is omitted , and various application programs 203 . the various applications 203 include the above desktop and full - screen applications . the cpu 111 executes a basic input / output system ( bios ) stored in bios - rom 116 which is a non - volatile memory . the bios is a system program for controlling hardware . the gpu 114 is a display controller that controls a liquid crystal display ( lcd ) 31 used as a display monitor of this computer 10 . the gpu 114 generates , from display data stored in a video memory ( video random access memory ( vram )) 114 a , a display signal ( low voltage differential signaling ( lvds ) signal ) to be supplied to the lcd 31 . moreover , the gpu 114 can also generate , from display data , analog rgb signals and hdmi video signals . analog rgb signals are supplied to an external display via the rgb ports 24 . the hdmi output terminal 23 can send an hdmi video signal ( i . e ., a digital uncompressed video signal ) and a digital audio signal with one cable . an hdmi control circuit 119 is an interface for sending an hdmi video signal and a digital audio signal via the hdmi output terminal 23 to an external display . the system controller 112 is a bridge device that connects the cpu 111 to each component . the system controller 112 incorporates a serial advanced technology attachment ( ata ) controller for controlling the hard disk drive ( hdd ) 117 and the optical disk drive ( odd ) 118 . moreover , the system controller 112 performs communication with each component on a low pin count ( lpc ) bus . the ec / kbc 130 is connected to the lpc bus . the ec / kbc 130 , and the power - supply controller ( psc ) 141 and the battery 20 are interconnected to one another via a serial bus such as an inter - integrated circuit ( i2c ) bus . the ec / kbc 130 is a power management controller for performing the power management of this computer 10 and implemented as a one - chip microcomputer having an embedded keyboard controller that controls , e . g ., the keyboard ( kb ) 13 and the touch pad 14 . the ec / kbc 130 has the function of performing the power - on / off of this computer 10 in response to operations of the power - supply switch 16 , which are performed by users . the control of the power - on / off of this computer 10 is performed by the cooperation of the ec / kbc 130 and the power - supply controller ( psc ) 141 . when receiving an on - signal transmitted from the ec / kbc 130 , the power - supply controller ( psc ) 141 controls the power - supply circuit 142 to perform the power - on of this computer 10 . when receiving an off - signal transmitted from the ec / kbc 130 , the power - supply controller ( psc ) 141 controls the power - supply circuit 142 to perform the power - off of this computer 10 . the ec / kbc 130 , the power - supply controller ( psc ) 141 and the power - supply circuit 142 work by electric - power supplied from the battery 20 or an ac adapter 150 , even during the power - off of this computer 10 . moreover , the ec / kbc 130 can turn on / off the keyboard backlight 13 a arranged on the rear surface of the keyboard 13 . furthermore , the ec / kbc 130 is connected to a panel opening / closing switch 131 configured to detect the opening / closing of the display unit 12 . even when the opening of the display unit 12 is detected by the panel opening / closing switch 131 , the ec / kbc 130 can perform the power - on of this computer 10 . the power - supply circuit 142 generates electric - power ( operating - power ) to be supplied to each component , using electric - power supplied from the battery 20 or from the ac adapter 150 connected as an external power - supply to the computer main - unit 11 . the power - supply circuit 142 also receives electric - power from a noncontact power - feeding module 33 by , e . g ., an electromagnetic induction method , and obtains dc - voltage , using a circuit ( not shown ). this circuit includes , e . g ., a pickup coil wound on a pickup core arranged close to a power - feeding line , in which a high - frequency electric - current flows when a constant electric - current is supplied to the power - feeding line connected to the noncontact power - feeding module 33 that is a high - frequency power - supply configured to output a constant alternating electric - current . the circuit also includes a resonance capacitor parallel - connected to this pickup coil , a rectifying portion using a diode bridge parallel connected to this resonance capacitor , and a constant - voltage circuit configured to control electric - current output by this rectifying portion to a predetermined voltage . fig3 is a functional block configuration diagram for illustrating a primary part of the embodiment of the feeding apparatus , which focuses on the power - supply circuit 142 . reference numeral sm denotes the above dc - voltage . a higher one of this dc - voltage sm and a voltage output from the ac adapter 150 through the power - supply connector 21 is selected by diodes d 1 and d 2 , and relates to power - feeding . the ec / kbc 130 receives the dc - voltage sm as a detection signal that indicates the detection of the noncontact power - feeding module 33 . thus , the ec / kbc 130 turns on a dc - in light - emitting diode ( led ) ld , and sends out an operating - condition notification signal of the noncontact power - feeding module 33 to an electric - current variation detecting block 142 a ( through the power - supply controller ( psc ) 141 ). the electric - current variation detecting block 142 a is a block that detects the variation of electric - current flowing in a resistor ri . the voltage drop of the resistor ri is amplified , e . g ., several tens of times by an amplifier o 1 . the ac - component of the amplified voltage - drop is obtained by a capacitor c 0 and compared with a reference voltage rf 1 by a comparator o 2 . if the ac - component is relatively large , the electric - current variation detecting block 142 a sends a boost - on signal of several milli - seconds ( ms ) to a dc / dc converter 142 b . the dc / dc converter integrated circuit ( ic ) 142 b includes an input - current limitation control portion 142 b 1 , a pulse - width modulation ( pwm ) generation portion 142 b 2 , a driver logic portion 142 b 2 , a high - side field - effect transistor ( fet ) driver block 142 b 4 , and a low - side fet driver block 142 b 5 . the input - current limitation control portion 142 b 1 amplifies the voltage drop of the resistor ri to , e . g ., several tens of times by an amplifier o 3 , and compares the amplified voltage - drop with a reference voltage rf 2 by a comparator o 4 . if the voltage drop is relatively large , a diode d 0 is conducted . thus , a control loop , whose input electric - current has a constant value , is effective . the pwm generation portion 142 b 2 compares an output of a saw - tooth wave ( triangular wave ) transmitter 142 b 2 a with an input from the input - current limitation control portion 142 b 1 by a comparator o 4 . thus the pwm generation portion 142 b 2 obtains a pwm signal and sends the pwm signal to the driver logic portion 142 b 3 . the drier logic portion 142 b 3 is configured to control the high - side fet driver block 142 b 4 and the low - side fet driver block 142 b 5 in response to this pwm signal . n - channel metal - oxide semiconductor ( mos ) fets q 1 and q 2 are conducted or non - conducted by controlling the high - side fet driver block 142 b 4 and the low - side fet driver block 124 b 5 . thus , each component is usually supplied with electric - power through a route indicated with dashed lines rt 1 . however , during the duration of the above boost - on signal , each component is supplied with electric - power through a route indicated with dashed lines rt 2 in addition to the route indicated with dashed lines rt 1 . incidentally , capacitors c 1 and c 2 are used for smoothing . a diode d 3 is used for backflow prevention . a resistor r and an inductor l aim at electric - current stabilization . fig4 is a flowchart illustrating an example of a processing method according to the embodiment . in step s 41 , the electric - current variation detecting block 142 a monitors an output electric - current of the noncontact power - feeding module 33 while electric - power is supplied by noncontact power - feeding . if the electric - current variation exceeds a threshold ( i . e ., if the supply capability of the noncontact power - feeding module 33 is exceeded ), a boost - on signal is asserted ( enabled ) against a charger ( i . e ., the dc / dc converter ic 142 b ). in step s 42 , when the boost - on signal is asserted , the charger performs a boost operation using the battery 20 as a power supply . that is , the charger performs an operation of making an input electric - current constant , using a feedback loop . in step s 43 , then , if the variation of an output electric - current from the noncontact power - feeding module 33 becomes less than a threshold , the electric - current variation detecting block 142 a de - asserts ( disabled ) against the charger . in step s 44 , the charger finishes a boost operation when the boost - on signal is de - asserted . then , electric - power is supplied to the system only from the noncontact power - feeding module 33 . ( regarding dc - in led control in case of supplying electric - power to system by non - contact power - feeding ) generally , the ec monitors the voltage of a power - supply line directly or indirectly through an ic , such as the charger , which incorporates a comparator . then , according to the status of the monitored voltage , the dc - in led is turned on or off . thus , if a power - supply voltage largely varies due to a system load variation , as in the case of performing noncontact power - feeding , the dc - in led accordingly repeats turning - on and turning - off . this brings a feeling of anxiety to a user . then , “ providing a blank time ( e . g ., 100 ms ) between the reduction of the power - supply voltage and the turning - off of the dc - in led ( ld ) in the case of supplying electric - power only by contact power - feeding ” is added to the controlling of the dc - in led ( ld ) of the ec / kbc 130 according to the embodiment . consequently , the above problem of anxiety feeling is resolved . as described above , even when the system power is within a rated electric - power , if the electric - current variation of the noncontact power - feeding module exceeds a threshold ( i . e ., the electric - current variation is at a level that cannot be dealt with by the noncontact power - feeding module ), the stable supply of electric - power to the system can be achieved utilizing electric - discharge caused by performing a boost operation using the battery as a power supply . moreover , providing a blank time in the controlling of the dc - in led by the ec has resolved the problem that the dc - in led repeats turning - on and turning - off due to the variation of the power - supply voltage in the case of noncontact power - feeding . that is , even when the system power is within the rated electric - power , if the electric - current variation of the noncontact power - feeding module exceeds the threshold ( i . e ., the electric - current variation is at a level that cannot be dealt with by the noncontact power - feeding module ), the stable supply of electric - power to the system is implemented utilizing electric - discharge caused by performing a boost operation using the battery as a power supply . moreover , providing a blank time in the controlling of the dc - in led by the ec resolves the problem that the dc - in led repeats turning - on and turning - off due to the variation of the power - supply voltage in the case of noncontact power - feeding . in the future , it is predicted that a power - supply unit , such as a noncontact power - feeding type one , which is inferior to the conventional ac adapters in load response characteristic will be brought into a market . a system design in consideration of a power - supply unit having a poor load response will be needed on a system side in the future . at that time , if designing is performed to suppress system load variation , the problem of the degradation of system performance or the problem of power increase will arise . the presently proposed patent can prevent the problems of the system performance degradation and the power increase , and achieve stable power - feeding . moreover , it is requested that the problem of the repetition of the turning - on and turning - off of the dc - in led due to the variation of the power - supply voltage in the noncontact power - feeding can be resolved by providing a blank time in the controlling of the dc - in led by the ec . even when the system power is within the rated electric - power of the noncontact power - feeding module , if the electric - current variation of the noncontact power - feeding module exceeds the threshold ( i . e ., the electric - current variation is at a level that cannot be dealt with by the noncontact power - feeding module ), the stable supply of electric - power to the system can be achieved utilizing electric - discharge caused by performing a boost operation using the battery as a power supply . to resolve this problem , according to this embodiment , it has been devised that even when the system power is within the rated electric - power of the noncontact power - feeding module , if the electric - current variation of the noncontact power - feeding module exceeds the threshold ( i . e ., the electric - current variation is at a level that cannot be dealt with by the noncontact power - feeding module ), the stable supply of electric - power to the system is implemented utilizing electric - discharge caused by performing a boost operation using the battery as a power supply . according to this embodiment , boosting is performed by detecting the electric - current variation of the system . thus , the stable supply of electric - power can be implemented without occurrence of variation of the power - supply voltage of the system . this embodiment also can deal with the load variation within the rated electric - power of the noncontact power - feeding module . even when a power supply such as the noncontact power - feeding module , which is sensitive to the load variation , stable electric - power can be supplied to the system by detecting the variation of the load current of the system and performing an operation of boosting from the battery . even when the system power is within the rated electric - power of the noncontact power - feeding module , if the electric - current variation of the noncontact power - feeding module exceeds the threshold ( i . e ., the electric - current variation is at a level that cannot be dealt with by the noncontact power - feeding module ), the stable supply of electric - power to the system is impelemented utilizing electric - discharge caused by performing a boost operation using the battery as a power supply . incidentally , the invention is not limited to the above embodiments themselves . in an implementing stage , the invention may be embodied while variously modifying components without departing from the spirit and scope of the invention . moreover , various embodiments of the invention can be implemented by appropriately combining plural components disclosed in the above embodiment . for example , some components may be deleted from all components described in the above embodiment . furthermore , the components in different embodiments may appropriately be combined with one another .	7
firstly , alloy steels a - 1 to a - 10 and b - 1 to b - 5 comprising alloying components having the formulation set forth table 1 above were prepared . table 1 also shows cr equivalent of the various alloy steels . in table 1 , those having an alloying component content falling outside the range defined in claim 1 or cr equivalent falling outside the range defined in claim 2 are underlined . these alloy steels were each used to prepare an inner ring and an outer ring for radial ball bearing ( inner diameter : 40 mm ; outer diameter : 80 mm ; width : 18 mm ) having a nominal count of 6208 . during this procedure , the radius ri of curvature of the raceway 11 of the inner ring 1 and the radius re of curvature of the raceway 21 of the outer ring 2 shown in fig1 were each determined to various values . the various alloy steels were each formed into a predetermined shape , and then subjected to hardening at a temperature of from 840 ° c . to 1 , 050 ° c . and tempering at a temperature of 160 ° c . the alloy steels which had been subjected to heat treatment were each then subjected to grinding and superfinish . the surface roughness of the raceways 11 , 21 were each determined to a range of from 0 . 01 to 0 . 04 μmra . separately , balls 3 having a diameter ( d ) of 11 . 906 mm made of steel corresponding to grade 20 of suj2 were prepared . these balls 3 had been subjected to carbonitriding . these balls 3 , the aforementioned inner ring 1 , the outer ring 2 and a corrugated press retainer made of metal ( not shown in fig1 ) were then assembled into test bearings . the characteristics of the various test bearings , i . e ., “ material ”, “ surface hardness of raceway ”, “ residual γ ( retained austenite content ) of raceway ”, “ radius ( r ) of curvature of raceway / diameter ( d ) of ball ” of the inner ring 1 and the outer ring 2 are set forth in table 2 . the inner clearance in the radial is referred to as “ c3 clearance ”. 10 samples were prepared for each of these test bearings . these samples were each mounted on a ball bearing life testing machine produced by nsk ltd . these samples were each then subjected to life test by rotation under the following conditions . vibration was measured during rotation . when the amplitude of vibration of the bearing reached five times the initial amplitude of vibration , rotation was terminated . the rotation time thus reached was defined to be life . at this time , the bearing was examined for occurrence of flaking on the raceway of the inner and outer rings . in the case where the amplitude of vibration didn &# 39 ; t reach five times the initial amplitude of vibration , testing was terminated when three times of 705 hours , which is the calculated life under these conditions , passed . subsequently , the results of test on 10 samples were plotted on a weibull distribution graph ( cumulative failure rate — life ) for each of these test bearings . from this graph was then determined , beginning with those having short life , the total rotation time ( l10 life ) required until 10 % of the samples of these test bearings underwent flaking . l10 life of the various test bearings were each then calculated relative to that of no . 25 as 1 . lubricant : mixture of a type ns - 1 lubricant for continuously variable transmission ( produced by showa shell sekiyu k . k . ), which is classified as “ traction oil ” with 3 % by volume of tap water further , the various test bearings were each kept at 130 ° c . for 1 , 000 hours for high temperature retention test . the amount of dimensional change of outer diameter of the bearings from before to after testing was then measured . the results of these tests are set forth in table 2 below with the structure of the test bearings . the relationship between the chromium equivalent and the life ratio ( relative value of l10 life ) of the test bearings ( nos . 3 , 5 , 7 , 9 , 11 to 15 , 19 , 22 ) wherein r / d of the inner ring is 51 . 0 %, the carbon content in the material used falls within the range defined herein and the retained γ ( retained austenite content ) in the raceway falls within the range of from 6 % to 25 % are graphically illustrated in fig2 . the relationship between the chromium equivalent and r / d of inner ring of all the test bearings except no . 18 , r / d of inner ring and outer ring of which are 52 . 0 % and 53 . 0 %, respectively , are graphically illustrated in fig3 . in this graph , these plots are represented by “ δ ” when the life ratio is not greater than 1 . 0 , “◯” when the life ratio is from greater than 1 . 0 to not greater than 2 . 0 and “” when the life ratio is greater than 2 . 0 . in fig3 the range a indicates a range in which both the two requirements for ( r / d ) of inner ring ( from not smaller than 50 . 1 % by weight to not greater than 51 . 9 % by weight ) and chromium equivalent ( from not smaller than 3 . 5 to not greater than 16 . 0 ) are satisfied . there are two “ δ ” plots in the range a , but they indicate test bearings comprising an alloy steel made of alloying components having the formulation falling outside the scope of the present invention . as can be seen in these results , the test bearing nos . 1 to 15 have r / d ratio of from not smaller than 50 . 1 % by weight to not greater than 51 . 9 % by weight both in the inner and outer rings but are made of the alloy steels a - 1 to a - 10 , the alloying components of which fall within the scope of the present invention ( requirement ( 1 )) and have retained austenite in the raceway surface of the ring in an amount of from 6 to 25 % by volume ( requirement ( 2 )) and a chromium equivalent of from 3 . 5 to 16 . 0 ( requirement ( 3 )). thus , these test bearings can exhibit a prolonged bearing life when lubricated with a traction oil as compared with the test bearing nos . 16 to 25 , which don &# 39 ; t satisfy any one of the aforementioned requirements ( 1 ) to ( 3 ). in other words , the arrangement of the structures of the test bearing nos . 1 to 15 can provide a radial ball bearing for bearing the pulley shaft of a belt continuously variable transmission which undergoes little surface fatigue even with slippage while lessening center dislocation between the two pulleys round which the belt is wound to attain a prolonged bearing life under lubrication with a traction oil . in particular , the test bearing nos . 2 to 15 exhibited good results , i . e ., life ratio of not smaller than 1 . 8 and dimensional change of not greater than 5 μm at high temperatures because they were made of the alloy steels a - 2 to a - 10 , which have a chromium equivalent of from not smaller than 5 . 0 to not greater than 16 . 0 , respectively . on the other hand , the test bearing no . 1 exhibited a dimensional change of 7 μm at high temperatures because it was made of an alloy steel having a chromium equivalent as relatively low as 3 . 55 . further , the test bearing nos . 16 to 19 exhibited a dimensional change as great as from 17 μm to 23 μm at high temperatures because they were made of alloy steels having a chromium equivalent as low as 1 . 97 and 2 . 61 . moreover , the test bearing nos . 7 to 11 , 13 and 14 exhibited good results , i . e ., life ratio of not smaller than 3 . 0 because they were made of the alloy steels a - 4 to a - 6 , a - 8 and a - 9 , which have a chromium equivalent of from not smaller than 7 . 0 to not greater than 14 , respectively . accordingly , the use of the alloy steels a - 2 to a - 10 , which have alloying components falling within the scope of the present invention and a chromium equivalent of from not smaller than 5 . 0 to not greater than 16 . 0 , and the predetermination of the content of retained austenite in the raceway surface to a range of from 6 to 25 % by volume can provide a prolonged bearing life under lubrication with a traction oil and a good dimensional stability at high temperatures while keeping r / d ratio of the inner ring and outer ring to a range of from not smaller than 50 . 1 % to not greater than 51 . 9 %. in other words , the arrangement of the structures of the test bearing nos . 2 to 15 can provide a radial ball bearing for bearing the pulley shaft of a belt continuously variable transmission which undergoes little surface fatigue even with slippage and hence little dimensional change even with heat generation due to slippage while lessening center dislocation between the two pulleys round which the belt is wound to attain a prolonged bearing life under lubrication with a traction oil . firstly , alloy steels c - 1 to c - 9 and d - 1 to d - 5 comprising alloying components having the formulation set forth table 3 above were prepared . table 3 also shows cr equivalent of the various alloy steels . in table 3 , those having an alloying component content falling outside the range defined herein are underlined . these alloy steels were each used to prepare an inner ring and an outer ring for radial ball bearing ( inner diameter : 40 mm ; outer diameter : 80 mm ; width : 18 mm ) having a nominal count of 6208 . during this procedure , the radius ri of curvature of the raceway 11 of the inner ring 1 and the radius re of curvature of the raceway 21 of the outer ring 2 shown in fig1 were each determined to various values . the various alloy steels were each formed into a predetermined shape , and then subjected to ( c ) carburizing or carbonitriding , hardening and tempering or ( d ) only hardening and tempering ( through hardening ) as heat treatment . in the heat treatment ( c ), the alloy steels were each heated to a temperature of from 930 ° c . to 960 ° c ., subjected to carburizing or carbonitriding for 1 to 3 hours , subjected to soaking for 1 hour , and then subjected to oil hardening . tempering was effected at a temperature of 160 ° c . in the heat treatment ( d ), the alloy steels were each subjected to hardening at a temperature of from 840 ° c . to 1 , 050 ° c . and tempering at a temperature of 160 ° c . the alloy steels which had been subjected to heat treatment were each then subjected to grinding and superfinish . the surface roughness of the raceways 11 , 21 were each determined to a range of from 0 . 01 to 0 . 04 μmra . separately , balls 3 having a diameter ( d ) of 11 . 906 mm made of steel corresponding to grade 20 of suj2 were prepared . these balls 3 had been subjected to carbonitriding . these balls 3 , the aforementioned inner ring 1 , the outer ring 2 and a corrugated press retainer made of metal ( not shown in fig1 ) were then assembled into test bearings . the characteristics of the various test bearings , i . e ., “ material ”, “ c concentration of raceway ( carbon content - ratio )”, “ n concentration of raceway ( nitrogen content - ratio )”, “[ c + n ] of raceway ( total content - ratio of carbon and nitrogen )”, “ surface hardness of raceway ”, “ residual γ ( retained austenite content ) of raceway ”, “ radius ( r ) of curvature of raceway / diameter ( d ) of ball ” of the inner ring 1 and the outer ring 2 are set forth in table 4 . the inner clearance in the radial is referred to as “ c3 clearance ”. 10 samples were prepared for each of these test bearings . these samples were each mounted on a ball bearing life testing machine produced by nsk ltd . these samples were each then subjected to life test by rotation under the following conditions . vibration was measured during rotation . when the amplitude of vibration of the bearing reached five times the initial amplitude of vibration , rotation was terminated . the rotation time thus reached was defined to be life . at this time , the bearing was examined for occurrence of flaking on the raceway of the inner and outer rings . in the case where the amplitude of vibration didn &# 39 ; t reach five times the initial amplitude of vibration , testing was terminated when three times of the calculated life under these conditions , passed . subsequently , the results of test on 10 samples were plotted on a weibull distribution graph ( cumulative failure rate — life ) for each of these test bearings . from this graph was then determined , beginning with those having short life , the total rotation time ( l10 life ) required until 10 % of the samples of these test bearings underwent flaking . l10 life of the various test bearings were each then calculated relative to accounting life as 1 . lubricant : mixture of a type ns - 1 lubricant for continuously variable transmission ( produced by showa shell sekiyu k . k . ), which is classified as “ traction oil ” with 3 % by volume of tap water the results of these tests are set forth in table 4 below with the structure of the test bearings . the relationship between the chromium content in the alloy steels used in the inner ring and outer ring of the various test bearings and the resulting life ratio ( relative value of l10 life ) of these test bearings are graphically illustrated in fig4 . the relationship between the total content of c and n in the raceway of the inner ring and outer ring of the various test bearings and the resulting life ratio ( relative value of l10 life ) of these test bearings are graphically illustrated in fig5 . in fig4 the range h1 indicates a range in which the content of cr in the alloy steel falls within the range defined in the present invention ( 3 . 0 to 8 . 0 % by weight ). in fig5 the range h2 indicates a range in which the total content of c and n in the raceway surface of the ring falls within the range defined in the present invention ( 1 . 20 to 2 . 50 % by weight ). further , the test bearings were kept at a temperature of 130 ° c . for 1 , 000 hours or more . the outer diameter of the bearings were measured before and after aging to measure the dimensional change thereof . the test bearing nos . 26 to 43 , which correspond to examples of the present invention , exhibited a negligibly small dimensional change . as can be seen in these results , the test bearing nos . 26 to 43 have r / d ratio of from not smaller than 50 . 1 % by weight to not greater than 51 . 9 % by weight both in the inner and outer rings but are made of the alloy steels c - 1 to c - 10 , the alloying components of which fall within the scope of the present invention ( requirement ( 1 )), have c and n incorporated in the raceway surface of the ring in a total amount of from not smaller than 1 . 20 % by weight to not greater than 2 . 50 % by weight ( requirement ( 2 )) and retained austenite in the raceway surface of the ring in an amount of from 15 to 40 % by volume ( requirement ( 3 )) and exhibit a raceway surface hardness of from not smaller than 59 to not greater than 64 as calculated in terms of hrc ( requirement ( 4 )). thus , these test bearings can exhibit a prolonged bearing life when lubricated with a traction oil as compared with the test bearing nos . 44 to 54 , which don &# 39 ; t satisfy any one of the aforementioned requirements ( 1 ) to ( 3 ). thus , the arrangement of the structures of the test bearing nos . 26 to 43 , the inner ring and outer ring of which fall within the scope of the present invention , can provide a radial ball bearing for bearing the pulley shaft of a belt continuously variable transmission which undergoes little surface fatigue even with slippage while lessening center dislocation between the two pulleys round which the belt is wound to attain a prolonged bearing life under lubrication with a traction oil . in other words , in accordance with the present invention , the use of an alloy steel having a high chromium content and the enhancement of [ c + n ] in the raceway by carburizing or carbonitriding cause enhancement of texture stability and surface fatigue resistance , resulting in the prolongation of the life of rolling bearings which are used in environments subject to slippage . further , the arrangement of the content of retained austenite in the raceway surface of the ring to a predetermined range makes it possible to secure desired heat resistance and dimensional stability even with increased generation of heat due to slippage and hence prolong life against seizing . in particular , the test bearing nos . 35 to 43 exhibited a raceway nitrogen concentration of from not smaller than 0 . 1 % by weight to not greater than 0 . 3 % by weight due to carbonitriding and thus exhibited a higher life ratio than the test bearing nos . 35 to 44 , which had been subjected to carburizing . the test bearing nos . 44 to 46 were obtained by subjecting d - 1 , which corresponds to the related art bearing steel , to through hardening . these test bearings had different r / d ratios of inner ring and outer ring . the test bearing no . 45 , which has an inner ring r / d ratio of 50 . 1 %, and the test bearing no . 46 , which has an inner ring r / d ratio of 53 . 0 %, exhibited a shorter l10 life than the test bearing no . 45 , which has an inner ring r / d ratio of 52 . 0 % ( 0 . 2 times the calculated life ). as can be seen in these results , in the case where the related art bearing steels are used , when r / d is predetermined to a range of from not smaller than 50 . 1 % to not greater than 51 . 9 %, the bearing life is reduced . as mentioned above , in accordance with the present invention , the use of a specific alloy steel makes it possible to prolong the bearing life as compared with rolling bearings formed by the conventional alloy steels ( bearing steel such as suj2 , case hardening steel such as scr420 and scm420 ) even when lubricated with a traction oil and the radius ( r ) of curvature of the raceway on the inner ring and the outer ring is from not smaller than 50 . 1 % to not greater than 51 . 9 % of the diameter ( d ) of the balls . in some detail , the predetermination of the radius ( r ) of curvature of the raceway of inner and outer rings to a range of from not smaller than 50 . 1 % to not greater than 51 . 9 % of the diameter ( d ) of the balls and the use of a specific alloy steel make it possible to provide a radial ball bearing for bearing the pulley shaft of a belt continuously variable transmission which can exhibit a prolonged bearing life while lessening center dislocation between the two pulleys round which the belt is wound . further , the arrangement of the structure of the present invention makes it possible to exert an effect of causing little surface fatigue even with slippage and hence little dimensional change with heat generation due to slippage , resulting in difficulty in occurrence of seizing , in addition to the aforementioned effect . moreover , in accordance with the belt continuously variable transmission of the present invention , the rotary shaft of the pulley round which the belt is wound is born by the rolling bearing of the present invention , making it possible to rotate the pulleys stably over an extended period of time while lessening center dislocation between the two pulleys and hence keeping the belt durable over an extended period of time . as mentioned above , in accordance with the present invention , the use of a specific alloy steel and the arrangement of [ c + n ], retained γ and surface hardness of the raceway surface of the ring to predetermined range make it possible to lessen heat generation or surface fatigue due to metallic contact and make it difficult to produce a newly produced surface on the raceway . thus , the bearing life can be prolonged as compared with rolling bearings formed by the conventional alloy steels ( bearing steel such as suj2 , case hardening steel such as scr420 and scm420 ) even when lubricated with a traction oil and the radius ( r ) of curvature of the raceway on the inner ring and the outer ring is from not smaller than 50 . 1 % to not greater than 51 . 9 % of the diameter of the balls . in some detail , the predetermination of the radius ( r ) of curvature of the raceway of inner and outer rings to a range of from not smaller than 50 . 1 % to not greater than 51 . 9 % of the diameter ( d ) of the balls , the use of a specific alloy steel and the arrangement of [ c + n ], retained γ and surface hardness of the raceway surface of the ring to predetermined range make it possible to provide a radial ball bearing for bearing the pulley shaft of a belt continuously variable transmission which can exhibit a prolonged bearing life while lessening center dislocation between the two pulleys round which the belt is wound . further , in accordance with the belt continuously variable transmission of the present invention , the rotary shaft of the pulley round which the belt is wound is born by the rolling bearing of the present invention , making it possible to rotate the pulleys stably over an extended period of time while lessening center dislocation between the two pulleys and hence keeping the belt durable over an extended period of time .	5
an internal combustion engine 10 according to fig1 — this can in particular be a direct - injecting gasoline engine — includes a fuel tank 12 from which an electrically driven prefeed pump 14 delivers fuel via a low - pressure line 16 to a high - pressure pump 18 . the fuel travels onward via a high - pressure line 20 to an accumulator 22 ( also referred to as the common rail ) in which the fuel is stored at high pressure . the accumulator 22 has a number of injection devices 24 connected to it that inject the fuel directly into combustion chambers 26 . the combustion of the fuel in the combustion chambers 26 sets a crankshaft 28 into rotation . via a mechanical coupling 30 that is only depicted schematically in fig1 , the high - pressure pump 13 is driven by the crankshaft 28 serving as a drive shaft . the high - pressure pump 18 is a one - cylinder piston pump in which a drive cam 32 on a shaft 33 sets a piston 34 into a reciprocating motion . the piston 34 is guided in a housing 36 and delimits a delivery chamber 38 . an inlet valve 40 can connect the delivery chamber 38 to the low - pressure fuel line 16 . the inlet valve 40 is embodied in the form of a spring - loaded check valve . an outlet valve 42 can connect the delivery chamber 38 to the high - pressure line 20 . the outlet valve 42 is also a spring - loaded check valve . a quantity control valve 44 can also connect the delivery chamber 38 to the low - pressure chamber 16 . the quantity control valve 44 is a 2 / 2 - way switching valve . a spring 46 brings it into the open , neutral position . an electromagnetic actuating device 48 brings it into the closed , switched position . this actuating device includes a magnetic armature 52 that is connected to a valve element 50 and is encompassed by a magnetic coil 54 . the magnetic coil 54 is supplied with current by the driver stage , not shown , of a control unit 56 . the control unit 56 receives signals from a speed sensor 58 , which senses the speed of the crankshaft 23 of the internal combustion engine 10 . the input side of the control unit 56 is also connected to a pressure sensor 60 that detects the pressure prevailing in the accumulator 22 and transmits corresponding signals to the control unit 56 . the principal of adjusting the fuel quantity delivered by the high - pressure pump 18 will now be explained in conjunction with fig2 through 4 . during the intake stroke depicted in fig2 , the piston 34 moves downward so that fuel flows into the delivery chamber 38 via the inlet valve 40 . after reaching the bottom dead center , the piston 34 moves upward again ( fig3 ). during the intake stroke of the piston 34 , the magnetic coil 54 of the quantity control valve 44 is supplied with current so that , at the very latest , this valve closes when the piston 34 reaches the bottom dead center . the inlet valve 40 also closes . during the delivery stroke of the piston 34 , if the pressure in the delivery chamber 38 exceeds the opening pressure of the outlet valve 42 , then the outlet valve opens . the fuel can thus be pushed into the accumulator 22 . if the delivery of fuel into the accumulator 22 must be terminated during the delivery stroke of the piston 34 , then the supply of current to the magnetic coil 54 of the quantity control valve 44 is disconnected so that the quantity control valve switches back into the neutral position . this is shown in fig4 . the fuel can thus escape from the delivery chamber 38 into the low - pressure line 16 via the open quantity control valve 44 . correspondingly , the outlet valve 42 also closes . the maximum fuel quantity that can be delivered during a delivery stroke of the piston 34 is essentially independent of the speed of the crankshaft 28 and the related duration of a delivery stroke . during each ci th delivery stroke , the quantity control valve 44 can close off the delivery chamber 38 from the low - pressure line 16 for a certain duration . when not in idle mode , the quantity control valve 44 is actuated so that each delivery stroke of the pump is used . the quantity is controlled by using partial strokes through intermittent opening of the quantity control valve 44 , as described above . in idle mode , however , the operation switches over to a two - point control with full delivery . this means that a delivery and therefore the actuation of the quantity control valve 44 is only triggered if the pressure falls below a pressure threshold on the high - pressure side . in this operating state , the delivery is always executed as a full delivery so that the pressure in the high - pressure system increases by a relatively large amount . the injections that follow cause the pressure to decrease again steadily . but since the injection quantities are low in idle mode , it takes a relatively long time before the pressure falls below the lower pressure threshold that triggers the next delivery . fig5 is a graph of the curve of the process over time . the pressure phd in the accumulator 22 , i . e . the pressure in the common rail , is plotted over time t . the pressure curve is shown between an arbitrarily selected time t 0 and an arbitrarily selected time t 4 . at time t 0 , the pressure phd should equal the value of a lower pressure threshold pu . at this time , the quantity control valve 44 is closed so that the high - pressure pump delivers for the entire piston stroke and is operated in an operating mode that is referred to below as a full delivery . the quantity control valve 44 remains closed until an upper pressure threshold po is reached ; this occurs at time t 1 . at time t 1 , the quantity control valve 44 is completely open so that the high - pressure pump 18 no longer delivers any fuel to the high - pressure side . this operating mode is referred to below as idle delivery . because the injection devices 24 continue to execute injections , the pressure phd in the accumulator 22 ( common rail ) decreases with each injection . for the sake of simplicity , this is depicted as a continuous line in fig5 , but in reality , this is not continuous , but is instead more or less step - like in the depiction over time . at time t 2 , the lower pressure threshold pu is reached again so that the closing of the quantity control valve 44 switches the high - pressure pump 18 back into the full delivery operating mode . when the upper pressure threshold po is reached at time t 3 , the high - pressure pump 18 is switched back into the idle delivery mode so that the pressure phd falls again . in the time spans t 0 to t 1 and t 2 to t 3 , one or more piston strokes are executed , depending on the maximum delivery quantity of the high - pressure pump 18 . the duration of the idle delivery mode , i . e . between times t 1 and t 2 , essentially depends on the storage capacity of the accumulator 22 and the respective quantity injected . the operating mode depicted in fig5 is only selected in the idle mode of the internal combustion engine . when not in idle mode , the high - pressure pump 18 is operated in a partial delivery operating mode . in this operating mode , fuel is delivered to the high - pressure side with each piston stroke of the fuel pump 18 . the quantity control valve 44 controls the fuel quantity by intermittently opening as needed ( e . g . partial load ) during the piston stroke of the fuel pump 18 . fig5 also shows a desired pressure pso , to which the rail pressure ( on the high - pressure side ) should be set in the respective operating range . the lower pressure threshold pu and upper pressure threshold po are close to the desired pressure . the activation condition for the above - explained two - point control can be selected , for example , to be when the engine speed falls below a minimum speed ( e . g . when it reaches the idling speed ) or when the injection quantity falls below a minimum quantity . in this connection , the lambda regulation should be active , the engine temperature should be within a permissible range ( normal temperature ), and the engine should have been started long enough ago for the starting oscillations to have reached a steady state .	5
fig1 illustrates a drill bit assembly made according to the method of the present invention . it will be understood that the bit is shown in a position it would most likely assume during the manufacturing process , but that its vertical orientation would be reversed in downhole use . the bit assembly of fig1 includes a bit body having an externally threaded pin connection 10 at one end . the bit body also includes three legs ( only two of which are shown in fig1 ) at the other end of the bit body , extending generally parallel to the bit centerline , but being radially offset from that centerline as well as circumferentially spaced from one another . each of the bit legs has an inner portion or stub 12 and an outer extension 14 . the leg portions 12 , along with the pin 10 and the intermediate crown area 64 of the bit body comprise an integral main body member . this member may be salvaged from a used bit , or may be of new manufacture . the outer portion 14 of each of the bit legs has an integral trunnion or journal member 16 extending angularly therefrom . each leg extension 14 with its integral trunnion 16 will be jointly referred to as a &# 34 ; base &# 34 ; in this application . a respective roller cone is mounted on each of the trunnions 16 for rotation with respect thereto . each roller cone includes a cone body 18 of a suitable metal and a plurality of tungsten carbide inserts 20 , mounted in the cone body 18 in the well known manner . the gauge area of each cone body 18 has wear inserts 22 mounted therein . other types of cones , such as milled tooth cones , can also be used . the interior of each cone body 18 and the exterior of its respective trunnion 16 have opposed cylindrical surfaces between which is mounted a journal bearing member 24 . the interior of the cone body 18 has a counterbore located just outwardly of the bearing 24 and carrying an elastomeric o - ring type seal 26 which seals between the cone body 18 and the trunnion 16 at the wide end of the cone . inwardly of the bearing 24 , the trunnion 16 and cone body 18 are provided with opposed semi - circular ball races within which are disposed a plurality of balls 28 . although the balls 28 may take some bearing load , their primary function is to retain the cone body 18 on the trunnion 16 . the assembly is held together by the balls 28 , which in turn are retained by a pin 30 in a loading bore 32 through the base 14 , 16 . pin 30 , whose configuration and function will be described more fully hereinbelow , is retained by welding . in manufacturing the main body member 10 , 12 , the outer surfaces 36 of the respective leg portions 12 are simultaneously machined , by known techniques and available equipment , to lie on a common locus defining a surface of revolution , preferably a cone . ( see u . s . pat . no . 4 , 711 , 143 ). thus the surfaces 36 of the three leg portions 12 are concave , lie on a common conical locus coaxial with the centerline of the bit , and are inclined longitudinally inwardly from their radially outer extremities to their radially inner extremities . each of the leg portions 12 has a lubricant supply channel 42 extending generally lengthwise therethrough . each lubricant supply channel 42 opens through the outer or end surface 36 of the respective leg portion 12 . the end of each channel 42 opening through the respective surface 36 is counterbored , as shown at 42a . as is conventional , the main body member 10 , 12 has three mud openings ( not shown ) circumferentially spaced and interposed between the leg portions 12 . the mud openings communicate via angular branch bores ( not shown ) with a large central bore 48 in the pin end of the member 10 , 12 . each mud opening is adapted to receive a wear - resistant nozzle , and in use , drilling fluid is directed through bore 48 and the communicating branch bores and nozzles to cool the cones 18 and flush away rock cuttings . the main body member 10 , 12 , as thus far described , is substantially ready for assembly with the other bit parts and welding . referring now to fig2 and 3 , there is shown a portion of a first lathe used for certain portions of the method of forming the trunnion 16 . the lathe includes a rotatable spindle 70 which is rotated about its axis or longitudinal centerline a by a motor connected to it in the usual manner . an end plate 72 is fixed to the end of spindle 70 for rotation therewith by any suitable means , as diagrammatically indicated at 74 . instead of a conventional chuck , a pair of holder blocks 76 are fixed , in any suitable manner , to the longitudinally outer face of plate 72 for joint rotation therewith . in this specification , terms such as &# 34 ; longitudinally ,&# 34 ;&# 34 ; radially ,&# 34 ; and &# 34 ; circumferentially &# 34 ; will be used with reference to the axis a unless otherwise noted . as best seen in fig3 holder blocks 76 are spaced apart circumferentially so that a gap 78 is formed between them . the radially inwardly facing faces 80 of blocks 76 may be considered to jointly define a support surface interrupted by the gap 78 . diametrically opposite holder blocks 76 is a counterweight 82 adjustably mounted on plate 72 . a radially oriented key 84 on the counterweight 82 is received in a radial groove 86 in plate 72 for radial adjustment of the counterweight 82 so that it can properly balance different sizes and shapes of workpiece . when the counterweight has been placed in a desired position , it can be retained there by screws 88 passing through a slot 90 in the counterweight and threaded into suitable threaded bores 93 in plate 72 . as shown in fig2 slot 90 has an outermost widened section forming shoulders 91 to abut the heads of the screws 88 . fig2 and 3 also show the partially finished workpiece destined to form one of the cone - mounting bases of a drill bit of the type shown in fig1 . the workpiece includes a leg extension work portion 92 , having a preliminary end surface 96 , and a trunnion work portion 94 extending angularly from the leg extension work portion 92 . the workpiece is at least rough - formed to provide the two angularly disposed work portions 92 and 94 prior to being placed in the lathe . the phantom line 94 &# 39 ; may diagrammatically represent the trunnion work portion 94 prior to turning in the lathe . to mount the workpiece 92 , 94 in the lathe , an interface plate 98 is used . interface plate 98 has a base surface 102 for resting on the support surface 80 , and an indexing surface 104 , facing generally radially inwardly . surface 104 is angularly oriented with respect to surfaces 80 and 102 so as to correspond to , i . e . impart to trunnion work portion 94 , the desired skew and twist angles of the trunnion to be turned , as that trunnion will be oriented in the finished bit design . to accurately position interface plate 98 with respect to the holder blocks 76 , first positioning pins 100 are snugly fitted into bores 106 in the respective holder blocks 76 . then , respective bores 108 in the plate 98 are snugly fitted over the pins 100 . because of the smooth sides and snug fits of the pins 100 in their respective sets of opposed bores 106 and 108 , the positioning is more accurate than if it were achieved by the same means used to connect plate 98 to the blocks 76 . the latter function is served by interface screws 110 which pass through oversized bores 112 in plate 98 and are threaded into tapped bores 114 in blocks 76 . the oversizing of the bores 112 allows the screws 110 to be threaded into the tapped bores 114 even if the precise positioning provided by pins 100 causes bores 112 and 114 to be slightly displaced from coaxial alignment . there are two screws 110 for each block 76 , but only one set is shown , in fig2 . fig2 also shows that the bores 112 are counterbored to receive the heads of the screws 100 , which are short enough to fit completely into bores 112 , so that they do not interrupt or jut out from the indexing surface 104 . the workpiece 92 , 94 is connected to the interface plate 98 in much the same manner that the plate 98 is connected to blocks 76 , with its preliminary end surface 96 abutting the indexing surface 104 so that the angular orientation of indexing surface 104 is imparted to the workpiece . specifically , the plate 98 has a pair of smooth walled positioning bores 116 extending in through surface 104 , and the leg extension work portion 92 of the workpiece has a similar pair of positioning bores 118 extending in through its preliminary end surface 96 . the bores 116 and 118 are precisely located so that , when aligned , they will properly position the workpiece with its trunnion work portion 94 aligned with the axis a of the lathe . smooth walled positioning pins 120 are snugly interfitted between respective sets of opposed bores 116 and 118 to achieve this positioning . then , a large workpiece screw 122 is inserted through gap 78 and an oversized bore 124 in plate 98 and threaded into a tapped bore 126 in the leg extension work portion 92 . two adjustable bracing screws , one of which is shown at 128 , are threaded into counterweight 82 in such position that , by advancing them outwardly from their bores in the counterweight , their heads can be brought into abutment with a radially inner portion of the workpiece near the juncture of portions 92 and 94 . a respective spring 129 abuts the head of each screw 128 and the opposed counterweight 82 to keep the screw 128 from working out of the desired position . with the work 92 , 94 thus mounted in the lathe , the trunnion work portion 94 is turned using a tool 93 ( fig6 ) to form an innermost cylindrical bearing surface 130 , a ball race 132 , another short cylindrical section 135 ( slightly smaller than bearing surface 130 ), and a substantially reduced diameter nose portion 134 . this step of the work is diagrammatically indicated in step a of fig6 . the manner in which the work is connected to the lathe , unlike a conventional chuck , requires only enough excess length of the leg extension work portion 92 to allow for the short bores 118 and 126 . thus , the trunnion work portion 94 can be accurately and precisely turned , even at high speeds , without the generation of undue centrifugal forces , and thus without the need for the lathe to be exceptionally large , heavy , or otherwise unusual in any way which would make it unduly expensive or impractical . not only can the work be accurately and precisely rotated at a sufficient speed to allow true turning , as opposed to grinding , but the work can even be rotated at the very high speeds required for the use of superior ceramic cutting tools . after the trunnion work portion 94 is at least roughly turned to the configuration 130 , 132 , 134 , the workpiece 92 , 94 is removed from the lathe . further machine work may then be performed , and this may include several different types of machining processes . for at least some of such processes the workpiece 92 , 94 may be simply and conveniently mounted on the respective machine by an interface member similar to plate 98 in the orientation of its indexing surface and its manner of connection to the workpiece , but adapted as necessary for connection to the respective machine . an example is the formation of the ball - loading bore 32 which opens through the ball race 132 . however , additional machining steps may be performed , e . g . machining of shirttail surface 15 prior to formation of bore 32 . fig6 diagrammically illustrates formation of bore 32 at step b . the work is mounted on a second interface member 98a , having an indexing surface and connection means similar to those of plate 98 , but adapted for mounting on a machine 77 such as a drill press , so that the ball loading bore 32 can be formed by tool 79 , the bore 32 extending from the shirttail portion 15 through the ball race 132 . machining of some formations does not require mounting on a special interface plate . for example , a lubricant supply branch bore 29 ( fig4 and 6 , c ) intersects bore 32 and opens through bearing surface 130 perpendicular thereto . bore 29 may be formed with the work held in a more conventional chuck . however , it is preferable that the end of bore 29 opening through surface 130 be bevelled , as indicated at c in fig6 . next , the work , or at least its trunnion portion 94 is heat treated as shown at step d . here again , if any fixturing is required , uniformity is possible , i . e . the work can be mounted on a suitable interface member for heat treatment by means of pins received in bores 116 and a screw threaded into bore 126 . next , the treated work is returned to the lathe shown in fig2 and 3 , as indicated at step e , i . e . remounted on the first interface plate 98 in the same manner as was done for the first or rough turning . so precise is the positioning provided by the interface plate 98 , pins 120 , and screw 122 , and so precise is the turning operation which was previously performed on the relatively short workpiece , that , even after the further machining and heat treatment , the remounting of the work in the lathe of fig2 and 3 will place the work portion 94 in sufficiently precise alignment with axis a . a second or fine turning can then be performed at high speed , i . e . at least 500 surface feet per minute , preferably using a ceramic tool 95 . in addition to the high speed , the use of the ceramic tool , without damage thereto , is facilitated by the aforementioned beveling of the branch lubricant supply bore 29 . this prevents damage to the ceramic tool as it passes that bore during turning . the fine turning provides a very precise and smooth surface to the work . next , it is preferable to super finish the bearing surface 130 in a manner which imparts a very fine and precisely controlled microscopic crosshatch pattern to that surface . such a pattern not only does not harm or reduce the life of the bearing surface , but on the contrary , enhances that life by causing lubricant to cling better to the bearing surface . for this part of the process , the workpiece 92 , 94 is placed in a different lathe , shown in fig4 and diagrammatically at step f . this lathe has a rotatable end assembly including a stub shaft 136 connected to the rotatable portion of the lathe by three jaws , two of which are shown at 138 . a rotatable plate 142 is provided on the outer end of stub shaft 136 . an l - shaped holder has one leg fixed to plate 142 by screws 148 , and another leg 146 extending forward and providing a radially inwardly facing support surface 150 . an interface plate 152 is mounted on surface 150 in substantially the same manner as plate 98 is mounted on blocks 76 , including screws 154 and positioning pins ( not shown ). likewise , the leg extension work portion 92 is connected to the plate 152 with its end surface 96 abutting an indexing surface 156 of the plate 152 . the angle of surface 156 is similar to that of surface 104 , as is the manner of connecting the work portion 92 to plate 152 , the latter including positioning pin 100 &# 39 ; and other parts not shown . it will be understood that holder 146 will have a radially opening interruption allowing a workpiece screw to be passed through plate 152 and threaded into work portion 92 . because the work depicted in fig4 is done at a slower speed , there is no need for a counterweight on the lathe of fig4 . instead of a cutting tool , a roughened stone - type tool 158 is applied to the trunnion work portion 94 , more specifically , its larger diameter cylindrical surface 130 , as the work is rotated by the lathe . in addition , the tool 158 is simultaneously reciprocated paralled to the axis a &# 39 ; of rotation as indicated by the arrow b . this super finishes the bearing surface 130 , as aforementioned . in preferred versions of the invention , the stone is used alone in a first step , then with a lapping compound in a second step , and finally with an abrasive pad , such as that sold under the trademark &# 34 ; scotchbrite &# 34 ; between the work and the stone . the crosshatch grooves thus formed are microscopic in magnitude , so that they do not detract from the fine finish of the bearing surface 130 , but do provide the aforementioned lubricant retention effect . next , as indicated in fig5 a portion of the leg extension workpiece 92 is removed , and more specifically , that portion including the bores 124 and 116 is removed , to form a near - final end surface 96 &# 39 ;. although this surface will be further machined to cause it to conform to the same conical locus as the surfaces 36 ( fig1 ), this process can be shortened by removing the excess portion by a cut disposed at an angle with respect to the preliminary end surface 96 , and with the angle of that cut roughly approximating the desired final configuration , i . e . inclined longitudinally and radially inwardly with respect to the finished bit . after the final machining , the intermediate end surface 96 &# 39 ; will be reformed to the final end surface 52 ( fig1 ). the lubricant channel 56 will be formed from that end surface inwardly to intersect the ball loading bore 32 and counterbored . the bearing 24 , seal 26 , and cone 18 will be placed on the trunnion , cone 18 emplaced , balls 28 loaded into their race through bore 32 , and then a retainer pin 30 , reduced in diameter to allow lubricant flow therepast , inserted into the bore 32 to retain the balls in a well - known manner . the pin itself is retained by a plug 30c welded into the outer end of the ball loading bore . annular positioning pins 62 are installed in opposed counterbored portions of the lubricant supply bores 42 and 56 in the bit legs as the two portions 12 and 14 of each leg are matched up . the legs are then welded together along the surfaces 36 and 52 . lubricant supply devices 66 and mud nozzles are installed , and the bit is then complete . it will be appreciated that the method of formation of the workpiece 92 , 94 and its fixturing or manner of mounting on the lathe and other machines used in the process not only provides the aforementioned advantages vis - a - vis the turning process itself , but also allows a relatively simple and uniform type of fixturing to be used in other parts of the process . in another aspect , by changing the interface plate 98 , or other interface member as used on one of the other machines in the process , ( see 98 &# 39 ; in step g of fig6 ) each lathe or other machine can be quickly and easily adapted for machining different bit bases , e . g . having different leg lengths and / or different skew and twist angles . numerous modifications of the above - described method and apparatus will suggest themselves to those of skill in the art . accordingly , it is intended that the invention be limited only by the claims which follow .	4
the invention is a method of manufacturing an electrode array 6 , shown in fig1 , also known as a “ bed - of - nails ”, which is applied to living tissue to provide an effective electrical connection therewith , whether for sensing or stimulating purposes . the electrode array 6 provides a multiple possibility of successful electrical contact , and causes minimal damage or upset to either the living tissue or to the body system . the electrode array 6 includes an arrangement of electrically conductive needles that arise from a substrate 14 , are substantially normal thereto , and which serve as electrodes 4 ( fig2 ) for sensing or stimulation of living tissue . terminals and electrical conductors may be employed to connect individual electrodes 4 or groups of electrodes of the electrode array 6 to other electrical circuits . the bed - of - nails package 2 consists of the electrodes 4 , which form an array 6 that may be in a planar , square or rectangular arrangement having regular spacing intervals , as depicted in the various embodiments presented in fig1 to 9 and 13 to 16 , or which may be in an irregular or non - repetitive arrangement such as may be dictated by the desired function of the package 2 . while the package 2 is presented as a generally rectangular package having rounded edges and corners , it may advantageously have a flat circular or ovaloid shape or other shape without limitation to those shapes just disclosed . the package 2 may have a thickness of about 2 mm , plus the length of the electrodes . in a preferred embodiment , the electrodes 4 are about 0 . 5 to 4 . 0 mm ( 0 . 02 to 0 . 16 inches ) in length and about 0 . 02 to 0 . 10 mm ( 0 . 001 to 0 . 004 inches ) in diameter . aspect ratios ( height to diameter ) of 40 : 1 are readily achievable . in the embodiment presented , the electrode array 6 contains about 121 electrodes 4 in a square matrix . the electrodes 4 may , of course , be taller and narrower . electrode spacing in the array may vary , as may the size of the needles . of course , such electrodes 4 may be conical or other elongated shapes . the spacing of the electrodes 4 , transversely across a nerve , would be from approximately 0 . 5 micrometer to on the order of 100 micrometers . “ on the order of ” means within the range of 0 . 1 to 10 times the dimension , in this context and as used herein . spacing of the electrodes 4 along the length of a nerve might well be greater than the lateral spacing of the electrodes 4 across the nerve . that is , the spacing distance between electrodes 4 along the length of a nerve can vary a great deal . electrodes 4 or electrode array 6 might well be longitudinally spaced 1 , 000 micrometers , 2 , 000 micrometers , etc ., from one another , depending on the desired density of electrical contact with the nerve . the package 2 may be planar or may be alternately shaped to conform to a specific desired application , although only planar arrays are presented in fig1 to 9 and 13 to 16 . the electrodes 4 material is biocompatible and is not limited to but may be selected from titanium , titanium alloy , platinum , platinum alloy , activated iridium , platinum - iridium alloy , conductive polymer , carbon or other suitable electrically conductive material known by those skilled in the art as suitable for use in connection with the body . in general , metals or other conductive substances which are inert and are least subject to corrosion are selected . in the case of stimulating devices , conductive materials which can handle the necessary current densities are required . in a preferred embodiment , the electrodes 4 are comprised of an electrically conductive and biocompatible material which may be elemental metals or alloys , such as but not limited to a titanium alloy , such as ti - 6al - 4v , ti - 5al - 2 . 5fe , ti - 6al - 2sn - 4zr - 2mo , ti - 6al - 6v - 2sn , or ti - 4al - 4mo - 2sn — si , or a platinum alloy , such as 90pt - 10ir or 80pt - 20ir , or pure platinum , or pure iridium . as will be discussed herein , coatings may be employed to enhance the stability of the electrodes 4 . candidate coating materials include , but are not limited to , gold , platinum , iridium , platinum oxide or iridium oxide , or another coating that is suitable for electrode application . the coating is applied to the electrodes 4 surface at least where the electrodes 4 are exposed to living tissue , as it is at a reveal 72 or at an uncoated through - hole 76 . the electrodes 4 must , therefore , be spaced according to the specific application . the electrodes 4 should be small and of the correct sharpness to avoid damaging the nerve . also the electrically conductive portion of each electrode 4 should be small enough to contact only a single fiber and thereby obtain signals from only one fiber . consequently , a preferred embodiment of the invention is to insulate the electrode , except at selected location or locations between a distal end 80 and a proximal end 82 of the electrodes 4 , so that at least one electrically conductive portion of each electrode 4 is exposed . in this way , each electrode 4 may be designed to contact the living tissue at one location or at multiple locations , if more than one electrically conductive portion of the electrodes 4 are exposed to effect electrical contact more than one fiber of living tissue . in addition , the electrodes 4 must be high or long enough to assure sufficient penetration of the desired nerve so as to make electrical connection with the nerve fiber inside the nerve . in order to reach the nerve fiber , the sheath and other connective tissues must be penetrated . however , “ electrical connection ” or “ contact ” with a nerve fiber or other body tissue may mean actual physical contact with the nerve fiber or tissue or it may mean being in sufficiently close location to sense the electrical signals therefrom or to stimulate the fiber or tissue . the electrodes 4 spacing and length may vary on a given substrate 14 . in order to reach down into a fissure in the brain , for example , it may be desirable to have longer electrodes 4 on one portion of the electrode array 6 and shorter electrodes 4 on another portion . also , spacing density on one portion of the electrode array 6 may be greater or lesser than on another portion . the term “ electrode array ” as used herein means a collection of electrodes and includes systematic and orderly groupings or arrangements as well as including non - linear and irregular groupings or arrangements , which may be dictated by the function to be served by the electrode array . there may be an abrupt change of electrodes length or density , or both , in one or more directions . there may be graded or gradual changes in one or more directions . it is to be understood that the array 6 may be sized to fit the particular application and may be planar , multiplanar , curved , twisted , or other desired shape as required in the particular circumstances involved . ordinarily , the electrode array 6 is disposed on a rigid substrate 14 . however , it is to be appreciated that the substrate 14 may be flexible , or that the electrode array 6 may be comprised of electrodes 4 on a plurality of substrates 14 . in general , the electrodes 4 in an array 6 should be held in relatively fixed spacing with respect to each other . it is intended to cover by “ relatively fixed ” terminology , instances in which the substrate 14 is flexible , curved , stretchable , etc . among the suitable substrates 14 are , without limitation , ceramics , such as zirconia , more specifically stabilized - zirconia , partially - stabilized zirconia , tetragonal zirconia polycrystal , magnesia - stabilized zirconia , ceria - stabilized zirconia , yttria - stabilized zirconia , and calcia - stabilized zirconia , as well as silicon , sapphire , alumina , or germanium . biomedical grade plastics may also be used such as the polyamides , polyimides , polymethacrylates , acrylics , polycarbonates , etc ., to the extent that such plastics may be implantable or rendered implantable . these plastics cannot form a braze bond and , more importantly , they do not form a hermetic device . the electrodes 4 may be arranged in random fashion or ordered in columns and / or rows or other ordered arrangements . the optimum embodiment from the standpoint of orderly electrical connection is an ordered arrangement . one embodiment which may be desired is that in which each electrode 4 ( except , of course , those near the edges of the array 6 ) is surrounded by six other electrodes 4 , all equidistantly spaced . the electrodes 4 are electrically connected to a terminal which may , likewise , be randomly located or located in orderly columns and / or rows . the terminal may include bonding pads which provide an electrical connection between the electrodes 4 and other electrical circuits . connection points need not be in the same arrangement as the electrodes 4 . thus , the electrodes 4 may be located in columns , but not rows , and the terminals may be located in columns and rows . in addition , the package 2 is comprised of a case 12 that may have two halves , as illustrated in fig1 . the two halves of case 12 are welded together at weld 36 to form a hermetic seal . the case is comprised of biocompatible materials , which in a preferred embodiment may be titanium or an alloy of titanium that is weldable . cable 8 transmits electrical signals to and / or from the package 2 and is electrically connected to the electrodes 4 in a manner to assure that the desired function of the device is achieved . header 10 electrically isolates the connections between the cable 8 and the electrodes 4 . the isolation formed by the header 10 is not necessarily hermetic and may therefore be accomplished by forming header 10 of an epoxy material or a biocompatible electrically insulating material , which need not form a hermetic seal in the instant application , but which provide electrical isolation between the feedthrough pins 34 . in a preferred application , the number of electrical conductors in cable 8 approximate the number of feedthrough pins 34 . a cross - section of the device 2 is presented ( fig2 ) showing the electrodes 4 in a flat , rectangular electrode array 6 , where each electrode 4 is hermetically bonded to substrate 14 . electronic components 18 are presented and consist of integrated circuit chips , capacitors , and other electronic components that are known to those skilled in the art . inclusion of signal processing as part of the device enables a “ smart ” array , wherein it is necessary to have hermetic and biocompatible packaging for the bed of nails and electronics . the case 12 covers and encloses electronic components 18 and forms a hermetic seal with substrate 14 by , for example , a braze joint 86 . feedthrough pins 34 are shown in a preferred embodiment as flat headed pins that are comprised of a conductive brazeable metal , such as titanium or its alloys , niobium or its alloys , platinum or its alloys , iridium or its alloys , or silver or its alloys . the feedthrough pins 34 are bonded by known processes , such as brazing or welding , to the electrical conductors in cable 8 . the embodiment of device 2 presented in fig2 presents a preferred embodiment where a lid 84 is comprised of a material such as those candidates presented for substrate 14 , notably zirconia or alumina . the lid 84 is attached by braze joint 88 to case 12 , thereby forming a hermetic seal that protects electronics components 18 . in alternate embodiments lid 84 may be comprised of a metal and may be comprised of the same material as case 12 , potentially being an integral part of the assembly and thus avoiding joint 88 . a sub - assembly to aid in describing the assembly process is presented in fig3 . in this embodiment the electrodes 4 , while forming an electrode array 6 , are inserted into a conforming braze preform 16 , which is comprised of a braze material , from the top surface 124 of substrate 14 . substrate 14 receives a portion of each electrode 4 prior to being thermally processed to develop a hermetic seal between each electrode 4 and the substrate 14 . the substrate 14 , fig4 , contains a number of feedthrough holes 20 which correspond to the number and configuration of electrodes 4 when they are arranged in the electrode array 6 . the electrodes 4 , as presented in fig5 , consists of a shaft 22 which has a sharp end at the distal end 80 , for tissue penetration during use , and an end that contacts brazing head 24 at the proximal end 82 . the electrode then terminates with feedthrough 26 which , in the embodiment presented in fig5 , enters feedthrough hole 20 from the top surface 124 until brazing head 24 contacts braze preform 16 , which in turn contacts substrate 14 . a feedthrough 26 is comprised of a hole 20 , braze joint 74 , and electrode . substrate 14 is preferably comprised of a ceramic , preferably zirconia . braze preform 16 is presented in fig6 and is configured to have a hole 32 that corresponds to each substrate feedthrough hole 20 , which in turn corresponds in approximate diameter and location to the electrodes 4 and electrode array 6 . the braze material of braze preform 16 forms a plurality of tabs 30 thereby forming a matrix of braze material as a layer or multiple layers of braze material which , when thermally processed , hermetically bonds the electrodes 4 to the substrate 14 . a large non - functional opening or void 28 is formed by the interconnecting tabs 30 and holes 32 . the tabs 30 may be removed after brazing by sandblasting , dicing , laser ablation , etc . so that individual electrodes are isolated from each other . however , in a preferred embodiment , the dimensions of braze preform is designed so that the tabs 30 will disappear after brazing due to surface tension as the melted preform tabs 30 are drawn into the braze joint 74 between the electrodes 4 and the substrate 14 . in the case of using titanium or titanium alloys as the electrodes 4 material , a nickel braze preform is preferred . during brazing , the tabs 30 on the braze preform 16 liquefy when some titanium ( from the titanium electrodes 4 ) diffuses in and are pulled towards the electrode mating area due to surface tension . after brazing , the tabs 30 disappear . titanium nickel layered laminates are the preferred braze material when electrodes 4 are comprised of noble metals . during brazing , the tabs 30 liquefy when its temperature reaches above its melting point and are pulled towards the electrode mating area due to surface tension . after brazing , the tabs 30 disappear . this is a preferred phenomenon as the braze perform 16 makes the assembly process much easier and the disappearing tabs 30 enable the electrodes 4 to remain insulated from each other . it has been determined that the tabs have a maximum width of 0 . 1 inch , a maximum length of 0 . 2 inch , and a maximum thickness of 0 . 01 inch . bonding of electrodes 4 into substrate feedthrough holes 20 has been determined to occur between 25 and 300 degrees centigrade above the braze preform melting point . alternate embodiments of the braze preform 16 are conceived where the tabs 30 are removed and only a “ braze washer ” of material remains . yet another embodiment of the braze preform 16 is a sheet of braze material that contains holes that accept the electrodes 4 in alignment with substrate feedthrough holes 20 . the metal braze material may be , without limitation , an alloy , a composite , or a layered laminate that forms the desired thermally processed structure and is preferably comprised of nickel or an alloy of nickel , as disclosed in u . s . pat . no . 6 , 521 , 350 issued to fey , et al . on feb . 18 , 2003 , which is incorporated by reference in its entirety . also , u . s . pat . no . 6 , 989 , 200 , issued to byers , et al . on jan . 24 , 2006 ; u . s . pat . no . 7 , 022 , 4215 issued to schnittgrund on apr . 4 , 2006 ; and u . s . patent application ser . no . 10 / 793 , 006 filed by schnittgrund on mar . 3 , 2004 , now abandoned , all of which are incorporated by reference in their entirety , disclose candidate braze materials . the cross - sectional view of electrodes 4 presented in fig7 presents the shaft 22 in relation to the brazing head 24 , which abuts substrate 14 and is attached thereto by braze material at a braze joint 74 . the braze joint 74 continues along the interface formed between electrode feedthrough 26 and feedthrough hole 20 . the proximal end of the electrodes 4 comprises a contact surface 27 for connection to other electrical circuits . the electrodes 4 are covered by electrically insulating coating 70 thereby preventing electrical contact with the tissue in which the electrodes 4 are placed , except at the electrically conductive reveal 72 , which in a preferred embodiment is presented as an uncoated band that circumscribes shaft 22 . more than one reveal 72 may placed on a given electrode 4 to enable monitoring several neural fibers , for example . each fiber will have its own individual signal , which may be monitored individually by selecting the signal and utilizing electronic filtering to distinguish the several signals from each other . it is conceived that the distal tip 80 ( fig5 ) may be revealed also . the utilization of multiple reveals is most useful when electrical signals are being sensed , since in a stimulation mode , each reveal would stimulate each contact point simultaneously , while in the detection mode , the electronic package can discriminate between individual sensed inputs on a single electrode 4 having multiple reveals 72 or holes 76 . coating 70 is comprised of a biocompatible and electrically insulating coating , such as parylene , polyimide , alumina , or zirconia . coating 70 is preferably comprised of parylene , a well known organic coating that is biocompatible . electrically conductive contact between tissue and electrodes 4 is limited by the position , size , and shape of the reveal 72 . an alternative embodiment of the electrodes 4 is presented in fig8 , wherein the electrodes 4 are coated with insulating coating 70 except at through - hole 76 , which in this embodiment passes completely through the shaft 22 . the inside of hole 76 is left uncoated , where electrically conductive contact with the tissue occurs . a further feature of the embodiment presented in fig8 is that the living tissue , which may be a nerve bundle or an axon , grows into the hole 76 and thereby anchors the electrode in position in the tissue . hole 76 need not pass completely through shaft 22 to provide an anchor for the ingrowth of tissue . the hole 76 has a diameter of about 0 . 01 to 0 . 03 mm ( 0 . 0005 to 0 . 001 inches ) and may be fabricated by laser drilling . another alternative embodiment is presented in fig9 , where the hole 76 is electrically insulated and coated along its inside walls with coating 78 , which is preferably the same coating as the coating 70 on the outside of electrodes 4 . in this embodiment the hole 76 provides an anchor to the living tissue . the reveal 72 provides electrical communication with the tissue . a further embodiment of an electrode array 100 is presented in fig1 wherein the electrodes 106 , which are bonded to oval substrate 112 , have variable lengths . the substrate 112 and electrode array 100 pattern may be oval , circular , rectangular , or an irregular shape without limitation . the reveals , not illustrated , may be located in one plane , at variable locations , or in a non - repeating pattern . the embodiment presented in fig1 presents electrode array 102 wherein the electrodes 108 are of equal length but each has a reveal 116 that is disposed at various locations along the length of electrode 108 such that contact with the living tissue occurs with different tissue bundles , for example . while not illustrated , it is envisioned by the inventors that the spacing between electrodes 108 may be variable and need not be equidistant from each other . the embodiment of fig1 presents an electrode array 104 wherein the electrodes 110 , which are bonded to non - flat , irregular substrate 114 , have irregular lengths . the reveals , not illustrated , may be arranged in a multitude of arrangements , as described for fig1 . the alternative embodiment of fig1 presents the electrodes 4 inserted through the substrate 14 from the bottom surface 126 . the contact surface 122 of terminal 120 provides a connecting surface to the other electrical circuits . in this configuration , fig1 , the braze surface 74 is concealed from the living tissue environment . fig1 presents an embodiment that is similar to that of fig1 , except that presenting contact surface 120 is on brazing head 24 , which results in more readily formed electrodes 4 . fig1 is more readily formed that the electrode of fig1 or 14 and contact surface 122 is formed on shaft 22 . the substrate 14 , fig1 , contains a number of feedthrough holes 20 which correspond to the number and configuration of electrodes 4 when they are arranged in the electrode array 6 . the electrodes 4 then terminate with feedthrough 26 which , in the embodiment presented in fig1 , enter feedthrough hole 20 from the bottom surface 126 of substrate 14 until brazing head 24 contacts braze preform 16 , which in turn contacts substrate 14 . although the invention has been described and illustrated in detail , it is to be clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of this invention being limited only by the terms of the appended claims .	0
this invention relates to a hydraulic control device according to the preamble of patent claim 1 . in a control device of this type , as is known from publication d 7100 , june 1986 , edited by heilmeier & amp ; weinlein , the damping throttle is set in the control pressure conduit in such a way that , when the pressure medium is operatively warm and the load holding valve opened in a controlled way , it effects a decay of the amplitudes of the pressure variations . for preventing any delay in the controlled closing movement of the load holding valve and any after - running of the hydraulic motor under load , the damping throttle may be bypassed by a check valve which ensures a swift pressure reduction during closing . although pressure variations in the pressure control conduit and load movements caused thereby are gradually dampened by means of the damping throttle , some of them can clearly be felt because the load holding valve is subject to play and the hydraulic motor reacts unevenly . it has been found in practice that the dampening effect of the damping throttle is above all unsatisfactory in load systems that have a strong tendency to vibrate . when the load holding valve is rapidly opened in a controlled way , this produces pressure variations with a relatively harmonious vibration curve . in such a case , at least the first amplitude of the pressure variations has a high maximum and a low minimum while the subsequent amplitudes decrease gradually . the pressure values of the extremes of the first amplitude ( s ) are known . the pressure variations during rapid opening of the load holding valve result not only from a rapid pressure build - up , but also from conditions of the load which moves ( downwards ) after the controlled opening of the load holding valve and vibrates and thus acts on the pressure medium column within the hydraulic circuit of the control device . pressure variations are unavoidable , but it is desirable to dampen them as fast as possible . furthermore , a damping throttle which is tightly set for achieving a strong dampening action may delay the controlled opening movement . this disadvantageous effect is above all observed with a cold and tenacious pressure medium , as the damping throttle is responsive to viscosity . in accordance with the invention , this object is attained through the features outlined in the characterizing part of claim 1 . when the pressure rises , the respective check valve which is strongly biased opens at least during the first amplitude as soon as the biasing force has been overcome . depending on whether the one or the other check valve is strongly biased , the peak of the amplitude is eliminated down to the minimum of the pressure value of the pressure variation which could not be dampened by the damping throttle . a rapid decay of the first and the subsequent amplitudes is effected at the opening side . this is especially advantageous with a cold pressure medium and / or with a tightly set damping throttle because the check valves do not only support the dampening action of the damping throttle , but compensate for the damping throttle effect which is not desired under specific operating conditions . the amplitudes of the pressure variations which become effective at the opening side of the load holding valve are dampened as rapidly as possible , so that the load holding valve immediately enables the hydraulic motor to move uniformly under load , i . e . virtually from the beginning of the movement . the rapid dampening of the pressure variations at the opening side of the load holding valve has a dampening effect on pressure variations in the whole system . according to one solution , the pressure which does not pass through the damping throttle opens the strongly biased check valve towards the opening side of the load holding valve as soon as it has overcome the biasing force . the upper part of the peak of the at least first amplitude of the pressure variations is no longer effective at the opening side of the load holding valve . a more easy decay of the other amplitudes is thus made possible . along the falling part of the first amplitude or the first amplitudes , the second check valve which is almost unbiased permits a rapid pressure reduction , too . the two check valves cooperate with the damping throttle during dampening operations ; they take over those parts of the pressure variations the damping throttle cannot cope with . not only the amplitudes of the pressure variations decay rapidly , but there is the additional important advantage that any viscosity - dependent delay in the controlled opening and closing of the load holding valve through the damping throttle is suppressed , as well as a delay that might be caused by a tight setting of the damping throttle for damping reasons . in another embodiment the strongly biased first check valve responds not only to the first amplitude , but to several initial amplitudes of the pressure variations to effect , together with the damping throttle , a very rapid decay of the pressure variations that are effective at the opening side . this is especially expedient for a cold and thus viscous pressure medium because in such a case the damping throttle works in an unsatisfactory way on account of its viscosity dependence . in yet another embodiment the first amplitude or amplitudes of the pressure variations reach the opening side of the load holding valve through the only slightly biased first check valve , with the damping throttle being bypassed , so that the controlled opening movement of the valve takes place immediately . however , the lower portion of the first amplitude or amplitudes is diminished through the second check valve which is biased in the opposite direction , which promotes the rapid decay of the amplitudes . the second check valve is expediently biased to only such an extent that it is responsive to the pressure reduction established for the controlled closing of the load holding valve , and bypasses the damping throttle so as to avoid any delay in the controlled closing movement , even in the case of a cold and viscous pressure medium . according to another embodiment plurality of initial amplitudes are made to decay rapidly due to the response of the second , strongly biased check valve at the opening side . another embodiment is simple from a constructional point of view , for spring - biased check valves are simple , reliable and inexpensive hydraulic members . the biasing force can be exactly adapted by means of the adjusting device to the operating conditions so as to effect an optimum damping action . according to another embodiment since the damping throttle can also be adapted to the operating conditions . the two check valves that cooperate with the damping throttle have the additional advantage that the damping throttle can be adjusted substantially independently of the course and extent of the pressure variations with a view to optimum damping . hence , there is no longer any compromise adjustment of the damping throttle as has so far been practiced in conventional control systems , where the capacity of the damping throttle has not been exploited fully . to effect a rapid decay of the pressure variations also at the side of the damping throttle which faces away from the opening side of the load holding valve , the pressure medium according to another embodiment flows constantly off via the bypass conduit . the course of the amplitudes of the pressure variations is so effectively disturbed by the throttle passage in the control pressure conduit and the disturbance throttle passage in the bypass conduit , i . e . also in front of the damping throttle , that they decay rapidly . the pressure variations are dampened through the joint action of three measures , namely , damping throttle , check valves and bypass duct , and the control device is especially suited for vibration - prone or strongly vibratory systems . since the two check valves take part in the damping action , the disturbance throttle passage need only be slightly greater than the throttle passage in the control pressure conduit , so that only an infinitely small amount of pressure medium flows off via the bypass conduit . of course , since the dampening effect via the bypass duct can only take place if a pressure medium volume is actually moved , the bypass conduit can connected to the working conduit containing the load holding valve or directly to the tank . these features are incorporated in other embodiments of the invention . in the last - mentioned case , a directional control valve with supply controllers and a blocked central position may be used . such a valve is per se critical in vibration - prone or greatly vibratory systems of this type because of its long transient response . in any case , the strong dampening effect which can be achieved by taking the above - mentioned measures permits the use of directional control valves equipped with supply controllers , which is of advantage to the control accuracy and the response characteristics of the control device during movement of the hydraulic motor in any direction . embodiments of the subject matter of the invention shall now be explained with reference to the drawing , in which : fig1 is a block diagram of a first embodiment of a hydraulic control device ; fig4 is a diagram regarding the embodiment of fig1 and fig3 respectively ; and a hydraulic control device s according to fig1 serves to control the movement of a consumer v with which a load f is moved . consumer v is , e . g ., the lifting or bent cylinder of a crane with which load f is moved . in the hydraulic motor v , a piston 1 divides a cylinder into two chambers 2 and 3 . each of chambers 2 and 3 is alternately connectable to a pressure source p and a tank t via a working conduit 4 , 5 and a directional control valve c . at least working conduit 4 has disposed therein a load holding valve h which contains a valve 6 with a valve member 7 which is brought by a spring 8 into the illustrated closing position in which conduit 4 is blocked . the pressure prevailing in a precontrol conduit 10 acts in the same direction , whilst the pressure prevailing in a precontrol conduit 9 acts in the opening direction . a conduit loop 11 bypasses valve 6 in working conduit 4 and contains a check valve 12 opening towards hydraulic motor v . a control pressure conduit 13 branches from the other working conduit 5 to the opening side 16 of valve 6 . control pressure conduit 13 contains a preferably adjustable damping throttle d . two conduit loops 14 and 15 bypass damping throttle d . conduit loop 14 contains a first check valve r1 including a valve member 17 and a biasing spring 18 , which opens towards the opening side 16 . the biasing force of spring 18 can be adjusted with the aid of the outlined adjusting device e . conduit loop 15 contains a second check valve r2 which opens towards the second working conduit 5 and contains a valve member 19 and , optionally , a weak biasing spring 20 . the two check valves r1 , r2 are differently biased . the bias of the second check valve r2 may even become zero . in practice , a weak spring is used for positioning valve member 20 in the shut - off position in the inoperative state . by contrast , the bias of the first check valve r1 is great . the force with which valve member 17 is biased by spring 18 has a value which is smaller than the pressure value of the pressure maximum that acts on valve member 17 and pertains at least to the first amplitude ( fig4 ) of the pressure variations of pressure pl , and is slightly greater than the pressure value of the pressure maximum of the subsequent amplitudes . fig4 illustrates the pressure curve over time which follows from pressure variations in control pressure conduit 13 ( pressure pl between damping throttle d and working conduit 5 ), which pressure variations are typical of the rapid establishment of a lowering movement of the load . for the movement of hydraulic motor v under load , load holding valve h is opened in a controlled way , e . g ., via directional control valve c , by exerting pressure on working conduit 5 until load holding valve h opens the passage of working conduit 4 . pressure pl follows , e . g ., the curve shown in full line . the pressure variations would have subsequent and very slowly decreasing amplitudes with a respective pressure maximum and a pressure minimum . if the pressure variations constantly acted on the opening side 16 of the load holding valve , the movement of hydraulic motor v would not be uniform . a decay of the pressure variations which is as rapid as possible is therefore necessary , at least at the opening side 16 ( pressure p2 in fig1 curve shown in broken line in fig4 ). the biasing force of spring 18 in fig1 is set to the value shown in broken line , which is below the pressure maximum of the first amplitude and just above the pressure maximum of the second and subsequent amplitudes . as a result of the action of damping throttle d and the first check valve r1 , the pressure increase in the first amplitude becomes effective at the opening side 16 with a phase shift . when the biasing force of the first check valve is reached , the latter opens , so that the peak of the first amplitude is cut off before pressure p2 approximately follows the pressure drop at the rear slope of the first amplitude . damping throttle d is here bypassed . at the beginning of the next amplitude , damping throttle d becomes effective , so that the increase in pressure at the opening side 16 is already less steep and the second amplitude is dampened . likewise , the damping throttle effects a rapid decay of the other amplitudes at the opening side . as a result , the lowering movement of hydraulic motor v takes place without any jerks and in a uniform way immediately after the beginning of the movement , namely , at the speed set on the directional control valve . in a modification of the embodiment illustrated in fig1 it is also possible to feed control pressure conduit 13 from an extra control pressure reservoir . in this case , however , pressure variations , e . g ., according to fig4 also arise when the opening pressure is rapidly established for stopping hydraulic motor v , as can often be observed in practice . the embodiment of fig2 differs from that of fig1 by the exchange of the bias of the two check valves used for bypassing damping throttle d . the first check valve r1 &# 39 ; which opens towards the opening side 16 is biased with a biasing force that may even become zero , i . e . with a very small biasing force , whereas the second check valve r2 &# 39 ; that opens in the opposite direction is biased with a great biasing force . when there are pressure variations ( fig5 ), this results in a dampening effect at the opening side 16 . the first amplitude of the pressure variations of pressure p1 follows the first amplitude of the pressure variation of pressure p2 at the opening side with the phase shift effected by damping throttle d . the maximum of the pressure value of the first amplitude of pressure pl is not reached by pressure p2 because of damping throttle d , but pressure p2 follows the falling slope of the first amplitude of pressure p1 . the biasing force of the second check valve r2 has a value ( broken horizontal line in fig5 ) which is higher than the minimum of the pressure value of the first amplitude of pressure p1 , but lower than the minimum of the pressure values of the subsequent amplitudes of pressure p1 . thus , when the value of the biasing force is not reached , the second check valve r2 opens before the first amplitude reaches its minimum pressure value . the bottom between the first and second amplitudes of the pressure variations is cut off , pressure p2 first remains at the level of the biasing pressure of the second check valve r2 &# 39 ; before damping throttle d becomes active during renewed rise in the second amplitude and causes pressure p2 to rise more gently . a rapid decay of the pressure variations at the opening side 16 is thus achieved . the bias on the second check valve r2 &# 39 ; is expediently adjusted such that the second check valve r2 &# 39 ; opens when the pressure in the pressure control conduit is relieved for the controlled closing of the load holding valve . this prevents a delay in the closing movement via the damping throttle . in the two above - described embodiments , it is also possible to set the biasing force on the more strongly biased check valve such that the tops or bottoms of several initial amplitudes are cut off and the damping throttle only dampens subsequent amplitudes . the embodiment of fig3 differs from the two above - described embodiments by an additional damping means in the control circuit of the load holding valve . this damping device consists of a bypass duct 23 which branches from control pressure conduit 13 at a junction 22 and which leads either to a connection point 24 in working conduit 4 or directly to tank t ( as outlined by the broken line at 25 ). a throttle passage d1 is provided between working conduit 5 and junction 22 . bypass conduit 23 contains a disturbance throttle passage d2 which is slightly greater than throttle passage d1 . the damping means helps to dampen the vibration amplitudes in that a pressure medium flows off constantly via the two throttle passages and disturbs the propagation of the vibration amplitudes , so that the latter will decay very rapidly . the damping means ensures the damping of pressure variations also during movement of hydraulic engine v in the load lifting direction and also during pressure variations when the load is stopped . the two check valves r1 and r2 are arranged and biased in the way shown for the embodiment illustrated in fig1 . however , it is also possible to use the reverse arrangement and bias of fig2 in the embodiment of fig3 . the effect is similar in the two cases . in all embodiments , damping throttle d can also be set tightly for achieving optimum damping . nevertheless , any delay in the controlled closing and opening movements of the load holding valve is prevented in a cold and thus viscous pressure medium .	5
the back rest of a motor vehicle seat has a shell 1 as an upholstery support , which may be made from , for example , a fiberglass reinforced , carbon - fiber reinforced , or similar plastic material . in the areas of its two forwardly projecting lateral edge zones 1 &# 39 ;, the shell 1 can be securely connected with respective metal side beams 100 . the lower end of each of these two side beams 100 is connected in a known manner by an articulated fitting with the seat portion of the vehicle seat . two steel inserts 2 and 3 formed as flat bars , whose end sections each carry an inwardly directed welded nut 4 , are embedded in the two lateral edge zones 1 &# 39 ; for the connection of the shell 1 with the side beams 100 . these welded nuts project of the material forming the shell 1 and receive the connection screws , by which means the side beams are connected with the shell 1 . the inserts 2 and 3 are each located in a covering 5 which forms an elastic - plastic intermediate layer . this covering 5 is made from silicon in the exemplary embodiment , and was applied to the inserts 2 and 3 before they were embedded in the lateral edge zones 1 &# 39 ;. the covering 5 forms a secure connection both with the insert and with the lateral edge zone 1 &# 39 ;. if the insert 2 experiences a deformation , for example a stretching in its longitudinal direction under a mechanical load , then its cross - section is reduced , as shown in exaggerated fashion in fig4 . if the covering 5 were not present then tears would form in the contact area between the insert and the lateral edge zone , whereby the connection would be compromised or completely fail . the covering 5 , in contrast , permits this relative movement between the insert 2 and the lateral edge zone 1 &# 39 ;, without tears forming in the material of the lateral edge zone 1 . in addition , the connection between the covering 5 and the lateral edge zone on one hand and between the covering 5 and the insert 2 on the other hand , is maintained in its entirety . this is possible due to the fact that the covering elastically and / or plastically deforms to the degree required . the shell 10 illustrated in fig5 which also serves as an upholstery support of the back rest of a motor vehicle seat ( not shown ), is made , like the shell 1 , from a fiberglass reinforced , carbon - fiber reinforced or similar plastic material . the forwardly projecting lateral edge zones 10 &# 39 ; of the shell 10 are securely connected with respective metal side beams 11 . under a load on the central portion of the shell 10 from the front , as can occur when caused by a seat user , for example , during an accident , the shell 10 experiences an elastic deformation such that the central area is displaced to the rear and , accordingly , the curvature of the shell in the lateral direction is increased , whereby the spacing of the side beams 11 from each other is also reduced . in the known vehicle seat having elastic shells as back rest upholstery supports , the energy stored in the shell due to this deformation thereof can be so great that the seat user experiences an impermissibly large acceleration in an extremely short time period resulting from the return of the shell into its original position . in the shell 10 , this is prevented by a dampening element 12 , which , in the exemplary embodiment , is embedded in the shell 10 in the shoulder area . the dampening element 12 extends in the lateral direction of the back rest . its shape , size and arrangement , however , do not need to be selected as shown in fig5 because the only thing that really matters is that the dampening element , or , in case a plurality of dampening elements are provided , the dampening elements , are deformed with the deformation of the shell 10 and thereby irreversibly converts energy into deformation work of the relevant seat components . in the exemplary embodiment the dampening element 12 is formed by a flat bar consisting of a piece of steel extending in the lateral direction of the back rest from one side zone to the other . the dampening element 12 therefore experiences a plastic deformation in the form of a bending , and does so when the shell 10 is deformed under the load from the seat user , and also when the shell 10 would tend to return back into its original position . the dampening element 12 therefore reduces the bending of the shell 10 and above all prevents it from springing back toward the original position or at least slows such movement down significantly . of course , a flat bar is not the only shape that can be considered as a dampening element 12 . profile bars and plane - forming elements , such as those formed in the manner of an expanded metal mat , are also suitable . to prevent tears from forming in the shell 10 due to the relative movement between the shell 10 and the dampening element 12 , the dampening element 12 is provided with a covering 15 forming an intermediate layer , which in the exemplary embodiment consists of an elastic - ductile plastic or caoutshouc that forms a secure connection both with the dampening element 12 and with the shell 10 , and has an adequate deformability for the relative movements that take place . in the example illustrated in fig7 the back rest of a motor vehicle seat has a shell 101 made from plastic as an upholstery support , which is provided with side pieces 102 which expand the width and are drawn forward in the area supporting the shoulders of the seat user . the lateral edges of the shell 101 beneath these side pieces 102 project forward . these lateral edges are connected with metallic side beams ( not shown ), which are pivotably connected with the seat frame by means of respective articulated fittings ( also not shown ). a boundary line designated with reference numeral 103 encloses the area of the shell 101 in which at least one dampening element is provided , because in this area the shell can be elastically deformed so severely by the seat user during an accident , that at the conclusion of this deformation the seat user could be thrown forward by the back rest unless measures are taken to dampen the return deformation . however , the arrangement of at least one dampening element in the area supporting the shoulders of the seat user and / or in the area beneath the area serving to support the lower back is particularly advantageous . the latter area lies between the level of the upper edge of the pelvis and the point of the hip . both in the lower edge zone of the area supporting the shoulders of the seat user and in the area between the level of the upper edge of the pelvis and the level of the point of the hip , these areas of the shell 101 in the exemplary embodiment are respectively laminated together with dampening rails 104 , 105 comprised of a soft steel , which , as shown in fig7 extend horizontally over the entire width of the shell area lying between the forwardly projecting edges . the two dampening rails 104 and 105 have a thickness of about 6 mm and a width measured from top to bottom of 20 to 30 mm . under normal operational loads the two dampening rails 104 and 105 do not experience any plastic deformation . in an accident , however , the elastic deformation of the shell 101 can become so large that the dampening rails 104 and 105 experience a plastic deformation . consequently , a return deformation of the shell toward its original position has the result that the dampening rails 104 and 105 are again plastically deformed . this fact suppresses the return deformation of the shell 101 sufficiently that the result can no longer cause a dangerous forward acceleration of the seat user , since the dampening rails 104 and 105 also significantly reduce the path of the return deformation . as shown in fig8 through 11 , profile bars 106 , 107 , 108 and 109 can also be used in place of the dampening rails 104 and 105 , which profile bars have a semi - circular cross - section , a bracket - shaped cross - section , a circular cross - section and an angular cross - section . particularly with band or flat - shaped dampening elements , it is possible to extend these elements into the raised edges of the shell , thereby reinforcing these shell edges . although only preferred embodiments are specifically illustrated and described herein , it will be appreciated that many modifications and variations of the present invention are possible in light of the above teachings and within the purview of the appended claims without departing from the spirit and intended scope of the invention .	8
referring now to the drawings in more detail , numeral 10 designates the device of the present invention of fig1 . the device 10 comprises a needle guard 12 , a barrel casing 14 , a syringe barrel 16 , a plunger 18 , and a needle assembly 20 . the needle guard 12 comprises a first , nose portion 22 , a second , middle portion 24 , and a third , inner portion 26 . as can be seen in the drawings , the second portion 24 is of a greater overall diameter than the nose portion 22 , while the portion 26 is still of a greater diameter than the middle portion 24 . the nose portion 22 is provided with an annular groove 28 which is adapted for engaging an inner outwardly extending annular ridge formed on the interior of the medication bottle , when the nose portion 22 is inserted within the bottle neck . when used in drawing of medicine from the other medication bottles , which are not equipped with the inner ridge , the nose portion 22 is adapted to contact the bottle neck on the exterior thereof by a forwardmost end 30 of the portion 22 . the needle guard 12 is formed substantially hollow and receiving a syringe barrel 16 with an associated needle assembly 20 therein . a central opening 32 formed in the nose portion 22 to allow a needle 34 to pass therethrough during an injection or drawing of medication . the middle portion 24 of the needle guard 12 is telescopically received within a part of the hollow casing 14 , extending outwardly from the casing 14 to completely cover the needle assembly 20 when the syringe 10 is not in use . an outwardly extending angularly inclined inner shoulder 36 is formed on the middle portion 24 at an area of connection between the portion 24 and an integrally formed portion 26 . a matchingly inclined inwardly extending shoulder 38 is formed in the body of the casing 14 to match the angle of inclination of the shoulder 36 . the shoulder 36 and 38 abut each other and prevent disengagement of the needle guard 12 from the casing 14 . integrally formed on an exterior wall of the middle portion 26 is a locking tab 40 which is supported on the wall by a support member 42 . the locking tab 40 extends through an opening 44 formed in the thickness of the casing 14 to a distance slightly above the plane of the outer wall of the casing 14 . the support member has a spring - like qualities , allowing to depress the locking tab 40 , when necessary . however , once the tab is released , the support member 42 will &# 34 ; spring back &# 34 ; to its original position and force the locking tab 40 through the opening 44 . as will be appreciated , it is impossible to move the needle guard 12 forwardly or inwardly when the locking tab 40 is in the position shown in fig1 . however , when the locking tab 40 is depressed by the user &# 39 ; s finger to recede into the opening 44 and align the top of the locking tab 40 with the interior wall of the casing 14 , a respective movement between the needle guard 12 and the casing 14 is permitted . the locking tab 40 is formed from a resilient material which has inherent properties of returning to its original condition . such material can be a plastic , and the entire needle guard 12 can be manufactured from that material . the interior wall of the casing 14 is provided with a locking tab groove 45 , within which the tab 40 can slide in a co - axial movement in relation to the axis of the device 10 . formed at about 90 to the opening 44 is another groove 46 formed in the interior wall of the casing 14 . the groove 46 is adapted to receive in a sliding movement and engage a runner 47 which is formed on the outer surface of the needle guard portion 26 and extends outwardly therefrom . engagement of the runner within the groove 46 prevents misalignment of the locking tab 40 from the locking tab groove and insures that the locking tab 40 will always &# 34 ; spring out &# 34 ; through the opening 44 anytime the needle guard 12 is fully extended , such as when the device 10 is not in use . the needle guard 12 is further provided with a transverse shoulder 48 which forms a contact surface against which a coil spring 50 urges . the tension spring means 50 is mounted in a surrounding relationship about the exterior of the syringe barrel 16 , with the second end of the spring means 50 urging against an inner surface of a flange plate 52 , as will be described in more detail hereinafter . the tension spring means 50 insures that the needle guard 12 is continuously urged forward , covering the needle assembly 20 unless two safety mechanisms are overcome . the first mechanism is the locking tab 40 , while the second mechanism is application of an inward pressure on the end 30 of the nose portion 22 . only when the two conditions are met , that is when the locking tab is depressed and the pressure is applied to the nose portion 22 , the spring 50 can be moved into compression and allow movement of the needle guard 12 telescopically into the interior of the casting 14 to permit injection by the needle 34 or drawing of a medicine . mounted on the end of the casing 14 opposite the needle guard 12 is a flange plate 52 which is fixedly attached to the casing 14 , or formed integrally therewith . the flange plate 52 is provided with an opening 54 through which the piston 18 extends . a sealing plate 56 is &# 34 ; snapped &# 34 ; into a specially formed recess 58 in the flange 52 , the sealing plate 56 being provided with a plurality of pins 60 which extend at a right angle to the sealing plate 56 . the pins 60 are formed with angularly oriented projections 62 which &# 34 ; snap &# 34 ; into matching openings formed in the body of the flange plate 52 . those openings are formed with matching angular grooves , or cuts into which the pins 60 snap , without any possibility of disengagement . an end plate 64 is formed on the end of the syringe barrel 16 and is received within an inner groove 66 formed on the interior surface of the flange 52 . the end plate 64 also snaps into the groove 66 and thereby attaches the barrel 16 to the casing 14 . the piston 18 moves axially in a sliding movement within the barrel 16 , the piston 18 carrying a piston sealing member 65 on its forwardmost end . the sealing member 65 is made of a size to tightly engage the interior walls of the barrel 16 and create vacuum for drawing of medicine from a medicine bottle . the sealing member 65 insures that no air is admitted into the needle 34 from the interior of the syringe barrel 16 . in operation , the user removes the device 10 from its sterile packaging , wherein the device 10 is kept in a locked position illustrated in fig1 until it is ready to use . the nurse then compresses the tab 40 and moves the nose 22 in contact with a neck of a medication bottle . by slightly pushing against the force of the spring 50 , the user allows the needle guard 12 to move inwardly , telescopically in relation to the casing 14 and allows the sharp needle 34 to puncture the cap of the medication bottle 28 . a continuous pressure on the flange 52 will cause the needle 34 to further penetrate into the interior of the medication bottle . during that time the tab 40 is fully compressed and travels within the locking tab groove 45 inside the casing 14 . during that time the fingers of the user are positioned at the base of the syringe , so as not to accidentally cover the opening 44 . the spring 50 is fully compressed , and the user operates the plunger 18 moving it outwardly from the syringe barrel to allow introduction of medication into syringe barrel 16 . once the necessary amount is withdrawn , which can be detected by the comparison with the measuring indicia 70 , the suer removes the safety syringe 10 from the medication vial taking care not to cover the opening 44 . the spring 50 then forces the needle guard 12 outwardly , again covering the needle 34 and automatically locking the needle guard 12 in a first , extended position , such that the locking tab 40 extends through the opening 44 . when the user contacts the skin of the patient , so as to give an injection , he again compresses the locking tab 40 and by holding and pressing the casing 14 towards the skin of the patient , causes the needle guard 12 to move inwardly into the casing 14 and allows injection of the needle 34 into the patient . continuous pressure inward , while holding the casing 14 , forces the needle 34 into the body tissue of the patient . the hands of the user are then reversed , as he prepares to operate the plunger 18 again . one hand holds the syringe at its base , while the user reaches up with the other hand and pulls back the plunger 18 , aspirating to make sure that the needle 34 is not in the patient &# 39 ; s blood vessel , and then proceeds by compressing the plunger 18 towards the barrel casing 14 , holding a thumb on the plunger end plate 72 , and the second and third fingers around the flange plate 52 of the barrel casing 14 . once the injection of medication is accomplished by pushing the plunger 18 in the fashion described above , the user again pulls on the casing 14 , withdrawing it from the patient , while simultaneously the spring 50 extends again and forces the needle guard 12 into a position completely covering the needle guard 34 . as will be appreciated , at no time does the needle 34 become exposed to the air , thus avoiding a possibility of puncturing the skin of the user with an infected needle . turning now to the embodiment of fig2 an alternative resilient elastic spring means for use with the safety syringe needle of the present invention will be discussed . as can be seen in fig2 the syringe needle 100 , similarly to the syringe needle 10 is provided with a needle guard 102 , a casing 104 , a syringe barrel 106 , and a plunger 108 . the needle guard 102 is formed with a nose portion 110 which has a central opening 112 therein , through which a needle 114 travels during injection or drawing of a medicine . the needle guard 102 has a middle portion 116 and a third , inner portion 118 . an interior chamber 120 is formed in the casing 104 adjacent a first end 122 thereof . a pair of securing members 124 and 126 are formed on the interior of the surface 104 , each made in the form of an inwardly turned hook , to which one end of an elastic means 130 and 132 , respectively is secured . the elastic means 130 and 132 each can be made in the shape of an elongated flexible resilient band , made from such material as , for example , latex , or any other material having similar physical properties . it is necessary that the material from which the bands 130 and 132 are made be resilient and have an inherent property to return to its compressed state when not expanded , or stretched . the second end of the tension members 130 and 132 is engaged by hook - shaped band securing member 134 and 136 , respectively , formed on the exterior of the needle guard 102 . as can be seen in the drawings , the band securing members 134 and 136 curve inwardly from the middle portion 18 towards the center of the device 100 . the tension bands 130 and 132 can be simply wrapped over the hooks 134 and 136 and retained therein . as will be appreciated , the bands 130 and 132 are slightly stretched , so that in their tendency to return to their original size they will pull the needle guard 102 outwardly and forwardly from the casing 104 . when the needle guard 102 is pushed into the casing 104 by engagement of the nose portion 110 either with the skin of the patient or the medication bottle , the bands 130 and 132 are allowed to slightly expand . the bands 130 and 132 , are made sufficiently narrow to prevent them from occupying too much space within the opening 120 and interfering with the smooth movement of the needle guard 102 within the syringe barrel 104 . although the embodiment of fig2 illustrates the use of a pair of bands 130 and 132 , it will be appreciated that the number of the bands can be changed , as long as the equal force is applied to diametrically opposite sides of the needle guard 102 during use of the device 100 . the remainder of the structure of the device 100 is similar to the structure of the syringe 10 , in that it provides for the use of one , or more locking tabs 140 extending through an opening 142 formed in the casing 104 . similarly , the attachment of the casing 104 with the flange plate 144 is accomplished by engagement of an end plate 146 of the syringe barrel 106 within a groove 148 of the flange 144 . a sealing plate 150 is &# 34 ; snapped &# 34 ; into the corresponding groove formed in the outer surface of the flange plate 144 to seal that end of the device 100 . a runner 105 and groove 107 arrangement is similarly made in the needle guard 102 and the casing 104 , respectively , to ensure alignment of the locking tab 140 with the opening 142 . the operation of the device 100 is similar to the operation of the device 10 in all other respects , except that in this embodiment the abutting of runner 105 against the end of the runner groove 107 is the means for preventing disengagement of the needle guard 102 from the casing 104 and is also a means for correctly positioning the locking tab 140 in co - alignment with the opening 142 whenever the needle guard 102 is fully extended . the devices 10 and 100 can be made from clear , transparent plastic , with the exception of the needles 34 and 114 , which are made of metal . the spring 50 can be made from steel or other resiliently strong material , while the bands 130 and 132 can be made from other materials than latex . many other changes and modifications can be made within the design of the present invention without departing from the spirit thereof . i , therefore , pray that my rights to the present invention be limited only by the scope of the appended claims .	0
priority korean patent application no . 2001 - 43151 , filed jul . 18 , 2001 and priority korean applicaton no . 2001 - 78965 , filed dec . 13 , 2001 are hereby incorporated in their entirety by reference . the present invention will now be described in detail with respect to preferred embodiments as illustrated in the attached drawings . [ 0035 ] fig1 illustrates a preferred embodiment of a cavity - preventing type reactor 8 according to the present invention . the reactor 8 is preferably cylindrical and is preferably divided into an introduction part 10 and a reaction part 20 . the introduction part 10 may be equipped with a reactant inlet 11 through which a reactant is fed into the whole reactor 8 . the reaction part 20 may be equipped with a flow path 21 through which a reactant flows from the introduction part 10 to the reaction part 20 . between the introduction part 10 and the reaction part 20 , there are preferably provided a wall 32 and a cavity - preventing structure 30 . as a result , the wall 32 and the cavity preventing structure 30 prevent any cavity 34 that may have developed in the introduction part 10 from extending into the reaction part 20 when the reactor 8 is under rotation . the cavity - preventing structure 30 is equipped with flow paths 31 through which reactant flows from the introduction part 10 to the reaction part 20 . [ 0037 ] fig2 a - 2 e illustrates a series of diagrams showing the preferred process steps for fabricating a preform for a plastic optical fiber using the preferred embodiment of the present invention depicted in the fig1 . when the reactor 8 is rotated , a cavity 34 develops in reactant 36 from the unoccupied space as shown in fig2 b . as the rotational force ( i . e . speed ) is increased , cavity 34 extends ( i . e . downward ) to the top of cavity - preventing structure 30 as shown in exemplary fig2 c . with further increase in the rotational force , cavity 34 becomes cylindrical as reactant 36 is forced to the sidewalls of the introduction part 10 as shown in fig2 d . however , the cavity 34 does not extend to the reaction part 20 because of the cavity - preventing structure 30 . as the reactant 36 in the reaction part 20 is polymerized under the continuous rotation of the reactor 8 , volume shrinkage occurs . by introducing an additional volume of reactant — which is equal to the amount of the shrunken volume , the reactant 36 flows from the introduction part 10 to the reaction part 20 through flow paths 31 of cavity - preventing structure 30 as shown in fig2 e . as can be seen in fig2 e , the flow of reactant 36 is forced back to the center of reactor 8 as it enters into reaction part 20 . as a result , the cavity in the introduction part 10 become larger and no cavity is formed in the reaction part 20 . it is preferable to pressurize the reactant in the introduction part 10 with an inert gas in order to assist the reactant flow from the introduction part 10 flow into the reaction part 20 . a cavity - preventing type reactor according to the present invention is not limited to the reactor 8 depicted in fig1 . any reactor may be used on the condition that a cavity that developed in an introduction part 10 doesn &# 39 ; t extend into a reaction part 20 and that the reactant in the introduction part 10 flows into the reaction part 20 . for example , a diameter of a reaction part and a diameter of an introduction part may be the same as depicted in the fig1 or may be different from each other . the shape of a cavity preventing structure may be cylindrical as depicted in fig1 or may be plate - like . the number of cavity preventing structures may be one as depicted in fig1 or may be 2 or more . an introduction part may exist above a reaction part as depicted in fig1 or vice versa . it is also possible that a reaction part may lie along with the axis of rotation and is encircled with an introduction part . fig3 ( a ) and 3 ( b ) illustrate cross - sectional views of another preferred embodiment of the present invention . fig3 ( a ) shows a reactor 8 equipped with two cavity - preventing structures 30 having the same structure as depicted in fig1 . fig3 ( b ) shows a reactor 8 equipped with alternative exemplary plate - like cavity - preventing structures 38 or 32 between an introduction part 10 and a reaction part 20 . the structure may have several flow paths 31 on the peripheral part of the plate as shown in plate - like cavity - preventing structure 38 or have a single flow path 21 as shown in plate - like cavity - preventing structure 32 . the number and type of plate - like cavity - preventing structures may be any combination of the above or some other appropriate geometric arrangement . the aforementioned embodiments are presented to exemplify the cavity - preventing type reactor of the present invention only , and are not as intended to be limiting of the scope of the present invention . hereinafter , a fabrication method of a preform for a plastic optical fiber , using a cavity - preventing type reactor 8 according to the present invention is disclosed in detail . in the present invention , a reactant 36 is fed into the reaction part 20 of the cavity - preventing type reactor 8 , and then is polymerized during the rotation to provide a preform for a plastic optical fiber . at this time , refractive index distribution in a radial direction of a preform for a plastic optical fiber is regulated by controlling the composition of the reactant 36 introduced to the reaction part 10 and the introduction part 20 , the rotation speed of a reactor , etc . preferred embodiments of fabrication methods of a preform for a plastic optical fiber , wherein the cavity - preventing type reactor is used , are explained hereinafter . in the following embodiments , when particular things items are not explicitly referenced , the words such as ‘ reactant ’ should be interpreted as monomer ( s ), prepolymer ( s ) or polymer - dissolving monomer ( s ) containing a thermal or photo initiator and a chain transfer agent , which are available in polymerization reaction . in a first preferred embodiment according to the present invention , the refractive index gradient of a reactant 36 filling a reaction part 20 may be made to be different from that of a reactant filling an introduction part 10 by regulating the ratios of compositions of monomers . in a first step , two kinds of reactants 36 having the different ratios of composition of monomers are preferably prepared using two or more kinds of monomers having different refractive indexes . then , a reaction part 20 of a reactor 8 is preferably filled with a reactant 36 having a low refractive index , and an introduction part 10 of a reactor 8 is thereafter filled with a reactant 36 having a high refractive index . finally , the reactant in the reaction part 20 is polymerized while the reactor 8 is rotated in at either a constant or variable speed . at this time , volume shrinkage occurs in the reaction part 20 as reaction progresses and simultaneously , the reactant 36 having a high refractive index flows from the introduction part 10 to the center of the reaction part 20 . thus , the volume shrinkage is transferred to the introduction part 20 and the refractive index of the center of the reaction part becomes high . because volume shrinkage occurs during the polymerization process , the reactant introduced to the center of the reaction part diffuses into polymer or oligomer in the reaction part 20 to provide the preform with continuous refractive index gradient . as a result , when polymerization is completed , a preform for a plastic optical fiber with a continuous refractive index gradient in a radial direction is provided . in a second preferred embodiment according to the present invention , a reaction part 20 and an introduction part 10 of a reactor 8 are filled with only one kind of reactant . in a first step , a monomer having a low refractive index and high density is preferably mixed with a monomer having a high refractive index and low density to provide a reactant the reactant is then fed into a reaction part 20 and an introduction part 10 of a cavity - preventing type reactor 8 . thirdly , the reactant in the reaction part is thermally polymerized without rotation . when polymerization is performed to a certain degree , the reactor preferably begins rotating at a constant or variable speed until polymerization is completed . finally , a preform for a plastic optical fiber with a continuous refractive index gradient in a radial direction is provided . thus , even if the reaction part 20 and the introduction part 10 are filled with only one kind of reactant , a monomer having a low refractive index and high density may be diffused to the outer part of the reactor under the rotation of a reactor to provide a preform for a plastic optical fiber , with a refractive index distribution , wherein a refractive index corresponding to the central part of the perform is higher than that corresponding to the outer part of the perform . according to a third preferred embodiment of the present invention , prior to forming a core part , by filling partly the reaction part 20 with a reactant 36 and polymerizing the reactant 36 by rotating the reactor 8 , a clad part is preferably formed . in a first step , a reactant having a low refractive index is fed into reaction part 20 of a reactor 8 and is polymerized under the rotation at a constant speed to be formed as a clad part having desired thickness . secondly , when the clad part is completely polymerized to be classified , the reaction part 20 and the introduction part 10 are respectively filled with different monomer mixtures distinguished from each other in mixing ratio of monomers as in the first preferred embodiment of the present invention or only a single monomer mixture in the same manner as in the second preferred embodiment of the present invention . finally , the reactant is polymerized under the rotation in a constant or variable speed to provide a preform for a plastic optical fiber , with a continuous refractive index gradient in a radial direction . a fourth preferred embodiment of the present invention , features a first step , wherein crushed fragments of a polymer having a lower refractive index and higher density than those of a monomer mixture are preferably swelled or dissolved in the monomer mixture . in a second step , the reactant of the polymer - dissolving monomers is fed into a reaction part 20 and an introduction part 10 of a reactor 8 , and then is polymerized . when the reactant in the reaction part 20 is polymerized under the rotation of the reactor , the dissolved polymer having a higher density than that of the monomer mixture moves to the outer region of the reactor to form a clad part . a clad part may be formed by only one reactant introduction ; the volume shrinkage is significantly reduced , such that the fabrication process becomes more stable . in this preferred embodiment of the present invention , a reaction part and an introduction part are respectively filled with different monomer mixtures distinguished from each other in mixing ratio of monomers in the same manner as the first preferred embodiment of the present invention or with only one monomer mixture in the same manner as the second preferred embodiment of the present invention . in a fifth preferred embodiment of the present invention , a monomer mixture and a prepolymer are used together as reactants . in a first step , the prepolymer , which has a lower refractive index and higher density than those of the monomer mixture , is prepared . secondly , the prepolymer is mixed into the monomer mixture , and then is fed into reaction part 20 and introduction part 10 . alternatively , a reaction part may be party filled with the prepolymer , and then the remainder of the whole reactor is filled with the monomer mixture . thirdly , polymerization is carried out under the rotation of the reactor at a constant or variable speed to provide a preform for a plastic optical fiber with a continuous refractive index gradient in a radial direction . at this time , a composition ratio of the mixture filling the introduction part 10 may be controlled differently from that of the mixture filling the reaction part 20 as in the first preferred embodiment of the invention . the viscosity of a prepolymer is preferably 500 to 500 , 000 cps ( at 25 ° c . ), more preferably 1 , 000 to 10 , 000 cps ( at 25 ° c .). if viscosity of a prepolymer is less than 500 cps , it is difficult to obtain effective prepolymer addition . if viscosity of a prepolymer is more than 500 , 000 cps , many bubbles may be formed in a preform and it may take a long time to introduce it to the reactor . the fifth preferred embodiment of the present invention , wherein a prepolymer is used , has the following advantages , which are similar to those of the fourth preferred embodiment of the present invention , wherein a polymer is dissolved : a clad part can be formed using only one reactant introduction ; the volume shrinkage is significantly reduced , such that the fabrication process becomes more stable . in a sixth preferred embodiment of the present invention , a reactor is preferably rotated while set at an angle from − 90 to 90 degrees relative to the horizontal surface ( see fig5 ) in order to eliminate the refractive index gradient in an axial direction of a perform , which is caused by gravity . [ 0065 ] fig4 illustrates a cross - sectional view showing a cavity 34 formed in a reactor 8 rotating about a vertical axis z . in a cavity - preventing type reactor , as the reactant 36 in a reaction part 20 is polymerized , its volume is shrunk to provide an imaginary meniscus . if this imaginary meniscus is taken into account , we can estimate the amount of the reactant 36 that flows from an introduction part 10 to a reaction part 20 . this estimation can also provide a standard for a refractive index distribution profile and uniformity of refractive index gradient in an axial direction of a preform . the meniscus of the cavity 34 of reactor 8 preferably satisfies the formula : z + z 0 = ( ω 2 2  g )  r 2 ( 1 ) wherein ω is a rotation speed ( rad / s ); g is a gravitational acceleration constant ( about 9 . 8 m / s 2 ); and z 0 is a height ( m ) from the bottom of the imaginary meniscus to the real bottom of the reactor . if a 20 % volume shrinkage occurs when the reaction part 20 of the reactor 8 is filled with a monomer mixture , z 0 may be induced according to the formula : z 0 = ω 2  r 2 10  g - l ′ 2 ( 2 ) a radius r 1 at z = 0 and a radius r 2 at z = l ′ may be calculated using the formula : r 1 = 2  g ω 2  z 0   r 2 = 2  g ω 2  ( l ′ + z 0 ) ( 3 ) by using these radii r 1 and r 2 of the above formula 3 , for example , the condition under which r 2 − r 1 & lt ; 0 . 01r is satisfied is calculated as the formula : ω 2 & gt ; 223 . 6  gl ′ r 2 = 223 . 6  gl · sin   θ r 2 ( 4 ) as seen in the above formula 4 , not only raising the rotation speed ( ω ) of the reactor , but also reducing the height l ′ along to the gravitational direction , contributes to obtaining uniformity of a refractive index gradient in an axial direction . in order to reduce the height l ′, a reactor can be inclined as depicted in the fig5 wherein the smaller the angle θ , the smaller the height l ′. when the angle θ is sufficiently small , uniformity of refractive index gradient in an axial direction can be obtained even with a small rotation speed . in all the preferred embodiments of the present invention , a cavity due to volume shrinkage generated by polymerization is formed only in an introduction part 10 . thus , the volume of reactant 36 charged into the introduction part 10 must be regulated to secure the condition that when volume shrinkage is completed , the diameter of the bottom of the cavity 34 formed in the introduction part 10 must be less than that of the cavity preventing structure 30 in order to prevent the cavity 34 from extending into the reaction part 20 . furthermore , it is preferable to pressurize the introduction part 10 of reactor 8 with inert gas such as argon . such pressurization has the following advantages : reactant flow from the introduction part 10 to the reaction part 20 is aided , thus preventing a cavity 34 from forming in the reaction part 20 of a reactor 8 ; the polymerization reaction is made more stable ; and the boiling temperature of monomer is raised . thus , a reaction may be carried out at a higher temperature , allowing for shortened reaction time , and allowing for the reaction to be carried out without formation of bubbles due to vaporization of unreacted substances . at this time , if a cavity - preventing type reactor is made of fragile material such as glass , quartz , ceramics or plastics and so forth , it is difficult to pressurize inner part of the reactor more than 4 bar . however , if the outer part of the cavity - preventing type reactor is pressurized at the same time , the inner pressure of a reactor may be raised to 10 bars . [ 0075 ] fig6 illustrates a cross - sectional view of an apparatus used for pressurizing both the inner part and the outer part of a cavity - preventing type reactor . the apparatus of fig6 may be employed using the following procedure : firstly , a rotation reaction apparatus is preferably connected to an argon gas bomb through a quick connector 1 which is positioned in the upper part of the apparatus ; secondly , a height - controllable lid 2 is raised ; thirdly , argon gas is fed through a pressurization path 3 to an inner part of a cavity - preventing type reactor 5 and an inner part of the reaction apparatus 6 . in a fourth step , the lid 2 is lowered and an o - ring ( 4 ) is pressed to seal the reaction apparatus . thus , inner and outer parts may be simultaneously pressurized . according to the present invention , in principle , a cavity 34 originating due to volume shrinkage in a reaction part 20 would not be formed . however , if a radical polymerization , wherein a monomer can be vaporized due to the heat generated during the radical polymerization , is carried out in a reaction part , the vaporized gas bubbles may gather together to form a cavity in the reaction part 20 under the rotation of a reactor 8 . as mentioned above , pressurizing the reaction part 20 prevents bubbles from collecting in the reaction part 20 , and thus a cavity - free preform may be fabricated . in all of the preferred embodiments of the present invention , polymerization in a reaction part may be carried out by using either heat or uv light . [ 0077 ] fig7 illustrates a cross - sectional view of a reaction apparatus wherein uv light is used for polymerization . when uv light is used in polymerization , a photo initiator is preferably used instead of a thermal initiator to start the reaction . there are two significant advantages to using uv photopolymerization : 1 ) since there is no need to raise the temperature of a reactor , the vaporization of a monomer may be prevented thereby preventing formation of a cavity ; and 2 ) since only the reaction part 20 is exposed to the uv light , there is no possibility that the reactant in the introduction part 10 may become classified and stop the flow of the reactant 36 to the reaction part 20 . thus , the uv photopolymerization , provides a more stable fabrication process for creating cavity - free preforms for plastic optical fiber . in all of the preferred embodiments of the present invention , in order to obtain an improved refractive index profile , diverse changes may be given to rotation speed of the reactor 8 . for example , diverse changes in the rotation speed may be the simple repetition of rotating and stopping the reactor 8 , according to a sinusoidal function or a function having a variable period , phase and / or amplitude . in general , the preferred radius of the preform is about 1 to 10 cm in order to make heat transfer for polymerization easy . the preferred length of the preform is 100 cm or less in order to achieve a proper thermal drawing . in the foregoing , two kinds of monomers having different refractive index used in the present invention are preferably selected from the group consisting of methylmethacrylate , benzylmethacrylate , phenylmethacrylate , 1 - methylcyclohexylmethacrylate , cyclohexylmethacrylate , chlorobenzylmethacrylate , 1 - phenylethylmethacrylate , 1 , 2 - diphenylethylmethacrylate , diphenylmethylmethacrylate , furfurylmethacrylate , 1 - phenylcyclohexylmetha - crylate , pentachlorophenylmethacrylate , pentabromophenylmetha - crylate , styrene , tfema ( 2 , 2 , 2 - trifluoroethylmethacrylate ), pfpma ( 2 , 2 , 3 , 3 , 3 - pentafluoropropylmethacrylate ), hfipma ( 1 , 1 , 1 , 3 , 3 , 3 - hexafluoroisopropylmethacrylate ) and hfbma ( 2 , 2 , 3 , 3 , 4 , 4 , 4 - heptafluorobutylmethacrylate ). homopolymers or copolymers may be used as the polymers in the fourth preferred embodiment of the present invention . the homopolymer may be polymerized from a monomer such as methylmethacrylate , benzylmethacrylate , phenylmethacrylate , 1 - methylcyclohexylmethacrylate , cyclohexylmethacrylate , chlorobenzylmethacrylate , 1 - phenylethylmethacrylate , 1 , 2 - diphenyl - ethylmethacrylate , diphenylmethylmethacrylate , furfurylmethacrylate , 1 - phenylcyclohexylmethacrylate , pentachlorophenylmethacrylate , pentabromophenylmethacrylate , styrene , tfema ( 2 , 2 , 2 - tri - fluoroethylmethacrylate ), pfpma ( 2 , 2 , 3 , 3 , 3 - pentafluoropropylmetha - crylate ), hfipma ( 1 , 1 , 1 , 3 , 3 , 3 - hexafluoroisopropylmethacrylate ) and hfbma ( 2 , 2 , 3 , 3 , 4 , 4 , 4 - heptafluorobuthylmethacrylate ). the copolymer may include one or more selected form the group consisting of , for example , methylmethacrylate ( mma )- benzyl - methacrylate ( bma ) copolymer , styrene - acrylonitrile copolymer ( san ), mma - tfema ( 2 , 2 , 2 - trifluoroethylmethacrylate ) copolymer , mma - pfpma ( 2 , 2 , 3 , 3 , 3 - pentafluoropropylmethacrylate ) copolymer , mma - hfipma ( 1 , 1 , 1 , 3 , 3 , 3 - hexafluoroisopropylmethacrylate ) copolymer , mma - hfbma ( 2 , 2 , 3 , 3 , 4 , 4 , 4 - heptafluorobuthylmethacrylate ) copolymer , tfema - pfpma copolymer , tfema - hfipma copolymer , styrene - methylmethacrylate ( sm ) copolymer and tfema - hfbma copolymer . the prepolymer used in the fifth preferred embodiment of the present invention may be made from one or more monomers selected from the group consisting of methylmethacrylate , benzylmethacrylate , phenylmethacrylate , 1 - methylcyclohexylmetha - crylate , cyclohexylmethacrylate , chlorobenzylmethacrylate , 1 - pheny - lethylmethacrylate , 1 , 2 - diphenylethylmethacrylate , diphenylmethylmethacrylate , furfurylmethacrylate , 1 - phenylcyclohexylmethacrylate , pentachlorophenylmethacrylate , pentabromophenylmethacrylate , styrene , tfema ( 2 , 2 , 2 - trifluoroethylmethacrylate ), pfpma ( 2 , 2 , 3 , 3 , 3 - pentafluoropropylmethacrylate ), hfipma ( 1 , 1 , 1 , 3 , 3 , 3 - hexafluoro - isopropylmethacrylate ), and hfbma ( 2 , 2 , 3 , 3 , 4 , 4 , 4 - heptafluorobutylmethacrylate ). the thermal initiator which is introduced for thermal polymerization may include , for example , 2 , 2 ′- azobis ( iso - butyronitrile ), 1 , 1 ′- azo - bis ( cyclohexanecarbonitrile ), 2 , 2 ′- azobis ( 2 , 4 - dimethylvaleronitrile ), 2 , 2 ′- azobis ( methyl - butyro - nitrile ), acetyl peroxide , lauroyl peroxide , benzoyl peroxide , tert - butyl peroxide , tert - butyl hydroperoxide , azo - tert - butane , azo - normal - butane and tert - butyl peracetate . the photo initiator that is introduced for photopoly - merization may include , for example , 4 -( p - tolylthio ) benzophenone , 4 , 4 ′- bis ( dimethylamino ) benzophenone and 2 - methyl - 4 ′-( methylthio )- 2 - morpholino - propiophenone , 1 - hydroxyl - cyclohexyl - phenyl - ketone . the chain transfer agent that is introduced for regulating molecular weight may include , for example , n - butyl mercaptan , lauryl mercaptan and dodecyl mercaptan . a preform for a plastic optical fiber fabricated by the above process may be subjected to a thermal drawing to transform it to a graded index plastic optical fiber ( gi - pof ) having a desired diameter , or may be processed to a relatively thick strand to provide a refractive index - graded lens and an image guide for picture transmission . the present invention is now described in more detail using examples and comparative examples . the examples are intended to be only illustrative and , therefore , not intended to limit the scope of the present invention . the cavity - preventing type reactors used in the following examples are of the same shape as depicted in fig1 wherein the diameter of reactor 8 is 40 mm , the height of the introduction part 10 of the reactor is 100 mm , the height of the reaction part 20 of reactor is 120 mm , and the total height of the cavity - preventing reactor , inducing 25 mm - high inlet , is 245 mm . at least 2 monomers were selected from the group consisting of styrene monomer ( sm ), methyl methacrylate ( mma ) and trifluoroethyl methacrylate ( tfema ). as a thermal initiator , 2 , 2 ′- azobis isobutyronitrile ( aibn ) was used in mma - sm reaction and tert - butyl peroxybenzoate ( t - bpob ) was used in mma - tfema reaction . as a chain transfer agent , 1 - butanethiol ( 1 - bush ) was used . in a uv photoreaction , as a photo initiator , 4 , 4 ′- bis ( dimethylamino ) benzophenone ( dmabp ) was used . the loss of light of a plastic optical fiber was measured by using a optical power meter using a light source having the wavelength of 660 nm after the perform was transformed into an optical fiber having a thickness of 1 mm . a solution consisting of 150 g of the monomer mixture made of sm and mma at a weight ratio of 20 : 80 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 to the full . a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 40 : 60 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed at a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 300 db / km . a solution consisting of 260 g of the monomer mixture made of sm and mma at a weight ratio of 30 : 70 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 to the full . simultaneously , the solution was charged into the introduction part 10 of the cavity - preventing type reactor up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 300 db / km . a solution consisting of 50 g of methylmethacrylate ( mma ), 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 up to a height of 40 mm . the unoccupied space of the reactor was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours to form a clad layer . subsequently , a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 20 : 80 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was heated to a temperature of 70 ° c ., and then was charged into the reaction part 20 of the cavity - preventing type reactor 8 . subsequently , a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 40 : 60 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was heated to a temperature of 70 ° c ., and then was charged into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 260 db / km . a solution of 50 g of methylmethacrylate ( mma ), 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant solution was reacted at a temperature of 70 ° c . for 24 hours to provide a polymer . subsequently , the polymer was dissolved in a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 20 : 80 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution . the polymer - dissolved solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 . subsequently , a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 40 : 60 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was heated to a temperature of 70 ° c ., and was charged into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by continuous rotation having a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 250 db / km . 50 g of methylmethacrylate ( mma ), 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant solution were polymerized at a temperature of 70 ° c . for 4 hours to provide a prepolymer . the resultant prepolymer was introduced into the reaction part of the the cavity - preventing type reactor to a height of 40 mm . subsequently , a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 20 : 80 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the remaining reaction part 20 of the cavity - preventing type reactor 8 to the full . after that , a mixed solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 40 : 60 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the introduction part 10 of the cavity - preventing type reactor 8 . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reaction was performed in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 9 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by continuous rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 230 db / km . a solution consisting of 260 g of the monomer mixture made of sm and mma at a weight ratio of 30 : 70 , 0 . 066 % by weight of aibn and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant mixed solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 and simultaneously , was introduced into the introduction 10 part of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reactor was set to an angle of + 15 degrees relative to the horizontal surface and then , was rotated in a rotation speed of 1 , 000 rpm at a temperature of 70 ° c . for 12 hours . subsequently , the rotation of the reactor was paused for 5 minutes , followed by continuous rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 290 db / km . a solution consisting of 260 g of the monomer mixture made of sm and mma at a weight ratio of 30 : 70 , 0 . 066 wt % of dmabp and 0 . 2 wt % of 1 - bush , based to the weight of the resultant solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 and simultaneously , into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . after the reactor was closed with a lid , the reactor was rotated in a rotation speed of 2 , 500 rpm at a temperature of 40 ° c . for 12 hours with being exposed to uv by use of the same uv radiation apparatus as depicted in fig7 . subsequently , the rotation of the reactor was paused for 5 minutes , followed by continuous rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 300 db / km . a solution consisting of 170 g of the monomer mixture made of mma and tfema at a weight ratio of 70 : 30 , 0 . 066 wt % of t - bpob and 0 . 25 wt % of 1 - bush , based to the weight of the resultant solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 . after the reactor was closed with a lid , the reaction was carried out at a temperature of 70 ° c . for 12 hours without rotation . additionally , the reaction was carried out in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours to form a clad layer . subsequently , a solution consisting of 150 g of the monomer mixture made of mma and tfema at a weight ratio of 90 : 10 , 0 . 066 wt % of t - bpob and 0 . 25 wt % of 1 - bush , based to the weight of the resultant solution was heated up to 70 ° c . and then charged into the reaction part 20 of the cavity - preventing type reactor 8 . after that , a mixed solution consisting of 120 g of mma , 0 . 066 % by weight of t - bpob and 0 . 2 % by weight of 1 - bush , based to the weight of the resultant solution was heated to a temperature of 70 ° c ., and was charged into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the unoccupied space of the introduction part 10 was charged with argon gas having the purity of 99 . 999 % until the inner pressure reached 1 bar . the reactor was closed with a lid , the reaction was carried out in a rotation speed of 2 , 500 rpm at a temperature of 70 ° c . for 12 hours . after that , the rotation of the reactor was paused for 5 minutes , followed by rotation in a rotation speed of 2 , 500 rpm for 10 minutes . these procedures were repeated several dozens of times to obtain a cavity - free preform for a plastic optical fiber . the loss of light of the resultant fiber was measured at 150 db / km . a solution consisting of 150 g of the monomer mixture made of sm and mma at a weight ratio of 10 : 90 , 0 . 066 wt % of aibn and 0 . 2 wt % of 1 - bush , based to the weight of the resultant solution was charged into the reaction part 20 of the cavity - preventing type reactor 8 to the full . subsequently , a solution consisting of 110 g of the monomer mixture made of sm and mma at a weight ratio of 20 : 80 , 0 . 066 wt % of aibn and 0 . 2 wt % of 1 - bush , based to the weight of the resultant solution was charged into the introduction part 10 of the cavity - preventing type reactor 8 up to a height of 85 mm . the same rotation reaction apparatus as depicted in fig6 was equipped with the cavity - preventing type reactor 8 , and then argon gas was led through a pressurization path ( 3 ) to an inner part of the the cavity - preventing type reactor ( 5 ) and an inner part of the reaction apparatus ( 6 ) and was simultaneously pressurized to 10 bar . after that , the lid ( 2 ) was lowered and an o - ring ( 4 ) was pressed . after the reaction was carried out in a rotation speed of 2 , 500 rpm at a temperature of 110 ° c . for 4 hours , the temperature was lowered to 90 ° c . the rotation of the reactor was paused for 5 minutes , followed by rotation in a rotation speed of 2 , 500 rpm for 10 minutes at a temperature of 110 ° c . the procedures were repeated several dozens of times . after 8 hours , a cavity - free preform for a plastic optical fiber was obtained . the loss of light of the resultant fiber was measured at 250 db / km . the reactivity of sm is so analogous to that of mma that the preform made therefrom is an amorphous random copolymer . even if the reactivity of tfema is lower to that of mma , a transparent amorphous copolymer is made therefrom in all the aforementioned composition ratios . the present invention provides a new cavity - preventing type reactor and a method for fabricating a preform for a plastic optical fiber having a continuous refractive index gradient and thus no discontinuity of refractive index profile in a radial direction by using the same wherein it is needless to introduce reactants additionally . a preferred embodiment of the present invention has been disclosed herein and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purpose of limitation . accordingly , it will be understood by those of ordinary skill in the art that various changes in form and details may be made without departing from the spirit and scope of the invention as set forth in the following claims .	1
fig1 shows a soft drink display rack comprising a base 14 and a back 16 extending upwardly from the base . back 16 includes a left - hand upright shelf support member having a slotted sloping face 18 , and a slotted vertical face 20 . a similar slotted support is provided at the right - hand side of the back , and comprises a slotted sloping face 22 , and a slotted vertical face 24 . a first shelf 26 is supported in slots on sloping faces 18 and 22 , and a second shelf 28 is supported in slots on the vertical faces 20 and 24 of the support members . the shelves are preferably identical to each other , and are supported in a substantially parallel relationship to each other on the respective sloping and vertical supports . the tabs on the shelves cooperate with the slots on the respective sloping and vertical faces in two different ways . parallelism between the shelves is achieved by virtue of the relationship between the tab structure and the angle of the sloping faces of the support members . the manner in which this is accomplished is explained in detail in u . s . pat . no . 3 , 983 , 822 , dated oct . 5 , 1976 , and the entire disclosure of that patent is incorporated herein by reference . the shelves are formed from sheet metal . each shelf , as exemplified by shelf 28 in fig1 is generally in the form of a tray , bounded at the sides by shelf brackets 30 and 32 , at the rear by a wall 34 , and at the front by wall 36 . shelf 28 also has a series of eight equally spaced dividing walls 38 - 52 , which are parallel to brackets 30 and 32 , and which divide the space between these brackets into nine tracks extending from the rear wall 34 to front wall 36 . the dividing walls act as guides for bottles on the shelf , and cause bottles placed on the shelf to be arranged in nine columns , each column preferably being able to contain at least five soft drink bottles . five such bottles are shown between dividing walls 44 and 46 . each track contains a removable gravity - feed conveyor such as conveyor 54 in the track between bracket 30 and divider 52 . each conveyor comprises a flexible belt , the upper surface of which is used to support the bottles . this upper surface is preferably , though not necessarily , substantially planar , and the shelf is disposed so that the front end of the belt is lower than the rear end of the belt . desirably , the angle of inclination of the supporting surface of the belt is between about 7 degrees and 8 . 25 degrees from horizontal . this inclination provides for forward movement of the belt under the action of gravity acting on the bottles on the belt . fig2 shows the floor 56 of shelf 28 , the conveyor assemblies being removed . floor 56 is interrupted by an elongated rectangular opening in each track , exemplified by opening 58 in the leftmost track , bounded by bracket 32 and divider 38 . opening 58 extends from a point 59 near the front of the track to a flange 61 at the bottom of the rear wall 34 . the long edges of opening 58 are bounded by upwardly extending flanges 60 and 62 , best seen in fig3 . the remaining openings in shelf floor 56 are provided with similar upstanding flanges . the purpose of flanges 60 and 62 is to hold a removable conveyor assembly in the desired fixed position in the track . the flanges 60 and 62 themselves cooperate with depending side walls of the conveyor assembly to prevent left and right movement . the flanges are provided with struck - out projections 64 and 66 , which cooperate with openings ( not shown ) provided in the depending side walls of the conveyor assembly to prevent forward and rearward movement of the assembly . the conveyor assembly itself , as shown in fig4 comprises a substantially rigid sheet metal support structure comprising depending side wall 68 , a similar depending side wall ( not shown ) on the opposite side and parallel with side wall 68 , the upper edges of the side walls being integrally connected together by a web 70 , the upper surface of which provides support for an endless flexible conveyor belt 72 . the belt is arranged in a loop , and web 70 is located within the loop so that the upper run of the belt slides on the upper surface of web 70 , and the lower run passes underneath web 70 and between the depending side walls of the conveyor structure . in the preferred form of the conveyor assembly , rollers are provided at both ends of the belt . the roller at the front end of the assembly shown in fig4 comprises a pair of guide flanges 74 and 76 , which are provided at opposite ends of the roller itself , which is obscured by the belt . the roller is rotatably supported in polytetrafluoroethylene ( ptfe ) bearings which are fixed in bearing supports 78 and 80 , which are integral with the depending side walls of the conveyor support structure . one such bearing is indicated at 82 in bearing support 80 . the structure at the opposite end of the conveyor assembly of fig4 is substantially identical to the structure just described . the conveyor belt 72 is preferably a polyester sheet material , e . g . poly ( ethylene terephthalate ). the upper surface of web 70 , as shown in fig5 is preferably provided with one or more longitudinally extending strips 84 , 86 of ptfe or a similar low - friction material in order to allow the belt to slide smoothly over the support . it is desirable , though not necessary , to provide the outside of the belt loop with a somewhat rougher texture than the inside in order to prevent bottles from sliding with respect to the belt , while allowing the belt to slide smoothly on the support . it should also be noted at this point that the rollers are not absolutely necessary , and can be eliminated by providing instead a curved guide for the belt at the forward and rearward ends of the conveyor assembly , the curved guide being provided with ptfe or a similar material to promote smooth sliding of the belt around the belt guides . the brake means for stopping the forward movement of the flexible conveyor belt is preferably constituted by one or more frictional pads , as indicated in fig5 at 88 , 90 and 92 . preferably , these pads are located in a recess 94 formed in web 70 near the front edge of the conveyor assembly . the pads are preferably rubber , and are held in place either by a suitable adhesive , or by virtue of the engagement of integral projections extending downwardly from the underside of the pad with holes provided in the surface of recess 94 . as seen in fig5 the upper surfaces of pads 88 , 90 and 92 are substantially flat , and substantially flush with the surfaces of ptfe strips 84 and 86 . the term &# 34 ; substantially flush &# 34 ; as used herein is intended to encompass minor variations from an exact flush relationship . in fact , for the best operation of the brake pads , it has been found desirable to position the flat surfaces of the pads about 0 . 3 - 0 . 4 mm . above the surfaces of the ptfe strips . the three pads shown in fig5 are aligned with each other in transverse direction . of course , various other pad configurations and numbers of pads can be used , and examples of such other configurations are shown in fig7 - 10 . fig6 illustrates the operation of the belt brake mechanism of fig5 . bottles 96 , 98 , 100 and 102 are arranged in a column in the track between bracket 32 and the adjacent divider ( not shown ) the bottles rest on flexible belt 72 , and the weight of the foremost bottle 96 in the column presses belt 72 downwardly against the brake pads including pad 92 . the friction between the pads and the underside of the belt prevents movement of the belt under the influence of gravity acting on the bottles in the column . it should be noted that bottle 96 is spaced from the rolled upper edge 104 of the overhanging front wall 36 by a short distance . when bottle 96 is removed from the column , the pressure on the brake pads is relieved so that the belt is free to slide . because of the inclination of the conveyor belt , the remaining bottles in the column move forward under the influence of gravity until bottle 98 is positioned over the brake pads , whereupon it exerts a downward pressure causing the brake pads to retard the movement of the belt . the belt stops when bottle 98 reaches approximately the same position in which bottle 96 is shown in the drawing . preferably , the brake pads are positioned so that the foremost bottle stops at a distance of about 9 mm . from edge 104 of front wall 36 . by bringing the foremost bottle to a point near the front wall , a measure of protection is provided against possible forward tipping of a bottle by reason of its inertia when it is stopped by the action of the brake means on the conveyor belt . such forward tipping could occur , for example , in the event of misuse of the conveyor shelf by placing a single bottle at the top of the conveyor and allowing it to move forward under gravity through the entire length of the conveyor . in normal use of the conveyor , the fact that the conveyor belt is brought to a gradual stop by the brake means reduces the tendency of the bottles to tip forward . fig7 and 8 illustrate a modified version of the apparatus of fig5 and 6 , in which the recess 105 and brake pads 107 , 109 and 111 are tilted with respect to conveyor support surface 113 . as best shown in fig8 the upper surface 115 of brake pad 111 is in a plane tangent to roller 117 . since the top of roller 117 is above the supporting surface constituted by ptfe strips 119 and 121 , pad surface 115 is canted with respect to these surfaces . the lower ends of the brake pads are substantially aligned with ptfe surface 119 and 121 , and the upper ends are raised relative to these surfaces . the canting of the brake pads is most effectively accomplished by forming the recess in such a way that its upper surface is tilted . the canted brake pads of fig7 and 8 are effective in producing the desired retardation of belt movement while accommodating a wide variety of bottle sizes and weights . the multiple pad configuration of fig5 and 7 is especially effective in producing a gradual stoppage of the belt in that the center pad is the first one to act when a bottle approaches the brake pad location . the center pad acts to retard the movement of the belt , and the belt is ultimately brought to a stop when the bottle is positioned so that it pushes the belt downwardly against the outer pads of the three - pad configuration . the track assembly of fig9 and 10 is provided at its forward end with a recess 122 in which is secured a rectangular rubber pad 124 , which is elongated in the direction transverse to the direction of conveyor movement . ptfe strips 126 , 128 and 130 are arranged lengthwise along web 132 . the depth of recess 122 is related to the thickness of pad 124 in such a way that the upper surface of pad 124 is substantially flush with the upper surfaces of the ptfe strips . typically , the depth of the recess below the surface of web 132 is 0 . 91 mm ., and the thickness of pad 124 is 1 . 57 mm ., so that the frictional surface of the pad is slightly above the web by a distance of about 0 . 66 mm . the result is that the frictional surface of the pad is located slightly above the surfaces of the ptfe strips , and is able to exert a highly effective retarding action on conveyor belt 134 , as shown in fig1 . the principal advantage of the elongated rubber strip 124 is that its thickness can be carefully controlled , and therefore its vertical position relative to the ptfe strips can be accurately controlled in the production of the track assemblies for consistent stoppage of the column of bottles 136 , 138 , 140 and 142 at the position illustrated in fig1 . from the foregoing , it will be apparent that the frictional pad retarders underlying the conveyor belt near the forward edge thereof provides an effective and highly advantageous means for halting the movement of a column of bottles in an automatic , forward - feed shelf , particularly in that it substantially eliminates the possibility of damage to the bottles or their labels by eliminating the need for a bumper , and by bringing the column of bottles to a gradual stop . the incorporation of the brake means in forward - feed conveyor shelving is accomplished inexpensively , and is applicable to spring and motor - driven forward - feed conveyor shelving as well as to gravity - driven shelving . modifications , of course , can be made to the exact retarder configurations described herein . for example , the number of retarding pads and their configuration can be varied , and materials other than rubber can be used . another significant advantage arising out of the use of frictional pad retarders to stop the forward movement of the columns of bottles is that it eliminates the need for bumper rails , which require either a larger vertical spacing between shelves or a very steep tilt angle for access to the bottles by customers . consequently , with the use of frictional pad retarders , a given number of shelves can be positioned within a narrower vertical range . this facilitates customer access to the displayed bottles and allows a reduction in height and weight in the support .	0
a hydraulic motor 1 has a gearwheel set section 2 , a supply section 3 and a front section 4 . further sections can be provided . the gearwheel set section has in the present case an externally toothed gearwheel 5 with eight teeth and an internally toothed gear ring 6 with nine teeth , the gearwheel 5 rotating and orbiting in a known way inside the gear ring 6 during operation . via a shaft 7 the rotational movement is transferred to a schematically shown valve arrangement 8 , which , in the correct position , provides the pressure pockets formed between the teeth of the gearwheel 5 and the gear ring 6 with hydraulic fluid under pressure . the hydraulic fluid is led in or out , respectively , through the connections 9 , 10 . the individual sections 2 to 4 are kept together in the axial direction by fixing bolts 11 . in the present case , three fixing bolts are provided , which are arranged at regular distances on a circle around the centre of the motor 1 . the rotational movement of the gearwheel 5 is transferred to the outside through a cardan shaft 13 , which is often called a &# 34 ; dog bone &# 34 ; due to its shape . the end 14 projecting from the motor of the cardan shaft 13 is rotating . however , in many cases such a motor cannot be directly used . still though , motors comprising the parts described until now are sold , namely as so - called &# 34 ; short &# 34 ; versions . when operating , such a motor 1 is connected with an output arrangement 15 , shown with dashed lines . the output arrangement 15 can be a normal output shaft or a gear with output shaft . for fixing the output arrangement 15 the motor 1 has several connection bolts 16 arranged in axial through - bores 17 . the connection bolts 16 penetrate the motor 1 completely , that is , they project with their thread 18 from the front section 4 and can accordingly be screwed into the output arrangement 15 . during mounting the connection bolts 16 can , however , be pushed somewhat into the motor 1 . in this case the head 19 of the connection bolt 16 projects even more from the axial end of the supply section . by means of a schematically shown retaining arrangement 20 , for example a resilient ring , the connection bolts 16 are held captive in the motor 1 . also when the motor 1 must , for example , be mounted upside down , the connection bolts 16 will not fall out from the motor . the number of connection bolts 16 , namely six , is at least twice the number of fixing bolts ( three ). accordingly , the fixing bolts 11 initially serve the purpose of keeping the motor 1 together during transport and mounting . they also permit operation at a certain pressure , so that for example the motor , or at least certain functions , can be tested before mounting all bolts . during operation the motor 1 will be even tighter assembled when mounted on the output arrangement 15 by means of the connection bolts 16 . thus , the operational pressure of the motor can be increased without requiring additional fixing bolts 11 . the total number of connection and fixing bolts , namely nine , thus corresponds to the number of tooth spaces in the gear ring 6 and thus to the number of working chambers . each bolt can be allocated a working chamber , and it can be arranged as close as possible to the spot acted upon by the largest hydraulic forces . the bores 17 are arranged on the same circle as the fixing bolts 11 . they are also made at regular distances , so that in relation to the output arrangement 15 the motor 1 can be mounted in a large variety of rotational positions . the axial end of the supply section 3 is free of hydraulic connections . the hydraulic connections 9 , 10 are arranged on the circumferential wall of the supply section 3 . accordingly , the axial end 21 of the supply section 3 is free to access by a tool , with which the head 19 of the connection bolt 16 can be turned . due to the good accessibility of the heads 19 , the mounting of the motor 1 on the output arrangement 15 can be made with relatively little effort . as the connection bolts 16 are standard parts , the mounting opportunity of the motor 1 on the output arrangement 15 can be made with relatively little effort . thus , the motor remains inexpensive . in the embodiment according to fig1 the fixing bolts 11 and the connection bolts 16 are inserted in the motor 1 from different axial ends . accordingly , only the connection bolts 16 are accessible in the mounted state . thus , there is no risk that the motor is disassembled by accident , when the wrong bolts are loosened . in the embodiment according to fig2 which , by the way , corresponds to the embodiment in fig1 the fixing bolts 11 &# 39 ; are inserted in the motor 1 &# 39 ; from the same axial side as the connection bolts 16 . therefore , the same parts have the same reference numbers , corresponding parts have marked reference numbers . however , to provide a clear difference between fixing bolts 11 &# 39 ; and connection bolts 16 , the heads 19 of the connection bolts 16 have a different form than the heads 22 of the fixing bolts . for example , the heads 22 of the fixing bolts 11 &# 39 ; have an internal hexagon socket as torque working surface , whereas the heads 19 of the connection bolts 16 have an external hexagon . of course , other torque working surface geometries are also possible , for example such , which are sold under the names &# 34 ; torx &# 34 ; and &# 34 ; unbraco &# 34 ;. it is shown that the connection bolts 16 are provided with a thread 18 for fixing the output arrangement 15 . other engagement opportunities can also be imagined , for example a bayonet connection . in a not shown way , one or more bores 17 can be used to drain leakage fluid off the motor . as a through - bore is concerned , the leakage fluid can also be drained off from all axial areas of the motor , before leading to undesired pressure increases . this is realised rather easily in that such a bore 17 is made with a slightly increased diameter . of course , a connection bolt can also be made so that it forms a leakage channel , for example through an axially extending groove on its surface . such a connection bolt can also be made as connection for a leakage fitting .	5
the present invention uses raw material that can be found anywhere in the market , including , but not limited to any kind of starch , such as corn starch , potato starch , cassava starch , sweet potato starch , wheat starch and rice starch , etc . the method is described in general as follows : the raw material is dispersed in water , the solids content of the dispersed raw material is about 15 - 40 %. the dispersed raw material is adjusted to adequate ph and temperature . a high - temperature α - amylase is added to the dispersed raw material . the mixture of the raw material and the high - temperature α - amylase is spray liquefied . during the saccharification process , β - amylase , malt trisaccharide enzyme , pullanase and medium - temperature amylase , etc ., are added in separate steps to carry out a concerted catalysis . in order to ensure a proper de value after the liquefaction process , the high - temperature α - amylase must be added at two separate occasions . the de value can be determined by controlling the iodine number in the liquefaction . the liquefaction process destroys the molecular bond of the starch in the native starch granules , paving the way for saccharification so that more maltose can be produced . after the liquefaction process , β - amylase , malt trisaccharide enzyme , pullanase and medium - temperature amylase are added to carry out a concerted saccharification reaction in separate steps , the operation temperature , ph and reaction time must be adjusted so that optimal conditions are ensured for the various enzyme activities . all of these parameters are determined based on the sources of the substrate used , the source , type and activity of the enzymes , the concentration of the substrate and on whether or not a suppressing agent is added . it is necessary to denature the enzymes after the saccharification reaction , [ the temperature can be adjusted to ]≧ 75 ° c . for 15 min or the ph can be adjusted to ≦ 3 . 0 for about 1 h . the impurities and by - products of the reaction are removed by filtration , ion exchange and other processes and , following further concentration , a maltose - rich syrup is obtained ; if a certain amount of seed crystal is added , by means of a crystallization process , a solid maltose crystal product can be obtained ; and by means of hydrogenation , refining , concentration , crystallization , separation , drying and other processes , a corresponding maltose alcohol can be obtained . the following method for manufacturing a maltose - rich product is illustrative , but not limiting the scope of the present invention . reasonable variations , such as those occur to reasonable artisan , can be made herein without departing from the scope of the present invention . ( 1 ) a high temperature α - amylase at an amount of 2 . 5 - 10 . 5 lu / g starch was added to a starch slurry having a concentration of 15 - 40 %, ph 5 . 2 - 6 . 2 , to form a starch slurry mix . the starch slurry and the high temperature α - amylase were stirred for about 15 - 30 min . ( 2 ) the starch slurry mix was spray liquefied twice , with the first time at about 115 ° c ., for about 30 second ; and the second time at 125 ° c ., for 10 min . ( 3 ) the spray liquefied starch slurry mix was cool to 85 - 95 ° c . additional high - temperature α - amylase was added , followed by a third time spray liquefaction at about 135 ° c ., for about 5 min . ( 4 ) the spray liquefied starch slurry mix was cool to 58 - 62 ° c . the ph was adjusted . β - amylase , pullanase and malt trisaccharide hydrolysis enzyme were added to the spray liquefied starch slurry mix . the hydrolysis was carry out hydrolysis for 24 - 48 h . the amount of the enzymes used are 0 . 3 - 3 dp / g starch , 0 . 08 - 0 . 8 pun / g starch and 0 . 8 - 8 . 0 manu / g starch , respectively : ( 5 ) a medium - temperature amylase is added , 0 . 028 - 0 . 28 knu / g starch , and saccharification for up to 60 hours . at this point , a colorless , maltose - rich syrup with a 90 - 96 % maltose content in the syrup is obtained . this maltose syrup contained about 40 - 60 % solids . ( 6 ) a 5 to 10 % of nickel catalyst was added to the maltose - rich syrup , under alkaline condition , in a high - pressure reactor . ( 7 ) hydrogen gas was infused into the high - pressure reactor at 5 - 12 mpa . the maltose started to absorb the hydrogen gas and carried out a hydrogenation reaction . a maltose alcohol was generated . ( 8 ) the nickel catalyst in the syrup was filtered and removed . after a treatment with activated carbon and ion exchange , a clear maltose alcohol was obtained . ( 9 ) the maltose alcohol was concentrated under vacuum , crystallized , separated , and dried . a maltose - rich alcohol in liquid or powder forms was obtained . the above mentioned technologies , including spray liquefaction , hydrogenation , filtration , refinement , concentration , crystallization , separation and drying are all standard technologies known to one of ordinary skill in the art . a solid maltose product with high purity was obtained by heating the maltose syrup ( containing greater than 70 % maltose ) to 70 - 80 ° c ., followed by adding activated carbon at the amount of 0 . 1 - 1 . 0 % of the weight of the solid to the maltose syrup and filtered . the filtrate was evaporated to about 75 - 85 % of the weight of the dry solid . a seed crystal with a granule size of about 120 - 150 mesh at the amount of 0 . 05 - 0 . 5 % by weight of the dry solid in the maltose syrup was added to the filtrate and stirred thoroughly ; the filtrate was then poured into a mold , cooled naturally to the ambient temperature and a solid maltose was formed . the obtained solid maltose crystal product has a stable structure and shape , is easily dissolved in water and returns to a maltose syrup after being dissolved . it has the same functions as maltose syrup and is adapted for use in all the areas where a maltose syrup can be used , in particular as a forming agent for medicine and an additive in food . compared to the state of the art , the present invention has the following significant advantages : 1 . by means of the triple spray liquefaction , multiple enzyme cooperation , stepwise liquefaction and saccharification , a maltose - rich syrup with a & gt ; 90 % maltose content and its corresponding alditol can be obtained using a simple technical process and having a low cost of production ; 2 . the maltose syrup can be used directly as the raw material to produce a solid maltose crystal product which prevents a complicated refinement process by providing a simple preparation method and low cost of production ; 3 . the solid maltose produced by the present invention has a wider range of application compared to the maltose syrup of the state of the art and at the same time it is easy to store and transport . the present invention is further explained below with reference to the application examples : ( 1 ) high - temperature α - amylase at an amount of 6 . 5 lu / g starch was added to a starch slurry to form a reaction sample with a concentration of 25 %, ph 5 . 8 and stirred for about 20 min ; ( 2 ) the spray liquefaction was carried out twice , the first time at 115 ° c . for 30 seconds ; the second time at 125 ° c . for 10 min ; ( 3 ) the reaction sample was cooled to 92 ° c . additional high - temperature α - amylase was added , followed by spray liquefaction for the third time at 135 ° c . for 5 min ; ( 4 ) the reaction sample was cooled to 58 ° c . and the ph was adjusted . p - amylase in the amount of 1 . 5 dp / g starch , pullanase in the amount of 0 . 6 pun / g starch , and malt trisaccharide hydrolysis enzyme in the amount of 4 . 0 manu / g starch were added to carry out hydrolysis for 24 - 48 hours ; ( 5 ) medium temperature α - amylase in the amount of 0 . 2 knu / g starch was added to the reaction sample , and saccharification was carried out for up to 60 h ; ( 6 ) at this point , a maltose - rich syrup with a 94 . 5 % maltose content in the syrup was obtained . ( 7 ) the above maltose syrup was subjected to a decoloration treatment with activated carbon ( 75 - 80 ° c ., 30 min ); ( 8 ) an ion - exchange resin treatment and a filtration with a 0 . 45 - μm membrane was carried out ; ( 9 ) the filtrate was concentrated to 78 - 85 % to obtain a maltose - rich syrup with a 94 . 5 % maltose content . ( 1 ) a high - temperature α - amylase at an amount of 4 . 5 lu / g starch was added to a potato starch slurry with a concentration of 15 % and ph 5 . 4 and stirred for 15 min to form a reaction sample ; ( 2 ) the spray liquefaction was carried out twice , the first time 115 ° c ., 30 s ; the second time 125 ° c ., for 10 min ; ( 3 ) the reaction sample was cooled down to 90 ° c ., and additional high - temperature α - amylase was added , followed by another spray liquefaction at 135 ° c . for 5 min ; ( 3 ) the reaction sample was then cooled to 60 ° c . with the ph adjusted ; β - amylase in the amount of 1 . 2 dp / g starch , pullanase in the amount of 0 . 5 pun / g starch , and malt trisaccharide hydrolysis enzyme in the amount of 3 . 5 manu / g starch were added to carry out hydrolysis for 24 - 48 hours ; ( 4 ) a medium - temperature α - amylase in the amount of 0 . 18 knu / g starch was added , and saccharification is carried out for up to 60 hours ; ( 5 ) at this point , a maltose - rich syrup with a 96 % maltose content in the syrup was obtained . ( 6 ) the ph of the reaction sample was adjusted and a nickel aluminum molybdenum catalyst complex is added to carry out a reduction reaction at a prescribed temperature and under hydrogen gas pressure to obtain a corresponding maltose alcohol ; ( 7 ) the maltose alcohol solution was subjected to a decoloration treatment with activated carbon ( 75 - 80 ° c ., 30 min ); ( 8 ) the maltose alcohol solution was undergone an ion - exchange resin treatment and a fine filtration with a 0 . 45 - μm membrane ; ( 10 ) the concentrated filtrate was cooled down to 50 - 55 ° c . and then continuous crystallization was carried out in a horizontal crystallization tank ; ( 11 ) the concentrated and crystallized sample was separated and dried to obtain a maltose alcohol in powder form . ( 1 ) a high - temperature α - amylase at an amount of 7 . 2 lu / g starch was added to a cassava starch slurry with a concentration of 30 %, ph 5 . 6 and stirred for 25 min to obtain a reaction sample ; ( 2 ) the reaction sample was spray liquefaction twice , the first time at 115 ° c . for 30 seconds ; the second time at 125 ° c . for 10 min ; ( 3 ) the reaction sample was cooled to 88 ° c . ; additional high - temperature α - amylase was added , followed by another spray liquefaction at 135 ° c . for 5 min ; ( 4 ) the reaction sample was cooled to 62 ° c . and the ph was adjusted . β - amylase in the amount of 2 . 0 dp / g starch , pullanase in the amount of 0 . 7 pun / g starch ; and malt trisaccharide hydrolysis enzyme in the amount of 5 . 5 manu / g starch were added to carry out hydrolysis for 24 - 48 hours ; ( 5 ) a medium - temperature α - amylase in the amount of 0 . 20 knu / g starch was added , and saccharification was carried out for up to 60 hours ; ( 6 ) at this point , a maltose - rich syrup with a 92 . 5 % maltose content in the syrup [ is obtained ]. ( 7 ) the ph of the reaction sample was adjusted and a nickel aluminum molybdenum catalyst complex was added to carry out a reduction reaction at a prescribed temperature and under hydrogen gas pressure to obtain a corresponding maltose alcohol ; ( 8 ) the maltose alcohol was subjected to a decoloration treatment with activated carbon ( 75 - 80 ° c ., 30 min ); ( 9 ) the decolored maltose alcohol was further purified by an ion - exchange resin chromatography and a fine filtration with a 0 . 45 - μm membrane ; ( 11 ) the temperature of the concentrate was lower to 50 - 55 ° c . and then continuous crystallization was carried out in a horizontal crystallization tank ; ( 12 ) the crystallized maltose alcohol was separated and dried to obtain a maltose alcohol product in powder form . ( 1 ) a high - temperature α - amylase at an amount of 10 lu / g starch was added to a sweet potato , wheat and rice starch slurry with a concentration of 40 % and ph 5 . 7 and stirred for 30 min to form a reaction sample ; ( 2 ) the reaction sample was spray liquefaction twice , the first time at 115 ° c . for 30 seconds ; the second time at 125 ° c . for 10 min ; ( 3 ) the reaction sample was cooled to 95 ° c . ; additional high - temperature α - amylase was added , followed by spray liquefaction for the third time at 135 ° c . for 10 min ; ( 4 ) the reaction sample was cooled to 60 ° c ., and the ph was adjusted ; p - amylase at the amount of 3 . 0 dp / g starch , pullanase at the amount of 0 . 5 pun / g starch , and malt trisaccharide hydrolysis enzyme at the amount of 7 . 5 manu / g starch were added to carry out hydrolysis for 24 - 48 hours ; ( 5 ) a medium - temperature α - amylase at the amount of 0 . 26 knu / g starch was added , and saccharification was carried out for up to 60 h ; ( 6 ) at this point , a maltose - rich syrup with a 90 . 5 % maltose content in the maltose syrup was obtained ; ( 7 ) the ph of the maltose syrup was adjusted and a nickel aluminum molybdenum catalyst complex was added to carry out a reduction reaction at a prescribed temperature and under hydrogen gas pressure to obtain a corresponding maltose alcohol ; ( 8 ) the maltose alcohol was subjected to a decoloration treatment with activated carbon ( 75 - 80 ° c ., 30 min ); ( 9 ) the decolored maltose alcohol was further purified by an ion - exchange resin chromatography and a fine filtration with a 0 . 45 - μm membrane ; ( 11 ) the temperature of the concentrate was lower to 50 - 55 ° c . and then continuous crystallization was carried out in a horizontal crystallization tank ; ( 12 ) the crystallized maltose alcohol was separated and dried to obtain a maltose alcohol product in powder form . the maltose syrup with a maltose content of about 76 % that was obtained in application example 1 , in which the content of glucose was 11 . 3 % and the content of the tri - or higher saccharide was 13 . 7 %, was heated at a certain temperature ; 0 . 5 % activated carbon was added and stirred for 30 min , and filtered ; the filtrate was evaporated until a maltose solution was obtained in which the dry solids content was 78 . 5 %; the temperature was then reduced to 65 ° c . ; a seed crystal was added with a granule size of about 120 - 150 mesh and the amount used was 0 . 1 % of the dry solid in the solution ; the solution was stirred thoroughly to mix the seed crystal ; the solution was then poured into a mold , cooled naturally to the ambient temperature and a solid maltose was formed . the maltose syrup with a maltose content of about 83 % that was obtained in application example 2 , in which the content of glucose was 8 . 9 % and the content of the tri - or higher saccharide was 8 . 1 %, was heated at a certain temperature , 0 . 9 % activated carbon was added , stirred for 30 min , and filtered . the filtrate was evaporated until a maltose solution was obtained in which the dry solids content was 82 . 5 %; the temperature was then reduced to 60 ° c . a seed crystal was added with a granule size of about 120 - 150 mesh and the amount used was 0 . 3 % of the dry solid in the solution ; the solution was stirred thoroughly to mix the seed crystal ; the syrup was then poured into a mold , cooled naturally to the ambient temperature and a solid maltose was formed . while the invention has been described by way of examples and in terms of the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications .	2
fig1 a shows the armature ( 1 ) of bead ( 2 ) of a conventional expansion sleeve ( 3 ) with a rigid bead supplied with its mating flange ( 5 ) and fig1 b shows the armature with linked segments ( 4 ) of bead ( 2 ) replacing it according to the invention . the figure represents the part that would be obtained after elimination of the upper rubber layer of bead ( 2 ) thus stripped down to its armature ( 1 ) or ( 4 ) as the case may be . fig2 shows , in cross section , the structure of a sleeve ( 3 ) whose rubber body ( 6 ) is reinforced with a carcass of textile or metal plies ( 7 ) whose beads ( 2 ), which rest on the shoulder or mating flange ( 5 ), are reinforced by armatures with linked segments ( 4 ). here one may see how carcass ( 7 ) surrounds armature ( 4 ) in the vicinity of beads ( 2 ) at ( 8 ). fig2 also shows the force f which develops when the sleeve is pressurized , locking the segments of armature ( 4 ) against each other in a self - squeezing action without said segments being displaced . force f1 is the tractive force exerted on textile or metal carcass ( 7 ) of sleeve ( 3 ). the resistance to the tractive force f1 is not affected by the relative flexiblity of the armature , and the performance of sleeve ( 3 ) remains substantially identical in service to that which would be obtained with a sleeve with beads reinforced by continuous rigid armatures . in fig3 representing the most usual configuration of the armature with linked segments , the armature . ( 4 ) is composed of twelve segments ( 9 ) of the same size , generally trapezoidal in shape , made integral by a metal ring ( 11 ). fig4 shows another configuration of an armature with linked segments ( 4 ) wherein the number of individual segments ( 9 ) is limited to six . in fig4 segments ( 9 ) are all of the same size with the linking element ( 11 ) being an elastic bracelet engaged in a groove ( 12 ) placed at the outermost part of segments ( 9 ). fig5 illustrates an alternative embodiment of an armature with linked segments ( 4 ) wherein there are thirty - two segments ( 9 ), of a general trapezoidal shape , of different sizes and arranged alternately : one large segment / one small segment . linking element ( 11 ) is a continuous textile cord which allows the segments to be threaded on it . fig6 shows , as nonlimitative examples , some of the shapes segments ( 9 ) of armature with linked segments ( 4 ) may have . thus , segments ( 9a ) are lozenge - shaped and have between them a zone ( 10 ) with a large surface area for linking the rubber - based mixtures surrounding the armature with linked segments . segments ( 9b ) and ( 9c ) have a double - trapezoidal shape and are linked by the small bases in case ( 9b ) and by the large bases in case ( 9c ). shapes ( 9b ) and ( 9c ) are generally used together and have a separation zone ( 10 ) with a small surface area between them . it would also be possible to combine only segments with shape ( 9b ) or segments with shape ( 9c ), which would increase the flexibility of the bead by increasing the surface area of the separation zone , allowing for rubber bridges to separate two neighboring segments . these configurations are not shown in the drawings . shapes ( 9d ) and ( 9e ) are substantially rectangular and can be separated by a zone ( 10 ) with the width desired for the flexibility of the bead . chevron shapes ( 9f ) or more complex shapes such as ( 9h ) and ( 9i ) can be used in a quasi - interlocking structure or with a separation zone ( 10 ) of the desired width between two or more segments . with the parallelepipedic shape ( 9g ) it is possible to obtain , as with shapes ( 9b ), ( 9c ), ( 9h ), ( 9i ), and ( 9j ), a greater pinching effect than with shapes ( 9a ), ( 9d ), and ( 9e ) because of the very shape of the segments . triangular shapes ( 9j ) lend themselves to mounting as shown in the drawing as an assembly ( not shown ) where all the vertices or all the bases of the triangular segments would be directed toward the center of the armature with linked segments . the latter configuration leaves a wider separation zone ( 10 ) between two successive segments ( 9 ) and hence increases the flexibility of bead ( 2 ). linking elements ( 11 ) can be formed by any appropriate means to establish a flexible or articulated link between two consecutive segments . fig7 a shows a possibility of protecting the reinforcing carcass ( 7 ) of sleeve ( 3 ) by surrounding armature ( 4 ) with a protective ply ( 14 ) composed of a mixture based on rubber or a fine textile to protect said reinforcing carcass ( 7 ) from damage when in contact with the edges of segments ( 9 ) of armature with linked segments ( 4 ). this structure is obtained during the pre - manufacturing phase of the sleeve &# 39 ; s armature . fig7 b shows such a method of pre - manufacturing the armature with linked segments from the protective plies of rubber ( 15a ) while fig7 c and 7d show schematically how protective textile ply ( 15b ) is laid on a crude rubber sheet ( 16 ), serving as a support , either along as in fig7 c or integral with a textile substrate ( 17 ) as in fig7 d . fig8 shows various methods of making the element ( 11 ) which links segments ( 9 ) of armature ( 4 ). in fig8 a , segments ( 9 ), triangular in shape , are threaded onto a continuous cord made of textile , metal , or plastic , constituting linking element ( 11 ), like beads on a necklace string . in fig8 b , segments ( 9 ), which are lozenge - shaped , are connected by rings constituting linking element ( 11 ). in fig8 c and 8d , segments ( 9 ), in the shape of a double trapezoid , are connected by an elastic bracelet comprising linking element ( 11 ). this elastic bracelet is engaged in a groove ( 12 ) formed at the periphery of segment ( 9 ). in fig8 e , segments ( 9 ) are chevron - shaped and connected by an articulated anchoring system forming linking element ( 11 ) in which , as shown in fig8 f , the head of a round hook ( 13 ) is force - fitted into recess ( 14 ) of the following linking element . in fig8 g , segments ( 9 ) are parallelepipedic in shape and connected by a spiral binding constituting linking element ( 11 ). in fig8 h and 8i , linking element ( 11 ) is a strip of material with sufficient adhesion to segments ( 9 ) to join them . this linking element can be discontinuous as in fig8 h or continuous , for example , disk - shaped , as in fig8 i . it can be made of a rubber with high sticking ability when crude or an adhesive strip on a flexible substrate . of course , all the linking elements ( 11 ) can be associated with all shapes of segments ( 9 ) to form an armature ( 4 ) composed of segments linked flexibly together or an articulated armature which allows the bead of the finished article to be bent so that it can be introduced into the bore of the mating flange . fig9 shows the mounting of mating flanges ( 5 ) on sleeve ( 3 ) by forced passage of bead ( 2 ), comprising armature with linked segments ( 4 ) through the bore of the mating flange . fig1 illustrates an application of the invention to passage through a partition or wall ( 19 ) ( for example that of a tank or rigid pipe ) of a pipe , a rod , or a sheath ( 17 ) held by a sleeve ( 3 ) by means of a flange ( 20 ) fastened by bolts ( 21 ) when inner part ( 22 ) is inaccessible . arrow f3 indicates the mounting direction . the above figures have usually been illustrated by the application to bodies of revolution , but the anchoring device proposed is not limited to this type of part ; its operation would be just as satisfactory for mounting on parts with an oval or rectangular opening . fig1 shows a nonlimitative example of a rectangular opening such as a ventilation shaft ( 23 ) in which armature with linked segments ( 4 ) would be inserted only into the angular zones ( 24 ) of the shaft . the applications of the invention are not limited to the cases illustrated . among other possibilities , it is advantageous to use the system described in the invention for anchoring ends , which are then overmolded with rubber , tension or prestress cables , or for anchoring in openings of any shape in flexible emergency evacuation devices in buildings . as may be seen from the above description and illustrations , the proposed anchoring device allows easy mounting of a sleeve , a sheath , or any other flexible object of tubular shape on a rigid form , the only condition being that the object to be anchored by supplied with a bead whose armature , according to the invention , is composed of segments linked in a non - rigid manner . in this way the invention avoids handling heavy and voluminous parts which complicate sleeve manufacturing molds or tools . it reduces the need to stock a wide variety of sleeves , each of which has standardized - connection mating flanges ; it also decreases the areas necessary for storage since sleeves without mating flanges are less voluminous than those so equipped ; it simplifies filling of orders by allowing different types of mating flanges to be mounted for a given diameter ; hence , due to these advantages , it permits an appreciable gain in productivity and improves working conditions when sleeves are manufactured . finally , if a sleeve is damaged , the mating flanges can be removed and re - used on a replacement sleeve , which represents a non - negligible saving . the individual skilled in the art can , of course , make various modifications to the device described above and its applications illustrated as nonlimitative examples without departing from the scope of the invention .	5
referring to fig1 - 8 , it is known to use a slot board , broadly indicated at 20 , to support a shelf 21 and a bin broadly indicated at 22 . according to one embodiment of the prior art , one leg 23 of a w - shaped profile or w - clip 24 is attached by bonding 25 ( fig7 ) to the shelf 21 and the opposite leg 26 of the w - clip 23 is inserted in a known manner in a selected slot 27 of the slot board 20 . the slot board 20 is preferably made from wood and the plurality of slots 27 extend horizontally between the ends of the board . the board 20 may be of any desired dimensions with vertical spacing of the slots 27 . as seen in fig2 each of the slots 27 includes an upper extension 30 , and may include a lower extension 31 , within the board 20 . the leg 26 of the prior art w - clip 24 extends vertically in use into the upper extension 30 of a selected slot 27 in the slot board ( fig4 ). a leg 32 of the w - clip extends from the lower end of the leg 26 and outwardly through the slot 27 to the front 33 of the slot board 20 . another leg 34 extends downwardly in fig4 from the leg 32 , along the front 33 of the board 20 . the leg 23 of the w - clip is shown in fig4 as extending horizontally from the leg 34 but it may extend at any desired angle to the front 33 of the slot board 20 . it is the legs 23 and 34 of the prior art w - clip 24 that are attached by bonding 25 to the shelf 21 , and it is only the bonding 25 that connects the shelf 21 to the w - clip 24 . a prior art z - clip 40 , as seen in fig5 and 6 has only three legs , 41 , 42 , and 43 . the leg 41 corresponds to the leg 26 on the w - clip and extends , in use , into the upper extension 30 of a selected groove 27 in the slot board . the leg 42 of the z - clip 40 corresponds to the leg 32 of the w - clip 24 and extends from the lower end of the leg 41 and outwardly to the front 33 of the slot board 20 . the third leg 43 of the z - clip 40 corresponds to the leg 34 of the w - clip 24 and extends from the leg 42 of the z - clip along the front 33 of the slot board 20 . it is only the leg 43 of the z - clip that is attached by bonding 25 to the back wall 44 of the bin 22 . it is not unusual for the bond to fail in use , resulting in spillage of the contents of the bin . prior efforts to overcome the repeated failures of the bonding of the w - clip 24 to the shelf 21 have included making a modified w - clip 24a ( fig7 ) with an extension 50 of the horizontal leg 32 in fig7 . the extension 50 extends in spaced parallel relation above the shelf supporting leg 23 to increase bonding area and form a shelf receiving channel 51 . the channel and the additional bonding area provide additional strength and is an improvement over the initial w - clip 24 , but is unsatisfactory because the bonding still fails . fig8 illustrates another attempt to strengthen the attachment of the shelf within the channel 51 of modified w - clip 24a . here , the w - clip 24a is extruded from aluminum and the bonding is replaced with one or more screws 52 extending through the leg 23 and against the shelf 21 to bind the shelf between the leg 50 and the leg 23 in fig8 . additional strength is provided but the use of screws is not cost effective because of the cost of the screws and the expense of time and labor to install them . one profiled connector 60 ( fig1 ) of this invention is an improvement of the modified w - clip 24a ( fig7 and 8 ). a second profiled connector 80 ( fig1 ) of this invention is an improvement of the prior art z clip 40 ( fig5 ), and a third profiled connector 100 ( fig1 ) of this invention is a combination of the improved w - clip 60 and the improved z - clip 80 . all three of the improved connectors have the advantage of providing a reliably storing connection of a compatible shelf or bin ( storage receptacle ) to its connector without failure of the prior art bonding materials or the necessity in the prior art of using additional materials to attach the prior art clips to the shelf or bin . the improved w - clip 60 ( fig9 , and 11 ) is made from a suitably sturdy reinforced plastic or sturdy metal in the general configuration of the modified w - clip 24a ( fig7 ). the improved w - clip 60 has five legs , 61 , 62 , 63 , 64 , and 65 , corresponding to legs 26 , 32 , 34a , 23 , and 50 of the modified prior art w - clip 24a . the leg 63 of the improved w - clip 60 extends below the load supporting leg 64 to increase the bearing surface against the slot board 20 , as does the leg 34a on the modified w - clip 24a . the extension 65 of leg 62 on the improved w - clip 60 lies in spaced parallel relation to the shelf supporting leg 64 to form a channel 66 which receives one edge of a shelf 67 . the load supporting leg 64 extends beyond the leg 65 to provide additional support for the shelf 67 . a rib 68 on load supporting leg 64 is spaced outwardly from vertical leg 63 and extends upwardly toward the free end of leg 65 on the improved w - clip 60 in fig1 . the shelf 67 has a groove 70 in its lower surface in fig9 and 11 that is spaced inwardly from one longitudinal edge 71 of the shelf 67 . the groove 70 registers with the rib 68 on the w - clip 60 when the clip 60 and shelf 67 are assembled for use . the two are easily assembled by simply positioning the rib 68 in the groove 70 and sliding the clip to a desired location along the edge 71 of the shelf 67 . the w - clip 60 and the shelf 67 are then mechanically interlocked and the installation of the shelf is completed by positioning in the usual manner the leg 61 of the w - clip 60 in a selected slot 27 in the slot board 20 . the improved z - clip 80 ( fig1 and 13 ) has legs 81 , 82 , and 83 corresponding to the legs 41 , 42 and 43 on the prior art z - clip 40 ( fig5 ). as seen in fig1 , the load supporting leg 83 has an extension 85 that makes it longer than the corresponding leg 43 on the prior art z - clip . the extension 85 increases the bearing surface against the slot board 20 and provides space for a rib 84 . a channel 86 is formed on the z - clip 80 by the inner portion of leg 83 , an extension 87 of the leg 82 , and a leg 88 extending downwardly in fig1 from leg 87 in spaced parallel relation to the leg 83 . the bottom of the channel 86 in fig1 is open to receive the upper edge portion of one wall of a bin 90 , as in fig1 . the rib 84 is directed toward the free end of leg 88 at the open end of channel 86 . the improved z - clip 80 is connected to the bin 90 by placing the upper edge 91 of the bin &# 39 ; s rear wall 92 in the channel 86 in the z - clip 80 , as shown in fig1 , and sliding the z - clip along the upper edge 91 to a desired location on the bin 90 . the rear wall 92 of the bin has a groove 93 spaced from the upper edge 91 to register with the rib 84 when the z - clip 80 and bin 90 are assembled as shown in fig1 . the z - clip 80 and bin 90 are then mechanically interlocked . the leg 81 of z - clip 80 is positioned in the usual manner in a selected slot 27 on the slot board 20 to support the bin . the load bearing capacities of the bin 90 and shelf 67 , using their sturdy interlocking connectors , is not limited by bond strength or the tightness of the screws used in the prior art . a combination clip 100 ( fig1 ) combines the configuration of the improved w - clip 60 ( fig1 ) with the configuration of the improved z - clip 80 ( fig1 ) and is usable to connect either the grooved shelf 67 , as shown in fig1 , or the bin 90 with its grooved rear wall 92 as shown in fig1 . comparing fig1 and 14 , it will be seen that the elements of the combination clip in fig1 have been marked with the same reference numbers as like elements on the improved w - clip in fig1 , with the prime notation added to the reference numbers of like parts in fig1 , such as load supporting leg 64 &# 39 ;. similarly , the elements of the combination clip 100 in fig1 have been marked with the same reference numbers as like elements on the improved z - clip in fig1 , with the prime notation added to the reference numbers of like parts in fig1 , such as load supporting leg 83 &# 39 ;. the channel 66 1 on the combination clip 100 in fig1 receives the edge 71 of grooved shelf 67 in the same manner as channel 66 on the improved w - clip 60 ( fig1 ) has been described as receiving the edge 71 of grooved shelf 67 . the shelf and clip are interlocked in both cases by positioning the grooved edge portion of the shelf in the channel on the clip and by seating the rib in the groove in the shelf . the channel 86 1 is not used when it is desired to use the combination clip 100 to connect a shelf to the slot board . similarly , the channel 66 1 is not used when it is desired to use the combination clip 100 to connect a bin to the slot board . as shown in fig1 , the channel 86 1 receives the upper edge 91 of bin 90 and the rib 84 1 is seated in the groove 93 1 to interlock the combination clip 100 with the bin . there is thus provided improved connectors for supporting shelves and bins from slot boards . the improved w - clips and z - clips have the advantages of increased strength and of economies in time and materials . although specific terms have been employed in describing the invention , they have been used in a generic and descriptive sense only and not for the purpose of limitation .	0
fig1 depicts a computer 10 built according to the present invention . the computer 10 has three memory modules 12 , 14 , and 16 . each memory module has four random access memories ( ram ) 18 . the memory modules 12 , 14 , and 16 also have read - only configuration memories ( rocm ) 20 , 22 , and 24 respectively . each rocm could also be a rom , a prom , an eprom , an eeprom , or any other memory device that can not be modified merely by commands from the computer 10 . each rom stores the self - identification information for its respective module , also known as the memory module characteristic information . the memory module 12 is coupled to a processor 26 by two communication lines 28 , 30 . the memory module 14 is coupled to the processor 26 by two communication lines 32 , 34 . the memory module 16 is coupled to the processor 26 by two communication lines 36 , 38 . the processor requests self - identification information from memory module 12 via lines 28 , 30 , from memory module 14 via lines 32 , 34 , and from memory module 16 via lines 36 , 38 . in the preferred embodiment , lines 30 , 34 , and 38 are just one line , which carries a config signal from the processor to each module . communication lines 40 also couple the modules to the processor . the communication lines 40 carry data between the modules and the processor , and carry the memory module characteristic information from each module to the processor . fig2 depicts four self - identifying memory modules 12 , 14 , 16 , and 17 , built according to the present invention . the config signal is carried on a line 42 which connects to all four modules . a select (&# 34 ; sel &# 34 ;) signal is carried on sel lines 44 , each of which connects an address (&# 34 ; addr &# 34 ;) line 46 to a memory module . thus , for example , the sel signal is carried on line 44a from lines 46 to memory module 17 . the line 46 in fig2 and 3 represents multiple addr signal lines . thus , each memory module is connected to a different addr line , 46a , 46b , 46c , and 46d . the sel signal lines 44 serve the function of lines 28 , 32 , and 36 in fig1 . the sel signal is used to select only one of the memory modules to respond with configuration information . the addr lines 46 connect to all four modules and carry address signals &# 34 ; addr &# 34 ; used for the row and column addresses of dram locations for normal , non - configuration access . data in (&# 34 ; d &# 34 ;), data out (&# 34 ; q &# 34 ;) lines dq 48 connect to all four modules and carry data into and out of each module . the dq line 48 in fig2 and 3 represents multiple dq signal lines . a row access strobe (&# 34 ; ras &# 34 ;) signal line 50 and a column access strobe (&# 34 ; cas &# 34 ;) signal line 52 connect to each module . the ras and cas signals mark the row and column addresses as with standard drams . a write enable line (&# 34 ; we &# 34 ;) line 54 connects to all four modules and carries the signal we , which is used , as in standard , normal drams , to mark when an access to a dram is a &# 34 ; write &# 34 ;, instead of a &# 34 ; read &# 34 ;. the config and sel signals work together to request self - identification information individually from each module , as shown below in table 1 . table 1______________________________________ sel sel sel sel module config4 a 44b 44c 44d selected______________________________________high level x x x x nonesignallow level 0 0 0 0 nonesignallow level 0 0 0 1 12signallow level 0 0 1 0 14signallow level 0 1 0 0 16signallow level 1 0 0 0 17signallow level x x 1 1 invalidsignal______________________________________ where x is either zero or one , and the bottom row is only one example of an invalid combination of sel signals , because such combination would select more than one module . fig3 is a block diagram of the self - identifying memory module 12 built according to the present invention . the module 12 includes four dram &# 39 ; s 18 . each dram 18 is connected to four data in , data out ( dq ) lines 48 . the dram 18a is also connected to the ras 50 , cas 52 , we 54 , and addr 46 lines . one of the dq lines 48 connected to the dram 18d is also connected to a data out line 60 of the rocm 20 . the sel signal and the inversion of the config signal are connected to the rocm 20 . fig4 depicts the rocm 20 in block diagram form . a voltage supply point v cc 70 is connected to approximately five volts dc . a low voltage point v ss 72 is connected to ground . the rocm 20 is controlled by a next signal on line 52 from a cas signal , a config signal on line 42 , and a sel signal on the sel line 44d , according to table 2 shown below . in the memory module 12 , the next signal is the same as the cas signal . table 2__________________________________________________________________________ internal internal current nextinputs states out - states state state puts next next next sel config n e q n e__________________________________________________________________________x l ↓ x x hi z -- lh h ↓ x x hi z l hl h ↓ x x q . sub . 0 l h ↑ x l n h q . sub . n n + 1 hh x x n e hi z n ex x h n e hi z n ll x l n h q . sub . n n hx x l n l hi z n l__________________________________________________________________________ where : the output at t state = the input at t + 1 state ; n = current place ; e = enabled ; h = high signal level ; l = low signal level ; ↑ = transition from a low level signal to a high level signal ; and ↓ = transition from a high level signal to a low signal level signal . the signal line config connects to every module in the memory system . the signal line sel connects to an address line . each module connects to a different address line . the rocm is selected by ( 1 ) asserting an address on the addr lines , which only assert sel to a single module , ( 2 ) asserting cas , and ( 3 ) asserting config . sel is only sampled when config is asserted . when config is first asserted , the rocm resets to its initial state . thereafter , each time next is asserted , q is driven with the next bit in sequence . q is always held in the high impedance state unless config and next are both asserted and the module is selected by having sel asserted when config was first asserted . referring now to fig5 a , there is shown a flow chart depicting the process of the present invention , the self - identification of the configuration memory module . the process begins with an initialize step 80 . both ras and cas are initialized to high . the address is set to be an address that selects the first module , one with all zeros except for the lower order address bit equal to one . config is initialized to low . this sets the first module into a configuration mode . in step 82 , for each parameter in the parameter list as stored in configuration ram , the parameter is set to &# 34 ; collect 1 &# 34 ; which is a subroutine shown in fig5 b . in step 84 , the memory controller ( not shown in the figures ) is programmed for the memory module , such as a simm , to respond to those parameters . in step 86 , the address in the next module is selected by shifting the address left one position , which can also be done by multiplying the address by two . in step 88 , a count of the modules count is incremented . in step 90 , a configuration controller ( not shown ) checks to see whether it is beyond the last possible memory configuration address , or memory simm position , for the system . if not , the configuration controller goes back for each parameter stage and collects parameters for the next module or simm . if the configuration controller has finished , it is ready to enter normal operation ( step 92 ); it is finished with the configuration operation . referring now to fig5 b , the &# 34 ; collect 1 &# 34 ; flow chart , in step 94 the accumulator is set to zero , ( a cc = 0 ), and an internal counter is set to zero . the counter counts the number of data bits that the configuration controller reads out of the configuration memory . in step 96 , the configuration controller sets cas equal to low . this selects the memory and causes the rocm to drive out its first data . step 98 is the accumulate step , which sets the value of &# 34 ; collect 1 &# 34 ;. in step 98 , the configuration controller takes the bit on dq o and adds it into the previously accumulated bits , shifted up by multiplying the previously accumulated bits by two . ( accumulator × 2 + dq o ). thus , the configuration controller shifts the accumulator and adds in a lower order bit , taken from the memory module &# 39 ; s configuration memory . in step 100 , the configuration controller returns cas to high . this causes the rocm memory to increment to the next location . in step 102 , the configuration controller sets count = count + 1 in order to keep track of how many data bits have been taken in from the rocm . in step 104 , the configuration controller tests whether the count is less than the parameter size . if the count is less than the parameter size then the configuration controller goes back to step 96 , sets cas = 1 , to accumulate more of the data bits . if the count is greater than or equal to the parameter size , then the configuration controller has collected enough bits , and thus it returns , in step 106 , the contents of a cc as the value of &# 34 ; collect 1 &# 34 ; to step 82 of fig5 a . the fields in the rom &# 39 ; s 20 , 22 , and 24 are allocated to key parameters as shown below in table 3 . the full names of the key parameters are shown in table 4 . other key parameters which could be included are shown on page 6 - 5 in &# 34 ; mos memory data book &# 34 ;, # smyd091 , published in 1991 by texas instruments . table 3______________________________________code description space in memory______________________________________manufacturer : jdec code 8 bitspart number : ascii128 bits ( 16 bytes ) depth : binary value to 8 bits the base log2 of the number of words in the memorytarf : nanoseconds in 8 bits binarytarp : nanoseconds in 8 bits binarytdrf - rf : nanoseconds in 8 bits binarytdrf - rp : nanoseconds in 8 bits binarytdrp - rp : nanoseconds in 8 bits binarytdrf - wf : nanoseconds in 8 bits binarytdrp - wf : nanoseconds in 8 bits binarytdrp - wp : nanoseconds in 8 bits binarytdrf - wp : nanoseconds in 8 bits binarytddwf : nanoseconds in 8 bits binarytddwp : nanoseconds in 8 bits binarytdwf - rf : nanoseconds in 8 bits binarytdwf - rp : nanoseconds in 8 bits binarytdwp - rf : nanoseconds in 8 bits binarytdwp - rp : nanoseconds in 8 bits binary______________________________________ table 4______________________________________abbreviation : meaning : ______________________________________tarf : time access read fulltarp : time access read pagetdrf - rf : time delay read full to read fulltdrf - rp : time delay read full to read pagetdrp - rp : time delay read page to read pagetdrf - wf : time delay read full to write fulltdrp - wf : time delay read page to write fulltdrp - wp : time delay read page to write pagetdrf - wp : time delay read full to write pagetddwf : time delay data write fulltddwp : time delay data write pagetdwf - rf : time delay write full to read fulltdwf - rp : time delay write full to read pagetdwp - rf : time delay write page to read fulltdwp - rp : time delay write page to read page______________________________________ in order to keep connections to a minimum , most of the control lines and all the data lines needed are shared with signals normally present on the memory module . for example , shown below in table 4 are the signal lines which are used for two different signals . table 5______________________________________ signalsignal sharedline description with______________________________________ config configuration rom none enableq 1 bit data line dqosel select this module none next step to next serial cas bit______________________________________ this scheme requires only config and sel as additional connections to the module . the principles , preferred embodiments and modes of operation of the present invention have been described in the foregoing specification . the invention is not to be construed as limited to the particular forms disclosed , since these are regarded as illustrative rather than restrictive . moreover , variations and changes may be made by those skilled in the art without departing from the spirit of the invention .	6
the arbitration circuit of the mca bus in fig1 has an operating mode decode logic ( 108 ) which , through the mode0 ( 33 ) and mode1 ( 34 ) pins receives the signals that will allow one operating mode to be selected from the four possible modes of the circuit . a stack of four registers pos2 ( 112 ), pos3 ( 113 ), pos4 ( 114 ), pos5 ( 115 ), contained in a programmable option circuit pos ( 106 ) allows the other elements of the integrated circuit , as a function of the operating mode selected , to use certain information from these pos registers to modify as a consequence the signals transmitted by the different elements of this integrated circuit . these pos registers are loaded by data bus ( do , d7 ) connected to pins ( 3 to 7 and 82 to 84 ) of circuit ( 102 ), after transmission of the channel reset signal ( chreset ) arriving at the mca bus on pin ( 31 ). the operation of the arbitration circuit depends both on the decoding of the mode0 ( 33 ) and mode1 ( 34 ) inputs and the content of the programmable option selection registers depending on the associated mode . thus , as shown in fig2 when pins ( 33 , 34 ) are connected so as to indicate the programming in mode0 to the circuit , registers ( 112 ) to ( 115 ) have the contents shown in figure 2 , with the following meanings : field ( encd ) of bit 0 of register ( 112 ) is the card enable field according to the following code : the field ( alti0 ) represented by bit 1 of register ( 112 ) defines an alternate address for the input - output ( io ) field of the arbitration circuit and is equivalent to the presence or absence of address bit a3 which may have been placed in bit 0 of register ( 114 ), not used . field arb , composed of bits 2 to 5 of register ( 112 ) defines the priority level . bit 0 is the least significant bit associated with the lowest priority level and bit 3 is the most significant bit associated with the highest priority level . field fe , composed of bit 6 of register ( 112 ), defines the enable of the fairness mode according to the following code : bit 7 of register pos 112 is not used and is still at the low read level . the segrom field composed of bits 0 to 2 of register ( 113 ) defines the segment of read only memory rom used with the arbitration circuit according to the following table for the sizes of each 16 kb segment : ______________________________________bit5 bit4 bit3______________________________________0 0 0 c0000 - c3fff0 0 1 c4000 - c7fff0 1 0 c8000 - cbfff0 1 1 cc000 - cffff1 0 0 d0000 - d3fff1 0 1 d4000 - d7fff1 1 0 d8000 - dbfff1 1 1 dc000 - dffff______________________________________ the enrom field , composed of bit 3 of register ( 113 ), enables read only memory rom used with the arbitration circuit according to the following table : the burst field , composed of bits 4 - 5 of register ( 113 ), defines the size of the data bursts exchanged in the dma mode according to the following table : ______________________________________bit5 bit4______________________________________0 0 single access0 1 8 cycles1 0 16 cycles1 1 32 cycles______________________________________ bits 6 and 7 of register pos 113 are not used and are still at the low read level . bits 1 to 7 of register ( 114 ) define input - output ( io ) field position address bits a4 - a10 in the input - output ( io ) space of the system , and bits 0 to 4 of register ( 115 ) define the input - output field position address bits a11 - a15 in the input - output space of the system . the rdy field , composed of bit 5 of register ( 115 ), defines the management type of channel ready signal cdchrdy according to the following code : it will be noted that rom access is not sensitive to this bit and is fixed at 300 ns . bits 6 and 7 of register ( 115 ) are not used and are still at the high read level . as concerns mode 1 , registers ( 112 , 114 , and 115 ) are defined as for mode0 ; only register ( 113 ) is modified and the nit field composed of bits 0 and 1 of this register defines the interrupt line number of the mca bus used according to the following table : the segram field , composed of bits 3 and 5 of register ( 113 ), defines the segment of random access memory ram used by the arbitration circuit according to the following table for ram segment sizes of 16 kb : ______________________________________bit5 bit4 bit3______________________________________0 0 0 c0000 - c3fff0 0 1 c4000 - c7fff0 1 0 c8000 - cbfff0 1 1 cc000 - cffff1 0 0 d0000 - d3fff1 0 1 d4000 - d7fff1 1 0 d8000 - dbfff1 1 1 dc000 - dffff______________________________________ the field ( eram ), composed of bits 6 and 7 of register ( 113 ), defines the size of the ram associated with the arbitration circuit according to the following table : ______________________________________bit7 bit6______________________________________0 0 no ram0 1 16 kb1 0 32 kb1 1 64 kb______________________________________ in mode 2 , field ( encd ), composed of bit 0 of register ( 112 ), and the segrom field composed of bits 3 and 5 from this same register , have the same meanings as for mode 0 . field ( enio ), composed of bit 1 of register ( 112 ), is the input - output enable ( io enable ) field according to the following code : field ( enram ), composed of bit 2 of register ( 112 ), is the ram memory enable field according to the following code : the field ( nit ), composed of bits 6 and 7 of register ( 112 ), defines the interrupt line number used according to the following table : bits 0 to 5 of register ( 113 ) define the position of the ram memory field as a function of the field value ( ml16 ) constituted by bit 0 of register ( 114 ) according to the following table : if m116 = 0 , the ram field is defined by address bits a14 - a19 of the address bus ; if m116 = 1 , the ram field is defined by address bits a18 - a23 of the address bus ; the field ( wsize ), composed of bits 6 and 7 of register ( 113 ), defines the size of the ram memory field as a function of the field value ml16 according to the following table : ______________________________________bit7 bit6______________________________________ . if m116 = 00 0 x0 1 16 kb1 0 32 kb1 1 64 kb . if m116 = 10 0 x0 1 256 kb1 0 512 kbi 1 1 mb______________________________________ field ( m116 ), composed of bit 0 of register ( 114 ), defines the ram memory field position relative to the first megabyte according to the following table : the field ( vrom ), composed of bit 1 of register ( 114 ), defines the rom memory enable according to the following code : bits 2 to 7 of register ( 114 ) define , by address lines a5 - a10 of the mca bus , the input - output field position in the input - output space of the system . bits 0 to 3 of register ( 115 ) define , by address lines a11 - a14 of the mca bus , the input - output field position in the input - output space of the system . the field ( stat ), composed of bit 6 of register ( 115 ), defines the status availability according to the following code : the field ( cck ), composed of bit 7 of register ( 115 ), defines the channel check indicator according to the following code : finally , regarding mode3 , as shown in fig4 registers ( 112 , 114 , 115 ) are identical to those of mode0 , register ( 113 ) only is modified , and field ( arb0 ), composed of bits 0 to 3 from this register ( 113 ), defines the priority level among the four possible levels of channel 0 , bit 0 being the least significant and bit 3 the most significant . field ( arb1 ), composed of bits 4 to 7 , defines the priority level of dma channel 1 , bit 4 being the least significant and bit 7 the most significant . a circuit ( 106 ), on reception of the setup signal from the pos registers ( ls and up ) received at pin ( 9 ) and a selection signal sent to the address bus , allows signals ( lcpsoeid0 ) and ( lcdenoeid1 ) signals to be sent to the respective pins ( 46 , 47 ). the letter &# 34 ; l &# 34 ; placed in front of the name of the signal ( for example lsetup ) indicates that the setup signal is active in the low status . in modes 0 and 2 , output ( 46 ) is composed of the ( lcspos ) signal which , when the local output is active at the low status , indicates selection of pos registers ( 110 ) to ( 117 ), with signal ( lsetup ) being locked by signal ( ladl ). output ( 47 ) is composed of enable signal ( lcden ) of the card on which the arbitration circuit is installed . in modes 1 and 3 , output ( 46 ) is composed of signal ( 0eid0 ) indicating validation ( enable ) at the output from identifier ( id0 ). this active output at the low state indicates reading of a register ( 110 ) containing identifier ( id0 ). the output ( 47 ) is composed of signal ( 0eid1 ) indicating output validation ( enable ) of identifier ( id1 ). decode circuit ( 106 ) also delivers signal ( cdds16 ) to pin ( 16 ); signal ( cdsfdbk ) to pin ( 65 ); signal ( csrom ) to pin ( 45 ); signal ( lcsi0 ) to pin ( 44 ); signal ( scram dko ) to pin ( 25 ). this decode circuit ( 106 ) receives signal ( ladl ) at pin ( 16 ); signal ( mio ) at pin ( 15 ); the 24 address bits ( a0 - a23 ) at pins ( 49 to 60 ) and ( 68 to 79 ); signal ( made24 ) at pin ( 8 ); signal ( bhe ) at pin ( 48 ). this circuit also receives signal ( mem816 ) at pin ( 18 ); and signal ( i0816 ) at pin ( 17 ). the meaning and action of the various signals are listed below in the text and it will be seen below that certain pins such as ( 46 , 47 ) for example transmit or receive signals ( lcsp , oeid0 ) that have different meanings according to the operating mode selected by pins ( 33 , 34 ). circuit ( 107 ) that produces the &# 34 ; ready &# 34 ; signal delivers signal ( irdy ) internally to the card via the arbitrator at pin ( 10 ) and delivers signal ( cdchrdy ) externally to the bus mca at pin ( 67 ). this signal ( 107 ) receives , via link ( 118 ), the signal ( lwon1 ) produced by arbitration circuit ( 104 ). this signal ( lwon1 ) is also sent to decode circuit ( 106 ). circuit ( 107 ) also receives via line ( 124 ) the signals ( ladrom , ladi0 , ladram , csram , csi0 ) coming from circuit ( 106 ) and via link ( 119 ) signal ( bcmd ) coming from circuit ( 106 ). this signal ( bcmd ) is also sent via link ( 119 ) to circuit ( 105 ). finally , circuit ( 107 ) receives , via link ( 125 ), signal ( dpos55 ) which is composed of the fifth bit of register pos5 ( 115 ). control circuit ( 105 ) receives in input signal ( lcmd ) at pin ( 32 ); it receives signal ( s0 ) at pin ( 13 ); and signal ( s1 ) at pin ( 14 ); and at the output transmits signal ( liord ) at pin ( 21 ); transmits signal ( liowr ) at pin ( 20 ); transmits signal ( llden ) at pin ( 80 ); signal ( lhden ) at pin ( 19 ); and signal ( dir ) at pin ( 81 ). this circuit ( 105 ) also , at the output , transmits signal ( lmwrbstdk1 ) at pin ( 23 ) and signal ( lmrdoprempt ) at pin ( 24 ). a bus arbitration circuit ( 104 ) receives in input signal ( arboint0 ) at pin ( 28 ); it receives signal ( lprempt ) at pin ( 29 ); and the 14 mhz clock at pin ( 26 ). this arbitration circuit ( 104 ) transmits in input or output , signal ( arbstat ) to pin ( 27 ); signal ( tcchckdq1 ) to pin ( 30 ); signal ( wsoarb2 ) to pin ( 62 ); signal ( ws1apb3 ) to pin ( 61 ); and signal ( arb1m116 ) to pin ( 63 ). finally , in output , arbitration circuit ( 104 ) transmits one of the four interrupts it ( 0 to 3 ) available at pins ( 37 ) to ( 40 ). this circuit ( 103 ) also receives , via line ( 109 ), bits 6 and 7 ( nit ) of register pos ( 112 ) in mode2 . pins ( 37 to 40 ) also constitute outputs ( 0arb0to3 ) of bus arbitration circuit ( 104 ). a communications bus ( 109 ), via mode circuit ( 108 ), furnishes to all the decode ( 106 ), command ( 105 ), and arbitration ( 104 ) circuits , the mode signals that allow these circuits ( 106 , 105 , 104 , 107 ) to select , as a function of the mode selected , the information from the pos registers useful for producing output signals on each circuit ( 107 , 106 , 105 , 104 ) corresponding to the operating mode selected and the programming of the pos registers . decode circuit ( 106 ), via link ( 123 ), furnishes bits 2 to 7 of register pos2 ( 112 ) constituted by signals ( dpos 22 : 27 ) and bits ( 0 to 7 ) of register pos3 ( 113 ). decode circuit ( 106 ), via link ( 122 ), delivers signal ( cden ), via link ( 121 ) delivers signal ( idrq0 ), and via link ( 116 ) delivers signal ( lbcmd ) to arbitration circuit ( 104 ). arbitration circuit ( 104 ), via link ( 120 ), transmits to decode circuit ( 106 ) the signals ( dack0 , stat , ichck ), and via link ( 128 ) to control circuit ( 105 ) transmits signals ( dack1 , burst loprmpt ). arbitration circuit ( 104 ) receives from control circuit ( 105 ), via link ( 129 ), signal ( lcyiol ) and via link ( 130 ), signal ( cyiol ). the control circuit delivers , by link ( 127 ), signals ( lcymem , cyior , lcyior , lcyiow , is1 ), by link ( 126 ), signals ( ilcsio , ilcsram , ilcsrom ) to decode circuit ( 106 ), and via link ( 103 ), signal ( lreset1 ) to arbitration circuit ( 104 ) and decode circuit ( 106 ). the meaning of the signals transmitted or received by the various circuits in the integrated circuit is given below : __________________________________________________________________________pinnumbertype symbol description__________________________________________________________________________3 - 7 bidir . d4 - d0 data bus . these bits are d7 - d5 used to write or read the pos registers ( 112 to 115 ) during the circuit setup cycles . they are bidirectional three - status lines . 8 input made24 extended address indicator . a high level indicates an address less than or equal to 16m . 9 input lsetup this line , active at low status , indicates selection of the connector for access to the pos registers connected to the connector . 10 input rdy local bus &# 34 ; ready &# 34 ; signal for asynchronous extension of the mca cycle . the unready status is the low status . this signal must be generated such that the mca bus signal cdhrdy does not exceed 3 μs . 11 - 12 nc not connected . 13 - 14input s0 s1 mca bus status bit . these lines indicate the start of a cycle and its type ( read with s1 at low level and s0 at high level , write with s0 at low level and s0 at high level or reserved with s0 and s1 at the same levels ). 15 input mio memory / input - output cycle . this signal makes a distinction between a memory cycle and an input - output ( io ) cycle . the type of cycle , write or read , is defined as a function of the values of s0 and s1 . thus , if m / io and s1 are at the high level and s0 at the low level , a write memory cycle is run . high level : memory cycle low level : io cycle16 input ladl address decode latch ( or &# 34 ; lock &# 34 ;). this signal allows an address or status decode to be locked to its rising front to ensure proper running of the cycle . 17 input io816 8 or 16 bit input - output ( io ). this input determines the given bus width of the input - outputs ( io ) which allow or disallow generation of signals cdds16 and lhden for the input - output cycles . this line is hardwired and not a dynamic input . high level : 8 bits low level : 16 bits18 input mem816 8 or 16 bit memory . this input determines the memory data bus width allowing or disallowing generation of signals cdds16 and lhden for the memory cycles . this line is hardwired and is not a dynamic input . high level : 8 bits low level : 16 bits19 output lhden high byte data enable . this low level active output must be connected to the input of an external enable circuit ( 245 ). this line is active with input - output ( io ) access , memory [ access ], or in the dma mode on 16 bits corresponding to the address fields programmed in the pos registers ( 112 to 115 ). 20 output liowr io write strobe . this signal , active in the low status , indicates an io write . decoding of the s0 s1 status and of mio is authorized by command signal lcmd . 21 output liord io read strobe . this signal , active at low status , indicates an io read . decoding of the s0 s1 status and of mio is authorized by command signal lcmd . 22 output lmwbstdkl mode0 : burst . this high active signal connected to the mca bus through an open collector inverter gate ( f38 ) indicates transfer of a data block . this line is active after a won arbitration phase , following a drq request if the location corresponding to bits 6 and 7 of register pos ( 113 ) is not at zero . mode1 mode2 : lmemwr , memory write strobe . this signal , active at the low status , indicates memory write . decoding of statuses s0 , status s1 , and of mio authorized by command signal lcmd . mode3 : ldack1 , acknowledge channel 1 . this signal , active at low status , indicates an input - output ( io ) cycle in dma mode after an arbitration phase won after a drq1 request . 24 output lmrdoprempt mode0 mode3 : oprempt , request to mca . this high active signal connected to the mca bus through an open collector inverter gate ( f38 ) indicates request of the mca bus following a request drq . this line becomes inactive after a won arbitration phase . mode1 mode2 : lmemrd , memory read strobe . this signal , active at low status , indicates a memory read . decoding of statuses s0 , s1 , and mio is authorized by command signal lcmd . 25 input chckdrq0 mode0 mode3 : drq0 , dma request in mode0 . this input , active at high status , indicates a dma channel request and triggers an mca bus preempt . output chckdrq0 mode2 : chck , channel check . this output , active at high status , connected to the mca bus through an open collector inverter , indicates appearance of a serious error that could disrupt system operation . this line becomes inactive after writing to 1 of bit 7 [ of ] pos 115 . mode1 : not used . 26 input 014mhz clock at 14 . 318 mhz . this clock is used for internal arbitration of requests drq0 and drq1 in modes . 27 input arbstat mode0 mode3 : arbitration , arb / gnt . this high level input indicates an arbitration phase during which the competing priority levels are presented on the mca bus ( arb0 - 3 ). at the time of the descending front of this signal , the mca bus is allocated to the highest priority that maintains its arb level , as long as this signal is at the low level ; the other competitors have withdrawn their levels . mode2 : stat , status . this local input reports the presence of an error status . this signal , active in the high status , activates bit 6 of pos 115 if an error is reported by the ( chck ) signal . mode1 : not used . 28 input arb0into mode0 mode3 : arb0 , arbitration number . this signal from the mca bus indicates the priority number and allows determination during the arbitration phase ( with arb1 - 3 ) of the winner . the arb0 signal is the least significant bit . mode1 mode2 : into interrupt . this local signal active at the high status indicates appearance of an interrupt . 29 input lprempt mode0 mode3 : prempt , mca bus request . this mca bus signal active at the low status indicates an mca bus request . mode1 mode2 : not used . 30 input tcchckdq1 mode0 : tc ( terminal count ). this mca bus signal , active at the low status , indicates the end of a dma mode exchange . this input is used to interrupt the burst signal . mode1 : not used . mode2 : ichck , error check . this local signal , active at low status , indicates appearance of a serious error . this input is used to generate the chck signal as well as bit 7 of pos 105 . mode3 : drq1 , dna request on channel 1 . this local input , active at high status , indicates request for a dma channel and triggers a preempt of the mca bus . 31 input chreset channel reset . this mca bus signal , active at high status , is used when powering on to set up the circuit . 32 input lcmd command . this signal from the mca bus is active at low status . this input indicates that the data are valid on the bus . its rising front indicates end of cycle . this signal is used to authorize input - output ( io ) and memory commands as well as data buffer commands . 33 - 34input modeo these local signals indicate the mode1 operating mode of the circuit . mode0 mode1 0 0 mode0 1 0 mode1 0 1 mode2 1 1 mode335 input testin circuit test input signal . this input must be at the low level in operation . 36 output testout circuit test output signal . 37 - 40output oarb0it0 mode0 mode3 : oarb ( 0 - 3 ), oarb1it1 arbitration number . bus oarb2it2 arbitration priority level . oarb3it3 these 4 bits are connected to mca bus arb through open inverter collectors ( f38 ) and are active at the time of an arbitration phase following an mca bus request . these signals are maintained when an arbitration is won and disappear if it is lost . mode1 mode2 : it ( 0 - 3 ) interrupt number . interrupt lines . these 4 outputs are connected to mca bus irq through open inverter collectors ( f38 ). the int input is transmitted to multiplexer ( 103 ) which sends it to one of the 4 it outputs ( 0 - 3 ) according to the configuration of bits 6 and 7 ( nit ) of pos register ( 112 ) in mode2 . these lines are active at the high level . 41 output lcsramdk0 mode0 mode3 : ldack0 , acknowledge channel 0 . this local output , active at low status , indicates an input - output ( io ) cycle in the dma mode after an arbitration phase won following a drq0 request in mode3 . this local output , active at low status , indicates arbitration won following a drq0 request in mode1 . this line becomes inactive at the next arbitration . mode1 mode2 : lcsram , chip select ram . this local output active at low status indicates selection of the ram field programmed in bits 2 of register pos 112 and 0 of register 114 for modes 1 and 2 and ( on the one hand ) register 113 in mode 2 or ( on the other hand ) bits 3 to 7 of register 113 in mode 1 . addresses and valid statuses are locked by lcmd . 44 output lcsio chip select input - outputs . this local output , active at low status , indicates selection of the input - output ( io ) field programmed in the pos registers , on the one hand whose size in modes 0 , 1 , and 3 is indicated by bits 1 , 2 ( ioa ) of register 112 and whose position is indicated by register 114 and bits 0 - 4 of register 115 , and on the other hand is validated ( enabled ) in mode 2 by bit 1 of register 112 , and whose position is indicated by bits 0 - 4 of register 115 and 2 - 7 of register 114 . 45 output lcsrom chip select rom . this local output , active at low status , indicates selection of the rom field programmed in fields ( seg rom ) of bits ( 3 - 5 ) of register 112 and bits 6 - 7 ( erom ) of register 112 in modes 0 , 1 , and 3 or of bit 1 ( vrom ) of register 114 in mode 2 . valid addresses and status reads are locked by lcmd . 46 output lcspoeid0 mode0 mode2 : lcspos - pos register selection . this local output , active at low status , indicates selection of pos registers 110 to 117 . the lsetup signal is locked by ladl . mode1 mode3 : oeid0 , identifier output enable ( output enable id0 ). this local output active at low status indicates reading of register pos 110 . 47 output lcdenoeid1 mode0 mode2 : lcden card enable . this local output active at low status indicates that the card is active ( bit 0 pos 112 ). mode1 mode3 : oeid1 , identifier id1 output enable ( output enable id1 ). this local output active at low status indicates reading of register pos 111 . 48 input bhe system byte high enable . this signal from the mca bus is used to validate the high byte when accessing a 16 - bit system . 49 - 60input a0 - a11 mca bus addresses . 68 - 79 a12 - a23 these bits , of which a0 is the least significant bit and a23 the most significant , are used to decode the memory and input - output ( io ) resources . 61 input ws1arb3 mode0 mode3 : arb3 , arbitration level . this mca bus signal indicates the priority level and enables the winner to be determined during the arbitration phase ( with arb0 - arb2 ). arb3 is the most significant bit . output ws1arb3 mode2 : ws1 , size of memory window . this local output indicates with bits ws0 and m116 the size of the memory used by the card . this size is defined in mode 2 by bits 6 , 7 ( wsize ) of register 113 and bit 0 ( m116 ) of register 114 . m116 = 0 : in first megabyte ws0 ws1 size 1 1 64 kb 0 1 32 kb 1 0 16 kb m116 = 1 : over 1 megabyte ws0 ws1 size 1 1 1 mb 0 1 512 mb 1 0 256 mb62 input ws0arb2 mode0 mode3 : arb2 , arbitration level . this signal from the mca bus indicates the priority level and enables the winner to be determined during the arbitration phase ( with arb0 - 1 - 3 ). output ws0arb2 mode2 : ws0 , memory window size . this local output indicates , with bits ws1 and m116 , the size of the memory used by the card . see table ws1 arb3 . 63 input arb1m116 mode0 mode1 mode3 : arb1 , arbitration level . this signal from the mca bus indicates the priority level and allows the winner to be determined during the arbitration phase ( with arb0 - 2 - 3 ). output arb1m116 mode2 : m116 . this local output indicates , as seen above , the position of the memory used in the memory space of the system . see table ws1 arb3 . 65 output cdsfdbk card selected feedback . this output active at high status connected to the mca bus through an inverter ( f04 ) indicates selection of a memory or input - output ( io ) zone used by the card . 66 output cdds16 card data size 16 . this output active at high status connected to the mca bus through an inverter ( f04 ) indicates selection of a memory or input - output ( io ) zone of 16 bits . 67 output cdchrdy channel ready . this output , connected to the mca bus through an inverter ( f04 ), indicates an unready state at high status . this line can be generated by programming bit 5 of pos register 115 and maintained by the rdy input . 80 output llden low byte data enable . this local output , active at the low level , indicates low access of a local input - output ( io ) or memory resource . this line must be connected to the enable chip of an external buffer ( 245 ). 81 output dir direction . this local output indicates the direction of data transfers currently under way . a low level indicates a read and a high level , a write . this line must be connected to the direction [ sic ] of an external buffer ( 245 ). 1 43 input vdd 5v2 22 input vss ground42 64__________________________________________________________________________ fig6 a shows in greater detail the logic blocks of decode circuit ( 106 ) which is composed mainly of a logic block of pos registers 112 to 115 , a logic block dps ( 1060 ) for commanding the pos registers , and a logic block ( 1061 ) dcs generating selection signals , either from input - outputs or from random access memory ram or from read only memory rom as a function of the addresses presented on the address bus . fig6 b is the detailed logic diagram of the pos registers composed of flip - flops whose outputs dposxy indicate the number by x , and can be loaded from data bus id0 - id7 in synchronization with signals lwpos2 , lwpos3 , lwpos4 , and lwpos5 selecting each of the registers in the write or read modes . fig6 c shows the multiplex logic enabling selection , in the read mode , of any of the four paths constituted by outputs dposxy of each of the four registers of which each of the significant bits is sent to a four - input multiplexer and an output ody , y being the corresponding number of bits . fig6 d shows the general logic of the pos register selection signals , particularly signals lwpos2 to lwpos5 which enable the pos registers and signals sel 0 , sel 1 which command the multiplexers to be selected or set up . the various signals are generated by decoding addresses ia0 to ia2 of address bus mca and signals lrsetup , lradl , lreset 1 , lcyiow , lcyior , cyior and mode 02 . fig6 e and 6f are the logic diagrams of the circuits that select inputs - outputs by the csio signal , random access memory ram by the csram signal , and read only memory rom by the lcsrom signal . these signals are generated by processing the various mio signals from the mca bus and mem816 , io816 from the card and indicating the bus size from these signals , for example by selecting inputs - outputs obtained by comparing addresses a3 to a15 with bits 1 to 7 of the pos4 register and bits 0 to 4 of the pos5 register . likewise , comparison of addresses a16 to a23 with bits 0 to 2 of the pos3 register forming the word segrom in mode 0 or with bits 3 to 5 of the pos2 register in mode 2 and bits 6 and 7 of register pos2 in mode 02 allow generation of the read only memory rom selection signal by intermediate signal adrom . fig6 g is the circuit selection logic diagram that selects the ram memory . in mode 1 this logic makes a comparison between low address bits a14 to a16 furnished by the mca bus with bits 3 to 5 of the pos3 register constituting the segram information to form an adram address enable signal . a ram memory enable signal enram is formed either by combining bits 6 and 7 of the pos3 register in the case of mode 1 operation or by bit 2 of the pos2 register in the case of mode 2 operation of the circuit . these signals produce the enram signal by addition . the address enable signal is also to be produced in mode 2 by comparing address bits a14 to a19 furnished by the address bus with bits 0 to 5 of the pos3 register or by comparing bits a18 to a23 furnished by the address bus with the same bits of the pos3 register , this comparison being made according to the value of the made24 signal indicating extension of the addresses to 16 megabits . fig7 a shows the breakdown of command logic circuit 105 into two logic blocks ( 1050 , 1051 ). the first ( 1050 ) furnishes the commands from the various elements that may be associated with this arbitration circuit such as a memory , inputs - outputs , or buffer registers . this circuit 105 also has a logic block ( 1051 ) buf forming the buffer selection signals , which , as will be seen below in the applications , may be associated with this arbitration circuit . fig7 b shows production of the ilhden and illden signals from external signals io816 and mem816 as liowr , mwrbsidk1 , cs10 , csram , csrom and from a signal indicating operation in mode 1 or 2 ( mode 1 , 2 ). fig7 c is the detailed logic diagram of block ( 1050 ) which produces outputs mwirbstdk1 as a function of the modes used and the burst oprmpt and dack1 signals and the mrdoprmit signal , also as a function of modes 1 or 2 or mode 0 and 3 . these circuits also produce internal signals from inputs so to s1 indicating the start of a cycle , with mio indicating whether the cycle is a memory or an input - output cycle , and ladl which ensures that the cycle is running properly by means of the address decode latch ( lock ). this information is used to generate internal signals lcymem indicating a memory cycle , cyior indicating an input - output read cycle , and lcyior , lcyiow indicating an input - output write cycle . fig8 a is the breakdown of an arbitration logic circuit ( 104 ) into a logic block ( 1040 ) handling interrupts , a logic block ( 1041 ) measuring arbitration , and a logic block ( 1042 ) generating the burst signal . fig8 b shows the detailed logic diagram of part of logic block 1041 producing , from signals from arbitration level [ s ] rarb0 to rarb3 coming from the mca bus and bits 2 to 5 of the pos2 register in mode 0 or bits 0 to 3 or 4 to 7 in mode 3 depending on the arbitration channel enabled by signal enarb1 or enarb0 , signals oarb0 to oarb3 . fig8 c is the detailed logic schematic of the part of logic block 1041 that allows signals enarb0 to enarb1 to be produced as well as other arbitration signals by using mode signals , acknowledge signals ldack1 , and request signals on bus loprmpt . fig8 d shows the detailed logic diagram of logic block it ( 1040 ) generating the interrupt levels in the arbitration procedure bearing in mind , on the one hand , arbitration numbers oarb0 to oarb3 furnished by arbitration circuit dma and the values of bits 0 and 1 of the pos3 register in mode 1 constituted by the nit information and by bits 6 and 7 of register pos2 in mode 2 . fig8 e is the detailed logic diagram of logic block ( 1042 ) generating the burst signal . this signal is produced from bits 4 and 5 of the pos3 register and from signals cden , lbcmd , lrprempt , larb , itccmckdd1 , lwon1 , lcyiol , idrqo in order to satisfy the dma cycle with a burst in mode 0 as shown in fig1 . fig9 represents the detailed logic diagram of mode decode circuit ( 108 ) that , from signals rmod0 and rmod1 available at input pins 3334 , allow these signals to be decoded in the form of four signals mode 0 , mode 1 , mode 2 , mode 3 and additional signals mode 12 , mode 02 , mode 03 necessary for exploiting and selecting certain information contained in the pos registers by means of the circuits described above . fig1 is the detailed logic diagram of the circuit generating the ready signal upon reception of the irdy signal to form the icdrdy signal intended for the mca bus by using signals indicating a memory cycle ladrom , ladram or an input - output cycle ladio , as well as by using signals selecting the random access memory or inputs - outputs , csram and csio respectively , and by using bit 5 of the pos5 register constituting the rdy information . this circuit also uses signals rmio and lwon1 . thus , the integrated circuit represented , once installed on a card , permits the following functions depending on the information contained in the registers , whatever the operating mode used : control of data buffer registers by signals dir , llden , and lhden ; generation of read or write input - output commands with signals liord and liowr ; decoding a read only memory rom field by generating signal lcsrom , this field being programmable in terms of position and size in the rom memory space of the bios extension defined by pos register ( 112 ); decoding an input - output ( io ) field by the lcsio signal , this field being programmable in terms of position and size in the input - output ( io ) space defined in the pos registers ( 112 , 114 , 115 ); management of ready channel signal ( cdchrdy ) to obtain a synchronous cycle at 300 ns or an asynchronous cycle higher than 300 ns with the local input ( rdy ); local inputs of signals mem816 and io816 , defining the width of the memory or input - output data bus . for modes 0 and 2 , this circuit also allows selection of pos registers ( 110 , 117 ) by sending signal ( lcspos ) and generating card enable signal ( lcden ). for mode 0 , this circuit implements : the function of management of a dma channel in the single or burst mode , authorizing a channel by defining the burst size and the arbitration level programmable in register ( 113 ); generation of the dack signal after participation in an arbitration phase following a drq request . in modes 1 and 2 , this circuit implements the memory command generation functions by furnishing signals ( lmemrd ) and ( lmemwr ) and the random access memory ram field decode function by furnishing signal ( lcsram ), this field being programmable in terms of position and size in the system memory space by the pos registers ( 112 , 113 , 114 ) in mode 2 and the pos register ( 113 ) in mode 1 . this circuit also furnishes the multiplex function of one local interrupt line out of four interrupt levels defined by pos register ( 102 ) in mode 2 and by pos register ( 113 ) in mode 1 . also , in mode 2 , this circuit furnishes the signal generation function ( chck ) and management of bits 6 and 7 of the pos register ( 115 ) with local inputs ( ichck ) and ( stat ). in addition , in modes 1 and 3 , this circuit furnishes the selection function of the external identification registers by sending signals ( oeid0 ) and ( oeid1 ). finally , in mode 3 , this circuit adds to the functions of modes 1 and 3 and in common to the four modes , a function of management of two dma channels in the single mode with internal arbitration and programmable arbitration level in pos register ( 113 ) and a signal ( dack0 ) or ( dack1 ) generation function after an mca arbitration phase following a request ( drq0 ) or ( drq1 ), the fairness mode always being active . it will be noted that this circuit allows control of generation of the identifiers necessary for operation with an mca bus by decoding the pos ( 110 ) and pos ( 111 ) addresses and commanding access to the registers in modes 1 , 2 , and 3 . in the hardwired identifier mode for a card containing no read only memory of the prom type , the circuit generates signals ( oeid0 ) or ( oeid1 ) with ( la0 at 0 or 1 ) in order to control the external buffer generating the coupler card identifier . in mode 0 , in a nonhardwired fashion , in the case where the coupler card has a read only memory which furnishes this identifier locally after a period . in this case , the circuit generates an identifier request directed to the local interface and opens the coupler data buffer sending signal ( cdpos ) with ( lao - 2 at 0 or 1 ). thus , depending on the operating modes selected , this circuit can be used in various applications shown in fig6 to 9 . fig1 is the schematic diagram of an intelligent interface disk controller card . this card is connected to a bus ( 1 ) of the mca ( micro channel architecture ) type via a bus arbitration integrated circuit ( 102 ) which is the interface between bus ( 1 ) and the circuits on the card . for further details on this integrated circuit ( 102 ), see the patent application filed by bull s . a . entitled &# 34 ; mca bus arbitrator integrated circuit and applications of such a circuit .&# 34 ; this circuit ( 102 ) manages , by means of signal ( csrom ) sent over line ( 623 ), the accesses to a memory ( 3 ) of the eprom type which contains the bios ( basic input / output system ) part of the disk interface . a coupler circuit ( 4 ) physically provides the input - output interface between the central processing unit and a microprocessor circuit ( 6 ) as well as the interface between a cache memory ( 5 ) composed of dynamic random access memories and a disk controller circuit ( 9 ). coupler circuit ( 4 ) is connected to disk controller circuit ( 9 ) of the type marketed by nec under number 7282 , by two separate data buses , and one bus md ( 0 : 7 ) ( 450 ) connecting coupler circuit ( 4 ) of cache memory ( 5 ), and the other bus cd ( 0 : 7 ) ( 492 ) connecting the disk controller both to microprocessor ( 6 ) and to coupler circuit ( 4 ). coupler circuit ( 4 ) receives the data from mca bus ( 1 ) via bus ( 41 ) that interfaces with this mca bus ( 1 ) via buffer registers ( 11 ) commanded by signals dir , lden , and hden from arbitration circuit ( 102 ). a bus ( 34 ) also allows eprom memory ( 3 ) containing the bios interface program to be connected with bus ( 41 ). a bus ( 241 ) connects this bus ( 41 ) to interface coupler ( 2 ) for the mca bus . coupler circuit ( 4 ) also receives , via a bus ( 412 ), addresses la ( 0 : 15 ) coming through buffer circuits ( 612 ) from address bus a ( 0 : 23 ) ( 121 ) which connects mca bus ( 1 ) to interface coupler circuit ( 102 ). these buffer circuits ( 612 ) are commanded by signal ( adl ) from arbitration circuit ( 102 ). signals ( ma , oe24 , sbhe ) also pass through this bus ( 121 ). a control bus ( 120 ) allows signals ( s0 , s1 , m / io , dl , cmd ) from mca bus ( 1 ) to be received . coupler interface circuit ( 2 ) transmits via bus ( 213 ), interfaced by a buffer register ( 13 ), and receives signals arb ( 0 : 3 ) via bus ( 210 ). a control bus ( 21 ) receives and transmits signals ( tc , burst , preempt , arb /- gnt ). interface circuit ( 2 ) sends , via control bus ( 24 ), signals ( cspos , csio ; iord , iowr ). circuit ( 2 ) receives or transmits via control lines ( 42 ), signals ( drq , dack ). coupler circuit ( 4 ) receives via line ( 694 ) the index signal coming from the disk and , via lines ( 640 ), signals ( iostb , mrq , r / w , refrq ) coming from microprocessor circuit ( 6 ). microprocessor circuit ( 6 ) also receives signals ( itga ) and ( atn ) coming from coupler circuit ( 4 ) via lines ( 460 ). this microprocessor ( 6 ) is connected by an address bus ca ( 0 : 19 ) ( 674 ), with both coupler circuit ( 4 ) and static memory ( 7 ), and finally with eprom memory ( 8 ) which contains the card operating program . coupler circuit ( 4 ) sends control signals ( we , ras0 , ras1 , cas0 , cas1 ) via link ( 451 ). disk controller ( 9 ) receives from disk connector ( 90 ), via lines ( 95 ), signals ( cmdc , atn , sct , dsel , index , xack , stsd , drdy ). likewise , this circuit ( 9 ) receives via line ( 94 ), the read data signal ( rnrz ); via line ( 93 ), the read clock signal ( rclk ); via line ( 92 ), the write data signal ( wnrz ); via line ( 91 ), the write clock signal ( wclk ); and via line ( 96 ), interfaced by circuit ( 17 ), signals ( xreq , cmdd , rg , wg , ame , ds ( 0 : 2 ), hs ( 0 : 3 )). in this application , the arbitration circuit operates in mode 0 and the memory and input - output data buses are fixed at 8 bits by the fact that inputs m8 / 16 and io8 / 16 of the circuit are held at the low logic level . fig1 represents a third application of the arbitration circuit wherein arbitration circuit ( 102 ) commands , via signals ( dir , lden ), a buffer register ( 811 ) of the 8 bit data bus ( 841 ); by signals ( loeid ), buffer registers ( 814 ) containing the card identifier , and by signal ( ladl ), the locked registers of address bus a0 - a23 which is converted into a 14 bit bus ( 817 ). this circuit ( 102 ) is connected in mode 3 and at its inputs ( io818 ) and ( mem818 ) receives the signals allowing it to operate with an 8 bit input - output bus and an 8 bit memory bus . circuit ( 102 ) exchanges signals ( arb gnt , arb0 - 3 , lpreempt , lcdchrdy , cdsfdbk , ladl , s0 , lcmd , made24 , sbhe ) with the mca bus . the circuit sends signal ( lcsrom ) to a prom memory ( 806 ) which contains the bios and which is connected both to data bus ( 841 ) and to address bus ( 817 ). a configuration register ( 807 ) is also connected to data bus ( 841 ). on the data bus and on the address bus there is also connected a communications interface circuit , part number 82 , 590 ( 802 ) connected to a network physical interface ( 803 ) which communicates with two telecom paths . circuit ( 802 ) exchanges signals ( lcsio , liord , liowr , drq0 , drq1 , ldack0 , ldack1 ) with the arbiter . circuit ( 802 ) sends interrupt outputs it to a logic ( 804 ) that multiplexes the interrupts and also receives signal ( lcsio ) from circuit ( 102 ) and address signal ( la1 ) via register ( 812 ). this interrupt logic is connected at the output to an interrupt multiplexing logic ( 805 ) which emits signal ( irq ). when used on a card of the type shown in fig1 , the circuit operates , when set up , in the sequence shown in fig1 and , for a memory access cycle , after executing a dma arbitration cycle with the mca bus corresponding to fig1 , it executes a dma exchange in the single mode according to the cycle shown in fig1 . finally , when used in a card of the type shown in fig1 , the circuit operates in the dma burst mode in the sequence shown in fig1 . fig1 represents another utilization of arbitration circuit ( 102 ) wherein the signals ( dir , lden , hden ) command buffer registers ( 911 ) of the 16 bit data bus and convert it into an 8 bit bus ( 941 ). likewise , signal ( loeid ) commands registers ( 914 ) containing the card identifier element transmitted over 8 bits to bus ( 941 ). finally , signal ( ladl ) commands locked registers ( 912 ) which convert the 24 bit address bus into a 16 bit address bus ( 917 ). this address bus is sent to an eprom ( 915 ) containing the local bios . this eprom is connected by an 8 bit bus or 16 bit bus to bus ( 941 ). address bus ( 917 ) sends its first 13 lines to an &# 34 ; intel 82 560 &# 34 ; memory management circuit . this circuit ( 902 ) receives signals ( lcsrom , liord , liowr , lcsio , lcsram ), which signals are also sent to the eprom and an interrupt logic ( 903 ). this interrupt logic exchanges signal ( int ) with circuit ( 102 ). circuit ( 902 ) transmits signal ( rdy ) to arbiter ( 102 ). this circuit ( 902 ) commands a buffer ( 907 ) which allows bus ( 941 ), which has 8 data lines , to be converted into a 16 line bus ( 930 ). this circuit ( 902 ) furnishes a 12 bit address bus ( 927 ) to a set of static random access memories ( 904 ) connected to the 16 bit data bus ( 930 ). likewise , this circuit ( 902 ) sends the command signals ( 928 ) necessary for commanding the static random access memory . finally , this circuit ( 902 ) exchanges the dma command signals and interrupt signals via a bus ( 929 ) with an interface management circuit 82 , 592 ( 905 ), which itself is connected at the output to a physical interface circuit 82 , 501 ( 906 ). when used on a card of the type shown in fig1 or 13 , the circuit operates when started in the cycle of sequences shown in fig1 and , for a read cycle or a memory write cycle in the sequences shown in fig1 and 17 , respectively . other modifications within the reach of the individual skilled in the art are also part of the spirit of the invention .	6
fig1 is a schematic block diagram illustrating an ignition control system in an embodiment according to the present invention . crank angle position sensor 10 is fixed to an axle of a distributor of , for example , a four - cycle , six - cylinder internal combustion engine . the sensor 10 generates a predetermined number of pulse signals , illustratively six pulse signals , each of which have a pulse width corresponding to a predetermined crank angle θ 1 , per one revolution of the axle of the distributor at every predetermined crank angle position . a well - known air - flow sensor 20 is provided for generating an analog signal which indicates the amount of air sucked into the engine . a power supply circuit 30 generates a voltage which is applied to a primary winding of an ignition coil . the pulse signals from crank angle position sensor 10 are applied to a speed signal forming circuit 40 for generating a digital signal which indicates the rotational speed n of the engine . the generated digital speed signal is applied to an ignition timing signal generating circuit 70 . the outputs from the air - flow sensor 20 and the power supply circuit 30 are converted into digital signals at an intake air amount signal forming circuit 50 and at a voltage signal forming circuit 60 , respectively . the outputs of circuits 50 and 60 are applied to ignition signal generating circuit 70 . an ignition signal from ignition signal generating circuit 70 is applied to an ignition current control circuit 80 which controls the ignition current transmitted into an ignition mechanism 90 . fig2 is a detailed block diagram illustrating a part of the ignition control system of fig1 . as illustrated in fig2 the speed signal forming circuit 40 comprises : a clock signal generator 41 ; an and gate 43 , to which clock pulses from generator 41 and pulse signals from crank angle position sensor 10 are conducted via an input terminal 42 ; a binary counter 44 which counts the number of clock pulses applied via and gate 43 ; a latch circuit 45 which momentarily stores outputs of the binary counter 44 ; and a decade counter 46 for generating decade outputs which are used to control the reset timing of counter 44 and the input operation of data applied to latch circuit 45 . in this embodiment , binary counter 44 counts the number of clock pulses applied thereto while the pulse signal fed from the crank angle position sensor 10 is in a high logic state . in other words , a crank shaft of the engine rotates through a predetermined crank angle θ 1 , and then , latch circuit 45 stores the counter number of clock pulses in the counter 44 at every 120 ° of rotation of the crank . as a result , a rotational speed signal of the engine is formed by this speed signal forming circuit 40 three times for each revolution of the crank . the intake air amount signal forming circuit 50 which generates a digital signal corresponding to the amount of air sucked into the engine , comprises : an amplifier 52 for amplifying the output analog signal from air - flow sensor 20 via an input terminal 51 ; an analog - digital converter ( a / d converter ) 53 for converting the amplified analog signal to a digital signal ; and a latch circuit 54 for momentarily storing the converted digital signal at every 120 ° of rotation of the crank . the power supply circuit 30 is composed of a battery 31 and an ignition switch 32 . the voltage signal forming circuit 60 comprises : an emitter - follower circuit 61 to which a voltage developed across the terminals of battery 31 is applied ; an a / d converter 62 for converting the output of the circuit 61 to a digital signal ; and a latch circuit 63 for momentarily storing the converted digital signal at every 120 ° of rotation of the crank . therefore , circuit 60 forms a digital signal which corresponds to the voltage at the terminals of battery 31 , which is applied to the primary winding of the ignition coil . the ignition signal generating circuit 70 comprises : a digital computer 71 having a micro - processor and a read only memory ( rom ) ( not shown ); a first presettable down - counter 72 for determining a time at which the current flowing to the ignition coil primary winding is discontinued , that is , for determining ignition timing ; and a second presettable down - counter 73 for determining a time at which the current flowing to the ignition coil primary winding is initiated . the digital computer 71 calculates an optimum ignition timing based on the rotational speed signal and the intake air amount signal which are fed from the above - mentioned forming circuits 40 and 50 , in accordance with a well - known algorithm . in addition , digital computer 71 calculates a time period t a required by the crank shaft for rotating from the predetermined crank angle position to a position of the calculated optimum ignition timing , and ; thereafter , the digital computer 71 feeds the down - counter 72 with a digital signal having a value corresponding to the calculated time period t a divided by a period of clock pulses applied to down - counter 72 . furthermore , digital computer 71 calculates a time period t on ( hereinafter called an &# 34 ; on - current &# 34 ; period ) during which current flows through the ignition coil primary winding based on the above - mentioned rotational speed signal and on the voltage signal fed from the voltage signal forming circuit 60 , by using a specific algebraic function described hereinafter . the digital computer then calculates a time period t off ( hereinafter called an &# 34 ; off - current &# 34 ; period ) during which current does not flow through ignition coil primary winding , from the calculated on - current period t on . thereafter , the computer 71 calculates a time period t b by adding the previously calculated time period t a and the calculated off - current period t off , and then , feeds down - counter 73 a digital signal corresponding to the value of the calculated time period t b divided by a period of the clock pulses applied to down - counter 73 . the ignition current control circuit 80 comprises : a flip - flop 81 which is set and reset by output signals from the first and second down - counters 72 and 73 , respectively , and a driving circuit 82 for controlling the conduction of a current from a battery 31 via an ignition switch 32 to a primary winding of ignition coil 91 in ignition mechanism 90 , in accordance with an output signal from flip - flop 81 . the ignition mechanism 90 is comprised of a conventional ignition coil 91 , a distributor 92 and spark plugs 93 . the operation of the present embodiment will now be described by referring to fig3 and 4 . the crank angle position sensor 10 generates a standard pulse signal , as shown in fig3 -( b ), at every crank angle position of 70 ° before top dead center ( 70 ° btdc ); in other words , at every standard crank angle position which appears at an interval of 120 °. the pulse width t . sub . θ . sbsb . 1 of this standard pulse signal corresponds to a time period required by the crank shaft for rotating at a crank angle of θ 1 . therefore , this pulse width t . sub . θ . sbsb . 1 maintains a fixed relationship with respect to the angle of rotation of the crank , but varies in time in accordance with the rotational speed of the engine . fig3 -( a ) shows a crank angle signal waveform relative to a position which corresponds to a position advanced 10 ° before top dead center of the first cylinder . hereinafter , the operation of the present embodiment will be illustrated by using the above - mentioned crank angle shown in fig3 -( a ). as mentioned hereinbefore , the crank angle position sensor 10 generates a standard pulse signal having a pulse width of t . sub . θ . sbsb . 1 at each crank angle position of 60 °, 180 °, 300 °, 420 °, 540 ° and 660 °. on the other hand , the clock signal generator 41 generates pulse signals with an interval of , for example , 12 . 5 μsec , as shown in fig3 -( c ). the binary counter 44 counts the number of the clock pulse passing within a time period corresponding to the pulse width t . sub . θ . sbsb . 1 of the standard pulse signal . therefore , the counted number of clock signals counter 44 is inversely proportional to the rotational speed of the engine . the decade counter 46 is reset at the negative edge of the standard pulse signal , and then , counts the number of the above - mentioned clock pulses so that the decade outputs of the counter number appear at output terminals q 1 to q n thereof . fig3 -( d ) and fig3 -( e ) show the decade outputs appearing at the output terminals q 1 and q 3 , respectively . the output of q 1 is delayed from the negative edge of the standard pulse signal by one period of the clock pulse , and the output of q 3 is delayed from the negative edge by three periods of the clock pulse . the output of q 1 is used to transfer the counted number in the counter 44 to the latch circuit 45 , and the output of q 3 is used to reset the counter 44 . therefore , a new rotational speed signal is stored in the latch circuit 45 every time the standard pulse signal appears . furthermore , since the output of q 1 is also applied to the respective latch circuits 54 and 63 of the intake air amount signal forming circuit 50 and the voltage signal forming circuit 60 , a new intake air amount signal and a new voltage signal are stored in the latch circuits 54 and 63 every time the standard pulse signal appears , respectively . the digital computer 71 reads the data from the latch circuits 45 , 54 and 63 in accordance with control signals , respectively , and then , carries out the calculation of an optimum ignition timing and of an optimum time period of supplying current to the ignition coil primary winding in accordance with a predetermined program . the calculation of an optimum ignition timing can be accomplished by using various known algorithms . in one of the known algorithms of calculating an optimum ignition timing , functions f 1 ( n ) and f 2 ( n ) having specific relationships with respect to the rotational speed n ( rpm ) of the engine 99 shown in fig5 a and 5b , respectively , are preliminarily stored in the rom . the computer reads out values of the functions f 1 ( n ) and f 2 ( n ) from the rom , in accordance with the actual rotational speed n ( rpm ) indicated by the rotational speed signal from the latch circuit 45 . then , the computer calculates an optimum spark - advance time period t e by using the above - mentioned values of functions f 1 ( n ) and f 2 ( n ), the amount q ( g / sec ) of air sucked into the engine per second , which amount is indicated by the intake air amount signal from the latch circuit 54 , and the following equation : according to the above - mentioned algorithm , an optimum spark - advance time period t e , as shown in fig5 c , corresponds to a time period between an optimum ignition timing and top dead center . in other words , t e represents a time period which is obtained by converting an optimum spark - advance angle into a unit of time , in accordance with the rotational speed of the engine . thereafter , computer 71 calculates a time period t a , shown in fig3 -( f ), between the ignition timing and a standard crank angle position , and feeds the down - counter 72 with a signal value a a which corresponds to the time period t a divided by a period of the clock pulses ( 12 . 5 μsec ). the calculation concerning a time period of supplying current to the ignition coil primary winding by the digital computer 71 will now be described with reference to the flow diagram shown in fig4 . at a point 100 of the program , the digital computer 71 reads out the voltage signal v b from the latch circuit 63 , and then , at a point 101 , calculates a maximum value t onmax of the time period of supplying current to the ignition coil primary winding ( hereinafter called as a maximum on - current period t onmax ) by using the following equation : ## equ1 ## on the other hand , at a point 102 of the program , the computer 71 calculates the number chrpm of the clock pulses having a period of 12 . 5 μsec , which are generated within a time period required by the crank shaft to rotate at a crank angle of 120 °. this calculation is carried out based on the actual rotational speed n of the engine , by using the following equation : then , at a point 103 , the computer 71 calculates an optimum on - current period t on at the actual rotational speed and the actual voltage applied to the ignition coil primary winding from the equation : ## equ2 ## at a point 104 , whether the on - current period t on obtained at the point 103 is smaller than or equal to the maximum on - current period t onmax obtained at the point 101 is judged . if the on - current period t on is t on ≦ t onmax , the program proceeds to a point 106 . if the on - current period t on is t on & gt ; t onmax , the on - current period t on is made equal to the maximum on - current period t onmax at the point 105 , and then , the program proceeds to the point 106 . according to the above - mentioned procedures of the program from the points 100 to 105 , the optimum on - current period t on as a function of the rotational speed n and of the applied voltage v b , as indicated in fig6 is obtained . in fig6 the linear line portion a is represented by the experimental equation used for the calculation at the point 101 , and the non - linear line portion b is represented by the experimental equation used for the calculation at the point 103 . the digital computer 71 calculates a number a on of the clock pulses , having a period of 12 . 5 μsec , which appear during the on - current period t on , in other words , calculates the number a on from the equation : then , the computer 71 calculates a number a off of the clock pulses having a period of 12 . 5 μsec , which appear during the off - current period t off , from the following equation , at a point 107 : this equation can be easily derived because the ignition in each cylinder of the engine occurs at an interval of the crank angle of 120 °. then , at points 108 and 109 , computer 71 limits the off - current period t off to not less than a predetermined value , for example , 0 . 6 msec . according to this procedure , no current is supplied to the ignition coil for a predetermined period after ignition , so that enough time for firing the air - fuel mixture in the cylinder can be obtained . in practice , the computer 71 compares the number a off with the quotient of 0 . 6 msec / 12 . 5 μsec at the point 108 , and then , if the number a off is less than the above - mentioned quotient , this a off is made equal to the quotient of 0 . 6 msec / 12 . 5 μsec , at the point 109 . thereafter , at a point 110 , the computer 71 calculates a value a b of the time period t b ( shown in fig3 -( g )) divided by a period ( 12 . 5 μsec ) of the clock pulse , from the following equation : the calculated value a b is fed to and preset in down - counter 73 . the down - counter 72 and 73 start the operation of counting the number of the clock pulses fed from the clock signal generator 41 when the output of q 3 is fed from the decade counter 46 , in other words , when the crank shaft rotates to the standard crank angle position . when the counted number reaches a figure equal to the preset value a a fed from the digital computer 71 , the down - counter 72 stops the counting operation and simultaneously generates a pulse signal . that is , as shown in fig3 -( f ), the down - counter 72 generates a pulse signal at the time a delay occurs at the time period t a from the standard crank angle position , and the flip - flop 81 is set by this pulse signal . as a result , the driving circuit 82 operates so that a primary current fed to the primary winding of the ignition coil 91 is cut off . on the other hand , when the counted number reaches a figure equal to the preset value a b fed from the computer 71 , the down - counter 73 stops the counting operation and simultaneously generates a pulse signal . as shown in fig3 -( g ), down - counter 73 generates a pulse signal at a time a delay occurs at the time period of t b from the standard crank angle position , and the flip - flop 81 is reset by this pulse signal . as a result , current flow through the primary winding is started . when the primary current flow stops , as shown in fig3 -( h ), a high voltage shown in fig3 -( i ) is induced in the secondary winding of the ignition coil 91 and fed to the spark plugs 93 via the distributor 92 to cause a spark to jump the spark - plug gap . it is apparent that various known algorithms for calculating an optimum ignition timing can be used with the ignition energy control method according to the present invention . for example , an optimum ignition timing can be calculated by using a mapping method instead of the algebraic function . furthermore , a vacuum level signal or a throttle valve opening degree signal can be used instead of the intake air amount signal . in the foregoing embodiment , the number of the clock pulses fed to the down - counters is employed as a unit of the various calculations . however , in these calculations , time or crank angle can be used as a unit . in the embodiment shown in fig2 an internal combustion engine having six cylinders is employed . however , the present invention can similarly be applied to embodiments in which a number of cylinders different from six are employed . according to the present invention , the time period for supplying current to a primary winding of an ignition coil is calculated from an algebraic function in which the actual voltage applied to the ignition coil primary winding and the actual rotational speed of the engine are used as variables . in view of this teaching , an ignition control system which supplies the required ignition energy to the engine , irrespective of the change of the voltage applied to the ignition coil and irrespective of the change of the rotational speed of the engine , can be constructed by using a digital computer having small storage capacity . thus , an ignition control system can be miniaturized and formed at a very low cost .	5
in fig1 there is shown generally at 10 an automatic washer and dryer constructed as a single unit , which includes in a bottom half an automatic washer 12 and in a top half an automatic dryer 14 . the automatic washer 12 is a conventional vertical axis type washer which has an outer cabinet 16 with a horizontal top surface 18 and openable lid 20 providing access into the interior of the washer . the washer has a treatment zone which includes an imperforate wash tub 22 , a perforate wash basket 24 and a vertical axis agitator 26 . the washer tub mechanism is mounted on legs 28 and includes a spring - type suspension 30 . an electric motor 32 is connected via a transmission 34 to operate the washer 12 through a series of spinning and agitation steps . the dryer 14 is also of conventional design such as that disclosed in u . s . pat . no . 3 , 890 , 719 which was assigned to the same assignee as the present application , and which specification is included herein by reference . the dryer 14 includes an outer cabinet 36 with a vertical front panel 38 having an openable door 40 therein to provide access into the interior of the dryer which includes a dryer treatment zone comprising a rotatable horizontal axis drum 42 . the drum 42 is mounted for rotation on rollers 44 and is driven by an electric motor 46 through a transmission means such as a continuous drive belt 48 . an air inlet 52 and air outlet 50 and an air heating means 54 are also provided in a normal fashion to provide a continuous stream of heated air into the interior of the rotating drum 42 . interior baffles 56 ( only one shown ) ensure irregular movement of a clothes load being dried within the drum 42 . a single control panel 58 is mounted at the bottom of the dryer housing 36 above the washer 12 and contains controls and switches 60 used to operate both the washer 12 and dryer 14 through their preprogrammed series of automatic laundering steps . fig2 through 5 show a lid latching mechanism 62 which is comprised of a latch pin 64 captured in a guide means 66 for limited vertical movement . as best seen in fig4 and 6 , the pin 64 has a narrow upper cylindrical portion 68 which is joined with a wider cylindrical central portion 69 at a shoulder 70 . the cenral cylindrical portion 69 is joined to a still wider cylindrical lower portion 71 at a second shoulder 72 , thus providing three cylindrical portions of progressively larger diameters from the upper portion 68 to the lower portion 71 . the guide 66 has a first internal cylindrical passage 74 which extends from an open bottom end up to a shoulder 76 where it communicates with a second narrower cylindrical passage 78 . the first cylindrical passage has a diameter slightly larger than the diameter of the lower portion 71 of the pin 64 . the second cylindrical passage has a diameter slightly larger than the diameter of the central pin portion 69 , but slightly smaller than the diameter of the lower portion 71 . thus , the pin 64 is free to move upwardly within the guide 66 until the second shoulder 72 of the pin engages the shoulder 76 of the guide . when the pin 64 is inserted into the guide 66 , the upper cylindrical portion 68 of the pin projects above a top end 82 of the guide to allow for a retaining member 84 to be positioned on the upper portion 68 of the pin adjacent to the first shoulder 70 to prevent the pin from moving downward within the guide beyond a predetermined limit established by the shoulder 70 . the dryer cabinet 36 has a bottom wall 90 including an indented channel portion 92 providing clearance for an end 94 of the lid 20 in the open or latched position as is shown in fig3 and 4 . as seen in fig2 the length of the channel 92 is just longer than the width of the lid 20 . the guide 62 is secured on the inside of the dryer cabinet by appropriate fastening means such as screws . a preferred embodiment of the fastening as seen in fig4 and 5 includes a screw 96 in the base of the channel 92 which extends ino a perpendicular leg 98 of the guide 62 and two lateral screws 100 , 102 which engage first portions 101 , 103 of the main body portion 105 of the guide 62 . an opening 104 in the dryer bottom wall 90 is provided for the pin 64 to protrude through the bottom wall . referring to fig3 as the washer lid 20 is opened , it pivots about a fulcrum 104 until the front edge 94 contacts the lower end 75 of the pin 64 . further rotation of the lid 20 moves the pin 64 upward as shown in phantom in fig4 allowing the lid front edge 94 to move into the channel 92 in the dryer bottom wall 90 . as the lid 20 is rotated into the channel 92 , the pin 64 is freed from contact with the lid and falls by gravity in front of the lid 20 . the lid 20 is positively trapped behind the pin 64 , and falls forward to rest against the pin . to lower the lid , the operator must push the pin 64 upward past the lid front edge 94 , releasing the lid . this can be easily done by the operator with one hand . in some washer / dryer combinations , the washer opening is smaller and thus the washer lid 20a is shorter as seen in fig6 . in this arrangement , the front edge 94a of the lid 20a does not extend up into the channel 92 of the dryer and therefore , the lid 20a would not be captured by the latch pin 64 . however , the latching mechanism of the present invention can be utilized with this shorter lid without changing the basic construction of the dryer . to accommodate the shorter lid 20a , the position of the latch 62 is rotated 180 degrees relative to the channel 92 such that the pin carrying portion is secured behind the channel 92 rather than in front of it . a new opening 104a is provided in the dryer bottom wall 90 to allow the bottom end 70 of the pin 64 to protrude . a mounting arrangement similar to that described above is utilized in this alternative emboidment and the operation of the latch mechanism is identical to that described above . however , instead of the rotation of the lid front edge 94a into the channel 92 , it is rotated to a position behind the pin 64 allowing the pin to fall by force of gravity in front of the lid 20a . the same manual release is required to unlatch the lid . as is apparent from the foregoing specification , the invention is susceptible of being embodied with various alterations and modifications which may differ particularly from those that have been described in the preceding specification and description . it should be understood that we wish to embody within the scope of the patent warranted hereon all such modifications as reasonably and properly come within the scope of our contribution to the art .	8
below reference to a drawing attaching a desirable embodiment of the present disclosure and explains in detail . also , the present embodiment doesn &# 39 ; t limit the present disclosure extent of a right , but merely suggests an example , various modifications in the extent of not leaving the technological main point is possible . fig2 is a drawing schematically depicting an elongated sheet carrying speed adjusting system , fig3 and fig4 are drawings schematically showing the elongated sheet carrying speed adjusting system operation process , in the case of carrying speed of the elongated sheet located at the unit of front - end is faster than the elongated sheet located at the unit of rear - end , fig5 and fig6 are drawings schematically showing the elongated sheet carrying speed adjusting system operation process , in the case of carrying speed of the elongated sheet located at the unit of front - end is slower than the elongated sheet located at the unit of rear - end , fig7 is a drawing schematically depicting an auxiliary belt device comprising an auxiliary belt roller with low friction coefficient , fig8 is a drawing schematically showing three auxiliary belt rollers in an auxiliary belt device comprising an auxiliary belt roller with low friction coefficient , fig9 is a drawing schematically depicting four auxiliary belt rollers in an auxiliary belt device comprising an auxiliary belt roller with low friction coefficient , fig1 is a drawing schematically depicting five auxiliary belt rollers in an auxiliary belt device comprising an auxiliary belt roller with low friction coefficient , fig1 is a drawing schematically showing bearing included in an auxiliary belt roller with low friction coefficient , fig1 is a drawing schematically illustrating an elongated sheet slacking sensing device in an auxiliary belt device having three auxiliary belt rollers , fig1 is a drawing schematically depicting an elongated sheet slacking sensing device in an auxiliary belt device having five auxiliary belt rollers , fig1 is a drawing schematically showing the elongated sheet slacking sensing device provided with the electrospinning apparatus , fig1 is a process schematic diagram schematically showing the embodiment of the electrospinning apparatus , fig1 is a process schematic diagram schematically showing the fourth embodiment of the electrospinning apparatus , fig1 is a schematic diagram schematically illustrating a nozzle block of the electrospinning apparatus , and fig1 is a process schematic diagram schematically showing the fifth embodiment of the electrospinning apparatus . as illustrated in the drawing , the electrospinning apparatus ( 1 ) according to the present invention of the first embodiment comprises the elongated sheet carrying speed adjusting system ( 30 ) which is installed in the electrospinning apparatus ( 1 ), adjusts and controls the carrying speed and carrying time of the elongated sheet ( 15 , 15 ′) carried from each of the unit ( 10 , 10 ′) according to each of the unit ( 10 , 10 ′) here , the electrospinning apparatus ( 1 ) comprises a spinning solution main tank ( not shown ) which fills spinning solution inside , a metering pump ( not shown ) to supply the required amount of polymer spinning solution filled in the spinning solution main tank , a nozzle block ( 11 ) having plurality of pin type formed nozzles ( 12 ) to discharge polymer spinning solution inside the spinning solution main tank , a collector ( 13 ) which is installed separately in predetermined space from the nozzle ( 12 ) to collect spinning solution jetted from the nozzle bock ( 11 )&# 39 ; s nozzle ( 12 ) and a unit ( 10 ) containing inside a power supply device ( 14 ) which generates voltage to the collector ( 13 ). meanwhile , spinning solution supplied through the nozzle ( 12 ) inside the unit ( 10 ) is composed of solute and solvent , for solute is polymer including siloxane alone or combination of siloxane and selected coupler among monomethacrylate , vinyl , hydride , distearate , bis ( 1 , 2 - hydroxymethyl ), methoxy , ethoxylate , propoxylate , diglycidyl ether , monoglycidyl ether , monohydroxyalkyl , bishydroxyalkyl , chlorine and bis (( aminoethyl - aminopropyl ) dimethoxysilyl ) ether . it is preferably selected one or more among polyvinylidene fluoride , polyvinylidene fluoride - hexafluoropropylene copolymer , composite composition thereof , polyamide , polyimide , polyamideimide , poly ( meta - phenylene isophthalamide ), meta - aramid , poly ethylene chlorotrifluoroethylene , polychlorotrifluoroethylene , poly ( methyl methacrylate ), polyacrylonitrile , polyvinylidene chloride - acrylonitrile copolymer and polyacrylamide . solvent is preferably composed of one or more among phenol , formic acid , sulfuric acid , m - cresol , trifluoroacetic anhydride / dichloromethane , water , n - methylmorpholine n - oxide , chloroform , tetrahydrofuran , and an aliphatic ketone group such as methyl isobutyl ketone and methyl ethyl ketone , an aliphatic hydroxyl group such as m - butyl alcohol , isobutyl alcohol , methyl alcohol and ethanol , an aliphatic compound group such as hexane , tetrachloroethylene and acetone , a glycol group such as propylene glycol , a diethylene glycol and ethylene glycol , a halogen compound group such as trichloroethylene and dichloromethane , an aromatic compound group such as toluene and xylene , an alicyclic compound group such as cyclohexanone , cyclohexane , a ester group such as n - butyl acetate and ethyl acetate , an aliphatic ether group such as butyl cellosolve , acetic acid 2 - ethozyethanol and 2 - ethoxyethanol , and an amide group such as dimethylformamide and dimethylcetamide . the electrospinning apparatus ( 1 ) by the structure according to the first exemplary embodiment of the present invention , fixed amount of spinning solution filled in the spinning solution main tank inside the unit ( 10 ) is consecutively provided in the several nozzles ( 12 ) provided with high voltage through a metering pump , polymer &# 39 ; s spinning solution is provided by the nozzle ( 12 ) spins and collects on the collector ( 13 ) with high voltage flowing through the nozzle ( 12 ) and nanofiber web ( not shown ) is formed , formed nanofiber web is laminating and produced to non - woven fabric , filter , etc . in this case , on the electrospinning apparatus ′( 1 ) collector ( 13 ) is provided with the elongated sheet ( 15 ) for preventing sagging and carrying a nanofiber web which is formed on the collector ( 13 ) when jetting spinning solution , the elongated sheet ( 15 ) is wound by the supply roller ( 3 ) which is provided on the one side of an electrospinning apparatus and the winding roller ( 5 ) provided on the other end . in the embodiment of the present invention , though polymer spinning solution is jetted on the elongated sheet ( 15 ) located on the collector ( 13 ) through the electrospinning apparatus ( 1 ) nozzle ( 12 ) and comprised forming a nanofiber web , it is possible that seperate supporter ( not shown ) is supplied on the elongated sheet ( 15 ), separate supply roller ( not shown ) is provided for providing the supporter , the nozzle ( 12 ) spinning solution is jetted on the supporter to form a nanofiber web . here , the supporter laminating polymer spinning solution which is jetted from the electrospinning apparatus ( 1 ) the nozzle ( 12 ) is preferably comprising non - woven fabric or fabric etc , but it is not limited to this . meanwhile , the collector ( 13 ) outer side is provided with the auxiliary belt ( 16 ), the collector ( 13 ) both ends in the direction of length are each provided with a carrying roller ( 17 ), the auxiliary belt ( 16 ) is driven by the carrying roller &# 39 ; s ( 17 ) rotation , by driving of the auxiliary belt ( 16 ) the elongated sheet ( 15 ) is carried from the front of the electrospinning apparatus ( 1 ) to the rear . according to the structure , spinning solution filled in the inside of the electrospinning apparatus ( 1 ) unit &# 39 ; s spinning solution main tank is jetted on the collector &# 39 ; s ( 13 ) elongated sheet ( 15 ) by the nozzle ( 12 ), nanofiber web is formed as spinning solution jetted on the elongated sheet ( 15 ) is laminated , the elongated sheet ( 15 ) is carried by the auxiliary belt ( 16 ) driving by the carrying roller ( 17 ) rotation provided with on both ends of the collector ( 13 ) and located inside another unit ( 10 ′), by repeatedly performing the process a final production is produced . in this case , the nozzle block &# 39 ; s ( 11 ) nozzle &# 39 ; s ( 12 ) outlet is formed in the upward direction , the collector ( 13 ) is located in the upper side of the nozzle block ( 11 ) and spins spinning solution in the upward direction . in the embodiment of the present invention , the electrospinning apparatus ( 1 ) is composed of a bottom - up electrospinning apparatus which spins spinning solution in the upward direction , but it is also possible to comprise a top - down electrospinning apparatus which spins spinning solution in the downward direction . here , the elongated sheet carrying speed adjusting system ( 30 ) comprises a buffer section ( 31 ) formed between each of the unit ( 10 , 10 ′) of the electrospinning apparatus ( 1 ), a pair of support roller ( 33 , 33 ′) which supports the elongated sheet ( 15 ) provided on the buffer section ( 31 ), and an adjusting roller ( 35 ) provided between the pair of the support roller ( 33 , 33 ′) in this case , the support roller ( 33 , 33 ′) supports carrying of the elongated sheet ( 15 ) when carrying the elongated sheet ( 15 ) on which a nanofiber web is laminated and formed by nozzle jetted spinning solution in each of the unit ( 10 , 10 ′), each of them is provided in front - end and rear - end of the buffer section ( 31 ) formed between each of the unit ( 10 , 10 ′). moreover , the adjusting roller ( 35 ) is provided between a pair of the support roller ( 33 , 33 ′), the elongated sheet ( 15 ) is winding , by the adjusting roller ( 35 ) upper , lower movement , the carrying speed and carrying time of the elongated sheet ( 15 a , 15 b ) according to each of the unit ( 10 , 10 ′) are adjusted . for this , a sensing sensor ( not shown ) for sensing the elongated sheet ( 15 a , 15 b ) carrying speed in each of the unit ( 10 , 10 ′) is provided , and the main control device ( 50 ) is provided as illustrated in fig1 in order to control the adjusting roller ( 35 ) movement according to carrying speed of the elongated sheet ( 15 a , 15 b ) in each of the unit ( 10 , 10 ′) sensed by the sensing sensor . though in the embodiment of the present invention , carrying speed of the elongated sheet ( 15 a , 15 b ) in each of the unit ( 10 , 10 ′) is sensed , according to the sensed carrying speed of the elongated sheet ( 15 a , 15 b ), the main control device ( 50 ) controls the adjusting roller ( 35 ) movement , in order to carry the elongated sheet ( 15 a , 15 b ), an auxiliary belt ( 16 ) provided on one side of the collector ( 13 ), or a carrying roller ( 17 ) for driving the auxiliary belt ( 16 ), or a motor ( not shown ) driving speed is sensed , and according to this , it is possible to comprise the main control device ( 50 ) controlling the movement of the adjusting roller ( 35 ). by the structure stated above , by the sensing sensor , in the case of carrying speed of the elongated sheet ( 15 a ) located in front - end of the unit ( 10 ) is faster than carrying speed of the elongated sheet ( 15 b ) located in the unit of rear end ( 10 ′), the main control device ( 50 ) moves the adjusting roller ( 35 ) provided between a pair of the support roller ( 33 , 33 ′) to lower side , carrying speed of the elongated speed ( 15 a ) located in the unit of front end ( 10 ) and the carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - end ( 10 ′) are modified and controlled to the same level . in other words , in the case of sensed carrying speed of the elongated sheet ( 15 a ) located in the unit of front - end ( 10 ) is faster than carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - end ( 10 ′), in order to prevent slacking of the elongated sheet ( 15 a ) carried in the unit ( 10 ) located in front - end , the adjusting roller ( 35 ), provided between a pair of the support roller ( 33 , 33 ′) and wind the elongated sheet , is moved to the lower side , among the elongated sheet ( 15 ) carried from the unit ( 10 ) located in front - end to the unit ( 10 ′) located in rear - end , the elongated sheet ( 15 a ), carried to outer side of the unit ( 10 ) in front - end and excessively carried to the buffer section ( 31 ) located between each of the unit , is pulled , carrying speed of the elongated speed located in front - end of the unit and the carrying speed of the elongated sheet located in rear - end of the unit are modified and controlled to the same level , and thereby slacking and crumpling of the elongated sheet ( 15 a ) are prevented . according to the structure stated above , by adjusting carrying speed of the elongated sheet ( 15 a ) carried in the unit of front end ( 10 ) among each of the unit ( 10 , 10 ′), carrying speed of the elongated speed in front - end of the unit and carrying speed of the elongated sheet in rear - end of the unit become to the same level . meanwhile , by the sensing sensor , in the case carrying speed of the elongated sheet ( 15 a ) located in the unit of front - end ( 10 ) is slower than carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - end ( 10 ′), the main control device ( 50 ) moves the adjusting roller ( 35 ) provided between a pair of the support roller ( 33 , 33 ′) to upper side , carrying speed of the elongated sheet ( 15 a ) located in the unit of front - end ( 10 ) and the carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - end ( 10 ′) are modified and controlled to the same level . in other words , in the case of sensed carrying speed of the elongated sheet ( 15 a ) located in front - end of the unit ( 10 ) is slower than carrying speed of the elongated sheet ( 15 b ) located in rear - end of the unit ( 10 ′), in order to prevent snapping of the elongated sheet ( 15 b ) carried in the unit of rear - end ( 10 ′), the adjusting roller ( 35 ), provided between a pair of the support roller ( 33 , 33 ′) and wind the elongated sheet , is moved to the upper side , among the elongated sheet ( 15 ) carried from the unit ( 10 ) in front - end to the unit ( 10 ′) in rear - end , the elongated sheet ( 15 a ), carried to outer side of the unit ( 10 ) in front - end and wound in the buffer section ( 31 ) located between each of the unit ( 10 , 10 ′) by the adjusting roller ( 35 ), is fastly provided to the unit ( 10 ′) in rear - side , carrying speed of the elongated sheet ( 15 a ) located in the unit of front - end ( 10 ) and the carrying speed of the elongated sheet ( 15 b ) located in the unit of rear end ( 10 ′) are modified and controlled to the same level , and snapping of the elongated sheet ( 15 b ) is prevented . according to the structure stated above , among each of the unit ( 10 , 10 ′), by adjusting carrying speed of the elongated sheet ( 15 a ) carried in the rear - end of the unit ( 10 ′), carrying speed of the elongated sheet ( 15 b ) in rear - end of the unit ( 10 ′) and carrying speed of the elongated sheet ( 15 a ) in front - end of the unit ( 10 ) become to the same level . below statement explains operation process of the elongated sheet adjusting system of the electrospinning apparatus according to the present invention . first , according to the present invention through the supply roller provided in the electrospinning apparatus ′( 1 ) front - end , the elongated sheet ( 15 ) is supplied to the electrospinning apparatus ′( 1 ) unit ( 10 ). thus , the elongated sheet ( 15 ) which is supplied to the electrospinning apparatus ′( 1 ) unit ( 10 ) through the supply roller ( 3 ) is located on the collector ( 13 ), the voltage generating device &# 39 ; s ( 14 ) high voltage is occurred on the collector ( 13 ) through the nozzle ( 12 ), polymer spinning solution filled in spinning solution main tank ( not shown ) is jetted on the elongated sheet ( 15 ) which is on the collector ( 13 ) occurring high voltage through the nozzle block &# 39 ; s ( 11 ) nozzle . here , spinning solution filled in the spinning solution main tank is consecutively supplied in the required amount in a plurality of nozzles ( 12 ) with high voltage through the metering pump ( not shown ), spinning solution supplied to each of the nozzle ( 12 ) is spun and line - focused on the collector ( 13 ) applied high voltage through the nozzle ( 12 ), jetted on the elongated sheet ( 15 ) and nanofiber web is laminated and formed . as stated above , the elongated sheet ( 15 ), which laminating a nanofiber web located in the unit ( 10 ) of front - side among the electrospinning apparatus ′( 1 ) each unit ( 10 , 10 ′), is carried from the unit ( 10 ) of front - side to the unit ( 10 ′) located on the rear - side by the carrying roller ( 17 ) operated by the motor &# 39 ; s ( not shown ) driving and auxiliary belt ( 16 ) driven by rotation of the feed roller ( 17 ), as the process is repeated a nanofiber web is laminating formed on the elongated sheet ( 15 ). in this case , among each of the unit ( 10 , 10 ′) the elongated sheet ( 15 ) carried from the unit ( 10 ) in front - end to the unit in rear - end ( 10 ′) is conveyed through a pair of support roller ( 33 , 33 ′) provided in the buffer section ( 31 ) between each of the unit ( 10 , 10 ′), and simultaneously carried and wound by the adjusting roller ( 35 ) provided between a pair of the support roller ( 33 , 33 ′) here , carrying speed of the elongated sheet ( 15 ) in each of the unit ( 10 , 10 ′) comprises 0 . 2 to 100 m / s , in the case of carrying speed of the elongated sheet ( 15 a ) located in the unit of front - side ( 10 ) and carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - side ( 10 ′) are same , it operates well . however , in the case of carrying speed of the elongated sheet ( 15 a ) located in the unit of front - side ( 10 ) and carrying speed of the elongated sheet ( 15 b ) located in the unit of front - side ( 10 ) are different , according to the elongated sheet carrying speed adjusting system ( 30 ) of the present invention , carrying speed of the elongated sheet ( 15 a ) carried from the unit ( 10 ) located in front - end among each of the unit ( 10 , 10 ′) or carrying speed of the elongated sheet ( 15 b ) carried from the unit ( 10 ′) located in rear - end is adjusted , and carrying speed of the elongated sheet ( 15 a , 15 b ) going through each of the unit ( 10 , 10 ′) are modified and controlled to the same level . for example , if carrying speed of the elongated sheet ( 15 a , 15 b ) carried in each of the unit ( 10 , 10 ′) is 1 , in the case of carrying speed of each of the elongated sheet ( 15 a , 15 b ) in unit ( 10 ) located in front - end and unit located in rear - end ( 10 ′) among each of the unit ( 10 , 10 ′) is all 1 , it operates well . however , in the case of sensed carrying speed of the elongated sheet ( 15 a ) located in the unit of front - side ( 10 ) is faster than carrying speed of the elongated sheet ( 15 b ) located in the unit of rear - side ( 10 ′) is sensed , for example , in the case of the elongated sheet ( 15 a ) in unit ( 10 ) located in the unit located in front - end among each of the unit is 1 , and the elongated sheet ( 15 b ) in the unit located in rear - end is 0 . 7 , the adjusting roller ( 35 ) winding the elongated sheet is moved to the lower side , among the elongated sheet ( 15 ) carried from the unit ( 10 ) located in front side to the unit ( 10 ′) located in rear - side , the elongated sheet ( 15 a ), excessively carried to the buffer section ( 31 ) in the unit of front - side located between each of the unit , is pulled , carrying speed of 0 . 3 is modified and controlled , carrying speed of the elongated sheet ( 15 a ) located in the unit of front side ( 10 ) and carrying speed of the elongated sheet ( 15 b ) located in the unit of rear side ( 10 ′) are modified and controlled to the same level , and slacking and crumpling of the elongated sheet ( 15 a ) is prevented . also , sensed carrying speed of the elongated sheet ( 15 a ) located in the unit of front side ( 10 ) is slower than carrying speed of the elongated sheet ( 15 b ) located in the unit of rear side ( 10 ′), for example , in the case of the elongated sheet ( 15 a ) in unit ( 10 ) located in front - end among each of the unit is 0 . 7 , and the elongated sheet ( 15 b ) in unit located in rear - end is 1 , the adjusting roller ( 35 ) winding the elongated sheet is moved to the lower side , among the elongated sheet ( 15 ) carried from the unit ( 10 ) located in front side to the unit ( 10 ′) located in rear - side , extra elongated sheet ( 15 a ) wound in the adjusting roller ( 35 ) is rapidly supplied to the unit ( 10 ′) in rear end , carrying speed of 0 . 3 is modified and controlled , carrying speed of the elongated sheet ( 15 a ) located in the unit of front side ( 10 ) and carrying speed of the elongated sheet ( 15 b ) located in the unit of rear side ( 10 ′) are modified and controlled to the same level , and snapping , breakage , and damage of the elongated sheet ( 15 b ) is prevented . as stated above , the elongated sheet ( 15 ), on which a nanofiber web is electrospun , going through each of the unit ( 10 , 10 ′) of the electrospinning apparatus ( 1 ) to perform post - process such as laminating , and the final product is manufactured . in this case , defect - checking of air permeability of produced nanofiber is possible using an air permeability measuring device ( not shown ), using separate device for other post processing , process is performed , and the final product is manufactured . meanwhile , reference to fig7 to fig1 , the electrospinning apparatus ( 1 ) according to the second embodiment of the present invention provided with the elongated sheet ( 15 ) going through between nozzle ( 12 ) and nozzle block ( 11 ) connected to minus terminal and collector ( 13 ) connected to plus terminal in desired carrying speed , in order to make it easier to desorption and carry of the elongated sheet ( 15 ) attached to the collector ( 13 ) by electrostatic attraction , auxiliary belt ( 16 ), rotating synchronized with carrying speed of the elongated sheet ( 15 ), and auxiliary carrying device , supporting the auxiliary belt ( 16 ) and comprising the auxiliary belt roller ( 17 ′) to assist rotation , are provided . in this case , it is preferable the auxiliary belt roller ( 17 ′) comprising roller with low friction coefficient , if a roller with low friction coefficient is applied , other various rollers can be applied , and a bearing ( not shown ) with low friction coefficient can be provided . here , the nozzle block ( 11 ) comprises a plurality of nozzles , the nozzle block &# 39 ; s ( 11 ) polymer solution discharge toward the collector from an outlet as nanofiber , nonofiber stacked on the elongated sheet ( 15 ), the elongated sheet ( 15 ) maintains uniform thickness and moves . here , according to the electrospinning apparatus ( 1 ), average diameter of nanofiber laminating formed on the elongated sheet ( 15 ) is tens to thousands nm , synthetic resin possible of electro spinning is not separately limited otherwise , for example , polypropylene ( pp ), polyethylene terephthalate ( pet ), polyvinylidene fluoride , nylon , polyvinyl acetate , polymethyl methacrylate , polyacrylonitrile ( pan ), polyurethane ( pur ), polybutylene terephthalate ( pbt ), polyvinyl butyral , polyvinyl chloride , polyethyleneimine , polyolefins , poly ( lactic acid ) ( pla ), polyvinyl acetate ( pvac ), polyethylene naphthalate ( pen ), polyamide ( pa ), polyvinyl alcohol ( pva ), polyethylene imide ( pei ), polycaprolactone ( pcl ), polylactic glycolic acid ( plga ), silk , cellulose , and chitosan , and among them the material of polypropylene ( pp ) and heat - resistant polymer matter such as polyamide , polyimide , polyamideimide , poly ( meta - phenyleneisophthalamide ), polysulfone , polyether ketone , polyetherimide , aromatic polyester such as polyethylene terephthalate , polytrimethylene terephthalate , polyethylene naphthalate , poly - phosphazenesuch as polytetrafluoroethylene , polydiphenoxyposphazene , poly - bis [ 2 -( 2 - methoxyethoxy ) phosphazene ], and polyurethane copolymer including polyurethane and polyether urethane , cellulose acetate , cellulose acetate butyrate , polymers of the group consisting of cellulose acetate propionate are used commercially and widely , does not limited thereto . in this case , polymer solution is solution with dissolving polymer which is synthetic resin matter possible of electro spinning dissolved in suitable solvent , also the kind of solvent , as long as it can dissolve the polymer , are not limited , for example , phenol , formic acid , sulfuric acid , m - cresol , trifluorineaceticanhydride / dichloromethane , water , n - methylmorpholine n - oxide , chloroform , tetrahydrofuran and aliphatic ketone group such as methyl isobutyl ketone and methyl ethyl ketone , aliphatic hydroxyl group such as m - butyl alcohol , isobutyl alcohol , isopropyl alcohol , methyl alcohol , ethanol , aliphatic compound group such as haxane , tetrachlorethylene , acetone , glycol group such as propylene glycol , diethylene glycol , ethylene glycol , halogen compound group such as trichloroethylene , dichloromethane , aromatic compound group such as toluene , xylene , alicyclic compound group such as cyclohexanone , cyclohexane , and an ester group such as n - butylacetate and ethyl acetate , aliphatic ether group such as butylcellosolve , acetic acid 2 - ethoxy ethyl ethanol , 2 - ethoxyethanol , amide such as dimethylformamide , dimethylacetamide can be used , and can be used by mixing plural kinds of the solvent , the polymer solution can also contain an additive such as a conductivity - enhancing agent , does not limited thereto . moreover , temperature of each unit ( 10 , 10 ′) where polymer spinning solution is jetted through the electrospinning apparatus ( 1 ), for example , could be set to 25 ° c ., and humidity of each unit ( 10 . 10 ′), for example , could be set to 30 %, but does not limit to this . meanwhile , the auxiliary carrying device ( not shown ) is additionally provided to each of the unit ( 10 , 10 ′) of the electrospinning apparatus ( 1 ) according to the second embodiment of the present invention , smoothly adjusts the elongated sheet ( 15 ) carrying , the elongated sheet ( 15 ) is attached to the collector ( 13 ), and prevents polymer spinning solution from uneven spinning due to uneven carrying . in this case , as illustrated in fig7 , the auxiliary carrying device has the auxiliary belt ( 16 ) operated by two auxiliary belt roller ( 17 ′) rotation , each of the auxiliary belt roller ( 17 ′) comprises roller with low friction coefficient . meanwhile , in the second embodiment of the present invention , though the number of the auxiliary carrying device &# 39 ; s auxiliary belt roller ( 17 ′) is two , as illustrated in fig8 to fig1 , the number of the auxiliary carrying device &# 39 ; s auxiliary belt roller ( 17 ′) can be three , four or five , and the elongated sheet ( 15 ) carrying could be smoothly adjusted . in this case , the electrospinning apparatus ( 1 ) auxiliary carrying device not only assists carrying of the elongated sheet ( 15 ) attached to the collector ( 13 ) with electrostatic attraction through the roller with low friction coefficient , but also adjusts stack amount of nanofiber laminated and formed on the elongated sheet ( 15 ) by adjusting the elongated sheet ( 15 ) height upper and lower side . here , for conditions of adjusting stack amount of nanofiber laminated and formed on the elongated sheet ( 15 ) are voltage adjusting , adjustment of polymer solution viscosity , adjustment of polymer solution temperature , adjustment of number of nozzle ( 12 ) which is outlet , and adjustment of distance between the nozzle block ( 11 ) and the elongated sheet ( 15 ) which nanofiber is stacked , and among them the most simple method to adjust stack amount maintaining nanofiber matter is adjusting the distance between the nozzle block ( 11 ) and the elongated sheet ( 15 ). though conventional art needs separate equipment to adjust the elongated sheet ( 15 ) location , and it is hard to control the location of the elongated sheet ( 15 ) because the elongated sheet ( 15 ) is attached to the collector ( 13 ) with electrostatic force in conventional art , the electrospinning apparatus ( 1 ) of the present invention is for separating the elongated sheet ( 15 ) with the collector ( 13 ) and carrying , the elongated sheet ( 15 ) location can be easily controlled . in the embodiment , by adjusting the auxiliary carrying device location to upper or lower side , the elongated sheet ( 15 ) location is changed and nanofiber stack amount is adjusted , by moving location of the auxiliary belt roller ( 17 ′) provided in the auxiliary carrying device , the elongated sheet ( 15 ) height could be adjusted . also , though in the embodiment , the auxiliary carrying device of electrospinning apparatus ( 1 ) comprises the auxiliary belt ( 16 ) and the auxiliary belt roller ( 17 ′) with low friction coefficient , as illustrated in fig1 , each of the unit ( 10 , 10 ′) of the electrospinning apparatus ( 1 ) front and rear side is provided the roller ( 17 ′) with low friction coefficient , and enables to assist carrying of the elongated sheet ( 15 ). in the embodiment ( in the second embodiment of the present invention ), as an example of the roller with low friction coefficient , a roller comprising ball bearing is shown , if comprising with a roller with low friction coefficient , the form and composition of a roller is not limited , more detail bearing such as rolling bearing , oil bearing , ball bearing , roller bearing , sliding bearing , sleeve bearing , hydrodynamic journal bearing , hydrostatic journal bearing , pneumatic bearing , air dynamic bearing , air static bearing , and air bearing could be comprised , and roller with low friction coefficient including material and additives such as plastic and emulsifier could be comprised . meanwhile , reference to fig1 to fig1 , the electrospinning apparatus ( 1 ) according to the third embodiment of the present invention has the elongated sheet ( 15 ) carrying in desired speed between the nozzle ( 12 ) and nozzle block ( 11 ) connected to minus terminal and the collector ( 13 ) connected to plus terminal , in order to make easily of desorption and carrying of the elongated sheet ( 15 ) attached to the collector ( 13 ) with electrostatic attraction , auxiliary belt ( 16 ), rotating synchronized with carrying speed of the elongated sheet ( 15 ), and auxiliary belt roller ( 17 ′), supporting the auxiliary belt ( 16 ) and assisting rotation , are provided , the auxiliary belt device ( not shown ) has the auxiliary belt driving device ( 18 ) as one among the auxiliary belt roller ( 17 ′), among the auxiliary belt device &# 39 ; s auxiliary belt roller ( 17 ′) one or two or more auxiliary belt roller ( 17 ′) is driving roller ( not shown ) and the other auxiliary belt roller ( 17 ′) is preferably comprising driven roller ( not shown ), but does not limit to this . in this case , in the auxiliary belt driving device ( 18 ) provided in each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), the sheet slacking sensing device ( 19 a ) which senses sagging of the elongated sheet ( 15 ), controls the speed , and receives signal controlling the speed is additionally connected and provided , controls the elongated sheet ( 15 ) carrying speed , automatically restores sagging of the elongated sheet ( 15 ), and enables mass - producing of nanofiber . meanwhile , as illustrated in fig1 , the auxiliary belt device provided in each of the unit ( 10 , 10 ′) of the electrospinning apparatus ( 1 ) comprises three auxiliary belt roller ( 17 ′), among three auxiliary belt roller ( 17 ′), one is driving roller comprising the auxiliary belt driving device ( 18 ), the other two auxiliary belt roller ( 17 ′) comprises driven roller , using the sheet slacking sensing device ( 19 a ) provided between each of the unit ( 10 , 10 ′), sagging of the elongated sheet ( 15 ) is sensed , and according to this , signal adjusting speed is transferred to the auxiliary belt driving device ( 18 ). here , the auxiliary belt driving device ( 18 ) including the auxiliary belt roller ( 17 ′) preferably comprises the auxiliary belt roller ( 17 ′) and the driving device which rotates the auxiliary belt ( 16 ), the auxiliary belt driving device ( 18 ) is preferably operated by a motor . the sheet slacking sensing device preferably comprises contact type or noncontact type of device sensing sagging of the elongated sheet ( 15 ), preferably comprises one among optic sensor , ultrasonic sensor , image sensor , or tension meter , as illustrated in fig1 , more preferably the sheet slacking sensing device ( 19 a ) senses the location of the sheet exactly using ultrasonic sensor . meanwhile , in the third embodiment of the present invention , the auxiliary belt device provided in each of the unit ( 10 , 10 ″) of the electrospinning apparatus ( 1 ) comprises three auxiliary belt roller ( 17 ′), among three auxiliary belt roller ( 17 ′) one is driving roller comprising auxiliary belt driving device ( 18 ), and the other two are driven roller . as illustrated in fig1 , auxiliary belt device provided in each unit ( 10 , 10 ′, 10 ″) comprises five auxiliary belt roller ( 17 ′), among five auxiliary belt roller ( 17 ′), one is driving roller comprising auxiliary belt driving device ( 18 ), and the other four could be driven roller . according to the structure stated above , because of problem such as the sheet slacking sensing device ( 19 a ) located between each of the unit ( 10 , 10 ′, 10 ″) arranged in series , senses sagging of the elongated sheet ( 15 ) in noncontact type , such signal is transferred from the unit ( 10 ′, 10 ″) located in rear - end to the auxiliary belt driving device of the unit ( 10 , 10 ′) located in front - end , by enhancing the rotation speed of the auxiliary belt driving device ( 18 ), the elongated sheet ( 15 ) sagged in front - end and the elongated sheet ( 15 ) attached to the collector ( 13 ) are effectively pulled and transferred to rear - end . meanwhile , as illustrated in fig1 , the sheet slacking sensing device ( 19 a ) is provided between each unit ( 10 , 10 ′, 10 ″, 10 ′″) arranged in series , where the elongated sheet is carried with desired speed and desired direction , the elongated sheet ( 15 ) supplied from the supply roller ( 3 ) is provided certain height and direction through the auxiliary roller ( 23 ), by the driving roller ( 24 , 25 , 26 , 27 ), maintains desired carrying speed , and moves forward toward the winding roller ( 5 ). in this case , in the case of electrostatic attraction between the collector ( 13 ) of each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) and the elongated sheet ( 15 ) is bigger than feed force of each driving roller ( 24 , 25 , 26 , 27 ), the elongated sheet ( 15 ) is attached to the collector ( 13 ), and doesn &# 39 ; t smoothly carried to the winding roller ( 5 ), when the elongated sheet is pulled to each of the driving roller ( 24 , 25 , 26 , 27 ) by force in the state of the elongated sheet ( 15 ) is attached , there could be problem such as the elongated sheet ( 15 ) is ruptured . therefore , in each of the unit ( 10 , 10 ′, 10 ″, 10 ′″), to assist carrying of the elongated sheet to each of the unit ( 10 , 10 ′, 10 ″, 10 ′″), the auxiliary belt device comprises the auxiliary belt ( 16 ), the auxiliary belt roller ( 17 ′), and auxiliary belt driving device ( 18 ) provided one among the auxiliary belt roller ( 17 ′), the sheet slacking sensing device senses sagging of the elongated sheet ( 15 ) and adjusts speed of the auxiliary belt device , thereby the elongated sheet ( 15 ) in each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ) is smoothly carried . as stated above , through each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), the elongated sheet ( 15 ) on which nanofiber stacked and formed finalize nanofiber - manufacture through the heating device ( 29 ), in this case heating temperature could be set differently according to the elongated sheet ( 15 ) or type of nanofiber . for example , through the heating device ( 29 ), it could be heated by heating temperature from 40 to 400 ° c . the elongated sheet ( 15 ) passes through the heating device ( 29 ), the location of the elongated sheet ( 15 ) is modified in certain direction through the auxiliary roller ( 28 ), wound by the winding roller ( 5 ), nanofiber stacked and laminating on the elongated sheet ( 15 ) is manufactured to nanofiber non - woven fabric . meanwhile , though in the third embodiment of the present invention , the sheet slacking sensing device ( 19 a ) is provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), as illustrated in fig1 , the air permeability measuring device ( 19 b ) could be consecutively arranged and installed between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ). in other words , to measure air permeability of nanofiber laminated on the elongated sheet ( 15 ) of the electrospinning apparatus ( 1 ), the air permeability measuring device ( 19 b ) is each provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ) according to the fourth embodiment of the present invention . in this case , the electrospinning apparatus ( 1 ) comprises bottom - up or top - down electrospinning apparatus , the electrospinning apparatus ( 1 ) provided in each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) is installed in the case ( not shown ) comprising conductor or non - conductor . here , in the electrospinning apparatus ( 1 ) according to the embodiment of the present invention , in each of the unit ( 10 , 10 ′, 10 ″, 10 ′″), the auxiliary belt ( 16 ), provided between the collector ( 13 ) and the elongated sheet ( 15 ), and the elongated sheet ( 15 ) on which nanofiber is stacked and formed are carried in horizontal direction the auxiliary belt roller ( 17 ′) is an automatic roller with very low frictional force , by operating the auxiliary belt ( 6 ) provided between the collector ( 13 ) and the elongated sheet ( 15 ), the elongated sheet ( 15 ) is smoothly carried without pulling by the collector ( 13 ) with high voltage . meanwhile , based on air permeability value measured by the permeability measuring device ( 19 b ) provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), the elongated sheet ( 15 ) carrying speed and the nozzle block ( 11 ) discharging amount are controlled . in other words , in the case air permeability value of nanofiber , stacked and formed on the elongated sheet ( 15 ) passing through each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), is large , smaller air permeability can be attained by increasing discharged amount of nanofiber per unit area of the elongated sheet ( 15 ) thereby increasing stacked amount on the elongated sheet ( 15 ). to increase discharged amount of nanofiber per unit area of the elongated sheet ( 15 ), carrying speed of the elongated sheet ( 15 ) in the unit ( 10 ′, 10 ″, 10 ′″) located in rear - end of the control device ( 50 ) could be slowed , the voltage intensity of the voltage generating device ( 14 ) could be controlled , or through the nozzle block discharging amount control device ( 60 ) discharged amount from the nozzle block ( 11 ) is increased . in the case air permeability value of nanofiber , stacked and formed on the elongated sheet ( 15 ) passing through each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), is small , larger air permeability can be attained by decreasing discharged amount of nanofiber per unit area of the elongated sheet ( 15 ) thereby decreasing stacked amount on the elongated sheet ( 15 ). to decrease discharged amount of nanofiber per unit area of the elongated sheet ( 15 ), carrying speed of the elongated sheet ( 15 ) in the unit ( 10 ′, 10 ″, 10 ′″) located in rear - end of the control device ( 50 ) could be faster , the voltage intensity of the voltage generating device ( 14 ) could be controlled , or through the nozzle block discharging amount control device ( 60 ) discharged amount from the nozzle block ( 11 ) is decreased . thereby , nanofiber with uniform air permeability can be stacked and formed on the elongated sheet ( 15 ). here , the air permeability measuring device ( 19 b ) is preferably measuring device with ultrasonic method , but it is not limited to this . in this case , in the nozzle block ( 11 ) of the electrospinning apparatus ( 1 ) according to the embodiment , as illustrated in fig1 , provided a plurality of nozzle ( 12 ) is provided , a plurality of tubular body ( 43 ) having the nozzle ( 12 ) for spinning polymer spinning solution upward or downward from the outlet ( not shown ) is arranged and installed , polymer spinning solution spun from the plurality of nozzle ( 12 ) outlet could be overflow and reused , through the nozzle block discharging amount control device ( 60 ) connected to the tubular body ( 43 ) having the plurality of nozzle ( 12 ) with the nozzle block discharging amount control device connection ( 61 ), polymer spinning solution discharging amount from the polymer solution storage tank ( 44 ) connected to each of the nozzle ( 12 ) with the polymer solution circulation pipe ( 45 ) could be automatically controlled . meanwhile , air permeability of the elongated sheet ( 15 ) on which nanofiber is stacked and formed means air permeability value measured in the state of nanofiber layer laminated and formed on the elongated sheet ( 15 ) on which nanofiber is stacked and formed . according to the structure stated above , in the case the nanofiber air permeability deviation is less than a desired value , the main control device ( 50 ) doesn &# 39 ; t change carrying speed from initial value , in the case the deviation is more than a desired value , the main control device ( 50 ) could be controlled by changing carrying speed from initial value , and carrying speed control can be simplified . moreover , in the case of the nanofiber air permeability deviation is less than a desired value , the nozzle block discharging amount control device ( 60 ) doesn &# 39 ; t change the nozzle block ( 11 ) discharging amount from initial value , and simultaneously doesn &# 39 ; t change voltage intensity from initial value . in the case of the nanofiber air permeability deviation is more than a desired value , through the nozzle block discharging amount control device ( 60 ) and the main control device ( 50 ), the nozzle block ( 11 ) discharging amount and voltage intensity could be controlled by changing from initial value , control of the nozzle block ( 11 ) discharging amount and voltage intensity could be simplified . below statement specifically explains the embodiment . however , the embodiment is an example of the present invention , the present invention scope is not limited to this . permeability measuring tester does reciprocating motion in desired cycle according along the elongated sheet ( 15 ) width direction , through an ultrasonic sensor , measures the elongated sheet ( 15 ) air permeability . air permeability measurement according to the air permeability measuring tester is carried out , for example , every 10 ms . take an average of measured air permeability in desired cycle using the permeability measuring tester , and calculate average air permeability . a deviation between the average air permeability ( p ) and desired goal air permeability ( δp ). based on the deviation ( δp ), nozzle block discharging amount and voltage are controlled . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed from the supply roller ( 3 ) toward the winding roller ( 5 ), laminating nanofiber in order . in this case , measuring air permeability of the elongated sheet ( 15 ) laminating formed nanofiber from the unit ( 10 , 10 ′, 10 ″) of front - end according to the electrospinning apparatus , simultaneously based on measured air permeability by the air permeability measuring device ( 19 b ), carrying speed is controlled , after laminating nanofiber on the elongated sheet ( 15 ) consecutively in the unit ( 10 ′, 10 ″, 10 ′″) of rear - end , air permeability is measured , repeatedly carrying speed is controlled , and nanofiber is laminated . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed from the supply roller ( 3 ) toward the winding roller ( 5 ), laminating nanofiber in order . in this case , measuring air permeability of the elongated sheet ( 15 ) laminating formed nanofiber from each of the unit ( 10 , 10 ′, 10 ″, 10 ′″), simultaneously based on measured air permeability according to the air permeability measuring device ( 19 b ), the nozzle block ( 11 ) discharging amount and the voltage generating device ( 14 ) voltage intensity are controlled , after laminating nanofiber on the elongated sheet ( 15 ) consecutively in the unit of rear - end ( 10 ′, 10 ″, 10 ′″), air permeability is measured , repeatedly the nozzle block ( 11 ) discharging amount and the voltage generating device ( 14 ) voltage intensity are controlled , and nanofiber is laminated . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed from the supply roller ( 11 ) toward the winding roller ( 12 ), laminating nanofiber in order . after successively laminating nanofiber , carrying speed ( v ) is not controlled , after the last unit , air permeability is measured . as known in the result , through the main control device ( 50 ) of the embodiment , by controlling the elongated sheet ( 15 ) carring speed and the voltage generating device ( 14 ) voltage intensity , simultaneously by controlling the nozzle block ( 11 ) discharging amount through the nozzle block discharging amount control device ( 60 ), nanofiber with uniform air permeability could be manufactured . meanwhile , in the fourth embodiment of the present invention , the air permeability measuring device ( 19 b ) is provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), as illustrated in fig1 , the thickness measurement device ( 19 c ) could be successively arranged and installed between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ). in other words , to measure the thickness of nanofiber laminated and formed on the elongated sheet ( 15 ) of the electrospinning apparatus ( 1 ), the thickness measurement device ( 19 c ) is each provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ) according to the fifth embodiment of the present invention . according to the structure stated above , based on the thickness value measured by the thickness measurement device ( 19 c ) provided between each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), the elongated sheet ( 15 ) carrying speed and the nozzle bock ( 11 ) discharging amount can be controlled . in other words , in the case thickness value of nanofiber , stacked and formed on the elongated sheet ( 15 ) passing through each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), is measured thinner than deviation , thicker thickness value can be attained by increasing discharged amount of nanofiber per unit area of the elongated sheet ( 15 ) thereby increasing stacked amount on the elongated sheet ( 15 ). to increase discharged amount of nanofiber per unit area of the elongated sheet ( 15 ), carrying speed of the elongated sheet ( 15 ) in the unit ( 10 ′, 10 ″, 10 ′″) located in rear - end of the control device ( 50 ) could be slowed , the voltage intensity of the voltage generating device ( 14 ) could be controlled , or through the nozzle block discharging amount control device ( 60 ) discharged amount from the nozzle block ( 11 ) could be increased . in the case thickness value of nanofiber , stacked and formed on the elongated sheet ( 15 ) passing through each of the unit ( 10 , 10 ′, 10 ″, 10 ′″) of the electrospinning apparatus ( 1 ), is measured thicker than deviation , thinner thickness value can be attained by decreasing discharged amount of nanofiber per unit area of the elongated sheet ( 15 ) thereby decreasing stacked amount on the elongated sheet ( 15 ). to decrease discharged amount of nanofiber per unit area of the elongated sheet ( 15 ), carrying speed of the elongated sheet ( 15 ) in the unit ( 10 ′, 10 ″, 10 ′″) located in rear - end of the control device ( 50 ) could be faster , the voltage intensity of the voltage generating device ( 14 ) could be controlled , or through the nozzle block discharging amount control device ( 60 ) discharged amount from the nozzle block ( 11 ) is decreased . thereby , nanofiber with uniform thickness can be stacked and formed on the elongated sheet ( 15 ). here , the thickness measurement device ( 19 c ) is arranged in opposite sides between the elongated sheet ( 15 ), using ultrasonic measuring method , thickness measuring tester ( not shown ), which measures the distance to the elongated sheet ( 15 ) and comprising a pair of ultrasonic , longitudinal wave , and transverse wave measuring method , is provided , based on measured distance according to the thickness measurement device ( 19 c ), the elongated sheet ( 15 ) thickness could be calculated . in other words , the thickness measurement device ( 19 c ) uses ultrasonic longitudinal wave and transverse wave to calculate the thickness of a subject . the thickness measurement device ( 19 c ) projects ultrasonic longitudinal wave and transverse wave together on the elongated sheet ( 15 ) laminating nanofiber , after measuring reciprocating motion time of each ultrasonic signal of longitudinal wave and transverse wave from the elongated sheet ( 15 ), in other words , after measuring each propagation time of longitudinal wave and transverse wave , the thickness of a subject can be calculated from predetermined formula using propagation time of measured longitudinal wave and transverse wave , propagation speed of measured longitudinal wave and transverse wave in reference temperature of the elongated sheet ( 15 ) laminating nanofiber , and a temperature constant of propagation speed of longitudinal wave and transverse wave . in other words , in the thickness measurement device ( 19 c ) using ultrasonic longitudinal wave and transverse wave , after measuring each propagation time of longitudinal wave and transverse wave , the thickness of the elongated sheet ( 15 ) laminating nanofiber can be calculated from predetermined formula using propagation time of measured longitudinal wave and transverse wave , propagation speed of measured longitudinal wave and transverse wave in reference temperature of the elongated sheet ( 15 ) laminating nanofiber , and a temperature constant of propagation speed of longitudinal wave and transverse wave . the thickness could be accurately measured even in the state of uneven inner temperature by self compensating error made by change of propagation speed according to change of temperature , thereby the thickness could be accurately measured even though there is temperature distribution in any form inside nanofiber in the thickness measurement device ( 19 c ). in the embodiment , in this case in the nozzle block ( 11 ) of the electrospinning apparatus ( 1 ) according to the embodiment , as illustrated in fig1 , provided a plurality of nozzle ( 12 ) is provided , a plurality of tubular bodies ( 43 ) having the nozzle ( 12 ) for spinning polymer spinning solution upward or downward from the outlet ( not shown ) is arranged and installed , polymer spinning solution spun from the plurality of nozzle ( 12 ) outlet could be overflow and reused , through the nozzle block discharging amount control device ( 60 ) connected to the tubular body ( 43 ) having the plurality of nozzle ( 12 ) with the nozzle block discharging amount control device connection ( 61 ), polymer spinning solution discharging amount from the polymer solution storage tank ( 44 ) connected to each of the nozzle ( 12 ) with the polymer solution circulation pipe ( 45 ) could be automatically controlled . here , thickness of the elongated sheet ( 15 ) on which nanofiber is stacked and formed means measured thickness value in state of nanofiber layer laminated and formed on the elongated sheet ( 15 ) on which nanofiber is stacked and formed . according to the structure stated above , in the case the nanofiber thickness deviation is less than a desired value , the main control device ( 50 ) doesn &# 39 ; t change carrying speed from the initial value , and in the case the thickness deviation is more than a desired value , the main control device ( 50 ) controls to change carrying speed from the initial value , so carrying speed control are simplified . moreover , in the case of nanofiber thickness deviation is less than a desired value , the nozzle block discharging amount control device ( 60 ) doesn &# 39 ; t change the nozzle block ( 11 ) discharging amount from the initial value , simultaneously the main control device ( 50 ) doesn &# 39 ; t change voltage intensity from the initial value , and in the case of the thickness deviation is more than a desired value , through the nozzle block discharging amount control device ( 60 ) and the main control device ( 50 ), the nozzle block ( 11 ) discharging amount and voltage intensity could be controlled to be changed from the initial value , so the nozzle block ( 11 ) discharging amount and voltage intensity control are simplified . below statement more specifically explains than the embodiment . however , the embodiment is merely an example of the present invention , the present invention scope is not limited to this . the thickness measurement tester does reciprocating motion in desired cycle along the elongated sheet ( 15 ) width direction , through an ultrasonic sensor , measures the elongated sheet ( 5 ) thickness . thickness measurement using the thickness measurement device is carried , for example , every 10 ms . take an average of measured thickness measured by the thickness measurement device in desired cycle , and calculate average thickness . a deviation between the average thickness ( d ) and desired goal thickness ( d 0 ). based on the deviation ( δd ), nozzle block discharging amount and voltage are controlled . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed ( v ) from the supply roller ( 3 ) toward the winding roller ( 5 ), laminating nanofiber in order . in this case , measuring thickness of the elongated sheet ( 15 ) on which nanofiber is laminated and formed from the unit of front - end ( 10 , 10 ′, 10 ″) according to the electrospinning apparatus , simultaneously based on measured thickness according to the thickness measurement device ( 19 c ), carrying speed is controlled , after laminating nanofiber on the elongated sheet ( 15 ) consecutively from the unit of rear - end ( 10 , 10 ′, 10 ″), thickness is measured , repeatedly carrying speed is controlled , and nanofiber is laminated . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed ( v ) from the supply roller ( 3 ) toward the winding roller ( 5 ), laminating nanofiber in order . in this case , measuring thickness of the elongated sheet ( 15 ) on which nanofiber is laminated and formed from each of the unit ( 10 , 10 ′, 10 ″, 10 ′″), simultaneously based on measured thickness according to the thickness measurement device ( 19 c ), the nozzle block ( 11 ) discharging amount and the voltage generating device ( 14 ) voltage intensity are controlled , after laminating nanofiber on the elongated sheet ( 15 ) consecutively from the unit of rear - end ( 10 , 10 ′, 10 ″), thickness is measured , repeatedly the nozzle block ( 11 ) discharging amount and the voltage generating device ( 14 ) voltage intensity are controlled , and nanofiber is laminated . installing five units , the elongated sheet ( 15 ) is carried in desired carrying speed from the supply roller ( 11 ) toward the winding roller ( 12 ), laminating nanofiber in order . after successively laminating nanofiber , carrying speed is not controlled , after the last unit , thickness is measured . as known in the result , through the main control device ( 50 ) of the embodiment , by controlling the elongated sheet ( 15 ) carrying speed and the voltage generating device ( 14 ) voltage intensity , simultaneously by controlling the nozzle block ( 11 ) discharging amount through the nozzle block discharging amount control device ( 60 ), nanofiber with uniform thickness could be manufactured . while the present invention is described with reference to particular embodiments thereof , it will be understood by those skilled in the art that variations or amendment may be made therein without departing from the sprit and scope of the invention . the scope of the present invention is not limited by those variations or amendments , but by the following claims .	3
referring to the drawings , a typical weld tip 10 on a weld head 11 during the weld operation is shown in fig1 . molten metal 14 is transferred from the weld tip to the workpiece surface 12 during the welding operation . this results in a bright arc 16 in the vicinity of the weld . radiant energy from the arc may be seen directly by the vision system or may be reflected by the workpiece or the support structures into the vision system . this radiant light energy will compete with the light energy used for vision . weld spatter 17 consists of metal particles which are projected radially from the weld location . they may be red hot , emitting light energy which interferes with the vision system or the metal particles may physically block the light energy used for vision . weld fumes 18 generated by the heat of the weld may also block the light energy used for vision . any or all of these three interfering factors may be present during the various weld techniques available . fig2 shows a typical location for the vision system 20 with respect to the weld point . the weld spatter paths 17 are shown as they cross the vision volume . when the vision system sees the red hot spatter or the direct or indirect arc glare special processing either in hardware or software must be used to detect the desired vision data in the presence of these interfering factors . typically , methods such as pulse width discrimination , data connectivity , frame to - frame correlation , a priori knowledge or other methods are used to distinguish between wanted and unwanted vision information . interfering vision data which is similar to or physically near the desired data is difficult if not impossible to remove . this data can distort the desired data or may result in incorrect vision data . metal particles which do not radiate energy within the vision system bandwidth , may physically block the desired data resulting in missing and incomplete vision data . the method shown in fig3 eliminates or greatly reduces the mentioned problems . the flexible barrier 22 is physically located between the vision center 26 and the weld point . in a preferred embodiment , the lower portion of the barrier consists of a flexible hairlike material 24 which can change shape to fill voids in the workpiece . the hairlike nature of the flexible barrier allows filling the weld seam 23 as well as following the contours of the surface as shown in fig4 . this efficiently blocks direct or indirect arc glare , weld spatter or smoke from reaching the vision system 20 . the hairlike section 24 at the bottom of the barrier can be easily replaced to allow periodic replacement as it wears or become damaged or to change the hairlike section for one more suited to a particular workpiece or weld technique . for applications where there are bumps 28 or irregularities an adaptive flexible barrier as shown in fig5 may be used . here there is a sectioned conforming barrier 30 located between the hairlike 24 and rigid portions 32 of the barrier . this conforming section is made of a flexible material that allows the barrier to pass over bumps or protrusions in the workpiece 12 while maintaining the desired performance . for applications where air flow around the weld is required and the previously described barriers would limit the flow , an arrangement shown in fig6 could be used . the hairlike structure is divided into two or more sections 34 allowing more air flow but maintaining the required blocking characteristics . because of the nature of the mechanical structures associated with robotic welding it is possible that even with the described barriers some interference will still be seen by the vision system . the frequency of occurrence however will be greatly reduced from present systems . when this interference occurs simplified versions of the processing techniques mentioned previously can be used to separate vision data from interference or the data ignored . since many views of the seam are taken , losing an occasional data point should not degrade system operation . the use of a barrier may be extended to examine weld seams during the weld operation or to shield a vision system during a procedure which generates interference with vision , such as vision guided routing or finishing operations . for some applications , a solid flexible material may be preferred to using a hairlike material . in general , if the interference of a hostile environment can be blocked by a barrier , then a barrier provides a simple means of improving vision system performance . rigid barriers may be used in fixed installations and in precision motion applications . however , flexible barriers provide the most economical solution when complex shapes and / or imprecise motion between the observed surface ad the vision system is involved . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention , and therefore , such adaptations should and are intended to be comprehended within the meaning and range of equivalence of the following claims .	1
the preferred embodiment of the present invention will now be described with reference to the drawings . identical elements in the various figures are identified with the same reference numerals . fig1 shows the wrist pad 100 on the wrist 110 of the user . the hand of the user 120 is shown holding the mouse 130 , in a way that is typical when conducting data entry on a computer . gel pad 100 is attached to the user &# 39 ; s wrist 110 by the right strap 1100 . fig2 illustrated the user &# 39 ; s hand 120 with gel pad 100 on wrist 110 . strap 1100 holds the gel pad 100 onto the user &# 39 ; s wrist 110 . fig2 shows the user wearing the wrist pad on the user &# 39 ; s left hand , but the invention may be worn on the right hand as well . fig3 shows the wrist pad 100 unattached to a wrist . the wrist pad 100 is shown from a front view , with right strap 1100 , which has a bottom 1120 and a top 1140 . fig3 also shows left strap 1200 , which has a bottom 1220 and a top 1240 . fig4 shows a top view of the wrist pad 100 unattached to a wrist . the wrist pad has a pad base 200 which rests under the wrist , and a wrist pad extension 300 which extends into the palm of the hand . the pad extension of the present invention prevents the users wrist from flexing downward during use , reducing wrist strain and improving comfort to the user . wrist pad extension 300 has width 320 and a length 340 . wrist pad extension 300 can be any shape but is preferably conformed to fit into the palm of the users hand , and will preferably have a generally conical shape as seen in fig4 . wrist pad extension has length 340 , which is at least 1 . 3 cm and preferably from 1 . 9 to 5 . 1 cm , and most preferably 2 . 5 cm to 5 . 1 cm in length . wrist pad extension 300 also has a width 320 , which is from 1 . 3 to 7 . 5 cm , and may vary in width to a taper or conical shape as seen in fig4 . wrist pad base 200 has a width 220 and a length 240 . wrist pad base width 220 can be from 6 . 4 to 11 . 4 cm and is preferably about 8 . 9 cm , and wrist pad base length 240 is from 1 . 9 to 5 . 1 cm with 3 . 8 cm being preferred . the total length of the of the invention 225 , as seen in fig4 , will vary from 20 . 3 to 30 . 5 cm , which includes the strap lengths , with a preferred length of about 25 . 4 cm . the dimensions are above are mostly illustrative and could be varied depending on the size of the user &# 39 ; s hand . commercial models of the invention could , for example , be sold in small , medium and large sizes with the basic dimensions altered accordingly . fig4 also shows right strap 1100 and left strap 1200 . fig5 and fig6 illustrate the wrist pad 100 , fig5 with straps attached to each other , fig6 with the straps not attached . the wrist pad 100 is not on the user &# 39 ; s wrist . fig5 and fig6 show right strap 1100 and left strap 1200 , the canvas cover of the wrist pad 1000 , the pad base width 220 , the pad base length 240 , the pad extension width 320 , and the pad extension length 340 . in a preferred embodiment , the pad base width 220 is greater than the pad extension width 320 , with the pad extension width 320 being about ½ the pad base width 220 . fig7 shows a preferred embodiment of the invention in which the wrist pad is constructed in layers of material which have the same shape . each layer has a pad base 200 and a pad extension 300 . the pad base 200 has pad base width 220 and pad base length 240 . the pad extension 300 has a pad extension width 320 and a pad extension length 340 . in fig7 , and in a preferred embodiment of the invention , the pad extension width 320 is approximately half of pad base width 220 . the pad extension length 340 is at least half an inch . typically , the pad base 200 and the pad extension 300 are made in a single piece , but could also be made from separate pieces and attached together using conventional means , such as glue or sewing . fig8 and 9 show views of an alternate embodiment of the wrist pad 1500 unattached to a wrist . the wrist pad has a pad base 200 which rests under the wrist , and a wrist pad extension 300 which extends into the palm of the hand . the pad extension prevents the users wrist from flexing downward during use , reducing wrist strain and improving comfort to the user . wrist pad extension 300 has width 320 and a length 340 and wrist pad base 200 has a width 220 and a length 240 . wrist pad extension 300 can be any shape but is preferably conformed to fit into the palm of the users hand , and will preferably have a generally conical shape . note also in fig8 that wrist pad extension 300 may have a raised lip 350 that can give further support to the users hand . raised lip can be beveled , as shown in the drawing or it can be any suitable shape , such as rectangular or triangular . wrist pad extension has length 340 , which is at least 1 . 3 cm and preferably from 1 . 9 to 5 . 1 cm , and most preferably 2 . 5 cm to 5 . 1 cm in length . wrist pad extension 300 also has a width 320 , which is from 1 . 3 to 7 . 5 cm , and may vary in width to a taper or conical shape as seen in fig4 . wrist pad base 200 has a width 220 and a length 240 . wrist pad base width 220 can be from 6 . 4 to 11 . 4 cm and is preferably about 8 . 9 cm , and wrist pad base length 240 is from 1 . 9 to 5 . 1 cm with 3 . 8 cm being preferred . alternate embodiment 1500 could be inserted in bottom and top canvas covers which are in turn attached to straps . alternatively , straps could be attached directly to the invention 1500 . embodiment 1500 is preferably molded from gel , plastic , or rubber , but could be any material . the embodiment 1500 could be a solid piece or could be fabricated from a honey combed material . the total length of the of the invention 225 , as seen in fig4 , will vary from 20 . 3 to 30 . 5 cm , which includes the strap lengths , with a preferred length of about 25 . 4 cm . the dimensions are above are mostly illustrative and could be varied depending on the size of the user &# 39 ; s hand . in this embodiment shown in fig8 and 9 , the pad base 200 and wrist pad extension 300 have material removed to form a cavity 360 . the cavity 360 makes the wrist pad lighter . also , if wrist straps are attached directly to the pad base 200 , cavity 360 allows air to circulate to the user &# 39 ; s palm , making the pad more comfortable . the preferred embodiment is constructed from five layers . a larger or smaller number of layers or no layers could be used to construct the invention . the layers may all be the same shape , may all be different shapes , or some could be the same shape while others are different shapes . a wide variety of materials may be used for the various layers , including but not limited to gels , made from materials including but not limited to , natural materials such as aloe vera , man made materials such as petroleum gels , or any combination thereof . other materials for the wrist pad include but are not limited to foams , beads , soil , seeds , elastomers , plastics , rubbers , feathers , canvas , leather , fabrics , wood , paper , cardboard , glass , fiberglass , sand , metals , animal or plant components , fluids , such as but not limited to , oils or water or combinations thereof . the purpose of the multiple layers is to separate the inner components from one another to reduce wear and tear . the advantages of multiple layering is also to enhance users comfort . in addition , multiple padding serves to protect the users hand and or wrist in the event that the unit is exposed to extreme heat or cold . the wrist pad 100 may be formed as a single piece in the preferred embodiment . alternatively , it is possible that the wrist pad 100 might be formed as multiple pieces . as illustrated in fig7 , the preferred embodiment may consist of a bottom canvas cover 400 , plastic support 500 , cotton pad 600 , vibrating mechanism 700 , gel pad 800 , foam pad 900 , top canvas cover 1000 right wrist strap 1100 and left wrist strap 1200 . the plastic support 500 may be fastened to the bottom canvas cover 400 in any way , including but not limited to gluing , or sewing . additionally , the plastic support 500 could be constructed with small holes so it could be more readily fastened to bottom canvas cover 400 . the plastic support could be replaced by a support made of other materials , including but not limited to , metal or wood . plastic support 500 supports wrist pad extension 300 , and may be shaped in any manner that gives additional support to the user &# 39 ; s wrist . any of the components shown in fig7 can be made from any of the materials described above . vibrating mechanism 700 may be one or more vibrating coin motors fastened into the cotton pad 600 by methods such as , but not limited to , sewing or gluing . also other kinds of vibrating mechanisms could be used in place of vibrating coin motors , such as but not limited to miniature vibrating cylinder motors . wires 720 may be connected to the vibrating coin motors 700 and lead to the on / off switch 740 and then onto the batteries 740 , which may be affixed to the right wrist strap 1100 . alternatively the vibrating mechanism power source and switch could be completely contained in the wrist pad 100 . other alternative arrangements for powering the vibrating coin motors 700 are possible , such as but not limited to rechargeable and solar powered units . preferably , the unit is rechargeable and economical for the user . the rechargeable unit would have a led light to indicate when the unit is fully charged and an automatic charge shut off . this will avoid overcharging and increase the batteries life . the bottom canvas cover 400 , cotton pad 600 , gel pad 800 , foam pad 900 , and top cover 1000 may be fastened together along their matching perimeters or at any place in their bodies by methods such as , but not limited to , gluing or sewing . the layers may be joined together in such a way as to allow for wires to emerge from the wrist pad . the right wrist strap 1100 and the left wrist strap 1200 may be made of rectangular pieces of elastic . other materials that could be used for the right wrist strap 1100 and the left wrist strap 1200 include but are not limited to , fabrics such as leather , cotton , or nylon , or other materials such as but not limited to paper , plastic , metals , fiberglass , or wood . the right wrist strap 1100 has a right bottom surface 1120 and a right top surface 1140 . the left wrist strap 1200 has a left bottom surface 1220 and a left top surface 1240 hook and loop fasteners may be attached to the right top surface 1140 and a left bottom surface 1220 forming closing and adjustment mechanism for the wrist straps . other kinds closing and adjustment mechanisms include but are not limited to belt buckles , snaps , buttons , and slip buckles . devices for containing batteries may be attached to the right wrist strap 1200 to power a vibrating mechanism . the right wrist strap 1100 and the left wrist strap 1200 may be fastened to wrist pad 100 by methods including but not limited to gluing or sewing . a wide variety of shapes can be accommodated by this specification . compare fig4 to fig7 . in fig4 the pad base 200 is almost rectangular as compared to the more rounded shape of the pad base 200 in fig7 . in fig4 the pad extension 300 had a complex curvature as compared to the simple curvature of the pad extension 300 in fig7 . in another embodiment , the strap is basically a metal band which is curved a certain way so when it is bent it will coil and wrap itself around the user &# 39 ; s wrist . in this version the slap bracelet has an outer silicone rubber coating to provide comfort . this silicone rubber coating also would allow for the co - molding of the wrist pad and bracelet into one piece as opposed to the mockup sample in the pictures that is two pieces joined together . the gel wrist pad is attached to the slap bracelet through a backing which acts like a belt buckle and the slap bracelet is inserted into this opening and it allows the wrist pad to slide side to side on the bracelet so the user can position it where they want it . although this invention has been described with a certain degree of particularity , it is to be understood that the present disclosure has been made only by way of illustration and that numerous changes in the details of construction and arrangement of parts may be resorted to without departing from the spirit and the scope of the invention .	0
an object of the invention is to accurately detect a concentration of alcohol contained in fuel in order to achieve appropriate ecu control . first , upon describing a mechanism for measuring the concentration of alcohol contained in fuel , a configuration and an operation of an entire fuel control system are first described with reference to fig1 . fig1 is a diagram illustrating the configuration of an on - vehicle fuel control system . in fig1 , reference numeral 100 designates a fuel property detection device ( hereinafter referred to as an optical fiber sensor ) implemented by an optical fiber sensor . reference numeral 101 designates an engine of an automobile or the like . reference numeral 102 designates a fuel injection valve . reference numeral 103 designates a fuel tank . reference numeral 104 designates a fuel pump . reference numeral 106 designates a high - pressure filter for filtering fuel 117 sucked up from the fuel pump 104 via a fuel supply pipe 105 . reference numeral 107 designates a fuel distribution pipe . reference numeral 108 designates a fuel pressure regulator . reference numeral 109 designates a fuel return pipe . reference numeral 110 designates an air - fuel - ratio sensor . reference numeral 111 designates an ignition plug . reference numeral 112 designates an engine speed sensor . reference numeral 113 designates an intake pressure sensor . reference numeral 114 designates a throttle valve . reference numeral 115 designates an air cleaner . reference numeral 116 designates a control unit including an ecu , to which signals output from the optical fiber sensor 100 , the air - fuel - ratio sensor 110 , the engine speed sensor 112 , the intake pressure sensor 113 , and the like are input . the control unit 116 drives the fuel injection valve 102 , the ignition plug 111 , and the like , based on controlled variables corresponding to the input signals . next , a series of operations of the fuel control system are described hereinafter . when the fuel 117 is supplied to the fuel tank 103 , the engine 101 is started . simultaneously , the fuel 117 is pressurized by the fuel pump 104 . thus , the fuel 117 flows into the fuel distribution pipe 107 through the fuel supply pipe 105 and the high - pressure filter 106 . apart of the fuel 117 is supplied to the engine 101 from the fuel injection valve 102 . the rest of the fuel 117 is returned to the fuel tank 103 through the fuel pressure regulator 108 and the fuel return pipe 109 . incidentally , the fuel pressure regulator 108 always maintains the pressure of the fuel 117 in the pipes up to the fuel distribution pipe 107 at a constant value , regardless of an amount of fuel consumption of the fuel injection valve 102 . the presence / absence of alcohol mixed in the fuel 117 is detected by the optical fiber sensor 100 attached to the fuel pump 104 . when alcohol mixed in the fuel is present , the rate of content of alcohol is measured by the optical fiber sensor 100 , as will be described below . when the measured rate of content of alcohol is input to the control unit 116 , the control unit 116 grasps the state of the engine according to signals output from the engine speed sensor 112 and the intake pressure sensor 113 , and the control unit 116 changes an amount of fuel supplied to the engine by controlling the valve opening time of the fuel injection valve 102 . on the other hand , an air - fuel ratio is detected by the air - fuel - ratio sensor 110 . the control unit 116 performs the feedback control of the air - fuel - ratio so that the air - fuel - ratio reaches a target value corresponding to the state of the engine at that time . in addition , the control unit 116 controls the ignition timing of the ignition plug 111 according to the state of the engine . accordingly , optimum engine control according to the type of fuel supplied to a vehicle becomes possible . next , the attachment of the optical fiber sensor 100 to the fuel pump 104 is described below with reference to fig2 . incidentally , fig2 is a diagram detailedly illustrating an a - portion shown in fig1 , what is called a fuel supply apparatus . as illustrated in fig2 , the fuel pump 104 sucks and pressurizes the fuel 117 through a filter 50 and feeds the pressurized fuel 117 into the fuel injection valve 102 ( see fig1 , that is a part of injector ) through the fuel supply pipe 105 . generally , when the fuel pump 104 is mounted in the fuel tank 103 , the fuel pump 104 is removably supported therein by a stay 52 fixed to a plate 51 that blocks a hole 103 a provided in the fuel tank 103 . the stay 52 is provided with an arm 53 on which the optical fiber sensor 100 is provided so that the direction of the optical fiber sensor 100 is perpendicular to a liquid surface of the fuel 117 . a pair of sensing lines 54 respectively extending from a light source portion 3 and a light receiving portion 5 ( to be described below ) provided in the optical fiber sensor 100 are connected to a control portion 55 in which signals from the sensing lines 54 are converted into optimum signals representing the property of the fuel 117 . then , the optimum signals are connected via a signal line 56 to a connector 57 which is connected to the control unit 116 . the pair of sensing lines 54 differs in length between the optical fiber sensor 100 and the control portion 55 from each other due to the structure of the optical fiber sensor 100 . in fig2 , the control portion 55 is added to the fuel pump 104 such that the control portion 55 is one member including the fuel supply apparatus . alternatively , the control portion 55 may be installed in or outside the fuel tank 103 . for example , when the fuel tank 103 is installed in the fuel tank 103 , the number of members can be reduced by incorporating the function of the connector 57 to the control portion 55 . the fuel supply apparatus maybe configured by incorporating the high - pressure filter 106 and the fuel pressure regulator 108 illustrated in fig1 thereinto , i . e ., in the form of what is called a fuel pump module . specifically , when the fuel pressure regulator 108 is incorporated into the fuel supply apparatus , the fuel is not returned to the fuel tank 103 through the fuel return pipe 109 , and thus this case has a merit that the temperature resistance of the optical fiber sensor 100 can be improved . next , the internal structure of the optical fiber sensor 100 is described hereinafter with reference to fig3 to 4c . fig3 is an enlarged diagram of a b - portion shown in fig2 . fig4 a to 4c are perspective diagrams illustrating the appearance of the b - portion shown in fig3 . in fig3 , reference numeral 1 designates an optical fiber . reference numeral 3 designates a light source portion including a light emitting element 2 disposed at a first end portion of the optical fiber 1 . reference numeral 5 designates a light receiving portion including a light receiving element 4 disposed at a second end portion of the optical fiber 1 . a light emitting diode , a laser diode or the like can be used as the light emitting element 2 . a spectral analyzer , a photodiode or the like can be used as the light receiving element 4 . the light source portion 3 and the light receiving portion 5 are airtightly connected to the optical fiber 1 penetrating through opening portions 6 a of a pipe 6 . the light source portion 3 and the light receiving portion 5 are immersed in the fuel 117 , as shown in fig2 . thus , each of the light source portion 3 and the light receiving portion 5 has an airtight structure . the airtight structure is obtained by performing a welding connection of each of the opening portions 6 a or by applying a fusion structure using glass thereon . preferably , each of the opening portions 6 a functioning as a part of a connection portion is sealed with low - melting - point glass by way of example . preferably , the pipe 6 is formed of metal when the opening portions 6 a are sealed . in addition , in consideration of the fact that the pipe 6 is immersed in the fuel 117 , similarly to the light source portion 3 and the light receiving portion 5 , preferably , the pipe 6 is formed of a stainless steel . obviously , it is necessary that the optical fiber 1 is contacted with the fuel 117 . thus , as shown in fig3 or fig4 a , the pipe 6 can maintain the continuity thereof ( in plain words , the pipe 6 can hold the optical fiber 1 ) by providing a spiral fuel introduction hole 6 b therein . the fuel introduction hole 6 b may be formed into a shape illustrated in fig4 b or 4 c . specifically , the shape illustrated in fig4 c facilitates forming the pipe 6 of resin and reduction in weight of the optical fiber sensor 1 . when the pipe 6 is formed of resin , it is useful that the sealing of the opening portions 6 a with low - melting - point glass is performed at the light source portion 3 and the light receiving portion 5 , and that the light sealing portion 3 and the light receiving portion 5 are connected to the pipe 6 by , e . g ., screwing . even when the pipe 6 is formed of resin , similarly in consideration of the fact that the pipe 6 is immersed in the fuel 117 , preferably , the material of the pipe 6 is a polyacetal resin . hereinafter , a principle of detecting the property of fuel is described with reference to fig5 to 7 . incidentally , fig5 is an enlarged diagram of a c - portion shown in fig3 . fig6 is a graph illustrating an output characteristic of the optical fiber sensor . fig7 is a table illustrating the refractive index of fuel . the optical fiber 1 includes a core 10 in which light emitted from the light source portion 3 ( see fig3 ) propagates , a clad 11 which covers the core 10 to confine light in the core 10 , and a fiber jacket 12 covering the core 10 and the clad 11 for protection . in order to detect the property of the fuel 117 around the optical fiber sensor 100 , a part of the fiber jacket 12 is removed so that the clad 11 is contacted directly with the fuel 117 . inorganic glass such as quartz glass , or plastic materials such as polymethylmethacrylate , can be used as the materials of the core 10 and the clad 11 . a highly gasoline - resistant resin , such as a fluororesin , can be used as the material of the fiber jacket 12 . the principle of detecting the property of fuel utilizes a phenomenon that the intensity of a light beam in “ a cladding mode ” caused when a grating 13 reflects or transmits the light beam propagating in the core 10 , which varies depending upon the refractive index of fuel contacted with an outer peripheral part of the clad 11 . that is , in a part of the core 10 not formed the grating 13 the light beam propagating therein repeats reflection on the boundary surface between the core 10 and the clad 11 , so that the light beams propagate only in the core 10 . however , when the light beam reaches the grating 13 , the light beam is split into a first light beam 14 which is transmitted by the grating 13 and propagates in the core 10 , a second light beam 15 which undergoes a bragg reflection at the grating 13 and propagates in the core 10 in a opposite direction , and a third light beam 16 which leaks out of the core 10 and propagates in the clad 11 . the intensity of the first light beam 14 which is transmitted through the grating 13 and propagates in the core 10 , and the third light beam 16 which leaks out of the core 10 and propagates in the clad 11 , can be detected by the light receiving portion 5 ( see fig3 ) located at the second end of the optical fiber 1 in the direction of propagation of the light beams . here , the wavelength characteristic curve of the intensity of the transmitted light in the cladding mode has periodic loss peaks . because the optical fiber 1 is immersed in the fuel 117 , the height of each periodic loss peak varies depending upon the refractive index of the fuel 117 . in the alcohol - blended fuel , it has already been known that the refractive index of the fuel varies depending upon the concentration of ethanol contained in the fuel , shown in fig7 . thus , it is detected that the loss peaks of the transmission spectra of light in the cladding mode vary depending on the refractive index of the fuel , the concentration of alcohol contained in the fuel can be estimated by detecting the refractive index of the liquid . that is , a total amount of the intensity of light transmitted through the grating 13 changes depending upon the property ( refractive index ) of the fuel contacted with the outer peripheral part of the clad 11 . accordingly , the property ( refractive index ) of the fuel can be detected by an amount of light received by the light receiving element 4 . the control portion 55 ( see fig3 ) converts the amount of light detected by the light receiving element 4 into a voltage signal and outputs the voltage signal . as shown in fig6 , an output voltage ( v ) of the control portion 55 has a substantially inverse proportion relationship with the refractive index of the fuel . that is , as shown in fig6 and 7 , when the concentration of alcohol contained in the fuel increases , the refractive index of the fuel decreases , while the output voltage increases . an estimated value of the refractive index is calculated from the value of the output voltage ( v ) of the control portion 55 . specifically , the refractive index is estimated from the output voltage . then , the properties of the fuel , e . g ., the presence / absence of alcohol mixed in the fuel and the rate of content of the alcohol when the alcohol mixed in the fuel is present , can be grasped by the estimated refractive index . in other word , because such an output voltage corresponding to such a refractive index of the fuel is obtained , the valve opening time of the fuel injection valve 102 and the ignition timing of the ignition plug 111 are controlled according to such an output voltage . consequently , optimal engine control can be implemented . the shape of the optical fiber sensor 100 , which results in the optimal engine control , is described hereinafter in more detail . as is apparent from fig2 and 3 that have already been described , the optical fiber sensor 100 is configured so that the light source portion 3 and the light receiving portion 5 in addition to the optical fiber 1 are immersed in the fuel 117 . because it is unnecessary to bend the optical fiber 1 , an error of the output voltage obtained corresponding to the property of the fuel is extremely small . the light source portion 3 and the light receiving portion 5 need to maintain airtightness . however , because the light source portion 3 and the light receiving portion 5 are immersed in the fuel , change in the temperature thereof is relatively small . accordingly , the invention can have a considerable ripple effect that a sensor stable in temperature is obtained . because the optical fiber sensor 100 is attached to the arm 53 installed on the stay 52 , when the optical fiber sensor 100 is immersed in the fuel , an immersing operation is very easily achieved . when the optical fiber sensor 100 is attached to the fuel pump 104 , the fuel pump 104 and the optical fiber sensor 100 according to the invention are configured such that the area of a projection of the fuel pump 104 and the optical fiber sensor 100 on a plane including the hole 103 a is less than the area of the hole 103 a as shown in fig8 . that is , the area ( s 3 ) of a cross - section of the optical fiber sensor 100 is less than a value obtained by subtracting the area ( s 2 ) of a maximum cross - section part of the fuel pump 104 from the area ( s 1 ) of the hole 103 a . thus , even in the case of a fuel supply apparatus having a fuel property detection device , the fuel supply apparatus can smoothly be mounted in the fuel tank 103 without being damaged . hereinafter , another embodiment will be described . the relationship between the output voltage of the optical fiber sensor 100 and the refractive index of the fuel 117 has shown in fig6 . for example , when the fuel is not contacted with the grating 13 , an output voltage having an output characteristic curve indicated with a dashed line added to fig6 is obtained . when the output voltage which is about 5 v is input to the control portion 55 , the output voltage can be used to turn on an alarm lamp indicating occurrence of a “ small - remaining - fuel - amount ” state in which the liquid level of the fuel contained in the fuel tank 103 is lower than the position of the optical fiber sensor 100 . the optical fiber sensor 100 according to the invention has been described as a member of the fuel supply apparatus attached to the fuel pump 104 . however , the mode for carrying out the invention is not limited thereto . for example , even when the optical fiber sensor 100 is used in a stand - alone mode , similarly to shown in fig4 of wo2006 / 126468 , it is apparent that the advantages can similarly be obtained . in addition , although the optical fiber sensor 100 has been described as a fuel property detection device , similarly , it is apparent that the optical fiber sensor 100 can be applied to a liquid level detection device by causing the optical fiber sensor 100 itself extending in a direction perpendicular to the liquid surface of the fuel . while the invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	6
in accordance with the present invention , a first preferred family of i - line dyes having the requisite differential solubility and non - subliming characteristics comprise symmetrical structures having two identical chalcone moieties linked by appropriate spacer groups ( r 2 ). the bischalcone compounds may be represented by the following general formula : ## str1 ## where r 1 is chosen from the group : ## str2 ## where r 2 is selected from the group : -- o -- ch 2 -- ch 2 -- o -- co -- r 4 -- co -- o -- ch 2 -- ch 2 -- o --; -- nh -- co -- r 4 -- co -- nh --; where r 3 =-- h , -- ch 3 , halogen , -- oh , or -- och 3 ; where r 4 is chosen from the group : ## str3 ## where r 5 is an aliphatic , cycloaliphatic , or alkylaryl divalent radical such as : ## str4 ## a particularly preferred representative dye of this family is as follows : ## str5 ## in accordance with the present invention , a second family of preferred i - line dyes having the requisite differential solubility and non - subliming characteristics are bis - a - cyanoacrylates and bis - a - cyanoacrylamides having the general formula : ## str6 ## where r 1 is defined as above and where r 6 is selected from the group : ## str7 ## and where r 4 and r 5 are defined as above . a particularly preferred representative dye of this family is as follows : ## str8 ## likewise , in accordance with the present invention , a third family of preferred i - line dyes having the requisite differential solubility and non - subliming characteristics are the 1 , 4 - divinylbenzenes having the general formula : ## str9 ## where r 7 is selected from the group : ## str10 ## where r 8 is an alkyl , cycloalkyl , or alkylaryl monovalent radical such as methyl , ethyl , cyclohexyl , or benzyl ; where r 9 , r 10 and / or r 11 are -- h , -- ch 3 , -- oh , -- och 3 , halogen , or -- o -- ch 2 -- ch 2 -- oh ; and where a ! is a monovalent anion such as chloride , bromide , tosylate or methanesulfonate . a particularly preferred representative dye of this family is as follows : ## str11 ## 1 . exhibiting low solubility (& lt ; 2 wt . %) in commonly used photoresist solvents such as ethylene ( propylene ) glycol monomethyl ether acetate ( egmea and pgmea ), chlorobenzene , butyl acetate , 3 - ethoxyethyl propionate , and ethyl lactate ; 2 . exhibiting solubility to & gt ; 1 . 5 wt . % in preferred solvent systems for ultra - thin bottom anti - reflective coatings , e . g ., n - methylpyrrolidone , g - butyrolactone , tetrahydrofurfuryl alcohol , and mixtures thereof with higher volatility cosolvents such as cyclohexanone , diglyme , and diacetone alcohol ; 3 . possessing a molar extinction coefficient ( expressed in l / mol - cm ) in excess of 10 , 000 and , more preferably , in excess of 20 , 000 at i - line ; 4 . remaining effectively non - subliming over the temperature range 100 °- 220 ° c . when the dye is present in an ultra - thin anti - reflective coating applied onto a semiconductor substrate and when said coating is baked on a hot plate within the stated temperature range for 10 - 120 seconds . these compounds unexpectedly enable i - line arcs having ultra - thin thicknesses of less than 0 . 25 microns , preferably 0 . 05 to 0 . 20 microns . the arcs comprise a solvent ( or solvent mixture ), an organic polymer binder and the i - line dye ( s ). the dyes will be present in an amount of 25 wt . % to 60 wt . % thus providing high film absorbance at i - line ranging typically from 0 . 3 / 1000 å to 0 . 9 / 1000 å . despite the ultra - thin characteristics and heavy dye loading of the arc , there is no microscopic intermixing ( defined as less than a 0 . 01 micron zone centered at the photoresist / arc interface ) with i - line photoresists such as oir ® 32 ( ocg corporation trademark ) either when applied or baked . preferred polymer binders for ultra - thin arcs incorporating the new dyes are copolymers with high glass transition temperatures such as polyamic acids , polyarylethers , polyarylsulfones , aromatic polyamides , solvent - soluble polyimides , and aromatic polyureas . examples of especially useful binders include the following polymers : 1 . polyamic acid prepared by the reaction of 4 , 4 &# 39 ;- oxydianiline and pyromellitic dianhydride ; 2 . polyamide prepared from dimethyl terephthalate and 2 , 2 , 4 - trimethylhexanediamine ( known commercially as trogamid ®, huls america trademark ); 3 . polysulfone prepared as the reaction product of 4 , 4 &# 39 ; isopropylidenediphenol and 4 , 4 &# 39 ;- chlorophenylsulfone ( known commercially as udel ®, amoco performance products trademark ); 4 . polyurea prepared as the reaction product of bis ( 4 - 4 - amino - phenoxyl ! phenyl ) sulfone and methylene - di - p - phenyl diisocyanate . arcs incorporating the new dyes are prepared by dissolving the polymer binder and the dye ( s ) in the preferred arc solvents described above to a total solids concentration of 3 wt . % to 10 wt . %. the total solids concentration is adjusted so that when the coating is spin coated at 2000 - 6000 rpm for 30 - 90 seconds on a semiconductor substrate and then hot plate baked at 100 °- 220 ° c . for 30 - 120 seconds , the desired coating thickness will be obtained in the range of 0 . 05 microns to 0 . 25 microns . spin coating at 2500 - 5000 rpm for 60 - 90 seconds is preferred to obtain defect - free coatings . likewise , baking at 150 °- 210 ° c . for 30 - 60 seconds is preferred to achieve the best lithographic performance with most resists . ( defect - free refers to the absence of thickness variations , voids , pinholes , dewetted areas or particulate matter .) organosilanes such as 3 - aminopropyltriethoxysilane and / or surfactants such as fluorad ® fc - 430 ( 3m corporation trademark ) may be added to the ultra - thin arcs at levels of 0 . 01 wt . % to 0 . 5 wt . % to improve the adhesion and wetting character - istics of the coatings . preparation of bis - a - cyanoacrylamide dye from diamine , ethyl cyanoacetate , and vanillin ## str12 ## procedure to a 5 l , four - necked , round - bottomed flask equipped with a mechanical stirrer , thermometer , reflux condenser , and temperature probe with rheostat controller and heating mantle was added 197 . 56 g ( 1 . 70 mmol ) of 2 - methyl - 1 , 5 - pentanediamine . to this diamine was slowly added with stirring , 384 . 60 g ( 3 . 40 mmol ) of ethyl cyanoacetate . the reaction of 2 - methyl - 1 , 5 - pentanediamine and ethyl cyanoacetate produced an initial exotherm . when the exotherm subsided , the solution was heated at reflux for 1 h to give a clear , dark orange solution . heating was temporarily removed and the solution diluted with 1200 ml of ethanol . to the diluted solution was added 517 . 32 g ( 3 . 40 mmol ) of vanillin and 12 . 00 g ( 100 . 70 mmol ) of n - methyldiethanolamine as a catalyst , followed by an additional 1200 ml of ethanol . heating was reapplied and the dark orange solution maintained at reflux for 3 . 5 h . the solution was slightly cooled and 12 . 00 g ( 122 . 34 mmol ) of concentrated sulfuric acid was added to neutralize the reaction mixture . the solution was stirred overnight at room temperature to allow the dye to crystallize from the solution . the crystallized dye was collected by vacuum filtration using 500 ml of isopropanol for rinsing and washing . the collected dye was allowed to dry in the filtration funnel for 20 minutes and then washed twice with 1000 ml portions of deionized water to remove salts . subsequently , it was washed with three 1000 ml portions of acetone to remove unreacted starting materials and soluble by products . the wet solid was placed in a glass baking dish and air dried for two days to give 620 . 20 g ( 70 . 6 % yield ) of light orange colored dye . the dye exhibited a molar extinction coefficient of 38 , 700 l / mol - cm in tetrahydrofurfuryl alcohol . a 500 ml round - bottomed flask equipped with magnetic stirring bar and condensor was charged with 100 ml of ethanol , 12 . 40 ( 74 . 6 mmol ) of acetovanillone and 5 . 00 g ( 37 . 3 mmol ) of terephthaldehyde . the stirred mixture was first warmed to give a solution and the solution then cooled to 15 ° c . to the stirred solution at 15 ° c . was added 66 . 0 g ( 181 mmol ) of tetramethylammonium hydroxide ( 25 weight % aqueous solution ) over 18 min , with the temperature rising to a maximum of 25 ° c . the reaction flask was covered with aluminum foil to protect light sensitive chalcone and stirring continued at ambient for 2 days . the resulting reaction product was added dropwise to 450 g of stirred 1 . 5n hcl . solid terephthalaldehyde - derived chalcone was collected by filtration and washed on the filter with three 200 ml aliquots of deionized water , two 100 ml aliquots of ethanol , and two 25 ml portions of acetone . drying gave 13 . 8 g ( 86 % yield ) of yellow bischalcone that exhibited a molar extinction coefficient in n - methypyrrolidone ( nmp ) of 42 , 112 l / mol - cm . about 13 . 4 g of the product was stirred with 150 ml of boiling ethanol for 0 . 5 h , the mixture filtered hot , the precipitate washed on the filter with 50 ml of acetone , and then dried to give 8 . 2 g ( 52 % yield , overall ). the melting point of the purified yellow diphenolic chalcone was 234 °- 239 ° c . and the extinction coefficient in nmp was 49 , 550 l / mol - cm . a 250 ml round - bottomed flask equipped with magnetic stirring bar and condensor was charged wtih 82 ml of ethanol , 9 . 01 g ( 60 . 0 mmol ) of 4 - methoxyacetophenone , and 4 . 02 g ( 30 . 0 mmol ) of terephthalaldehyde . the stirred mixture was heated gently to give a solution . to this stirrred solution at 23 ° c . was added 28 . 1 g ( 77 . 0 mmol ) of 25 weight % tetramethylammonium hydroxide over 16 min . during the hydroxide addition , a precipitate almost immediately formed . the base addition was interrupted , an additional 80 ml of ethanol added , the chalcone lump broken up , and the rest of the tetramethylammonium hydroxide added . the final reaction mixture temperature was 26 ° c . the reaction mixture was then protected with aluminum foil and stirred at ambient for 3 days . the mixture was placed in the freezer for several hours ; and with the mixture temperature being 0 ° c ., the product was collected by filtration . the bischalcone was washed on the filter with ethanol followed by three 300 ml portions of deionized water . after drying , the yield of crude cream - colored solid was 10 . 63 g ( 89 %), mp 221 °- 246 ° c . the molar extinction coefficient in nmp was 44 , 700 l / mol - cm at 365 nm . the data for other representative dye structures from families 1 - 3 are summarized in table i . table i__________________________________________________________________________dye examples 4 - 27__________________________________________________________________________families 1 & amp ; 2 formula weight extinction coefficientexample aldehyde spacer group family ( g / mole ) ( l / mole - cm × 10 . sup .- 4 ) __________________________________________________________________________ 4 cinnamaldehyde 4 , 4 &# 39 ;- diacetylphenyl ether 1 482 5 . 69 5 n , n - dimethylamino - 2 - methyl - 1 , 5 - pentanediamine / eca * 2 513 3 . 65 benzaldehyde 6 furylcrolein 1 , 3 - propanediamine / eca 2 416 5 . 83 7 hydroxybenzaldehyde 2 - methyl - 1 , 5 - pentanediamine / eca 2 459 2 . 18 8 3 , 4 - dimethoxybenzaldehyde 2 , 2 , 4 - trimethylhexanediamine / eca 2 589 4 . 73 9 3 , 4 - dimethoxybenzaldehyde amine - terminated urethane oligomer / eca 2 802 4 . 7910 cinnamaldehyde di ( 2 - hydroxyethyl ) ester of pmda */ eca 2 707 5 . 5511 vanillin 1 , 2 - propanediamine / eca 2 477 3 . 8112 3 , 4 - dimethoxybenzaldehyde 2 - methyl - 1 , 5 - pentanediamine / eca 2 547 4 . 68__________________________________________________________________________family 3 reactant with terephthaldicarboxaldehyde yield (%) mp (° c . ) __________________________________________________________________________13 4 - hydroxyacetophenone 82 -- 370 3 . 3214 acetophenone -- -- 338 3 . 8315 n - 2 - hydroxyethyl cyanoacetamide 77 237 354 2 . 6516 4 - hydroxy - 2 - methylacetophenone 60 250 - 255 398 3 . 1817 4 - hydroxy - 3 - methylacetophenone -- -- 398 4 . 8018 3 , 4 - dimethoxyacetophenone 80 200 - 216 458 5 . 3419 2 - hydroxy - 6 - methoxyacetophenone 70 199 - 205 430 4 . 0920 4 - hydroxy - 3 , 5 - dimethoxyacetophenone 54 245 - 250 490 4 . 2721 2 - hydroxy - 4 - methoxyacetophenone 46 230 - 243 430 3 . 4922 2 - hydr5oxy - 5 - methoxyacetophenone 58 152 - 210 430 1 . 6823 2 - hydroxyacetophenone 65 223 - 245 370 1 . 9924 3 - hydroxyacetophenone 98 210 - 213 370 1 . 4125 2 , 4 - dihydroxyacetophenone 88 -- 402 1 . 3926 4 - hydroxy - 2 - methylacetophenone 60 250 - 255 398 3 . 1827 4 - hydroxyethoxyacetophenone 85 249 - 255 458 3 . 71__________________________________________________________________________ / eca denotes reaction product of diamine with two moles of ethyl cyanoacetate ; ** pmda is pyromellitic dianhydride . the dichalcone dye described in example 2 was dissolved in a polyamic acid solution formulated with solvents nmp and cyclohexanone to achieve a weight ratio of dye to other ingredients ( excluding solvents ) of 0 . 67 : 1 . 00 . this arc formulation was spincoated onto three separate glass slides at 5000 rpm for 60 seconds . the three slides were baked on a hot plate at respective temperatures of 168 °, 200 °, and 230 ° c . for 60 seconds . for adjusted film thicknesses of 1300 å , the absorbances at i - line were 0 . 61 , 0 . 60 , and 0 . 59 , indicating that dye sublimation was not occurring as bake temperature increased . to demonstrate the lithographic capability of the arc , the formulation was spin coated at 5000 rpm for 60 seconds onto a silicon wafer that had been treated with brewer science &# 39 ; s apx adhesion promoter and the coating was then baked on a hot plate at 168 ° c . for 60 seconds . a positive - working photoresist ( shipley microposit ® 1470 ) soluble in propylene glycol methyl ether acetate ( pgmea ) was immediately applied over the arc by spin coating at 5000 rpm for 30 seconds . the resist was soft baked for 30 seconds on a hot plate at 100 ° c . and exposed on a stepper with a mercury - xenon light source . the specimen was then developed in aqueous tetramethylammonium hydroxide ( shipley mf ®- 319 developer ) for 45 seconds at ambient temperature to clear the exposed areas of the resist and those portions of the arc immediately beneath the exposed resist . microscopic examination showed that the cleared areas were residue - free and that stable 0 . 7 μm features were resolved . an arc formulation was prepared by combining 144 . 40 g of 20 % solids polyurea solution in tetrahydrofurfuryl alcohol ( thfa ), 23 . 10 g of the bis - a - cyanoacrylamide dye from example 1 , 568 . 58 g of cyclohexanone , and 379 . 06 g of thfa . ( the polysulfone was a copolymer of bis ( 4 - 4 - aminophenoxy ! phenyl ) sulfone and methylene - di - p - phenyl diisocyanate .) the solution was ion exchanged with 50 g of rohm and haas amberlite ® 200c ( h ) ion exchange beads for 4 h to remove ionic contaminants . a sample was then taken and the thickness checked to give 1300 å ± 50 å . the ion exchange beads were removed with a coarse screen and the final formulation filtered through a 0 . 2 μm capsule filter . the experimental arc was spin coated for 60 seconds at 2500 rpm onto a 6 &# 34 ; silicon wafer and baked on a hot plate for 60 seconds at 200 ° c . to obtain a defect - free film with a thickness of 1332 å ( by ellipsometry ). an ethyl lactate - based , i - line photoresist capable of submicron resolution ( ix 500 el from japan synthetic rubber ) was spin coated over the arc and soft baked at 100 ° c . for 90 seconds in proximity . the resist was exposed with a nikon i - line stepper ( 0 . 50 numerical aperature ) for 580 msec and then post - exposure baked at 110 ° c . for 90 seconds in proximity . the wafer specimen was then single - puddle developed for 40 seconds in aqueous tetramethylammonium hydroxide to generate the line & amp ; space patterns shown in fig1 . ( the unetched arc film can be seen beneath and between the resist features .) the high quality of the resist features , i . e ., the presence of highly vertical resist feature sidewalls and the absence of any rounding at the bottom of the resist features , as well as the linearity of the pattern critical dimension ( cd ) and mask cd ( fig2 ) was evidence of the excellent compatibility of the arc and photoresist . using a sublimable , photoresist - soluble dye in a polyimide - based arc . comparison with performance of arc from example 28 . dicinnamalacetone ( dca , structure shown below ) was selected as an example of a highly absorbing i - line dye which is sublimable at arc processing temperatures and is soluble in photoresist solvents such as propylene glycol methyl ether acetate ( pgmea ). arcs were prepared from dca and evaluated to demonstrate 1 ) the negative relationship between bake temperature and film absorbance and 2 ) the excessive removal of dca from the film during photoresist application . ## str15 ## dicinnamalacetone was combined with polyamic acid solution ( in nmp and cyclohexanone ) in a manner similar to that described in example 28 to form arcs with weight ratios of dca to other ingredients of 0 . 60 : 1 . 00 and 0 . 80 : 1 . 00 . ( these values correspond to coated films which contain 37 . 5 wt . % and 44 . 4 wt . % dye , assuming the proportions of the ingredients remain the same during the spin coating process .) the two arcs were spin coated onto round glass slides at 4000 rpm ( 60 sec ) and baked on a hot plate at these respective temperatures : 150 °, 168 °, 190 °, and 210 ° c . the film thickness ( by profilometry ) and film absorbance of each specimen were measured shortly after baking . subsequently , the specimens were placed back on the spin coater and liquid pgmea was puddled on the coating for five seconds in a static condition and then spun until dry . film absorbance was then redetermined . ( the absorbance loss of the arc resulting from pgmea application can be correlated with absorbance loss during the application of a photoresist , a process commonly known as stripping .) the initial film thickness and absorbance data before and after pgmea application are presented in table ii . table ii______________________________________film thickness and film absorbance for dicinnamalacetone - loadedpolyamic acid - based arc as a function of bake temperature andbefore and after pgmea applicationcalculated bake filmwt . % dca temperature thickness film absorbance at 365 nmin arc film (° c .) ( å ) before after % loss______________________________________37 . 5 150 1327 0 . 7543 0 . 4885 35 . 237 . 5 168 1215 0 . 6361 0 . 4840 23 . 937 . 5 190 1013 0 . 4299 0 . 4285 0 . 337 . 5 210 902 0 . 2027 0 . 2026 0 . 044 . 4 150 1522 0 . 9741 0 . 4265 56 . 244 . 4 168 1416 0 . 8331 0 . 5239 37 . 144 . 4 190 1058 0 . 5494 0 . 5209 5 . 244 . 4 210 915 0 . 2095 0 . 1976 5 . 7example 28 arc containingusing 40 . 1 wt . % family 3 dye 168 1565 0 . 7206 0 . 6845 5 . 0 200 1545 0 . 7171 -- -- 230 1495 0 . 6799 -- -- ______________________________________ the results showed that dca - loaded arcs , though highly absorbant at i - line , showed significant sublimative losses as bake temperature increased from 150 ° c . to 210 ° c . this was evidenced by a sharp monotonic decrease in starting film absorbance and film thickness as bake temperature was raised . the films were also highly susceptible to stripping by pgmea ( as measuredby % loss ), particularly at the lower bake temperatures . as expected , stripping was more severe for the arc prepared with a higher dye loading . these results could be contrasted with those ( bottom of table ii ) for the example 28 arc which showed virtually no stripping or sublimative loss at a comparable dye loading . using a sublimable , photoresist - soluble dye in a polyurea - based arc . comparison with performance of arc from example 29 . an arc similar to the polyurea composition described in example 29 was prepared by combining dca with polyurea in a mixture of thfa and cyclohexanone . the arc was formulated to provide 28 . 6 wt . % dca in the coated film . it was spin coated onto round glass slides at 5500 rpm ( 60 sec ) which were baked on a hot plate at these respective temperatures : 168 °, 190 °, and 220 ° c . the film thickness ( by profilometry ) and film absorbance of each specimen were measured shortly after baking . a pgmea - based resist ( shipley microposit ® 1470 ) was spin coated over the arc and then immediately removed by spraying the specimen with pgmea for five seconds while spinning . film absorbance was remeasured to determine the degree of dye stripping resulting from the resist apply and removal process . the initial film thickness and absorbance data before and after resist application are presented in table iii . table iii______________________________________film thickness and film absorbance for a dicinnamalacetone - loadedpolyurea - based arc as a function of bake temperature andbefore resist application and after resist removalcalculated bake filmwt . % dca temperature thickness film absorbance at 365 nmin arc film (° c .) ( å ) before after % loss______________________________________28 . 6 168 2180 0 . 6571 0 . 2614 60 . 228 . 6 190 1980 0 . 3483 0 . 1708 51 . 028 . 6 220 1800 0 . 1275 0 . 0904 29 . 1example 37 arc containing44 . 4 wt . % family 1 dye 200 1485 0 . 5498 0 . 4259 22 . 5 220 1460 0 . 5371 0 . 4292 20 . 1______________________________________ as in example 30 , the dca - loaded films showed a sharp drop in absorbance and thickness as bake temperature increased , indicating that dye sublimation was occurring . likewise , resist application and removal caused a significant reduction in arc absorbance at all bake temperatures because of the high solubility of dca in the resist solvent , pgmea . it should be noted that stripping levels were high even though the dca content in the as - spun films was low . the example 29 arc ( see bottom of table iii ), on the other hand , exhibited much less stripping than the dca - loaded arc at a higher dye loading . the film thickness and absorbance of the example 29 arc were also stable at the bake temperatures used in the study .	2
an ear protector 1 , according to a first embodiment of the invention , is shown in fig1 and 2 in a position of use supported on the head of a user , shown generally at 3 , and covering an ear , shown generally at 5 . protector 1 is supported on a headband 7 or other similar appliance encircling head 3 of the user . protector 1 is essentially defined by a cup - shaped cap member 9 , a suspension member 11 and a retainer clip 13 . cap member 9 is configured to fit over ear 5 and preferably molded from plastic material . cap member 9 is also provided with a plurality of openings 15 therethrough for the dual purpose of providing ventilation to ear 5 and permitting sound transmission through cap member 9 . openings 15 may generally be in the form of wide parallel slots as shown in fig1 . suspension member 11 is in the form of a flexible elongate strap , preferably molded from plastic material , so that it may easily conform to the external curvature of both cap member 9 and ear 5 , as shown in fig2 . the lower end of member 11 is attached to the central portion of cap member 9 by an appropriate pivot connection 17 which permits cap member 9 to rotate with respect to suspension member 11 and thereby conform to the angular disposition of ear 5 . the upper end of suspension member 11 is joined to retainer clip 13 , with both member 11 and clip 13 being preferably integrally formed from plastic material through injection molding or other known forming process . the details of retainer clip 13 shall now be described with reference to fig3 . as shown therein , clip 13 includes a first plate 19 and a second plate 21 , with plates 19 and 21 being of corresponding size and configuration and joined by a hinge section 23 . in this way , first plate 19 may be folded on top of second plate 21 to enclose headband 7 therebetween , as particularly shown in fig2 . first plate 19 includes a tab 25 provided with a longitudinal recess 27 therein . recess 27 has a substantially cylindrical configuration for receiving a correspondingly shaped longitudinal rib 29 supported on the end of a second tab 31 , as seen in fig2 carried by second plate 21 . thus , plate 19 may be retained in a folded position over plate 21 by snap fitting rib 29 within recess 27 . it is also preferred that the inner opposed surfaces of plates 19 and 21 be provided with opposed gripping means 33 in order to prevent clip 13 from sliding with respect to headband 7 during use of protector 1 . gripping means 33 is preferably in the form of plural strips of rubber or similar friction members adhesively attached to the inner surfaces of plates 19 and 21 as shown in fig3 . suspension member 11 and retaining clip 13 may be integrally injection molded from polypropylene or other suitable polymer plastic having lightweight , high strength and particular durability under repeated flexing and required for hinge section 23 . cap member 9 may also be injection molded from the same plastic or any other type of material deemed appropriate for the practice of the invention as disclosed herein . pivot connection 17 may be of any conventional metal or plastic connection which preferably permits rotation of cap member 9 with respect to suspension member 11 and also permits cap member 9 to be retained in a desired position of rotation . an ear protector 100 according to a second embodiment of the invention shall now be described with reference to fig4 . as shown therein , protector 100 is similar to protector 1 of the first embodiment in its inclusion of cap member 9 , suspension member 11 and retaining clip 13 . however , in the instant embodiment , cap member 9 is provided with a securing member 35 for the purpose of securing cap member 9 to a temple 37 of an eyeglass frame . member 35 is preferably of an elongate configuration and defined by a pair of arms 39 and 41 , the terminal ends of which are provided with a pair of loops 43 for engaging temple 37 . as is apparent from fig4 arms 39 and 41 may be disposed in any desired angle with respect to each other in order to accommodate temples of different configurations . member 35 is preferably secured to cap member 9 by pivot connection 17 , or in any other manner deemed suitable for the practice of the invention as described herein . as shown in fig5 securing member 35 is preferably of a flat strip configuration and provided with an aperture 45 through which pivot connection 17 may be inserted . loops 43 are preferably formed of elastic material to permit their snug engagement around temple 37 , and also to accommodate temples of different sizes . arms 39 may also be formed of elastic material or any other suitable material known in the art . it is to be understood that the embodiments of the invention herein shown and described are to be taken as preferred examples of the same , and that various changes in shape , size , arrangement of parts and composition may be resorted to without departing from the spirit of the invention or scope of the subjoined claims .	8
since the beginning of the cd - rom and dvd industry , there has been a need to destroy the information and data carried by an optical disc such as a compact disc , as discussed above . to date , there has been a distinct lack of lightweight or low cost portable units available to the military or to such diverse businesses as banks and large corporations that publish confidential and sensitive information on optical discs and which would enable such entities to accomplish the important objective of destroying the compact discs once their usefulness has expired . as previously indicated , the department of defense ( dod ) has issued destruction standards for compact disc media , as has nist . whether the entire disc is destroyed or just the information bearing surface thereof , the resultant information - containing particulate material must be at least 250 microns or less in size in order for 100 % safe digital destruction . otherwise , optical microscopy can be utilized to extract data and information from particles larger than this size . moreover , it is also highly desirable to be able to save the polycarbonate substrate layer of the compact disc for subsequent recycling as well as positive identification for documenting the disc destruction . the device of the present invention accomplishes both of these very important functions . it should be understood that the term “ optical disc ” as used herein and in the claims attached hereto is understood to include field upgradable forms of optical media including , but not limited to , commercially produced cd - rom , commercially produced dvd - rom , cd - r , dvd - r , dvd , dvd9 , dvd - ram , dvd - rom , dvd - erasable , dvd - rewritable , blue laser and blu - ray in all their forms , and other forms of optical media . perhaps the invention can be better understood from the drawings . fig1 is an oblique , substantially lateral view of an embodiment of the invention , where a housing 2 has a first hinged lid or cover 4 with hinges 6 and a second hinged lid or cover 8 with rear hinges ( not shown ). a cd or other optical disc can be positioned on disc retaining spindle 12 on surface 14 . in the substantially cross - sectional schematic of fig2 , housing 2 defines a first chamber 18 and a second chamber 20 . within chamber 18 is a drive member 22 that comprises two or more vanes 24 and cutter or cutting member 26 . at the upper portion of cutter 26 is cutting edge or surface 30 . a support member 34 supports surface 14 . within first chamber 18 a particulate transfer chamber 38 extends to an opening 40 in a wall 42 between first chamber 18 and second chamber 20 . opening 40 preferably engages a cylindrical member 46 that will direct particulate matter into a disposable paper or plastic bag ( not shown ). a disc drive mechanism 48 to cause an optical disc to rotate is mechanically connected to drive member 22 . the rotational velocity of drive member 22 can be the same as or less than the rotational velocity of disc drive mechanism 48 . preferably the rotational velocity of drive member 22 and cutter 26 is from about two to five times the rotational velocity of drive member 22 . a top view of an embodiment of the invention is shown in fig3 . a power on / off switch 52 , an led indicator 54 , and on and off buttons 56 and 58 , respectively , are positioned on a top surface 62 between cover 4 and cover 8 . on cover 4 an adjustment switch or dial 64 is adjacent a recess 66 that is shaped to allow clearance around an optical disc that may be positioned on spindle 12 . a finger grip 68 is positioned on each side of cover 8 . fig4 represents a partial top view of an embodiment of the invention where cover 4 has been removed or rotated out of the view . spindle 14 , which is shown in a “ start ” position , is mechanically connected to a mechanism ( not shown ) in chamber 18 . when an optical disc is placed on spindle 14 and start button 56 is pushed , spindle 12 and the disc move along groove or track 70 toward cutter 26 and disc drive mechanism 48 . disc drive mechanism 48 then causes the disc to rotate while cutter 26 removes the information - bearing layer . particulate matter from the information - bearing layer is “ sucked ” through at least the openings 72 around cutter 26 into particulate transfer chamber 38 to be collected in second chamber 20 . a unique feature of the invention is the ability to adapt to optical discs of different types and / or sizes . there are at least two places on this embodiment of the invention where adjustments can be made . first , an allen wrench receptable 76 on surface 14 can be rotated to make “ coarse ” adjustments . also , knob 64 on cover 4 is intended to facilitate finer adjustments . the cutter may not produce a clean disc if contact between the disc and the cutter is too loose or too tight . adjustment begins with the fine control knob 64 turned to the minimum setting ( counter - clockwise ). the ideal setting for the coarse control is set when the cutter just skims the disc surface . the coarse control 76 is modified by using a number 5 metric allen wrench , where the allen wrench is rotated in ¼ turn intervals until the ideal setting is reached . a disc should be tested at each interval until the ideal setting is reached . adjusting the coarse control counter - clockwise decreases the force between the disc and cutter ; clockwise adjustment increases the force between the disc and cutter . adjustments are also possible using an automated sensor and pressure switch which removes manual intervention from the adjustment process . once the ideal setting on the coarse control has been reached , the cutter adjustment should be fine - tuned by gently depressing and turning the fine adjustment one click clockwise . then , a disc should be tested , and the procedure should be repeated as necessary . a maximum of ten settings is provided ; if the course adjustment is appropriately set , the fine adjustment should only require three or four turns . one of the adjustment mechanisms is shown in detail in fig5 , which is a partially cross - sectional schematic of a detail of an embodiment of the invention . an optical disc 80 has been positioned where its lower surface 82 is in contact with cutter head 84 . dial / switch 88 in cover 90 is connected through a spring bias 92 with contact 94 . turning dial / switch 88 causes contact 94 to raise or lower , thus determining the pressure contact 94 exerts on the upper surface 98 of optical disc 80 . cutter head 122 is preferably replaceable . the device can be designed so that either cutter head 122 alone is replaceable or both cutter head 122 and cutter support member 118 are replaceable together . preferably there will be a typical push - in - and - twist type of function to facilitate the replacement . another detail of the invention is shown in fig6 , which is a schematic of the cutter and cutter device mechanism . an electric motor 102 has a drive shaft 104 that engages and rotates vane assembly 106 . vane assembly 106 has vanes 108 that create fluid motion to move particulate matter . the distal surface 110 of vane assembly 106 has a cylindrical fitting 114 that receives and engages a spring 116 and a cutter support member 118 . cover support member 118 in turn receives and removably engages cutter head 122 with cutting surface 124 . preferably a device according to the invention will have more than one speed . in one embodiment , “ speed 1 ” is the fastest speed . it cuts the information layer in about 15 seconds in the unit developed for the dod . in a commercial unit , the cutting time is twice as long to account for thicker coatings on the discs . this is the default speed . pushing on the blue start button 56 once for ½ second activates speed 1 . if the results are not adequate , as measured by complete removal of the printed surface layer so that you can see the clear polycarbonate , then the next speed should be tried . “ speed 2 ” is the middle speed . this speed should be used if the results at speed 1 are not adequate . to activate speed 2 , blue button 56 should be held down for about two seconds , or until one beep is heard . if the results are not adequate , as measured by complete removal of the printed surface layer so that you can see the clear polycarbonate , then the next speed should be tried . “ speed 3 ” is the slowest speed . this speed should be used if the material coatings on the discs are significant , such as in highly art intensive commercially produced discs . an example of such discs is the discs received from aol ®. to activate speed 3 , blue button 56 should be held down for about four seconds , or until two beeps are heard . in another embodiment of the invention there can be a two - speed system in which a switch is moved into a first position to control the first speed process of approximately under 15 seconds . movement of the switch to a second position slows the cutting speed process from about 15 seconds to about 30 seconds . this improvement permits the user of the device to push down the start button for a fraction of a second , and the controls then process the speed of the destruction cycle . the department of defense uses a sticky label to identify a cd - rom disc which contains classified information . the label is similar to an avery ® label used in bulk mailings that have pre - printed addresses . these labels have two materials other than the ink : the paper the ink is printed on , and a glue underneath the paper which holds the label to the disc . when sticky labels are removed from the cd - rom discs , it may be necessary to slow the device to speed 2 or speed 3 for the cutter , which spins at 6 , 500 rpm , to cut through the label and then into the information bearing sub - layers of the discs . the cutter described above is preferred but not exhaustive of the cutting arrangements that could be employed to remove an information - bearing layer . other known cutting , grinding , or abrasive configurations could be used . see , for example , u . s . pat . no . 6 , 039 , 637 , incorporated hereon by reference . as can be seen from the above , the present invention provides a security device particularly adapted to destroying the information - bearing surface layer of an optical disc in a rapid and efficient manner . utilizing the present invention , the information - bearing surface layer of an optical disc can be reduced to particulate matter having a particle size as small as only about 2 microns , which is two orders of magnitude less than the minimum 250 microns required by the department of defense . in one embodiment of the invention , the particulate matter may have a particle size of less than about 326 microns . in another embodiment of the invention , the particulate matter may have a particle size of less than about 250 microns . in another embodiment of the invention , the particulate matter may have a particle size of from about 2 to about 200 microns . in another embodiment of the invention , the particulate matter may have a particle size of from about 10 to about 150 microns . in another embodiment of the invention , the particulate matter may have a particle size of from about 326 microns to about 5 mm . the embodiment of the present invention represented by fig1 - 6 weighs only approximately 10 pounds and has a height of about 5 inches , a width of about 10 inches and depth of about 12 inches . consequently , the device of present invention is lightweight and easily portable . thus , sensitive and confidential information can be accumulated in substantial amounts on compact discs , yet they are readily declassifable in short order simply by utilizing the present invention . moreover , the substrate layers of the optical discs are retained intact for either recycling use or to identify the complete destruction of the compact disc for security purposes . the foregoing description and the illustrative embodiments of the present invention have been described in detail in varying modifications and alternate embodiments . it should be understood , however , that the foregoing description of the present invention is exemplary only , and that the scope of the present invention is to be limited to the claims as interpreted in view of the prior art . moreover , the invention illustratively disclosed herein suitably may be practiced in the absence of any element which is not specifically disclosed herein .	6
referring to fig1 , the servo adjustable gripper device 2 according to the invention will be described . the device is used to grip a plurality of objects such as boxes 4 and deposit them onto a pallet 6 for shipment . the boxes originate from a conveyor or other device in which a plurality of boxes of packaged articles are aligned in end to end fashion and are transported by the gripper device for placement on the pallet . more particularly , the gripper device includes a frame 8 which is connected with a robotic arm 10 and a controller 12 . the controller controls the movement of the arm and operation of the gripper device to simultaneously transport the boxes . the details of the servo adjustable gripper device according to the invention are better shown in fig2 - 4 . at the top of the frame is a swivel device 14 which is connected with the end of the robotic arm so that the frame can be rotated relative to the arm . the frame has a generally rectangular configuration and includes a pair of side plates 16 , 18 , a pair of end plates 20 , 22 , and a center plate 24 . a junction box 26 is arranged at one end of the frame and is electrically connected with the controller 12 for receiving control signals therefrom . a plurality of carriages 28 are slidably connected with the frame as will be discussed in greater detail below in connection with fig5 - 8 . the carriages have at least one gripping assembly 30 connected therewith . also connected with the frame are pallet grasping arms 32 and pneumatic cylinders 34 for displacing the arms 32 under control of a pneumatic valve assembly 36 as will be described below with reference to fig1 - 15 . referring now to fig5 - 8 , the slidable carriages 28 and gripping assemblies 30 will be described . in the embodiment shown in these figures , there are four carriages 28 a , 28 b , 28 c , and 28 d . connected between the frame end plates 20 , 22 and passing through the center plate 24 of the frame are parallel guide rails 38 which support the carriages 28 a - d . between the guide rails 38 are provided two parallel lead screws 40 and 42 which are rotated by a servo motor 44 under control of the controller 12 via the junction box 26 . referring to fig7 , a drive gear 46 is rotated by the servo motor 44 . an idler gear 48 transfers rotation of the drive gear to a first gear 50 which rotates the screw 40 and a second gear 52 which rotates the screw 42 . the first and second gears have different diameters so that the first gear 50 rotates the screw 40 at a first speed and the second gear 52 rotates the screw 42 at a second speed which is twice the first speed . substituting different sized gears will alter the rotational speed of the screws . the first and second screws pass through couplings 54 in the frame center plate 24 . the portions of the screws on opposite sides of the plate are threaded in opposite directions . that is , the left portion of the screw 40 is threaded in a first direction and the right portion of the screw on the opposite side of the center plate is threaded in an opposite direction . the same applies for the screw 42 . each carriage includes a nut 56 a , 56 b , 56 c , 56 d which is threadably connected with one of the screws . more particularly , the nut 56 a connects the carriage 28 a with the left portion of the screw 42 and the nut 56 d connects the carriage 28 d with the right portion of the screw 42 . the nut 56 b connects the carriage 28 b with the left portion of the screw 40 and the nut 56 c connects the carriage 28 c with the right portion of the screw 42 . as the screw 40 rotates in a first direction , the carriages 28 b and 28 c are drawn together and when the screw rotates in the opposite direction , the carriages 28 b and 28 c are pushed away from each other . similarly , as the screw 42 rotates in a first direction , the carriages 28 a and 28 d are drawn toward each other and when the screw rotates in the opposite direction , the carriages 28 a and 28 d are pushed away from each other . the carriages 28 a and 28 d move at twice the speed as the carriages 28 c and 28 d because of the different sizes of the drive gears 52 and 50 . connected with each carriage 28 is at least one set of gripping assemblies including an array of gripping devices . in fig1 - 15 , the gripping devices are vacuum devices 58 which utilize suction to grip the top surface of a box . the suction is provided by vacuum supplies 60 mounted on the frame . as shown in fig8 , three vacuum devices are provided in alignment for each set of gripping assemblies although any number of devices may provided . in lieu of vacuum devices , mechanical gripper devices may be provided where articles are to be transported instead of boxes . fig1 shows a mechanical gripper device 62 which includes gripper fingers 64 which are displaced between gripping and released positions by a servo motor 66 . as shown in fig4 and 5 , the carriages 28 a and 28 d at opposite ends of the frame 8 include a single set of gripping assemblies whereas the carriages 28 b and 28 c include two sets of gripping assemblies . this enables gripping assemblies to be positioned at the edges of the boxes . as shown in fig5 , the single set of gripping assemblies from the carriage 28 a and one set of gripping assemblies from the carriage 28 b are positioned at opposite edges of the left most box 4 , the other set of gripping assemblies from the carriage 28 b and one set from the carriage 28 c are at opposite edges of the center box , and the other set of gripping assemblies from the carriage 28 c and the single set of gripping assemblies from the carriage 28 d are positioned at opposite edges of the right box . this arrangement is more clearly shown in fig9 . fig1 and 11 show an alternate arrangement of carriages for transporting an even number of boxes . a center carriage 28 e is provided which is fixed to the frame . unlike the carriages 28 a - d , the fixed center carriage 28 e does not move along the frame . the fixed carriage includes two sets of gripping assemblies which are positioned at the edges of adjoining center boxes as shown . the remaining carriages are positioned as in the embodiment of fig5 and 9 so that gripping assemblies are provided at the opposite edge of each box to be transported . in fig1 , the same servo adjustable gripper device as shown in fig1 is provided , except that the device is being used to transport larger ( wider ) boxes than are being transported in fig1 . the larger boxes are accommodated by positioning the slidable carriages as necessary so that the gripping assemblies are arranged adjacent the end edges of the boxes . with the present invention , all the operator of the servo adjustable gripper device must do is enter into the controller the number and dimension of the boxes to be transported . these entries are used by the controller to activate the servo motor 44 to turn the screws 40 , 42 to properly position the carriages in accordance with the number and size of the boxes . if only two boxes are to be transported the outermost carriages 28 a and 28 d and the outermost gripping assemblies of the inner slidable carriages 28 b and 28 c would not be used . thus , the adjustable gripper of the invention is extremely versatile and efficient for transporting boxes of articles from a loading conveyor to a pallet or other storage device . by entering the coordinates of the origin and destination into the controller , the robotic arm automatically transports the boxes as required . this allows a plurality of boxes to be efficiently transported simultaneously . turning now to fig1 - 15 , the pallet grasping arm feature of the invention will be described . four pallet grasping arms 32 are pivotally connected with the side walls of the frame 8 , two arms per side . the arms on opposite sides of the frame are connected via rotatable shafts 68 . pneumatic cylinders 34 on one side of the frame have plungers 70 which are connected with intermediate portions of the arms 32 . operation of the cylinders by the pneumatic valve assembly 36 displaces the plungers to pivot the arms 32 up and down relative to the frame . pivotal movement of the arms enables the end portions thereof to engage a pallet for transporting the same . a pallet stabilizer arm 72 is pivotally connected with the frame and pivoted by a pneumatic cylinder 74 under control of the pneumatic valve assembly 36 which is in turn operated by the controller . the stabilizer arm helps to steady the pallet during transport . while the preferred forms and embodiments of the invention have been illustrated and described , it will be apparent to those of ordinary skill in the art that various changes and modifications may be made without deviating from the inventive concepts set forth above .	1
fig1 shows a longitudinal section through an upper half of a magnetic resonance device with a tunnel - shaped patient acceptance chamber according to the prior art , wherein for clarity only the components in the sectional plane are shown . the magnetic resonance device has an essentially hollow - cylindrical basic field magnet 110 that , to generate an optimally homogenous static basic magnetic field in the patient acceptance chamber , has superconducting primary coils 114 and likewise superconducting shielding coils 115 associated with the primary coils 114 . a likewise essentially hollow - cylindrical gradient coil system 120 to generate rapidly switchable gradient fields is arranged in the cavity of the basic field magnet 110 . the gradient coil system 120 includes , diagnosed from the inside out , the following elements that are concentric to one another in essentially hollow - cylindrical sub - regions of the gradient coil system 120 : a first transverse gradient coil 121 , formed by four saddle coils to generate a first transverse gradient field with a gradient in a direction perpendicular to the hollow - cylinder main axis 150 ; a second transverse gradient coil 122 , likewise formed by four saddle coils to generate a second transverse gradient field with a gradient in a direction perpendicular to that of the first transverse gradient coil 121 and perpendicular to the hollow - cylinder main axis 150 ; a cooling device ( not shown ) to cool the gradient coils 121 , 122 and 123 ; a longitudinal gradient coil 123 formed by two solenoid coils to generate a longitudinal gradient field with a gradient in the direction of the hollow - cylinder main axis 150 ; a further cooling device in connection with a shim device that are not shown ; a longitudinal gradient shielding coil 127 associated with the longitudinal gradient coil 123 ; a first transverse gradient shielding coil 125 associated with the first transverse gradient coil 121 , and a second transverse gradient shielding coil 126 associated with the second transverse gradient coil 122 . since the conductor structures of the gradient coil system 120 are comparatively large and significantly lossy for many wavelengths in the radio - frequency range , an essentially hollow - cylindrical radio - frequency shield 130 is disposed between the gradient coil system 120 and a radio - frequency antenna 140 . this radio - frequency shield is fashioned such that passes the gradient fields generated by the gradient coil system 120 in a low - frequency range and is impermeable for the signals generated by the radio - frequency antenna 140 in the high - frequency ( radio - frequency ) range . the radio - frequency antenna 140 is disposed in the cavity of the radio - frequency shield 130 formed as a birdcage antenna in the illustration . a radio - frequency field can be generated in the patient acceptance chamber with the radio - frequency antenna 140 , with exemplary field lines 149 of the radio - frequency field being indicated in the region of the patient acceptance chamber with the symbol ⊙. the symbol ⊙ thereby identifies a numbered field line 149 exiting from the drawing plane at this location . the actual radio - frequency antenna 140 is separated , for example , by approximately 3 cm from the radio - frequency shield 130 . compared to a predetermined size of the patient acceptance chamber for a basic field magnet not taking into account the 3 cm , these 3 cm represent a dimensional enlargement of approximately 10 % that has significant costs . this separation enables a flux return of the radio - frequency field generated by the radio - frequency antenna 140 , thus a closing of the field lines 149 , with the field lines being indicated with the symbol { circle around ( x )} in the region between the radio - frequency antenna 140 and the radio - frequency shield 130 . the symbol { circle around ( x )} identifies a numbered field line 149 entering the drawing plane at this location . the width of this space provided for the flux return cannot be selected too small , since otherwise the counter - propagating portions of the field lines 149 would lie very close to one another , and an unacceptably large portion of the field energy would be located in the return , and the filling factor and the efficiency of the radio - frequency antenna 150 would be significantly decreased . furthermore , a field line 119 of the basic magnetic field is shown as an example in fig1 that encloses the region of the basic field magnet 110 , and exemplary field lines 129 of the second transverse gradient field are shown that enclose the region of the gradient coil system 120 . all magnetic fields that are applied in the patient acceptance chamber must close outside of the patient acceptance chamber . fig2 shows , as an exemplary embodiment of the invention , a longitudinal section through an upper half of a magnetic resonance device with a substantially tunnel - like patient acceptance chamber , wherein for clarity again only the components in the section plane are shown . to generate an optimally homogenous static basic magnetic field in the patient acceptance chamber , the magnetic resonance device has a basic field magnet 210 with superconducting primary coils 214 and likewise superconducting shielding coils 215 associated with the primary coils 214 . furthermore , to generate rapidly switchable gradient fields , the magnetic resonance device has an essentially hollow - cylindrical gradient coil system 220 with a first transverse gradient coil 221 , a second transverse gradient coil 222 , a longitudinal gradient coil 223 , and gradient shielding coils 225 , 226 and 227 associated with the gradient coils 221 , 222 and 223 . the conductor arrangements of the gradient coils 221 , 222 and 223 are designed such that a middle region of the gradient coil system 220 is free of conductors of the gradient coils 221 , 222 and 223 , in which is arranged a radio - frequency antenna element 240 of the magnetic resonance device . the conductors of the gradient coils 221 , 222 and 223 arranged on both sides of the middle region are surrounded by thin metallic radio - frequency shields 231 and 232 . the rf antenna element 240 can either form an rf antenna by itself , or it can be part of an rf antenna together with both rf shields 231 and 232 . in addition , the rf antenna element 140 and the rf shields 231 and 232 connected with one another in terms of radio - frequency . the longitudinal gradient primary coil 223 formed by two coils fashioned substantially like solenoids exhibits , from the housing outward , a minimum with regard to its current density in the aforementioned middle region , such that its free - of - conductors design is unproblematic in this middle region . the essentially transverse gradient coils 221 and 22 formed by four saddle coils generally carry a current in the circumferential direction in this middle region . particularly , in the case of transverse gradient coils with comparatively slight longitudinal extent , it is necessary for realization of optimally linear gradient fields to disperse the current in the middle region such that a minimum or even a weakly developed reverse current density results . in the illustrated design this can explicitly be set to zero such that a middle region free of conductors is obtained . given a longitudinal extent of the gradient coil system 220 by approximately less than one and a half times its diameter , the middle region can exhibit , for example , a longitudinal extent of 12 cm . the conductors of the gradient coils 221 , 222 and 223 arranged on both sides of the middle region are , as stated , surrounded by the metallic radio - frequency shields 231 and 232 , respectively . the radio - frequency shields 231 and 232 can carry a high - frequency current and omit the conductor - free middle region . both radio - frequency shields 231 and 232 are provided in a known manner with capacitively bridged gaps in order to keep the eddy currents induced in the radio - frequency shield 231 and 232 by the time - variable gradient fields small . the short radio - frequency antenna element 240 arranged in the middle region lies on a cylinder radius that is not smaller than the inner radius of the gradient coil system 220 . in contrast to the conventional solutions , the radio - frequency antenna formed by the rf antenna element 240 takes away no space within the patient acceptance chamber . the field lines 249 of the radio - frequency field that can be generated with the radio - frequency antenna close within the gradient coil system 220 in a field return space 228 outside of the gradient coils 221 , 222 and 223 . a return of the gradient fields 229 also ensues in the fields return space 228 . thus at least parts of the gradient coil system 220 are used for the return of the radio - frequency field . the radio - frequency shields 231 and 232 can form a part of the current path of the radio - frequency antenna 240 . an external restriction of the return of the radio - frequency field first ensues on the radio - frequency shield 223 associated with the gradient shielding coils 225 , 226 and 227 . the rf shield 233 thus extends radially outside of the antenna element 240 . the rf field is strongest in this region . in order to more clearly delimit the field return space 233 , the rf shield 233 preferably is elongated on both sides in the axial direction , such that it extends in regions disposed radially outwardly of the gradient coils 221 , 222 , 223 . the symbols and u used to represent the field lines are explained in fig1 . that which is specified in fig1 for the field lines 119 and 129 is valid for the field lines 219 of the basic magnetic field and the field lines 229 of the second transversal gradient field of fig2 , fig3 shows a magnetic resonance device with the components of the mr device from fig2 , wherein a field return space 229 ′ is additionally shielded from radio - frequency in the axial direction . this ensues by rf shielding side walls 234 that connect both ends of the rf shield 233 with the rf shields 231 , 232 . the field return space 228 ′ is shielded from radio - frequency up to the middle region , i . e . it is surrounded with rf shields up to the middle region . this has the advantage that primary gradient coils 221 , 222 , 223 can be connected in series with the corresponding shielding coils 225 , 226 , 227 without creating interactions of the rf field with the connecting electrical conductors 224 . the expansion of the field return space 228 ′ in the axial direction can be optimized dependent on the efficiency of the rf antenna , taking into account that a too - high magnetic field energy in the field return space 228 ′ that is too large can have a disadvantageous effect on the efficiency . as a further exemplary embodiment of the invention , fig4 shows a longitudinal section through an upper half of a magnetic resonance device with an essentially tunnel - like patient acceptance chamber , wherein for clarity again only the components in the section plane are shown . the magnetic resonance device has a substantially hollow - cylindrical basic field magnet 310 with superconducting primary and shielding coils 314 and 315 , with a barrel - shaped electrically - conductive vacuum vessel 312 of the basic field magnet 310 in the region of the cavity to convert [ implement ] the concept of the previously mentioned in german os 101 56 770 . a gradient coil system 320 formed by two hollow - cylindrical halves separated from one another is arranged in the cavity . the gradient coil system 320 includes , from the inside out , a longitudinal gradient coil 3232 , a first transverse gradient coil 321 , and a second transverse gradient coil 322 . the sub - coils of the gradient coils 321 , 322 and 323 are , in each half , completely enclosed by the radio - frequency shields 331 and 332 . analogous to fig2 or 3 , a radio - frequency antenna element 340 is attached between the halves of the gradient coil system 320 . a sufficiently large field return space 328 thus is available between the gradient coil system 320 and the vacuum vessel 312 to close the field lines 349 of the radio - frequency field that is generated with the radio - frequency antenna formed by the radio - frequency antenna element 340 . the vacuum vessel 312 either is fashioned as an rf shield 333 on the side associated with the field return space 328 , or such an rf shield 333 is attached to it . the rf shield preferably extends over the barrel - shaped bulge in order to optimally shield the basic field magnet 310 . the description for the field lines 119 and 129 in fig1 is valid for the field lines 319 of the basic magnetic field and the field lines 329 of the second transversal gradient field of fig4 . fig5 shows a magnetic resonance device with the components of the mr device from fig4 , wherein the gradient system 320 and the barrel - shaped basic field magnet system 310 lie so close to one another that the radio - frequency shield 333 and the first and second radio - frequency shields 331 and 332 are connected with one another in terms of radio - frequency . a field return space 328 ′ shielded from radio - frequency up to the middle region thereby is achieved . as a further exemplary embodiment of the invention , fig6 shows in a perspective view a radio - frequency antenna 240 or 340 formed as a birdcage antenna disposed between the radio - frequency shields 231 and 232 or 331 and 332 . fig7 shows , in a perspective view as a further exemplary embodiment of the invention , a radio - frequency antenna 240 or 340 formed as an array antenna disposed between the radio - frequency shields 231 and 232 or 331 and 332 . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .	6
fig1 is an image processing system 100 depicting the present invention that , in one embodiment , performs image enhancement by taking in a plurality of unprocessed image data 120 and outputs a plurality of processed image data 130 . the image processing system 100 contains adaptable processing resources 110 and a memory 118 for performing image processing on the plurality of unprocessed image data 120 . the adaptable processing resources 110 of the image processing system 100 is capable to perform intensive processing routines 112 , light processing routines 114 , and an image analysis routines 116 . the image analysis routines 116 of the adaptable processing resources 110 permit the image processing system 100 to intelligently allocate the intensive processing routines 112 and the light processing routines 114 for processing the plurality of unprocessed image data 120 . for example , if the plurality of unprocessed image data 120 is of one a first data type , then the intensive processing routines 112 are invoked . alternatively , if the plurality of unprocessed data 120 is of one a second data type , then the light processing routines 114 are invoked . the decision making of which of the intensive processing routines 112 and the light processing routines 114 are invoked is performed , at least in part , upon using the image analysis routines 116 to classify the plurality of unprocessed image data 120 into the first or the second data types . this intelligent decision making of which of the intensive processing routines 112 and the light processing routines 114 permits efficient allocation of the processing resources of the image processing system 100 . the adaptable processing resources 110 help avoid inefficient over - allocation on the plurality of unprocessed image data 120 having substantial portions of low frequency image data . the intensive processing routines 112 are used on portions of the plurality of unprocessed image data 120 containing substantially high frequency image data , and the light processing routines 114 are used on portions of the plurality of unprocessed image data 120 containing substantially low frequency image data . efficient use of the image processing system 100 is achieved while minimizing undesirable artifacts in the plurality of unprocessed image data 120 . after processing the plurality of unprocessed image data 120 using the image processing system 100 , the plurality of processed image data 130 is generated . a number of peripheral devices may interact with the image processing system 100 for displaying , storing , or transmitting the plurality of processed image data 130 . for example , a communication link 180 is used to transmit the plurality of processed image data 130 to another device in certain embodiments of the invention . an image data print device 160 is used to generate reproductions of the plurality of processed image data 130 . if desired , an image data storage device 140 is used to keep the plurality of processed image data 130 for later use . the communication link 180 , in certain embodiments of the invention , is used to transmit the plurality of processed image data 130 to the image data storage device 140 or to another image data storage device ( not shown ). an image data display device 150 extracts either the plurality of processed image data 130 that has been stored in the image data storage device 140 or the plurality of processed image data 130 immediately upon its being generated . another image processing device 170 is also incorporated in certain embodiments of the invention . in certain embodiments of the invention , the image processing system 100 is processing circuitry that performs the loading of the plurality of unprocessed image data 120 into the memory 118 from which selected portions of the plurality of unprocessed image data 120 are processed in a sequential manner . if the processing circuitry possesses insufficient processing capability to handle the entirety of the plurality of unprocessed data 110 at a single , given time , then the processing circuitry may employ any method known in the art that transfers data from a memory for processing and returns the plurality of processed image data 130 to the memory . alternatively , the image processing system 100 is a system that converts raw image data ( shown by the plurality of unprocessed image data 120 ) into image data suitable for printing ( shown by the plurality of processed image data 130 ) using the image data print device 160 . various devices may be used to perform the printing of the image data print device 160 including color photo - copy machines , color facsimiles , color printers , black and white printers , and digital printers . in other embodiments of the invention , the image processing system 100 is a system that converts raw image data into image data suitable for display using the image data display device 150 . various displays may be used for the image data display device 150 in accordance with the present invention including monitors and other media capable of displaying digital image data . the image processing system 100 converts image data that is already in a form suitable for printing by the image data print device 160 , yet additional processing is performed to improve the visible perceptual quality of the image data for reproduction . in particular , this additional processing is image enhancement in certain embodiments of the invention . fig2 is a system diagram depicting an image processing system built in accordance with the present invention as described in fig1 . the system diagram of fig2 is , in one embodiment , an image processing system 200 . the image processing system 200 has a white edge detector 210 , a black edge detector 220 , and an image classifier 230 . the image classifier 230 operates cooperatively with at least one of the white edge detector 210 and the black edge detector 220 for processing a plurality of image data . the plurality of image data may be viewed to be the plurality of unprocessed image data 120 as described in fig1 . the image classifier 230 analyzes a predetermined region of the image data and identifies it as a substantially text - like region or a substantially photo - like region . the image data is then classified as being either a text image type or a photo image type . in certain embodiments of the invention , the white edge detector 210 , the black edge detector 220 , and the image classifier 230 all operate cooperatively in the image processing system 110 described in fig1 . each of the white edge detector 210 , the black edge detector 220 , and the image classifier 230 contains internal processing circuitry to perform their respective function . the processing circuitry is performed using combinations of digital signal processors ( dpss ), logic circuitry , and other hardware known to those skilled in the art for performing image processing . fig3 is a functional block diagram 300 depicting an embodiment of the present invention that selects an appropriate threshold scheme to an image . in a block 310 , a region of an image data is input into an image processing system capable of performing image data management . in a block 320 , the region of the image data is classified as being either a substantially image - like region or a substantially text - like region . depending on the classification performed on the region of the image data in the block 320 , an appropriate threshold scheme is selected in a block 330 . the threshold scheme is used in subsequent blocks to perform edge enhancement of the region of the image data . for regions of the image region that are substantially rough , one particular threshold is chosen . alternatively , for regions of the image region that are substantially smooth , another threshold is chosen . in a block 340 , black edges of the image region are identified . similarly , in a block 350 , white edges of the image region are identified . all of the functional blocks performed in the functional block diagram 300 may be performed using the image processing systems 110 and 200 described in fig1 and 2 . for example , the classification of the image region as being either a substantially image - like region or a substantially text - like region , performed in the block 320 of fig3 , is performed using the image classifier 230 of fig2 in one embodiment of the invention . similarly , the identification of the black edges in the block 340 and the identification of the white edges in the block 350 of fig3 are performed using the white edge detector 210 and the black edge detector 220 in fig2 , respectively . fig4 is a functional block diagram 400 depicting an embodiment of the present invention that selects between a first threshold scheme and a second threshold scheme upon classification of a region of an image . in a block 410 , an image region is classified as being either a substantially image - like region or a substantially text - like region . based upon the classification performed for the image region in the block 410 , in a decision block 420 , a decision is performed whether to apply either a first threshold scheme in a block 430 or a second threshold scheme in a block 440 . the selection of either the first threshold scheme in the block 430 or the second threshold scheme in the block 440 is made primarily as a function of the classification of the image region in the block 410 as being a substantially photo - like region . if the image region is a substantially photo - like region , the first threshold scheme is applied in the block 430 . alternatively , if the image region is not a substantially photo - like region , the second threshold scheme is applied in the block 440 . similar to the functional block diagram 300 of fig3 , all of the functional blocks performed in the functional block diagram 400 of fig4 may be performed using the image processing systems 110 and 200 described in fig1 and 2 . for example , the classification of the image region as being either a substantially image - like region or a substantially text - like region , performed in the block 410 of fig4 , is performed using the image classifier 230 of fig2 in one embodiment of the invention . similarly , the selection of the appropriate threshold scheme as determined by the decisional block 420 in fig4 is performed and each of the first and second threshold schema applied in the blocks 430 and 440 , respectively , are applied using the white edge detector 210 and the black edge detector 220 in fig2 . that is to say , the first threshold scheme that is selected in the block 430 of fig4 is performed using the white edge detector 210 of fig2 . similarly , the second threshold scheme that is selected in the block 440 of fig4 is performed using the black edge detector 220 of fig2 . fig5 is a functional block diagram 500 depicting a specific embodiment of the functional block diagram 400 of fig4 that selects between a fixed threshold scheme and a dynamic threshold scheme upon classification of a region of an image . in a block 510 , a filter is applied to an image region of a plurality of image data . a predetermined number of image parameters are identified in a block 520 . these image parameters constitute a variety of image characteristics roughness , smoothness , intensity , contrast and other characteristics known to those skilled in the art if image processing . in a block 530 , the image region is classified as being either a substantially image - like region or a substantially text - like region . based upon the classification performed for the image region in the block 530 , in a decision block 540 , a decision is performed whether to apply either a fixed threshold scheme in a block 550 or a dynamic threshold scheme in a block 560 . when the dynamic threshold scheme of the block 560 is selected upon the classification performed in the block 530 of the image region being a substantially non - photo - like image region , in a block 570 , the dynamic threshold is determined as a function of the pixel intensity of the plurality of image data contained within the image region . the determination of the dynamic threshold as a function of the pixel intensity , as performed in the block 570 , is a function of at least one pixel within the image region . the intensity of the pixel region is one of the parameters identified in the block 520 . the selection of either the fixed threshold scheme in the block 550 or the dynamic threshold scheme in the block 560 , followed by determining the dynamic threshold as a function of the at least one pixel intensity in the block 570 , is made primarily as a function of the classification of the image region in the block 530 as being a substantially photo - like region . if the image region is a substantially photo - like region , the fixed threshold scheme is applied in the block 550 . alternatively , if the image region is not a substantially photo - like region , the dynamic threshold scheme is applied in the block 560 wherein the dynamic threshold is determined as a function of the at least one pixel intensity in the block 570 . in certain embodiments of the invention , the dynamic threshold , determined as a function of the at least one pixel intensity in the block 570 , is determined by using a predetermined number of pixels associated with one particular pixel within the image region . for example , as will be discussed below , when performing processing on one particular pixel , the pixels immediately surrounding the particular pixel govern the determination of the dynamic threshold scheme . similar to the functional block diagrams 300 of fig3 and 400 of fig4 , all of the functional blocks performed in the functional block diagram 500 of fig5 may be performed using the image processing systems 110 and 200 described in fig1 and 2 . for example , the classification of the image region as being either a substantially image - like region or a substantially text - like region , performed in the block 530 of fig5 , is performed using the image classifier 230 of fig2 in one embodiment of the invention . similarly , the selection of the appropriate threshold scheme as determined by the decisional block 540 in fig5 is performed and the fixed and dynamic threshold schema applied in the blocks 550 and 560 , respectively , are applied using the white edge detector 210 and the black edge detector 220 in fig2 . that is to say , the fixed threshold scheme that is selected in the block 550 of fig5 is performed using the white edge detector 210 of fig2 . similarly , the dynamic threshold scheme that is selected in the block 560 of fig5 is performed using the black edge detector 220 of fig2 . fig6 is a functional block diagram 600 of the present invention that performs black edge detection . a plurality of image data 610 in pixel form is shown to illustrate the operation of the functional block diagram 600 in accordance with the present invention . each of the individual pixels ( a , b , c , d , e and f ) within the plurality of image data 610 are involved in performing the image processing within the functional block diagram 600 . the black edge detection of the functional block diagram 600 is performed by comparing several of the individual pixels to one specific pixel within the plurality of image data 610 . within the functional block diagram 600 , the one specific pixel that is being processed is pixel e . at least one characteristic of the one specific pixel e is compared to the adjacent pixels a , c , d and f . several different parameters may constitute the at least one characteristic that is compared between pixels that constitute the plurality of image data 610 including contrast , intensity , color , and other characteristics known to those skilled in the art of image processing . an absolute value difference between the at least one characteristic of pixel a and the at least one characteristic of pixel e in a block 620 is compared to a dynamic black edge threshold ( dbeth ). in a block 630 , an absolute value difference between the at least one characteristic of pixel a and the at least one characteristic of pixel e is compared to the dbeth . similarly , an absolute value difference between the at least one characteristic of pixel d and the at least one characteristic of pixel e in a block 650 is compared to the dbeth ; in a block 660 , an absolute value difference between the at least one characteristic of pixel f and the at least one characteristic of pixel e is compared to the dbeth . using the logical or operation known in the art , as shown in a block 640 , if either the an absolute value difference between the at least one characteristic of pixel a and the at least one characteristic of pixel e in the block 620 is larger than the dbeth or the an absolute value difference between the at least one characteristic of pixel c and the at least one characteristic of pixel e in the block 630 is larger than the dbeth , then a logical true is emitted from the block 640 to another logical or operation performed in a block 680 . similarly , if either the an absolute value difference between the at least one characteristic of pixel d and the at least one characteristic of pixel e in the block 650 is larger than the dbeth or the an absolute value difference between the at least one characteristic of pixel f and the at least one characteristic of pixel e in the block 660 is larger than the dbeth , then a logical true is emitted from a block 670 to the logical or operation performed in the block 680 . the outputs from the logical or operations performed in the blocks 640 and 670 are input to the logical or operation performed in the block 680 . the logical output , whether true or false , of the block 680 is used to determine in a block 690 the detection of a black edge within the plurality of image data 610 . in short , if any one of the absolute value differences determined in the blocks 620 , 630 , 650 , or 660 is found to be greater than the dbeth , then a black edge has been detected as shown in the block 690 . alternatively , if none of the absolute value differences determined in the blocks 620 , 630 , 650 , or 660 is found to be true , then a black edge has not been detected as shown in the block 690 . in certain embodiments of the invention , the absolute value difference between the at least one characteristic of the pixels is a pixel intensity . alternatively , the absolute value difference between the at least one characteristic is a contrast . any parameter used to characterize a pixel or the plurality of image data 610 known to those having skill in the art of image processing may be used to perform the operation as presented in the functional block diagram 600 . in one embodiment of the invention , the dbeth used in the functional block diagram 600 is determined as a function of the intensity of the one specific pixel e wherein the plurality of image data 610 is a substantially text - like region . it is adjusted during the processing of the plurality of image data 610 , dynamically , as a function of the one specific pixel e that is being processed at a given time . when a new plurality of image data ( not shown ), is being processed using the functional block diagram 600 , the intensity of an equivalent pixel to e ( not shown ) within the new plurality of image data ( not shown ) determines the dbeth for the new plurality of image data ( not shown ). fig7 is a functional block diagram 700 of the present invention that performs white edge detection . a plurality of image data 710 in pixel form is shown to illustrate the operation of the functional block diagram 700 in accordance with the present invention . each of the individual pixels ( a , b , c , d , e and f ) within the plurality of image data 710 are involved in performing the image processing within the functional block diagram 700 . the white edge detection of the functional block diagram 700 is performed by comparing several of the individual pixels to one specific pixel within the plurality of image data 710 . within the functional block diagram 700 , the one specific pixel that is being processed is pixel e . at least one characteristic of the one specific pixel e is compared to the adjacent pixels a , c , d and f . several different parameters may constitute the at least one characteristic that is compared between pixels that constitute the plurality of image data 710 including contrast , intensity , color , and other characteristics known to those skilled in the art of image processing . an absolute value difference between the at least one characteristic of pixel a and the at least one characteristic of pixel e in a block 720 is compared to a white edge threshold ( weth ). in a block 730 , an absolute value difference between the at least one characteristic of pixel c and the at least one characteristic of pixel e is compared to the weth . similarly , an absolute value difference between the at least one characteristic of pixel d and the at least one characteristic of pixel e in a block 750 is compared to the weth ; in a block 760 , an absolute value difference between the at least one characteristic of pixel f and the at least one characteristic of pixel e is compared to the weth . using the logical or operation known in the art , as shown in a block 740 , if either the an absolute value difference between the at least one characteristic of pixel a and the at least one characteristic of pixel e in the block 720 is larger than the weth or the an absolute value difference between the at least one characteristic of pixel c and the at least one characteristic of pixel e in the block 730 is larger than the weth , then a logical true is emitted from the block 740 to a logical and operation performed in a block 780 . similarly , if either the an absolute value difference between the at least one characteristic of pixel d and the at least one characteristic of pixel e in the block 750 is larger than the weth or the an absolute value difference between the at least one characteristic of pixel f and the at least one characteristic of pixel e in the block 760 is larger than the weth , then a logical true is emitted from a block 770 to the logical and operation performed in the block 780 . the outputs from the logical or operations performed in the blocks 740 and 770 are input to the logical and operation performed in the block 780 . the logical output , whether true or false , of the block 780 is used to determine in a block 790 the detection of a white edge within the plurality of image data 710 . in short , if at least one of the absolute value differences determined in the blocks 720 or 730 is greater than the weth , as well as at least one of the absolute value differences determined in the blocks 750 or 760 is greater than the weth , then a white edge has been detected as shown in the block 790 . alternatively , if both of the absolute value differences determined in the blocks 720 or 730 are found to be less than the weth , or if both of the absolute value differences determined in the blocks 750 or 760 are found to be less than the weth , then a white edge has not been detected as shown in the block 790 . in certain embodiments of the invention , the absolute value difference between the at least one characteristic of the pixels is a pixel intensity . alternatively , the absolute value difference between the at least one characteristic is a contrast . any parameter used to characterize a pixel or the plurality of image data 710 known to those having skill in the art of image processing may be used to perform the operation as presented in the functional block diagram 700 . when contrast is used for the at least one characteristic of the pixels , a white edge is found only when the absolute value difference of the contrast in both a horizontal and a vertical direction exceed the weth . in one embodiment of the invention , the weth used in the functional block diagram 700 is a fixed threshold wherein the plurality of image data 710 is a substantially photo - like region . when a new plurality of image data ( not shown ), is being processed using the functional block diagram 700 , and it is found to be a substantially text - like region , the same fixed threshold is used within the new plurality of image data ( not shown ) for the weth in processing the new plurality of image data ( not shown ). in view of the above detailed description of the present invention and associated drawings , other modifications and variations will now become apparent to those skilled in the art . it should also be apparent that such other modifications and variations may be effected without departing from the spirit and scope of the present invention .	6
now , an embodiment of a disc drive arrangement according to the present invention will hereinafter be described with reference to the attached drawings . referring initially to fig1 to 3 , the disc drive arrangement of the invention generally comprises a chassis 1 . a drive spindle 2 is rotatably provided at the front half portion ( as viewed from left to right in fig1 ) of the chassis 1 and a magnetic head mechanism arrangement 3 is provided at the rear half portion of the chassis 1 . the magnetic head mechanism arrangement 3 includes a carriage 4 movable in the right to left or front to rear direction in , for example , fig1 and an upstanding head post 5 fixed to the carriage 4 . the head post 5 supports a pair of upper and lower magnetic heads 6 and 7 through first and second gimbals or arms 8 and 9 which are fixed to the upstanding head post 5 so as to be extended forward . the first arm 8 carrying the upper head 6 is attached to the head post 5 to be moved up and down with resiliency and includes a platform 10 attached to the rear upper surface of the head post 5 . the platform 10 includes an engaging portion 10a which is secured thereto and opened rearwardly . this platform 10 is moved up and down by a pushing elongated portion 12a of a bell - crank - shaped head lifter 12 which is pivoted to a bearing portion 11 secured to the rear portion of the chassis 1 . the disc drive arrangement of this invention further includes a cartridge mounting and positioning means 13 . the cartridge mounting and positioning means 13 is a so - called cartridge holder which is located above the drive spindle 2 in the front half portion of the chassis 1 so as to be freely movable in the up and down direction . specifically , the cartridge holder 13 includes rollers 14 pivoted to the front and rear portions of both side walls thereof . these rollers 14 are engaged with vertically - elongated guide grooves 15a of support members 15 at the front and rear positions of the front half portion ( as viewed from left to right in fig1 to 3 ) of the chassis 1 so that the cartridge holder 13 can move up and down in parallel to the chassis 1 . coil springs 16 are extended between the chassis 1 and the cartridge holder 13 to urge the cartridge holder 13 toward the chassis 1 at all times . the chassis 1 further includes an upstanding post 1a secured at one corner and in the front half portion thereof . a movable block 18 is slidably inserted into a guide shaft 19 extended from the upstanding post la rearward in the horizontal direction . a coil spring 20 is stretched between the upstanding post la and the movable block 18 to always bias the movable block 18 toward the rearward . the movable block 18 includes a pin 17 plated thereon upward which will release a disc pushing spring of a disc cartridge which will be described later . a slide plate 21 is provided to be movable back and forth between the chassis 1 and the cartridge holder 13 . the slide plate 21 includes cam members 22 at the front and rear portions of its both side walls in correspondence with the respective rollers 14 of the cartridge holder 13 . each of the cam members 22 includes a front high edge 22a and a rear low edge 22b corresponding to the up and down positions of the cartridge holder 13 and also a central inclined edge 22c . an arm member 21a is extended from one side of the rear portion of the slide plate 21 . a rear cam member 23 is implanted on the rear end of the arm member 21a , and this rear cam member 23 includes a front high edge 23a and a rear low edge 23b to oppose through a roller 25 to an operating rod 24 connected to an elongated arm member 12b of the head lifter 12 . the slide plate 21 further includes a pushing member 26 at its one front side portion in correspondence with the movable block 18 . to the rear portion of the thus arranged slide plate 21 is secured a female screw arm 27 . this female screw arm 27 is screwed by a lead screw 28 that is rotatably supported at two positions in the front to rear direction of the chassis 1 . the lead screw 28 is rotated through a reduction gear mechanism 29 by a loading motor 30 . thus , when the lead screw 28 is rotated by the motor 30 , the slide plate 21 is moved back and forth through the female screw 27 , i . e ., in the forward or rearward direction in accordance with the rotational direction of the lead screw 28 . there is provided a stepper motor 31 ( shown in phantom in fig1 ) coupled with a spindle 31a around which a steel belt 32 fixed to the carriage 4 is wrapped . then , the turning of the spindle 31a in the clockwise or counter - clockwise direction causes the carriage 4 to slide forwardly or rearwardly through the steel belt 32 . although the carriage 4 is provided with a means for fine moving the magnetic heads , such means is , however , not directly related to the present invention , and it may therefore not be shown and described . fig4 and 5 illustrate an example of a disc cartridge driven by the disc drive arrangement of the present invention . fig4 is a plan view illustrating the disc cartridge retaining a disc with the upper half of the disc cartridge removed . fig5 is a partially cross - sectional view of fig4 wherein a magnetic disc in the cartridge is urgedly held . referring to fig4 and 5 , there is shown a magnetic disc 41 having a center core 41a at the center thereof . it is to be understood that when the disc 41 is inserted into the disc drive arrangement of the invention , the magnetic head 6 can be placed adjacent the upper surface thereof and the magnetic head 7 can be placed adjacent the lower surface thereof so that the reading and writing can be accomplished on both sides of the disc 41 . there is shown a cartridge 42 which retains therein the disc 41 on its disc table portion 42b formed therein . the form of the disc table portion 42b is circularly - concaved one and , at the center of the disc table portion 42b is bored an opening 42a through which will be inserted the drive spindle 2 ( fig1 ). through the upper and lower halves of the cartridge 42 over both sides of the disc 41 there are formed windows 42c through which the magnetic heads 6 and 7 are inserted into the cartridge 42 for recording and reproduction . a shutter 43 is provided over both outsides of the cartridge 42 to open and close the windows 42c . a biasing member , for example , a spring 44 is provided in the cartridge 42 to always spring - bias this shutter 43 toward the direction to close the windows 42c . the cartridge 42 incorporates therein a pushing member for urging the magnetic disc 41 , for example , a pushing spring member 45 whose length is made enough to cross the retained disc 41 in its substantially diametrical direction . a spring tongue 45a is elongated from the center of the spring member 45 to urge the center core 41a , of the magnetic disc 41 . the spring member 45 engages with the inner side walls of the cartridge 42 to be slidable in the front and rear direction . also , the spring member 45 is spring - biased by a spring - biasing member 46 provided in the cartridge 42 so that the spring tongue 45a thereof is always urged against the center core 41a of the magnetic disc 41 . the spring member 45 urges the magnetic disc 41 to one side of the cartridge 42 to thereby prevent the magnetic disc 41 from being unnecessarily moved within the cartridge 42 . further , the spring member 45 urges the center core 41a toward the opening 42a side . the spring member 45 has at one end an opening 45b with which is engaged the afore - mentioned releasing pin 17 . the cartridge 42 has bore therethrough a rectangular slit 42d which is long in the front to rear direction at the position corresponding to the opening 45b and to which is inserted the pin 17 when the cartridge 42 is lowered . the loading operation of the disc drive arrangement of the invention for the cartridge 42 with the disc 41 therein , that is , the disc cartridge is as follows . before the operation of the disc drive arrangement , as shown in fig2 since the slide plate 21 is in its full rearward position , the cartridge holder 13 is lifted by the high edges 22a of the cams 22 through the rollers 14 and placed in its full upward position . meanwhile , the high edge 23a of the rear cam 23 lifts the arm 12b of the head lifter 12 upwardly through the rod 24 . thus , the head lifter 12 is rotated in the upward direction causing the arm 12a to urge the first gimbal 8 of the upper magnetic head 6 upwardly through the head base 10 , so that the upper magnetic head 6 is spaced apart from the lower magnetic head 7 considerably . under this condition , the pushing member 26 is spaced apart from the movable member 18 with the releasing pin 17 . next , the cartridge 42 is inserted into the cartridge holder 13 . as the cartridge 42 is inserted into the cartridge holder 13 , the shutter 43 for the cartridge 42 is pulled open . a member for opening the shutter 43 is not shown in fig2 . after the completion of the insertion of the cartridge 42 into the cartridge holder 13 , the loading motor 30 is driven by the detected signal indicating this complete insertion to rotate the lead screw 28 . thus , the slide plate 21 is slid forwardly through the female screw 27 . as the slide plate 21 is slid forwardly , each cam 22 comes in contact with each roller 14 of the cartridge holder 13 from its inclined edge 22c to the lower edge 22b . thus , the cartridge holder 13 is lowered in cooperation of the biasing force of the tension coil spring 16 , as shown in fig3 . then , the cartridge 42 is carried above the drive spindle 2 and then the drive spindle 2 is inserted through the opening 42a into the cartridge 42 to be engaged with , or chuck the center core 41a of the magnetic disc 41 through the opening 42a . this chucking operation is carried out with a help of the biasing force of the spring member 45 . under this condition , the pin 17 is inserted through the rectangular slit 42d of the cartridge 42 to the opening 45b of the spring member 45 . since the slide plate 21 keeps sliding forwardly even after the completion of the chucking operation , the pushing means 26 urges the movable member 18 forwardly so that the movable member 18 is moved forward against the biasing force of the compression coil spring 20 , as shown in fig3 . as the movable block 18 is moved forwardly , the spring member 45 with the pin 17 engaged is slid forwardly and then the spring portion 45a comes away from the center core 41a of the magnetic disc 41 , thus the magnetic disc 41 being released from the urging by the spring portion 45a of the spring member 45 to become freely rotatable . during this operation , the lower edge 23b of the rear cam 23 comes in contact with the rod 24 so that the head lifter 12 is rotated in the downward direction to thereby release the head base 10 from the pushing - up by the pushing arm 12a . thus , the upper magnetic head 6 is moved downwardly through the first gimbal 8 to get close to the lower magnetic head 7 . that is , the upper magnetic head 6 contacts with the upper surface of the magnetic disc 41 through the window 42c of the cartridge 42 . meanwhile , the lower magnetic head 7 is brought in contact with the lower surface of the magnetic disc 41 when the magnetic disc 41 is chucked by the drive spindle 2 . at the completion of the above mentioned operations , the loading motor 30 is stopped and then the recording and / or reproduction of the magnetic disc 41 will start . the recording and / or reproduction operation will be carried out with the movement of the carriage 4 which carries thereon the upper and lower magnetic heads 6 and 7 . after the end of the recording and / or reproduction , the magnetic disc 41 is ejected . that is , the unloading operation is carried out by the eject operation , in which the loading motor 30 is reversely rotated , the slide plate 21 is moved rearwardly ( from left to right in fig3 ), and the above - mentioned operation is carried out in an opposite fashion to thereby lift up the cartridge holder 13 allowing ejecting the cartridge 42 from the cartridge holder 13 . according to the present invention , as set forth above , in the loading operation for loading the magnetic recording and / or reproducing disc retained in the cartridge and urged thereto by the pushing member , the single movable body can carry out the following three operations at a time in which the magnetic disc is chucked with and / or disengaged from the drive spindle with the upward and / or downward movement of the cartridge , the magnetic disc is released from the urging within the cartridge , and the upper and lower magnetic heads are brought in contact with the upper and lower surfaces of the magnetic disc . thus , the disc drive arrangement of the invention can be simplified in construction and can be operated simply and positively . it should be understood that the above description is presented by way of example on a single preferred embodiment of the invention and it will be apparent that many modifications and variations could be effected by one skilled in the art without departing from the spirit and scope of the novel concepts of the invention , so that the scope of the invention should be determined only by the appended claims .	6
hereinafter , the preferred embodiment of the present invention will be described in detail with reference to the accompanying drawings . a steering wheel , as shown in fig1 to 3 , includes a steering wheel rim 1 taking a shape of a ring , a hub 2 into which the front end of a steering shaft is mounted in addition to a horn and an air - bag , and an upper spoke 3 a and a lower spoke 3 b for connecting the hub 2 and the steering wheel rim 1 . the upper and the lower spoke 3 a and 3 b include a t - shaped connector 4 manufactured in a 1 die casting . the three end openings of the t - shaped connector 4 are respectively inserted and welded into a hub core 5 and a hub rod 2 a secured at the hub 2 for an integral form of the steering wheel rim 1 and the hub 2 . following the completion of the frame of a steering wheel , a cover layer 6 having a hard part 6 a and a soft part 6 b is formed thereon for a fine external look and easy operation . the hard part 6 a is preferably formed by an injection molding using a glass fiber , while the soft part 6 b is preferably formed by a foam molding using a polyurethane ( pu ). moreover , a grained vinyl cover 7 and a leather cover 8 are used to shroud the external surface of the cover layer 6 for a good external look and non - slippage of the steering wheel . in other words , as shown in fig1 , the grained vinyl cover 7 is wrapped around the upper part of the steering wheel 1 above the upper spoke 3 a and around the lower part of the steering wheel 1 below the lower spoke 3 b . the leather 8 is covered at the remaining portions of the steering wheel rim 1 . on the other hand , because the grained vinyl cover 7 and the leather cover 8 respectively have different contraction and expansion coefficients in response to temperature and moisture , the boundary part ( m ) therebetween may generate a gap when a hard contraction occurs . this drawback , however , can be overcome by extensively protruding the frontal end of the hard part 6 a toward the soft part 6 b and by coupling the hard part 6 a protruded toward the soft part 6 b with the soft part 6 b and the leather cover 8 . as a result , the frontal end of the hard part 6 a is formed with a coupling protruder 6 a - 1 projected to the soft part 6 b , wherein a plurality of coupling ribs 6 a - 2 are formed at the surface of the coupling protruder 6 a - 1 . the soft part 6 b is coupled with the plurality of coupling ribs 6 a - 2 by foam molding so as to be overlapped with the hard part 6 a . in addition , when the leather cover 8 embraces the soft part 6 b , the plurality of coupling ribs 6 a - 2 are closely attached to the inner side of the leather cover 8 , thereby preventing the boundary part ( m ) of the grained vinyl cover 7 and leather cover 8 from being widened even if contraction or expansion occurs due to the temperature and moisture . the coupling protruder 6 a - 1 and the plurality of coupling ribs 6 a - 2 are preferably integrally formed with the hard part 6 a , the hard part 6 a made via injection molding . further , coupling rib grooves 8 b into which the plurality of coupling ribs 6 a 2 are inserted are formed inside the leather cover 8 for increasing the connecting force of the grained vinyl cover 7 and leather cover 8 . the steering wheel is preferably configured through a process as illustrated in the flowchart in fig4 . a hub core 5 of the steering wheel rim 1 is manufactured by either steel roll - molding or mg injection - molding ( s 1 ). a t - shaped connector 4 manufactured by al die casting is assembled with a hub core 5 by welding ( s 2 ). the hub core 5 and t - shaped connector 4 assembly is put into a mold for integrally forming with a hard part 6 a , a coupling protruder 6 a - 1 , and a plurality of coupling ribs 6 a - 2 at a predetermined section thereon by glass fiber injection molding ( s 3 ). a soft part 6 b embraces the leftover section unformed with the hard part 6 a , by pu foam - molding ( s 4 ), thereby completing the exterior of the steering wheel . a film sheet of a grained vinyl cover 7 is attached onto the surface of the hard part 6 a manufactured by the glass fiber ( s 5 ). a leather cover 8 is wound by stitches around the surface of the soft part 6 b manufactured by pu ( s 6 ), allowing to complete the manufacturing process of a steering wheel having the grained vinyl cover 7 and the leather cover 8 . thus , there is an advantage in embodiments of the present invention in that a soft part 6 b shrouds a coupling protruder 6 a - 1 and a plurality of coupling ribs 6 a - 2 embedded into coupling rib grooves 8 b of a leather cover 8 . as a result , the end of the leather cover 8 may be held by the plurality of coupling ribs 6 a - 2 , preventing contraction between the grained vinyl cover 7 and the leather cover 8 even in varying temperature and moisture conditions . there is another advantage in that the structure thus described prevents the boundary part ( m ) of the grained vinyl cover 7 and the leather cover 8 from being widened , thereby maintaining a fine look of the steering wheel . as apparent from the foregoing , there is still another advantage in that the automobile steering wheel is integrally formed with a coupling protruder and a plurality of coupling ribs at a frontal end of a hard part as a cover layer wherein a soft part is overlapped with the coupling protruder and the plurality of coupling ribs by foam molding , enabling to prevent a gap at a boundary caused by changes in temperature and moisture between the grained vinyl cover and leather cover which respectively encompass the hard part and soft part .	8
a limitation to the use of radiation sterilization is the adverse effects that ionizing radiation may have on the product being irradiated . similarly steam sterilization cannot be applied to heat - labile product . heat may also be a limitation for ethylene oxide as well as effects produced from reaction with the gas itself . with modern technology , heat labile or otherwise process - sensitive product may be produced by aseptic processing to a level where a less than one - in - a - thousand items are contaminated . such product cannot realistically achieve a 10 − 6 sal through aseptic processing , but could , provided that product could stand the necessary radiation dose , be brought to a 10 − 6 sal by a relatively low radiation dose . the microbial world contains a vast number of species varying widely in their resistance to ionizing radiation . although many are extremely sensitive there are some that are very radiation resistant , thus an essential element of any acceptable dose setting method is the inclusion in the process of a step that measures the radiation response of the product bioburden . the present invention improves upon prior methods to determine 10 − 6 sal product - specific sterilization dose that has an appropriate level of conservatism . it includes a determination of the bioburden to more accurately calculate sterilization doses in the presence of a low bioburden . to determine the sterilization dose according to the present invention it is preferred to select at least 270 product items from each of three independent production batches of a product to be sterilized . the bioburden is determined for each of ten nonsterile selected product items from each batch including the average bioburden per item for each of the three batches and the average bioburden per item for all selected product items . it is preferred to determine the bioburden on individual product items but if the bioburden is too low it is possible to pull ten items from a single batch for the purpose of determining a batch average bioburden . preferably , bioburden is determined following iso 11737 . the average bioburden level for each of the three batches are compared to the overall average bioburden to determine whether any one of the batch averages is two or more time greater than the overall average bioburden . if one or more of the batch averages are two or more times higher than the overall average bioburden then for subsequent calculations the bioburden used should be the highest batch average , otherwise for subsequent calculations the overall average bioburden will be used . an ide is performed by irradiating twenty product items from one of the three production batches at one of a series of not less than eight doses increasing in nominal increments of 0 . 25 kgy starting at not less than 0 . 25 kgy . each of these is monitored with dosimeters . preferably , the dosages should be within a tolerance of + 0 . 05 kgy or + 10 %, whichever is greater . the irradiated product items are then tested for sterility and the number of positive tests is noted . preferably , such testing follows iso 11737 - 2 . the fnp dosage is then determined . for each of the three batches the fnp dose is the lower of two consecutive doses at which all the tests of sterility are negative followed by no more than one further positive test in any of the remaining tests in the incremental dose series . alternatively , fnp can be determined by finding the lowest dose at which one positive in 20 tests of sterility occurs immediately preceded by one and only one incremental dose at which all tests were negative and followed by incremental doses at which all tests are negative . this information is used to determine a “ verification dose ” ( vd ) which is equal to the highest of the three fnp doses . the vd is used to perform a vde in which 100 products from each of the three batches are irradiated at the vd . the tolerances for the vde should be similar to those in the ide . the irradiated product items are individually tested for sterility and the number of positive tests recorded no more than two positive tests of sterility should appear for each of the batches . this data is then used to calculate a primary d 10 value ( pd 10 ) using the formula pd 10 = vd /( 2 + log ( bb )), where bb is the batch average bioburden in colony - forming units ( cfu ). the present inventors have examined a large number of actual populations and a large series of simulated populations of microorganisms to determine a relationship of the d 10 required to reduce each population over a wide range of bioburden numbers between that yielding a 10 − 2 sal ( pd 10 ) and that necessary to reduce the population remaining at the 10 − 2 dose to a 10 − 6 sal . the second d 10 is termed the terminal d 10 or td 10 . populations a through f comprising distributions of resistance of six different microbial populations , and selected modifications thereof , have found use as challenges in computer evaluations of various dose setting and substantiation methods . population c is the standard employed in dose setting method 1 and , as such , was designed to represent a highly severe challenge to the radiation sterilization process ; in developing the distribution , measurements of the resistance of constituent microorganisms giving d 10 values ranging from 1 . 0 to 4 . 2 kgy , were carried out with the organisms dried in the presence of organic material , thereby deliberately creating highly effective radiation protective conditions . population b represents the resistances of the same microorganisms as in population c but with resistances measured in the absence of organic solutes ; overall , it &# 39 ; s response to radiation is somewhat greater than that of population c , the d 10 range being 0 . 8 to 3 . 3 kgy . theoretical population a was postulated from population b to represent a minimal microbial challenge to the radiation sterilization process — it was derived by reducing each of the 9 classes of d 10 values by around 30 % while retaining frequencies of occurrence found for population b . clearly , the initial selection of population a is in keeping with the envisaged microbiological status of candidate products to which a new method of dose setting would be applied . d , e and f are populations which possess resistance distributions that exhibit responses to radiation much less than that of population c and thus are not relevant in the present context . the notion of dividing a radiation dose - response curve of a heterogeneous microbial population into two distinct parts was first utilized in the development of method vd max . in taking this activity forward , it was recognized that , subject to passing the vde at a specified sal ( generally 10 − 2 ), it is solely the response of the microbial population on product surviving at this sal that sets the sterilization dose to achieve a target sal somewhat below 10 − 2 ( generally 10 − 6 ). this terminal response is definable quantitatively by the d 10 value derived from the linear line joining the two points ( log 10 − 2 , dose at 10 − 2 ), ( log 10 − 6 , dose at 10 − 6 ); its value has been symbolized by the term td 10 . the upper part of the dose - response curve , occurring above an sal of 10 − 2 , is similarly definable through a d 10 derived from the line joining the points ( log bioburden , dose = 0 ), ( log 10 − 2 , dose at 10 − 2 ), its value being symbolized by pd 10 . this analysis of dose - response curves of population c is the foundation of method vd max that is now being applied to the substantiation of a range of sterilization doses extending from 15 to 35 kgy ; in this context , it has proved to be both a valuable and valid approach ( note , with method vd max , verification is performed at an sal of 10 − 1 and , hence , this sal is the transition point on the dose - response curve for the calculation of values of pd 10 and td 10 for use with this method ). heterogeneous microbial populations with an associated heterogeneous radiation response will generally constitute the bioburden present on product prior to sterilization . such populations inevitably yield values of td 10 that exceed those of pd 10 and , hence , give td 10 / pd 10 ratios that are greater than 1 . 0 . exceptionally , bioburden may comprise microorganisms of single type exhibiting a homogeneous response to radiation . homogeneous populations give ratios of 1 . 0 or , in circumstances where the microorganism &# 39 ; s dose - response curve exhibits a shoulder , less than 1 . 0 . for “ population a ” ( popa ), which is heterogeneous , the expectation is for td 10 / pd 10 ratios to be greater than 1 . 0 irrespective of the level of bioburden . this was found to be so . td 10 / pd 10 ratios vary systematically over the bioburden range , 0 . 02 to 1000 , taking a value of 2 . 01 at the lower limit and 1 . 67 at the upper while passing through a maximum of 2 . 18 at a bioburden of 0 . 50 . the existence of a maximum is due to the different rates at which values of td 10 and pd 10 increase with increasing bioburden . rounding up of this maximum to a value of 2 . 2 provides an initial choice of the pd 10 coefficient against which values of td 10 / pd 10 ratios derived from populations possessing distributions of resistance other than that of popa can be compared . values of td 10 / pd 10 ratios for “ population c ” ( popc ), another heterogeneous microbial population , behave in a manner similar to that found for popa with increasing bioburden . for bioburden levels extending from 0 . 02 to 1000 , ratios range from 1 . 78 to 1 . 58 with a maximum of 1 . 92 at a bioburden of around 0 . 30 . popc is the resistance distribution ( so - called standard distribution of resistances ) on which dose setting method 1 is founded and its td 10 / pd 10 ratios are , at comparable bioburden levels , universally less than those of popa , a finding indicating a degree of conservativeness associated with a choice of 2 . 2 as the pd 10 coefficient . these microbial populations comprise a family developed by the modification of popa . modification involved shifting systematically to the right the frequency of the highest resistance occurring in popa while reversing the displaced frequencies in ascending order within the eight populations . this gave populations with responses to radiation that progressively decrease with increasing md designator . as all eight mds are heterogeneous , they gave values of td 10 / pd 10 ratios greater than 1 . 0 . for this group of populations with widely varying resistance distributions , no value of the td 10 / pd 10 ratio was greater than 2 . 05 for the bioburden range 0 . 02 to 1000 with the vast majority well below the comparator value of 2 . 2 . in fact , as the overall resistance of the populations increased ( in other words , the response to radiation decreased ), the ratios approached a value of 1 . 0 , again pointing to the conservative nature of a coefficient of 2 . 2 . another means of developing distributions of resistance varying overall from that of the parent distribution is to progressively sum the resistance probabilities , starting with that which takes the lowest value and proceeding to the highest . this provides populations for which responses to radiation are , to varying degrees , either more than or less than that of the parent population . popa_md6 and md9 is one such pair of populations that respond in this opposite way , popa_md10 and md14 is another and popa_md15 and 20 is a third , the population with the higher numerical designator of the pair showing the lesser response to radiation and the difference in response for the paired populations becoming greater as the designator increases . for those modified populations whose response to radiation is greater than that of popa ( md6 , 9 and 15 ), calculated values of td 10 / pd 10 ratios across the bioburden range 0 . 02 - 1000 are all below corresponding values for popa and thus are amply covered by a value of 2 . 2 . in contrast , the populations , which have been modified in a way that provides a proportion of resistant microorganisms in excess of that of popa resulting in a lessened response to radiation , give values of ratios at the low end of bioburden range that are greater than 2 . 2 . for example , a maximum ratio of 2 . 52 is seen for popa_md9 at a bioburden of 0 . 3 , 2 . 76 for md14 at 0 . 2 and 3 . 04 for md20 at 0 . 08 . clearly , these findings require consideration in making the final choice for the value of the pd 10 coefficient . seven further populations have been studied . two , created from each of popa and popc , were developed so that the same probability occurred in each resistance class making up the distribution ; they were designated popa_even and popc_even , respectively . two more populations were modifications of popa and popc . they comprised equal probabilities of each of solely the most sensitive and most resistant classes of the populations and were given designates popa — 50s — 50r and popc — 50s — 50r . three populations were homogeneous in nature , each comprising a single type of microorganism having a resistance defined by a d 10 value of 0 . 5 , 2 . 5 or 4 . 2 kgy ; they were designated pop_mono 0 . 5 , 2 . 5 and 4 . 5 , respectively . all seven populations gave td 10 / pd 10 ratios according to the general expectation noted above . the heterogeneous populations provided a range of values of ratios that varied systematically with changing bioburden level and exhibited a maximum . furthermore , with the exception of popa — 50s — 50r at a bioburden of 0 . 02 , ratios took values of less than 2 . 2 . the exception resulted from the presence of an unduly low pd 10 value at this bioburden level . the homogeneous ‘ mono ’ populations all showed td 10 / pd 10 ratios of 1 . 0 . simulated experiments , employing mixed suspensions of b . pumilus spores and s . marcescens cells irradiated at doses ranging from 0 . 25 to 1 . 0 kgy , gave the necessary assurance that detection is technically feasible with these radiation doses . they also demonstrated that an incremental dose experiment employing this dose range could yield an array of fraction positive results from which an estimate of the dose to achieve an sal of 10 − 2 could be obtained . the simulated ide and vde have demonstrated that associated procedures , as modified , give successful outcomes . thus , there is good reason to believe that ‘ low dose ’ ides and vdes carried out on product will be technically - feasible , practical procedures from which meaningful and necessary doses can be identified . the td 10 / pd 10 analysis of popa produced a maximal rounded - up ratio of 2 . 2 and this value has been set against values of ratios derived from analyses done on a wide variety of populations having substantially different , but often allied , resistance distributions . the general outcome from this comparison is that popc , which has a greater radiation resistance than popa , and most populations with modifications to the resistance distribution of popa provide values of ratios appreciably less than 2 . 2 over a wide range of bioburden levels . clearly , this outcome supports strongly the choice of 2 . 2 as the pd 10 coefficient and underlines the conservativeness of the value . the exceptions to this finding are certain populations possessing distributions in which there are present higher proportions of microorganisms of high radiation resistance than that in popa . their presence produces principally increases in the values of td 10 which , in turn , give high td 10 / pd 10 ratios . given the above exceptions , what has to be considered is the relevance of such distributions to the ‘ real world ’. at present this is a judgment decision , although it has to be said that , in the light of the stipulated manufacturing conditions and the controls to be imposed on them , the occurrence on product prior to sterilization of microbial populations having a significant number of microorganisms of high radiation resistance is highly unlikely . moreover , the results of the vdes will act as a check for their absence . if such microorganisms do occur , they will have to present at a specific bioburden in a proportion in excess of that of popa level for the pd 10 coefficient of 2 . 2 to be invalid . td 10 is thus assumed to be 2 . 2 times pd 10 . the sterilization dose to achieve a 10 − 6 sal is then calculated by adding four td 10 doses to the vd , in other words sterilization dose equals vd plus ( 4 * td 10 ). the sterilization dose is thus the dose used to sterilize the devices in question and provides a sterility assurance level of 10 − 6 . the method is recommended for extremely low average bioburdens of five cfu or below . it is useful for sterilization of delicate drugs and radiation sensitive devices . proteins are particularly difficult to sterilize without damage . one particular area of concern for the inventors is the sterilization of blood proteins and plasma proteins . the source of the proteins may be natural ( i . e . human , animal ), synthetic or recombinant . blood protein / plasma protein serves as a transport molecule for lipids , hormones , vitamins and metals . they also serve as enzymes , complement components , protease inhibitors , and kinin precursors . blood protein / plasma protein includes , but is not limited to , albumin , ancrod , batroxobin , collagen , ecarin , elastin , epinephrine , factor x / xa , factor vii / viia , factor ix / ixa , factor xi / xia , factor xii / xiia , fibrin , ficolin , fibrinogen , fibronectin , gelatin , globin , haptoglobin , hemoglobin , heparinase , inhibin , insulin , interleukin , lamininthrombin , platelet surface glycoproteins , prothrombin , selectin , thrombin , transferin , von willebrand factor , vasopressin , vasopressin analogs , procoagulant venom , platelet activating agents and synthetic peptides having hemostatic activity . the present inventors are also concerned with sterilization of polymers , and in particular polymers useful in preparing the fabric substrates in wound dressings , which include , without limitation , collagen , calcium alginate , chitin , polyester , polypropylene , polysaccharides , polyacrylic acids , polymethacrylic acids , polyamines , polyimines , polyamides , polyesters , polyethers , polynucleotides , polynucleic acids , polypeptides , proteins , poly ( alkylene oxide ), polyalkylenes , polythioesters , polythioethers , polyvinyls , polymers comprising lipids , and mixtures thereof . preferred fibers comprise oxidized regenerated polysaccharides , in particular oxidized regenerated cellulose . the methods of the present invention are expected to be quite useful with the preceding polymers and proteins . while the invention has been particularly described in connection with specific embodiments thereof , it is to be understood that this is by way of illustration and not of limitation , and that the scope of the appended claims should be construed as broadly as the prior art will permit .	0
braided articles of this invention are preferably made on an apparatus that consists of a concave inner braiding surface 10 such as that shown in fig1 . the braiding surface consists of movable segments 20 which are capable of rotation about an axis 30 through a desired arc of rotation . the concave surface 10 can be any partial or full surface of rotation . the concave inner surface 10 can of course consist of curved and flat portions . the segments 20 are supported and guided in their revolution by stationary guide rails 40 . rotation of the individual segments 20 may be accomplished by hydraulic or pneumatic actuators , electric motors or other conventional mechanisms which may be located at any convenient location such as between the guide rail 40 and the convex surface of the braiding segment 20 . pivot discs 50 are situated on the concave surfaces of the braiding segments 20 . the shape of the braiding surface 10 , the mobility of the braiding segments 20 and the individual control of carrier members 150 facilitates the unique placement of fibers that heretofore has been unattainable except by manual manipulation of yarns , as discussed below . the end view of the braiding apparatus shown in fig2 illustrates various positions of the segments 20 on the guide rail 40 in relation to the braiding zone 60 formed by the fiber strands of the article 80 being braided . guide rings 45 secure the segments 20 on the guide rails 40 . guide mechanisms 25 such as a grooved wheel are powered by a motor 28 , fixedly connected to movable segments 20 , and travel along guide rails 40 . the motor is powered by a power supply 216 controlled by a computer 215 in the same manner as shown in fig1 . fig3 illustrates the layout of evenly spaced , non - translating pivot discs 50 on the concave surface of the braiding segments 20 . the braiding surface 20 consists of an assemblage of pivot discs 50 . along the flat or singularly curved regions of the braiding segments 20 the pivot discs 50 are evenly spaced . however , on the region of the braiding surface 10 with double curvature some of the rows of pivot discs 50 are omitted . deleting rows along the doubly curved region of the braiding surface 10 limits the amount of movement between rows that is capable in this region . each pivot discs 50 is capable of rotation through ± 180 ° about its center point , i . e ., about an axis perpendicular to the concave side of the braiding surface 20 as discussed below . situated on the pivot discs 50 are linear shafts 90 which can be longitudinally aligned with similar shafts 90 on adjacent pivot discs 50 by rotation of the discs 50 . non - braiding yarn tubes 75 extend through the braiding segments 20 between the pivot discs 50 to guide unidirectional non - braiding fibers 77 for the braided article 80 . by extending these yarns through the braiding surface , the need for separate tractor / yarn carriers for these yarns is eliminated , thereby further reducing the required braiding area . fig4 shows additional details of a pivot disc 50 . the surface of the disc 50 has electrical power and sensor contact strips 110 . the linear shaft 90 is flanked by shaft gears 120 which are used to facilitate movement of carrier members 150 discussed below . below the pivot disc 50 is a stationary support disk 130 which houses a conventional stepper motor or rotary solenoid ( not shown ) which turns the pivot disc 50 . fig5 illustrates a carrier member 150 which travels on the concave side of the braiding surface 10 from pivot disc 50 to pivot disc 50 . the carrier member 150 consists of a yarn carrier 160 , which dispenses a fiber strand 70 , and a tractor assembly 170 . the tractor assembly 170 has a linear motion bearing 190 which guides the carrier member 150 on linear shafts 90 . independent propulsion of each carrier member 150 is accomplished by an electric motor 180 which operates a drive gear 200 which intermeshes with shaft gears 120 . the motor 180 is powered through integral electrical power and sensor contacts 210 and is controlled by a computer 215 through a power supply 216 . the computer 215 is programmed to activate power at the carrier members 150 , yarn carriers 160 and braid segments 20 in a sequence determined by the braiding pattern required to construct a given article . when power is turned on at a pivot point electrical current goes from the pivot point through the electrical contacts 110 and 210 and to the motor 180 on the carrier member 150 . the shaft of the motor turns the gears in the gear head assembly and the drive gears 200 . the drive gears 200 mesh with the rack gears 120 on the pivot disc 50 . when the drive gears 200 turn the carrier member 150 moves . referring to fig3 three different carrier member 150 movements are possible ; a carrier member 150 ( not shown in fig3 ) located on pivot disc 50a may advance forward to pivot disc 50b , turn to the left or right and advance to pivot disc 50d or 50e , and turn + 180 ° and advance to the pivot disc 50c behind the original location . to advance forward to the next pivot disc 50b the computer 215 must turn on the electrical power at the first pivot disc 50a . the carrier member 150 moves forward onto the next pivot disc 50b until the electrical contacts 210 of the carrier member 150 no longer make contact with the contacts 110 on the first pivot disc 50a . the computer 215 , through monitoring the current levels on the first pivot disc 50a , turns the power off at the first pivot disc 50a and turns on the power at the second pivot disc 50b . once the carrier member 150 is completely on the second pivot disc 50b the computer 215 turns off the power at the second pivot disc 50b . to move the carrier member 150 to the pivot discs 50d or 50e to the right or left of the original pivot disc 50a , it is first necessary to rotate both pivot discs 50a and 50d or 50a and 50e 90 ° so that the longitudinal axes of horizontal shafts 90 mounted on the pivot discs 50a and 50d or 50a and 50e line up with each other . it is important to insure that the pivot discs 50 are rotated in phase so that the carrier member 150 will not be facing the wrong direction after the transfer is complete . the computer 215 turns the electrical power on at the first pivot disc 50a and the carrier member 150 advances to the designated second pivot disc 50d or 50e . when electrical contact no longer exists between the first pivot disc 50a and the carrier member 150 , the computer 215 turns the electrical power off at the first pivot disc 50a and on at the second designated pivot disc 50d or 50e . once the carrier member 150 is positioned correctly on the second pivot disc 50d or 50e , the computer 215 reorients both pivot discs 50a and 50d or 50e . in the third case the computer 215 rotates the first pivot disc 50a 180 ° and the carrier member 150 advances to the second pivot disc 50c in a similar manner as is done in the other cases . after the carrier member 150 is correctly positioned onto the second pivot disc 50c , the computer 215 reorients the first pivot disc 50a . fig6 illustrates a yarn carrier 160 which is mounted on the top of a carrier member 150 and dispenses a braiding fiber strand 70 . the fiber 70 is wound on a spool 220 prior to the mounting of the yarn carrier 160 onto the carrier member 150 . yarn 70 is pulled from the yarn carrier 160 as the carrier member 150 is moved around the braiding surface 10 . tension is maintained in the yarn 70 to eliminate the beat up process by incorporating a friction coupling 230 and a rewind mechanism 240 . an electric motor or coil spring 240 may be used to rewind the fiber 70 . as the yarn 70 is being pulled out of the carrier 160 the coil spring 240 has already been contracted to its limit . therefore , tension increases in the yarn 70 until the torque on the spool 220 exceeds the resisting torque supplied by the friction coupling 230 . the yarn 70 is then pulled out of the carrier 160 when the tension in the yarn 70 exceeds the resisting force supplied by the friction coupling 230 . during the braiding operation there are times when a movement of the carrier member 150 does not result in the extraction of yarn 70 from the carrier 160 . therefore , to maintain tension in the yarn 70 a rewind mechanism must exist and hence the coiled spring 240 . the coiled spring 240 rewinds the yarn 70 when the tension in the yarn 70 diminishes . in order to maintain a constant distance between the braiding zone 60 and the braiding surface 10 and to maintain tension of the braiding yarns 70 , a material takeup system 85 is required . maintaining a constant distance between the braiding zone 60 and the braiding surface 10 permits accurate control of yarn braid angles . differing preform geometries require different customized takeup systems . referring to fig7 if a flat preform 80 is being braided a clamp 260 secures the top of the preform 80 and a simple set of tension rollers 270 advances the preform 80 . as the preform 80 is braided the tension rollers 270 periodically rotate , in accordance with the braid length , and advance the material . however , if a curved i - beam is braided then the takeup system ( not shown ) would consist of a series of small movable tension rollers that advance the outer surface of the i - beam at a faster rate than the inner surface of the i - beam . the programming required to achieve the desired movements of the segments 20 , pivot discs 50 and the carrier members 150 is specifically tailored to the particular braiding pattern . the functions described above define the range of motion for each element and specific operating parameters are implemented straightforwardly . the computer 215 also controls the position of the movable braiding segments 20 . certain yarns may be used as non - braiding yarns 77 and it may be necessary for the braiding segments 20 to be rotated to facilitate the insertion of the yarn 77 . there are other potential examples where the braiding segments 20 must be moved . it is possible that the braiding segments 20 may be rotated such that the carrier members 150 are inverted . in the braiding process a fault condition could occur with one of the carrier members 150 or yarn carriers 160 . for example , one of the yarn carriers 160 could have a yarn 70 breakage . a fault sensor ( not shown ) in the yarn carrier 160 signals the computer 215 that a problem existed and the computer 215 could stop the braiding process and signal the operator that a fault condition existed . the computer 215 could , by a graphical means , show which carrier member 150 or yarn carrier 160 signaled the problem . the operator would instruct the computer 215 to move the carrier member 150 to a position where the problem could be corrected or the computer 215 could rotate a braiding segment 20 and the operator manually correct the problem . even with the most sophisticated computers and state - of - the - art electronics , the braiding of complex structural preforms will be a slow process . the necessary fabrication efficiency will only be achievable when the entire process of braiding is automated from the original design of the preform to the final braiding of the preform . a designer from a computer aided design ( cad ) station preferably designs the structural preform 80 . prior to braiding the preform 80 the design undergoes computer braiding simulation to validate the design . after the design has been validated , the appropriate number of yarn carriers 160 are wound with yarn 70 . each yarn carrier 160 contains a specific amount of yarn 70 that is a function of the path the yarn travels in the braided preform 80 . each yarn carrier 160 is bar coded and stored until the setup of the braider commences . each yarn carrier 160 is mounted to a carrier member 150 , sensors tested , yarn tension set and then moved onto the braider 20 . the computer 215 directs the movement of the carrier member 150 ( as discussed above ) to the correct starting pivot disc 50 on the braider surface 20 . a robotic arm ( not shown ) extracts the end of the yarn 70 from the cap of the yarn carrier 160 and mounts it onto the material takeup system 85 . the process of positioning carrier members 150 and mounting the yarn ends 70 onto the material takeup system 85 is repeated until all the carrier 150 members are correctly positioned onto the braider 20 . when nonbraiding yarns 77 are used in a preform design the operator inserts these yarns 77 through the appropriate yarn tubes 75 on the braiding surface 20 and the robotic arm attaches the yarn ends 77 to the material takeup system 85 . once the braider has been strung the braiding begins . while a preform 80 is being braided additional yarn carriers 160 are being wound with yarn 70 , bar coded and stored for the next preform . many improvements , modifications and substitutions will be apparent to the skilled artisan without departing from the spirit and scope of the present invention as described herein and defined in the following claims .	3
after the development of the fabricable nickel aluminides , work was begun to assemble pieces by way of welds . the result was failed welds ; stress put on the assemblies consistently failed at the welds . there were attempts to clean the surface by mechanical and electropolishing with no success . in the course of studying corrosion resistance of nickel aluminides , scientists at oak ridge national laboratory developed data that is reproduced in the table . applicant speculated that a substance that would corrode the metal might effectively clean the metal ; thus , the corrosive materials of the table , notably fe 3 cl , hno 3 and hcl , were tested . trials with nitric acid established that it is an excellent choice for cleaning and surface of the metal ; however , no improvement of weldability was observed . similarly , hcl was tested but its use was deemed impractical due to high concentrations of the acid that would be required to clean the surface . finally , it was found that ferric chloride sufficiently cleaned the suface to result in a weld that when tested withstood stress better than the metal itself . in other words , failure occurred in the metal while the weld remained intact . in the preferred embodiment surface to be welded is immersed in a saturated soltuion of ferric chloride and rinsed with water . applicant believes the wash causes a chemical reaction whereby ferric chloride is reduced to ferrous chloride by the aluminum in the aluminide . the aluminum goes into solution and is rinsed away leaving a surface rich in the other metal , such as nickel in the case of nickel aluminide . therefore , any treatment that would remove aluminum from the surface and leave it rich in the second metal would be sufficient to perform the invention , provided the second metal is weldable . the surface removed by the cleaning is at the submicron level . if one desires to clean only part of a surface and weld it , the surface not to be welded is merely covered with a coating . the reason the hno 3 was unsuccessful was because the reaction upon immersion results in aluminum oxidation at the surface . the high rate of oxygen adsorption of this aluminum - rich surface interferes with the weldability of the surface . alloys tested were designated ic - 50 and ic - 218 , ic - 221 , ic - 306 and ic - 357 with the following weight percent compositions : ic - 306 ni - 9 . 01al - 13 . 10fe - 6 . 95cr - 0 . 34zr with 150 ppm b , 50 ppm ce and 300 ppm c at the start of the wash the ferric chloride solution is red and becomes green when its strength is lost by the conversion from ferric chloride to ferrous chloride . a surface chemistry check by scanning electron microscope confirmed the cleaned surface to be free of aluminum . improvement in the weldability was measured using a sigmajig test that determines the stress above which cracking occurs during welding . the results of the test are presented in the fig1 . the bars identified by a specimen number followed by th word &# 34 ; range &# 34 ; represents multiple lots of the same composition which may differ by a small variation . the slashed bar represents the lowest stress required to cause cracking upon welding while the open bar represents the highest stress required to cause cracking upon welding . there are other values between the high and the low of other intermediate lots . the specimens identified as &# 34 ; as received &# 34 ; and &# 34 ; cleaned &# 34 ; represent before and after cleaning . the slashed bar indicates an as received specimen that was welded and the stress required to cause cracking in specimens cleaned with ferric chloride before welding . results now cleaning increased the threshold stress by a factor of approximately 3 for ic - 50 and by a factor of over 15 for ic - 218 . note that the stress to initiate cracking of nickel aluminides in the cleaned condition is approaching that of the stainless steels , which are considered to be highly weldable . based on the improvement observed in the sigmajig test , tubes were welded by electron beam and gas tungsten arc , see the photograph of fig2 . the first tube on the left was welded without cleaning . it showed that the weld was of poor quality , did not give full penetration , and required a great deal of cleaning and final grinding . the next tube was welded by gas tungsten arc as used in the first case , except it was cleaned prior to welding . this tube shows excellent weld penetration and did not require any post weld preparation . a flattened tube piece in between first and second tube shows that the weld is of excellent quality and has a good ductility as the base metal . the last tube on the right shows a electron - beam weld , which is of excellent quality . the same cleaning procedure was found to be extremely useful in welding the as - cast tube blank , fig3 . except for the electron - beam weld , all gas tungsten arc welds were made using a filler metal . the sigmajig welds were without a filler metal .	1
an image forming apparatus according to a first embodiment of the invention as applied to a laser beam printer will be described with reference to fig1 to 5 b . fig1 is a perspective view showing the laser beam printer , and fig2 is a vertical sectional view of the laser beam printer . as shown in fig1 and 2 , the laser beam printer 1 is provided with a print unit pu having a housing 2 . mounted below the print unit pu , which is a substantially rectangular parallelepiped , is a paper feed cassette 10 with a handle 13 . the paper feed cassette 10 accommodates a stack of paper and is detachably attached to a cassette mount 80 provided for the housing . the cassette mount 80 has an opening 82 provided on the front face of the housing 2 to allow attaching / detaching of the paper feed cassette 10 . a user can remove the paper feed cassette 10 from the printer 1 by holding the handle 13 and pulling the paper feed cassette 10 toward the front ( in the direction of arrow p of fig2 ). in the paper feed cassette 10 , a paper lifter plate ( not shown ) upwardly urged by a pressure spring ( not shown ) is provided . the uppermost sheet of paper stacked on the paper lifter plate makes contact with a paper feed roller 14 that rotates in the direction of arrow f shown in fig2 . the uppermost sheet is separately fed with aid of a separation pad 15 . provided on the front face of the printer 1 are an operation panel 91 having an operation button 91 a and an led ( light - emitted diode ) 91 b , and an insertion slit 92 into which paper other than that accommodated in the paper feed cassette 10 ( for example , ohp films ) is inserted . the opening 82 , the operation panel 91 , and the insertion slit 92 are all provided on the front face of the housing 2 , which allows the user to operate all of them readily from the same side . as shown in fig2 , a process cartridge 20 is disposed above the paper feed cassette 10 . the process cartridge 20 includes a photosensitive member cartridge 20 a and a developer cartridge 20 b . the photosensitive member cartridge 20 a accommodates a photosensitive drum 21 that makes contact with the paper to transfer toner thereon , a transfer roller 22 opposed to the photosensitive drum 21 , and a scorotron type charger 28 that generates corona discharge to positively charge the surface of the photosensitive drum 21 . the developer cartridge 20 b accommodates a toner - containing developing chamber 24 , a developing roller 25 that supplies toner to the photosensitive drum 21 , and a supply roller that supplies toner to the developing roller 25 . the developing chamber 24 is provided with an agitator 24 a for agitating toner . the photosensitive member cartridge 20 a and the developer cartridge 20 b can be separated from each other . the detailed structure of the photosensitive member cartridge 20 a and the developer cartridge 20 b is described in u . s . patent applications ser . nos . 09 / 281 , 947 and 09 / 281 , 948 , which are herein incorporated by reference . the process cartridge 20 is detachably attached to the housing 2 with the photosensitive member cartridge 20 a and the developer cartridge 20 b assembled . when the process cartridge 20 is detached from the printer 1 , the photosensitive member cartridge 20 a and the developer cartridge 20 b are pulled out in their assembled condition . a cover 33 is provided on the front face of the printer 1 . the cover 33 is pivotally attached at its lower end to a pivot shaft 33 a . the above - described insertion slit 92 is formed integrally with the cover 33 . an opening 34 for attaching / detaching the process cartridge 20 is revealed by pivoting the cover 33 clockwise in fig2 ( in the direction of arrow r in fig1 ). the user can pull out the process cartridge 20 in the direction of arrow q through the opening 34 and attach a new process cartridge 20 therethrough . as shown in fig2 , paper supplied from the paper feed cassette 10 and paper inserted from the insertion slit 92 are guided to a common paper feed path s . a pair of resist rollers 31 , 32 is rotatably mounted between the process cartridge 20 and the paper feed cassette 10 . the photosensitive drum 21 is accommodated in the photosensitive member cartridge 20 a such that the axial direction of the photosensitive drum 21 is perpendicular to the mounting direction of the process cartridge 20 to the housing 2 . this makes the paper feed direction to be the same as the mounting direction of the process cartridge 20 . in other words , the paper feed cassette 10 and the process cartridge 20 can be mounted from the same side , that is , the front side . accordingly , operability of the printer 1 is improved and valuable space around the printer 1 is available for effective use . mounted above the process cartridge 20 is a laser scanner unit 40 that is provided with a laser generator ( not shown ) that emits a laser beam , a polygon mirror 41 that is driven to rotate , a lens 42 , a reflection mirror 43 , a reflection mirror 44 , a lens 45 , and a reflection mirror 46 . as shown in fig2 , a laser beam l reflected by the polygon mirror 41 irradiates to the photosensitive drum 21 , through the lens 42 , the reflection mirrors 43 , 44 , and the lens 45 , to form an electrostatic image on the surface of the photosensitive drum 21 . the laser scanner unit 40 provided above the process cartridge 20 will not interfere with the process cartridge 20 when it is replaced . accordingly , the laser scanner unit 40 does not need to be moved prior to replacement of the process cartridge 20 , and thus displacement of an optical axis can be prevented . a fixing unit 50 for fixing toner onto the paper is provided on the left side of the process cartridge 20 . the fixing unit 50 is provided with a heat roller 51 that heats and melts the toner transferred onto the paper , a pressure roller 52 that presses the supplied paper against the heat roller 51 , and a pair of transport rollers 53 , 54 . a curved chute 61 is pivotally attached on the left of the feed rollers 53 , 54 , as shown in fig2 , to reverse the paper feed direction . in an extending direction of the chute 61 , a pair of discharge rollers 64 , 65 is attached to support the paper transported along the chute 6 . 1 and discharge it to a paper discharge tray 70 formed on the upper surface of the print unit pu . on either side of the paper discharge tray 70 ( on the right and left sides and at the back in fig1 , and at the front and back in fig2 ), a protrusion 71 with a planar upper surface is provided and , as shown in fig2 , the paper discharge tray 70 is stepped down from the upper surface of the protrusion 71 . fig4 is a block diagram showing a control system of the laser beam printer . as shown in fig4 , the operation panel 91 , the laser scanner unit 40 , the fixing unit 50 , and a motor 102 for driving the photosensitive drum 21 and the various rollers are all connected to a printer controller 101 . the printer controller 101 controls operations of each part of the laser beam printer 1 . when the paper feed roller 14 is rotated in a predetermined timed sequence , paper is fed from the paper feed cassette 10 sheet by sheet . the paper is reversed in its feeding direction and guided to the paper feed path s with aid of a guide 35 . upon the arrival of the leading edge of the paper at the resist rollers 31 , 32 , the position of the leading edge is adjusted , and then the paper is transported between the photosensitive drum 21 and the transfer roller 22 . on the other hand , the surface of the photosensitive drum 21 charged by the charger 28 is irradiated with a laser beam emitted from the laser scanner unit 40 and an electrostatic latent image is formed thereon . when the electrostatic latent image on the photosensitive drum 21 is opposed to the developing roller 25 , toner carried by the supply roller 27 and the developing roller 25 turns the electrostatic latent image into a toner image . the toner image on the photosensitive drum 21 is transferred onto the paper passing between the photosensitive drum 21 and the transfer roller 22 . then , the paper with the transferred toner image thereon passes between the heat roller 51 and the pressure roller 52 . at this time , heat and pressure are applied to the toner image on the paper and the toner image is fixed onto the paper . further , the paper having passed between the transport rollers 53 , 54 is transported along the chute 61 and discharged while sandwiched by the discharge rollers 64 , 65 to the paper discharge tray 70 with its printed surface facing down . as shown in fig5 a , a cover 81 can be placed on the upper surface of the protrusion 71 . at this time , the paper discharge tray 70 is covered by the cover 81 . as shown in fig5 a and 5b , the cover 81 is provided with legs 81 a projecting downward . the lower end surfaces of the legs 81 a are made flat . the cover 81 is placed on the upper portion of the housing 2 such that the lower end surfaces of the cover 81 are brought into contact with the upper surface of the protrusion 71 . a cutaway 81 b is formed in the cover 81 , as shown in fig5 b . the cover 81 is placed on the upper surface of the protrusion 71 such that the cutaway 81 b is positioned on the front face of the housing 2 . thus , the user can access the paper discharge tray 70 to remove the paper stacked thereon through the cutaway 81 b . as shown in fig5 a and 5b , the upper surface 81 c of the cover that encloses the paper discharge tray 70 is made flat , allowing other peripheral devices to be mounted on the cover 81 . accordingly , space above the printer 1 can be effectively used . since the paper stacked on the paper discharge tray 70 can be removed through the cutaway 81 b , a peripheral device , if mounted on the cover 81 , will not interfere with the paper removal . a peripheral device mounted on the cover 81 may be electrically connected to the printer 1 so that image data can be exchanged therebetween . peripheral devices to be mounted on the cover 81 include a communication device for facsimile transmission and an image scanner for reading images . to facilitate the removal of paper from the paper discharge tray , it is possible to project one edge of the discharged paper from the cover 81 . specifically , a distance from the stopper 72 ( fig2 ), against which the other edge of the discharged paper abuts , to the cutaway 81 b should be adjusted to be shorter than the length of the paper ( for example , a4 - or b5 - size paper ) by a predetermined length . the distance may be adjusted according to the size of paper most frequently used in the printer 1 or according to the minimum size of paper usable in the printer 1 . with this arrangement , one edge of the paper projects from the cutaway 81 b , allowing the user to remove the paper easily by holding its one edge . when the cover 81 is mounted on the printer 1 , a vertical distance between the paper discharge tray 70 and the cover 81 , that is , a vertical distance of an opening formed by the cutaway 81 b , restricts the number of sheets stackable on the paper discharge tray 70 . thus , the cover 81 should be designed by considering the number of sheets discharged at a time . for example , it is preferable that the paper discharge tray 70 can stack the maximum number of sheets accommodated in the paper feed cassette 10 . in the above - described laser beam printer 1 according to the first embodiment of the invention , attaching / detaching the paper feed cassette 10 , attaching / detaching the process cartridge 20 , manual paper feeding , removal of discharged paper , and operation of the operation panel 91 can be all performed on the front side of the printer 1 . accordingly , all these operations and jobs can be performed by leaving space available only on the front side of the printer 1 . since it is unnecessary to open the lateral and upper sides of the printer 1 and unnecessarily to move the printer 1 , the printer 1 is easily operable by the user . further , the footprint of the printer 1 can be minimized and a limited amount of space can be made available for effective use . a second embodiment of the invention will be described with reference to fig6 and 7 . the second embodiment is almost the same as the first embodiment except for a certain difference . as shown in fig6 , a protrusion 71 - 2 in the second embodiment projects to a higher position than the protrusion 71 in the first embodiment . a cutaway 71 b is formed in the protrusion 71 - 2 that allows the paper discharge tray 70 to extend to the front face of the printer 1 . in the second embodiment , as shown in fig7 a and 7b , a planar cover 81 - 2 can be mounted on the protrusion 71 - 2 . the protrusion 71 - 2 is provided instead of the legs 81 a of the cover 81 in the first embodiment . as shown in fig7 a , because the user can remove the discharged paper from the paper discharge tray 70 through the cutaway 71 b , space on the upper side of the cover 81 - 2 , that is , space above the printer 1 , can be used freely . for example , various peripheral devices can be mounted on the upper surface of the cover 81 - 2 . at the same time , as the protrusion 71 - 2 provides space for stocking the discharged paper , any one of various peripheral devices can be mounted directly on the protrusion 71 - 2 without the cover 81 - 2 interposed therebetween . in such an arrangement , paper discharged on the tray 70 can be removed from the front side of the printer 1 through a clearance ( cutaway 71 b ) between the tray 70 and a peripheral device mounted thereon . even directly mounting a peripheral device having a flat bottom surface on the protrusion 71 - 2 provides space for stacking discharged paper and for allowing access to the discharged paper , without causing any inconveniences . accordingly , space above the printer 1 can be effectively used when the cover 81 - 2 is not interposed . also , in the second embodiment , it is possible to project one edge of the paper from the cover 81 - 2 by adjusting the distance from the stopper , against which the other edge of the paper abuts , to the cutaway 71 b to be shorter than the length of the paper ( for example , a4 - or b5 - size paper ) by a predetermined length . thus , the user can remove the paper easily by grasping the projecting one edge of the paper . when the cover 81 - 2 or a peripheral device is mounted on the protrusion 71 - 2 , the number of stackable sheets is restricted by the vertical space provided above the paper discharge tray 70 . accordingly , the height of the protrusion 71 - 2 should be designed by considering the number of stackable sheets . specifically , it is preferable that the number of sheets accommodated in the paper feed cassette 10 can be stacked on the paper discharge tray 70 . alternatively , if the paper discharge tray 70 is spaced 1 cm or more from the upper end surface of the protrusion 71 - 2 , at least 50 or more sheets can be stacked . with this arrangement , the paper discharge tray 70 becomes more practical and unlikely to be filled with paper discharged by a single print output . a third embodiment of the invention will now be described with reference to fig8 and 9 . the third embodiment shows an exemplary case where a scanner unit for reading images is mounted above the printer 1 of fig1 . as shown in fig8 , the printer 1 is provided with a print unit pu , that is common to the first embodiment , and a scanner unit 110 mounted above the printer unit pu for reading images . the print unit pu and the scanner unit 110 are accommodated in the single housing the scanner unit 110 is mounted above the print unit pu . the scanner unit 110 is provided with a document tray 111 that holds documents to be fed into the scanner unit 110 , an image reader 112 ( fig9 ) that scans and reads images on the fed documents and converts the read images into electrical signals , and an operation panel 115 that receives operations as reading commands . documents having passed the image reader 112 are discharged to a document discharge tray 117 . the document tray 111 , the operation panel 115 , and the document discharge tray 117 are provided so that the user can operate all of them from the front side of the printer 1 . paper on which printing has been performed by the print unit pu is discharged to the paper discharge tray 70 disposed below the document discharge tray 117 . fig9 is a block diagram showing a control system of the third embodiment . as shown in fig9 , in the scanner unit 110 , a driving motor 113 that drives a predetermined paper feed mechanism to feed paper , the image reader 112 , and the operation panel 115 are connected to a reading controller 114 . the reading controller 114 is also connected to a printer controller 101 of the print unit pu , which is the same as the printer controller 101 shown in fig4 . the reading controller 114 and the printer controller 101 are arranged so as to communicate with each other , and thereby images read by the scanner unit 110 can be printed by the print unit pu . a predetermined interface or a connecting terminal may be provided so that a personal computer can process images read by the scanner unit 110 . in this way , since any operation of both the print unit pu and the scanner unit 110 can be performed from the front side of the printer 1 , the printer 1 provides excellent operability to the user . a fourth embodiment of the invention will now be described with reference to fig1 a , 10b and 11 . the fourth embodiment shows an exemplary case where a reading / communication unit 130 is mounted above the print unit pu of fig1 . as shown in fig1 a , the printer 1 is provided with a print unit pu that is common to the first embodiment and a reading / communication unit 130 mounted above the print unit pu . the print unit pu and the reading / communication unit 130 are accommodated in the single housing 2 . the reading / communication unit 130 has an image reading function and an image transmission / reception ( facsimile ) function . the reading / communication unit 130 is provided with an operation panel 135 having a touch panel on the screen of a liquid crystal display . image reading , transmission and the like can be commanded through operation of the operation panel 135 . further , an image reader 112 a is built in the reading / communication unit 130 to read images on documents sent from a document tray 131 . the documents read by the image reader 112 a are discharged to a document discharge tray 139 . the document tray 131 , the operation panel 135 , and the document discharge tray 139 are all provided so as to be operable from the front side of the printer 1 . paper on which printing is performed by the print unit pu is discharged to a paper discharge tray 70 disposed below the document discharge tray 139 . fig1 is a block diagram showing a control system of the fourth embodiment . the reading / communication unit 130 has a driving motor 113 a that drives a predetermined paper feed mechanism to feed documents , an image reader 112 a that reads images on the documents fed by the paper feed mechanism , and a reading controller 114 a to which the operation panel 135 , the driving motor 113 a , and the image reader 112 a are connected . the reading / communication unit 130 is further provided with a receiver 132 that receives data sent via public communication lines , a transmitter 133 that transmits data via public communications lines , a communication controller 134 to which the operation panel 135 , the receiver 132 , and the transmitter 133 are connected . since the reading controller 114 a , the printer controller 101 , and the communication controller 134 can communicate with each other , the print unit pu can print images read by the image reader 112 a , or read images can be faxed via the transmitter 133 . further , a predetermined interface and a connecting terminal may be provided so that a personal computer can process images read by the image reader 112 a or images received via the receiver 132 . in this way , since any operation of both the print unit pu and the reading / communication unit 130 can be performed from the front side of the printer 1 , the printer 1 provides excellent operability to the user . a printer 1 shown in fig1 b is provided with an additional telephone function as compared to the printer 1 of fig1 a . in this printer 1 , a reading / communication unit 140 is provided above the printer unit pu . the reading / communication unit 140 has an image reading function , an operation panel 141 accepting operational commands for facsimile / telephone functions , and a handset allowing telephone conversation via telephone lines . a document tray 143 and a document discharge tray 144 are also provided so at to be operable from the front side of the printer 1 . since any operation can be performed from the front side of the printer 1 , the printer 1 provides excellent operability to the user .	6
reference will now be made to the drawings in which the various elements of the present invention will be given numeral designations and in which the invention will be discussed so as to enable one skilled in the art to make and use the invention . it is to be understood that the following description is only exemplary of the principles of the present invention , and should not be viewed as narrowing the pending claims . referring to fig1 there is shown a composite / metallic gun barrel , generally indicated at 10 , made in accordance with the principles of the present invention . the composite / metallic gun barrel 10 has an elongate metallic cylinder 14 which forms a liner for the gun barrel 10 . this metallic liner 14 is typically made of stainless steel , but can be made of other metals as well . the metallic liner has a first , thin walled portion 14a which extends from an open , first end 18 to a position two to four inches from a second end 22 which forms a chamber 24 for receiving a cartridge 26 . from the position at which the first , thin walled portion 14a ends , a second portion 14b of the metallic liner 14 has an increased thickness , as shown in fig1 . the thicker walls of the second portion 14b form the chamber 24 for receiving the cartridge 26 . the thicker walls also provide additional support to compensate for the explosive force caused by firing the cartridge 26 . wrapped about the metallic liner 14 is a casing 30 made of a composite material . while the composite material will typically be a graphite &# 34 ; prepreg &# 34 ;, or graphite fibers coated with epoxy , other composite fibers and / or resins may be used as is known to those skilled in the art . the casing 30 has a first , thick walled section 30a which extends along the barrel 10 for the length of the first , thin walled portion 14a of the metallic liner 14 . adjacent the second portion 14b of the metallic liner 14 , a second section 30b tapers to a thinner wall to match the increase in thickness in the metallic liner 14 . at the exterior circumference of the metallic liner 14 and the interior circumference of the composite casing 30 is an interface 34 . in prior art composite / metallic gun barrels , the metallic liner 14 and the composite casing 30 were bonded together along the length of the interface . if the composite casing 30 was formed on the metallic liner 14 , the bonding was usually achieved by the epoxy or other resin used to bond the composite fibers . if the composite casing 30 was formed on a mandrel , or some other device , and then placed on the metallic barrel liner , the bonding was typically accomplished by coating the metallic liner with a bonding material . as was discussed in the background section , the variation in bond strength due to uneven application between the metallic liner 14 and the composite casing 30 leads to uneven stresses during expansion and contraction due to both atmospheric changes , and the heat generated by repeated firing of the weapon . during the expansion and contraction of the metallic barrel liner 14 and the composite barrel casing 30 , it is common for some of the bonding material to break free of the composite casing or the metallic liner . when some , but not all of the bonding material breaks free of the casing 30 or the liner 14 , portions of the casing and liner pull against one another , while other portions are able to freely move . this results in the barrel 10 warping under the differing stresses . the warping , in turn , decreases the accuracy of the gun and causes increased friction between the metallic barrel liner and a bullet passing therethrough . in contrast to the prior art , the present invention does not bond the metallic liner 14 and the composite casing 30 together along the entire length of the barrel 10 . in the embodiment shown in fig1 no bonding agent is used along the entire length of the interface 34 between the composite casing 30 and the metallic liner 14 . in the alternative , the composite casing 30 and the metallic liner 14 can be freed from bonding together by use of a release agent such as teflon spray to provide a nonbonded interface 34 between the composite casing 30 and the metallic liner 14 . disposed along the second section 30b of the composite casing 30 and the second portion 14b of the metallic liner 14 is a holding pin 40 which extends into the metallic liner and the composite casing . the holding pin 40 is disposed in a position which prevents rotation of the composite casing 30 relative to the metallic liner 14 . the holding pin 40 can be made of numerous different materials , but steel is believed to be a preferred material . also shown in fig1 is a standard threaded barrel mounting 44 at an end of the second portion 14b of the metallic liner 14 opposite the first portion 14a . the threaded barrel mounting 44 allows the barrel to be mounted to a conventional machined metal action . a threaded tapered pre - stress insert 48 is also shown , the insert being disposed adjacent the open , first end 18 of the barrel 10 . the pre - stress insert 48 is typically made of stainless steel , although these skilled in the art will be familiar with other materials which could be used . the pre - stress insert stretches the barrel in advance of thermal expansion and thereby minimize the effects of the thermal expansion . referring now to fig2 there is shown an alternate embodiment of the invention . similar to the embodiment shown in fig1 the embodiment shown in fig2 has a barrel 110 having a metallic liner 114 and a composite casing 130 made of graphite or some other fibrous material as will be apparent to those skilled in the art . the metallic liner has a first , thinner walled portion 114a near an open first end 118 of the barrel 110 , and a second , thicker walled portion 114b , adjacent a second end 122 of the barrel . the second , thicker walled portion 114b forms a chamber 124 for receiving a cartridge 126 . unlike the embodiment shown in fig1 however , the interface 134 between the metallic liner 114 and the composite casing 130 is bonded along a portion thereof . disposed along the interface 134 between the second portion 114b of the metallic liner 114 and the second section 130b of the composite casing 130 is a bonding layer 138 . the bonding layer will typically be a layer of epoxy , but may be made of other bonding agents as well . the bonding layer 138 holds the second section 130b of the composite casing 130 to the second portion 114b of the metallic liner 114 so as to prevent rotation of the casing relative to the liner , and to prevent the two from separating . the bonding layer 138 , however , will typically be uniformly displaced around the barrel for a length of only two or three inches . over such a length , the expansion and contraction of the composite casing 130 and the metallic liner 114 presents a lower risk of warping the barrel . at least a substantial portion of the remaining length of the interface 134 between the composite casing 130 and the metallic liner 114 is not bonded so as to allow the casing and the liner to expand and contract independently of one another . those skilled in the art will recognize that gun barrels could achieve some of the advantages of the present invention while using a bonding layer extending a greater length . for example , the bonding layer 138 could be half the length of the barrel 110 , while still achieving some benefit by allowing the liner and casing of the remaining , nonbonded length of the barrel to move relative to one another . however , it is believed that having the bonding layer no more than 4 inches on a traditional rifle barrel provides superior results . while shown in fig2 as being disposed at the second end 122 of the barrel 110 , the bonding layer could be disposed at the first end 118 of the barrel , as is shown at 138b . in such a position , the heat from repeated firing of bullets would not effect the bonding layer 138 with as much intensity due to its remoteness from the point of firing . however , such a position of the bonding layer 138 leaves the second section 130b of the composite casing 130 and the second portion 114b of the metallic liner 114 unattached . this concern could be overcome by using a holding means such as a holding pin 140 , or other similar device , to prevent rotation of the second section 130b of the casing 130 relative to the second portion 114b of the metallic liner 114 . as with the embodiment shown in fig1 the embodiment of fig2 includes a barrel mounting 144 at the second end 122 of the barrel 110 , and a pre - stress insert 148 at the open first end 118 . referring now to fig3 there is shown a perspective view of a barrel , generally indicated at 210 being formed from a metallic barrel liner 214 overlaid with a composite material 230 . the composite material 230 will preferentially be a strip of fiberglass mesh about 26 inches long , which is commonly referred to as fiberglass scrim cloth . the fiberglass scrim cloth 230 may be preimpregnated with a resin or epoxy , i . e . &# 34 ; prepreg &# 34 ;, or may be coated with resin or epoxy shortly before being placed on the metallic liner 214 . the epoxy or resin connects the fiberglass fibers 230a of the scrim cloth 230 to form a nonconductive composite isolator or insulative layer between the metallic liner 214 and the remainder of the composite casing 30 ( fig1 ). the scrim cloth 230 is covered with graphite fibers 234 to create a composite casing ( 30 in fig1 and 130 in fig2 ). the initial graphite layer 234 will typically be graphite tape which is hoop wound , i . e . wound about the metallic liner 214 generally perpendicular to the long axis a -- a of the liner . of course , the tape 234 could be wound in a helical pattern , or a single strand or roving of graphite could be used and would be wound at approximately 1 - 5 degrees from perpendicular to the long axis . additionally , other composite materials may be used . those skilled in the art will be familiar with the different techniques for winding prepreg tape 234 or single or multiple roving of graphite fiber impregnated with resin at application , as well as other forms of composite winding which may be used with the present invention . following the hoop wound layer 234 , additional graphite fibers 234a are disposed along the metallic liner 214 in an axial or longitudinal direction generally parallel with the long axis of the metallic liner . after one or more layers ( typically 5 to 15 ) of the axial fibers , another hoop wound layer 234b is applied . the process is then repeated for several alternating groups of hoop wound and axially placed layers . by controlling the number of hoop wound layers to the number of axially placed layers , the thermal expansion coefficient of the composite casing ( 30 in fig1 and 130 in fig2 ) can be controlled . the higher the number of hoop layers , the lower the coefficient of thermal expansion in a radial direction . however , stiffness in the direction ( resistance to bending the barrel ) is improved with increased quantity of axial fibers . as the resin or epoxy impregnated tape 234 is overlaid on the metallic liner 214 , the lining is or can be coated with a release agent to prevent the resin or epoxy from bonding with the liner . preferentially , however , a release agent 236 is coated on the metallic liner 214 to prevent the epoxy or resin from bonding to the liner , or the bond is broken by a controlled use of heat and pressure as opposed to the heat and pressure introduced during use . once several alternating groups of hoop wound fibers and axially laid fibers are applied to the metallic liner 214 , an overwrap 242 is placed about the composite / metallic gun barrel 210 . the overwrap 242 can be a knitted or woven cloth , a camouflage or decorative cloth , plastic shrink tube , or a helical graphite / epoxy outer layer overwrap . the overwrap 242 helps to protect the fibers 230a and 230b , and allows an aesthetically pleasing finish to be formed on the outside of the gun barrel 210 . referring now to fig4 there is shown a perspective view of a composite portion 330 of a gun barrel being formed about a mandrel 335 . rather than using a graphite tape , such as that shown in fig3 a single graphite thread 330a is wound about the fiberglass insulative layer 332 which is formed about the mandrel 335 . this is typically accomplished by placing the mandrel 335 on a lathe ( not shown ) or similar machine , applying the fiberglass layer 332 and then rotating the mandrel at a high rate of speed . the resin or epoxy coated graphite forms a hoop wound layer . longitudinal layers and additional hoop layers are applied to achieve a desired thickness . because the composite layer 330 will be removed after curing , a release layer 336 is typically applied to the mandrel 335 prior to applying the initial layer of fiberglass . those skilled in the art will be familiar with such materials . once removed from the mandrel 335 , the cured composite layer 330 and fiberglass 332 are slid over a metallic liner to form the barrel of a gun . using a composite layer which has been cured on a mandrel 335 is advantageous in that failure to properly coat the metallic liner with a release agent could result in the composite portion being attached at undesirable locations to the composite casing . this in turn may cause warping as discussed above . this concern is overcome when using the mandrel 335 , as the bond between the mandrel 335 and the fiberglass layer of the composite casing must be broken to remove the mandrel . the mandrel 335 is also easier to work with , especially when applying a single graphite thread , and the risk of damaging the thin walls of the first portion ( 14a in fig1 and 114a in fig2 ) is not present . an additional advantage of using the mandrel 335 is that it is substantially easier to apply a consistent , short bonding layer , such as bonding layer 138 in fig2 when the composite casing is formed prior to being placed about the metallic liner . if the composite casing is formed on the liner , the maker must be careful that the release agent remains uniform and only on the areas along which the interface ( 34 in fig1 and 134 in fig2 ) between the casing and the liner are to remain nonbonded . thus there is disclosed a substantially nonbonded composite / metallic gun barrel . by maintaining 50 percent or more of the length of the barrel in an nonbonded state , a considerable improvement is made in avoiding warping of the gun barrel . those skilled in the art will be familiar with numerous modifications which might be made to the present invention without departing from the scope or spirit of the same . the appended claims are intended to cover such modifications .	5
fig1 shows in a perspective view a part of a round disc - shaped record carrier 1 . the information plane 2 of this carrier in which a user can write information and read it afterwards is located on the upper side of the record carrier so that writing and reading is effected through the carrier substrate 3 by means of a write spot ws and a read spot rs , respectively . a previously provided servo - track 4 of which only a small part is shown in fig1 is present in the information plane 2 . by rotating , in the direction of the arrow 7 , the record carrier about a shaft 6 inserted through a central opening 5 in the carrier the spots can scan a revolution of the servo - track 4 . the entire spiral - shaped servo - track is scanned by a defined movement of the two spots in the radial direction . the write and read device has two radiation source units 10 and 11 supplying a write beam wb and a read beam rb , respectively . these beams are directed towards an objective system 15 by means of a reflector 14 which is adjustable , for example in the tangential and radial directions , and the objective system focuses the beam wb to a write spot ws and the beam rb to a read spot rs in the information surface . the beams wb and rb emitted by the radiation source units 10 and 11 are linearly and mutually perpendicularly polarized . a beam - splitter 13 , for example a partially transparent prism is arranged in the path of the beam rb , which prism reflects this beam to a polarisation - sensitive beam splitter 12 , for example in the form of a prism . this prism reflects both the beam rb from the radiation source unit and the beam rb &# 39 ; reflected by the information plane . the write beam wb is passed by the beam splitter 12 and traverses a highly selective λ / 4 plate 16 twice on its path to and from the information plane . λ is the wavelength of the beam wb . the plate 16 rotates the direction of polarisation of only the write beam through 90 ° so that the reflected beam wb &# 39 ; is reflected by the beam splitter 12 . the highly selective plate 16 does not have any influence on the direction of polarisation of the read beam rb . the beams wb &# 39 ; and rb &# 39 ; which are reflected by the beam splitter 12 and which have the same direction of polarisation are passed by the prism 13 to their associated detectors 22 and 23 . the beams wb &# 39 ; and rb &# 39 ; may be separated from each other by , for example the combination of a highly selective α / 2 - plate 1 , which rotates the direction of polarisation of one of the beams through 90 °, and a polarisation - sensitive beam separator 19 which substantially passes one of the beams , for example wb &# 39 ; and substantially reflects the other beam to the detectors 22 and 23 , respectively . wavelength - selective filters 20 and 21 may be arranged in front of the detectors , which filters prevent radiation of the write beam and the read beam from reaching the detector for the read beam and the write beam , respectively . the lens 17 focuses the parallel beams wb &# 39 ; and rb &# 39 ; on the detectors 22 and 23 . for further details about writing and reading with the device according to fig1 and about the servo - systems used for tracking and focusing reference is made to u . s . pat . no . 4 , 546 , 463 in which other embodiments of the write - read device based on the same principle are described . for a satisfactory operation of the device it is required for the beams entering the objective system to have a constant cross - section , in other words the radiation source units should supply beams which are constantly collimated independent of temperature variations . as is shown in fig2 each radiation source unit 10 and 11 comprises a holder 30 , for example of aluminium or stainless steel . this holder has an abutment 31 . a radiation source in the form of a diode laser 33 has a flange 34 whose top face engages the abutment 31 and whose side face engages the inner wall of the holder . the diode laser is fixed in the holder by means of the bent edges 32 . furthermore the holder comprises a collimator lens 37 which is arranged between the bent edges 40 and is fixed against the inner wall of the holder , for example by means of an adhesive . the holder may be closed by means of a transparent plate 41 . the radiation source unit may further have a cylindrical lens at the area of the plate 41 or between this plate and the radiation source for correction of possible astigmatism of the beam . the collimator lens is for example a planoconvex lens whose plane surface 38 faces the diode laser . it must be ensured that the distance between the surface 38 and the diode laser is such that the radiating surface 36 of the diode laser is located in the focal plane of the collimator lens . however , under the influence of temperature variations the holder may expand or shrink so that the distance between the radiating surface 36 and the surface 38 of the collimator lens changes , which results in the surface 36 no longer coinciding with the focal plane of the collimator lens and in the beam wb or rb emanating from this lens no longer being collimated . according to the invention the refractive index , the coefficient of expansion and the other lens parameters are chosen to be such that the length variation of the holder is compensated for . the condition under which this is effected will now be described with reference to fig3 . in this fig . f 1 is the object focus in which focus the radiating surface of the laser must be located . f is the focal length , or the distance between the focus f 1 and the principal plane h of the lens . f t is the co - called front focal length , that is to say the distance , measured along the optical axis 00 &# 39 ;, between the surface 38 of the lens and the focus f 1 . l h is the distance between the surface 38 and the principal plane h and d 1 is the axial thickness of the collimator lens . r 1 is the radius of curvature of the convex surface 39 of the lens . it is assumed that the lens is secured in the holder at the position of the surface 38 and that the radiation source is secured in the holder at the position of the radiating surface of this source . the expansion dl / dt = α 2 l of the holder portion having a length l between the said areas of fixation must then be equal to the change df t / dt · α 2 is the coefficient of expansion of the holder material . the focal length f of a planoconvex lens is given by ## equ9 ## in which n 1 is the refractive index of the lens material . for l h it holds that ## equ10 ## therefore it holds that ## equ11 ## in the case of temperature variations both the geometry of the lens , and hence the quantities r 1 and d 1 and the refractive index n 1 change so that ## equ12 ## by filling in ## equ13 ## with α 1 being the coefficient of expansion of the lens material , and ## equ14 ## equation ( 4 ) changes into ## equ15 ## in which α eq can be indicated as an equivalent coefficient of expansion , or in other words the change of the focal length per degree of temperature change due to changes within the optical system . according to the invention it is ensured that so that , if f t and l are equal α eq = α 2 . the radiation source which is used in the radiation source unit is preferably a diode laser , for example an algaas laser . for such a laser the wavelength λ of the emitted radiation can vary with the temperature . a great advantage of the present invention is that this variation can also be compensated for by taking this variation into account when choosing the parameters in equation ( 5 ). since the refractive index n 1 of the lens material depends on the wavelength of the radiation passing through the lens , dn 1 / dt in equation ( 5 ) must be replaced by ## equ16 ## in which the symbols ∂/∂ λ and ∂/∂ t denote the partial derivatives with respect to wavelength and temperature , respectively . according to the invention , for a radiation source unit having a radiation source whose wavelength depends on the temperature it holds that ## equ17 ## instead of a planoconvex lens , a lens having two curved refractive surfaces may be used alternatively as a collimator lens , for example a biconvex lens . fig4 shows a biconvex lens . as is known from the handbooks on optics it holds for the focal length f of a biconvex lens that : ## equ18 ## and the front focal length is given by : ## equ19 ## in which ## equ20 ## so that ## equ21 ## since d 1 and r 1 relate to the same material : ## equ22 ## so that for the second term on the right - hand side in ( 9 ) it holds that : ## equ23 ## consequently it holds that ## equ24 ## for the lens according to fig4 it also holds that ## equ25 ## so that ## equ26 ## since r 1 , r 2 and d 1 relate to the same material it holds that : ## equ27 ## so that : ## equ28 ## and hence : ## equ29 ## in this expression f 1 corresponds to f in the expression ( 2 ) for the planoconvex lens from which it can be derived that : ## equ30 ## so that ( 12 ) can be written as : ## equ31 ## and hence : ## equ32 ## filling in ( 10 ) and ( 15 ) and ( 9 ) results in : ## equ33 ## whose right - hand term can be arranged as : ## equ34 ## if a biconvex collimator lens in the radiation source unit is combined with a diode laser whose wavelength is temperature - dependent , dn 1 / dt in expression ( 17 ) must be replaced by ∂ n 1 /∂ λ ∂ λ /∂ t +∂ n 1 /∂ t so that : ## equ35 ## if in ( 18 ) r 2 is provided with a minus - sign , the condition for temperature compensation is obtained for a radiation source unit having a concave - convex collimator lens whose concave surface has a radius of curvature r 2 . fig5 shows diagrammatically a radiation source unit 50 which in combination with an objective system 51 and a built - in radiation - sensitive detection system 52 constitutes a read device which is particularly suitable for reading optical record carriers . for the operation of this device reference is made to the u . s . pat . no . 4 , 592 , 627 in which the device has been described in detail . in connection with the present invention it is only important that a beam - separating element , for example in the form of a partially transparent prism 53 is arranged between the diode laser 33 and the collimator lens 37 . this prism passes a part of the beam rb emitted by the diode laser to the record carrier 1 and reflects a part of the beam reflected by the information plane 2 to the radiation - sensitive detection system 52 . by arranging the prism in the radiation path the optical path length changes by ## equ36 ## in which d 3 is the thickness of the prism , measured along the optical axis 00 &# 39 ; and n 3 is the refractive index of the prism material . for the optical path length s between the radiating surface of the diode laser and the collimator lens 37 it now holds that : ## equ37 ## and for the change caused by temperature variations it holds that : ## equ38 ## hence ## equ39 ## if , as shown in fig5 the collimator lens is a planoconvex lens , the expression ( 5 ) can be filled in for df t / dt and ## equ40 ## if the collimator lens is a biconvex lens df t / dt must be replaced by the expression ( 17 ) so that : ## equ41 ## if the radiation source is a diode laser with a temperature - dependent wavelength , dn / dt in the expressions 21 and 22 must be replaced by ## equ42 ## if the collimator lens is a planoconvex lens , its convex surface preferably has an aspherical profile in order to correct for spherical aberrations . as described in the u . s . pat . no . 4 , 592 , 627 and as shown in fig5 the aspherical surface may be in the form of an aspherical outer profile 57 of a thin layer of transparent synthetic material 56 which is provided on the convex surface 55 of the lens 37 . in the afore - mentioned expressions for the equivalent coefficient of expansion there are no quantities which relate to this synthetic material layer because , due to the small thickness of the layer , the temperature effects in the layer hardly have any influence on the focal length of the overall optical system within the holder . certain types of diode lasers emit an astigmatic beam , i . e . a beam which , viewed in two mutually perpendicular planes , has two axially shifted points of convergence . when using this type of laser in an optical radiation source unit , a cylindrical lens is generally used to render the beam stigmatic . this cylindrical lens may be integrated with the collimator lens by superposing the required cylindrical shape on the surface of the collimator lens facing the diode laser . in that case the above given expressions for the equivalent coefficient of expansion remain valid because the radius of curvature of the said cylindrical lens is of the order of a hundred times that of the convex surface of the collimator lens so that the position of the focus of the optical system within the holder is substantially uninfluenced by the presence of the cylindrical lens and by variations in the behaviour of this lens . it has been assumed in the foregoing that the radiation source in the holder is secured at the position of the radiating surface and that the collimator lens is secured at the position of the point of intersection of the surface 38 and the optical axis . if the fixations are located elsewhere , the coefficient of expansion of the portions of the holder between the points of fixation and the axial positions of the radiating surface of the radiation source and the surface of the collimator lens facing the radiation source must be taken into account , as is known from , for example german patent application no . 2 , 830 , 341 . the influence of the changes of these portions can be calculated and the above given conditions for the temperature compensation can then be corrected . a radiation source unit supplying a collimated beam can also be used in a so - called target - seeking device with which a target can be traced and / or followed by means of a beam emitted by the radiation source unit and received by a radiation - sensitive detector . the temperature compensation according to the invention can also be used in this device . the invention is not limited to a radiation source unit but may be generally applied in optical systems whose optical behaviour should not be influenced by a change of the holder accommodating this system . a system which must have a constant factor of magnification such as a telecentric system shown diagrammatically in fig6 may be mentioned as an example . a telecentric lens system comprises a number of , for example two lenses , l 3 and l 4 in fig6 with given powers and mutual distances . if the centre of the so - called aperture stop aa &# 39 ; of this system is located in the focus f 4 of the lens l 4 , the exit pupil of the system , i . e . the image of the aperture stop formed by the lens l 4 is located at infinity and the system is telecentric on the image side . this means that the chief ray h of each beam b traversing the system is perpendicularly incident on the image plane ip . if the aperture stop is in the focus f 3 of the lens l 3 , the entrance pupil is located at infinity and the system is telecentric on the object side , op &# 39 ; is the object plane which is conjugated to the image plane ip . in a double telecentric system as is shown in fig6 f 3 and f 4 both coincide with the centre of the aperture stop . according to the invention the variation of the distance between the lenses which is caused by a temperature - dependent variation in length of the holder h 1 can be compensated by adapting the coefficients of expansion and the refractive indices of the lenses to the coefficient of expansion of the holder . analogously as described above for a radiation source unit , the condition at which the temperature compensation occurs can be derived for a telecentric system .	6
the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains . although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , suitable methods and materials are described below . any publications , patent applications , patents , or other references mentioned herein are incorporated by reference in their entirety . in case of conflict , the present specification , including any definitions , will control . in addition , the materials , methods and examples given are illustrative in nature only and not intended to be limiting . accordingly , this invention may be embodied in many different forms and should not be construed as limited to the illustrated embodiments set forth herein . rather , these illustrated embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . other features and advantages of the invention will be apparent from the following detailed description , and from the claims . in this disclosure , n 1 - acetylspermine , spermine , and spermidine have been identified as potential biomarkers for inflammatory bowel disease ( ibd ). of these three , n 1 - acetylspermine and spermidine were preferred as markers . in patients with active ibd the levels of these polyamines were significantly higher than control healthy tissues . in this regard , these compounds could be useful as medical diagnostic agents for determining the severity of ibd , its initial diagnosis , its current state of severity or its transition into colon cancer and its elevated levels represent a metabolic endpoint for colon cancer diagnosis . as shown in fig2 , our hypothesis in uc is that : i ) high polyamine import activity may contribute to high intracellular polyamine content within uc cells , ii ) ingestion of these cells by macrophages leads to high intra - macrophage polyamine concentrations , and iii ) which would then result in a reduced immune response and disease progression via reduced macrophage phagocytosis activity 10 , 11 and presumably reduced inos translation . 5 a first step in support of this hypothesis is to demonstrate high polyamine content in ibd tissues . thus , the aim of our study was to test this hypothesis by first determining whether the polyamine content in inflamed tissues of patients with ibd is abnormal . forty nine tissue samples from both uc and cd patients and seven control samples were screened for polyamine content using a n - dansylation and hplc protocol . 14 significantly higher levels of spermidine ( spd ), spermine ( spm ) and n 1 - acetylated spermine ( nacspm , a spermine metabolite ) were observed in patients with active inflammatory bowel disease ( ibd ). further analyses were consistent with significantly higher levels of spd in the sigmoid tissues from both active uc and crohns as compared to inactive disease or healthy controls . in summary , spermidine levels are elevated in the sigmoid mucosa of active ibd patients . while both cd and uc are considered forms of ibd , their causes and disease progression are different . for example , one of the current hypotheses regarding cd etiology is that a luminal antigen may contribute to the disease state via adoptive immunity resulting in tissue damage . indeed , defective innate immunity via nod - 2 and tlr mutations , have been shown to be relevant in cd but not in uc . 12 , 13 in summary , although genetic susceptibility , immunodeficiency ( innate and specific ), nutrition and the enteric microfloral environment have been suggested as potential etiologies of cd , 15 the etiology of uc is unknown . as mentioned above , the hypothesis relies on the presence of ibd tissues with high polyamine content . the purpose of this study was to survey both uc and cd tissues to see if there were statistically significant higher levels of polyamines in particular tissue types . in addition , we hoped to identify potential polyamine markers for these disease states . typically , the patient biopsy tissues are homogenized and the polyamine contents are separated from the protein components . the protein content is measured by the lowry method and provides the total mg of protein present . the polyamine fraction is then dansylated and extracted into an organic solvent , which is removed and replaced with acetonitrile and injected into an hplc , which separates out the respective dansylated polyamine compounds . the area under the curve is converted to moles of polyamine using calibration curves generated from pure samples . spermidine , spermine and n 1 - acetylspermine are quantified as their dansylated derivatives in nmoles of compound . the final polyamine quantification is listed as nmol polyamine / mg protein . saline ( 50 μl ) and perchloric acid buffer ( 100 μl )) were added to the biopsy sample and the mixture was homogenized with the help of a sonic dismembrator at speed of 5 for 10 seconds . the mixture was allowed to settle down and then additional perchloric acid buffer ( 50 μl )) was added . the mixture was vortexed and centrifuged at 12000 rpm at 23 ° c . for 5 minutes . the pellet and supernatant were separated . the supernatant was used for polyamine content determination via the n - dansylation procedure and the solid pellet was used for protein determination . the protein content of the remaining pellets were determined by the method of lowry 16 after dissolution in 0 . 1n naoh . the results were expressed in mg of protein . the respective supernatants , which were collected above , were left in a freezer overnight , and then thawed to room temperature . to this solution , the internal standard ( 1 , 6 - diaminohexane ( std , 5 in fig1 ): 30 μl of 1 . 43 × 10 − 4 m ) was added followed by the addition of aq . na 2 co 3 ( 200 μl of 1m aqueous solution / 100 μl ), and dansyl chloride ( 400 μl of a 5 mg / ml solution / 100 μl ). the reaction mixture was shaken on a rotary shaker at room temperature for 2 hours . a 1m proline solution ( 100 μl per 100 μl ) was added and again the reaction mixture was shaken on a rotary shaker for 1 hr . chloroform ( 2 ml ) was added and the sample was shaken and the layers allowed to separate . the top water portion was removed by pipette and the chloroform layer was saved . the chloroform layer (˜ 2 ml ) was concentrated . the residue was dissolved in methanol ( 250 μl ). each sample was injected as its respective methanol solution ( 20 μl ) and analyzed by hplc using calibration curves determined with independently synthesized n - dansylated standards to provide the nmoles of each n - dansylated polyamine derivative . the hplc polyamine quantification ( nmol / mg protein ) results are listed in table 1 . tissue biopsies used for polyamine extraction were obtained from rush university gasteroenterology tissue repository . this repository stores 6000 plus samples collected from ibd patients at − 70 ° c . relevant clinical data for these samples is stored in a database . for the purposes of this study , we used snap frozen endoscopic biopsies from 30 uc , 28 crohns and 7 healthy subjects . control subjects were those , who underwent surveillance colonoscopy and did not show any pathology during colonoscopy . for ibd patients , diagnosis was ascertained based on clinical data , endoscopy findings and histology findings . in ibd patients , biopsies were taken from inflammed and / or non - inflammed areas as indicated and appropriately labeled . patients were considered to have active disease , if they were symptomatically positive , otherwise they were considered inactive . blinded tissue samples were shipped to the university of central florida ( ucf ) in dry ice for polyamine extraction . the study was approved by both the ucf and rush university research and clinical affairs irb committees . to evaluate the degree of inflammation , the weiss endoscopic index was used . 0 = no signs of inflammation , 1 = low degree of inflammation ( increased granularity and friability of mucosa in uc and single small apthous lesion in crohns ), 2 = moderate inflammation ( mucous membranes , spontaneous bleeding and small ulcers in uc , multiple apthous lesions , and small ulcers in crohns ). 3 = severe inflammation ( large ulcers in uc and large ulcerous lesions in crohns ). ms excel and sas v8 . 2 was used to perform anova ( analysis of variance ) and fisher &# 39 ; s lsd test . data is expressed as means +/− sem . differences were considered significant when p & lt ; 0 . 05 . each of the n - dansylated derivatives shown in fig3 were synthesized , purified and characterized ( see experimental ). a modified hplc protocol with fluorescence detection was developed to separate and quantify these nine derivatives . since 6a and 7a were positional isomers , they are difficult to resolve in most cases . since their respective molar response was very similar , the area % s of these two merged peaks were combined and listed tallied as ‘ 6a + 7a ’ and represents the total mono - n - acetylspermidine population ( i . e ., 6 and 7 ). technically speaking , the hplc method quantifies each of the n - dansylated polyamine derivatives ( e . g ., 1a ). however , the number of nmoles of the n - dansyl derivative ( e . g ., 1a ) is directly equal to the number of nmoles of free polyamine from which it was derived ( i . e ., 1 ) because the yield in the n - dansylation reactions was nearly quantitative (− 98 %). therefore , discussions and comparisons pertaining to the n - dansylated derivatives ( 1a - 9a ) directly apply to their respective free polyamine forms as well ( 1 - 9 ). a sample hplc trace is shown in fig4 . due to their direct molar relationship and to simplify the discussion , the measured hplc levels will be referred to as their non - dansylated free polyamine forms , although technically the measured values shown in the tables are from the respective n - dansylated derivatives . cadaverine ( cad , 4 ) exists in most bacteria and is synthesized by the degradation of l - lysine by lysine decarboxylase . 17 , 18 to the best of our knowledge , cadaverine 4 is not synthesized in human cells . as such , the detection of cadaverine 4 indicates the presence of bacterial contaminants in the tissue samples collected , even though the tissues were washed extensively before analysis . therefore , cadaverine provides an important cross - check and control for bacterial contributions to the polyamine pools . of the initial 58 samples collected , nine samples had cadaverine 4 present and were removed from the study . this was an essential step for our subsequent analyses as gut flora also produce polyamines and may have skewed the results if these samples had been included . in short , each of the samples presented in the tables and discussed in this report had no detectable cadaverine 4 present ( as measured by our hplc protocol ) and were deemed ‘ bacteria - free ’. in this regard , our conclusions are from the human tissue analyzed . the first experiments determined the baseline pa levels in healthy ileum and sigmoid tissues . as shown in table 1 , no significant differences were observed in the small and large bowel samples collected . as expected , the pattern of pa levels in these two sites were very similar with cnacspd ( combination of 6 + 7 ) being the highest and with nacspm ( 8 ) being undetectable in these healthy samples . table 1 shows the amount of polyamines ( in nmoles / mg of protein ) found in each of the samples tested . armed with the above controls , we determined the polyamine levels of the ileal and sigmoid mucosal biopsies obtained during endoscopic procedures from healthy subjects and patients with active and inactive ibd ( ulcerative colitis and crohn &# 39 ; s disease ). the seven control samples in table 1 were averaged and combined to provide the control values in table 2 for comparison to the average polyamine ( pa ) levels measured in the collected ibd samples . as such , table 2 gives an overview of healthy vs . ibd associated pa levels . as shown in table 2 , the ibd polyamine levels for 1 , 2 , 3 and 6 + 7 were not statistically different from the healthy samples with the lone exception of 8 , i . e ., n 1 - acetylated spermine . as will be discussed below , compound 8 is involved in intracellular polyamine catabolism . intracellular polyamine levels are tightly regulated by a negative feedback control mechanism involving a balance between pa biosynthesis and catabolism . for example , spermine 3 is converted into acetyl derivative 8 by the action of ssat ( spermine - spermidine acetyl transferase ). in turn , 8 is converted to spermidine 2 via the action of polyamine oxidase . in this regard , 8 represents an important metabolite generated by cells in response to high intracellular spermine levels and / or high ssat activity . the fact that this compound was undetected in healthy tissues suggests that 8 may represent a new biomarker for tracking ibd activity and progression . to see if active , ongoing inflammation affected tissue pa levels , we compared values from symptomatic patients with active ibd , asymptomatic inactive ibd ( based on standard clinical disease activity indices ) and controls . as shown in table 3 and fig1 , tissue levels of spd 2 , spm 3 and nacspm 8 were significantly elevated in patients with active ibd compared to inactive ibd and controls . tissue levels of put 1 and cnacspd ( 6 + 7 ) were not significantly different among three groups ( fig1 ). there was no significant differences in the mean pa levels between patients with inactive ibd and the controls . this early observation suggested that elevated tissue levels of 2 , 3 and 8 may be due to active inflammation and may not be specific for ibd per se . in order to determine whether elevated tissue polyamines in symptomatic patients with active ibd represent tissue injury , we used endoscopy as an assessment tool to assign tissue samples as being “ involved ” ( injured ) vs . “ non - involved ” ( normal ), regardless of whether patients had clinically active disease or not . in this manner , we compared polyamine ( pa ) levels in tissues , which appeared via endoscopy to be injured ( involved ) tissues , to pa levels in tissues which appeared to be normal mucosa . pa levels did not correlate with tissue ‘ involvement ’ in the terminal ileum samples tested . as shown in fig2 , spd levels in ‘ involved sigmoid ’ were significantly higher than in ‘ non involved sigmoid ’ ( fig2 : spd 4 . 59 ± 0 . 58 vs . 2 . 68 ± 0 . 33 nmol / mg protein ). however , the spd level was not statistically higher than the control value when one takes into account the error of the measurement ( fig2 ). nevertheless , this finding indicated that spd levels in sigmoid biopsies may provide an additional indication of active ibd disease and correlated with the endoscopic indicators of inflammation . the results depicted in fig1 and 2 suggest that spermidine ( spd ) levels were increased in symptomatic patients with active ibd and more specifically in the macroscopically -‘ involved ’ mucosa . to see if the combination of clinical activity and endoscopic ‘ involvement ’ correlated with pa levels , we compared the pa levels in endoscopically ‘ involved ’ samples to the levels in ‘ non - involved ’ mucosa in patients with active and inactive ibd . these findings are listed in table 4 . an analysis of variance showed significantly raised spd 2 , spm 3 and nacspm 8 levels in the active “ non - involved ” ibd group as compared to inactive “ non - involved ” ibd group ( table 4 ). this result with the ‘ non - involved ’ samples ( which appear normal via endoscopy ) indicates that increased levels of 2 , 3 and 8 track well with the clinical activity of ibd even when the biopsy site appears to be normal . in short , tissue samples , which appeared endoscopically normal ( non - involved ) from patients with clinically - active ibd , had statistically significant higher levels of these three polyamines ( 2 , 3 and 8 ). a comparison of active ‘ involved ’ ibd versus inactive ‘ involved ’ ibd also showed significantly higher levels of 2 ( 4 . 64 ± 0 . 41 vs . 2 . 81 ± 0 . 77 nmol / mg protein ) for the clinically - active ibd subjects over their clinically inactive counterparts , respectively . if inflammation ( or the degree of ‘ involvement ’) alone explained the findings , then one would have expected these latter two “ involved ” entries to have similar spd levels . clearly , this was not the case . the significant difference observed suggested that the ‘ involvement ’ or inflammation alone did not explain the high spd levels . overall , the clinically - active ibd samples consistently had higher levels of spd than the clinically - inactive group . collectively , these findings support the conclusion that tissue spd levels are significantly increased in clinically - active ibd patients regardless of whether the biopsy site is visibly injured or visibly assigned as normal colonic mucosa . to this end , we initially compared the tissue pa levels in patients with uc and patients with cd to values from healthy subjects and then compared the values between uc and cd . as expected , the polyamine levels in non - involved ileum from uc patients were similar to normal ileum from healthy subjects ( table 5 ). moreover , there was no significant difference in the mean pa levels between inactive uc and the sigmoid control ( table 6 and fig3 a ). in contrast , the mean spd levels were significantly higher in active uc compared to inactive uc and controls ( table 6 and fig3 a ). the tissue levels of the other polyamines in patients with active uc were similar to the control group ( table 6 ). however , it is interesting to note that compound 8 was detected in the active uc samples but not in the inactive uc tissues or the sigmoid control . table 6 polyamine levels in the sigmoid mucosa of healthy subjects and patients with ulcerative colitis ( nmoles / mg protein ) activity n put ( 1 ) spd ( 2 ) spm ( 3 ) cnacspd ( 6 + 7 ) nacspm ( 8 ) sigmoid control 4 0 . 53 ± 0 . 53 3 . 06 ± 1 . 20 5 . 46 ± 2 . 05 12 . 51 ± 6 . 28 0 . 00 ± 0 . 00 inactive uc 12 0 . 83 ± 0 . 76 2 . 59 ± 0 . 45 4 . 67 ± 0 . 66 11 . 35 ± 4 . 52 0 . 00 ± 0 . 00 active uc 6 0 . 44 ± 0 . 20 4 . 64 ± 0 . 62 5 . 97 ± 0 . 64 8 . 73 ± 1 . 62 0 . 09 ± 0 . 09 indicates a statistically significant difference from inactive uc with p & lt ; 0 . 05 a further analysis of variance for uc based on endoscopic involvement did not show any significant differences in the pa levels ( fig3 b ). regardless of whether the biopsy site was endoscopically assigned as ‘ involved ’ or ‘ non - involved ,’ the polyamine levels in the ileum of cd patients were similar to controls ( fig4 a ). there were no statistically significant trends observed in fig4 a . however , when the samples were assessed via their clinical activity ( i . e . active inflammation ) spd and spm levels in ileal tissue of clinically - active cd patients were significantly higher than those of inactive cd patients and the ileal control as shown in fig4 b . this indicates that spd and spm levels are increased in the inflamed injured mucosa . the other pa levels in the active heal samples ( 1 , 6 + 7 , and 8 ) were not statistically different from the ileal controls ( fig4 b ). sigmoid cd . spd levels in the ‘ involved ’ sigmoid tissue of cd patients were higher than the corresponding ‘ non - involved ’ sigmoid tissue ( fig5 a ). however , the spd level was not significantly different than the sigmoid control ( fig5 a ). of particular note was that 8 was detected in the involved cd sigmoid tissue and not in the sigmoid control ( fig5 a ). when the samples were assessed via their clinical activity ( i . e . active inflammation ) again spd was statistically significantly higher in active cd tissue than in the inactive cd tissues . however , the spd level in active cd tissue was not significantly different than the sigmoid control ( fig5 b ). the other pa levels in active crohn &# 39 ; s patients were similar to the values obtained from healthy controls and inactive patients with the exception of 8 . compound 8 was detected in active cd tissue and not in the control or inactive cd tissue ( fig5 b ). lastly , we investigated whether there was a difference between cd and uc in tissue polyamines levels . to determine whether changes in tissue pa levels noted in ibd patients were specific for the types of ibd , we compared the tissue values in uc and cd patients . as depicted in table 7a - c , there were no significant differences in polyamine levels between tissues from uc and crohn &# 39 ; s patients with the exception of the observed higher spd 2 and cnacspd ( 6 + 7 ) levels in inactive uc tissues over the inactive crohns tissue ( table 7b ). ** denotes a statistically significant difference from crohns inactive group with p & lt ; 0 . 05 table 7c active crohns vs active uc ( nmoles / mg protein ) group n put spd spm cnacspd nacspm crohns active 9 0 . 78 +/− 0 . 32 3 . 98 +/− 0 . 61 7 . 15 +/− 1 . 00 8 . 25 +/− 2 . 38 0 . 17 +/− 0 . 11 uc active 6 0 . 44 +/− 0 . 20 4 . 64 +/− 0 . 62 5 . 97 +/− 0 . 64 8 . 73 +/− 1 . 62 0 . 09 +/− 0 . 09 in a comparison between ibd vs healthy tissues , the level of compound 8 was significantly higher in ibd tissues and was not detected in the control healthy tissues . when the ibd tissues were segregated into clinically active and inactive categories , the ibd active tissues revealed increased levels of spd 2 , spm 3 and nacspm 8 . clinical activity tracked well with increased spd levels regardless of whether the tissue appeared inflamed or normal by endoscopy ( table 4 ). active uc gave statistically higher spd levels than either inactive uc tissue or the sigmoid control ( table 6 ). compound 8 was detected in active uc tissues and not in the control samples . active cd gave higher spd and spm levels than inactive cd tissues and the ileal control . the cd sigmoid results were equivocal except for the fact that 8 was detected in the involved sigmoid but not in the control . no difference between uc and cd samples were observed except that higher levels of spd and nacspd ( 6 + 7 ) were noted in the inactive uc over the inactive cd tissues ( table 7b ). in summary , both spd 2 and compound 8 represent useful tools to track ibd progression especially in the ileal samples of cd patients and the colonic samples of uc patients . polyamine metabolism . polyamine levels are tightly regulated in cells and there is an exquisite balance between polyamine biosynthesis via odc and polyamine catabolism via ssat and pao action . 18 - 21 as shown in scheme 1 , polyamine biosynthesis starts primarily with the decarboxylation of ornithine to form putrescine 1 . 20 spermidine synthase then aminopropylates one end of 1 to form spermidine 2 . likewise , spermine synthase then aminopropylates the butylamino end of 2 to form spermine 3 . in this stepwise manner , cells build the higher polyamines 2 and 3 from their putrescine precursor , 1 . 20 note : the aminopropylation fragment is donated by decarboxylated s - adenosyl - methionine ( dcsam ), which is generated by the action of adenosyl methionine decarboxylase ( samdc ) on s - adenosyl - methionine ( sam ). 20 polyamine catabolism or breakdown mainly occurs by the action of spermidine / spermine acetyl transferase ( ssat ), which n - acetylates one of the terminal ends of the polyamine chain . 20 for example , the action of ssat on spermidine 2 results in 6 , whereas the action of ssat on spermine 3 results in 8 . the acetylated adducts 6 and 8 are excreted by the cell or oxidized by polyamine oxidase ( pao ), a flavin adenine dinucleotide - dependent enzyme into putrescine 1 and spermidine 2 , respectively . the other oxidation byproducts are hydrogen peroxide 10 and 3 - acetaminopropanol 11 . 20 therefore , high intracellular levels of spm 3 would be converted to nacspm 8 by ssat and eventually converted to spd 2 via pao activity . in this regard , this study is the first observation of both high spd 2 and high n 1 - acetylspermine , nacspm 8 in uc tissues . the fact that the levels of 2 and 8 are significantly higher than the controls supports our premise of high intracellular polyamine levels . the current spd results are consistent with those observed by obayashi , who also noted high spd levels in uc patients . 21 moreover , obayashi concluded that the high spermidine levels in cells were “ not due to changes in the synthesis or degradation of polyamines ” but due to “ increased exogenous spermidine uptake ”. 21 high polyamine uptake via pat would raise intracellular polyamine levels . however , weiss et al using isolated colonic epithelial cells ( cecs ) from patients with severe ulcerative colitis observed a lack of the anti - inflammatory polyamine , spermine 3 . 22 weiss also observed increased levels of spermidine and n 8 - acetylspermidine 7 and rationalized the findings by stating that the increased levels may be due to increased uptake and metabolism due to accelerated proliferation of cecs . the current findings identified 8 as another potential marker for this disease and may explain the lack of 3 in weiss &# 39 ; study . hypothetically , if polyamine metabolism ( i . e ., ssat activity ) is high in uc tissues then 3 would be converted to 8 , a spermine metabolite ( scheme 1 ). putting these observations together , high pat activity leads to high levels of spd in uc tissues . ingestion of these polyamine - rich cells by macrophages reduces their phagocytotic ability and facilitates disease progression ( fig2 ). macrophages . macrophages are derived from specific white blood cells called monocytes . 10 , 11 monocytes and macrophages are phagocytes , which engulf and digest pathogens and rouge cells present in tissues . they provide innate immunity and can also be involved in specific cell - mediated defense . unlike the early responding neutrophils , which have a short life span ( days ), macrophages can live for months ( to years ) and are attracted to damaged tissue via chemotaxis ( e . g ., via chemical attractants such as histamine and released cytokines ). a macrophage ingests its target via formation of an intracellular compartment known as a phagosome . the phagosome then fuses with a lysosome , which uses digestive enzymes to destroy the pathogen . after digestion , a common antigen found on the surface of the pathogen will be positioned on the surface of the macrophage as a mhc class ii complex . even though previous authors have demonstrated the relationship between macrophages and polyamines , 10 , 11 further studies are needed to see if high levels of spermidine 2 ( or n - acetylated spermine 8 ) in uc tissues causes defective macrophage function in uc patients . although not obtained in uc patients per se , there are several observations , which support our premise . first , bulychev et al have already demonstrated that spermidine 2 can alter the structure and lower the phagocytotic activity of aveolar macrophages . 11 second , high spermidine levels have been observed in ibd - related macrophages and monocytes . 23 specifically , initial results revealed high spd levels in crohns mono - nuclear cells ( mncs ) in support of this premise . moreover , macrophages isolated from crohns patients had lowered phagocytotic activity . 23 lastly , as shown in table 8 , mncs were isolated from the blood of crohns patients and healthy subjects and the levels of spd and spm were determined by the hplc protocol . indeed , our data revealed high spermidine ( spd ) levels in the circulating mononuclear cells of crohns patients . a related finding was also found by obayashi in the mucosa of active ulcerative colitis ( uc ) patients . 21 collectively , these observations indicate that polyamine metabolism and transport may be involved in uc progression ( and possibly ibd in general ). indeed , the high polyamine content of inflamed ibd tissues ( e . g . 2 ) may result in a reduced innate immune response by limiting the phagocytotic activity of circulating macrophages . while more work is needed in this area , the relationship between polyamines , inflammation and ibd continues to an area ripe for investigation . 20 once confirmed , the ibd community will at last have a possible etiology for uc . moreover , if polyamine transport is the cause of high intracellular polyamine levels , then pat inhibitors 24 and special diets 25 may offer a novel therapy / treatment for uc patients . in summary , the findings that both n - acetylated spermine 8 and spermidine 2 are elevated in uc tissues suggest not only a potential new biomarker for uc ( e . g ., 8 ), but also ‘ earmarks ’ the role of polyamine metabolism in ibd progression for future study . the possibility that the polyamine metabolites themselves ( 8 and 9 ) could be diagnostic agents , which identify the conversion of ulcerative colitis tissue into colon cancer is most provocative . the fact that the di - acetylated spermine 9 is a known biomarker for colon cancer 6 - 9 suggests that elevated levels of its immediate precursor , the monoacetylated spermine 8 , may be a potential predictor of the ‘ cancer transition ’ ( fig6 ). the fact that 8 is elevated in uc , a disease known to eventually convert to colon cancer , may be more than a remarkable coincidence . indeed , future studies will pursue this intriguing possibility . accordingly , in the drawings and specification there have been disclosed typical preferred embodiments of the invention and although specific terms may have been employed , the terms are used in a descriptive sense only and not for purposes of limitation . the invention has been described in considerable detail with specific reference to these illustrated embodiments . it will be apparent , however , that various modifications and changes can be made within the spirit and scope of the invention as described in the foregoing specification and as defined in the appended claims . 1 . a ) tabor , c . w . ; tabor , h . polyamines . annu . rev . biochem . 1976 , 45 , 285 ; b ) pegg , a . e . biochem . j . 1986 , 234 , 249 ; c ) seiler , n ., dezeure , f . polyamine transport in mammalian cells . int . j . biochem . 1990 , 22 , 211 - 218 . 2 . a ) aikens , d . ; bunce , s . ; onasch . f . ; parker , iii , r . ; hurwitz , c . ; clemans , the interactions between nucleic acids and polyamines ii . protonation constants and 13 c nmr chemical shift assignments of spermidine , spermine and homologs . biophys . chem . 1983 , 17 , 67 - 74 . b ) onasch , f . ; aikens , d . ; bunce , s . ; schwartz , h . ; nairn , d . ; hurwitz , c . the interactions between nucleic acids and polyamines iii . microscopic protonation constants of spermidine . biophys . chem . 1984 , 19 , 245 - 253 . 3 . gardner , r . a . ; delcros , j .- g . ; konate , f . breitbeil iii , f . ; martin , b . ; sigman , m . ; huang , m . ; phanstiel iv , o . n 1 - substituent effects in the selective delviery of polyamine conjugates into cells containing active polyamine transporters . j . med . chem . 2004 , 47 , 6055 - 6069 . 4 . seiler , n . ; delcros , j .- g . ; moulinoux , j . p . polyamine transport in mammalian cells . an update . int . j . biochem . cell biol . 1996 , 28 , 843 - 861 . 5 . françoise i . bussière , rupesh chaturvedi , yulan cheng , alain p . gobert , mohammad asim , darren r . blumberg , hangxiu xu , preston y . kim , amy hacker ∥, robert a . casero , jr . and keith t . wilson , spermine causes loss of innate immune response to helicobacter pylori by inhibition of inducible nitric - oxide synthase translation . j . biol . chem . 2005 , 280 , 2409 - 2412 . 6 . kawakita , m . ; hiramatsu , k . diacetylated derivatives of spermine and spermidine as novel promising tumor markers . j . biochem . 2006 , 139 , 315 - 322 . 7 . hiramatsu , k . ; takahashi , k . ; yamaguchi , t . ; matsumoto , h . ; miyamoto , h . ; tanaka , s . ; tanaka , c . ; tamaori , y . ; imajo , m . ; kawaguchi , m . ; toi , m . ; mori , t . ; kawakita , m . n 1 , n 12 diacetylspermine as a sensitive and specific novel marker for early and late stage colorectal and breast cancers . clin cancer res . 2005 , 11 , 2986 - 2990 . 8 . hiramatsu , k . ; sugimoto , m . ; kamei , s . ; hoshino , m . ; kinoshita , k . ; iwasaki , k . ; kawakita , m . diagnostic and prognostic usefulness of n 1 , n 8 - diacetylspermidine and n 1 , n 12 - diacetylspermine in urine as novel markers of malignancy . j . cancer res . clin . oncol . 1997 , 123 , 539 - 545 . 9 . sugimoto , m . ; hiramatsu , k . ; kamei , s . ; kinoshita , k . ; hoshino , m . ; iwasaki , k . ; kawakita , m . significance of urinary n 1 , n 8 - diacetylspermidine and n 1 , n 12 - diacetylspermine as indicators of neoplastic diseases . j . cancer res . clin . oncol . 1995 , 121 , 317 - 319 . 10 . zhang , m . ; borovikova , l . v . ; wang , h . ; metz , c . ; tracey , k . j . spermine inhibition of monocyte activation and inflammation . mol . med . 1999 , 5 , no . 9 , 595 - 605 . 11 . bulychev , a . g . ; johansson , a . ; lundborg , m . ; camner , p . ; afzelius , b . a . effects of spermidine on function and ultrastructure of aveolar macrophages . exp . mol . pathol . 1994 , 60 , no . 1 , 52 - 59 . 12 . a ) hugot , j . p . ; zouali , h . ; lesage , s . lessons to be learned from the nod2 gene in crohn &# 39 ; s disease . eur . j . gastroenterol . hepatol . 2003 , 15 , 593 - 597 ; b ) tamboli , c . p . ; cortot , a . ; colombel , j . f . what are the major arguments in favour of the genetic susceptibility for inflammatory bowel disease ? eur . j . gastroenterol . hepatol . 2003 , 15 , 587 - 592 . c ) ogura , y . ; bonen , d . k . ; inohara . n . ; nicolae , d . l . ; chen , f . f . ; ramos , r . ; britton , h . ; moran , t . ; karaliuskas , r . ; duerr , r . h . ; achkar , j .- p . ; brant , s . r . ; bayless , t . m . ; kirschner , b . s . ; hanauer , s . b . ; nunez , g . ; cho , j . h . a frameshift mutation in nod2 associated with susceptibility to crohn &# 39 ; s disease . nature 2001 , 411 , 603 - 606 . 13 . moncada , d . m . ; kammanadiminti , s . j . ; chadee , k . mucin and toll - like receptors in host defense against intestinal parasites . trends in parasitol . 2003 , 19 , 305 - 311 . 14 . a ) bergeron , r . j . ; mcmanis , j . s . ; liu , c . z . ; feng , y . ; weimar , w . r . ; luchetta , g . r . ; wu , q . ; ortiz - ocasio , j . ; vinson , j . r . t . ; kramer , d . ; porter , c . anitproliferative proerties of polyamine analogues : a structure - activity study . j . med . chem . 1994 , 37 . 3464 - 3476 ; b ) bergeron , r . j . ; feng , y . ; weimar , w . r . ; mcmanis , j . s . ; dimova , h . ; porter , carl ; raisler , b . ; phanstiel , o . a comparison of structure - activity relationships between spermidine and spermine analogue antineoplastics . j . med . chem . 1997 , 40 , 1475 - 1494 . 15 . a ) sartor , r . b . innate immunity in the pathogenesis and therapy of ibd . j . gastroenterol . 2003 , 38 , 43 - 47 . ; b ) fellerman , k . ; wehkamp , j . ; herrlinger , k . r . ; stange , e . f . crohn &# 39 ; s disease : a defensin deficiency syndrome ? eur . j . gastroenterol . hepatol . 2003 , 15 , 627 - 634 . ; c ) folwaczny , c . ; glas , j ; torok , h . p . crohn &# 39 ; s disease : an immunodeficiency ? eur . j . gastroenterol . hepatol . 2003 , 15 , 621 - 626 . ; d ) cashman , k . d . ; shanahan , f . is nutrition an aetiological factor for inflammatory bowel disease ? eur . j . gastroenterol . hepatol . 2003 . 15 , 607 - 613 . ; e ) rath , h . c . the role of endogenous bacterial flora : bystander or the necessary prerequisite ? eur . j . gastroenterol . hepatol . 2003 , 15 , 615 - 620 . 16 . lowry . o . h . ; rosenbraugh , n . j . ; farr , a . l . ; randall , r . j . ; protein measurement with the folin phenol reagent . j . biol . chem . 1951 , 193 , 265 - 275 . 17 . takatsuka , y . ; yamaguchi , y . ; ono , m . ; kamio , y . gene cloning and molecular characterization of lysine decarboxylase from selenomonas ruminantium delineate its evolutionary relationship to ornithine decarboxylases from eukaryotes . j . bacterial . 2000 , 182 . no . 23 , 6732 - 6741 . 18 . yamaguchi , y . ; takatsuka , y . ; matsufuji , s . ; murakami , y . ; kamio , y . characterization of a counterpart to mammalian ornithine decarboxylase antizyme in prokaryotes . j . biol . chem . 2006 , 281 , no . 7 , 3995 - 4001 . 19 . ha , h . c . ; woster , p . m . ; yager , j . d . ; casero , jr ., r . a . the role of polyamine catabolism in polyamine analogue - induced programmed cell death . proc natl acad sci usa . 1997 , 94 , 11557 - 11562 . 20 . peulen , o . ; deloyer , p . ; deville , c . ; dandrifosse , g . polyamines in gut inflammation and allergy . curr . med . chem .— anti - inflammatory & amp ; allergy agents 2004 , 3 , 1 - 8 . 21 . obayashi , m . ; matsui - yuasa , i . ; matsumoto , t . ; kitano , a . ; kobayashi , k . ; otani , s . polyamine metabolism in colonic mucosa from patients with ulcerative colitis . am . j . gastroenterol . 1992 , 87 , 736 - 740 . 22 . weiss , t . s . ; herfarth , h . ; obermeier , f . ; ouart , j . ; vogl , d . ; schölmerich , j . ; jauch , k .- w . ; rogler , g . intracellular polyamine levels of intestinal epithelial cells in inflammatory bowel disease . inflamm . bowel dis . 2004 , 10 , 529 - 535 . 24 . covassin . l . ; desjardins , m . ; charest - gaudreault , r . ; audette , m . ; bonneau , m . j . ; poulin , r . synthesis of spermidine and norspermidine dimers as high affinity polyamine transport inhibitors . bioorg . med . chem . lett . 1999 , 9 , 1709 - 1714 . 25 . estebe , j .- p . ; françois , legay ; gentili , m . ; wodey , e . ; leduc , c . ; ecoffey , c . ; moulinoux , j .- p . evaluation of a polyamine - deficient diet for the treatment of inflammatory pain . anesth . analg . 2006 , 102 , 1781 - 1788 .	6
the present invention provides at least two modes of safety for vehicles , including industrial trucks , forklifts , and especially bucket lift trucks or man lifts . by the combination of preferred features , those persons within proximity of the vehicle are warned whenever said vehicle is backing - up . vehicle or bucket lift operators are also warned of low battery conditions , such that they have early knowledge of potential danger , for example , due to a critical loss of power of their lifting and positioning equipment . as a backup alarm , the preferred embodiment conforms to sae standard j994 type c , producing a 1200 hz tone with a 97 db sound level , measured at a distance of four feet . the preferred embodiment also is capable of providing a warble sound at a level of 97 db , to alert operators of a low battery voltage condition . self - resonant back - up alarm oscillator circuitry , as described in u . s . pat . no . 5 , 596 , 311 to bess , et al is employed in the preferred embodiment to provide superior sound output performance throughout the life of the product . other similar systems may be employed in alternate embodiments to effect desired alarm sound and or optional light outputs . preferably , the componentry of the preferred embodiment is fully contained within a single , preferably plastic housing . in the preferred embodiment , the backup alarm and low voltage alarm may be operated together or independently . if the backup alarm is energized during a low voltage condition , the backup alarm will take priority . power for battery voltage sensing , internal reference and logic supplies may be sourced in one of two ways : a ) continuous operation via connection to the battery / alternator ( battery side of vehicle key switch ), or b ) active operation via connection to the ignition side of the vehicle key switch . an important aspect of the preferred embodiment of the invention , regarding its low battery detection circuitry , is the capability of sensing two or more voltage points with different timing algorithms being associated with each voltage point , thereby detecting discharge to a higher degree of accuracy over varying battery loads . for example , in the preferred embodiment , if either a ) the battery voltage drops to less than 12 . 0 volts for five minutes , or b ) the battery voltage drops to less than 11 . 5 volts for one minute , the alarm will be triggered . for either of these instances , once the battery voltage climbs again above 12 . 0 volts , the alarm will be reset . in the preferred embodiment , the alarm tone that signals a low battery condition is distinctively different from a standard back - up alarm tone . for example , the low battery alarm tone is preferably a four second warble sound , occurring once each minute . this is in contrast to the preferred back - up alarm tone , namely a 1200 hz tone repeating at a rate of 80 pulses per minute . after eight minutes total time from first detection of less than a 12 . 0 volt level , the alarm will be automatically reset and the low voltage function silenced . this feature is implemented in order to prevent the low - battery alarm from running continuously , and entirely draining the battery . a typical housing for the circuitry is a molded plastic enclosure 24 , for example , one constructed of glass filled nylon polymer , as depicted in fig5 . the preferred embodiment has approximate dimensions of : h 2 . 5 ″; w 4 ″; d 1 . 5 ″, mounted by way of two 0 . 3 ″ holes on 3 . 25 ″ centers , on the back and bottom of the housing . the three wiring terminals 25 may consist of three # 8 - 32 unc terminal studs . an operating input voltage of 9 to 16 volts allows for connection to typical 12 - volt automotive vehicle electrical systems . fig5 also depicts speaker 13 , back - up signal input 15 , sense input 1 , and a signal ground connection . with reference now to the accompanying figures , fig1 is a schematic block diagram of the preferred embodiment of the present invention , depicting its major circuit elements . sense input 1 is input to an input voltage sense circuit 2 . the function of the input voltage sense circuit 2 is to perform a comparison between the voltage reference 3 output and sense input 1 . if sense input voltage 1 falls below 12 . 0 volts , then the low voltage detect signal 4 becomes active , turning on timing circuit 5 . conversely , if the low voltage detect signal 4 becomes inactive , then the timing circuit 5 will be reset immediately , requiring another voltage dip below 12 . 0 volts in order to re - activate . timing circuit 5 has output signals that become active when timing cycles are completed . the output signals , in conjunction with the two voltage threshold signals 8 and 9 , control the operation of gating circuit 6 and self - resonant back - up alarm circuit 7 . voltage threshold signals 8 and 9 become active when the battery voltage falls below threshold levels , which are settable according to resistor divider arrays in input voltage sense circuit 2 , but in the preferred embodiment are set respectively to 12 . 0 and 11 . 5 volts . a signal that is pre - emptive of any other in the circuit is that of back - up signal input 15 , which typically is an input from the reverse switch in the vehicle onto which the invention is installed . when this signal activates , it immediately enables gating circuit 6 to start self - resonant back - up alarm circuit 7 , which outputs the standard on - off back - up alarm signal sequence for as long as that input signal is active . the main time base for all timings in this circuit is clock source 10 , and the power supply source for all circuitry is logic voltage regulator 11 . signals from self - resonant back - up alarm circuit 7 are amplified by audio amplifier circuit 12 , and are converted to sound energy by speaker 13 . fig2 and 3 are each schematic block diagrams of two separate alternate embodiments of the present invention . in a similar way to the preferred embodiment , clock 10 supplies all timings in these circuits , and the requisite power source for all circuitry is logic voltage regulator 11 . each circuit also incorporates audio amplifier circuit 12 and speaker 13 , similar to the preferred embodiment , as previously described above and as depicted in fig1 . the circuit of fig2 employs a microcontroller 14 that operates according to the embedded software contained in program memory 18 . inputs to the microcontroller 14 are from back - up signal input 15 , low voltage detect signal 4 , first threshold 8 and second threshold 9 from comparator circuit 16 . from these inputs , the microcontroller , through operation by programmed control , interprets the machine state and performs appropriate audio tone generation output to audio amplifier 12 in response . the function of this circuit can be made to perform in much the same , if not identical , manner to the circuit of fig1 , according to conventional techniques . the comparator circuit 16 of fig2 performs a similar function to the input voltage sense 2 of fig1 . the function of gating 6 , timing 5 , and self - resonant back - up alarm 7 circuits of fig1 can each be accomplished by programmed control within microcontroller 14 of fig2 according to conventional techniques . such a program controlled device can also generate different tone sequences , if end users wish to incorporate them . fig3 depicts a variation of a microcontroller circuit in which there is incorporated an analog to digital converter ( adc ) 17 , as featured in many varieties of commercially available microcontrollers . microcontroller 14 again operates according to the embedded software contained in program memory 18 . sense input 1 is an analog voltage that is converted to digital data words upon successive samples of adc 17 . these converted data words are typically stored following preliminary digital signal processing steps , executed from program memory 18 . for example , high and low ( or more than two ) threshold constants can be stored in program memory , and a rolling average would be typically performed on the incoming sense voltage to provide smoother values to be used for comparison to these different threshold levels . such an averaging step on raw data prevents spurious timer events due to noise spikes that might be present on sense input 1 . from the result of the comparisons , and through internal timing conditions , each as controlled according to the steps contained in program memory 18 , microcontroller 14 interprets the machine state and performs appropriate audio tone generation output to audio amplifier 12 in response . the function of this circuit can be made to perform in much the same , if not identical manner to the circuits of fig1 and fig2 . an extra , optional feature of the embodiment as depicted in fig3 is the incorporation of a lamp driver circuit 19 and signaling lamp 20 . the incorporation of a signaling lamp allows for both audio and visual notification of alerts to the vehicle operator and to those within its path of movement when backing - up . another feature is ambient light sensor 21 , which signals microcontroller 14 of relatively light and dark ambient light conditions , thereby allowing for automatic selection of light - based alarm operation at night and sound - based alarm operation during the daytime , for example . this feature can allow for quiet operation at nighttime in noise sensitive areas , such as where industrial yards are located near neighborhoods . the diagram in fig4 illustrates multiple alarm mode timing of the preferred embodiment of the present invention . the top row of the diagram depicts the time in minutes after an event is started , which is triggered by the sense voltage 1 dropping below a threshold value . the second row 22 depicts the alarm intervals that occur when the sense voltage 1 has dropped below 12 . 0 volts , but is above 11 . 5 volts . the third row 23 depicts the alarm intervals that occur when the sense voltage 1 has dropped below 11 . 5 volts . the purpose of these two different timing schemes is to allow faster alarm indication when deeper discharging has occurred and a hold - off in alarm for slight voltage dips that may be only momentary , due to intermittent battery loading such as when a bucket lift motor is in operation . the foregoing description of different embodiments , including a preferred embodiment of the invention , has been presented for purposes of illustration and description . this is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many modifications and variations will be apparent to practitioners skilled in this art , after viewing this description and the drawings . it is intended that the scope of the invention be defined by the following claims and their equivalents .	1
fig1 a and 1b each show a top plan view of a shield or visor 1 , which usually protects the face , which can be detachably or undetachably connected to a helmet , a mask or generally a head covering ( not shown ). the visor 1 comprises a transparent plate 2 , which is bent in fig1 a and 1b , generally a two - or three - dimensionally bent plate , which plate , when used on a helmet , will usually be made of a flexible , transparent plastic , such as polycarbonate , by thermal molding or injection - molding . the plate 2 has an inner side 3 , which faces towards the helmet or the user , and an outer side 4 . in the embodiment that is shown in fig1 a , a recess 5 has been formed in the outer side 4 , the depth of said recess being equal to the thickness of the layer 6 of a light - sensitive material ( yet to be explained hereinafter ), so that the surface at the front side of the visor 1 is flat , which reduces the occurrence of local turbulence which may be accompanied by objectionable whistling sounds or noise while riding . if desired , the layer 6 may merge into a sun visor in the outward direction . when the polycarbonate is being injection - molded , the pre - formed layer of material 6 can be melted in place in the recess 5 . the advantage of this is that no water or moisture can penetrate between the various layers , which are thus closely packed together , but that there will be no trapped air bubbles , either , so that light can reach the eye without any optical interference . the recess is preferably limited to an effective field of vision or viewing portion of the plate 2 . if desired , a motorcyclist can look past said portion when there is not enough light available temporarily , for example upon driving into a tunnel . in the embodiment of fig1 b , too , the layer 6 of light - sensitive material is permanently provided on the outer side 4 of the transparent plate 2 . in this embodiment the layer 6 of material , which preferably has a minimum thickness of only 0 . 5 mm , has been applied to the plate 2 during or after the injection - molding process , in the latter case by means of a suitable vacuum technique . in view of the cost price of the light - sensitive material , which material will be explained hereinafter , the dimensions of the layer 6 of material will be limited to those of the field of vision or viewing portion of the plate 2 . suitable ways of permanently combining the plate 2 and the layer 6 are : injection molding or casting , thermal molding , gluing or laminating . as regards said laminating , the photosensitive material may also be laminated between two transparent layers of plastic material , preferably polycarbonate . usually this takes place by means of a combination of a thermal treatment and a pressure treatment , followed by a treatment in a furnace so as to realize the desired two - or three - dimensional shape . said sandwich will have a thickness of about 0 . 5 mm in that case , comprising two polycarbonate layers each having a thickness of 0 . 2 mm , between which a laminate or glue is provided in a thickness of 0 . 1 mm . in this way very little of the costly photosensitive material is used in the intermediate layer , which is advantageous . fig2 a , 2 b and the detail of fig2 c show embodiments in which the layer 6 of photosensitive material , possibly in the form of a laminate or a film , is detachably provided on the outer side 4 of the transparent plate 2 . the visor 1 is provided with fastening means 7 in that case , for example in the form of a clamp , tension , snap , clip , pin , or magnet fastening system , or of single - or double - sided adhesive means . an example of this is shown in fig2 a , in which velcro 7 is affixed to the plate 2 and the layer 6 of photosensitive material . in the embodiment of fig2 b , this manner of attachment is combined with a snap connection 7 - 1 , 7 - 2 as shown in more detail in fig2 c , which is connected or molded to the layer 6 and which makes it possible to detach the layer 6 from the plate 2 . in an embodiment that is not shown in the figures , the embodiment of fig2 a is provided with velcro in several places , and holes may have been formed both in the plate 2 and in the layer 6 , if desired , for receiving the pins , thus making it possible to detach the layer 6 from the plate 2 . the plate 2 may in turn be detachable or pivotable with respect to the helmet , as the embodiment of fig3 a ( yet to be explained ) shows . important is in any case that the layer which comprises the photosensitive material is detachable and that the layer 6 can be secured to the plate 2 with sufficient mechanical tension . to that end clamping means may be provided , which may be eccentric and rotatable , for example , and to which the layer 6 is connected , which layer can subsequently be pulled tight on the plate 6 under tension , for example by rotating a pin . fig3 a and 3b are top plan views of two embodiments of the visor 1 , in which the layer 6 of photosensitive material is kept spaced from the transparent plate 2 by a short distance by means of pins 7 - 3 and 7 - 4 ( fig3 a ). present between the plate 2 and the layer 6 , in particular round the pins 7 - 3 and 7 - 4 , is an elastic element 8 , for example in the form of a ring , which , in compressed condition , exerts a pressure on the plate 2 and the layer 6 , thus ensuring water - tightness around the pins . the element 8 , which functions as a spacer between the transparent plate 2 and the photosensitive layer 6 , is preferably configured as a dry , non - adhesive , flexible silicone seal which may extend over at least part , possibly even the whole , of the circumferential edges of the photosensitive layer 6 . this achieves that the visor 1 is water - tight all around , whilst the flexible seal prevents the occurrence of mechanical point loads by distributing the tensions . in the embodiment that is shown in fig3 a , separable pins , i . e . pins that can be detached from each other , for example configured with male and corresponding female connecting elements , make it possible to detach the layer 6 from the plate 2 . the flexible , dry , transparent element 8 prevents the ingress of air , water , moisture and dirt in that case and prevents the plate 2 and the layer 6 from moving undesirably relative to each other under the influence of the wind when driving . in the embodiment that is shown in fig3 b , the layer 6 is detachably provided on an extension 9 of the transparent plate 2 . the element 8 , which forms a practically cured silicone seal in that case , on the one hand maintains a certain spacing between the plate 2 and the layer 6 in that case , also when the wind exerts a pressure force on the layer 6 when driving , whilst on the other hand said element 8 thus prevents the plate 2 and the layer 6 from flapping and beating together , so that there will be no damage and / or wear . the use of the silicone seal furthermore prevents the occurrence of so - called newton rings . in the case of the non - permanent , i . e . detachable or removable variants it is generally not necessary to buy a new helmet or a new visor and nevertheless benefit from the light - sensitivity . after all , the existing helmet may be fitted with a new visor exhibiting the light - sensitive characteristic , or the old visor may be exchanged for the new visor temporarily or permanently . not only does this have a cost - saving effect , but it also leads to less wear , because it is possible in that case to use the new visor only in situations in which the rider considers this necessary in view of the weather conditions . possibly , a permanent layer of light - sensitive material may be provided once - only on the visor 1 by means of foam or acrylic tape in the field of vision of an existing visor 1 . the light - sensitive , in particular uv - sensitive layer 6 comprises ( photochromatic ) pigments , which have the property that they are photosensitive and regulate the amount of light transmitted , especially uv light , in dependence on the amount of visible light and / or uv light incident thereon . in that case the layer 6 is transparent in unexposed , deactivated condition . in particular uv light - intensity - activated , light - blocking pigments are commercially available . for example , to form the layer 6 , a pigment mixed with a suitable liquid is applied to a transparent substrate or is integral with the substrate itself , or a pigment - containing film is glued to the substrate , or the pigment or pigment mixture is mixed with the glue itself in a laminating process . the properties of the layer 6 of photosensitive material to be finally obtained must meet the stringent european public road safety regulations . a pigment which is suitable for use in the visor 1 is a so - called “ base grey ” pigment , which consists of three mixed base color , light - sensitive pigments . in non - uv - activated condition the light transmission thereof is at least 90 %, and it meets all the safety regulations for a safe use also at night or when unexpectedly driving into a badly lit or unlit tunnel . the pigment layer that regulates the transmission of light above 380 nm is preferably minimally 0 . 1 mm thick , it may for example be sandwiched between two polycarbonate layers , each preferably having a thickness of minimally 0 . 1 mm . polycarbonate is easy to extrude and process in an injection - molding process . the layer 6 of light - sensitive material thus built up of three layers is easy to form to precisely the required dimensions and shape . this may be done mechanically , but also by the aforesaid thermal molding , using heat and pressure . it stands to reason that combination possibly with other plastics in a laminating - bonding process is possible , in which case the pigment powder is mixed in an amount that matches the desired light - blocking specifications and which , for cost - saving reasons , will be provided only in the field of vision or viewing portion of the visor 1 . on the outer side , the visor 1 may be provided with a , preferably water - repellent , anti - scratch film applied to the outer side of the layer 6 of photosensitive material . furthermore , means which are known per se may be used on the visor 1 , for example to prevent parts of the visor from misting up or becoming moist . the helmet and the visor 1 are each provided with length - adjustable connecting means , which are known per se , for being fixedly or detachably connected together . apart from the above - explained sandwich variant and the variant in which the pigment or the pigments are incorporated in the plastic or the polycarbonate , the uv - sensitive or light - sensitive material 6 must be provided on the outer side of the visor 1 , as it would otherwise take too long for the material to adapt its transparency in case of a change in the amount of light incident thereon , which might lead to unsafe situations . it is for that reason that the material is intentionally not provided on the inner side of the visor 1 .	6
referring now in detail to the drawings where like reference numerals identify similar or like components throughout the several views , several different embodiments of the spinal implant of the present invention are described herein . the spinal implants of the present invention are designed to be inserted minimally invasively into the disc space , thus enabling a smaller incision to be used in the procedure . this is achieved by the implants being deflectable laterally to a substantially linear configuration . that is , the implant is in a more straightened shape to enable minimally invasive insertion through a cannula . once ejected from the delivery instrument at the desired site , i . e . the disc space between adjacent vertebrae , the balloon will be filled and the implant maintained in a curved configuration . implanted in the disc space , the spinal implant is radially compressible in response to vertebral loads placed thereon . turning first to the instrumentation for minimally invasively preparing the disc space and for minimally invasively delivering the spinal implant , and with initial reference to fig1 and 2 , a device used in the intra - vertebral space to remove the spinal disc nucleus in a minimally invasive fashion is illustrated . the disc removal device 10 has an elongated tubular portion 12 which is inserted through an arthroscopic cannula 14 and has a pair of cutting jaws 16 which are operatively connected to and remotely manipulated , i . e . opened and closed , by a proximal handle ( not shown ) to cut and remove the disc nucleus . insertion through arthroscopic cannula 14 enables the disc to be removed minimally invasively rather than through a larger incision during an open more invasive surgical procedure . as the nucleus is removed endoscopically , i . e . through a cannula forming a small incision , the implant of the present invention that is designed to replace the removed disc is also advantageously inserted minimally invasively . a delivery instrument ( not shown ) containing the spinal implant 30 within a distal portion is inserted through cannula 14 . implant 30 is maintained in the delivery instrument in a substantially straightened ( linear ) configuration . fig7 illustrates the implant 30 partially ejected from the device ; fig8 illustrates the implant 30 fully deployed and implanted in the disc space . as can be appreciated , as the implant 30 is ejected it moves from its more straightened configuration toward its curved configuration described below . after placement of the implant 30 , the delivery device and cannula are removed from the body . as can be appreciated in the plan view of fig8 , the implant 30 is substantially horseshoe - shaped or substantially c - shaped in configuration as it extends circumferentially along the periphery of the disc space , thus providing support along the periphery or circumference of the disc space . that is , adjacent individual implant sections 32 are linked and form the curved shaped in a plane defined as lying perpendicular to the spine and parallel to the disc space defined between upper and lower vertebral bodies . it is also contemplated that the implant could be a closed loop , e . g . circular , or extend more than 360 degrees so the end portions overlap . in each of these instances , the implant would be delivered in a substantially straighter configuration and move to its curved shape for placement in the disc space . with reference to fig3 and 4 , the implant 30 is composed of a series of sections 32 linked together ( only some of which are labeled for clarity ). the linked sections 32 can be composed of a shape memory material , stainless steel , or other material to provide sufficient support . each of these sections is preferably c - shaped or u - shaped in configuration with a lip 34 formed at the ends of its arms or upper and lower walls 35 , 37 . a textured surface such as protrusions 36 can be formed on the upper and lower surfaces 38 , 39 , respectively , of walls 35 , 37 to increase surface friction between the implant and the opposing bone / vertebrae . although protrusions are shown , other friction enhancing surfaces can be provided such as recesses , textured surfaces , different shaped projections and coatings . the walls 35 , 37 can move toward each other due to the forces of the vertebral bodies between which it is inserted . adjacent sections 32 are hinged to enable movement from a more linear configuration for delivery through the cannula to the curved configuration shown in fig4 . fig6 is an enlarged view of one embodiment of the hinged structure showing ball 42 received and snapped in a slot formed on the underside of connector 44 . this frictional engagement interlocks adjacent sections 32 while still enabling lateral and pivotal movement with respect to one another . a support or strut 48 illustratively in the form of an elongated flat strip is attached to the outer surface 33 of the hinged sections 32 , preferably extending along the entire length . this strip 48 is preferably composed of metal and provides support for the hinged sections and assists in linking of the sections . in one embodiment , the support is made of shape memory , such as nitinol , a nickel titanium alloy , although other shape memory metals or polymeric materials are contemplated , and has a shape memorized configuration of a substantially horseshoe shape or substantially c - curve as shown in fig4 . in this manner , the support 48 is maintained in a substantially straightened configuration for delivery . once ejected from the delivery device , it will move to its memorized configuration , cooperating with the balloon explained below to move the hinged sections 32 into the curved configuration of fig4 . a balloon is designated by reference numeral 50 and shown in the inflated ( filled ) position in fig3 - 5 . the balloon has a reduced diameter section 52 ( see arrow d ) along its length to fit within the open arms 35 , 37 of the hinged sections 32 . the balloon is substantially horseshoe shaped and functions to give the hinged sections the substantially horseshoe or curved shape shown in fig4 . the larger cross - section area 54 has a curved outer surface 56 and remains outside the hinged sections 32 . a portion abuts lip 34 . the balloon is filled with a gas or liquid after placement of implant 30 in the disc space to expand and extend in the curved configuration . the substantially horseshoe shape of the balloon thus forces the attached hinged sections 32 to form and / or maintain a curved shape , thereby providing the curved shape to the implant . the balloon 50 can also apply a force against the walls 35 , 37 of the implant 30 ( i . e . in a direction transverse to a plane of the disc space ) and in some embodiments slightly expands these walls to further move surfaces 38 , 39 against the vertebrae . the balloon materials and pressure can vary to thereby vary the degree of compressibility , cushioning and rigidity of the implant . that is , the variations of the balloon can affect the movement of adjacent vertebrae . for example , a less compressible balloon will increase stability but further restrict movement of the vertebrae ; a more compressible balloon will provide more movement and mobility . in the alternate embodiment of fig9 , the metal support strip 160 , shown rectangular in cross section , is positioned inside the open arms 135 , 137 of implant 130 . the surface 152 of the balloon 150 is attached to the strip 160 . the opposite surface 162 of the strip is attached to the inner surface of hinged sections 132 . metal strip 160 functions in a similar manner to strip 48 of fig3 . fig1 illustrates an alternate way to connect the implant units ( sections ) 230 . two engaging closed loops 232 , 234 are linked to provide the attachment . this connection provides for movement of adjacent sections 230 , while maintaining the inter - lock . it also helps to maintain the linked sections 32 in the curved configuration . it is also contemplated that the support 48 ( or 160 ) constitutes the element for moving the hinged sections to the curved configuration , with the balloon being moved to its curved shape by the hinged sections 32 and then maintaining the shape and support of the sections . alternatively , the balloon can be the sole element moving the hinged sections 32 to the curved shape , with the support following the movement of the sections 32 to subsequently support the sections . alternatively , both the balloon and support 48 ( or 160 ) cooperate together to move and maintain the hinged sections . each of the implants assumes a substantially straightened configuration for delivery to the surgical site . once delivered to the disc space , the hinged sections and the inflated balloon provide sufficient springiness in response to vertebral loads placed on the device by the spine . this provides both support for the vertebral bodies plus the desired flexibility . as noted above , variations in the balloon can vary the support and flexibility for the vertebral bodies . any of the foregoing implants can be provided with a roughened surface , such as a textured surface , to enhance bone ingrowth to enhance implant retention in the disc space . surface finishes such as hydroxyapatite , calcium silicate and calcium phosphate could also be applied to allow for bone ingrowth . in use , the disc nucleus is removed arthroscopically , i . e . through cannula 14 , by device 10 . cannula 14 can optionally be placed by first inserting a needle and wire , removing the needle and sequentially placing and removing dilators of progressively increasing diameter over the wire until the desired cannula diameter is reached . after removal of the disc , device 10 is withdrawn through cannula 14 and then a delivery device , containing any of the foregoing implants , is inserted through the cannula . the implant is contained within the delivery device in a substantially straightened configuration with the balloon in the collapsed ( unexpanded ) configuration . the implant is then ejected from the delivery device and implanted in the disc space between the vertebral bodies , with the balloon filled to expand and maintain the curved configuration . the delivery instrument and cannula 14 are withdrawn from the body . fig8 illustrates the implant 30 positioned within the disc space . while the above description contains many specifics , those specifics should not be construed as limitations on the scope of the disclosure , but merely as exemplifications of preferred embodiments thereof . for example , in addition to the substantially c - shaped cross - sectional configurations , substantially circular , rectangular , hexagonal , substantially octagonal as well as other configurations are contemplated . also the length of the implant could be longer than that shown in the drawings for assuming the curved shape . those skilled in the art will envision many other possible variations that are within the scope and spirit of the disclosure as defined by the claims appended hereto .	0
the present invention now is described more fully hereinafter with reference to the accompanying drawings , in which embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . referring now to the drawings , fig1 - 5 illustrate an exemplary vehicle energy harvester . the exemplary embodiments can make productive use of the energy that is normally wasted ( in the form of heat ) in reducing the speed of motor vehicles on exit ramps , toll plazas etc ., etc . the vehicle energy harvester can absorb mechanical energy from passing ( or breaking ) vehicles and convert the mechanical energy to electrical energy using , for example , shaft driven generators . other means for converting the mechanical energy to electrical energy also are contemplated . in an exemplary aspect , the electric power from the generators can be converted , metered , and fed into the commercial power grid . in another exemplary aspect , each site can be equipped with wireless communications to monitor the status and / or output of the system . the disclosed embodiments can include individual assemblies with integral generators . other generator configurations also are possible , such as separate generators . as shown in fig1 , the vehicle energy harvester unit 10 can be a low - profile surface mounted assembly . the vehicle energy harvester unit 10 can include an entry ramp 12 and an exit ramp 14 . the vehicle energy harvester unit 10 can include a plurality of subunits 16 having a top surface or driving surface 17 . each subunit can include one or more vehicle activated treadles 18 . in an embodiment , each subunit 16 can include a generator unit 20 . in other embodiments , the vehicle energy harvester unit 10 can be set into the road surface . the surface mounted assembly may require minimal installation effort . additionally , the unit count can be scaled to road / breaking needs . in an embodiment , each generator unit 20 can feed a common power summing / conversion unit 22 . a simple cable interconnect 24 can be provided to connect each generator unit 20 to the common power summing / conversion unit 22 . a fail safe configuration can protect the system against individual unit failures . in a disclosed embodiment , the individual absorber units 16 can be connected via cable assemblies 24 . the input power can be summed and applied to a low - loss inverter unit . the power can be converted immediately to a form that is transmittable to the power grid . the output can be metered and applied to the power grid for transmission . with reference to fig2 , an exemplary embodiment of a subunit 16 of a vehicle energy harvester unit 10 can include spring - loaded treadles 18 having a treadles gear 30 engaging a drive gear 32 . the drive gear 32 is coupled to a shaft 34 . in operation , one or more vehicle tires force the spring - loaded treadles 18 down as they roll over the treadles 18 . the treadle gears 30 drive the plurality of drive gears 32 , which rotate the shaft 34 . the shaft 34 winds a torsion spring 36 , thereby absorbing the treadle drive transient . a pawl can lock the shaft 34 as rotation ends . the torsion spring 36 rotates a flywheel 38 , thereby spreading the impulse of the treadle drive over time to extend output to a generator 40 . the flywheel 38 can turn a generator 40 , such as a hydro pump . the generator 40 , in turn , can generate electric power for sale / use / storage . the exemplary embodiments improve the durability of the system under practical use scenarios . the exemplary embodiments of the invention are capable of withstanding the stresses placed upon the system during normal use , as well as minimizing or preventing interference or damage to the system resulting from other factors . the exemplary embodiments of the invention recognize that factors that may reduce the durability of the system under normal use further include , for example , environmental conditions such as ambient temperature , rain , sleet , snow , or ice , among other things . the exemplary embodiments of the invention address and solve these problems and improve the durability of a treadle based energy conversion systems according to the exemplary embodiments of the invention . with reference to fig3 , an exemplary embodiment of a vehicle energy harvester having at least one temperature detector 50 will now be described . in order to reduce the wear and tear on the treadle assembly ( e . g ., 18 ), exemplary embodiments of the present invention can include one or more temperature sensors 50 that aid in determining whether icy ( freezing ) conditions may prevent normal operation of the treadle assembly . the temperature sensor 50 can be mounted , for example , under a top cover plate or driving surface 17 of one or more subunits 16 . in other embodiments , the temperature sensor 50 can be mounted on or in a surface of the top cover plate or driving surface 17 of one or more subunits 16 , or on another part of the vehicle energy harvester unit 10 . alternatively , the temperature sensor 50 can be separate from the vehicle energy harvester unit 10 and communicate with the vehicle energy harvester unit 10 via a wired connection or wireless connection . in this manner , the temperature sensor 50 can accurately measure surface temperatures of the vehicle energy harvester unit 10 . a common , commercially available , semiconductor temperature sensor 50 , such as the xxx - 111 temperature sensor or the like , can be used in conjunction with a low - cost micro - controller unit ( mcu ) ( not shown ) to determine if hazardous conditions exist . an embodiment having a low - cost single chip ( ic ) arrangement can provide a very reliable and durable design . one of ordinary skill in the art will recognize that integrated circuits ( ics ) with temperature conversion accuracy of 0 . 5 degrees are readily available . these circuits can provide a simple serial ( digital ) output to the micro - controller unit ( mcu ). the micro - controller unit ( mcu ) can use the temperature sensor 50 to control overall operation of the vehicle energy harvester unit 10 . in other embodiments , the temperature sensor 50 can be used in conjunction with other sensors or detectors , for example , as described in the exemplary embodiments below . with reference to fig4 , an exemplary embodiment of a vehicle energy harvester having at least one precipitation detector 60 and / or a snow / ice sensor 70 will now be described . an exemplary embodiment of the present invention can include one or more precipitation detectors 60 that aid in determining whether icy ( e . g ., freezing ) conditions may prevent normal operation of the treadle assembly ( e . g ., 18 ). one of ordinary skill in the art will recognize that a common operational amplifier can be as a precipitation detector 60 and configured as shown , for example , in fig4 to detect the presence of liquid precipitation ( rain ). the precipitation detector 60 can be mounted , for example , under a top cover plate or driving surface 17 of one or more subunits 16 . in other embodiments , the precipitation detector 60 can be mounted on or in a surface of the top cover plate or driving surface 17 of one or more subunits 16 , or on another part of the vehicle energy harvester unit 10 . alternatively , the precipitation detector 60 can be separate from the vehicle energy harvester unit 10 and communicate with the vehicle energy harvester unit 10 via a wired connection or wireless connection . in this manner , the precipitation detector 60 can accurately detect the presence of liquid on or in one or more subunits 16 of the vehicle energy harvester unit 10 . in other embodiments , the precipitation detector 60 can include a plurality of contacts that can be used to estimate the amount of rain fall . the precipitation detector 60 can take samples continuously or periodically to conserve power usage . in addition , one or more snow / ice sensors 70 having , for example , a small , low - cost infrared emitter / detector 72 , 74 can be used as illustrated in fig4 to detect the presence of snow and / or ice obscuring a channel between the emitter and detector 72 , 74 . other conventional devices for detecting the presence of snow and / or ice can be used . the snow / ice sensor 70 can be mounted , for example , on or in a surface of the top cover plate or driving surface 17 of one or more subunits 16 , or on another part of the vehicle energy harvester unit 10 . alternatively , the snow / ice sensor 70 can be separate from the vehicle energy harvester unit 10 and communicate with the vehicle energy harvester unit 10 via a wired connection or wireless connection . in this manner , the snow / ice sensor 70 can accurately detect the presence of snow or ice on one or more subunits 16 of the vehicle energy harvester unit 10 . the snow / ice sensor 70 can take samples continuously or periodically to conserve power usage . one or more snow / ice sensors 70 can be used in conjunction with , for example , the temperature sensor 50 and a low - cost micro - controller unit ( mcu ), for example , to determine if hazardous conditions exist . with reference to fig5 , an exemplary embodiment of a vehicle energy harvester having at least one treadle locking means will now be described . in an exemplary aspect , during normal operation , the treadle 18 is in the active ( elevated ) position and pushed downward upon impact with a tire of an oncoming motor vehicle . if ice is formed inside the vehicle energy harvester unit 10 , the treadle assembly may no longer be free to move when struck by the tire of the vehicle . instead , the momentum of the vehicle may be applied directly and entirely to the mechanical components connected to the treadle 18 . this type of collision may result ( or will almost certainly result ) in physical damage to the vehicle energy harvester unit 10 ( e . g ., bending or breaking of mechanical members , stripping gearbox assemblies , etc .). to minimize or prevent such damage in freezing weather , the exemplary embodiments of a vehicle energy harvester unit 10 can be equipped with a solenoid operated locking pawl such that the unit can be locked safely in a flat ( i . e ., level with the driving surface 17 ) position until more favorable weather conditions are detected . this locking means also can minimize or prevent damage to the vehicle energy harvester unit 10 that may be caused by snow removal equipment operating on the road surface or driving surface 17 . as illustrated in fig5 , the spring - loaded treadles 18 can be configured to pivot about one end . in operation , one or more vehicle tires force the spring - loaded treadles 18 down into a flush position with the driving surface 17 as they roll over the treadles 18 . an exemplary embodiment of treadle locking means for a vehicle energy harvester unit 10 can include a locking latch 80 coupled to a portion of the treadle 18 , for example , a free or open end of the treadle 18 as shown in fig5 . a portion of the subunit 16 that is opposite to the hinged side of the treadle 18 can include a sliding lock pawl 82 configured to selectively engage the locking latch 80 to secure the treadle 18 in a closed or flush position with the driving surface 17 of the subunit 16 . the sliding lock pawl 82 can be moved into a locked or unlocked position by a solenoid 84 or the like . the solenoid 84 can move the locking pawl 82 in or out ( e . g ., right or left as shown in fig5 ) under control of the micro - controller unit ( mcu ). for example , the application of voltage to the solenoid 84 can push the pawl to the left to lock the treadle down . in operation , the impact of the tire of a vehicle travelling on the driving surface 17 can force the treadle 18 downward into a flush position with the driving surface 17 and cause the locking latch 80 to engage with the sliding lock pawl 82 . the power to the solenoid 84 can be removed to conserve power after the treadle 18 is locked . by reversing the voltage to the solenoid 84 , the solenoid 84 momentarily will move the sliding lock pawl 82 to the right and release the locking latch 80 of the treadle 18 such that the treadle 18 can return to an elevated or open position ( e . g ., active position ). other locking means are possible for securing and locking the treadle 18 in a flush position with the driving surface 17 . the locking means can be using in conjunction with a micro - controller unit ( mcu ) and one or more of the temperature sensor 50 , precipitation sensor 60 , and snow / ice sensor 70 . in this manner , the micro - controller unit ( mcu ) can apply or remove voltage from the solenoid 84 to lock or unlock the treadle 18 based on signals or input received from one or more of the temperature sensor 50 , precipitation sensor 60 , and snow / ice sensor 70 , thereby locking or securing the treadle 18 in a flush position with the driving surface 17 when conditions exist that may affect the operation of the vehicle energy harvester unit 10 . accordingly , the exemplary embodiments can improve the durability of the system under practical use scenarios . the exemplary embodiments of the invention are capable of withstanding the stresses placed upon the system during normal use , as well as minimizing or preventing interference or damage to the system resulting from other factors , for example , including environmental conditions such as ambient temperature , rain , sleet , snow , or ice , among other things . the present invention has been described herein in terms of several preferred embodiments . however , modifications and additions to these embodiments will become apparent to those of ordinary skill in the art upon a reading of the foregoing description . it is intended that all such modifications and additions comprise a part of the present invention to the extent that they fall within the scope of the several claims appended hereto . like numbers refer to like elements throughout . in the figures , the thickness of certain lines , layers , components , elements or features may be exaggerated for clarity . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . unless otherwise defined , all terms ( including technical and scientific terms ) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . it will be further understood that terms , such as those defined in commonly used dictionaries , should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein . well - known functions or constructions may not be described in detail for brevity and / or clarity . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated listed items . as used herein , phrases such as “ between x and y ” and “ between about x and y ” should be interpreted to include x and y . as used herein , phrases such as “ between about x and y ” mean “ between about x and about y .” as used herein , phrases such as “ from about x to y ” mean “ from about x to about y .” it will be understood that when an element is referred to as being “ on ”, “ attached ” to , “ connected ” to , “ coupled ” with , “ contacting ”, etc ., another element , it can be directly on , attached to , connected to , coupled with or contacting the other element or intervening elements may also be present . in contrast , when an element is referred to as being , for example , “ directly on ”, “ directly attached ” to , “ directly connected ” to , “ directly coupled ” with or “ directly contacting ” another element , there are no intervening elements present . it will also be appreciated by those of skill in the art that references to a structure or feature that is disposed “ adjacent ” another feature may have portions that overlap or underlie the adjacent feature . spatially relative terms , such as “ under ”, “ below ”, “ lower ”, “ over ”, “ upper ”, “ lateral ”, “ left ”, “ right ” and the like , may be used herein for ease of description to describe one element or feature &# 39 ; s relationship to another element ( s ) or feature ( s ) as illustrated in the figures . it will be understood that the spatially relative terms are intended to encompass different orientations of the device in use or operation in addition to the orientation depicted in the figures . for example , if the device in the figures is inverted , elements described as “ under ” or “ beneath ” other elements or features would then be oriented “ over ” the other elements or features . the device may be otherwise oriented ( rotated 90 degrees or at other orientations ) and the descriptors of relative spatial relationships used herein interpreted accordingly .	7
fig1 shows a fuel gas generating unit 10 associated with a first embodiment of the invention , comprising of a fuel gas source 12 which generates the primary fuel gas by burning a liquid fuel such as alcohol ; a gas pipe 14 which directs the primary fuel gas generated by the fuel gas source 12 to a definite direction ( from left to right in the figure ); an air nozzle 16 with the tip in the gas pipe 14 which ejects pressurized air in the same direction as that of the primary fuel gas ; and a means to form mixed flow 17 which mixes the primary fuel gas with air from the air nozzle 16 in spiral and / or vortex flow in the gas pipe 14 . said fuel gas source 12 has a combustion chamber 18 made of cylindrical shaped metallic material . the inner surface of the combustion chamber 18 is provided with a fuel layer 20 , consisting of a metal with continuous pores , for example , to which liquid fuel is circulated and supplied from a fuel tank 22 by a pump 24 . fig1 shows in addition a motor 26 to drive the pump 24 , and an ignition plug 28 which ignites fuel at the surface of the fuel layer 20 . in the figure , the right end of said combustion chamber 18 is open and is connected to said gas pipe 14 , while the left end has a cover 30 with air inlet holes 30a . said gas pipe 14 comprises a portion of a smaller diameter 14a connected to said combustion chamber 18 and a portion of a larger diameter 14b connected to the right end of the portion 14a in the figure . several air inlet holes 14c are pierced peripherally through said portion 14a at an appropriate distance . the inner surface 17a of said portion 14a , the step 17b between the portions 14a and 14b , and the air inlet holes 14c constitute a means to form mixed flow 17 . said air nozzle 16 runs through the center of said cover 30 of said combustion chamber 18 , and the tip is located in the portion of a smaller diameter 14a close to said air inlet holes 14c on the center line of said gas pipe 14 . said air nozzle 16 is formed by a metallic pipe and held by a pipe guide 30b formed on the cover 30 so that the nozzle can be shifted in the axial direction . in fig1 numeral 32 denotes a pump to supply pressurized air to the air nozzle 16 , 34 denotes a motor to drive the pump 32 , 24a denotes a fuel nozzle to supply fuel to the combustion chamber 18 , and 24b denotes a fuel purge nozzle to purge excess fuel not reacted in the fuel layer 20 . the angle θ formed by a straight line from the tip of the air nozzle 16 to the corner 14d forming transition from the portion 14a to 14b and the center line of said air nozzle 16 is preferably 30 - 65 degrees . the action of the first embodiment shown in fig1 is described below . a liquid fuel , for example alcohol , is supplied to the fuel layer 20 in the combustion chamber 18 by the pump 24 , and ignited by the ignition plug 28 at the surface of the fuel layer 20 , where it burns mildly oozing out of the layer 20 . in the meantime , pressurized air is supplied to the air nozzle 16 by the pump 32 and ejected into the portion 14a in the gas pipe 14 . air flow thus produced causes the combustion gas and unburnt gas , and air in the combustion chamber 18 flow into the gas pipe 14 . air sustaining the combustion of the fuel in the chamber 18 flows into the chamber 18 through the air inlet holes 30a in the cover 30 . a part of said combustion gas , unburnt gas and air forms spiral flow around the strong air flow from the air nozzle 16 and eventually mixed with the latter ( see fig2 ). at the position of the tip of the air nozzle , the cross section of the pressurized air increases when it is ejected from the air nozzle 16 into the gas pipe 14 under the normal pressure , but the increase is limited by the inner surface 17a of the portion of a smaller diameter 14a of the gas pipe , and , as a result , vortices are generated as shown in fig3 along the boundary with the combustion gas from the chamber 18 ( primary fuel gas ), whose cross section relatively diminishes in the same portion , and mixes the two streams vigorously to promote the reaction . air intake through the air inlet holes 14c in the portion 14a near the tip of the air nozzle 16 also produces vortices along the boundary with the primary fuel gas . the total cross section of the flow of the primary fuel gas and pressurized air from the air nozzle 16 increases considerably when the flow reaches the portion of a greater diameter 14b of the gas pipe 14 , whereupon the boundary between the primary fuel gas and air passes through the corner 14d . vortices are generated near the step 17b , which promotes the reaction of the primary fuel gas with air , thus providing a secondary fuel gas at the outlet 14e of the gas pipe 14 . the reaction can be controlled by adjusting the amount of fuel supplied to the fuel layer 20 , air flow to be ejected from the air nozzle 16 , and the position of the tip of the air nozzle 16 . experiments performed by the inventor have shown that combustion of a secondary fuel gas obtained from alcohol ( methyl alcohol , ethyl alcohol or a mixture thereof ) endured three times longer than that of simple combustion , with a maximum combustion temperature of 1 , 600 ° c . ( as compared with 800 ° c . obtained in normal combustion ). the longer duration of combustion and higher combustion temperature result from an excited state of carbon and hydrogen atoms , obtained by decomposition of the primary fuel gas in reaction with air , which burn at a high rate and high temperature . measurements have shown that the exhaust gas after combustion of the secondary fuel gas contained very small amount of nitrogen oxides ( nox ), since the nitrogen content of the fuel gas was very low in comparison with the combustible components . the air inlet holes 14c in the portion of a smaller diameter 14a of the gas pipe 14 in said first embodiment shown in fig1 do not limit the scope of the invention , and can be eliminated as in a second embodiment of the invention shown in fig4 as far as the reaction proceeds satisfactorily with pressurized air from the air nozzle 16 . a third embodiment of the invention shown in fig5 is described below . in the third embodiment , fins 36 to form a spiral flow , arranged in the same oblique angle against the gas flow , are placed around the air nozzle 16 at a position upstream to the tip in the gas pipe 14 connected to the combustion chamber 18 as in the first embodiment . the fins 36 , the air inlet holes 14c , the inner surface 17a and the step 17b constitutes a means to form mixed flow 38 . in this particular embodiment , the fins 36 are directed to form a right - handed screw in order to produce a right - handed spiral flow of the primary fuel gas around the air nozzle 16 . therefore , the primary fuel gas leaving the combustion chamber 18 and to be involved in the pressurized air flow from the air nozzle 16 is forcibly turned into right - handed spiral flow by the fins 36 . this arrangement provides vigorous mixing of air ejected from the air nozzle 16 with the primary fuel gas in a strong spiral flow , thus promoting the reaction . in addition to the spiral flow formed by the fins 36 , the boundary areas of air flow from the air intake holes 14c and from the air nozzle 16 , and at the step 17b , as in the first embodiment , contribute to formation of vortices which promote reaction of the primary fuel gas with air . a fourth embodiment of the invention shown in fig6 is described below . in this fourth embodiment , gas nozzles 40 are provided at the connecting part of said combustion chamber 18 and said gas pipe 14 , in such an arrangement that the nozzles eject the primary fuel gas in right - handed spiral flow around the center line 16a of the air nozzle 16 . in this fourth embodiment , the primary fuel gas from the combustion chamber 18 is forcibly turned into right - handed spiral flow , as in the third embodiment , by the obliquely arranged gas nozzles 40 , thus mixing the primary fuel gas with air effectively and vigorously and promoting the reaction . a fifth embodiment of the invention shown in fig7 and 8 is described below . in this fifth embodiment , seven air nozzles 44a - 44g are located spirally along a virtual conical surface 42 placed with its apex directed downstream in the gas pipe 14 connected to a combustion chamber 18 similar to that in the first embodiment . in this embodiment , pressurized air ejected from the nozzles 44a - 44g forms spiral flow in the gas pipe 14 , thus promoting reaction of the primary fuel gas with air . a sixth embodiment of the invention shown in fig9 is described below . in the sixth embodiment , a punched metal sheet 46 is provided in the gas pipe 14 , connected to a combustion chamber 18 similar to that in the first embodiment , closely downstream to the tip of the air nozzle 16 , in an arrangement oblique to the air flow . in this embodiment , vortices are formed when the primary fuel gas from the combustion chamber 18 and pressurized air flow from the air nozzle 16 pass through a number of orifices 46a formed through the punched metal sheet 46 due to decrease and increase in relative cross sections of the flows , giving rise to the same reaction as in the first embodiment . a seventh embodiment of the invention shown in fig1 is described below . in this seventh embodiment , a means to modify the cross section of the channel 48 constructed by forming metal mesh in a conical spiral is provided in the gas pipe 14 connected to a combustion chamber 18 similar to that in the first embodiment . in this seventh embodiment , a number of vortices are generated when the primary fuel gas and pressurized air from the air nozzle 16 pass through the spiral mesh due to changes in relative cross sections of the flows , thus promoting the reaction . an eighth embodiment of the invention shown in fig1 is described below . in the eighth embodiment , a combustion chamber 50 , similar to that in the first embodiment , is extended beyond the end of the fuel layer 52 , thus constituting a gas pipe 54 , in which a reaction cylinder portion 56 is provided as a principal element of a means to form mixed flow . the reaction cylinder portion 56 consists of a first reaction cylinder made of a heat - resistant material , such as a metal or a ceramic , with a number of through holes 58a formed as a hollow cone with the base directed downstream , and a reaction coil 60 formed by winding spirally a plate of a heat - resistant material , as used in the first reaction cylinder 56 , with a number of through holes 60a with one of the ends connected to the base of the first reaction cylinder 58 . the tapered apex of said reaction cylinder 58 is connected to an air nozzle 62 to eject pressurized air into the cylinder 58 . the connecting part of the cylinder 58 has the same diameter as that of the air nozzle 62 , and provided with through holes 60a in the wall . in fig1 , numeral 64 denotes a stay to hold the reaction cylinder 56 in the combustion chamber 50 , and other components are numbered by the same numerals of the same components in the first embodiment shown in fig1 and description of the other components is omitted . in this embodiment , vortices are generated when the primary fuel gas generated in the combustion chamber 50 enters the first reaction cylinder 58 through the holes 60a by the action of pressurized air ejected from the air nozzle 62 into the central region of the apex of the reaction cylinder 56 to give rise to reaction with the air . additionally , a number of vortices are formed when the mixture moves from the central region of the reaction coil 60 outwardly passing through the holes 58a therein repeatedly , causing the reaction at a number of sites and thus producing a secondary fuel gas capable of sustaining high temperature combustion . in this embodiment , the maximum combustion temperature of the gas formed is increased by increasing the number of turns of the reaction coil 60 . the total calorific value is determined by the amount of fuel supplied to the fuel layer 52 and the amount of air supply from the air nozzle 62 . a ninth embodiment of the invention shown in fig1 is described below . in the ninth embodiment , a reaction cylinder 66 with a number of through holes 66a , formed by spirally winding a sheet of a heat - resistant material , such as a metal or a ceramic , as a hollow truncated cone with the larger base directed downstream , is provided instead of the reaction cylinder 58 in the eighth embodiment ( fig1 ), and the air nozzle 62 is connected to the center of the smaller end surface ( base end side ) of the reaction cylinder 66 to eject pressurized air into the latter . in this embodiment , vortices are formed and reaction occurs when the primary fuel gas flows into the reaction cylinder 66 , pressurized air ejected into the central region of the cylinder 66 . the reaction of the primary fuel gas is further enhanced when the mixture passes through the each layer of the coil in the reaction cylinder 66 , thus producing a secondary fuel gas capable of sustaining high temperature combustion . an advantage of this embodiment is that the reaction cylinder 66 can be fabricated simply by winding spirally a punched metal sheet to form a truncated cone . in the embodiments described above , the primary fuel gas is obtained by burning a liquid fuel , such as alcohol , supplied to the fuel layer in the combustion chamber 50 . this feature , however , does not limit the scope of the invention : any fuel gas obtained by heating a liquid , gaseous , or solid fuel or a mixture thereof to a temperature equal to or higher than the boiling point and lower than the flash point can be employed . for example , as shown in fig1 , a primary fuel gas source 68 may consist of a fuel chamber 70 to contain a liquid , solid or gaseous fuel , and a heating means 72 , such as an electric heating coil , to heat the fuel in the fuel chamber 70 to a temperature equal to or higher than the boiling point and lower than the flash point , the fuel gas generated by heating being sent to the gas pipe . in the above , a throttle valve 75 provided at the air inlet 74 of the fuel chamber 70 can be used to adjust the air flow into the latter , thus controlling the gas generation . in the embodiment described above , the fuel layer in the combustion chamber is made of foamed metal with continuous pores . this feature , however , does not limit the scope of the invention : any material with satisfactory heat resistance capable of impregnation of a liquid fuel may be employed , such as asbestos or metallic fibers . in the embodiment described above , a liquid fuel such as alcohol is used . this feature , however , does not limit the scope of the invention : gaseous fuels such as city gas , natural gas , propane , methane , butane , carbon monoxide or hydrogen , may be used if the gas is heated in an appropriate location in the path . in addition , a solid fuel such as coal , charcoal , cellulose , wax or coke may be used in the invention if a means of continuous generation of the primary fuel gas capable of supplying the fuel and discharging the combustion gas continuously . this means may be eliminated if only a short - period combustion is required . the fuel gas thus obtained can be supplied to an internal combustion engine with air and ignited to give a high efficiency in combustion . the fuel gas can equally be used with air in external combustion engines , boilers and stoves . the fuel gas as generated may be used in fuel cells , in which case the high temperature of the gas generated lead to a high efficiency in generating electricity .	2
with reference to fig1 , a pumping unit 10 is shown in its entirety , of the type which can be used in a machine for the distribution of concrete , such as for example a concrete mixer , a truck - transported pump or other apparatus typically used in building sites to make concrete constructions . the pumping unit 10 according to the present invention includes a hydraulic command circuit 11 , a pair of pumping cylinders , respectively a first 12 and a second 13 , a feed terminal 14 to feed the concrete toward a relative concrete distribution circuit , of the known type and not shown , and an exchange circuit 24 , operatively associated to the feed terminal 14 . the pumping unit 10 also includes two sensor members 15 operatively associated to each of the two pumping cylinders 12 and 13 , the functions of which will be explained in detail hereinafter . the hydraulic command circuit 11 in this case is of the oil - dynamic type and includes a first feed pipe 16 , a second feed pipe 17 , two bi - directional feed pumps 19 and 20 and a motor member 21 . the first feed pipe 16 is structured to fluidically connect the feed pumps 19 and 20 with the first pumping cylinder 12 . the second feed pipe 17 is structured to fluidically connect the bi - directional pumps 19 and 20 with the second pumping cylinder 13 . the two bi - directional feed pumps 19 and 20 are structured to alternately direct the oil - dynamic flow toward the first feed pipe 16 , or toward the second feed pipe 17 , so as to condition the alternate actuation of the first pumping cylinder 12 and the second pumping cylinder 13 . each pumping cylinder 12 and 13 includes a pumping piston , respectively a first 22 and a second 23 , each able to slide inside a relative chamber 25 , for a determinate travel s . the linear movement of each pumping piston 22 , 23 as far the speed , the pressure and the direction of actuation are concerned , is commanded , as we said , by the hydraulic command circuit 11 , or main circuit . to close the hydraulic command circuit 11 , a connection pipe 18 is provided disposed in a fluid dynamic connection between the two pumping cylinders 12 and 13 . in particular the connection pipe 18 puts in communication the chambers 25 of the cylinders where the pistons 22 , 23 move in alternate motion . to optimize the performance of the pumping unit 10 , the volume of fluid contained in the chambers 25 of the pistons connected by the pipe 18 must have a precise and constant value depending on the size of the pistons 22 , 23 . this volume , thanks to the presence of the sensor members 15 , can be detected continuously by the system in a point - by - point manner . it is therefore possible to intervene at any moment to restore the correct value by the aid of a hydraulic block 37 , dedicated for this function . in particular , the hydraulic block 37 is suitable to remove / introduce oil , at a sufficient pressure , in a point - by - point manner and in any case able to optimize the performance of the pumping unit 10 based on the detections supplied by the sensors 15 . the fluid used to restore the correct value can be introduced into / removed from the chambers 25 of the cylinders by directly exploiting the mouth 38 present on the chamber 25 of the lower cylinder , in fig1 , or by inserting a branch 39 on the connection pipe 18 . an auxiliary circuit is thus made which , based on the commands from the sensors 15 , determines the introduction / discharge of fluid into / from the chambers 25 thanks to the selective activation of the hydraulic block 37 , so as to optimize at every moment the behavior of the pumping pistons 22 , 23 . the bi - directional pumps 19 and 20 are of the variable volume type , both commanded by the motor member 21 which can be a combustion engine of the diesel type or other , of a substantially traditional type . advantageously , the two bi - directional pumps 19 and 20 are connected to a power adjuster set to about 60 - 80 kw , and a pressure cut of about 340 - 360 bar . in the form of embodiment shown as a non - restrictive example in the drawings , each sensor member 15 includes a slider element 26 ( fig2 ) mounted solid and on board the relative pumping piston 22 , 23 , and a detector element 27 mounted on the relative cylinder 12 , 13 , in a fixed position with respect to the pumping piston 22 , 23 . in this case , each pumping piston 22 , 23 has a blind axial hole 29 which is open toward the outside on the side opposite the end suitable to act on the concrete . the slider element 26 includes an annular magnet disposed inside the axial hole 29 at a distance from the blind bottom at least equal to the travel s of the pumping piston 22 , 23 . the detector element 27 includes a shaft 30 fed electrically and disposed with play inside the axial hole 29 . the shaft 30 is conformed and disposed so that the magnet of the slider element 26 is also outside and in a condition substantially surrounding the shaft 30 , so that the magnetic field of the magnet generates an induced current on the shaft 30 . in this way , the movement of the pumping piston 22 , 23 , and therefore of the slider element 26 with respect to the shaft 30 , determines a movement of the magnetic field generated by the magnet along the travel s of the cylinder and along the length of the shaft 30 . this movement determines a variation in the position of the magnetic field generated by the magnet with respect to the shaft 30 and therefore the detection of a different induced current on the shaft 30 . the variation in the induced current detected on the shaft 30 is translated by the detector element 27 in terms of variation of the position of the slider element 26 with respect to the shaft 30 ; it is therefore possible to obtain data relating to the actual position , speed , acceleration and other of the relative pumping piston 22 , 23 . advantageously , the shaft 30 includes a support push rod 31 with sizes correlated to the axial hole 29 and able to support the shaft 30 , keeping it in a substantially linear position inside the axial hole 29 , that is , without interference with the outside walls of the latter . in this case , an end - of - travel sensor 36 is also associated to each pumping cylinder 12 , 13 , which assists the system to command the operative inversion both of the bi - directional pumps 19 and 20 and also of the exchange circuit 24 , and therefore of the feed terminal 14 . the feed terminal 14 is of the substantially traditional type and is known in jargon by the term “ s ” valve . the feed terminal 14 is alternately moved by the exchange circuit 24 , in a coordinated manner to the movement of the two pumping pistons 22 and 23 . the exchange circuit 24 traditionally includes a mono - directional pump 32 , a directional valve 33 , and a pair of exchange cylinders 35 , hydraulically connected with each other . the mono - directional pump 32 has a variable volume , is commanded by the same motor member 21 as the two bi - directional pumps 19 and 20 , and is pressure adjusted . in particular , when a determinate pressure value is reached in the exchange cylinders 35 the volume of the pump 32 is reduced to its minimum value with the sole function of compensating the oil leaks . the value of this pressure is variable between about 120 bar and about 200 bar . the directional valve 33 is a 4 / 2 valve with electro - hydraulic command with detention of the position , and is able to alternately exchange the flow of oil entering the exchange cylinders 35 , until these determine the alternate movement of the feed terminal 14 . the exchange command of the directional valve 33 occurs in a coordinated manner to the frequency of operative alternation of the pumping pistons 22 and 23 , and is subject to possible operative variations defined by the effect of the data detected by the sensor member 15 . in fig1 the discharge lines of both the command circuit 11 and the exchange circuit 24 are represented by a dotted line . it is clear that modifications and / or additions of parts may be made to the pumping unit 10 as described heretofore , without departing from the field and scope of the present invention . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims .	5
many programmable digital devices today utilize microprogramming . in such devices , a large portion of the device &# 39 ; s control is performed utilizing a read - only - memory ( rom ) rather than large arrays of gates and flip - flops . this technique frequently reduces the package count in the digital device and provides a highly ordered structure , not present when random logic is used . moreover , microprogramming makes changes in the device &# 39 ; s instruction set very simple to perform , reducing post - production engineering costs for the device substantially . fig1 illustrates the typical microprocessor system architecture used in a programmable digital device and can be divided into two distinct sections : an instruction acquisition and processing section a on the left and a data acquisition and processing manipulation section b on the right . section a has , as its heart , the microprogram sequence controller of the present invention , generally designated with the reference numeral 10 . the data acquisition and manipulation section b includes the data processing circuits , generally designated as 12 , which includes the working registers 14 , the arithmetic logic unit ( alu ) 16 and the status register 18 . the data processing circuits process data acquired from memory 20 by performing whatever operations are required by the &# 34 ; machine &# 34 ; instruction pointed to by the data acquisition circuits , generally designated as 21 , as addressed by program counter 22 and accessed via the memory address register 24 . each &# 34 ; machine &# 34 ; instruction is implemented on the microprocessor by a sequence of microinstructions selected by the microprogram sequence controller 10 . while , for the purposes of discussion , certain of the blocks shown in fig1 are shown explicitly interconnected by designated lines , it is to be understood that data communication between any of the blocks shown can be effected along the bidirectional data bus 26 . similarly addresses can be communicated between any of the blocks shown , on address bus 28 . microprogram sequence controller 10 generates addresses that determine the sequence of microinstructions that ultimately issue from the microprogram memory 30 . the addresses generated by the microprogram sequence controller 10 are conducted from data -- out terminals of controller 10 on a &# 34 ; y &# 34 ; address bus 32 to the address circuits ( not shown ) of the microprogram memory 30 . with the application of such microinstruction addresses , the microprogram memory 30 will issue , on the microinstructions , bus 34 , microinstructions , usually of a word length on the order of 32 or more bits . the microinstruction bus 34 conducts the microinstructions to the data inputs of a pipeline register 36 , which accepts and temporarily holds the microinstruction . while the microinstruction is contained in pipeline register 36 , output lines of the register go out to the various system elements , including a portion of the microinstruction which is returned to the sequencer controller to determine the address of the next microinstruction to be executed . that next address is computed by the microprogram sequence controller 10 , conducted to the microprogram memory 30 via the &# 34 ; y &# 34 ; address bus 32 , and the next microinstruction sits at the input of the pipeline register 36 . those portions of the microinstruction that are returned to the microprogram sequence controller 10 include a 6 - bit controller instruction word , conducted on a controller instruction bus 38 and a multi - bit data word that is conducted on a controller data bus 40 to the data bus inputs of the sequence controller 10 . other portions of the microinstruction are control signals which are conveyed to the data processing circuits 12 along processor instruction bus 42 . these signals cause data to be transferred from memory 20 to the working register 14 and then processed by the arithmetic logic unit 16 and the result transferred to memory 20 . during the processing of the data the processor may set certain bits in status register 18 . the processor device can communicate this information to the microprogram sequence controller 10 . for example , the status register 18 signals may be placed on the condition test ( ct ) output of the data processing circuits includes circuitry that can multiplex a plurality of condition test signals to the ct output . a detailed description of data processing circuits providing the functions herein described is supplied in &# 34 ; bit - slice microprocessor design &# 34 ; by john mick and jim brick , mcgraw - hill , 1980 isbn 0 - 07 - 041781 - 4 . the test signals appearing at the ct output of the data processing circuits 12 are applied to the test inputs of the microprogram controller 10 , via the status signal lines 44 , where , under control of the select inputs s0 - s3 , they are used to conditionally modify the address that will be presented to the microprogram memory 30 . microinstruction &# 34 ; branch &# 34 ; addresses can be obtained from any one of five sources : first , from the controller data bus 40 to the data 13 in inputs of the microprogram sequence controller , where it is used for microprogram addresses . a second possible source of microinstruction addresses is from a mapping read - only - memory ( rom ) 50 which is connected via a microinstruction register 51 to the aux -- data -- in inputs of the microprogram sequence controller 10 . these addresses are utilized by certain microinstructions as an alternative to the addresses on the data -- in inputs . the mapping rom 50 typically contains the starting microroutine &# 34 ; branch &# 34 ; address and is itself addressed by the output of the instruction register 52 . the instruction register 52 , in turn , is provided with a &# 34 ; machine instruction &# 34 ; from memory 20 under the direction of program counter 22 . the machine instruction is performed by executing several of the microinstructions ( stored in the microprogram memory 30 ) in sequence . the so - called four - bit &# 34 ; multiway &# 34 ; inputs m0 , ml , m2 and m3 to microprogram sequence controller 10 are a third source of microinstruction branch addresses whereby certain microinstructions permit substitution of one of the four - bit patterns present at m0 , ml , m2 or m3 for the least significant four bits at the data -- in inputs depending on the two least significant bit values on the data -- in inputs . the fourth and fifth sources of microinstruction branch addresses are from registers internal to the controller 10 ; a return or loop address from the top of a stack register ; or the next sequential address from the microprogram counter register . the microprogram sequence controller 10 has an internal multiplexer which , under the direction of microinstructions , controls the selection of the particular one of the five sources of branch addresses . in a typical application of the microprogram sequence controller , circuitry 54 for servicing asynchronous event handling requests would be included . for example , as shown in fig1 an interrupt / trap controller 56 and in interrupt / trap vector prom ( ivp ) 58 . the interrupt / trap controller 56 would receive at its inputs ( ii 1 , ii 2 , . . . , ii n ), via corresponding signal lines 60 , interrupt or trap signals from individual peripheral units , requesting some type of servicing ( i . e ., data transfers , reading switches , etc .). when an interrupt or trap signal is received at one of its ii 1 - ii n inputs , the interrupt / trap controller 56 issues interrupt or trap request signals from its interrupt / trap ( int / trap ) output , which are conducted to a set of interrupt / trap ( intr / trp ) inputs of the microprogram controller 10 via signal lines 61 . as will be seen , the signals received by the microprogram sequence controller 10 at its intr / trp inputs may cause it to initiate a storage routine to store information presently contained in various registers of the controller 10 to enable it to return to the present microinstruction sequence at the proper place . following receipt of an accepted asynchronous event handling request , controller 10 generates an acknowledge interrupt / trap signal at output inta which is sent via line 62 to ivp 58 and interrupt / trap controller 56 , which formulates a multibit word identifying the particular unit requesting servicing . the formulated word is conducted on the signal lines 64 to the ivp 58 . each memory location of the ivp 58 contains an address of each sequence of microinstructions contained in the microprogram memory 30 needed for servicing the individual requests . accordingly , the coded word generated by the interrupt / trap controller 56 and conducted on the signal lines 64 is applied to the address circuits of the ivp 58 . in turn , the ivp communicates the address of the first microinstruction of the needed asynchronous event handling subroutine to the microprogram memory 30 via a vector address bus 66 , which interconnects with the &# 34 ; y &# 34 ; address bus 32 via tri - state buffering . when the vector address communicated from the ivp 58 is applied to the microprogram memory 30 , the microinstruction for the subroutine needed to handle the asynchronous event requesting servicing is loaded into the pipeline register 36 . as with all microinstructions , portions of the microinstruction contained in the pipeline register 36 are returned via controller instruction bus 38 to microprogram sequence controller 10 to allow it to control the sequence of microinstructions of the asynchronous event subroutine . furthermore , these microinstruction portions are transmitted via bus 38 to interrupt / trap controller 56 which uses them to generate internal control signals . when the asynchronous event has been serviced , a last microinstruction will cause the microprogram sequence controller to effect a return to the program sequence of address generation from which it &# 34 ; jumped .&# 34 ; depending on the state of certain external signals applied to the intr / trp input terminals of the microprogram sequence controller 10 , such as the interrupt enable ( inten ) signal , the trap request signal ( intr ), the force continue ( fc ) signal , and the complemented carry - in ( c -- in ) to address incrementer signal , the return will be to the microinstruction next - following the microinstruction which was executing when the asynchronous event request was received , in the case of an interrupt , or for re - execution of the same microinstruction which was aborted when the asynchronous event request was received , in the case of a trap . what may be termed a &# 34 ; machine &# 34 ; instruction is loaded into an instruction register 52 . the contents of the instruction register 52 is applied to the mapping rom 50 to , in turn , generate the address of the first microinstruction in microprogram memory 30 which must be executed to perform the required function ( specified by the instruction held by the instruction register 52 ). a branch to this address occurs through the microprogram sequence controller 10 . the machine instruction may call for several microinstructions to be executed such as , for example , fetching data from memory 20 , performing arithmetic or logic operations within alu 16 , testing for overflow or other status indications and setting status register 18 accordingly , and so forth . following completion of the microinstructions called for by the machine instruction , controller 10 will normally initiate an instruction fetch cycle . at this point , however , there may be branches to other sections of the microcode . for example , the microprocessor might receive an interrupt at one of the interrupt controller inputs 60 to obtain an interrupt service routine address from the ivp 58 . in order to effect synchronous operation of the microprocessor of fig1 a system clock 68 is provided that generates clock pulses communicated on a clock line 70 to the individual elements of the microprocessor of fig1 . microprogram sequence controller 10 can be operated in a master / slave configuration with another sequence controller so that faults both of an internal and external nature can be detected . the two controllers are operated in parallel , one sequencer is designated as the master and operates normally as explained above . the second controller is put into slave mode by placing a high signal on a slave input and connecting all its outputs except an error output to the corresponding outputs of the master controller . a high signal on the error output of the master controller indicates a malfunctioning external device such as a driver or bus contention . a high signal on the error output of the slave controller indicates an error at either one of the controllers . while the interrupt / trap handling circuitry of the present invention will be described in relation to a microprogram sequence controller 10 having the specific internal architecture shown in fig2 it is understood that the internal structure , the type of internal elements , the number of bits processed thereby , and so forth , may vary from implementation to implementation while still providing the various benefits of the invention . the controller 10 shown in fig2 is identical in all respects except as will be described hereinafter to the controller shown in fig2 of the related copending u . s . patent application ser . no . 608 , 319 , filed may 8 , 1984 , on behalf of ole moller and sanjay iyer entitled &# 34 ; interruptible structured microprogrammed 16 - bit address sequence controller &# 34 ; and assigned to the assignee of the instant application , and is hereby incorporated by reference in the instant application . except insofar as will be described hereinafter regarding the interrupt / trap handling aspects of the controller of the instant invention , a detailed description of the controller of the instant invention is supplied in the related copending application . the microinstruction set supported by the instant controller is identical in all relevant respects to the instruction set described in the related copending application . fig2 a of the instant application is identical in all respects with fig2 a of the related copending application , and the detailed description therein applies equally to fig2 a of the instant application in all respects , except for the provision of the set of input terminals , collectively denoted intr / trp in fig1 of the instant application , including a force continue ( fc ) input to the controller 10 , an interrupt enable ( inten ) input , an interrupt request ( intr ) input and an interrupt acknowledge ( inta ) output connected to the interrupt logic circuit 176 , renamed interrupt / trap logic circuit 176 in the instant fig2 a , the relative locations of the microprogram counter ( mpc ) register 154 and the incrementer 158 , and the presence of signal lines communicating signals from the interrupt / trap logic circuit 176 to a disable ( dis ) input of control 100 and to a hold z ( hold z ) input of incrementer 158 , and for the presence of a signal line communicating a signal from a complemented carry - in ( c -- in ) input terminal of controller 10 to the incrementer 158 . the c -- in terminal is part of the set of input terminals denoted intr / trp on fig1 . ( fig2 b of the instant application and fig2 b of the related copending application are identical in all respects , and the description therein applies equally to fig2 b of the instant application in all respects ). the microprogram sequence controller 10 of the instant invention can handle an asynchronous event if the controller is enabled to receive interrupts or configured to receive a trap and is not being reset or held , i . e . a high is applied to an interrupt enable ( inten ) and an interrupt request ( intr ) terminal of controller 10 and a low is applied to a reset and a hold terminal . if a high is applied to a force continue ( fc ) terminal and to a complemented carry - in to incrementer ( c -- in ) terminal then a trap can be received . with reference to fig2 a of the instant application , an interrupt / trap logic circuit 176 receives at an input i 1 , the signal received at the interrupt request ( intr ) terminal of controller 10 . interrupt / trap logic circuit 176 alu has communicated to a set of inputs i 2 , i 3 , i 4 , i 5 and i 6 signals received at the five other input terminals of controller 10 mentioned above ; the signal at the interrupt enable ( inten ) input terminal to input i 2 , the signal at the reset ( reset ) input terminal to input i 3 , the signal at the hold input terminal to input i 4 , the signal at the slave ( slave ) input terminal to input i 5 and the signal at the force continue ( fc ) terminal to input i 6 . an interrupt acknowledge ( inta ) output terminal of controller 10 is connected to an output ( 0 ) of the interrupt / trap logic circuit 176 . a signal representing the occurrence of a high , at the fc or hold terminals of controller 10 is also conducted to a disable ( dis ) input of combinational logic circuit ( control ) 100 which if high , covers control 100 to generate signals which override the instruction word received at the inst inputs i 0 - 5 of control 100 , as will be described below , in connection with fig3 . in addition to the signal conducted to the disable ( dis ) input , control 100 receives from the interrupt / trap logic circuit 176 signals conducted to a force continue or hold ( fch -- z ) input and an interrupt processing ( int -- z ) input . the control 100 also receives the signal at the fc terminal of controller 10 . a complete description of those signals will be given in connection with the explanation of fig3 a , 3b and 3c , below . the function and meaning of the signals at the reset , slave , hold and inta terminals of controller 10 are as described in the related copending application . unlike their descriptions in the related copending application of the microprogram sequence controller 10 , the microprogram counter ( mpc ) register 154 of the instant invention contains the address of the currently - executed microinstruction , and the incrementer 158 contains the address of the currently - executed microinstruction plus one and is used to point to the next microinstruction to be executed if no branching is to be performed . the mpc register 154 receives the address at the output of interrupt multiplexer ( int mux ) 172 via signal lines 174 . mpc register 154 also receives the clock pulse clk at each clock cycle . the resulting contents is conducted along signal lines 156 from the mpc register 154 to the incrementer 158 , providing the &# 34 ; current address plus one &# 34 ; to the addr mux 116 and the stack mux 132 via signal lines 152 . incrementer 158 also receives the signal applied to the complmented carry - in ( c -- in ) terminal of controller 10 . if the carry - in to the incrementer c -- in is a high , the incrementer 158 is inhibited and the address received from mpc register 154 on signal lines 156 is conducted unchanged onto the signal lines 152 , if the c -- in is a low , the incrementer 158 adds one to the address received from the mpc register before it is placed onto the signal lines 152 . referring again to fig2 a of the instant application , the sixteen signal lines 162 forming the output of addr mux 116 are communicated to a set ( of sixteen ) three - state output drivers 164 . the drivers 164 place the 16 - bit branch address determined by microprogram sequence controller 10 onto a three - state , bidirectional y - bus 166 provided to receive , conduct and transmit the data signals to the data -- out terminals of controller 10 . the three - state output drivers 164 are enabled by a high received on a signal line 168 . signal line 168 is the output of an nor gate 170 which is controlled by signals received at a slave input , a hold input terminal of microprogram sequence controller 10 , and a signal ( int ) generated by an interrupt logic circuit 176 . when these three signals are low , nor gate 170 sets line 168 high and the outputs of three - state drivers 164 are enabled . the address signals on lines 162 may then be applied to y - bus 166 and presented to the data -- out terminals of controller 10 . when the signal on line 168 to three - state output drivers 164 is a low , the outputs of the three - state output drivers are in the high impedance state and an address signal may then be applied to the &# 34 ; y &# 34 ; address bus 32 ( fig1 ) by the ivp 58 ( fig1 ) to select the next microinstruction , as will be described below . address signal lines 162 are also coupled to an interrupt multiplexer ( int mux ) 172 which can conduct branch addresses present on y - bus 166 to mpc register 154 and comparator 129 via signal lines 174 . furthermore , the data -- out terminals can receive an interrupt address and conduct it along y - bus 166 to an interrupt multiplexer ( int mux ) 172 , as will be described below . an interrupt return address register ( int ret addr reg ) 175 is used to temporarily hold the return address of the interrupted or trapped microprogram when an interrupt or trap request is received by the microprogram sequence controller 10 . in all other respects , the structure and operation of the microprogram sequence controller 10 as shown in fig2 a of the instant application is essentially identical to the structure and operation of the microprogram sequence controller 10 as shown in fig2 a of the related copending application , as it relates to the handling of interrupts . to reiterate briefly , when there is no interrupt or trap request supplied to sequence controller 10 and it is not being operated in the slave mode and not being held , branch addresses are conducted from addr mux output lines 162 to the data -- out terminals via y - bus 166 and three - state output drivers 164 . furthermore , under these conditions , interrupt / trap logic circuit 176 codes the received inputs and generates interrupt signal ( int ) communicated to int mux 172 on line 178 so that the branch addresses input to int mux 172 are passed along signal lines 174 to the mpc register 154 and comparator 129 . when an interrupt is to be processed by microprogram sequence controller 10 , the current microinstruction can safely be permitted to finish execution . at the start of the next controller clock cycle , however , inten is high , reset and hold are low and interrupt / trap logic circuit 176 causes an interrupt ( int ) signal to change from low to high and this high signal is communicated via line 178 to int mux 172 which disables the address communication path from the addr mux 116 to mpc register 154 and comparator 129 via y - bus 166 and signal lines 174 . furthermore , y - bus three - state output drivers 164 are disabled by virtue of nor gate 170 sending a low signal along line 168 to drivers 164 , in response to the high int signal generated by interrupt / trap logic circuit 176 . the y - bus 166 , in addition to conducting the outputs of the three - state output drivers 164 to the data -- out terminals , is also connected to an input to the int mux 172 which , as mentioned earlier , has its output connected via signal line 174 to the mpc register 154 and therefrom via signal lines 156 to the incrementer 158 which increments the address supplied by the ivp 58 . accordingly , presence of the high int signal on line 178 causes int mux 172 to select the input receiving the signals on the bidirectional y - bus 166 from the data -- out terminals of controller 10 , namely the interrupt address . this interrupt address is then conducted via the output signal lines 174 of the int mux 172 to the mpc register 154 and the comparator 129 . the address from the addr mux 116 is saved by storing it in the interrupt return address register 175 and during the next clock cycle pushed onto the lifo stack 130 . the interrupt routine causes the content of certain of the registers to be stored in the lifo stack 130 , which can be retrieved later . the information stored provides an address linkage return to the microinstruction sequence that the microprogram sequence controller 10 was in when it received an interrupt request . since this return address is saved on the lifo stack 130 , nested interrupts can be handled by a mioroprogram sequence controller 10 constructed according to the teaching of the instant invention . in order to ensure that all information needed to establish the linkage back to the sequence interrupted , yet proceed with the branching and executing of the interrupt subroutine to which the branch occurs , all information is stored in one clock period . accordingly , certain of the information is temporarily stored in the int ret addr reg 175 which is then communicated to the lifo stack 130 via the stack mux 132 . the int ret add reg 175 receives the clock ( clk ), provided at and communicated from the cp input terminal , at its clock ( cl ) input . information is stored in the interrupt return address register 175 every clock ( instruction ) cycle ; but the stored information is used only when an interrupt signal is received . when the microprogram sequence controller 10 is enabled to detect traps , at the occurrence of a trapped event the current microinstruction must be aborted before the end of the current controller clock cycle and re - executed after the execution of a trap routine , which is designed to take intervening corrective measures . as soon as the controller 10 receives those inputs signalling the occurrence of an event to be trapped i . e ., inten , intr , fc and c -- in are high , interrupt / trap logic circuit 176 immediately causes the interrupt ( int ) signal to change from low to high and this high signal is communicated via line 178 to int mux 172 which , as in the case of an interrupt , disables the address communication path from the addr mux 116 to the mpc register 154 and comparator 129 via y - bus 166 and signal lines 174 . furthermore , y - bus three - state output drivers 164 are disabled by virtue of nor gate 170 sending a low signal along line 168 to drivers 164 , in response to the high int signal generated by interrupt / logic circuit 176 . accordingly , presence of the high int signal on line 178 causes int mux 172 to select the input receiving the signals on the bidirectional y - bus 166 from the data -- out terminals of controller 10 , namely the address of the trap routine . this trap address is then conducted via the output signal lines 174 of the int mux 172 to the mpc register 154 ( and the comparator 129 ). due to the relative positions of the incrementer 158 and the mpc register 154 within the controller 10 , the address present at the output of the incrementer 158 , which is the trap return address , i . e ., the address of the aborted microinstruction , is available to be conducted via signal lines 152 to the addr mux 116 and saved by storing it in the int ret addr reg 175 ( and during the next clock cycle ) pushed onto the lifo stack 130 , at the same time that the trap address is being stored in the mpc register 154 , as described above . since the c -- in signal received at the incrementer 158 is a high , the trap address received by the incrementer via signal lines 156 will be conducted unchanged via the signal lines 152 to the addr mux 116 . due to the fact that the fc signal input to the microprogram sequence controller 10 is a high , a high signal is generated by interrupt / trap logic circuit 176 and conducted to the dis input of the control 100 . control 100 then generates a signal communicated to the cond input of addr mux 116 , which causes addr mux 116 to conduct the trap return address to its output lines 162 . whereupon the address of the currently - executed microinstruction is replaced on the y - bus 166 by the address of the first microinstruction of the trap routine . since this currently - executed microinstruction did not complete execution , due to the high fc signal , the contents of the registers within the microprogram sequencer 10 were not updated and thus upon return from the trap routine , the instruction can be re - executed without further action . the handling of the trap by the microprogram sequence controller 10 therefore can proceed beyond this point as described above for an interrupt . the signals received by microprogram sequence controller 10 at its interrupt request ( intr ) and interrupt enable ( inten ) terminals are conducted to the interrupt / trap logic circuit 176 at its i 1 , i 2 inputs , respectively . these signals are latched by the interrupt / trap detect circuit 200 illustrated in fig3 a . as shown , a pair of flip - flops 202 , 204 receive on their clock ( c ) inputs the clk signal . the flip - flop 202 receives at its data ( d ) input the interrupt signal ( int ) generated by a nor gate 206 which , in turn , receives the intr , inten , terminals via inverters 208 and 210 and the signals conducted from the controller hold and reset terminals , each at a complemented input of gate 206 . accordingly , the true ( q ) output of flip - flop 202 is the logical and of the signal at the intr terminal and the signal at the inten terminal from the preceding clock cycle , if the microprogram sequence controller 10 is not being held or reset . this q output signal ( int -- z ) is received at the complemented input to an and gate 216 . in similar fashion , the data ( d ) input of the flip - flop 204 receives the signal on the signal line conducting the signal from the hold terminal of controller 10 . the signal at a first true ( q ) output of flip - flop 204 is received at an input to a wired - or gate 218 . the signal at a second true ( q ) output of flip - flop 204 forms the hold -- z signal output from interrupt / trap detect circuit 200 . gate 218 also receives at a second input the signal conducted from the controller 10 force continue ( fc ) terminal . since the signal at the hold terminal is latched by flip - flop 204 , the output of the wired - or gate 218 , force continue hold ( fch -- z ) will follow the present state of the fc terminal during any clock cycle when the microprogram sequence controller 10 is not being held . accordingly , the output signal fch -- z is applied to the disable ( dis ) input of control 100 which causes the currently - applied microinstruction bits i 0 -- 5 to be ignored and causes all output signals generated by control 100 to be inactive , other than causing a cmuxctl to be generated which deselects any of the inputs to the cmux 118 on lines 110 , 140 or 150 from the data -- in , tos , aux -- data -- in sources , respectively , and causing a cond signal to be generated which causes the addr mux 116 to select the inputs on lines 152 from the incrementer 158 to be placed on the output of the addr mux 116 and conducted via signal lines 162 to the int ret addr reg 175 . the signal int generated at the output of nor gate 206 is conducted via signal line 178 to an input of the nor gate 170 , which in turn generates a signal on line 168 causing the set of sixteen three - state output drivers 164 to achieve the high impedance state . this disconnects y - bus 166 from addr mux output lines 162 . the int signal is also conducted to the int mux 172 where it causes the interrupt / trap address placed on the y - bus 166 by the ivp 58 to be conducted to the mpc register 154 via signal lines 174 . interrupt / trap detection circuit 200 includes a nor gate 222 which receives at inputs the signal on the slave and hold terminals of controller 10 via inverters 224 and 212 ; respectively . the output of nor gate 222 is connected to inverting the enable input of a three - state buffer 226 . the output of nor gate 206 , the int signal , is passed through the inverting buffer 226 to become the inta signal that enables ( via its oe input ) the ivp 58 ( fig1 ). accordingly , if the currently - executing microinstruction is &# 34 ; trapped ,&# 34 ; the address of the currently - executing microinstruction is saved in the int ret addr reg 175 , as follows : during a trap the incrementer 158 receives a high signal from the c -- in terminal of controller to which , as shown in fig3 b , is conducted via an inverter 250 to an input of a wired - or gate 252 . the hold -- z signal generated by the flip - flop 204 is conducted to a second input of the wired - or gate 252 . the hold - z signal is a low since the controller 10 is , by assumption , not being held , both inputs to wired - or gate 252 are low and the resulting low output is received by increment circuit 254 which causes incrementer 158 to pass the address of the currently - executing microinstruction received on signal lines 156 unincremented , i . e . the trap return address , onto signal lines 152 where it is selected by addr mux 116 to be passed to the int ret addr reg 175 . at the same time , int mux 172 receives the address of the first instruction of the trap routine and passes it to the input of the mpc register 154 via lines 174 . at the next clock cycle , this address is received by the incrementer 158 on signal lines 156 and since a low carry - in c -- in signal is now received by the incrementer 158 , the address of the instruction next - following the first instruction of the trap routine is presented to the addr mux 116 via bus 152 . since the trap return address is present at the output of the int ret addr reg 172 it is pushed onto the lifo stack 130 by the first instruction of the trap routine , and accordingly this first instruction may not use the lifo stack 130 . the final instruction of the trap routine will pop this trap address from the lifo stack 130 and since it was not incremented prior to its push onto the stack , as mentioned , the microprogram sequence controller 10 will issue the trap return address on the data -- out terminal 166 upon return from the trap routine and accordingly the trapped microinstruction will be re - issued following execution of the trap routine . as mentioned above , since trap return addresses are pushed onto the lifo stack 130 , traps may be nested . as mentioned above , since the fc terminal of the controller 10 is tied high during a trap , the outputs of the control 100 , other than the cmuxctl signal and the cond signal previously described , are inactive and the currently - executing microinstruction bits i 0 -- 5 are ignored for the duration of the present controller clock cycle . thus , other than the actions just described regarding the storage of the trap return address in the int ret addr reg 175 and the storage of the address of the trap routine in the mpc register 154 , the trapped instruction is aborted . alternatively , if the currently - executing microinstruction is &# 34 ; interrupted ,&# 34 ; i . e . the fc terminal of controller 10 is low , the presently - executing microinstruction will complete execution since the fch -- z signal output from the wired - or gate 218 is low throughout the remainder of the controller &# 39 ; s present clock cycle . hence the control 100 will proceed to generate all the signals it normally would . however , during the present clock cycle , the nor gate 206 , at the time the interrupt is activated , will pass the signal from the intr terminal of controller 10 and the resulting signal int will be conducted on signal line 178 to the nor gate 170 which will cause the three - state output drivers 164 to disconnect the y - bus 166 from the addr mux 116 output lines 162 and the int mux 172 causes the interrupt address to be conducted to the mpc register 154 as mentioned above . accordingly , the address of the currently - executing microinstruction is saved in the int ret addr reg 175 since during an interrupt the c -- in terminal is high and thus the incrementer 158 passes the address of the currently - executing microinstruction received on signal lines 156 onto signal lines 154 where it is selected by the addr mux 116 to be passed to the int ret addr reg 175 . at the same time , int mux 172 receives the address of the first instruction of the interrupt routine and passes it to the input of the mpc register 154 via lines 174 . at the next clock cycle , this address is received by the incrementer 158 and incremented as explained above in connection with the trap - handling by controller 10 . similarly , the final instruction of the interrupt routine will pop this interrupt return address from the lifo stack 130 , the microprogram sequence controller 10 will issue the interrupt return address on the data -- out terminals 166 upon return from the interrupt routine and accordingly the microinstruction next following the interrupted microinstruction will be executed following completion of the interrupt routine . as mentioned above , since interrupt return addresses are pushed onto the lifo stack 130 , interrupts may be nested .	6
as previously stated , applicant has found that particularly good oil emulsification results are obtained when the secondary surfactant of the present invention stabilizes and solubilizes the primary surfactant composition to a degree such that the resulting , manufactured end product compositions ( before any field dilution of such manufactured compositions takes place ) have a hydrophilic / lipophilic balance ( hlb ) between about 12 . 0 and about 13 . 5 . those skilled in this art will appreciate that the term “ hlb ” as used herein is a well - known measure of the relative hydrophilicity or lipophilicity of a surfactant composition . generally speaking , hlb values are obtained by dividing the molecular weight of the hydrophilic component of a compound by the molecular weight of the compound and multiplying the resulting number by selected adjuster values known to those skilled in this art . hlb values range on a scale from 1 to more than 20 , with 1 indicating the least hydrophilic and 20 and above indicating the most hydrophilic . applicant has found that the stability of the dispersant / spilled oil emulsions produced by the compositions of this patent disclosure can be further increased when small amounts of an emulsion - stabilizing agent are included in applicant &# 39 ; s compositions . these emulsion - stabilizing agents are often used to provide steric stabilization of dispersed particles ( for example , literature published by imperial chemical industries plc ( ici ) suggests use of their hypermer a409 ® and hypermer a394 ® compositions for this purpose ). applicant has , however , found that the inclusion of such emulsion - stabilizing agents in the herein - described compositions for disversinc , spilled petroleum products greatly increases the stability of the resulting petroleum / composition emulsion . this is an important finding because the increased longevity of the petroleum / composition emulsion enables the emulsion to be more completely biodegraded . some of the better descriptions of such emulsion - stabilizing agents are found in the technical literature published by their manufacturers , and therefore , applicant hereby incorporates by reference the following publication describing the properties of ici &# 39 ; s hypermer ® polymeric surfactants and dispersants for industrial applications ”, ici americas inc ., 1994 . regardless of the identity of their supplier , however , such emulsion - stabilizing agents may constitute from about 1 . 0 to about 4 . 0 weight percent of the overall manufactured compositions of this patent disclosure . to prepare the emulsifying compositions of the present invention , the primary surfactant composition is preferably made by first combining the first and the second ethoxylated sorbitol oleates under light , nonaerating agitation . if desired the emulsion - stabilizing agent and / or the polyethylene glycol are combined under moderately high shear conditions and then blended with the primary surfactant composition . in some of the more preferred embodiments of this invention , the secondary surfactant is added to the primary surfactant composition by blending it under nonaerating shear conditions . finally , the water component , if desired , is preferably added by blending under low shear conditions . again , it should be understood that additional water can be incorporated into the manufactured compositions of this patent disclosure at a later time , e . g ., just prior to use , so that smaller volumes of the manufactured compositions of this parent disclosure may be transported to a spill site . the emulsifying compositions of the present invention may be applied to petroleum spills on water or on land by conventional methods known to those skilled in the oil spill remediation arts , e . g ., using various tank and spray nozzle devices or example , applicant &# 39 ; s emulsifying compositions may be sprayed directly on petroleum spills on water or on land with a small diameter hose equipped with a spray nozzle to supply a uniform spray . it also should be noted that it is not necessary to apply the compositions using a high - pressure hose . for large petroleum spills , applicant &# 39 ; s compositions may be applied by using a helicopter equipped with tanks having a dump spout that can be operated from within the helicopter or such helicopters may be provided with tanks and a pipe manifold systems that are affixed to a plurality of spray nozzles . for petroleum spills on land , dispension of the emulsifying compositions of this patent disclosure may be followed by physical agitation of the soil and then flushing with water . alternatively , applicant &# 39 ; s compositions also may be dispensed under pressure , for example , by a conventional fire extinguisher , whereby the pressure supplied by such a device mixes the emulsifying composition with the petroleum and simultaneously flushes it away . because of its emulsifying properties , the composition of this invention is useful in other applications as well , including , e . g ., extinguishing fires occurring in petroleum or petroleum - based products , cleaning surfaces ( including the body surfaces of wildlife , e . g ., birds ) contaminated with petroleum and / or petroleum - based product , accelerating biodegradation rate of petroleum or petroleum - based product ( e . g ., in a sewage system ), and suppressing production of methane and / or ammonia vapors by a petroleum or petroleum - based product or other material undergoing biodegradation or decay . thus , one aspect of the present invention is directed to a method for extinguishing a fire occurring in a petroleum or petroleum - based product and caused by vapors released by the product , involving applying the composition of this invention to the fire and the product . as stated previously herein , the composition of this invention encapsulates the petroleum droplets to form an emulsion and prevents escape of vapors that feed the fire , e . g ., ammonia and / or methane ( which are released by the petroleum or petroleum - based product ), thereby cutting off the source of and extinguishing the fire . a further aspect of the present invention is directed to a method for cleaning a surface contaminated with petroleum and / or petroleum - based product , involving applying the composition of this invention to the surface . non - limiting examples of suitable surfaces include those of airport runways , rail cars , tanker trucks , sea - going tankers , storage tanks , automobile fuel tanks , machine tool parts , track beds , railway system switches , and meat packing and poultry processing plants . the surface can also be the body surface of a wildlife member , e . g ., birds . yet another aspect of the present invention is directed to a method for accelerating biodegradation rate of a petroleum or petroleum - based product , involving applying the composition of this invention to the product . in one embodiment of this method , the product is disposed in a sewage system . a still further aspect of this invention is directed to a method for suppressing production of methane and / or ammonia vapors by a petroleum or petroleum - based product or other material undergoing biodegradation or decay and releasing ammonia and / or methane vapors , involving applying the composition of this invention to the product or material . this invention is further illustrated by reference to the following tests conducted upon various formulations of the compositions of this patent disclosure with respect to their dispersion abilities , biodegradation , and toxicity . three emulsifying compositions were prepared having the following three formulations a , b , and c : 45 weight percent — ethoxylated sorbitol septaoleate , containing 40 moles of ethylene oxide . 9 weight percent — ethoxylated sorbitol trioleate , containing 40 to 50 moles of ethylene oxide . 36 weight percent — linear ethoxylated secondary alcohol , containing 7 to 11 moles of ethylene oxide and having an hlb of between 10 and 15 , preferably 13 . 50 weight percent — ethoxylated sorbitol septaoleate , containing 40 moles of ethylene oxide . 10 weight percent — ethoxylated sorbitol hexaoleate , containing 50 moles of ethylene oxide . 20 weight percent — polyoxylethylene aryl ether , having an hlb of greater than 15 . 5 45 weight percent — ethoxylated sorbitol septaoleate , containing 40 moles of ethylene oxide . emulsifier formulation a was tested using a conventional low - energy swirling flask dispersant effectiveness test . this test is more fully described in 40 cfr section 300 and said regulation is incorporated into this patent disclosure . the specific oil types used in applicant &# 39 ; s test were two standard preference oils , that is , prudhoe bay crude and south louisiana crude ( a lighter oil than the prudhoe bay crude ). the test was performed in “ artificial sea water ” ( made from instant ocean ®) made to a salinity of 35 parts per thousand . one part ( by weight ) of emulsifying formulation a was used to 10 parts ( by weight ) of oil . the test was done with three or four replicate samples . results were measured as the uv - vis spectrophometric absorbance at 340 nm . 370 nm or 400 nm . the results of these tests are expressed below as the percentage of the oil remaining dispersed for 10 minutes after all agitation had ceased . those skilled in this art will appreciate that in the oil remediation arts , a dispersion of 45 % of the oil in such tests is regarded as being an acceptable test result . the results of applicant &# 39 ; s tests are given in table i and table ii . tables i and ii clearly show that emulsifying , formulation a disperses 48 % of the prudhoe bay crude and 65 % of the south louisiana crude . applicant also conducted emulsifying and dispersing tests with emulsifying formulation a using concentrations as low as about 3 % solutions with respect to “ lighter ” oil products such as no . 2 diesel oil , under moderately high shear conditions . however , applicant also found that if less agitation is available , somewhat higher concentrations , e . g ., 15 % solutions , were often required to emulsify and disperse a like amount of the no . 2 diesel oil . by way of contrast , in order to emulsify and disperse no . 6 fuel oil , a 100 % solution of formulation a was applied at a ratio of one ( 1 ) part of composition to 10 parts of oil under moderate agitation to produce the desired emulsification effects . the relatively quick and extensive biodegradation property of the oil - emulsifying compositions of this patent disclosure is one of their more important properties . it was tested using various tests known to the art including the e . m . p . a . test ( the e . m . p . a . is a swiss government organization charged with certifying oil - dispersant and emulsifying compositions ). to this end , a standard test ( empa sop 720 ) was performed on emulsifying formulation a to determine the rate of biodegradation of this formulation in combination with an oil sludge over a period of 28 days . the amount of degradation was determined by measuring the percentage of the initial total oxygen concentration . in such tests , applicant found that about 73 % of a combination of emulsifying formulation a / oil sludge ( at a concentration of 118 mg of formulation a per liter of oil sludge ) was biodegraded by day 3 of the experiment , and about 81 % was biodegraded day 21 . the further results of this test are shown in table iii . consequently , these test indicate that the values for the biodegradation of emulsifying formulation a in combination with oil sludge are well within the acceptable , range for certification of emulsifying formulation a by the e . m . p . a . applicant &# 39 ; s own laboratory and field tests showed that more than 81 % degradation of a combination of oil and emulsifying formulation a was observed within four ( 41 ) days of application . in these tests , about 10 % of the biodegradation occurred within the first three ( 3 ) hours after application of formulation a . in other tests , more than 97 % of the oil / emulsifying formulation a combination was biodegraded after 28 days . total elimination of the oil / formulation a combination in eight ( 8 ) days was observed in vet another laboratory test . the significance of these results can be better appreciated when one considers that natural biodegradation of one ( 1 ) kilogram of crude oil may take as long as 22 years . another advantageous attribute of applicant &# 39 ; s emulsifying / dispersant compositions is their low toxicity , especially toward aquatic life . in order to verify this low toxicity , a sample of formulation b ( as described above ) was tested for toxicity against two aquatic organisms , brine shrimp ( artemia sp .) and a species of fish ( fundulus heteroclitus ). the test procedure involved exposing the organisms to increasing concentrations of emulsifying formulation b alone and to a combination of equal amounts of emulsifying formulation b and diesel oil and determining , the lc 50 ( the concentration of formulation b alone or formulation b / oil combination that kills 50 % of the organisms ) after 8 hours of exposure for the shrimp and 96 hours of exposure for the fish . the lc 50 values for emulsifying formulation b alone were compared with lc 50 values for other dispersants of comparable efficiency as listed in the national contingency plan defined in 40 cfr section 300 . the results are shown in table iv . the data in table iv show that , for example , only 115 ppm ( parts per million ) of product d - 9 will kill one - half of the fish in 96 hours , whereas 4900 ppm of applicant &# 39 ; s emulsifying formulation b is required to kill one - half of the fish in the same period . for artemia sp ., the comparative dispersants kill one - half of the shrimp in 48 hours at concentrations of 8 to 630 ppm . emulsifying formulation b by contrast , had an lc 50 of 2500 ppm against artemia sp . these tests indicate that emulsifying formulation b is less toxic than comparative dispersants by an order of magnitude . when emulsifying formulation b was mixed with an equal amount of diesel oil and this diesel oil / emulsifier combination was tested for toxicity against organisms in the same way as described above , the lc 50 for artemia sp . was 1500 ppm , and the lc 50 for fundulus sp . was 1400 ppm . again , these toxicity values are far lower than the lc 50 values shown in table iv for comparative dispersants without oil . the above disclosure sets forth a number of embodiments of the present invention . those skilled in this art will however appreciate that other embodiments , not precisely set forth , also could be practiced under the teachings of the present invention and that the scope of this invention should only be limited by the scope of the following claims .	8
fig1 illustrates the stresses that may be induced in a straight tube 101 having a pressurized interior portion 104 . this interior pressure generates a radially oriented force 102 on side wall 106 . force 102 tends to push tube wall 106 outward and generates circumferential stress 107 . the internal pressure can also generate an axially oriented stress 103 . circumferentially oriented stress 107 is approximately twice that of the axially oriented stress 103 for a given internal pressure . fig2 illustrates stresses that can be induced in tube 101 when it has bending loads l1 , l2 and l3 applied to it . when the ends 105 and 106 of tube 101 are bent downward by l1 and l2 on fig2 and upward by l3 , tensile stress 203 is induced in the portion of the tube above the center plane 204 while compressive stress 202 is induced in the lower tube portion . tensile stress 203 varies in magnitude from zero at the center ( neutral ) plane 204 to a maximum at the upper periphery of tube 101 . compressive stress 202 varies in magnitude from zero at center plane 204 to a maximum at the lower extremity of the tube 101 . the force 102 and stress 103 caused by the internal pressure of tube 101 are not shown on fig2 . however , if the tube of fig2 is pressurized and bent , then both the pressure generated stresses 107 and 103 , as well as the bending generated stresses 202 and 203 , are present in the tube . fig3 discloses the deflections to which the flow tubes of a typical coriolis flowmeter are subjected when in use . flow tubes 308 and 309 are fixed at their lower leg extremities to circular faces of member 306 and 307 comprising a portion of the flow tube manifold 302 . when in use , inlet flange 303 and its opening 304 are affixed by holes 313 and bolts ( not shown ) to a supply conduit ( not shown ) while outlet flange 305 is connected by bolts through holes 314 to an exit conduit ( not shown ). when in use , flow tubes 308 and 309 are deflected out of phase with respect to each other inwardly and outwardly along the direction of arrow 312 . this deflection is generated by a driver similar to driver d shown on fig5 . this deflection causes the flow tubes to bend about a pivot point at surfaces 306 and 307 where their lower leg ends are attached to circular surfaces 306 and 307 . flow tubes 308 and 309 assume an undeflected position as represented by their solid lines and a deflected position as shown by their dotted lines 310 and 311 . the deflections of flow tubes 308 and 309 are termed the out - of - phase bending mode . the flow tubes must not be unduly stiff in their lower leg portions . if they were they would be unable to generate sufficient deflections in response to coriolis forces for the flowmeter to perform its measurement functions . the measurement functions of the coriolis flowmeter and its flow tubes 308 and 309 are performed by a left and a right sensor such as elements rs and ls of fig5 . these sensors , in a well known manner , detect the relative velocity of the two flow tubes with respect to each other . the phase difference of this velocity signal is proportional to the generated coriolis forces and , in turn , to the flow rate of the material in the flow tubes . fig4 discloses the coriolis flow tubes of fig3 being subjected to lateral deflections in the direction shown by arrow 322 . the solid line represents the normal and desired position of flow tube 309 . dotted line 310 represents one extremity of the undesired lateral vibration mode of flow tube 309 . the out of phase bending deflections of fig3 are a desirable vibration mode of the flow tubes . the lateral vibration mode of fig4 is undesired and produces no useful information . this lateral vibration mode is induced in the flow tubes by undesirable factors such as noise and vibrations to which the coriolis flowmeter 302 may be subjected to when in use . the embodiment of fig5 is similar to that of fig3 except that the lower , front and rear ( not shown ) surfaces of legs 501 through 504 are covered with or include axially oriented fibers 506 through 509 extending from the lower extremities of the legs upwards along the length of the legs to a location proximate sensors ls and rs . the left legs 501 and 502 are covered on their front and rear surfaces with axially oriented fibers 506 and 507 . right legs 503 and 504 are covered on their front and rear surfaces with axially oriented fibers 508 and 509 . the axially oriented fibers 506 , 507 , 508 and 509 and the fibers ( not shown ) on the rear leg surfaces impart a stiffness to the legs . this increased leg stiffness raises the resonant frequency of flow tubes 308 and 309 for the out - of - phase bending ( drive ) mode . this increased resonant frequency is sometimes desirable to provide increased frequency separation between the drive frequency and the frequency of vibration generated by undesirable ambient conditions in which the flowmeter is operated such as frequencies generated by pumps , adjacent machinery and even the 50 / 60 hz of ac power . the embodiment of fig6 is similar to that of fig5 in that flow tubes 308 and 309 have side legs 501 , 502 , 503 and 504 . the left side legs 501 , 502 are embedded with or include axially oriented fibers 601 and 602 on their left side in addition to axially oriented fibers on their unseen right sides . the right side legs 503 , 504 are formed with axially oriented fibers 603 and 604 on their left side as well as unseen fibers on their right sides . the axially oriented fibers of fig6 increase the stiffness of the flow tube to lateral movement of the type shown in fig4 but do not substantially increase the stiffness of the side legs with respect to out - of - phase bending deflections of the type shown in fig3 . thus , the embodiment of fig6 provides a flow tube structure that has increased lateral vibration frequency but that does not affect the vibrational frequency for out - of - phase bending . the fiber placement shown in fig6 can increase the frequency separation between the drive and lateral deflection modes . fig7 discloses a pair of substantially u - shaped flow tubes 308 and 309 having axially oriented side leg fibers 701 and 702 , top portion fibers 703 and 704 , and right side leg fibers 705 and 706 . these axially oriented fibers surround the entirety of flow tubes 308 and 309 and provide increases the stiffness to the flow tubes for all modes of vibration including the out - of - phase bending mode of fig3 and 5 as well as the lateral vibrational mode of fig4 . this configuration also increases the stiffness of the flow tubes with respect to the desired coriolis forces generated in response to material flow through the tubes as they are vibrated . this increased stiffness is sometimes desirable to provide a higher drive frequency as well as to fine tune the operational frequencies of the flow tubes to controllably separate the desirable operational frequencies from the undesirable frequencies imparted by noise , surrounding machinery , etc . fig8 discloses flow tubes 308 and 309 covered in their entirety by fibers 807 , 808 circumferentially oriented with respect to the longitudinal axis of the flow tubes . the circumferential orientation of the fibers has a limited effect on the stiffness of the tubes with respect to any type of bending . the main purpose served by the fibers 807 , 808 is to increase the capability of the walls of flow tubes 308 and 309 to contain higher internal pressures than would be the case for a flow tube of the same wall thickness but not containing the circumferentially oriented fibers . this enables flow tubes to be used that have thin flexible walls and enhanced sensitivity to the coriolis forces . since the circumferentially oriented fibers 807 , 808 have only a limited effect on bending stiffness , flow tubes 308 , 309 have a high flexing capability while being able to contain higher internal pressures . fig9 discloses a pair of u - shaped flow tubes 308 and 309 whose left side legs 901 and 902 and right side legs 905 and 906 have axially oriented fibers 909 , 910 and 913 , 914 . the entirety of tubes 308 and 309 include circumferentially oriented fibers 907 , 908 and 917 , 918 . the axially oriented fibers stiffen the side legs for lateral bending as shown for the embodiment of fig6 . this raises the resonant frequency of the flow tubes for lateral bending mode vibrations . the circumferentially oriented fibers provide a pressure containment enhancement function and a limited amount of increased stiffness . fig1 discloses a substantially straight flow tube 1000 whose outer wall surface 1001 includes multi - layer circumferentially oriented fibers 1002 . fibers 1002 provide increased pressure containment and a limited increased rigidity to the structure . a flow tube 1000 of increased sensitivity and increased side wall flexibility is achieved by making the isotropic portion 1005 of the side walls thin to achieve the desired flexibility . the layers 1004 of circumferentially oriented fibers 1002 affixed to portion 1005 provide a pressure containment function . if the internal pressure is relatively low , a single layer of fibers 1002 may suffice . additional layers may be added to accommodate higher internal operating pressures . fig1 discloses a flow tube 1100 having a left end portion 1104 , side walls 1105 and axially oriented fibers on the front and rear surfaces 1101 of the tube . the fibers on the rear portion of tube 1101 surface are not shown . the side walls 1105 alone provide a limited amount of resistance to a bending or deflection of the type shown in fig2 in a direction as indicated by arrows 1106 and 1107 . fibers 1102 increase the side wall stiffness and thereby increase the resonant frequency of the tube in the direction perpendicular to the plane of the fibers 1102 . fig1 shows a flow tube 1201 having a side wall 1205 and an end portion 1204 having axially oriented fibers 1202 and circumferentially oriented fibers 1203 affixed thereto . side walls 1205 of tube 1200 provide an increased resistance to bending by an amount related to the thickness of the side walls . side walls 1205 by themselves also provide a pressure containment function by an amount related to the thickness of the side walls and the material comprising the side walls . additional pressure containment is provided by circumferentially oriented fibers 1203 which may include as many layers as may be desired to accommodate the expected working pressure to which tube 1200 is subjected . the axially oriented fibers 1202 impart an increased bending stiffness to the tube in a direction perpendicular to the plane of the fibers 1202 . fibers 1202 do not affect the flexibility of tube 1200 in so far as concerns bending in an up and down motion as shown on fig1 . however , fibers 1202 provide significant increased rigidity and resistance against tube bending in a direction perpendicular to the front and rear tube surfaces containing fibers 1202 . the fibers on the back side of tube 1200 are not shown in fig1 . fig1 shows a flow tube 1300 having a left end portion 1303 and a side wall 1302 . surface 1301 of the side wall includes or is covered with helically oriented fibers 1304 and 1305 comprising a double helix . the helically oriented fibers include a component in the circumferential direction as well as a component in the axial direction . therefore , depending upon the angle of the helix , the fibers provide a pressure containment function due to their circumferential component as well as a stiffening function due to their axial component . the magnitude of the pressure containment function and the stiffening function can be controlled by the angle of the helix . this double helix prevents pressure or bending stresses from causing the tube to twist . fig1 through 18 illustrate other flow tube configurations to which the principals of the invention may be applied . fig1 illustrates an oval flow tube 1401 having a solid wall 1402 and a circular interior cross section 1403 . fig1 illustrates a rectangular flow tube 1501 having a solid wall 1502 and a circular interior 1503 . fig1 discloses a flow tube 1601 having an irregular shaped exterior having a solid body portion 1602 and a circular interior 1603 . fig1 discloses a flow tube 1701 having an irregular exterior wall portion 1702 and a hollow center 1703 having a width greater than its height . the flow tube on fig1 is similar to that of fig1 in that its external configuration of flow tube 1801 is irregular , it has a solid wall 1802 and an irregularly shaped hollow interior 1803 whose width is greater than its height . flow tubes 1701 and 1801 may be used with strain gauges 1704 and 1804 to measure their internal pressures . the operation is such that as the internal pressure increases , the height of the interior portion of the flow tubes expands and stresses the flow tube wall portions immediately above and below interior portions 1703 and 1803 . strain gauges 1704 and 1804 affixed to the flow tube walls detects the stress created by the walls deformation and generate output signals indicative of inner pressure . wall elements 1702 and 1802 are advantageously geometrically designed so that the hollow interior 1703 and 1803 gradually approaches a circular shape , and the measured strain gradually increases with increasing internal pressure . it is to be expressly understood that the claimed invention is not to be limited to the description of the preferred embodiment but encompasses other modifications and alterations within the scope and spirit of the inventive concept . for example , the principals of the invention are applicable to flowmeters having flow tube configurations of any type including straight , curved , u - shaped , v - shaped , irregular shaped , as well as the specific configurations disclosed herein . the principals of the invention are not limited to round flow tubes . they are equally applicable to flow tubes having a rectangular , triangular , or irregular shape .	6
in the following description the method of the present invention will be described in connection with the mounting of insulation to concrete walls . however , it will be obvious to one skilled in the art that the method of this invention could be used as well in connection with the mounting of other types of paneling , such as decorative paneling , as well as wall shelving and the like . in referring to the drawings , the same identification numerals will be used throughout to denote identical parts and structures . in fig1 an exploded view is shown of the wall forms used in a popular method of cast - in - place concrete construction . these forms are secured together to define the walls of a structure and remain in place to receive wet concrete and hold it in place while the concrete cures . the wall forms which define each side of the wall are secured together by nuts and bolts or pins and wedges ( not shown ). the wall forms which define opposite sides of the wall are held in spaced relation by wall ties 8 , each of which is inserted into the tie slots 9 of corresponding wall forms . after the concrete has cured , wall forms 1 are removed to expose a finished concrete wall 16 . wall ties 8 , which were bonded to the cement during curing , remain in the wall . the part of each wall tie which extends out from the exterior face of the concrete wall is normally broken off with the remaining part covered with mortar to maintain the aesthetic quality of the exterior surface . the part of each wall tie which extends from the interior surface of the concrete wall is left intact for purposes which will become apparent from the discussion which follows . wall tie 8 is shown in detail in fig3 . it is a rectangular solid and may be made from almost any strong , rigid material . steel or aluminum may be used as well as other metals , alloys or hard plastics . wall tie 8 has a hole 5 through each of its ends . fig4 illustrates another embodiment of the wall tie used in cast - in - place construction . this embodiment is designated by the numeral 6 and is referred to as the slotted wall tie . each embodiment of the wall tie may be interchanged with the other for maintaining the wall forms in spaced relation and for functioning in the method of the present invention . for the purpose of convenience , the method of the invention will be described as it is practiced with wall tie 8 of fig3 . after wall forms 1 have been removed with wall ties 8 remaining in the wall , furring strips are affixed to the cement wall . insulation is then mounted on the furring . this method provides for a dead air space between the insulation and the concrete wall which aids in insulating the wall and provides for a chamber to install conduit for electrical wiring or the like . fig1 illustrates the spacial relationship of the furring strips 10 to the insulation 20 and the cement wall 16 and the dead air space 29 created therebetween . in fig5 furring strip 10 is illustrated in perspective . it is typically a 1 inch × 4 inch strip of construction grade lumber which is as long as the wall is high . other dimensions and materials for the furring may be used , however , as conditions permit . the furring strip is slotted along its center line at intervals which correspond to the vertical distances between wall ties 8 . it is noted here that wall ties 8 align vertically in almost a perfect plumb line because of the restraints inherent in the method of securing wall forms 1 together during cast - in - place construction . the slots in furring strip 10 are identified by numeral 11 in fig5 . furring strip 10 is then placed over wall ties 8 and pressed up against wall 16 as shown in fig6 a . as can be seen in fig6 b , each wall tie 8 extends beyond furring strip 10 to expose part of hole 5 . according to the method of this invention , furring strip 10 is pressed up tightly against and permanently anchored to cement wall 16 by inserting a wedge - like fastening member into hole 5 in front of furring strip 10 . the preferred embodiment of the fastening member is illustrated in fig7 a - 7c and is identified by numeral 12 . fastening member 12 is also referred to as the &# 34 ; quick wedge .&# 34 ; quick wedge 12 is about three ( 3 ) inches long and is manufactured from strong rigid material . metals , such as steel , aluminum or ferrous - metal alloys , or high impact nylon or nylon - fiberglass may be used . its bottom surface 19 is flat and is intended to be placed against furring strip 10 . except for its leading edge , which is tapered , bottom surface 11 has a substantially constant width which is smaller than the diameter of hole 5 . quick wedge 12 has a substantially curved cross section when viewed from its back . its height increases gradually from the leading edge . back surface 31 is substantially flat , being intended to be struck by a hammer or mallet during insertion into hole 5 . quick wedge 12 has hole or holes 13 disposed vertically through it and positioned about one - quarter of the quick wedge &# 39 ; s length from its ends . as shown in fig8 quick wedge 12 is driven into the exposed part of hole 5 , and thereby furring strip 10 is pushed away from the frontmost boundary of hole 5 and is pressed more and more tightly against cement wall 16 . quick wedge 12 is made in different dimensions , usually varying in height , to accommodate the variations which exist in the entent to which holes 5 extend past furring strip 10 . for those instances in which hole 5 completely extends beyond furring strip 10 , for example , as shown in fig9 a small , thin , slotted piece of wood 14 or other material may be placed over wall tie 8 to cover part of hole 5 and to act as a spacer . quick wedge 12 is then driven into the exposed portion of hole 5 as described above . after quick wedge 12 has been driven into hole 5 so that furring strip 10 is pressed firmly and tightly against cement wall 16 , nail or nails 27 are placed through holes 13 of the quick wedge and driven into the furring . thus , the quick wedge is secured in place and the furring is permanently wedged in place against and anchored to the cement wall . ( see fig1 .) fig1 illustrates a portion of cement wall 16 with furring strips 10 permanently in place . insulation in the form of panels 20 is then mounted on the furring . ( see fig1 ) the insulation could be made from one of many known insulating materials , for example , rigid polystyrene plastic or urethane . the panels are cut so that they are wide enough to extend from the wall ties extending through one furring strip to the wall ties extending through the second furring strip over . the insulation is installed by placing one edge of panel 20 against the wall ties extending through one furring strip , placing its other edge against the wall ties extending through the second furring strip over and pushing in the center of the panel so that the wall ties of the center furring strip ( shown in phantom lines in fig1 ) partially penetrate the insulation . the insulation panel is then permanently affixed to the furring by driving nails 25 through the insulation into the center and two side furring strips . ( see fig1 and 13 .) if more rigid insulation panels are used , or if narrower panels are used , the insulation may be mounted on two consecutive furring strips without an intervening center furring strip . in that event , of course , the insulation would be nailed to the furring strips at its sides . fig1 provides a top view of insulation 20 mounted on cement wall 16 according to the method of the present invention . dead air space 29 is thereby formed . this dead air space , as previously discussed aids in insulating the wall and provides a chamber through which electrical conduit and the like could be placed prior to the mounting of the insulation panels . other types of paneling , such as decorative paneling could be installed by the method of this invention . by the same method , wall shelving could be installed on cement walls . without departing from the spirit of the present invention , decorative paneling and wall shelving could be installed over the previously mounted insulation panels . the present method provides for strong and permanent installation of paneling or shelving onto cement walls . this invention provides a quick , labor and cost saving method for making such installations and is simple enough for even the novice home builder to use competently . insulation of ceilings is also accomplished by the present invention . short tie sections ( not shown ), similar to wall ties 12 , are inserted into the tie slots of the forms used in ceiling or intermediate floor slab construction before the concrete is poured . after the concrete has cured and the forms are removed , the short tie sections which extend from the ceiling are used in the same manner as wall ties 12 for the fastening of furring strips 10 to the ceiling , with the remaining steps for insulating the ceiling being substantially the same as that described for insulating walls . while the invention has been illustrated and described in connection with the preferred procedures , it should be understood that it is capable of variation without departing from the principals of the invention and it is intended that any modified procedures or equivalents which may be reasonably included within their scope are covered by the claims .	4
an embodiment of the present application will be described below using fig1 to 6 . generally speaking , in the case that multiple machine units 37 , each comprising a supply section 3 a for supplying thread 41 , a thread take - up arm 22 and a needle bar 21 , are arranged in parallel on a machine head 3 , and that embroidery is made on cloth 29 , a configuration in which one of the multiple machine units is selected and used is widely known as a well - known matter . in addition , embroidery using the selected machine unit has been described in detail as common technical knowledge using fig5 ( a ), a known figure , as described above . hence , for understanding the embodiment of the present application shown in fig1 to 4 , the understanding should be done on the premise of the technical matters including the above - mentioned known matter . in the case that the configuration and the operation regarding the machine head 3 , the moving base frame 6 , the thread supplied from the thread supply section 3 a to the needle 21 a , the thread take - up arm 22 , the needle bar 21 , etc . shown in fig1 to 4 are easier to understand when they are described in relation to the technical matters shown in fig5 ( a ), refer to the technical matters shown in fig5 ( a ) because the same numerals as those used in fig5 ( a ) are used . next , numeral 3 designates the machine head provided on the front side of the frame , and numeral 6 designates the moving base frame that moves laterally under the guidance of a rail 4 provided on the front side of a machine arm . in the moving base frame 6 , the multiple machine units , each comprising the thread supply section 6 a , the thread take - up arm 22 and the needle bar 21 as is well known , are provided as shown in the figure . in the moving base frame 6 , numeral 6 a indicated above designates the thread supply section , and the thread supply section comprises multiple tension mechanisms 39 a , multiple thread breakage detectors 39 b , etc ., the number of which corresponds to the number of the needles , as is well known , and the thread supply section is configured so as to be able to supply the thread 41 ( including thread elements designated by numerals 42 , 43 , 44 , 45 and 46 ) from each of multiple spools ( not shown ) disposed above to the needle 21 a corresponding thereto . in the figure , the thread is shown partially , and the other most portions thereof are not shown in the figure because they are well known . in the moving base frame 6 , numeral 6 b indicated in the intermediate portion of fig1 designates a thread take - up arm mechanism section ; as described using fig5 ( a ), a thread take - up arm mechanism including a mechanism section selectively operated in relation to the operation of the thread take - up arm drive mechanism 8 is incorporated inside the section , and is configured so that multiple take - up arms 22 , 22 , . . . , 22 arranged in parallel as shown in fig2 can be selectively driven vertically . in this thread take - up arm mechanism section 6 b , a plate - like cover ( a cover integrally molded using a synthetic resin ) 50 exemplified as a thread twining preventing member is removably installed using appropriate fasteners , such as screws , while having an appropriate clearance 6 f from the surface 6 e of the thread take - up arm mechanism section . the thread twisting preventing member 50 is configured to have a size capable of covering the surface 6 e of the thread take - up arm mechanism section . on the surface of the preventing member 50 , thread take - up arm passing slits 52 are arranged in parallel , the number of which corresponds to the number of the thread take - up arms 22 , and each of the thread take - up arm passing slits 52 is required to vertically move the through hole 33 of each of the multiple thread take - up arms arranged in parallel between the top dead center 22 e and the bottom dead center 22 f ( for example , approximately 60 mm ) using a thread take - up arm shaft 24 as a pivot shaft . in addition , on one side ( the side through which the first thread element 42 corresponding to each thread take - up arm is passed ) of each of the multiple slits 52 , a thread passage 51 formed in a recess shape so as to cause the first thread element 42 to pass through between the first thread guide eye 31 and the second thread guide eye 32 is provided as shown in fig2 . furthermore , in each machine unit 37 , a jump preventing member 54 is provided in the thread passage 51 on the side of the adjacent machine unit . the jump preventing member 54 is formed in parallel with the passing locus ( 42 ) of the first thread element 42 so as to become a jump preventing face 54 a that makes the first thread element 42 come into contact with the wall face and reduces the lateral wobbling when the first thread element 42 wobbles laterally owing to the wind pressure caused at the time of the lowering of the thread take - up arm . the height ( the dimension extending in the left direction of fig3 ) of the jump preventing member 54 is made larger than the passing locus 42 of the first thread element and smaller than the reciprocating locus 33 a of the through hole 33 of the thread take - up arm ; the jump preventing member is thus positioned at an intermediate position between the two . the height of the jump preventing member 54 is made lower than the passing locus 42 of the first thread element as shown in the figure to avoid disturbance at the beaten portion 43 a of the second thread element 43 owing to the wind pressure from the thread take - up arm lowering abruptly near the bottom dead center of the thread take - up arm . in the thread passage 51 of each machine unit 37 , as shown in fig2 , at least in the space 59 between the position of the through hole 33 of the thread take - up arm 22 located at the bottom dead center 22 f and the position of the second thread guide eye 32 provided therebelow , a “ beaten thread receiving face 53 a ” is provided in the upper half zone 60 thereof ( for example , approximately 6 to 8 mm ). when the through hole 33 of the thread take - up arm lowers abruptly in the direction of the curved passing locus 33 a from the top dead center to the bottom dead center , the second thread element 43 that is pulled using the through hole 33 of the thread take - up arm and abruptly lowered is deflected to the “ beaten thread receiving face 53 a in the depth direction ( the right direction in fig2 ) of the through hole 33 of the thread take - up arm in an “ oversupply state .” in the depth direction to which the second thread element 43 being in this “ oversupply state ” is deflected and at a position near the place in which the beaten portion 43 a of the second thread element 43 being deflected as described above can be received ( the portion with which the “ oversupply portion ” of the second thread element 43 from the through hole 33 of the thread take - up arm makes contact , that is , a deflecting dimension 62 , for example , approximately 10 mm ( approximately 6 mm to 16 mm )), the “ beaten thread receiving face 53 a ” formed of the surface of the beaten thread receiving member 53 is provided . hence , the portion 43 a of the second thread element 43 being formed into a loop shape in the deflected “ oversupply state ” becomes a “ state of clinging ” to the “ face ” of the “ beaten thread receiving face 53 a ”, and the loop portion is pulled up as the through hole 33 of the thread take - up arm is raised abruptly without having a time of making an acute angle and forming twining . furthermore , at the positions on both sides of the receiving face 53 a and enclosing the front space 51 of the receiving face 53 a , the jump preventing faces 54 a and 54 a are provided to make the beaten portion 43 a of the second thread element 43 come into contact with and cling to the “ face ”, thereby preventing the second thread element 43 from jumping . the depth dimension 61 of the thread passing groove and the width dimension 63 of the thread passing groove cannot be determined uniformly because the deflecting inertia of the thread 41 is different depending on the rotation speed of the spindle ( the lowering speed of the thread take - up arm ), the kind , the thickness and the type of twisting of the thread , as in the case of the deflecting dimension 62 ; however , the depth dimension of the thread passing groove should only be approximately 2 mm to 6 mm , and the width dimension of thread passing groove should only be approximately 4 mm to 8 mm , for example . the receiving face 53 a and the jump preventing faces 54 a and 54 a should only be extended upward as shown in the figure beyond the space 59 between the position of the through hole 33 of the thread take - up arm located at the bottom dead center 22 f and the position of the second thread guide eye 32 provided therebelow . next , in each of the machine units 37 , 37 , . . . , 37 arranged in parallel , at the upper position of the thread passage 51 through which the first thread element 42 passes and on one side ( the right side in fig2 ) of each thread take - up arm 22 , the first thread guide eye 31 for guiding the first thread element 42 supplied from the thread supply section 6 a to the second thread guide eye 32 provided below via the thread passage 51 is provided ( in fig2 , nine pieces are arranged in parallel so as to correspond to the number of the thread take - up arms ). next , as shown in fig2 and 3 , the position of each of the multiple second thread guide eyes 32 arranged in parallel , with respect to an extending member 56 provided below the thread twining preventing member 50 , is determined at a lower position below each of the thread passages 51 , and also below the position of the through hole 33 of each thread take - up arm 22 located at the bottom dead center 22 f , while having the space 59 ( for example , approximately 12 to 17 mm ) determined usually . the second thread guide eye 32 is configured so as to be able to return the first thread element 42 going down along each thread passage 51 and to guide the thread element serving as the second thread element 43 toward the through hole 33 of each thread take - up arm 22 . next , each of the multiple third thread guide eyes 34 arranged in parallel , with respect to the extending member 56 provided below the thread twisting preventing member 50 shown in fig2 and 3 , is provided in the vicinity ( refer to fig2 ) of the left side of each second thread guide eye 32 so as to be able to guide the third thread element 44 going to the corresponding needle 21 a after passing through the through hole 33 of each take - up arm 22 . in the moving base frame 6 , numeral 6 c indicated in the lower portion designates a needle bar mechanism section , and a needle bar drive mechanism for vertically driving the needle bar 21 and the needle 21 a of the selected machine unit 37 in synchronization ( as shown in fig6 ) with the selected thread take - up arm 22 as is well known , in synchronization with the rotation of the machine spindle as described above using fig5 ( a ) is incorporated inside . in this kind of configuration , when sewing is carried out by moving the moving base frame 6 in the lateral direction ( indicated by arrow 65 ), by selecting one of the multiple machine units 37 arranged in parallel and by vertically moving the thread take - up arm 22 and the needle bar 21 of the selected machine unit 37 , the elements of the thread 41 , such as the first thread element 42 , the second thread element 43 and the third thread element 44 , are sequentially guided using the first thread guide eye 31 , the second thread guide eye 32 , the through hole 33 of the thread take - up arm 22 and the third thread guide eye 34 , thereby advancing toward the needle 21 a . the usage state of the sewing machine shown in fig1 to 4 ( also refer to fig5 ( a )) will be described . it is assumed that one of the multiple machine units 37 is selected as shown in the figure ( for example , the fifth unit from the left in fig2 is selected ) and that sewing starts as is usually known . in this case , as the spindle 7 rotates at high speed , both the take - up arm 22 and the needle bar 21 vigorously move vertically ( for example , vertical movement of 600 to 1200 times per minute ), whereby embroidery is made on the cloth 29 stretched around an embroidery frame . the operation is done at the timing shown in fig6 . as the embroidery proceeds , the thread 41 supplied from the thread supply section 6 a is supplied to the needle 21 a sequentially . in this thread supplying process , when the thread take - up arm 22 lowers abruptly from the top dead center 22 e to the bottom dead center 22 f , the second thread element 43 located between the two points and having a length corresponding to the length between the two points becomes an “ oversupply state ” at the space ( 59 ) between the thread guide eye 32 and the through hole 33 of the thread take - up arm having been lowered to the bottom dead center 22 f as shown in fig2 and 4 . however , in the configuration shown in fig2 and 4 , the “ oversupply portion 43 a ” of the second thread element 43 having been abruptly lowered together with the through hole 33 of the thread take - up arm is beaten to the “ beaten thread receiving member 53 a ” provided in the depth of the thread guide eye 32 as shown in the figure and cannot rotate on its axis . furthermore , the “ oversupply portion 43 a ” of the second thread element 43 , having gained momentum , is attached to the jump preventing faces 54 a provided on both sides of the “ beaten thread receiving member 53 a ” as shown in the figure , and cannot perform twisting ( twining ) by itself . at the next moment , the thread take - up arm rises , and the second thread element 43 is pulled up . in this way , the “ oversupply portion 43 a ” of the second threat element 43 can be used for continuous sewing without being twisted ( twined ).	3
as described earlier , the preparation of the antistatic film in the prior art is usually accomplished by adding conductive particles which result in problems such as low transmission or transparency , poor stability and technical issues such as poor dispersion and color shift . to solve these problems , unlike those in the prior art , the present invention provides a solution with no inorganic conductive particles added . by doing so , problems like low transmission or transparency , poor stability and technical issues such as poor dispersion and color shift would all no longer exist . the present invention provides an ionic antistatic coating composition , comprising a saturated polymer ; inorganic metal salt ; a uv - curing resin curable by radiation of uv light ; and a volatile organic solvent . the ionic antistatic coating composition of the present invention does not contain solid conductive powders or particles . wherein , n = 2 - 5 , m = 2 - 5 , x is oxygen , nitrogen , or sulfur , y is oxygen , nitrogen , or sulfur atom , and x and y provide lone pair electrons . according to one preferred embodiment of the present invention , the saturated polymer may be a cross - linked copolymer of polypropylene oxide ( ppo ) and polyethylene oxide ( peo ). in addition , the saturated polymer may be a polymer of identical monomer , such as ppo or peo . the inorganic metal salt includes a metal cation and an anion . according to one preferred embodiment of the present invention , the inorganic metal salt has a lower lattice energy such as li , na , k , rb and li is preferred . the anion is preferably the perchlorate ion but not limited to this . in other embodiments , the inorganic metal salt may include liasf 6 , lipf 6 , libf 4 or other similar ion - conducting additives , too . the positive charge of the cation , li + for example , is stabilized by the lone pair electrons provided by oxygen atoms of the cross - linked copolymer ppo and peo . the entangled polymer chains delocalize the positive charges of the li ions and segregate the negative charges of perchlorate ions effectively to render a charge separation of the system , as shown in fig1 . as shown in fig2 , the charge separation of the system may effectively neutralize the charges from an exterior system and the system is conductive to reduce the absorption of dust . the uv - curing resin curable by radiation of uv light includes acryl resins and is not limited to this . the uv - curing resins may be used along with the photo initiators such as acetophenone , benzophenone and oligomers . additional features of these traditional additives will not be described in detail here . the saturated polymers and the inorganic metal salts are the basic ingredients of the conductive coating liquid composition . the uv - curing resin , the photo initiators , the oligomers and the volatile organic solvents are the basic ingredients of the hard coat liquid composition . the polar solvents include isopropanol ( ipa ), ethyl acetate , 1 - methoxy - 2 - propanol and the like . the organic solvents may be used alone or in combination . one of the main features of the present invention resides in the “ saturated ” polymer in the ionic antistatic coating composition , i . e ., the composition should not include the double bond or conjugated double bond structure such as phenyl structure , aniline or thiofuran , which would absorb the uv - light . if the polymer includes the uv - absorbing double bond or conjugated double bond structure , they may be involved in the following photochemical reaction of the uv - curing resin and jeopardize the cross - linking polymerization of the uv - curing resin . besides , the absorbing coefficients of different conjugated double bond structures would be different according to the light having different wavelengths and result in color shift . in addition , to simplify the process and to increase the yield , another feature of the present invention lies in the combination of the separated hard coat film and the antistatic conductive film in the prior art . therefore , the choice of the antistatic conductive materials relies on the materials that are structurally supported by being entangled with the polymers of the uv - curing resin in the hard coating composition and dispersed in the composition uniformly . because the polymeric materials of the present invention dissolve in the hard coating composition too , the conductive coating composition and hard coating composition can be mixed up to form the ionic antistatic coating composition and applied on a transparent substrate . later the drying process and the uv radiation process are performed to allow the resin to be cured to obtain the antistatic hard coating film with superior antistatic ability , higher transmittance and no visible color shift . the method of fabricating the antistatic coating composition of the present invention substantially includes the following four steps : ( 1 ) providing a transparent substrate , such as polyester and triacetate cellulose ( tac ); ( 2 ) coating an ionic antistatic coating composition on the transparent substrate , wherein the ionic antistatic coating composition includes an inorganic metal salt including a metal cation and an anion , a saturated polymer providing lone pair electrons to stabilize the metal cation , a uv - curing resin , and an organic solvent exerting an effective solvation effect ; ( 3 ) performing a drying process to vaporize the organic solvent , wherein the drying process may be performed under a condition between 60 - 70 ° c . for about 1 minute ; and ( 4 ) performing a uv radiation process to allow the uv - curing resin to proceed a cross - linking polymerization reaction , and , thereby , forming an antistatic hard coating on the transparent substrate , wherein the intensity of the uv light is 0 . 242 w / cm 2 and the dosage is between 300 - 350 mj / cm 2 . the following is an example provided to illustrate the preparation of the antistatic coating composition of the present invention in detail , as well as the test results of the antistatic film . the present invention provides a method for fabricating an antistatic coating composition of easy preparation , high storage stability and uniform dispersion . commercially available hard coating material rc - 610r from nissan chemical co ., which is a uv - curing resin of acrylic type , is dissolved in a solvent containing isopropanol , ethyl acetate and 1 - methoxy - 2 - propanol in a ratio ( v / v ) of 1 : 1 : 1 to obtain a hard coating solution in the concentration of 40 % ( w / w ). the concentration depends on the thickness of the desired film . the suitable concentration may be between 20 %- 70 %, preferably 40 %. the product pel - 20a from the pel product series of japan carlit co . is a cross - linked co - polymer of ppo and peo and contains 20 % inorganic salt , liclo 4 . also , pel - 100 or pel - 20bbl may be suitable . 20 g of the hard coating solution of 40 % solid content is added into 2 %, 4 %, 6 %, 8 %, 10 %, and 12 % pel conductive coating solution respectively and the hard coating solution and the conductive coating solution are mixed uniformly by stirring . 40 g of rc - 610r gel of solid content 100 % is added into the solvent containing each ethyl acetate , isopropanol and 1 - methoxy - 2 - propanol of 20 g and the mixture is mixed uniformly by stirring . 2 % concentration : 0 . 408 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . 4 % concentration : 0 . 833 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . 6 % concentration : 1 . 276 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . 8 % concentration : 1 . 739 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . 10 % concentration : 2 . 222 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . 12 % concentration : 2 . 727 g of pel20a is added into the 40 % hard coating solution and the mixture is mixed uniformly by stirring . the ionic antistatic coating composition is applied on a tac transparent substrate of 80 μm thickness . a drying process is later performed under a condition between 60 - 70 ° c . for about 1 minute . then a uv radiation process is performed to allow the uv - curing resin to proceed a cross - linking polymerization reaction , and , thereby , forming an antistatic hard coating on the transparent substrate . the intensity of the uv light is 0 . 242 w / cm 2 and the dosage is between 300 - 350 mj / cm 2 . finally , the total thickness of the film is 85 μm . tests are conducted according to the following standards to test the hardness , total transmittance , haze and surface resistance . the results are shown in fig3 . pencil hardness : tested by scratch hardness tester model 291 from erichsen testing equipment . the load is 500 g and the hardness of the pencil is 3h . total transmittance and haze : tested by haze meter ndh2000 from nippon denshoku . surface resistance : tested by resistivity meter 1824 from bjz . the voltage is 500 v . according to the preferred embodiment of the present invention , the preferred surface resistance is between 10 8 - 10 12 ωcm 2 , most preferred 10 9 ωcm 2 . if the surface resistance is larger than 10 12 ωcm 2 , the wear - resistant ability may be weakened . lpf100 from otsuka tech electronics is used to test the transmittance of the visible light band ( 380 nm - 780 nm ) to analyze the hue ( as and bs values ) of the film . the test results in fig3 and fig4 show that an antistatic hard coating film with high transmittance and no visible color shift can be obtained through the uv light radiation . the transmittance is higher than 92 % and the as value and the bs value are almost identical to those of the transparent substrate . in addition , the concentration of the pel conductive coating solution does not affect the dispersion . the high concentration of pel conductive coating solution does not affect the as value and the bs value and the transmittance of the antistatic film either . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims .	2
a more detailed description of an aforementioned support associated with an antibody for forming a solid - phase support constituting the solid phase in an immunological test is provided hereinbelow . in this example , a 4 % solution of alginate ( protanal ® lf 20 / 60 produced by protan a / s , drammen , norway ) was formed in distilled water heated to 80 ° c . for 10 minutes , the resulting viscous liquid being cooled to ambient temperature . a very small quantity of detergent ( 0 . 01 % of tween ® lf 20 / 60 by merck - schuchardt , munich ) was then incorporated in the solution by foaming it with a propeller driven at 4 000 rpm , and the solution was distributed dropwise through a pipette having its tip 40 cm above the level of a solution of 0 . 1 cacl 2 , which was constantly agitated by a magnetic bar rotating at 250 rpm . the resulting granules were about 1 mm in diameter and enclosed gas cells . they were then washed in a number of baths of a solution of 0 . 1 m cacl 2 . a solid - phase antibody for an enzymatic tracer immunological test for testing human immuno gamma globulin ( igg ) is prepared as follows : 25 ml of granules prepared as in the aforementioned example are taken in suspension in the solution of 0 . 1 m cacl 2 and progressively transferred to acetone in successive steps by intermediate washing in acetone - water where the concentration of acetone is 10 : 90 , 50 : 50 , 80 : 100 and 100 : 0 in the successive steps . the 25 ml of granules are then suspended in acetone , the total volume being 50 ml . 3 g of carbonyldiimidazole ( sigma chem . co ) are then added , the substance being a bridging agent for the protein ( antibody ) to be fixed to the granule . the mixture is then agitated for 3 hours at 20 ° c . by vibration through an amplitude of 180 ° around a central transverse shaft . the excess bridging agent is then removed by repeated washing of the granules with acetone . the thus - activated granules are then balanced with an aqueous test buffer comprising 0 . 05 mol / l of barbitone ®, which is a diethyl barbituric acid produced by fluka , buchs ( switzerland ) adjusted to ph 8 . 0 with sodium hydroxide ( merk , darmstadt ) and containing 0 . 005 m cacl 2 . the concentration of the buffer solution relative to acetone is increased stepwise as follows : 10 : 90 , 20 : 80 and 100 : 0 . after the balancing operation , an antibody is immediately bridged to the activated granules . a solution of proteins ( antibody ) is added to the 25 ml of granules , the quantity of solution being sufficient to obtain a final volume , with the barbitone buffer , of 50 ml . the protein used was an enriched fraction of anti - human sheep immuno gamma globulin ( scottish antibody production , carluke , scotland ) which reacts with the granules at a final concentration of 5 mg of protein / ml of total volume . after agitation by vibrating the test substance through an amplitude of 180 ° around a central transverse shaft for 16 hours , the granules are separated from the liquid phase . in order to remove substances adhering in non - covalent mannner to the granules , the granules are then repeatedly washed alternately at ph 2 . 0 and ph 8 . 0 . the measured concentration of proteins bonded to the granules was about 1 μg / cm 2 . the granules prepared by the aforementioned process and bonded to the antibodies are about 1 mm in size . they are then prepared for use for an immunological test on a sample of human serum to be analysed . the test procedure will be described hereinafter . in a first step , a check was made of the sensitivity of the solid - phase granules bridged to the antibodies and obtained by the process previously described . to this end , on each occasion , two tests were analysed , using two samples of granules obtained with solutions of antigens consisting of normalized igg ( with concentrations from 0 . 1 to 100 μg / ml ) prepared in the test buffer ( barbitone ® 0 . 05 mol / l , ph 8 . 0 ) with 2 % v / v of normal sheep serum adapted to fill the sites not occupied by the antigens . the analyses were made by adding 100 μl of solution of normalized antigens to 103 μl of test buffer , followed by 50 μl of buffer and 50 μl of anti - human antibodies tagged by an enzyme ( peroxidase by dakopatts , copenhagen , denmark ) diluted in a final ratio of 1 : 500 in a buffer . after incubation at 22 ° c . for 90 minutes , the granules were washed three times with the test buffer and twice with the enzymes buffer ( 0 . 15 mol / l , acetate ph 5 . 0 buffer ). the colorimetric reaction for detecting the immobilised tagged specific antibody was brought about by adding 300 μl of chromogenic solution ( 20 mg / l orthophenanthraline diamine ), 20 μof a solution of 50 % h 2 o 2 , 50 ml of acetate buffer ( 0 . 1 mol / l , ph 5 . 0 ) and incubation at 22 ° c . for 30 minutes . the colorimetric reaction was stopped and stabilized by adding 1 ml of 0 . 1 n h 2 so 4 . the absorption rate was measured at 450 nm relative to 0 . 1n h 2 so 4 alone . the following table , in the case of both samples , shows the relation in dependence on the reading obtained with the enzymatic tagging immunological test for human igg , using granules according to the invention . table______________________________________concentration sample 1 sample 2of human igg at 450 nm at 450 nm______________________________________o 0 . 105 0 . 0980 . 1 0 . 101 0 . 1070 . 5 0 . 220 0 . 1901 . 0 0 . 311 0 . 2905 . 0 0 . 589 0 . 57510 . 0 0 . 701 0 . 70550 . 0 0 . 795 0 . 789100 . 0 0 . 895 0 . 926______________________________________ we shall now by way of example describe two immunological test procedures using two variants of variable - density granules as solid - phase supports of anti - human igg antibodies . first , we refer to fig1 a to 1f in the description of the first procedure . in a first step ( fig1 a ) a given volume of sample 2 for analysis or of a standardized solution used in parallel ( when it is desired to make a comparative test ) is introduced into test tube 1 with a given quantity of an enzymatic tracer . a given volume of buffer 3 is added together with a portion 4 of granules 5 comprising solid - phase antibody supports according to the invention . in this example , the density of the granules is below that of the liquid , so that at atmospheric pressure and ambient temperature the granules remain at the surface of the liquid . in the second step of the process , the contents of test - tube 1 is alternately subjected to pressures varying between atmospheric pressure and a higher pressure chosen so that the volume of granules 5 decreases sufficiently to give them a density higher than that of the liquid , so that the granules fall towards the bottom of test - tube 1 and then rise when the pressure varies . once the granules are in suspension ( fig1 b ) an intermediate pressure can be maintained or permanently varied . during this period , which corresponds to incubation , the liquid is kept at a predetermined temperature for a given time . when incubation is complete , the pressure is brought to its higher value in order to move all granules 5 to the bottom of tube 1 ( fig1 c ) and the supernatant liquid is sucked through a duct 6 ( fig1 e ). in the next operation , atmospheric pressure is restored and a washing buffer is added to granules 5 , after which the operations in fig1 b to 1d are repeated with the washing liquid . a number of successive washing operations are performed in this manner . the next phase is to colour a solution comprising an enzymatic reagent as described hereinbefore , by re - mixing the granules in the solution as already done ( fig1 b ) and incubating at controlled temperature , after which the aforementioned solution is added . to block and stabilize the reaction , the pressure is increased to its upper value ( fig1 c ) in order again to collect the granules at the bottom of tube 1 . conventional measurements can then be made ., more particularly in the present case , the measurements can be of the absorption rate of electromagnetic radiation by the liquid at a given wavelength , by sucking the liquid ( fig1 f ) into a photometer ( not shown ) or measuring it through the tube . alternatively a gamma count can be made of granules where the antibody has reacted with a human antigen , in the case of an isotopic tracer . as the preceding description shows , variable - density granules used as solid - phase support of one component in a reaction , in the present case an immunological reaction , can enable the solid phase to be mixed and separated without acting on the tube itself but only by acting on its contents and only through pressure , i . e . without contact with the liquid phase . the reaction process is particularly suitable for automation , since only a source of variable pressure is necessary for performing the entire process . it is only necessary to isolate the tube from atmosphere and connect it to a source of pressure . the mixing and the separation efficiency are completely reproducible and reliable . in the variant illustrated in fig2 a to 2f , the only difference is that granules 5 &# 39 ; have a density at atmospheric pressure greater than the density of the liquid , so that they are normally at the bottom of test - tube 1 &# 39 ;. in this case , therefore , an alternating pressure variation which is negative relative to atmospheric pressure has to be applied to the liquid to raise the granules and mix them or to suspend them in the liquid phase ( fig2 b ). the granules can be separated so as to suck the liquid , simply by restoring atmospheric pressure . this may have advantages over the preceding variant , in that all operations other than mixing or suspending the granules , as illustrated in fig2 b , occur at atmospheric pressure , and it is easier to maintain a negative pressure in a closed chamber than to maintain pressure . in other respects the test procedure is similar to that previously described . in another variant , the solid - phase granules have practically the same density as the solid phase at ambient temperature and pressure . in this variant , the granules remain in suspension during the incubation phase corresponding to fig1 a or 2b and pressure variations are used to separate the solid phase or return it to suspension . this variant has the additional advantage that incubation can be brought about in any suitable vessel without special equipment . as already mentioned , solid - phase granules used as support for a component in a biochemical or chemical reaction can be used in applications other than the described immunological tests . these supports are of use in other types of analysis and in manufacturing processes using tanks or continuous reactors . in the aforementioned continuous reactors , where a flow of reagents continuously enters the vessel and the products containing the aqueous phase continuously flow out of it , the solid - phase granules can be kept suspended in the reaction medium by suitably adjusting the pressure . the negative buoyancy of the granules can be adjusted against the ascending motion of the reagents , thus obtaining a sort of fluidized bed which is less dependent on the flow speed of the liquid phase . in the case of cell cultivation , it is known that granules collected in a reduced space will increase the formation of aggregates of particles and cells , increasing the cultivation yield . in us - a - 4 335 215 , it has been proposed to obtain this effect by periodic transfer of a suspension of microsupports in a separate , reduced - volume drum . if the solid - phase granules according to the invention are used , it is possible to concentrate them at either the top or the bottom of a reactor to assist the formation of aggregates , without transferring the suspension from the main reactor body . the variable - density granules may also be used as a solid - phase support for chromatographic separation of organic or inorganic compounds from a liquid ( aqueous ) phase , by covering the solid - phase support by a substance , e . g . an adsorbent substance , capable of separating the compound in solution from the liquid phase . if the granules are placed in a flow of the liquid phase , the pressure can be adjusted to prevent them being entrained by the flow . in the case of discontinuous separation , the granules can be moved in the liquid by varying their density as previously described . of course , centrifugal force may be one suitable method of varying the hydrostatic pressure applied to variable - density granules in order to reduce their volume and increase their density . hitherto we have described applications in which the granules according to the invention are solid - phase supports of a component adapted to participate in a reaction , or of a material capable of fixing a component in solution . there are many cases , however , where mixing of two or more components in a liquid phase poses problems which are inadequately solved by known methods . in many of these cases , the use of granules having a density variable with pressure will provide a solution even though the granules do not , as hitherto , constitute a support for a component in a reaction . in such cases , the granules will not act as mixing means . they can therefore be larger than the previously - described granules , so as to move larger volumes of liquid and thus help to form eddies in the liquid .	8
in this description , the terms “ communication device ,” “ wireless device ,” “ wireless telephone ,” “ wireless communications device ,” and “ wireless handset ” are used interchangeably , and the term “ application ” as used herein is intended to encompass executable and nonexecutable software files , raw data , aggregated data , patches , and other code segments . further , like numerals refer to like elements throughout the several views . with advent of 3 rd generation ( 3g ) wireless communication technology , more bandwidth has become available for wireless communications , and handsets and wireless telecommunication devices , such as cellular telephones , pagers , personal digital assistants ( pdas ) have increasing wireless capabilities . fig1 depicts a prior art cellular telecommunication network 100 . the communication network 100 includes one or more communication towers 106 , each connected to a base station ( bs ) 110 and serving users with communication devices 102 . the communication devices 102 can be cellular telephones , pagers , personal digital assistants ( pdas ), laptop computers , or other hand - held , stationary , or portable communication devices that use a wireless and cellular telecommunication network . the commands and data input by each user are transmitted as digital data to a communication tower 106 . the communication between a user using a communication device 102 and the communication tower 106 can be based on different technologies , such code division multiplexed access ( cdma ), time division multiplexed access ( tdma ), frequency division multiplexed access ( fdma ), the global system for mobile communications ( gsm ), or other protocols that may be used in a wireless communications network or a data communications network . the data from each user is sent from the communication tower 106 to a base station ( bs ) 110 , and forwarded to a mobile switching center ( msc ) 114 , which can be connected to a public switched telephone network ( pstn ) 118 . the msc 114 may be connected to a server 116 that supports different applications available to subscribers using the wireless communications devices 102 . optionally , the server 116 can be part of the msc 114 or connected to the pstn 118 . the server 116 can be operated by the wireless service supplier or a third party . the server 116 stores a directory of telephone service subscribers . the wireless subscribers can be identified by mobile identification number ( min ) or the wireless device &# 39 ; s electronic identification number ( ein ). when a user subscribes a wireless communications service from a service provider , the user selects a service plan that allocates certain free resources to him and the service provider stores the information about the service plan and the free resource information into the server 116 . the user , when equipped with a wireless handset 102 according to the present invention , may download the service plan and the corresponding free resource information into the wireless handset 102 . the user can also set up few personal settings on the wireless handset 102 that allow him to track use of the wireless handset 102 . fig2 illustrates this subscription process 200 . the user subscribes to an application , step 202 , that may be a wireless communications service or a game application , and a subscription plan is established for the user according to the user &# 39 ; s selection , step 204 . the user may also set up a few personal settings , such as when the user desires to be notified , step 206 . if the user sets up a flag for a notification when the remaining prime time minutes is 10 minutes , the service provider will provide a notification when the prime time minutes left in the subscription plan is 10 minutes . the user may also set up a flag for when a certain individual call exceeds a preset duration . for example , if the user sets a flag for a five minutes call duration , every time a call exceeds five minutes , the user will receive a notification . the user may also set up a flag so he will receive a summary of remaining minutes in his subscription plan at the end of every call . the usage tracking feature can be implemented on the wireless handset 102 . the user enters a setting on the wireless handset 102 and the wireless handset 102 will track the usage . every time the user receives a call or places a call , the wireless handset 102 records the duration of the call and deducts it from the available resource . if the call is made during the weekend , then the duration of the call is deducted from the weekend minutes . alternatively , if the subscription plan is created by the service provider and stored in the server 116 , the user can request download a copy of the service plan into his wireless handset 102 , before tracking the use with the wireless handset 102 . in an alternative embodiment , the subscription plan may be established in terms of a money amount . for example , a user may have purchased $ 100 . 00 of air time from a service provider who charges a flat rate of five cents per minute . the subscription plan will record that there are $ 100 . 00 available of resource for the user . when the user places a call , the wireless handset records the cost of connection by adding five cents for each connection minute , and at the end of the call the cost of connection is deducted from the available resource . fig3 is a flow chart for a usage tracking process 300 . the usage tracking process 300 can be implemented on the wireless device 102 or on the server 116 . when executed on the wireless handset device 102 , the request for an application , step 302 , is received after the user enters a destination telephone number at the wireless handset 102 , and the wireless handset 102 activates the application , step 304 , by sending the destination telephone number to the server 116 and requesting a connection to the destination telephone number . the wireless device 102 receives the available resource information either downloading from the server 116 or entered manually by the user . the flags are also entered by the user and stored in the wireless handset without being transmitted to the server . the wireless device 102 tracks the activation time , step 306 , compares the activation time with a preset limit , step 308 , and notifies the user , step 310 , if the activation time is larger than the preset limit , by displaying a message on a display screen on the wireless device 102 . after checking for the activation time , the wireless handset 102 adjust the available resource information to reflect the duration of the call , i . e ., the wireless handset 102 deducts the duration of the call from the available resource information , step 312 . the wireless handset also tracks the accumulate usage time by adding the activation time to the total of accumulated usage time . for example , if the call lasted 10 minutes during the prime time and the user had 190 prime time minutes of the available resource and 34 minutes of accumulated prime time usage , the wireless handset 102 will deduct the 10 minutes from the 190 minutes and add 10 minutes to the 34 minutes . the new available resource will then be 180 prime time minutes and the new accumulated usage prime time would be 44 minutes . the wireless handset 102 will check the adjusted available resource against preset limits , step 314 . if the adjusted available resource consists of 80 prime - time minutes , 150 non - prime time minutes , and 230 weekend minutes , the wireless handset 102 checks these numbers against the corresponding flags ( preset limits ) set by the user . if an available resource is less or equal than a preset limit , then the wireless handset 102 notifies the user , step 316 . the notification can be a display message or an audio message . the wireless handset 102 also checks whether it is time to reset the available resource to a default value . an example is that the wireless handset 102 will reset the available resource to a default value at the beginning of each billing period . the wireless handset 102 first determines whether the current date is the beginning of a billing period , step 318 , if so , the wireless handset 102 resets the available resource to the default value , step 320 . when it is implemented on the server 116 has steps similar to the ones executed on the server 116 . the server 116 checks whether it has received a request for an application , step 302 , e . g ., a request to connect to a destination telephone . if the request is received , the server 116 activates the application , step 304 , by connecting the wireless handset 102 to a destination telephone , which may be another wireless telephone 102 or a wireline telephone 120 . after the connection is established , the server 116 records the activation time , step 36 , i . e ., the duration of the call between the user and the destination telephone . after the call is completed , the server 116 compares the activation time with a limit set by the user , step 308 . if the activation time is greater than the preset limit , the server 116 sends a notice to the user , step 310 . the notice can be a message to the wireless device 102 or an audio message played after the end of the connection . the steps 312 – 320 can be substantially the same as described above for when the usage tracking process 300 is executed on the wireless handset 102 . fig4 is a block diagram 400 of the platform of a wireless handset 102 . the wireless handset 102 , besides being capable of supporting wireless communications applications , is capable of tracking use of specific applications and providing notifications to the user when certain user settable parameters have been achieved or surpassed . the wireless handset 102 includes a wireless transceiver 402 connected to an antenna 404 , a controller 406 , a display unit 408 , a timing module 410 , resource and setting registers 412 , and a user interface unit 414 . the wireless handset 102 communicates with a wireless network via radio transmissions through the wireless transceiver 402 . the wireless handset 102 receives user settings through the user interface unit 414 , which may include a keypad , a speaker , a microphone , or other suitable input devices . after the user settings are received , they are saved in the resource and setting registers 412 . the settings are transmitted to the server if the server tracks controls the usage tracking and notification operations . the resource and setting registers 412 may be part of a computer readable memory accessible by the controller 406 . the available resource information is also stored in the resource and setting registers 412 , and the controller 406 may update the resource and setting registers 412 according to the usage information . the timing module 410 is essentially a timer that the controller 406 can set up to track the usage information . the display unit 408 may be a liquid crystal display ( lcd ) screen or a plasma based display screen . the wireless handset 102 is also capable of archiving , retrieving , and viewing summaries of previous activities at the device . at the beginning of each billing period , before resetting the available resources to their default value , the wireless handset 102 archives the usage information that has been recorded . the usage information , such as number of prime time , non - prime time , and weekend minutes used , is stored and available for later retrieval and review . the archiving can occur at pre - determined intervals , such as every 7 days . alternatively , the archiving of files can occur after another event , such as the threshold of available minutes being met or like activity . fig5 is a retrieval process 500 of data at the wireless handset 102 . when the user wants to review the usage of an application in a particular month , the user can enter his selection at the wireless handset 102 . the wireless handset 102 receives a selection for an archived usage file , step 502 , and retrieves the archived file , step 504 . after retrieving the archived file , the wireless handset 102 displays it to the user , step 506 . the archiving of usage information can also be done in the server 116 . the user will enter his selection of an archived file on the wireless handset 102 , and the wireless handset 102 sends the requests to the server 116 . the server 116 retrieves the archived file and transmits it to the wireless handset 102 . the wireless handset 102 then displays it to the user . fig6 illustrates a resource tracking table 600 that may be stored in the resource and setting registers 412 or in other accessible media . the resource tracking table 600 stores available resource information 602 for different resources , such as prime time minutes 604 , non - prime time minutes 606 , and weekend minutes 608 . it also stores user settable flags ( preset limits ) 610 for different resources , including for the call duration 612 . the available resource information 602 for each resource may be updated after each call . for example , if a call lasted 15 minutes , where 9 minutes were made during the prime time hours and 6 minutes were made during non - prime time hours , then 9 minutes is deducted from the prime time minutes 604 and 6 minutes are deducted from the non - prime time minutes 606 . for the table shown in fig6 , where a flag is set for 10 minutes for the call duration 612 , a notification is provided to the user . it should be noted that the system is not limited to communications applications , and can be applied to any application that runs on a remote wireless device and requires a subscription . the following is a description of a use scenario , where the user requests an interactive game from a server . the user subscribes to the interactive games from the service provider and chooses a subscription plan that affords him 100 prime time minutes , 500 non - prime time minutes , and 700 weekend minutes . after subscribing to the service plan , the user proceeds to set up flags for each individual resource , so he can receive notification when , for example , he plays a game more than 10 minutes continuously or exceeds 10 minutes in each resource category . fig6 is an example of the user &# 39 ; s subscription plan and settings . the information of fig6 can be stored on user &# 39 ; s wireless handset 102 or on the service provider &# 39 ; s server 116 . the user can change the settings by using his wireless handset 102 or through an internet web access . after subscribing to the service and setting up his preferences , the user may use the wireless handset 102 to request an interactive game that he can play against others online users . the user makes a request to the server 116 for a menu of games , and the request is transmitted wirelessly to a communication tower 106 , passes through a base station 110 and a messaging switching center 114 , and delivered to the server 116 . the server 116 sends the menu to the wireless device 102 . after receiving the menu , the user activates the application by selecting an application . the activation request is received by the server 116 , and the server 116 enables the user to become a player in a multi - user interactive game . the server 116 also starts a timer to record the user &# 39 ; s play time . when the user is finished playing the game , the server 116 deducts the playing time from the user &# 39 ; s subscription plan and sends the call duration and the available resource information to the user &# 39 ; s wireless handset 102 . the wireless handset 102 stores the available resource information received from the server 116 in the resource and setting registers 412 and compares the call duration with the flags in the resource and setting registers 412 . if the call duration exceeds any of the flags , the wireless handset 102 displays a corresponding notification to the user . in view of the method being executable on a wireless service provider &# 39 ; s computer device or a wireless communications device , the system can be implemented with a program resident in a computer readable medium , where the program directs a wireless computer device having a computer platform to perform the steps of the method . the computer readable medium can be the memory of the device , or can be in a connective database . further , the computer readable medium can be in a secondary storage media that is loadable onto a wireless communications device computer platform , such as a magnetic disk or tape , optical disk , hard disk , flash memory , or other storage media as is known in the art . in the context of the invention , the method may be implemented , for example , by operating portion ( s ) of the wireless network to execute a sequence of machine - readable instructions , such as the wireless communications device or the server . the instructions can reside in various types of signal - bearing or data storage primary , secondary , or tertiary media . the media may comprise , for example , ram ( not shown ) accessible by , or residing within , the components of the wireless network . whether contained in ram , a diskette , or other secondary storage media , the instructions may be stored on a variety of machine - readable data storage media , such as dasd storage ( e . g ., a conventional “ hard drive ” or a raid array ), magnetic tape , electronic read - only memory ( e . g ., rom , eprom , or eeprom ), flash memory cards , an optical storage device ( e . g . cd - rom , worm , dvd , digital optical tape ), paper “ punch ” cards , or other suitable data storage media including digital and analog transmission media . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail maybe made without departing from the spirit and scope of the present invention as set for the in the following claims . furthermore , although elements of the invention may be described or claimed in the singular , the plural is contemplated unless limitation to the singular is explicitly stated .	7
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . in order to use rigid insulation , as opposed to or in combination with flexible insulation material , some suitable design needs to be employed in order to deal with complex and compound curved surfaces . rigid material is desirable as a means to stiffen and provide rigidity to thin material shells and flexible skins . rigid material may also provide a higher r - value than some flexible materials but molded rigid foam is expensive and a mixture of rigid and flexible insulation is a desirable compromise . straight lengths of insulation material work well when a straight or uniform cavity is to be filled , such as a semi - cylindrical cavity . since the flexible insulation material strips are compressible , this allows the rigid insulation strips to adapt to the outside diameter curvature . however , if there is a second curvature in a different plane so as to provide a compound curved surface , the task is not the same and the straight lengths of insulation material which extend the length of the cavity will not work . compound curvatures require flexing or compressibility in at least two planes or directions . if a rigid strip can lay in one direction without interference , how can it at the same time bend 90 degrees or curve into another surface . the answer to the foregoing question is provided by the unique thermal insulation blankets illustrated in fig1 - 6 . referring to fig1 there is illustrated an insulation block 280 which includes an alternating series of flexible insulation material panels 281 and rigid insulation material panels 282 . adjacent panels of this alternating series of panels are bonded together by means of a suitable adhesive disposed between the panels . once block 280 is formed , the next step in the assembly of a totally flexible blanket of rigid and flexible insulation material is to cut a top layer from block 280 . top layer 283 is separated from block 280 by a complete horizontal cut along the geometric plane containing cutting lines 284 and 285 . due to the adhesive bonding together of adjacent panels , the alternating strips of rigid and flexible insulation material of top layer 283 remain together , intact . the next step in the process is to continue making horizontal cuts of uniform thickness as represented by broken lines 288 and 289 through the remainder of block 280 such that the then - next top layer of the reduced size block is separated . the result is a series of insulation panels ( top layers 283 ) which are all similarly sized and shaped . the next step in the assembly process for one style of a totally flexible insulation blanket is to stack each of the removed top layers derived from the cutting of the block as illustrated in fig1 into a new block 290 which includes representative top layers 283a - 283d turned on end and alternated with panels 291 of flexible insulation material as illustrated in fig2 . the number and size of panels 281 and 282 may vary and the thickness of cut determines the number of panels or layers 283 which come from block 280 . as with block 280 adjacent layers and panels are bonded together by means of a suitable adhesive . once block 290 is fabricated , horizontal cuts are taken to remove top layer 292 . saw lines 293 and 294 represent the geometric plane of the first horizontal cut and the broken lines represent the remaining cuts which are taken so as to completely separate block 290 into a plurality of insulation blankets . in this particular arrangement , it is to be noted that the cutting planes do not have to be evenly or uniformly spaced since the top layer 292 which is removed goes directly into an end - use environment , such as being assembled to one half of an elbow shell or to one half of a t - shell or directly around a pipe , conduit , elbow or t - connector or directly around an object of a complex or compound curvature . the value of the insulation blanket provided by top layer 292 is its ability to bend or flex with virtually any curvature and in any direction . compound curves can be easily covered by the blanket since the flexible insulation material of the blanket completely surrounds the four sides of each block or cube of rigid insulation material . regardless of the direction of flex or bending or the degree or extent of flexing for each rigid block 295 , there is flexible and compressible insulation material ( block 296 or a strip ) immediately adjacent which yields to allow the blanket to conform to virtually any desired shape . a top plan view of one top layer ( blanket ) 292 is illustrated in fig3 . the use of rigid insulation material is desirable since it stiffens and adds rigidity to the shell skin and since the thermal insulation properties of many rigid insulation materials are superior to many flexible insulation materials . the heretofore problem with rigid insulation material is its inability to be used in any complex curved shape unless precisely molded resulting in a dramatically higher cost to the insulation device . an alternative blanket style consistent with the foregoing fabrication steps and resulting panel design is illustrated in fig4 and 5 . the difference between blanket 300 and top layer 292 lies in the third step of the assembly process . after all the top layers are cut from insulation block 280 and are turned on edge to be used to form block 290 , a substitution occurs . for blanket 300 instead of using panels 291 of flexible insulation material between each pair of top layers , top layers are staggered and alternated with each other as to the position of flexible insulation material and rigid insulation material between adjacent panels providing a checkerboard type appearance . the most efficient way to fabricate this alternative blanket style is to begin with block 280 and to fabricate a similar block 301 ( see fig4 ) of equal size except that in block 301 the flexible insulation material panels 281 and the rigid insulation material panels 282 are in reverse sequence from the arrangement of block 280 . in block 280 , the rigid insulation panels are on the exterior surfaces while in block 301 it is the flexible insulation material panels which comprise the outer surfaces of the block . as top layers 283 and 302 are removed from their respective blocks 280 and 301 , these layers are alternately laminated into block 304 ( see fig5 ) and bonded together with a suitable adhesive . by taking horizontal cuts in the plane defined by cutting lines 305 and 306 , blanket 300 is separated from block 304 . the manner in which the flexible insulation material blocks 307 are disposed on the four sides of each rigid insulation material block 308 makes blanket 300 able to bend or flex in virtually any direction and with virtually any curvature . compound curves can be easily covered by blanket 300 , and blanket 300 , like top layer 292 , is suitable to be used in combination with one - half of an elbow shell or with one half of a t - shell or blanket 300 may be applied directly to a pipe , conduit , elbow , or t - connector . to enhance the assembly of either insulating blanket 300 or 290 or to provide for improved handling capabilities an outer layer or facing material 310 ( see fig6 ) can be bonded to the blanket before , after , or during the horizontal cutting process . this material must be able to stretch and flex such as a thin polyethylene or pvc film or a thin flexible foam such as urethane . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .	5
in the following detailed description of the preferred embodiments , reference is made to the accompanying drawings that form a part hereof , and in which is shown , by way of illustration , specific embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice the invention , and it is understood that other embodiments may be utilized and that logical structural , mechanical , electrical , and chemical changes may be made without departing from the spirit or scope of the invention . to avoid detail not necessary to enable those skilled in the art to practice the invention , the description may omit certain information known to those skilled in the art . the following detailed description is , therefore , not to be taken in a limiting sense , and the scope of the present invention is defined only by the appended claims . referring now primarily to fig1 - 3b , an illustrative , non - limiting embodiment of a reduced - pressure wound treatment system 100 for treating a tissue site 103 on a patient is presented . the tissue site 103 may , be , for example , a wound 102 , or damaged area of tissue , on a patient . the tissue site 103 may be the bodily tissue of any human , animal , or other organism , including bone tissue , adipose tissue , muscle tissue , dermal tissue , vascular tissue , connective tissue , cartilage , tendons , ligaments , or any other tissue . unless otherwise indicated , as used herein , “ or ” does not require mutual exclusivity . while the reduced - pressure wound treatment system 100 is shown in the context of the wound 102 , it will be appreciated that the reduced - pressure wound treatment system 100 may be used to treat many different types of tissue sites 103 and wounds including area wounds , incisions , internal wounds , or other tissue sites . the reduced - pressure wound treatment system 100 is shown on the wound 102 , which is through the epidermis 104 , or generally skin , and the dermis 106 and reaching into a hypodermis , or subcutaneous tissue 108 . the reduced - pressure wound treatment system 100 generally includes a sealing member 110 , a microstrain - inducing manifold 112 , and a reduced - pressure subsystem 114 . as will be described further below , in operation the microstrain - inducing manifold 112 induces microstrain and may be referred to as a microstrain - inducing manifold . the microstrain - inducing manifold 112 has a first side 113 and a second , patient - facing side 115 . among the numerous benefits of the reduced - pressure wound treatment system 100 is the biological response initiated by microstrain within the wound 102 . microstrain results from pressure distributed with the microstrain - inducing manifold 112 to a tissue site 103 , such as a wound surface 105 of the wound 102 . it is believed that this action creates areas of cell surface strain , or microdeformation . the cells appear to respond to the strain by expressing special receptors on the surface of the cells and turning on genetic pathways in the cells , which promote healing activities . the healing activities may include increased metabolic activity , stimulation of fibroblast migration , increased cellular proliferation , extra cellular matrix production , and the formation of granulation tissue , as well as a decrease in edema and a subsequent improvement of perfusion at the tissue site 103 . with respect to the wound 102 , over time , granulation tissue fills the wound 102 and thereby further reduces volume and prepares the wound 102 for final closure by secondary or delayed primary intention . the sealing member 110 is generally formed from a flexible sheet . the sealing member 110 includes a first surface 120 and a patient - facing surface 122 . the sealing member 110 may be sized so that the sealing member 110 overlaps the wound 102 in such a manner that a drape extension 116 extends beyond the peripheral edge of the wound 102 . the sealing member 110 may be formed from any material that provides a fluid seal . as used herein , “ fluid seal ,” or “ seal ,” means a seal adequate to maintain reduced pressure at a desired site , e . g ., a tissue site , given the particular reduced - pressure source involved . the sealing member may , for example , be an impermeable or semi - permeable , elastomeric material . “ elastomeric ” means having the properties of an elastomer . elastomeric generally refers to a polymeric material that has rubber - like properties . more specifically , most elastomers have ultimate elongations greater than 100 % and a significant amount of resilience . the resilience of a material refers to the material &# 39 ; s ability to recover from an elastic deformation . examples of elastomers may include , but are not limited to , natural rubbers , polyisoprene , styrene butadiene rubber , chloroprene rubber , polybutadiene , nitrile rubber , butyl rubber , ethylene propylene rubber , ethylene propylene diene monomer , chlorosulfonated polyethylene , polysulfide rubber , polyurethane , eva film , co - polyester , and silicones . specific examples of sealing member materials include a silicone drape , 3m tegaderm ® drape , acrylic drape such as one available from avery dennison , or an incise drape . an attachment member 118 or device may be coupled to the sealing member 110 . the attachment member 118 is operable to removably couple the sealing member 110 to a patient &# 39 ; s epidermis 104 . as used herein , the term “ coupled ” includes coupling via a separate object and includes direct coupling . the term “ coupled ” also encompasses two or more components that are continuous with one another by virtue of each of the components being formed from the same piece of material . also , the term “ coupled ” may include chemical , such as via a chemical bond , mechanical , thermal , or electrical coupling . fluid coupling means that fluid is in communication between the designated parts or locations . the sealing member 110 and attachment member 118 work together to form a fluid seal over the patient &# 39 ; s epidermis 104 . the attachment member 118 may be any material suitable to help couple the sealing member 110 to a patient &# 39 ; s epidermis 104 . for example , the attachment member 118 may be a pressure - sensitive adhesive , heat - activated adhesive , sealing tape , double - sided sealing tape , paste , hydrocolloid , hydrogel , hooks , sutures , etc . in the illustrative embodiment , the attachment member 118 is an adhesive layer 119 coupled to the patient - facing surface 122 of the drape extension 116 . the attachment member 118 may span the entire width or a portion of the patient - facing surface 122 of the sealing member 110 . alternatively , in the case of sealing tape , the attachment member 118 may be applied over the entire first surface 120 of the sealing member 110 , or over the first surface of the drape extensions 116 . the microstrain - inducing manifold 112 is typically positioned between the second , patient - facing surface 122 of the sealing member 110 and the tissue site 103 , e . g ., the wound 102 . the microstrain - inducing manifold 112 may be sized to approximate the estimated area of the wound 102 , although a larger or smaller size may be used in different applications . in the illustrative embodiment , the microstrain - inducing manifold 112 includes a plurality of interconnected nodes 124 . the interconnected nodes 124 may have a substantially circular cross - section , but it will be appreciated that the interconnected nodes 124 may have any suitable cross - section including , but not limited to , triangular , square , rectangular , hexagonal , octagonal , elliptical , etc . each interconnected node 124 may include one or more shaped projections 126 . the shaped projections 126 are operable to create microstrain at the cellular level within the tissue site 103 , e . g ., the wound 102 . while the illustrative embodiment shows each interconnected node 124 having a plurality of shaped projections 126 , it will be appreciated that some interconnected nodes 124 may be formed to avoid creating microstrains in certain areas . for example , one or more shaped projections 126 may be formed with a lower profile in a certain area or be absent all together in certain areas . moreover , an additional manifold with no shaped projections , e . g ., a smooth , laminar manifold , may be placed between at least a portion of the shaped projections 126 of the microstrain - inducing manifold 112 and a portion of the tissue site 103 to prevent the creation of strain in a certain area . it is believed that avoiding microstrains in certain areas is helpful to overall patient care . for example , it may be desirable to have a microstrain - inducing manifold 112 without projections 126 or that does not create microstrains in certain areas if a portion of the microstrain - inducing manifold 112 will lay on top of a vein , an artery , graft ( s ), objects used for adjunctive treatment or therapy ( e . g ., stents ), exposed organs ( e . g ., heart or bowel ), etc . the shaped projections 126 may be substantially the same size . alternatively , some projections 126 may be larger or smaller than others . in one alternative , some shaped projections 126 may have a larger pitch than others , where “ pitch ” is defined by the angle 128 between a reference line 127 formed to have a right angle with a longitudinal axis 129 of the shaped projection 126 as shown in cross section in fig3 c . each shaped projection 126 has an outer surface 130 and a base 132 . while the shaped projections 126 in the illustrative embodiment are conical in shape , it will be appreciated that the shaped projections 126 may have any suitable shape capable of creating a microstrain within the wound 102 ; for example , the shaped projections 126 may be substantially cube shaped , pyramid shaped , hemispherically shaped , cylindrically shaped , triangularly shaped , cylindrically shaped with a distal recess , tapered , more elaborately shaped , etc . the shaped projections 126 are typically angled or tapered from a thick proximal end to a thin distal end or vice versa . in one embodiment , the shaped projections 126 are formed of the same material as the interconnected nodes 124 . alternatively , at least some of the shaped projections 126 may be formed from a different material or the same material type of material with different properties than the interconnected nodes 124 or the other shaped projections 126 . via material selection , one may control the stiffness of the interconnected nodes 124 such that greater microstrain may be provided in certain areas of the wound 102 versus others . the interconnected nodes 124 , shaped projections 126 , and the microstrain - inducing manifold 112 generally may be formed of a foam material or a non - foam material . the interconnected nodes 124 may be interconnected using a network of connecting members 134 . for example , the network of connecting members 134 may include a plurality of members 136 with each member 136 coupling adjacent interconnected nodes 124 to one another . in the illustrative embodiment , the members 136 have a substantially circular cross - section ; however , it will be appreciated that the members 136 may have any suitable cross - section , including , but not limited to , triangular , square , rectangular , hexagonal , octagonal , elliptical , etc . in addition , as will be discussed below , the connecting members 134 may be configured such that the microstrain - inducing manifold 112 behaves anisotropically when subjected to a reduced pressure . the interconnected nodes 124 , connecting members 134 , and shaped projections 126 are arranged such that the microstrain - inducing manifold 112 includes a plurality of flow channels 140 ( fig3 b ) or pathways between the interconnected nodes 124 . the flow channels 140 improve distribution of fluids provided to and removed from the area of tissue around the microstrain - inducing manifold 112 . thus , the microstrain - inducing manifold 112 is operable to assist in applying reduced pressure to , delivering fluids to , or removing fluids from a tissue site 103 . moreover , the design of microstrain - inducing manifold 112 helps to avoid painful removal caused by in - growth , i . e ., when growth of granulation tissue occurs into a manifold , and allows for easier removal from the tissue site 103 . the microstrain - inducing manifold 112 may be formed from any suitable material . by way of example only , and without limitation , the microstrain - inducing manifold 112 may be formed from an elastomer , a bioabsorbable / biodegradable polymer , etc . in addition , the manifold material may itself be , or may be combined with , a radio opaque material or a uv florescent material such that the wound 102 may be scanned with an x - ray or uv light in order to determine whether or not any remnants of the microstrain - inducing manifold 112 remain in the wound 102 after efforts have been made to remove the microstrain - inducing manifold 112 from the wound 102 . additionally , the shaped projections 126 , or microstrain - inducing manifold 112 as a whole , may be coated with a drug ( e . g ., an anticoagulant ), an antimicrobial agent ( e . g ., silver or copper ), a hydrophilic material , etc . optionally , the microstrain - inducing manifold 112 may also be formed with additional components , e . g ., a delivery tube ( not shown ), whereby drugs or antimicrobial agents may be delivered to the wound 102 through the microstrain - inducing manifold 112 . the microstrain - inducing manifold 112 may be formed by any suitable process , including , but not limited to , micromolding , injection molding , casting , etc . the shaped projections 126 may be formed to be substantially integral with corresponding interconnected nodes 124 or may be coupled to corresponding interconnected nodes 124 by any suitable technique , including , but not limited to , mechanical fasteners , welding ( e . g ., ultrasonic or rf welding ), bonding , adhesives , cements , etc . the microstrain - inducing manifold 112 may include numerous devices for creating point pressure or otherwise inducing microstrain . in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 includes limited contact points with the tissue site 103 . the contact points contribute to the inducement of microstrain at the tissue site 103 . thus , in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 40 percent of the surface area x ( 40 % x ). as used herein , “ projection surface area ” means the area that a general projection of an item would make on a flat surface . in another illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 30 percent of the surface area x ( 30 % x ). in another illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 20 percent of the surface area x ( 20 % x ). in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 10 percent of the surface area x ( 10 % x ). in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 5 percent of the surface area x ( 5 % x ). in still another illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 2 percent of the surface area x ( 2 % x ). in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 1 percent of the surface area x ( 1 % x ). in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 0 . 5 percent of the surface area x ( 0 . 5 % x ). in one illustrative , non - limiting embodiment , the microstrain - inducing manifold 112 adjacent the tissue site 103 may have a projection surface area of x cm 2 associated with the second , patient - facing side , and yet the portion of the microstrain - inducing manifold 112 directly impinging on the tissue site 103 may be less than 0 . 2 percent of the surface area x ( 0 . 2 % x ). referring to fig2 , the microstrain - inducing manifold 112 adjacent to tissue site 103 103 , e . g ., wound surface 105 , may cover the wound surface 105 , and may have a projection surface area x , and yet the portion of microstrain - inducing manifold 112 directly impinging on the wound surface 105 may only be 0 . 2 percent of x . referring to fig3 c , it should be understood that the impinging portion may only be a portion of an outer surface 130 of each of the plurality of shaped projections 126 . the microstrain - inducing manifold 112 may be disposed proximate the wound 102 such that the interconnected nodes 124 engage the wound surface 105 . in one illustrative embodiment , the microstrain - inducing manifolds 112 are stacked on top of one another to substantially fill the wound 102 . however , it will be appreciated that a single microstrain - inducing manifold 112 may be employed or a multi - layer microstrain - inducing manifold may also be formed and used . the microstrain - inducing manifold 112 may be formed from a single interconnected node 124 with a shaped projection 126 ; multiple independent interconnected nodes 124 with shaped projections 126 ; or a group of interconnected nodes 124 , which include shaped projections 126 , that are interconnected with the connecting members 134 . it will also be appreciated that a single microstrain - inducing manifold 112 may be rolled up or folded over itself in order to fill the wound 102 . furthermore , it will be appreciated that a single microstrain - inducing manifold 112 may be loaded into the wound 102 and an additional manifold placed atop the manifold 112 . examples of additional manifolds that may be placed atop the microstrain - inducing manifold 112 include , without limitation , devices that have structural elements arranged to form flow channels , cellular foam such as open - cell foam , porous tissue collections , and liquids , gels and foams that include or cure to include flow channels . referring again to fig1 , the reduced - pressure subsystem 114 includes a reduced - pressure source 142 , which may take many different forms . the reduced - pressure source 142 provides reduced pressure as a part of the reduced - pressure wound treatment system 100 . as used herein , “ reduced pressure ” generally refers to a pressure less than the ambient pressure at a tissue site that is being subjected to treatment . in most cases , this reduced pressure will be less than the atmospheric pressure at which the patient is located . alternatively , the reduced pressure may be less than a hydrostatic pressure at the tissue site . reduced pressure may initially generate fluid flow in the microstrain - inducing manifold 112 , a conduit 150 , and proximate the tissue site 103 . as the hydrostatic pressure around the tissue site 103 approaches the desired reduced pressure , the flow may subside , and the reduced pressure may be maintained . unless otherwise indicated , values of pressure stated herein are gauge pressures . the reduced pressure delivered may be static or dynamic ( patterned or random ) and may be delivered continuously or intermittently . although the terms “ vacuum ” and “ negative pressure ” may be used to describe the pressure applied to the tissue site , the actual pressure applied to the tissue site may be more than the pressure normally associated with a complete vacuum . consistent with the use herein , an increase in reduced pressure or vacuum pressure typically refers to a relative reduction in absolute pressure . the reduced - pressure subsystem 114 provides reduced pressure . the reduced - pressure subsystem 114 includes a reduced - pressure source 142 that may be any source of a reduced pressure , such a vacuum pump , wall suction , etc . while the amount and nature of reduced pressure applied to a tissue site will typically vary according to the application , the reduced pressure will typically be between − 5 mm hg and − 500 mm hg . pressure may be applied to the microstrain - inducing manifold 112 in other ways as well ; for example , a pressure wrap may be used . in the illustrative embodiment of fig1 , the reduced - pressure source 142 is shown having a battery compartment 144 and a canister region 146 with windows 148 providing a visual indication of the level of fluid within canister 146 . an interposed membrane filter , such as hydrophobic or oleophobic filter , may be interspersed between the conduit 150 , or tubing , and the reduced - pressure source 142 . the reduced pressure supplied by the reduced - pressure source 142 is delivered through the conduit 150 to a reduced - pressure interface 152 , which may be an elbow port 154 . in one illustrative embodiment , the port 154 is a trac ® technology port available from kinetic concepts , inc . of san antonio , tex . the reduced - pressure interface 152 allows the reduced pressure to be delivered to the sealing member 110 and realized within an interior portion of sealing member 110 as well as the microstrain - inducing manifold 112 . in this illustrative embodiment , the port 154 extends through the sealing member 110 to the microstrain - inducing manifold 112 . in use , the reduced - pressure wound treatment system 100 may be applied to a patient &# 39 ; s epidermis 104 over the tissue site 103 , e . g ., wound 102 . the microstrain - inducing manifold 112 may be disposed proximate the tissue site 103 , e . g ., disposed within the wound 102 , or may overlay a portion of the wound 102 . the sealing member 110 may be placed over the top of the microstrain - inducing manifold 112 such that drape extensions 116 extend beyond the periphery of the wound 102 . the drape extensions 116 are secured to the patient &# 39 ; s epidermis 104 ( or a gasket member , such an additional piece of over drape surrounding the wound edges ) by the attachment member 118 in order to form a fluid seal over the wound 102 . as used herein , reference to forming a fluid seal with the patient &# 39 ; s epidermis shall be deemed to also include forming a seal with a gasket proximate the wound 102 . the reduced - pressure interface 152 is applied , if not already installed , and the conduit 150 fluidly coupled at one end to the reduced - pressure interface 152 . the other end of the conduit 150 is fluidly coupled to the reduced - pressure source 142 . the reduced - pressure source 142 may be activated such that reduced pressure is delivered to the sealing member 110 and microstrain - inducing manifold 112 . the reduced pressure provides reduced - pressure treatment to the tissue site 103 , removes fluids , and may force the shaped projections 126 of the microstrain - inducing manifold 112 against the wound 102 such that they create a microstrain at the cellular level within the wound 102 . as previously suggested , the microstrain may promote cellular proliferation , formation of granular tissue , and other beneficial effects . alternatively , the microstrain - inducing manifold 112 may be placed proximate the tissue site 103 and then pressure may be applied by using a wrap over the microstrain - inducing manifold 112 or other source of pressure . referring now primarily to fig4 a and 4b , an illustrative , non - limiting embodiment of a microstrain - inducing manifold 212 for use as part of a reduced - pressure wound treatment , such as the reduced - pressure wound treatment system 100 in fig1 , is shown . the microstrain - inducing manifold 212 includes interconnected nodes 224 , which include shaped projections 226 extending from the interconnected nodes 224 . in the illustrative embodiment , the shaped projections 226 are conical in shape ; however , it will be appreciated that the shaped projections 226 may be any suitable shape capable of creating microstrain within a wound as previously discussed . moreover , while each interconnected node 224 of the illustrative embodiment includes two projections 226 ( one directed up and one directed down for the orientation shown in fig4 a ), it will be appreciated that any number of projections 224 may extend from each interconnected node 224 or that some of the interconnected nodes 224 may have no projections 224 . also , in the illustrative embodiment , each projection 226 extends substantially normal from a corresponding interconnected node 224 , but it will be appreciated that each projection 226 may extend from the corresponding interconnected node 224 at any angle . the interconnected nodes 224 are spaced apart and interconnected by a network of connecting members 234 as clearly shown in fig4 b . the network of connecting members 234 includes a plurality of curved members 236 . a plurality of flow channels 240 are formed between the interconnected nodes 224 and members 236 . the members 236 have curved surfaces 290 that are curved in a cooperative manner with one another or with the radius of one or more corresponding interconnected nodes 224 such that when the microstrain - inducing manifold 212 is subjected to a reduced pressure , the microstrain - inducing manifold 212 collapses ( partially or fully ) in two directions ( e . g ., along the x - axis 286 and y - axis 288 ) but not at all or to a lesser extent in a third direction ( e . g ., the z - axis 284 ). as the microstrain - inducing manifold 212 collapses , each curved surface 290 of each member 236 abuts or approaches a curved surface 290 of an adjacent member 236 or at least one corresponding interconnected node 224 . this may be particularly advantageous if the reduced - pressure wound treatment system is configured to assist in drawing the wound together during reduced pressure therapy . referring now primarily to fig5 a and 5b , an illustrative , non - limiting embodiment of a manifold structure 412 , which is a form of a microstrain - inducing manifold , is presented . the manifold structure 412 is for use with a reduced - pressure wound treatment system , such as the reduced - pressure wound treatment system 100 of fig1 , is shown . the manifold structure 412 includes one or more longitudinal members 456 . the longitudinal members 456 may be coupled in a spaced relationship by lateral connecting members 460 . the lateral connecting members 460 may be coupled to the longitudinal members 456 . the longitudinal members 456 and lateral connecting members 460 are shown with circular cross - sections , but it should be appreciated that the longitudinal members 456 and lateral connecting members 460 may have any suitable cross - sectional shape . while reference is made to longitudinal and lateral members , the members 456 , 460 need not be orthogonal but may have other relative angles . each longitudinal member 456 of the manifold structure 412 includes one or more shaped projections 426 for creating a microstrain within a wound . the longitudinal members 456 and shaped projections 426 are arranged such that the manifold structure 412 includes a plurality of flow channels 440 or pathways between adjacent longitudinal members 456 or between projections 426 . the flow channels 440 facilitate distribution of fluids provided to and removed from the area of tissue around the manifold structure 412 . it should be understood that any combination of longitudinal members 456 and lateral members 460 may be used . for example , the manifold structure 412 may be formed by a longitudinally connected group of longitudinal members 456 with projections 426 . there are eight such longitudinal groups shown in fig5 a , and while shown with the lateral connecting members 460 , the lateral connecting members 460 may be omitted in some embodiments . moreover , while only lateral connecting members 460 are shown on the ends , it should be understood that any number of permutations are possible , and lateral members 460 may be distributed at various locations between the longitudinal members 456 . in the illustrative embodiment , each shaped projection 426 projects substantially normal from the corresponding longitudinal member 456 . as used here , “ normal ” is a vector which perpendicular to that surface . for a non - flat surface , the normal vector may be taken at a point and is the same as a normal to the tangent plane at that point . it should be appreciated , however , that each shaped projection 426 may project at any angle relative to the corresponding longitudinal member 456 . each shaped projection 426 may include a columnar body 427 , which has a first outer diameter ( d 1 ), and an enlarged member 429 , which has a second outer diameter ( d 2 ). each enlarged member 429 is positioned at the distal end of an associated columnar body 427 . each columnar body 429 may have any shape , e . g ., the cross - section may be a circular , square , elliptical , irregular , etc ., and may vary along its longitudinal dimension . the enlarged member 429 may be a spherical member as shown or may take any other shape , such as rounded cylindrical member , a cubical member , or an irregular shape . the second outer diameter ( d 2 ) of the enlarged member 429 is greater than the first outer diameter ( d 1 ) of the columnar body 427 , i . e ., d 2 & gt ; d 1 . in this regard , the shaped projections 426 may be considered to be tapered from a larger distal end to a smaller proximal end . each shaped projection 426 may have any suitable shape capable of creating a microstrain within the wound when the shaped projection 426 impinges upon the wound . additionally , in the illustrative embodiment , the shaped projections 426 have substantially equal heights , but it will be appreciated that the shaped projections 426 may have varying heights along each longitudinal member 456 or among the plurality of longitudinal members 456 . also , it will be appreciated that certain portions of certain longitudinal members 456 may not have shaped projections 426 such that microstrain is not provided to certain areas within the wound . as with the microstrain - inducing manifolds previously discussed , the manifold structure 412 may be formed using any suitable process , including , but not limited to , micromolding , injection molding , casting , etc . the shaped projections 426 may be formed to be substantially integral with corresponding longitudinal members 456 or may be coupled to corresponding longitudinal members 456 by any suitable technique including , but not limited to , mechanical fasteners , welding ( e . g ., ultrasonic or rf welding ), bonding , adhesives , cements , etc . in use , the manifold structure 412 is placed proximate the tissue site , e . g ., wound , and a sealing member is deployed over the manifold structure 412 and tissue site . reduced pressure may then be applied or alternatively a direct pressure may be applied . in some embodiments , e . g ., embodiment with widely spaced lateral members 460 , when the manifold structure 412 is subjected to a reduced pressure , the manifold structure 412 may behave anisotropically . in other words , when the manifold structure 412 is subjected to a reduced pressure , in addition to the shaped projections 426 being forced into the wound to create microstrain , the longitudinal members 456 may move laterally towards each other . each longitudinal member 456 move closer to an adjacent longitudinal member 456 than the adjacent longitudinal members 456 were prior to the introduction of the reduced pressure . at the same time , the manifold structure 412 does not substantially contract in a direction substantially parallel to the longitudinal members 456 . if the lateral connecting members 460 are omitted , even further contraction may be possible . the manifold structure 412 may deform more in a direction substantially perpendicular to the longitudinal members 456 ( as illustrated by arrows 458 in fig5 a ) without a proportional deformation in the direction parallel with the longitudinal members 456 . the deformation is typically within the same plane . this may be advantageous if the system employs other components , such as an anisotropic drape or another manifold , for drawing the wound together during reduced pressure therapy wherein the illustrative manifold structure 412 contracts in a manner complimentary therewith . if spaced lateral connecting members 460 are used in sufficient number , very little contraction may take place . in an alternative embodiment , the manifold structure 412 is configured such that some longitudinal members 456 are arranged substantially perpendicular to other longitudinal members 456 whereby the manifold structure 412 partially contracts , or contracts in a more limited manner , in two directions within the same plane when subjected to a reduced pressure . referring now primarily to fig6 a and 6b , another illustrative , non - limiting embodiment of a microstrain - inducing manifold 512 for use with a reduced - pressure wound treatment system , such as a reduced - pressure wound treatment system 100 ( fig1 ), is shown . the microstrain - inducing manifold 512 includes a mat 558 , or base , from which a plurality of shaped projections 526 extend . the mat 558 has a first side 513 and a second , patient - facing side 515 . in the illustrative embodiment , the shaped projections 526 are tapered and in particular are substantially conical in shape , but it will be appreciated that the projections 526 may have any suitable shape capable of creating microstrain within the wound . also , while the illustrative embodiment shows the projections 526 extending substantially normal , i . e ., perpendicular , from the mat 558 , it will be appreciated that the projections 526 may extend from the mat 558 at any suitable angle . furthermore , in the illustrative embodiment , the projections 526 have substantially equal heights , but the mat 558 may include projections 526 of varying heights . portions of the mat 558 may not have any projections such that microstrain is not provided to certain areas within the wound . additionally , the stiffness of the shaped projections 526 and pitch of the shaped projections 526 may vary along the mat 558 such that the microstrain created by the projections 526 may be greater in certain areas of the wound versus other areas . the shaped projections 526 may be formed as integral portions of the mat 558 or coupled to the mat 558 by any suitable techniques , including but not limited to mechanical fasteners , welding ( e . g ., ultrasonic or rf welding ), bonding , adhesives , cements , etc . the mat 558 may also includes a plurality of apertures 560 ( fig6 b ) disposed between the projections 526 to improve the distribution of fluids provided to and removed from the area of tissue around the microstrain - inducing manifold 512 . in an alternative embodiment , the shaped projections 526 may be formed from a modified honey on the mat 558 . the honey may be modified so that it is solid or partially solid and retains its shape for at least a certain amount of time whilst engaging the wound . advantageously , the honey may act as an antimicrobial agent and may be absorbed by the patient after a period of time . other dissolvable substances may be used as well . in operation , the microstrain - inducing manifold 512 is typically placed proximate the tissue site with the second , patient - facing side 515 facing the patient and covered with a sealing member . reduced pressure is then delivered to the microstrain - inducing manifold 512 . when subjected to a reduced pressure , the microstrain - inducing manifold 512 impinges on the wound whereby the shaped projections 526 create microstrain within the wound . additionally , exudate and other fluids pass through the mat 558 via the apertures 560 . also , in some instances , it may be desirable to avoid increasing microstrain within the wound via the shaped projections 526 . in such an instance , the microstrain - inducing manifold 512 may be inverted such that the first side 513 of the mat 558 is placed against the wound and the shaped projections 526 extend towards the sealing member ( not shown ). thus , the microstrain - inducing manifold 512 may assist in perfusion and fluid removal ( via the apertures 560 ) without also increasing microstrain within the wound via the shaped projections 526 . referring now primarily to fig7 , an illustrative , non - limiting embodiment of a microstrain - inducing manifold member 624 for use with a reduced - pressure wound treatment system , such as the reduced - pressure wound treatment system 100 in fig1 , is shown . a microstrain - inducing manifold may be formed by a plurality of microstrain - inducing manifolds 624 . each microstrain - inducing manifold member 624 has one or more shaped projections 626 extending from a surface 631 . unlike the reduced - pressure wound treatment system 100 of fig1 - 3b , the microstrain - inducing manifold members 624 are not interconnected by a network of connecting members . rather , a plurality of microstrain - inducing manifold members 624 may be poured into a wound whereby they work together to form the microstrain - inducing manifold in the wound ( in situ ) and whereby the shaped projections 626 of the microstrain - inducing manifold members 624 contact the wound to create microstrain therein . the plurality of microstrain - inducing manifold members 624 may fill the entire wound . alternatively , the plurality of microstrain - inducing manifold members 624 may partially fill the wound , and , optionally , an alternative manifold may be placed atop the microstrain - inducing manifold members 624 to fill the wound . in another alternative , the microstrain - inducing manifold members 624 may have a coating of material that allows the microstrain - inducing manifold members 624 to fuse or sinter in situ to one another and form a single , integral manifold . non - limiting examples of coatings include the following : any water soluble , swellable , or softenable material , including polymers such as poly vinyl alcohol and its copolymer , polyvinyl pyrrolidone and its copolymers , polyethylene oxide and its copolymers , polypropylene oxide and its copolymers , hydroxyl , carboxyl , and sulphonyl containing polymers ( e . g ., hydroxyl ethyl acrylate , carboxyl methyl cellulose , acrylamido methyl propane sulphonic acid and its salts ), alginates , gums ( e . g . xanthan and guar ), other hydrogels and hydrocolloids . although the present invention and its advantages have been disclosed in the context of certain illustrative , non - limiting embodiments , it should be understood that various changes , substitutions , permutations , and alterations can be made without departing from the scope of the invention as defined by the appended claims . it will be appreciated that any feature that is described in a connection to any one embodiment may also be applicable to any other embodiment .	0
the following description includes the best mode of carrying out the invention . the detailed description is made for the purpose of illustrating the general principles of the invention and should not be taken in a limiting sense . the scope of the invention is determined by reference to the claims . each part is assigned its own part number throughout the specification and drawings . fig1 illustrates a data storage system 10 , including a plurality of hosts coupled to data storage subsystem ( s ). each host is a computer that can connect to client ( s ), to data storage subsystem ( s ), and each other . each host provides software / hardware interfaces such as network interface cards and software drivers to implement ethernet , fibre channel , atm , and scsi , and infiniband . hennessy and patterson , computer architecture : a quantitative approach ( 2003 ), and patterson and hennessy , computer organization and design : the hardware / software interface ( 1998 ) describe computer hardware and software , storage systems , caching , and networks and are incorporated by reference . in an embodiment , the first host includes a motherboard with a cpu - memory bus 14 that communicates with dual processors 12 and 41 . the processor used is not essential to the invention and could be any suitable processor such as the intel pentium 4 processor . a processor could be any suitable general purpose processor running software , an asic dedicated to perform the operations described herein or a field programmable gate array ( fpga ). also , one could implement the invention using a single processor in each host or more than two processors to meet more stringent performance requirements . the arrangement of the processors is not essential to the invention . the first host cache memory 20 includes a cache manager 13 , a cache directory 15 , and cache lines 16 . the cache memory 20 is nonvolatile memory or volatile memory or a combination of both . nonvolatile memory protects data in the event of a power interruption or a host failure . data is defined as including user data , instructions , and metadata . nonvolatile memory may be implemented with a battery that supplies power to the dram to make it nonvolatile memory when a conventional external power interrupt circuit detects a power interruption or with inherently nonvolatile semiconductor memory . each host includes a bus adapter 22 between the cpu - memory bus 14 and an interface bus 24 . each host runs an operating system such as linux , unix , a windows os , or another suitable operating system . tanenbaum , modern operating systems ( 2001 ) describes operating systems in detail and is hereby incorporated by reference . the first host is representative of the other hosts , but this feature is not essential to the invention . the first host can communicate with the second host through an interconnect 40 , shown as connected to an adapter 25 to the interface bus 24 . the pci bus is one suitable interface bus and the interconnect 40 may be any suitable known bus , san , lan , or wan technology . in an embodiment , the interconnect 40 is a dedicated fibre channel ( fc ) point - to - point link that connects to fc - pci bus adapter 25 to provide fast point - to - point communication between the hosts . in an alternative embodiment , the interconnect network 30 such as a fc fabric provides extra bandwidth for host - to - host communications . in this embodiment , links 28 , 38 connect to the interconnect network 30 and the hosts use link 28 and link 38 when available . fc standard software can set priority levels to ensure high priority peer - to - peer requests , but there will still be some arbitration overhead and latency in claiming ownership of the links . for example , if links 28 and 38 are busy transferring data when a write request arrives , that operation must complete before either link is free for arbitration . if the interconnect 40 ever fails , communication between hosts can be handled using the interconnect network 30 . the interconnect network 30 can be implemented by interconnects used in data storage systems such as fibre channel , scsi , infiniband , or ethernet , and the type of interconnect is not essential to the invention . in either embodiment , redundant communication between hosts ensures the data storage system has high availability . see clark , ip sans : a guide to iscsi , ifcp , and fcip protocols for storage area networks ( 2002 ) and clark , designing storage area networks ( 1999 ) are incorporated herein by reference . in an embodiment , the data storage subsystems shown in fig1 can be those described in the co - pending u . s . patent application ser . no . 10 / 264 , 603 , entitled , systems and methods of multiple access paths to single ported storage devices , filed on oct . 3 , 2002 , and incorporated herein by reference . it is understood , however , that other storage device ( s ) or data storage subsystems could be used instead of the data storage subsystem described in that u . s . patent application . as shown in fig1 , the first host connects , or couples , to the first data storage subsystem through the bus adapter 22 , the interface bus 24 , the adapter 26 , the link 28 , the interconnection network 30 , and the link 32 . to connect to the second data storage subsystem , the first host uses the same i / o path except the data passes through link 34 , while the second host uses the same type of i / o path plus link 32 to communicate with the first data storage subsystem , or link 34 to communicate with the second data storage subsystem , or link 36 to the data storage subsystem n . fig2 illustrates that each host of the data storage system can store and retrieve files from a data storage subsystem 35 using an interconnect 28 , an interconnect 33 , and an interconnect network 30 . in an embodiment , each storage device in the data storage subsystem is assigned a logical unit number ( lun ) that is an identifier for the storage device . a virtual logical unit number ( vlun ) is as an abstraction of the storage device ( s ) or the virtualization of the data storage subsystems such as a linear array of blocks as it appears to the data storage system users . in various embodiments , the implementation of a vlun may be striped ( i . e ., spread ) over multiple raid groups for added performance , spread over sections of a raid group for flexibility , or copied on multiple raid groups for reliability . as shown , the storage devices of the data storage subsystem are virtualized as a file system employing contiguous fixed sized blocks 0 - n where the size of each block is some value preferably 1 - kb to 64 - kb . fig3 illustrates a data storage subsystem for maintaining ( e . g ., allocating , reading , writing , and deallocating ) some blocks for index tables , some for space maps , and others for usable space for data storage . the block ( s ) allocated to an index table depends on the size of each block and the number of concurrent snapshots supported . for example , three 8 - kb blocks may be sufficient space to support an index table of 254 snapshots . as shown , the file system has a pair of index tables 195 and 196 and thus uses six 8 - kb blocks so the host can alternate writes to the index tables to ensure recovery in case of a data storage system failure . thus , if the system fails during a write to one index table , the host can retrieve the unmodified copy of the other index table . while we describe this method of writing to alternate index table copies , other methods , such as write journaling , can be used to protect against system failure during index table writes . the remainder of the storage is allocated to space map blocks with usable space for data storage . each index table includes an index value of the active file system 17 permitting fast location of the active file system . the index table includes a known algorithm to verify the data integrity such as a checksum 18 , a cyclic redundancy check , or a digital signature . the index table provides an index to the snapshots and the active file system . each entry in the index table represents a snapshot or the active file system . as illustrated , the index range is 1 - 255 , but this range is not essential to the invention . in various embodiments , each snapshot and the active file system has one or more associated attributes such as a version number 19 , timestamp 23 and / or image name 29 to identify the snapshot or active file system , an image state 21 , a root block pointer 27 , as described below . when the data storage system takes a snapshot of the file system it assigns the snapshot a unique version number such as a 32 - bit unsigned integer that increases monotonically for each subsequent snapshot . the version number is not reused even as snapshots are deleted or made obsolete to the file system . active — representing the active file system in - use snapshot — representing a snapshot that users can access free — representing available for writing by a snapshot or active file system deleted snapshot — representing a user has deleted the associated snapshot but a cleaner process or thread has not yet removed the space map block entry for this snapshot obsolete snapshot — representing a user has reverted to an earlier snapshot and the cleaner process or thread has not yet removed the space map block entry for this snapshot in an embodiment , when the data storage system takes a snapshot of the file system , the host provides a timestamp ( e . g ., time and date ) when the snapshot or active data image was created . the root block pointer provides the address of the root block in the hierarchical structure of the snapshot and the image name is a character string used to easily identify the snapshot to users . referring to fig4 , the remainder of the data storage subsystem is allocated to space map blocks and usable space for data . each space map block keeps track of the blocks in its usable space for data storage . for example , a space map block can keep track of 2 , 047 blocks of usable space . each space map block entry contains a pair of indexes (“ a space map block entry ”), for example , 8 - bits in length that represent any of 254 snapshots or the active file system . each space map block entry is an index into the index table shown in fig3 . each space map block entry has a beginning value b that indicates the first snapshot ( i . e ., snapshot b ) and an ending value e that indicates the last snapshot ( i . e ., snapshot e ) to use the associated block . thus , each space map block entry ( b , e ) in the space map block is used to track the usage of an associated block in the usable space : in an alternative embodiment , each space map block entry contains a pair of version numbers ( e . g ., 32 - bit ) that represent snapshots or the active file system . thus , each version pair ( b , e ) in the space map block would be used to track the usage of an associated block in the usable space . fig5 illustrates how a space map block entry is used to track a block in the usable space . in an earlier stage of operation , the space map may contain many entries with beginning and ending values equal to zero indicating that many blocks in the data storage subsystem are free - to - use for snapshots or the active file system . at the same time , other blocks will be in - use that is allocated to snapshots or the active file system . fig5 shows one such block used by snapshots assigned version number 10344 through version number 10388 inclusive . the space map block entry ( 16 , 13 ) indicates the snapshots that use this block . the host associates the space map block entry with the version number of the snapshot by reading the index table . the space map block also contains space map block entry ( 212 , 0 ) to show that the active file system , for example , assigned version number 65993 is using an associated block . fig6 illustrates the relationship between the index table 200 and the snapshot attributes and the active file system attributes . the table below illustrates the group of attributes 203 , 204 , 205 , 206 , 207 , and 208 that are shown in fig6 : fig7 illustrates a flow diagram of a method for creating a file system . this method can occur during the process of initialization . in an embodiment , the initialization process has proceeded to the point where the next steps relate specifically to file system creation . although the method is described serially below , the steps can be performed in parallel , for example , asynchronously or in a pipelined manner . there is no requirement the method be performed in the order shown except where indicated . further , the steps are implemented by computer such as one or more host ( s ) described earlier . for brevity , we describe the methods as executed by a host . referring to step 105 of fig7 , the host sets all of the space map block entries equal to ( 0 , 0 ). this indicates that the blocks corresponding to the entries are free - to - use . at step 106 , the host selects an 8 - bit index “ a ” that represents the active file system . at step 108 , the host assigns a starting version number to index a . at step 110 , the host loads index “ a ” into the index of the active file system 201 in the directory 200 ( fig6 ). at step 112 , the host selects the first available space map block and at step 114 loads the beginning index 8 - bit index “ a ” and an 8 - bit ending index 0 into the first entry in the selected space map block . at step 116 , the host sets the starting version number in the associated attributes for the active file system in index table entry “ a ”. the host further sets the image state to active at step 118 , the timestamp to the current date and time at step 120 , and a starting root block pointer at step 122 , calls an algorithm to verify the data integrity ( e . g ., checksum ) of the snapshot attributes , and stores the results in index table entry “ a ” at step 124 . at step 126 , the host may write the index table to nonvolatile storage . in one embodiment , at step 128 , the host continues with any other activities such as initialization . in another embodiment , the other activities can precede the creation of the file system . fig8 illustrates a flow diagram of a method of block management . at step 42 , the host receives a request to update the file system data . at step 44 , the host reads the space map block entry of the associated received data to determine if that block is used by the active file system only . if yes , as indicated by the space map block entry =( a , 0 ), the host determines at step 45 whether or not the data is a modification of existing data or an addition to existing data . if the received data is a modification of existing data , the host overwrites the block at step 46 and returns to normal operation at step 58 . if the received data is an addition to the existing data , the host determines at step 48 if the space available in the current block is enough to hold all of the received data . if yes , the host adds the received data to the current block at step 50 and returns to normal operation at step 58 . if not , the host allocates a free - to - use block at step 52 to hold the additional data and changes the associated space map block entry from ( 0 , 0 ) →( a , 0 ). at step 54 , the host adds the received data to the newly allocated block . at step 56 , the host updates the file system block pointers to point to the new data . at step 58 , the block management routine returns to normal system operation . at step 44 , if the space map block entry of the block associated with the received data indicates an in - use snapshot uses the block , that is , the space map block entry ( b , 0 ), the host allocates a free - to - use block for the received data at step 60 . at step 62 , the host adds the received data to the new allocated block . at step 63 , the host changes the space map block entry of the new allocated block from ( 0 , 0 )→( a , 0 ) indicating the new block is used by the active file system only . at step 64 , the host updates the file system block pointers to point to the new data . at step 66 , the host determines if there are other in - use snapshots pointing to the same old block . if the index b is associated with the latest snapshot version number , there is no other in - use snapshots pointing to the same old block . therefore , at step 67 , the host updates the old space map block entry from ( b , 0 )→( b , b ) indicating snapshot b is the only snapshot pointing to the associated old block and that the old data has been modified since snapshot b was created . if the index b is not associated with the latest snapshot version number , there is another in - use snapshot pointing to the same old block . therefore , at step 68 , the host updates the old space map block entry from ( b , 0 )→( b , e ) to indicate that snapshot b is the beginning snapshot and snapshot e is the ending snapshot ( i . e ., current in - use snapshot with the latest snapshot version number ) pointing to the associated old block . in this case , there may be other snapshots with version numbers less than snapshot e and greater than snapshot b pointing to the same old block . in either case , the block management routine returns to normal system operation at step 58 . fig9 illustrates a flow diagram of a method of creating a snapshot . after receiving a request for a new snapshot of the file system , the host holds off from updating the active file system at step 140 . at step 142 , the host searches through the index table for the first snapshot with an image state equal to free . at step 144 , if the host searches the entire index table and does not find a free image state , the routine reports no free snapshots at step 146 and the host resumes normal file system operation at step 164 and if appropriate , the operator can delete some snapshots . if , at step 144 , a free image state is found , the host changes the active file system &# 39 ; s image state to in - use at step 148 . at step 150 , the host enters a timestamp of the new in - use snapshot . when this snapshot is created , the version number and the root block pointer remain as they were when the block was allocated to the active file system . at step 151 , the host assigns a user - friendly image name for the in - use snapshot . this completes creation of the new snapshot . next , the host establishes an active file system for normal use . at step 152 , the host changes snapshot attributes containing the image state free to the active file system . at step 154 , the host assigns the next version number to the new active file system . at step 156 , the host enters the current root block pointer ( same as the new snapshot ) in the attributes of the active file system . at step 158 , the host saves a user - friendly image name of the active file system . the snapshot table is written to nonvolatile storage at step 162 . the host returns to normal operation at step 164 . fig1 illustrates a flow diagram for a method used to revert to an earlier version of a snapshot . fig1 a and 15 b illustrate diagrams of the method of reversion . at times it is desirable or necessary to revert to an earlier version of the file system . an earlier version of the file system is any previous snapshot of the active file system . once a previous snapshot is selected , the host discards all versions of the file system after the chosen version , including the current active file system . after receiving a request to revert to the previous snapshot , for example , snapshot p shown in fig1 a , the host will hold off updates to the current active file system at step 210 . at step 212 , the host changes the image state of all snapshots after snapshot p from in - use to obsolete and changes the image state of the active file system from active to obsolete ( see fig1 b ). at step 214 , the host makes a copy of snapshot p , for example , called snapshot c . snapshot c is used to receive any updates to space map block entry ( p , 0 ) that were held off during the process of reverting to the previous snapshot version . this permits snapshot p to be preserved in its present state after the system is brought back to an active image state , while at the same time , not losing the pending updates . at step 216 , the host sets the image state of snapshot c to in - use . at step 218 , the host assigns the next unused version to snapshot c . at step 220 , the host sets the root block pointer of snapshot c to the same root block pointer of snapshot p . at step 222 , the host creates another copy of snapshot p , for example , called copy a . the copy a will become the active file system of the desired image of snapshot p . at step 224 , the host sets the image state of copy a to the active file system . at step 226 , the host assigns the next version number to copy a . at step 228 , the host sets the root block pointer of copy a to the same root block pointer of snapshot p . at step 230 the host records index a of the active file system into the index table 200 ( fig6 ). at step 232 , the host writes the index table to nonvolatile storage . at step 234 , the host returns to normal file system activity . fig1 a illustrates a flow chart for a method to delete a snapshot . at step 75 , after receiving a request to delete a snapshot ( see also fig1 c ) the host searches the index table for the requested snapshot . at step 76 , the host sets the image state of the requested snapshot to deleted . at step 77 , the host returns to normal file system operation . fig1 b illustrates a high level flow chart for cleaning deleted and obsolete snapshots from the space map blocks and index table of the file system . at step 79 , the host determines if any obsolete snapshots exist . if yes , the host goes to reference a in fig1 to clean obsolete snapshots from the space map blocks . if not , the host goes to step 81 and determines if any deleted snapshots exist . if not , then no work needs to be done and the method is complete . at step 81 , if a deleted snapshot is found , the host goes to reference h in fig1 to clean deleted snapshots from the space map blocks and index table of the file system . fig1 illustrates the detailed flow chart for cleaning obsolete snapshots from space map block entries after a reversion to snapshot p . step 300 examines each space map block entry one by one in the file system . step 310 tests whether the beginning index of the space map block entry either matches the snapshot p to which we reverted or precedes snapshot p while the ending index refers to an obsolete snapshot later than p and earlier than c , the snapshot copy created in step 222 on fig1 . if the space map block entry matches these conditions , step 312 changes the space map block entry to ( b , 0 ) to indicate that the block is now in use by the active file system . if so , step 314 tests if the beginning index of the space map block entry indicates a snapshot later than the reverted - to snapshot p and the ending index indicates an obsolete snapshot earlier than the copy snapshot c . if so , step 316 sets the space map block entry to ( 0 , 0 ) to indicate that the entry is free - to - use since no snapshot any longer references it . if neither of the conditions tested by steps 310 or 314 are true , then step 318 leaves the space map block entry unchanged . after executing step 312 , 316 , or 318 , step 306 tests if we have processed the last space map block entry in the file system . if we have processed the last entry , processing continues at reference j on fig1 a to remove the index table entry for all the obsolete snapshots . otherwise , step 308 moves to the next space map block entry and processing continues at step 300 . after completing the processing of all obsolete snapshots in the space map blocks , processing continues at reference j on fig1 a to remove the index table entries corresponding to obsolete snapshots . processing begins at the first index table entry in step 400 . step 410 tests if the index table entry is obsolete . if so , step 420 clears the index table entry by setting the image state to free - to - use , the timestamp to 0 , the root block pointer to 0 , and by clearing the name reference . step 430 tests if we have processed the last index table entry . if this is not the last index table entry , step 440 moves to the next index table entry and processing continues at step 410 . after all index table entries have been processed , all obsolete snapshots have been completely removed from the file system . returning to fig1 b , if step 81 detects any deleted snapshots in the index table , processing continues at reference h on fig1 . on fig1 , step 600 begins with the first space map block entry . step 610 tests if the beginning index of the space map block entry references a deleted snapshot . if yes , then step 620 tests for any active file system or in - use snapshot with a version later than the beginning space map block entry index . if no snapshot or active file system is found later than the space map block entry beginning index , then step 680 sets the entry to ( 0 , 0 ) to indicate the corresponding block is free to use . if a later snapshot or active file system is found , step 630 sets the beginning index of the space map block entry to the index of the found snapshot or active file system and continues processing at reference g on the same sheet . step 640 similarly tests the ending index of the space map block entry to see if it references a deleted snapshot . if so , step 650 tests if there is a snapshot with version less than the current ending index and later than or equal to the version of the beginning index . if not , step 680 sets the space map block entry to ( 0 , 0 ) to indicate that the block is free - to - use . otherwise , step 660 sets the ending index to the latest in - use snapshot before the current ending index . after completion of either step 660 or 680 , step 670 tests for another space map block entry . if there are more space map block entries to process , control returns to step 610 . after all space map block entries have been processed , control resumes at reference k on fig1 b to remove index table entries for deleted snapshots . fig1 illustrates a diagram of a case where a second reversion to a prior snapshot s has occurred before the background cleaning process for the first reversion to snapshot p has completed . as the file system reverts to a prior snapshot , a pending list is maintained to record the indexes and associated version numbers of the affected snapshots each time the reversion process is invoked . if the file system reverts to more than one snapshot over a span of time where the background cleaning process has not completed , the pending list organizes the cleaning activity by individual reversion event to maintain data reliability of the snapshots . multiple reversions are likely to occur in large and / or high activity test environments . at times , a user may want to free storage space in the file system . because some data may not be deleted without prior consent , a user administering a data storage system may seek a quicker way to get more storage space . for example , the user may be curious how much space will be freed if he deletes older snapshots . however , since the present invention provides snapshots that share blocks and different snapshots share varying amounts of space with each other and with the active file system , it may not be apparent how much space will be freed by deleting a given snapshot . the invention enables a user to determine in advance how much freeable space will be acquired by deleting a given snapshot . fig1 illustrates a user interface for presenting snapshot statistics and assisting in snapshot management that can be run in a management controller of a data storage system such as described in u . s . application ser . no . 10 / 837 , 322 , guided configuration of data storage systems , filed on apr . 30 , 2004 , and in particular , fig2 - 3 and accompanying specification , and incorporated by reference herein . referring to fig1 - 18 , the user interface uses a table to represent a set of snapshots and each of their attributes ( e . g ., image name , timestamp and freeable space ) and select one or more snapshots for deletion . below this table are graphical elements to actually delete the selected snapshots . the total field keeps a running tally of the total freeable space in gb that will be obtained if the selected snapshot ( s ) are deleted . fig1 illustrates the user interface as displaying a set of snapshots ( e . g ., eight snapshots ) taken over a time period ( e . g ., several weeks ). once the user selects a first snapshot for deletion , the user interface presents a first value of freeable space . as shown , if the user marks the check box adjacent the snapshot with an image name of weekly 1 and a timestamp of apr . 02 , 2006 , the user interface presents a value of freeable space , e . g ., 1150 gb . the user can delete the first snapshot by interacting with another graphical element ( e . g ., delete snapshots ) and the freeable space , e . g ., 1150 gb , is released to the free memory in the file system . if the user decides instead he wants to start all over again in selecting snapshots for deletion without leaving the user interface for snapshot management , he can interface with another graphical element ( e . g ., clear selections ) and all snapshot selections will be cleared ( e . g ., marks in the checkbox erased ). fig1 illustrates the user interface , prior to deletion of the first snapshot selected , after the user selects a second snapshot with an image name of daily 4 and a timestamp of apr . 12 , 2006 . now the freeable space shows a second value of freeable space , e . g ., 700 gb . in our example , the freeable space of the first snapshot also increases ( e . g ., from 1150 to 1300 ) since the first and second snapshot share an additional 150 data blocks . finally , the user interface presents the total freeable space , e . g ., 2000 gb , that will result once the first and second snapshots are actually deleted . after all selections are made as illustrated by the two snapshots in fig1 , the user will make his final decision on whether the value of keeping the snapshots is less than the benefit of freeing up that amount of storage space . if so , the user executes his final decision by interacting with the graphical element ( e . g ., delete snapshots ). this two - step selection and deletion process enables the user to see the freeable space associated with any combination of snapshots before deletion and reduces the chance of unintentional deletions . again , if the user wants to clear the selections , prior to deletion , he can select the clear selections button or select exit to leave this user interface ( not shown ). in alternative various embodiments , the user interface can present the same information and choices as just explained in a menu - based or command based interface . to present this information in the user interface , the file system maintains the snapshot space statistics in the following manner . the file system will scan all the space map blocks at time intervals and count the number of each type of space map block entry in the space map blocks . because space map block entries serve as an index to a block in user data space , the blocks can be related to each snapshot . in an embodiment , the invention stores the free space information after a scan ( e . g ., a scan to free blocks from deleted or obsolete snapshots ) and keeps the free space information up to date during operation and with creation and deletion of snapshots . to keep track of the blocks associated with each snapshot , the file system provides a data structure referred to as snapspace matrix or simply snapspace . fig1 illustrates a small snapspace matrix that is a two - dimensional array in the file system and indexed by beginning and ending ( b , e ) snapshot indexes in space map blocks . the size of the snapspace matrix corresponds to the number of snapshots to be taken , and can be static or dynamic at run time . the number of space map blocks and their size depends on the relative allocation between the usable data space and the space map blocks and the overall size of the file system as shown in fig4 . as shown in fig1 , each element of the snapspace matrix contains the number of index entries found in the space map blocks . if each space map block entry points to one block in usable data space ( see fig4 ), each element also contains the number of blocks associated with that index entry ( b , e ). for example , the first and second space map blocks each contain five index entries ( 0 , 0 ), representing free blocks , so element [ 0 , 0 ] of the snapspace matrix contains 10 . further , the first and second space map blocks each contain an index entry ( 3 , 1 ) so element [ 3 , 1 ] of the snapspace matrix contains 2 blocks . the first space map block contains an index entry ( 1 , 0 ), representing the active file system , so element [ 1 , 0 ] of the snapspace matrix contains 1 block , while the second space map block contains an index entry ( 2 , 2 ), so element [ 2 , 2 ] of the snapspace matrix contains 1 block . because the number of space map block entries corresponds to the number of blocks in the file system having a given index entry , a 64 - bit counters should be more than adequate in many situations to keep track of the number of index entries contained in each element of the snapspace matrix . operations that scan and update the space map blocks to remove deleted and obsolete snapshots update the snapspace matrix as described earlier for normal operations . as shown in fig2 a , during operation on space map block p , the file system updates the snapspace matrix beginning at step 800 . if a normal operation changes a space map block entry from ( old_b , old_e ) to ( new_b , new_e ), the file system updates the snapspace matrix by decrementing snapspace [ old_b , old_e ] at step 810 and incrementing snapspace [ new_b , new_e ] at step 820 . at step 830 , the method of update is done . this value swap also illustrated in fig2 b entails the total value of all of the elements of the snapspace matrix remains constant which is to be expected given a file system has a predetermined size . file system utilities can use the snapspace matrix to determine the number of blocks a user will free by deleting a snapshot . in one case , snapspace [ s , s ] indicates the number of blocks that deleting snapshot s will free . as the user considers the deletion of more snapshots , the file system takes into account the cumulative effect of deleting a set of snapshots . an embodiment can simply copy the snapspace matrix and update the copy accordingly as the user considers deleting various snapshots . in another aspect , the invention provides a snapspace matrix that reduces the required memory needed to hold the elements of snapspace matrix updated during normal operations . during normal operation with active index a and the most recent snapshot having index r , the file system changes the space map block entries to ( b , r ) and allocates new space with entries of the form ( a , 0 ). if we arrange snapspace by columns and put snapspace [ b , e ] adjacent to snapspace [ b + 1 , e ] then we need to keep in memory only 2 × 256 × 8 bytes or 4 , 096 bytes . fig2 shows a flowchart of a method for calculating the amount of free space available after deleting one or more snapshots . at step 700 , the method initializes the variable freed_blocks to zero . freed_blocks will accumulate the number of blocks available in deleted snapshots . at step 702 , the method initializes the variable b to 1 . the variable b indicates the beginning snapshot index under current consideration ; no space map block entry representing allocated space has a beginning index of 0 , so the method starts with 1 . at step 704 , the method compares b to see if the maximum value of 256 has been reached . if so , the method terminates at step 722 with freed_blocks containing the total number of blocks available in deleted snapshots . at step 706 , the method initializes the variable e to 1 ; e indicates the ending snapshot index under consideration . since no space map block entries representing space that can be freed end in 0 , the method begins with the value of 1 . at step 708 , the method compares e to the maximum value ; if e has reached this value , the method increments b at step 720 and resumes execution at step 704 . at step 710 , the method determines the value tsb representing the timestamp of the snapshot index b . at step 712 , the method determines the value tse representing the timestamp of snapshot index e . at step 714 , the method tests for any undeleted snapshots with a timestamp between tsb and tse , inclusive . if there are any such snapshots , then the file system still needs to retain blocks represented by space map block entry ( b , e ), so the method increments e to the next value at step 718 and resumes execution at step 708 . at step 716 , the method has determined no snapshots still need to retain blocks represented by space map block entry ( b , e ), so the method adds snapspace [ b ][ e ] to freed_blocks , then continues execution at step 718 . in an embodiment , an array is prepared in advance that contains the timestamps of undeleted snapshots sorted in ascending order . the search for undeleted snapshots with a timestamp between tsb and tse at step 714 is performed by a binary search of the array of timestamps for any timestamp at least as large as tsb and no larger than tse . while the method of fig2 determines the space allocated to deleted snapshots , it can be modified to determine the space allocated by a set of snapshots proposed to be deleted by changing the test at step 714 to test for any snapshots not in the proposed list with timestamps between tsb and tse . an enterprise may want to protect data contained in its file system by storing a remote copy of the file system off - site if the primary data storage system fails or in the event of a local disaster . data replication can provide this protection by transmitting the primary file system over a network to a secondary data storage system . the primary data storage system &# 39 ; s file system is actively modified . the primary data storage maintains a base snapshot of the active file system that represents the contents of the file system of the secondary data storage system . to bring the secondary file system up - to - date after modifications to the blocks of the primary file system , the primary data storage system will periodically ( e . g ., hourly or daily or weekly ) take a delta snapshot , examine the space map block entries of the file system to identify the modified blocks between the base snapshot and the delta snapshot , and transmit the modified blocks from the primary data storage system to the secondary data storage system . an enterprise may also protect data in its file system by only backing up the blocks that have been modified since the last back up . the invention provides an efficient way to find the modified blocks . fig2 a through 22 g shows the relationship between a block that has an associated space map block entry ( b , e ) and a base snapshot and a delta snapshot . these relationships explain whether the block has been modified after the base snapshot and is still in use in the delta snapshot and therefore contains new or modified information associated with the delta snapshot . in fig2 a , the space map block entry describes a block allocated and freed before the base snapshot . therefore , the block was not modified after the base snapshot and is not associated with the delta snapshot . in fig2 b , the space map block entry describes a block allocated before the base snapshot and freed before the delta snapshot . while the block transitions from being allocated to not being allocated between the base snapshot and the delta snapshot , the data on the block is not modified . in fig2 c , the space map block entry describes a block allocated after the base snapshot and freed before the delta snapshot . therefore , the block does not contain data that changed since the base snapshot and is still allocated after the delta snapshot . in fig2 d , the space map block entry describes a block allocated after the base snapshot and freed after the delta snapshot . therefore , the block was modified after the base snapshot and is still allocated after the delta snapshot . the block is modified between the base snapshot and the delta snapshot . in fig2 e , the block is allocated and freed after the delta snapshot . therefore , the block is not modified between the base snapshot and the delta snapshot . in fig2 f , the block is allocated before the base snapshot and freed after the delta snapshot . therefore , the block is not modified between the base snapshot and the delta snapshot . in fig2 g , the space map block entry describes a block allocated after the base snapshot that remains active ( i . e ., as indicated by the last entry being “ 0 ”) after the delta snapshot . therefore , the block was modified after the base snapshot and is still allocated after the delta snapshot . the block is modified between the base snapshot and the delta snapshot . fig2 shows a method implemented in a software program and executed in a host ( fig1 ) that determines whether a block is modified after a base snapshot and before a delta snapshot . at step 822 , the method reads the base snapshot version ( e . g ., time stamp or version number ). at step 823 , the method reads the delta snapshot version ( e . g ., time stamp or version number ). at step 824 , the method reads ( b , e ) from the space map block entry corresponding to the block . at step 820 , the method reads versions corresponding to ( b , e ) from the index table . at step 825 , the method tests if the snapshot version corresponding to entry e is greater than or equal to the delta snapshot version . if not , the method indicates that the block is not in use at the delta snapshot ( see fig2 a , 22 b , and 22 c ) and terminates at step 831 . if the snapshot version corresponding to the entry e is greater than or equal to the delta snapshot version at step 825 , the method tests if the snapshot version corresponding to the entry b is less than or equal to the delta snapshot version at step 826 . if not , the method determines that the block was modified after the delta snapshot ( see fig2 e ) and terminates at step 832 . if so , the method tests if the snapshot version corresponding to the index b is greater than the base snapshot version at step 828 . if not , the method determines that the block is the same in the base snapshot and the delta snapshot ( see fig2 f ) and terminates at step 834 . if so , the method determines that the block was modified after the base snapshot and is still allocated to the delta snapshot ( see fig2 d and 22 g ) and terminates at step 830 . fig2 shows a method implemented in a software program executed in a host for finding all the blocks modified in a file system between a base snapshot and a delta snapshot . at step 700 , the method reads the base and delta snapshot versions . at step 702 , the method sets a block number to the base block number in the file system . at step 704 , the method checks if block number is less than the file system size . if not , the method terminates at step 716 . steps 702 and 704 determine the block is in the file system . if the block is in the file system , the method tests if the block number is a space map block at step 706 . if yes , at step 713 , the method reads the spacemap block version . at step 722 , the method tests if the version of the space map block is greater than the version of the base snapshot . if yes , the method proceeds to step 712 and outputs the block number of the modified block . if not , the method increments the block number at step 714 and resumes at step 704 . if step 706 determines that the block number is not a space map block , the method proceeds to step 710 that determines if the block was modified after the base snapshot and before the delta snapshot ( fig2 ). if not , the method increments the block number at step 714 and resumes at step 704 . if yes , the method outputs the block number of the modified block at step 712 , increments the block number at step 714 and resumes at step 704 . fig2 illustrates the details of a space map block and its space map block version . the space map block version indicates the version of the file system from the index table ( fig3 ) that last modified the space map block . this permits the file system to identify space map blocks that have been modified . fig2 illustrates a method for finding modified blocks between a base snapshot and a delta snapshot in a file system by traversing a tree data structure such as a b - tree or radix tree . cormen et al ., introduction to algorithms ( 2003 ) describes b - trees at pages 434 - 454 and other suitable data structures and is incorporated by reference herein . at step 733 , the method reads the base snapshot and the delta snapshot versions . at step 734 , the method reads ( b , e ) from the space map block entry that corresponds to the root block of the tree data structure . at step 736 , the method determines if the root block was modified between the base snapshot and the delta snapshot using the method of fig2 . if not , the method terminates at step 738 . if so , the method outputs the block number of the modified block at step 746 . next , the method proceeds to step 740 and determines if the root block is a leaf block ( i . e ., has no descendants ). if so , the method terminates at step 744 . if not , the method proceeds to step 742 where the method performs steps 734 , 736 , 740 , 742 , and 746 on the direct children of the root block .	6
one object of the invention is an active molecule capable of modulating the activity of a native protein of a parasitic organism of the apicomplexa phylum , wherein said molecule is endowed with serine - threonine phosphatase activity , or a fragment thereof a fragment of said molecule is peptidic sequence capable of being recognized by a polyclonal serum obtained after immunization of a rabbit with a purified pp2c protein of t . gondii . in a preferred embodiment , the molecule endowed with serine - threonine phosphatase activity is a type 2c phosphatase ( pp2c ), and the parasitic organism of apicomplexa phylum is selected from the group comprising toxoplasma gondii , plasmodium falciparum and crystosporidium parvum . another object of the invention is a molecule for preventing or treating an infection due to a parasitic organism of the apicomplexa phylum wherein said molecule modulates the interaction between a protein of said parasitic organism endowed with serine - threonine phosphatase activity and toxofilin of said parasitic organism . in a preferred embodiment , the protein of said parasitic organism endowed with serine - threonine phosphatase activity is a type 2c phosphatase ( pp2c ), and the parasitic organism of apicomplexa phylum is selected from the group comprising toxoplasma gondii , plasmodium falciparum and crystosporidium parvum . the protein of said parasitic organism has a nucleic acid sequence and an amino acid sequence with sufficient identity compared to the sequence of fig1 for being endowed with serine - threonine phosphatase activity . the active site corresponding to the enzymatic activity is located from amino acid 18 to amino acid 325 ( included ). the molecular weight is 37 kda . another object of the invention is a method for screening molecules capable of modulating the activity of a native protein of a parasitic organism of the apicomplexa phylum endowed with serine - threonine phosphatase activity wherein said method comprises the steps of : a ) possibly fixing a native or a recombinant toxofilin of said parasitic organism to a matrix ; b ) phosphorylating said toxofilin with labeled atp using a parasite kinase fraction or a recombinant casein kinase ii ; d ) incubating the labeled toxofilin with or without the molecule to be tested and adding a native or a recombinant serine - threonine phosphatase of said parasitic organism ; wherein a variation of the labeling of the toxofilin incubated with the molecule to be tested compared with the labeling of the toxofilin incubated without the molecule to be tested is indicative of the capacity of the molecule to modulate said serine - threonine phosphatase activity of said protein . in a preferred embodiment , the protein of said parasitic organism endowed with serine - threonine phosphatase activity is a type 2c phosphatase ( pp2c ), and the parasitic organism of apicomplexa phylum is selected from the group comprising toxoplasma gondii , plasmodium falciparum and crystosporidium parvum . an other object of the invention in a molecule capable of modulating the activity of a native protein of a parasitic organism of the apicomplexa phylum endowed with serine - threonine phosphatase activity which is capable to be screened by said method . another object of the invention is a method for screening molecules for preventing or treating an infection due to a parasitic organism of the apicomplexa phylum wherein said method comprises the steps of : f ) possibly fixing a native or a recombinant toxofilin of said parasitic organism to a matrix ; g ) phosphorylating said toxofilin with labeled atp using a parasite kinase fraction or a recombinant casein kinase ii ; i ) incubating the labeled toxofilin with or without the molecule to be tested and adding a native or a recombinant serine - threonine phosphatase of said parasitic organism ; wherein a decrease of the labeling of the toxofilin incubated with the molecule to be tested compared with the labeling of the toxofilin incubated without the molecule to be tested is indicative of the capacity of the molecule to prevent or treat an infection due to a parasitic organism of the apicomplexa phylum . in a preferred embodiment , the protein of said parasitic organism endowed with serine - threonine phosphatase activity is a type 2c phosphatase ( pp2c ), and the parasitic organism of apicomplexa phylum is selected from the group comprising toxoplasma gondii , plasmodium falciparum and crystosporidium parvum . another object of the invention is an active molecule for preventing or treating an infection due to a parasitic organism of the apicomplexa phylum which is capable to be screened by said method . another object of the invention is an antibody directed against a native protein of a parasitic organism of the apicomplexa phylum , said protein being endowed with serine - threonine phosphatase activity . another object of the invention is a method for preventing or treating an infection due to a parasite of the apicomplexa phylum wherein said method comprise administration of a molecule of the invention . in vivo 32 p orthophosphate labeling of tachyzoïte and toxofilin immunoprecipitation purified transiently extracellular parasites were rinsed in phosphate and serum - free buffer ( 10 mm tris - cl ph 7 . 4 , 150 mm nacl , 5 mm kcl , 5 mm mgcl 2 , 1 . 6 mm cacl 2 , 0 . 5 % glucose , 0 . 1 % bovine serum albumin ) and incubated at 10 8 per ml in the same medium supplemented with 500 μci per ml of orthophosphoric acid ( specific activity of 8 . 8 10 9 ci per mmole from nen life science products , inc ) ( 120 min , 37 ° c ., 5 % co 2 ). unincorporated radioactive phosphate was then washed out by rinsing three times the parasites in 50 ml of phosphate and serum - free buffer . 10 9 tachyzoïtes were lysed in 1 ml of [ 20 mm tris - cl ph 8 . 0 , 50 mm kcl , 0 . 1 mm ethyleneglycol - bis ( β - aminoethyl )- n , n , n , n ′- tetraacetic acid ( egta ), 0 . 1 mm ethylenediamine - tetraacetic acid ( edta )] supplemented with 0 . 5 % ( vol / vol ) protease inhibitor stocks by 5 liquid nitrogen freezing and defreezing cycles . lysates were centrifuged ( 10 min , 800 × g , 4 ° c .) and the corresponding supernatants were first clarified ( 20 min , 20 . 000 × g , 4 ° c . ), then precleared on sepharose cl - 4b ( pharmacia ) ( 1 hour , 4 ° c .). after removal of the sepharose - bound protein fractions , the soluble fractions were successively incubated with toxofilin antibodies ( overnight , 4 ° c .) and with protein g - sepharose ( 1 hour , 23 ° c .). after successive washes in buffer a ( 50 mm tris - hcl , ph 7 . 5 , 150 mm nacl ) supplemented with 0 . 1 % vol / vol tx - 100 and 0 . 5 % ( wt / vol ) serum albumin then supplemented only with 0 . 1 % vol / vol tx - 100 and a final wash in buffer a , the protein g - sepharose bound fraction was eluated in sds - page sample buffer . eluates were boiled prior to a 12 % acrylamide gel electrophoresis and radioactive scan of the dried gel . the inventors used the expression vector pgex6 - p3 ( pharmacia ) into which the full length toxofilin encoding cdna was cloned as described in poupel et al ( 2000 ) but to improve the yield of toxofilin production , the protocol was slightly modified as follows . an e . coli clone ( bl21 strain ) positive for the plasmid was grown up to od = 1 . 2 - 1 . 4 and induced with isopropylthio - β - d - galactoside ( 0 . 1 mm , 1 hour , 25 ° c .). at the end of the induction period the bacteria were pelleted and subsequently lysed in buffer pbs - and sonicated ( 30 seconds , 4 ° c .). the lysate was supplemented with tx - 100 ( 0 . 5 % vol / vol ) and n - tetradecyl - n , n - dimethyl - 3 ammonio - 1 - propanesulfonate ( 0 . 5 % wt / vol , sigma ) ( 15 min , 4 ° c .). the supernatant recovered after centrifugation ( 15 . 000 × g , 15 min , 4 ° c .) was incubated with sepharose cl - 4b ( 1 hour , 4 ° c .) and the unbound fraction was incubated with glutathione sepharose ( pharmacia ) ( 4 ° c ., overnight ). the beads were washed with 30 bead volumes of pbs - containing 0 . 1 % tx - 100 and with 10 volumes of prescission cleavage buffer ( 50 mm tris - hcl , ph 7 . 0 , 150 mm nacl , 1 mm edta , 1 mm dithiothreitol ( dtt )). the bound gst - polypeptide was cleaved with pre - scission protease to recover the recombinant toxofilin ( r - toxofilin ) without gst ( pharmacia ) ( 8 hours , 4 ° c .). soluble r - toxofilin was immunoprecipitated with anti - toxofilin antibodies ( overnight , 4 ° c .) and recovered on protein g - dynabeads ( 1 hour , 23 ° c .) ( dynal ) before the kinase / phosphatase assay . identification and cloning of t . gondii type 2c phosphatase ( tgpp2c ) native gel and peptide microsequencing : the native gel was performed as described in poupel et al . ( 2000 ). the gel slice containing the 36 kda actin - binding protein from the parasite was subjected to tryptic digestion ( 30 ° c ., 18 hours , 0 . 3 mg of trypsin in 0 . 1 m trishcl , ph 8 . 6 ; 0 . 01 % ( vol / vol ) tween 20 ). the tryptic peptides were recovered by hplc on a deae and a c18 columns . the sequencing of two peptides gave respectively svfdgtvgdfaqenv and nqsadnitamtvffk and the latter was found in one clone from the t . gondii database of expressed sequence tags ( est , washu - merk toxoplasma est project ). cdna library screening and dna sequencing : non - degenerate primers were synthesized for amplification of the target sequence from the clone identified as tgestzy48a06 . r1 . the oligonucleotide with the sequence : 5 ′- agtgcagacaacattactgcgatg - 3 ′ corresponding to part of one peptide microsequence ( sadnitam ) was used as the up stream primer , while 5 ′- agacacaccaagaatctcgtc - 3 ′ was chosen as the down stream primer in the tgest clone . the pcr conditions for amplification of the 207 bp dna product were as follows : a hot start of 2 min at 94 ° c . followed by 35 cycles ( 45 sec , 94 ° c . ; 30 sec , 53 ° c . ; 30 sec , 72 ° c .) and a final elongation step at 72 ° c . for 10 min . the 207 bp fragment recovered was 32 p - labeled using random priming ( megaprime kit , amersham ), purified on sephacryl s - 400 hr column ( pharmacia ) and used as a probe to screen a t . gondii tachyzoite cdna library ( kindly provided by j . w . ajioka , cambridge , uk ). after 2 rounds of screening , 12 independent overlapping clones were selected and their cdna was prepared for nucleotide sequencing performed by genset ( france ), using both vector and t . gondii sequence specific primers ( genset ). phosphatase assays were carried out using 10 μm 32 p - casein . briefly , the reaction mixture in a total of 30 μl , consisted of 10 μl containing 100 ng protein of tachyzoïte cytosolic fraction ( in 10 mm tris - cl ph 8 . 0 , 150 mm nacl , 0 . 1 % vol / vol of protease inhibitors , 4 ° c .) plus 10 μl of phosphatase assay buffer ( 50 mm tris - cl ph 7 . 4 , 0 . 5 % β - mercaptoethanol , 0 . 1 % bsa ) containing the different effectors . 10 μl of labeled substrate ( 32 p - casein ) was added to start the reactions ( 30 min , 30 ° c .) and 200 μl of 20 % trichloracetic acid to stop them . the mixtures were centrifuged ( 5 min , 15 . 000 × g ) and 180 μl of the supernatant was directly counted for 32 p radioactivity using a cerenkov counter . the fragment for expression of tgpp2c was prepared by pcr amplification of a full length tgpp2c encoding cdna , using primers introducing a ecori restriction site at position 5 ′ and a xbai restriction site at position 3 ′. for amplification of the upper strand : 5 ′- gccgaattcccatgaagtcctctgctgaaattag - 3 ′ and of the lower strand : 5 ′- gcctctagactaatcagtcttcttgaagaacactg - 3 ′. the amplified fragment was cloned into the expression vector pthiohis b ( invitrogen ) after digestion with ecori and xbai of both fragment and vector . for expression of the thiohis - tgpp2c , an e . coli clone ( top10 strain ) positive for the plasmid was grown up to od = 0 . 8 and induced with isopropylthio - β - d - galactoside ( 0 . 1 mm , 2 hours , 37 ° c .). at the end of the induction period , the bacteria were pelleted and subsequently lysed in buffer ( 20 mm nah 2 po 4 , 500 mm nacl , n - octylglucoside ( 0 . 5 % vol / vol ) supplemented with 0 . 1 % ( vol / vol ) protease inhibitor stocks by sonication ( 30 seconds , 4 ° c .) and one liquid nitrogen freezing and defreezing step ( 10 min , 4 ° c .). dnase was added to 2 μg / ml ( 30 min , 4 ° c .) followed by centrifugation ( 10 min , 14 . 000 × g , 4 ° c .). the supernatant was chromatographied on a nickel column ( probond , invitrogen ) and the imidazole eluate was dialyzed before being chromatographied on a phenylarsineoxide - agarose column ( thiobond , invitrogen ). mercaptoethanol eluates were dialyzed against 5 mm tris - hcl , ph 7 . 5 , 50 mm nacl and stored aliquoted in 5 % sucrose at 80 ° c . until use for testing the activity ( see above ). cytosol : frozen tachyzoites ( 10 9 ) were thawed on ice and lysed by 5 liquid nitrogen freezing and defreezing cycles in 500 μl of kinase buffer ( 10 mm tris - hcl , ph 7 . 5 , 150 mm nacl , 10 mm mgcl 2 , 1 mm dtt ) supplemented with 0 . 2 % ( vol / vol ) protease inhibitor stocks . the extract was centrifuged ( 15 min , 800 × g , 4 ° c .) to remove nuclei and unbroken cells . the supernatant was centrifuged ( 30 min , 100 . 000 × g , 4 ° c .) in a tl100 table top ultracentrifuge ( beckman ) using the tla 100 . 3 rotor . the resulting cytosol was stored frozen at − 80 ° c . in 100 μl aliquots until use . heparin chromatography : a cytosolic fraction from 10 9 parasites was pre - cleared on sepharose cl - 4b ( 1 hour , 4 ° c . ), and subsequently chromatographied on heparin sepharose ( pharmacia ) ( 1 hour , 4 ° c .). after several washes in 10 mm tris - hcl , ph 7 . 5 , 150 mm nacl supplemented with 0 . 5 % vol / vol tx - 100 , the heparin - bound proteins were recovered by a 0 . 5 m nacl elution in 10 mm tris - hcl , ph 7 . 5 . the eluate was dialyzed against kinase buffer ( overnight , 4 ° c .) prior to be used in kinase assay while the heparin unbound fraction ( i . e . : flow through ) was thoroughly recovered and stored at − 80 ° c . each lot was controlled for its activity on casein ( see above ). kinase reaction : 2 μg of immobilized rtoxofilin on protein g - dynabeads were washed in kinase buffer before to be incubated with a tachyzoïte cytosolic fraction prepared in kinase buffer ( μg of proteins in 100 μl ) and precleared on protein g - dynabeads . the reaction was started by adding 100 μm of na 2 atp and 10 μci of [ γ 32 p ] atp ( 3000 ci / mmol , nen life science product , inc ) ( 15 min , 30 ° c .). unbound materials and unincorporated [ γ 32 p ] atp were washed out with 200 volumes of kinase buffer containing with tx - 100 ( 0 . 5 % vol / vol ) followed by 100 volumes of kinase buffer . toxofilin and bound proteins were eluted in sds - page sample buffer prior to electrophoresis and radioactivity scan ( phosphoimager , molecular dynamics ). toxofilin phosphorylation was quantified using nih image quant software . to characterize the kinase activity responsible for toxofilin phosphorylation , three types of experiments were carried out : 1 ) pharmacological inhibitors such as heparin ( 20 μg per ml , sigma ), gtp ( 200 μm , sigma ), 5 , 6 - dichloro - 1 - b - d - ribofuranosylbenzimidazole ( 100 μm , calbiochem ) or staurosporine ( 1 μm , calbiochem ) were added 15 min before starting the kinase reaction . 2 ) a fraction eluted after heparin chromatography of the cytosol and the corresponding unbound fraction ( see above ) were assayed for their respective kinase activity towards rtoxofilin . phosphatase reaction : the purified recombinant tgpp2c dialyzed against kinase buffer was added ( doses activité ) either before to start the kinase assay or after the last wash in kinase buffer . in the latter case , control and test samples were incubated for 15 additional minutes ( 30 ° c .) before a final wash in kinase buffer . in some control experiments , one unit of a recombinant fragment of rabbit catalytic type 1 phosphatase ( up state biotechnology ) which is known to dephosphorylate several t . gondii tachyzoïte proteins was replacing tgpp2c . eluates were treated as described for the kinase assay . a rabbit polyclonal antibody raised against the gst - partial pp2c was prepared and absorbed on gst to get only the pp2c reactive immunoglobulins . it has been initially raised using gst - partial pp2c separated in a polyacrylamide gel slice directly injected to rabbits ( according to standard protocol of eurogentec , 4 immunizations on day 0 , 14 , 28 and 56 ). each immunization performed with a composition containing from 20 to 100 μg of pp2c which is a polypeptide comprising 265 amino acids from v64 to k328 included as referred in fig2 . it is possible to covalently fix the recombinant toxofilin to a matrix ( resin or membrane ), to phosphorylate it with 32 p adenosine tri phosphateusing either an enriched parasite kinase fraction which is already available or even a recombinant casein kinase ii from other source ( see materiel and methods ). human casein kinase ii works well at phosphorylating toxofilin . in addition , the inventors are presently cloning the toxoplasma casein kinase ii . once phosphorylation has been controlled by radioactive counting , it is easy to incubate the sample ( 32 p - labelled toxofilin ) with or without ( control ) putative inhibitors and add recombinant pp2c . the criteria to analyze will be the radioactive counts and to observe if those counts have or have not decreased . an efficient phosphatase hydrolyses the 32 p phosphate which is then lost in the washes and consequently induces a decrease in radio - active counts . if the phosphatase activity is blocked by an inhibitor ( either towards the catalytic site or affecting the 3d structure of the catalytic site ), the 32 p phosphate will not be hydrolyzed . such assay also allows quantitative analysis of the inhibitory effect towards the phosphatase activity . some flurogenic substrates have been recently developed as an alternative to radio - activity for several phosphatase activity dosages . one might think about incorporating such fluorochrome to toxofilin . additionally , other substrate such as casein are commonly used to assay phosphatase activity including pp2c activity . protocol to screen for inhibitors of the host cell invasion by toxoplasma gondii . one feature of toxoplasma gondii tachyzoïte is that it can enter virtually any kind of cells , making in vitro invasion assay quite simple to realize . it is also feasible to incubate tachyzoïtes with orthophosphate ( see materials and methods ) and at the same time expose or not them to different putative inhibitors ( different doses . . . ). in that case , it is possible to check if this / these inhibitor ( s ) affect the phosphorylation of toxofilin ( preparation of cytosol , immunoprecipitation of toxofilin , electrophoresis and radioactive scanning to detect if toxofilin has or not incorporated 32p ). for invasion assay , the tachyzoïtes can be resuspended in 2 ml of dulbecco &# 39 ; s mem ( usually 5 × 10 7 ) supplemented with 2 % of heat - inactivated foetal calf serum and expose to the putative inhibitors ( different doses , duration . . . ) before being incubated with 70 - 80 % confluent human foetal fibroblasts previously plated on glass coverslips ( 20 min , 37 ° c ., 5 % co 2 ). it will be interesting to leave the inhibitor during the invasion assay ( in case it is reversible ) or to wash it off before the assay and finally to check any affect on the host cell . after a short contact between parasites and host cell ( 15 to 30 min ), both will be fixed in 2 % paraformaldehyde in pbs - ( 15 min , 23 ° c .). extracellular parasites will be stained with a monoclonal anti - p30 surface protein of t . gondii ( 40 μg / ml , euromedex ) and revealed using the alexa488 anti - mouse igg conjugate ( molecular probes ) while both internalized and extracellular parasite will be vizualized by 4 ′, 6 diamidino - 2 - phenylindole staining ( dapi , 5 μg / ml ) under microscope . the number of cells containing parasites out of 100 cells randomly selected will be reported in triplicate for each treatment . in addition , for each coverslip , the number of internalized parasites per cell will be counted on 4 samples of 25 infected cells .	0
it has been found that a modular storage unit constructed according to the invention , achieves a more flexible storage unit that makes effective use of available space . the heart of the modular storage unit is a tray 10 , shown in fig1 a ( top ) and 1b ( bottom ). tray 10 generally comprises a back wall 5 , side walls 3 and bottom ( or rear , depending upon upright or supine orientation ) wall 7 . side walls 3 and bottom wall 7 extend out of back wall 5 , preferably , in a direction perpendicular to back wall 5 . side lips 4 extend inwardly ( i . e ., towards a center of tray 5 ) from side walls 3 . bottom lip 6 extends upwardly ( i . e ., also towards a center of tray 5 ) from bottom wall 7 . each lip surface should be generally parallel to back wall 5 . the various walls and lips define a storage area 9 for documents or the like . while in fig1 a , back wall 5 is shown as having a series of holes h and raised portions r , the precise structure of back wall 5 is conventional except as will be described below . the novelty of tray 10 lies in its adaptability to be joined together with other identical trays to form a modular , multi - tray storage unit which may be hung or stood on a surface . in either arrangement , tray 10 of any multi - tray unit to be described below , will preferably have a face plate 20 ( fig2 a ) to prevent any documents or the like from falling out of storage area 9 . to join together a number of trays , a novel connecting structure has been developed . that structure starts with each side lip 4 having a tab 8 molded or mounted thereon . tabs 8 , which are preferably semi - circular , are meant to mate with corresponding mounting structures found on the bottom a subsequent tray . two tracks 11 are mounted on back surface 2 of back wall 5 . each track 11 is spaced toward the sides of tray 10 at a position that will be described later . each track 11 comprises an elongated raised portion 12 topped with an elongated ridge 14 . ridge 14 extends generally perpendicular to raised portion 12 , in a direction generally parallel to back wall 5 and towards side wall 3 , thus overhanging raised portion 12 , forming gap 15 . gap 15 will have a height substantially equal to the thickness of side lips 4 in the area of tab 8 ( although it is conceived that entire side lip 4 will have the same thickness ). each track 11 is spaced from side walls 3 so as to cause elongated portions 12 , and thus gaps 15 , to correspond with tabs 8 and the outermost edges of side lips 4 ( fig1 c ). furthermore , a series of holes 13 extends along the length of each raised portion 12 and extends entirely therethrough . however , it is also conceived that holes 13 may simply be indentations in raised portion 12 on its side facing gap 15 . finally , back surface 2 of back wall 5 has generally parallel protuberances 16 that add structural rigidity to the tray and allow an upright ( perpendicular to the bottom of the drawer ) drawer divider ( not shown ) to rest therebetween when the tray is used in a drawer as will be discussed with respect to fig3 below . the structure of an individual tray 10 having been described , it will now be described how two or more trays may be joined together to form a modular , multi - tray storage unit 1 . tabs 8 and side walls 4 of a first tray are slid through gaps 15 of a second or subsequent tray . this sliding continues until tabs 8 of the first tray are friction fitted / locked into the desired holes 13 or indentations of the second tray . by &# 34 ; desired &# 34 ;, it is meant that holes 13 allow for adjustment of the longitudinal spacing between trays to attain the specific spacing required for a particular application . for example , in fig2 a it is shown how the trays 10 can be connected together to form a step - like or inclined storage unit 1 . in fig2 b , it is shown how the trays 10 can be connected together to form a storage unit 1 in which the leading edges of all trays are flush because all back walls 7 are positioned along a plane and not spaced from each other . the particular tray configuration can be easily varied by applying opposing forces to the leading ( or the leading and trailing ) edges of the two trays until tabs 8 are forced out of holes 13 , allowing for relative movement between the trays until tabs 8 enter the next set of holes 13 . typically , to allow for some give in the structure of the tray such that the tabs 8 can be removed from holes 13 , yet retaining structural stiffness to prevent undesired relative movement between tabs 8 and holes 13 , trays 10 will preferably be made from injection molded polystyrene . having now described how a multi - tray storage unit 1 may be formed , description will be made as to how such a unit 1 may be stored at a work surface . first , as shown in fig3 unit 1 can be merely lied on its lowermost tray 10 within a desk drawer 25 ( unit 1 in configuration shown in fig2 b ). because of the spacing between entrances to adjacent trays , all trays are equally accessible . as described above , an upright drawer divider ( not shown ) is placed between protuberances 16 on the back of the uppermost tray . this drawer divider , in combination with the back of the uppermost tray and its protuberances , will cause the modular unit not to tip over . fig4 a and 4b illustrate how standing inclined unit 1 may be made using stand 30 ( which can also be a hanger as will be described below ). stand 30 has upper 32 and lower 33 horizontal bars . bars 32 , 33 are connected by one or more legs 31 . when bars 32 and 33 are parallel and there are two legs 31 , stand 30 assumes a generally trapezoidal shape . lower horizontal bar 33 has a base 34 extending perpendicularly from its lower edge . additionally , tabs 35 ( fig4 b ) extend from either end of upper horizontal bar 32 . while these tabs are shown as rectangular , they may be semi - circular like tabs 8 . to use the stand , as shown in fig4 a , tabs 35 will be inserted in holes 13 of elongated portion 12 ( fig1 b ) and the entire unit 1 stands on base 34 and bottom wall 7 of the lowermost tray in the unit 1 . in this configuration , because stand 30 is not placed into gap 15 , the thickness of upper horizontal bar 32 is not as important as the fact that tabs 35 fit within holes 13 . multi - tray unit 1 can also be hung from a wall , door , or panel . it is especially prefereable to hang unit 1 from conventional fabric panels v , typically used as room or cubicle dividers . these panels v have slotted steel tubing t from which accessories can be hung . there are at least three ways of doing this . first , as shown in fig5 a - c , unit 1 can be hung from a vertical surface v by the use of a hook 80 having a locking portion 87 , inserted into conventional hook receiving hardware 100 in tube t . in this arrangement , hanger clips 90 are attached to the back of multi - tray storage unit 1 ( fig5 c ), allowing unit 1 to be hung from hook 80 . fig5 b shows in detail hook 80 and hanger strip 90 . hook 80 is conventional except that it has a clip supporting portion 81 that is offset from the rest of the hook body and may have cut out portions 85 . hanger clip 90 has an inner wall 92 having adhesive backing 93 , with a peel - off backing ( not shown ) thereon . outer wall 96 has an overhanging portion 91 which defines a downwardly extending channel 95 . in use , the backing is peeled off to expose the adhesive , hanger clip 90 is adhesively attached to the back of unit 1 , hook 80 is positioned at the appropriate height , and unit 1 is positioned on hook 80 such that downwardly extending channel 95 overlies clip supporting portion 81 ( fig5 c ), thus allowing unit 1 to be hung . ridge 99 assures the proper positioning of hanger clip 90 . locking portion 87 may be : centrally mounted ( fig5 d ), left mounted ( fig5 e ), or right mounted ( fig5 f ). for left and right mounts , extra l - shaped support l is adhesively attached to the lower back of the rear tray . supports l reduce the drooping of the trays which would be caused by the off - centered mounting of locking portion 87 . fig6 a and 6b show a second way of hanging unit 1 ( of which , only a back wall 15 of a last tray 10 is shown in fig6 a ). here a hanger clip 90 &# 39 ;, very similar to that described immediately above , is attached to back surface 2 of back wall 15 by adhesive 93 &# 39 ;. ridge 99 &# 39 ; assures the proper positioning of hanger clip 90 &# 39 ;. clip 84 , similar to that of clip 90 &# 39 ;, is hung in an inverted orientation with respect to clip 90 &# 39 ; on a vertical surface v . the two clips &# 39 ; respective channels are brought into contact with each other , whereby the two clips interlock and the unit 1 is hung from clip 84 . finally , fig7 shows yet a third way of hanging unit 1 . in this figure , stand 30 in inverted and becomes hanger 30 &# 39 ;. what was base 34 now becomes overhang 34 &# 39 ; which can be fit over the top of a door or panel , etc . accordingly , unit 1 can be hung using hanger 30 &# 39 ;. it is thus seen how the modular storage unit according to the invention provides a storage unit made up of trays that may be joined together in various configurations . it is also seen how the modular storage unit according to the invention provides a storage unit that makes efficient use out of available space . further , it is also seen how the modular storage unit according to the invention to provide a storage unit that may be either hung on a vertical surface or stood on a horizontal surface . the above description is given in reference to a storage unit . however , it is understood that many variations are apparent to one of ordinary skill in the art from a reading of the above specification and such variations are within the spirit and scope of the instant invention as defined by the following appended claims .	0
referring to fig1 a ccis data link sub - system of a central switching office is shown . the control circuitry of the data link sub - system includes two intel 8086 microprocessors , cpu0 and cpu1 . intel is a registered trademark of the intel corporation . only one of these processors is active at a particular time . the other processor is a backup processor which operates upon detection of a fault in the active processor . the backup processor is a &# 34 ; hot &# 34 ; standby processor which runs self - diagnostics until such time as it becomes active and the other becomes standby . each cpu functions to collect data received or transmitted to or from analog and digital sources , such as modems and t1 spans or digital trunk units . this data is collected and analyzed and retransmitted to another processor group . cpu0 and 1 are respectively connected to the bus extender units 0 and 1 , which function to provide for a multiplicity of connections to each cpu &# 39 ; s address and data buses . connected between each cpu and bus extender is a corresponding bus cross - over network which provides the ability to operate circuitry of one portion of the ccis sub - system with the cpu of the opposite portion of the sub - system . for example , bus extender 0 may be operated by cpu1 . in addition , each cpu has a corresponding memory connected via the bus cross - over circuit . this memory contains the instruction and data stores necessary to operate each cpu for data collection , analysis and transfer . each bus extender circuit is connected to two multiplexer units 10 and 20 . each multiplexer unit may handle up to four sources of digital or analog information input . the two multiplexing units 10 and 20 may be operated by either cpu . each cpu may handle a total of eight sources of data input / output . cpu0 and cpu1 are respectively connected to unit register 0 and 1 . unit registers 0 and 1 are connected to multiplexers 10 and 20 respectively . the unit registers are operated under the cpu &# 39 ; s instructions to select which particular transmission source is connected to multiplexers 10 and 20 for the collection or transmission of data by the corresponding cpu . each source is connected to the cpus through its corresponding multiplexer by a terminal equipment control circuit ( tecc 0 - 3 , 4 - 7 ). the teccs serve to control the particular data terminal equipment device such as a modem ( analog 2400 bits per second or digital 4000 bits per second ) and may be implemented with an intel 8085 microprocessor and associated logic . fig1 represents a ccis configuration for a particular telephone central office . ccis data includes trunk signaling and supervision data from voice trunks . instead of transmitting this data in a conventional manner over the trunk itself , the signaling data is sent via a data link arrangement between two ccis telephone central offices . this results in more efficient use of the trunks than otherwise would be possible . each ccis sub - system may both transmit and receive data from another ccis sub - system of another central office . two groups of terminal equipment control circuits ( teccs ) are shown in fig1 . a first group of 4 terminal equipment control circuits ( tecc0 - tecc3 ) is connected between 2 to 1 multiplexer bus driver / receiver 10 and the terminal equipment such as modems , t1 spans and digital trunks . a second group of terminal equipment control circuits tecc4 - tecc7 is connected between another set of terminal equipment and 2 to 1 multiplexer bus driver / receiver 20 . each tecc operates to control its corresponding terminal equipment and each tecc includes a processor and associated memory . this processor may include a cpu such as an intel 8085 microprocessor . the cpu of each tecc may be programmed to operate modems in an analog mode of transmission at various rates between 110 and 2400 bits per second . this cpu may also operate t1 spans and digital trunks by performing such functions as error detection , error correction , synchronization , recovery and diagnostic functions , reformatting and prioritizing of ccis data . when the active cpu ( cpu0 or cpu1 ) of the ccis sub - system determines that incoming ccis data has been received by a tecc or that outgoing ccis data is to be transmitted to a particular tecc , data is transmitted or received directly between the active cpu and a particular tecc with its cpu and associated memory . the active cpu will directly read or write the memory of the particular tecc . the read or write corresponds to receiving or transmitting ccis data from or to the connected tecc . since no intermediate buffering exists , the data transfer arrangement between the active cpu and the particular tecc &# 39 ; s cpu is much more reliable . in addition , less components dictates the need for less diagnostic system software . in addition , the direct reading and writing of the tecc &# 39 ; s memory eliminates the need for any intermediate buffering and the associated cpus &# 39 ; real time overhead . as a result , the real time operation of both processors are improved . due to the direct data transfer between cpus and despite other switching system limitations , the teccs may operate the corresponding terminal equipment at nearly a 100 per cent duty cycle . referring to fig2 a portion of the cpu / memory access and bus structure of a particular tecc is shown . the control processors of the data link sub - system are cpu0 and cpu1 which are called the control data link processors or more simply the cdl processors . for normal operation of one such tecc , the tecc &# 39 ; s cpu 209 reads program instructions from a memory ( not shown ) and writes data and reads data from the memory . cpu 209 outputs a 16 - bit address to accessing a memory location . the lower byte of this address ( address bits a00 through a07 are transmitted via an 8 - bit bus and latched by octal latch 210 . the high byte of the cpu address ( address bits a08 through a15 are transmitted via another 8 - bit bus and latched by octal latch 211 . when cpu 209 outputs the proper read or write signal ( not shown ) the memory is written to read from . the data received from the memory or transmitted to the memory is via an 8 - bit data bus . this is connected from cpu 209 to the memory and is the same 8 - bit bus upon which the low byte of the address is output . the data word appears on the combined bus at a later time and is multiplexed with the low order byte of the address . for the rapid transmission of data between the cdl processor ( cpu0 or cpu1 ) and the tecc , the data bus of the cdl is connected to the data bus of the tecc via octal latch 200 . the address bus of the cdl processor is 16 - bits wide . the low order nibble ( 4 bits ) of the cdl address bus is connected to octal buffer 201 . the next nibble of the cdl address bus is connected to octal buffer 202 . the third and fourth nibbles of the cdl address bus are connected to octal buffers 203 and 204 respectively . the output of octal buffers 201 and 202 are combined into an 8 - bit bus ( ad0 - ad7 ) and the high byte of the cdl address is comprised by the outputs of octal buffers 203 and 204 as an 8 - bit address bus ( ad8 - ad15 ). each of the octal buffers 201 through 204 is connected to inverter 223 via the - hlda lead . each of the octal buffers 201 through 204 are controlled by the - hlda signal to be enabled to go from a tri - state condition ( off the bus ) to a logic 0 or 1 condition ( on the bus ). eight - bit address bus , ad0 - ad7 , is connected to the memory via 8 - bit bus loadd . the high byte of the cdl address bus , ad8 - ad15 , is connected to memory via the hiadd address bus . the - clr lead connects the cdl processor to cpu 209 and to nor gate 226 . the cdl processor signals on this clear lead for the tecc processor and associated circuitry to reset . when the cdl processor needs to transmit or receive data from the tecc , the cdl selects a particular tecc and causes the - cs lead to become active low . all tecc &# 39 ; s are connected to either multiplexers 10 or 20 via a unique - cs lead . the - cs lead is connected to the clock input of flip - flop 220 and to nand gate 221 . d - type flip - flop 220 latches and stores the cs signal to indicate that the cdl has selected this particular tecc for data transfer . the output of flip - flop 220 is connected to the hold input of cpu 209 and to nand gate 221 . the hold signal instructs cpu 209 to complete its present cycle , but to suspend operation and tri - state its buses before any further operation by cpu 209 . nand gate 221 has its output connected to nor gate 226 . nand gate 221 protects against any transient signal on the - cs lead being detected as a true signal . if the - cs lead has a transient signal , flip - flop 220 will latch a logic 1 on its output . at the next clock cycle , the - cs lead will not be active . this will cause nand gate 221 to go low which will operate nor gate 226 . the output of nor gate 226 is connected to the clear input of flip - flop 220 and will reset flip - flop 220 . at the next cycle of cpu 209 , a hold acknowledge signal will be produced on the hlda lead . the hlda lead is connected to flip - flop 225 and to inverter 223 . j - k flip - flop 225 will latch the hold acknowledge signal . flip - flop 225 will produce the bus clear signal on the busclr lead , which is connected to the enable input of octal latches 210 and 211 . octal latches 210 and 211 will operate in response to the bus clear signal to go to the tri - state condition and disable their outputs from the loadd and hiadd address buses respectively . simultaneously with the transmission of the bus clear signal , the hold acknowledge signal will be transmitted from inverter 223 to the enable input of octal buffers 201 through 204 via the - hlda lead . the hold acknowledge signal will enable octal buffers 201 through 204 onto the memory address bus ( loadd and hiadd ). as a result , the address on the memory address bus is now the cdl processor &# 39 ; s address . cpu 209 has had its address and data buses tri - stated ( high impedance ) or removed from the bus . the clock output lead ( clk ) of cpu 209 is connected to the clock input of j - k flip - flop 225 and to the input of tri - state device 230 . the clk signal clock j - k flip - flop 225 to produce the bus clear signal on the busclr lead . the bus clear signal enables or disables octal latches 210 and 211 from the memory address bus loadd and hiadd . the opposite sense of the bus clear signal is transmitted via the - busclr lead from flip - flop 225 to the enable input of tri - state device 230 . the terminal equipment ready signal , which is the output of tri - state device 230 , is transmitted to the cdl processor via the - terdy lead and the connected multiplexer . the terminal equipment ready signal indicates to the cdl processor that the cdl &# 39 ; s memory access to the particular tecc is complete . flip - flop 225 is connected to nand gate 205 via the - busclr lead . the low order address bit of the memory address bus ( addro ) is connected to another input of nand gate 205 . the output of nand gate 205 is connected to the enable lead of octal latch 200 . when the active cdl processor requires a data transfer with a particular tecc , the particular tecc &# 39 ; s - cs lead or card select is made active by the cdl processor via a connection from the multiplexer . the card select signal is sensed by flip - flop 220 . the latched output of flip - flop 220 is transmitted to the hold input of cpu 209 . the latched value of flip - flop 220 is compared with the card select lead by nand gate 221 . if a spurious signal is present on the card select lead , nor gate 226 will reset flip - flop 220 , thereby removing the hold request from cpu 209 . at the completion of its next cycle , cpu 209 will produce the hold acknowledge signal on the hlda lead . this signal will be latched by flip - flop 225 and its output is the bus clear signal . the hold acknowledge signal will cause octal buffers 201 through 204 to latch the cdl processor &# 39 ; s address for memory transfer . the hold acknowledge signal will also enable octal buffers 201 through 204 to place their outputs onto the memory address bus ( loadd and hiadd ). simultaneously , the bus clear signal will cause octal latches 210 and 211 to tri - state their outputs and thereby remove the cpu 209 address from the memory address bus . as the cdl &# 39 ; s address is placed on the memory address bus by octal buffers 201 through 204 , the low order address bit addro will be combined with the bus clear signal to enable octal latch 200 to either latch the data being sent by the cdl processor or to latch the data being received from the memory for transmission to the cdl processor . the bus clear signal will enable tri - state device 230 to transmit the clk signal of cpu 209 back to the cdl processor via the - terdy lead . this will signal the cdl processor that it may remove the data from octal latch 200 or that the data has been written into memory . since the hold acknowledge output of cpu 209 goes low on the next clock signal on the clk lead , flip - flop 225 will reset on the next clk signal and thereby cause the bus clear signals to go to the opposite logic value . as a result , tri - state device 230 will be tri - stated ( off the cdl &# 39 ; s bus ). in addition , nor gate 226 will be activated to reset flip - flop 220 , thereby removing the hold request from cpu 209 and allowing cpu 209 to resume it processing . in addition , the logic value change of the bus clear signal will cause octal latches 210 and 211 to be placed back on the memory bus loadd and hiadd respectively . the new value of the bus clear signal will cause octal latch 200 to be tri - stated and thereby removed the cd processor from the memory data bus . the inactive hold acknowledge signal will also cause octal buffers 201 through 204 to be tri - stated , thereby removing the cdl processor &# 39 ; s address bus ad0 - ad7 and ad8 - ad15 from the memory address bus loadd and hiadd . as a result , the tecc processor cpu 209 is placed back in control of the data and address buses of the memory . octal latches 200 , 210 and 211 maybe implemented with octal transceivers integrated circuit part number 74ls245 . octal buffers 201 through 204 may each be implemented with quad buffers integrated circuit part number 74ls244 . although the preferred embodiment of the invention has been illustrated , and that form described in detail , it will be readily apparent to those skilled in the art that various modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims .	6
this invention relates to strippers for use with a rotary die cutting of sheet material . modern practice uses such material in the form of so - called continuous web in substantial widths , which is die cut and sometimes printed without any preliminary step of cutting the web into individual blanks . this minimises costs , particularly where large quantities of identical articles are to be made , for example containers for the food trades . the parts being cut are often of complex shape and may be provided with crease lines where the parts are to be folded or hinged . the dies are arranged to cut the maximum number of parts from the web , but inevitably areas of scrap material are formed because of the complexity of the shapes . at a certain stage some or all of the scrap is separated from the parts , and this operation is known as stripping . it is known from bp no . 1074291 to effect stripping by spike - like parts projecting from one roll and arranged to stab the scrap pieces as the web passes through the roll nip . the impaled scrap is removed at an angularly spaced location in roll rotation . if a long production run is intended , the dies may be formed out of the surface of the rolls and the stripping may be accomplished in the die cutting roll pair . in this case the spikes contact the web in an area not yet die cut . if the web resists impalement the spikes ( for there may be series of these for example in rows across the roll ) may cause a ripple or bulges in the web . if the web material is a soft metal foil or plastics , or a laminate of these , the ripple or bulges may become permanent , and in any case the accuracy of the cut shapes may be affected . if shorter runs are envisaged the dies are often made detachable and then it may be necessary or convenient to use a separate roll pair for stripping , synchronised with the die cutting pair . in this case the web is already die cut when contacted by the spikes , and the pieces to be impaled are surrounded by cut lines , although the scrap still lies co - planar with the web . if impalement is resisted the result may be that the scrap pieces become prematurely detached from the web and cause problems elsewhere in the operation . in accordance with the invention , stripping apparatus of the kind comprising a spike carried by one roll of a roll pair is characterised by the provision of a cooperating abutment carried by the second roll of the pair , the spike and abutment being synchronised so as to contact the scrap piece on opposite faces of the same in advance of the nip between the rolls , and the abutment being retracted from projection beyond the roll surface as it approaches the nip . preferably the abutment is tubular so that the spike can be received in its bore when impalement is complete . preferably also the retraction is cam controlled so that the abutment end sweeps along a straight line tangential to the roll surface and coplanar with the web . by these means , the piece to be contacted and impaled on the spike is prevented from being displaced out of the plane of the web . the invention is now more particularly described with reference to the accompanying drawings wherein : fig1 is a fragmentary and part sectional elevation of a roll pair provided with the stripper of the invention ; turning now to the drawings and particularly fig1 there is shown a roll pair comprising an upper roll 10 and a lower roll 12 both of which are annular and of massive construction so as to be rigid , and which are arranged to rotate in the direction shown by the arrows a . the web to be stripped is fed in the direction of the arrow b through the roll nip , and the thickness of the web in the nip is indicated by the chain dot lines 14 . the roll 12 is provided with a series of spikes 16 which are synchronised for association with a series of abutments 18 provided on the roll 10 . construction of the abutments , and their operation , is best seen from fig2 . the abutment 18 is formed as one end of a tubular member which is slidable in a bore in the roll , being guided at its outer end by a bush 20 screwed into the face of the roll . the bush carries a cross pin 22 which extends through elongated slots 24 in the tube , and the pin extends through a first plug 26 which forms a seating for one end of a compression spring 28 lying in the tube bore , the opposite end of the spring seating against the second plug 30 which is cross pinned to the tube by a pin 32 . the second plug 30 terminates in a cam follower 34 . the spring 28 tends to displace the whole of the abutment radially inwardly by reaction with the fixed plug 26 . the inward displacement is controlled by a fixed cam 36 about which the roll 10 rotates . as will be seen from consideration of fig1 wherein the whole of the cam 36 is shown by a broken line , the abutment shown as 40 on fig1 is at its radially innermost position so that its outer end face is flush with the roll . as the abutment 40 travels about the cam it remains flush ( although this is unimportant ) until it has completed some 270 ° of a revolution when the cam commences to displace the abutment outwardly so that as shown at 41 fig1 there is a slight projection , and so on until when at the position occupied by the abutment 42 fig1 the projection is at a maximum and complete . the end face of the abutment then lies immediately adjacent to the true plane of the web . in movement from the position of the abutment 42 to the position of the abutment 40 fig1 the shape of the cam ensures that the spring causes the inward movement so that the outer end effectively sweeps along the plane of the surface of the web . turning now to fig3 it will be seen that the construction of the spike is generally similar to that of the abutment , save that the radially outermost plug is integral with the spike 44 and the spike projects beyond the surface of the roll . in the radially outermost position of the tube , the end part 46 surrounds the spike , and in the radially innermost position of the tube ( shown in fig2 ) the end part 46 is flush with the surface of the roll leaving the spike projecting . the roll 12 is provided with an eccentrically running solid shaft 48 which contacts the cam follower part of the spike assembly and the eccentric shaft is driven at the same speed as the roll so that there is no relative rotation : this is to minimise wear . the effect of the eccentric shaft is similar to that of a cam , except that the tube is projected outwardly to a maximum extent at say 120 ° removed from the nip , so that any material impaled on the spikes is displaced from the impalement by the tube movement , for collection of the scrap pieces at a position remote from the nip . as the spikes approach the nip the tubes are wholly retracted . it will be appreciated that the web is only contacted by the stripping spikes at a time when it is also contacted on the opposite face by the abutments , and because the abutment is controlled in position so that it cannot project beyond the true plane of the web , the risk of displacement or deformation is avoided .	8
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the present invention , while eliminating , for purposes of clarity , many other elements which are conventional in this art . those of ordinary skill in the art will recognize that other elements are desirable for implementing the present invention . however , because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . the present invention will now be described in detail on the basis of exemplary embodiments . fig1 shows a diagrammatic side view of a loudspeaker system according to the state of the art . in this case two adjacent segmented line array speakers 100 or the acoustic waveshaper of the line array speaker are shown . the waveshaper 200 has first and second ends 101 and 102 . a loudspeaker is provided at the first ends 101 . that loudspeaker produces for example a spherical wave which is converted into a plane wave in the waveshapers 100 . fig2 shows a diagrammatic sectional view of a loudspeaker system according to a first embodiment . the loudspeaker system has segmented line array speakers with acoustic waveshapers 200 . the acoustic waveshapers 200 have first and second ends 201 , 202 . a loudspeaker is provided at the first end 201 . the loudspeaker produces for example a spherical wave which is converted into a plane wave in the waveshapers 200 . in the first embodiment two adjacent waveshapers 200 have an overlap region 210 . in other words the housings of the waveshapers have an overlap portion or a superimposition portion . fig3 shows a view on an enlarged scale of a portion of the loudspeaker system of fig2 . the overlap region 210 is shown on a larger scale here . while in the loudspeaker system in accordance with the state of the art in fig1 there is no overlap of the waveshapers , the first embodiment is distinguished in that there is such an overlap region . fig4 a shows a perspective view of a part of a loudspeaker system according to a second embodiment . here the overlap region 210 is of such a configuration that the adjacent waveshapers 200 are of an inclined configuration or are cut off inclinedly at their oppositely disposed ends . fig4 b shows a perspective of a part of a loudspeaker according to the third embodiment . here the third embodiment is based on the first embodiment . the overlap region is of a stepped configuration in accordance with the third embodiment . fig4 c shows a perspective of a part of a loudspeaker according to a fourth embodiment . in this case the loudspeaker system according to the fourth embodiment is based on the loudspeaker system according to the first embodiment . the overlap region 210 is of such a configuration that an end is in the form of an arrow tip and the adjacent waveshaper has an end of a corresponding configuration for receiving the arrow - shaped end . the loudspeaker system according to the invention can have a multiplicity of segmented line array speakers . while this invention has been described in conjunction with the specific embodiments outlined above , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , the preferred embodiments of the invention as set forth above are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the inventions as defamed in the following claims .	7
according to the invention it is possible to perform a variety of anastomosis procedures , including coronary artery bypass grafting . the term “ target vessel ” is thus used to refer to vessels within the patient which are connected to either or both of the upstream and downstream end of the graft vessel . in such procedures , a large vessel anastomotic device is used with large diameter target vessels such as the aorta or its major side branches or a small vessel anastomotic device is used for a target vessel which has a small diameter such as a coronary artery . in deploying a large vessel anastomotic device , the device ( with one end of a graft vessel attached thereto ) is inserted into an incision in a wall of the target vessel with a deformable section in a first configuration , and the deformable section is radially expanded to a second configuration to deploy a flange . the flange applies an axial force against the wall of the target vessel . additionally , the flange can be configured to apply a radial force , substantially transverse to the device longitudinal axis , against the wall of the target vessel , to secure the device to the target vessel . for example , the device can have a plurality of deformable sections forming distal and proximal flanges . with the proximal and distal end flanges deployed , the device can be prevented from shifting proximally out of the target vessel or distally further into the interior of the target vessel . the large vessel devices can be configured to connect to target vessels of various sizes having a wall thickness of at least about 0 . 5 mm , and typically about 0 . 5 mm to about 5 mm . in a preferred embodiment of the invention , the large vessel anastomotic device is configured to longitudinally collapse as the deformable section is radially expanded . the surgeon can control the longitudinal collapse to thereby position the distal end flange at a desired location at least partially within the incision in the target vessel wall . the surgeon can also control the position of the proximal end flange by longitudinally collapsing the device to a greater or lesser degree , to thereby position the proximal end flange at a desired location in contact with the target vessel . thus , regardless of the thickness of the target vessel wall , the device can be longitudinally collapsed to position the flanges against the target vessel wall and effectively connect the device thereto . this feature is significant because the device must be connected to target vessels which have a wide range of wall thickness . for example , the aortic wall thickness is typically about 1 . 4 mm to about 4 . 0 mm and the aorta diameter can range from about 25 to about 65 mm in diameter . therefore , regardless of the thickness of the target vessel wall , the degree of deployment of the proximal end flange , and thus the longitudinal collapse of the device , can be controlled by the physician to thereby effectively connect the device to the target vessel . for example , the surgeon may choose between partially deploying the proximal end flange so that it is positioned against an outer surface of the target vessel wall , or fully deploying the flange to position it in contact with the media of the target vessel wall within the incision in the target vessel wall . in deploying a small vessel anastomotic device , the device can be used on small target vessels having a wall thickness of less than about 1 . 0 mm , and typically about 0 . 1 mm to about 1 mm in the case of coronary arteries . despite the small size of the target vessels , the small vessel devices provide sutureless connection without significantly occluding the small inner lumen of the target vessel or impeding the blood flow therethrough . for example , the small vessel devices can include an outer flange ( with the graft vessel connected thereto ) loosely connected to an inner flange before insertion into the patient with the space between the loosely connected inner and outer flanges being at least as great as the wall thickness of the target vessel so that the inner flange can be inserted through an incision in the target vessel and into the target vessel lumen , with the outer flange outside the target vessel . with the outer and inner flanges in place on either side of a wall of the target vessel , tightening the flanges together compresses a surface of the graft vessel against the outer surface of the target vessel . this configuration forms a continuous channel between the graft vessel and the target vessel , without the need to suture the graft vessel to the target vessel wall and preferably without the use of hooks or barbs which puncture the target vessel . in a coronary bypass operation in accordance with the invention , a large vessel device can be used to connect the proximal end of the graft vessel to the aorta , and a small vessel device can be used to connect the distal end of the graft vessel to an occluded coronary artery . however , in patients with an extreme arteriosclerotic lesion in the aorta , which may result in serious complications during surgical procedures on the aorta , the surgeon may wish to avoid this region and connect the proximal end of the graft vessel to any other adjacent less diseased vessel , such as the arteries leading to the arms or head . further , the devices can be used with venous grafts , such as a harvested saphenous vein graft , arterial grafts , such as a dissected mammary artery , or a synthetic prosthesis , as required . connection of the large vessel device does not require the stoppage of blood flow in the target vessel . moreover , the anastomotic devices can be connected to the target vessel without the use of cardiopulmonary bypass . in contrast , anastomosis techniques wherein the aorta is clamped to interrupt blood flow to the area of the aortic wall to which a vein is to be anastomosed may result in liberation of plaques and tissue fragments which can lead to organ dysfunction , such as strokes , renal failure , or intestinal ischemia . however , severely diseased aortas may not provide an area suitable for clamping due to significant calcification of the aortic wall . in the anastomosis technique according to the invention , the surgeon does not need significant room inside the patient to connect the anastomotic devices to the target vessel . for example , unlike sutured anastomoses which require significant access to the aorta for the surgeon to suture the graft vessel thereto , the anastomotic devices allow the proximal end of the graft vessel to be connected to any part of the aorta . all parts of the aorta are accessible to the large vessel anastomosis devices , even when minimally invasive procedures are used . consequently , the graft vessel may be connected to the descending aorta , so that the graft vessel would not be threatened by damage during a conventional sternotomy if a second operation is required at a later time . according to the invention , a sutureless connection can be provided between a graft and a target vessel , while minimizing thrombosis or restenosis associated with the anastomosis . the anastomotic devices can be attached to the target vessel inside a patient remotely from outside the patient using specially designed applicators , so that the devices are particularly suitable for use in minimally invasive surgical procedures where access to the anastomosis site is limited . the devices allow the anastomosis to be performed very rapidly , with high reproducibility and reliability , without clamping , and with or without the use of cardiopulmonary bypass . according to one preferred method of deploying the anastomosis device , the surgeon operates a deployment tool using both hands . one hand supports the tool via a handle while the other twists an actuation knob to deploy the anastomotic device . locating the actuation knob on the tool &# 39 ; s main axis minimizes the tendency of reaction forces to wobble the tool keeping it stable and in proper position during deployment . the twisting motion is converted to linear displacements by a set of rotating cams that engage a trocar , holder , and expander . the cams control the sequence of relative motions between the instrument &# 39 ; s trocar and device deployment mechanisms . during the foregoing procedure , a surgeon will place the tip of the instrument ( the mechanical stop ) in light contact with the site on the aorta to be anastomosed . having located a suitable site , the surgeon then twists the actuation knob to fire the spring - loaded trocar and continues twisting to deploy the anastomotic device . the trocar penetrates the aortic wall at a high rate of speed to minimize any unintended deformation of the aorta and maintains a substantially fluid - tight seal at the puncture site . having entered the aortic lumen , the trocar dilates as the anastomotic device and its holder tube ( crown ) are advanced through it , thus retracting the aortic tissue and serving as an introducer for the device . once the device has fully entered the aortic lumen the trocar is withdrawn . the anastomotic device is then expanded to its full diameter and an inner flange is deployed . the device is then drawn outwards towards the instrument ( mechanical stop ) to seat the inner flange firmly against the intimal wall of the aorta . an outer flange is then deployed from the external side , compressing the aortic wall between the inner and outer flanges and the device is disengaged from the instrument completing the anastomosis . fig1 illustrates the distal portion of an anastomosis device 10 according to a first embodiment of the present invention , the proximal portion ( not shown ) being adapted to be deployed by a deployment tool which will be explained later . the anastomosis device 10 includes a plurality of axial members 12 and a plurality of struts 14 interconnecting the axial members . the axial members 12 and struts 14 form a first linkage 16 at a first end of the device and a second linkage 18 at a second end of the device . the first and second linkages 16 , 18 form inner and outer flanges 20 , 22 when the anastomosis device 10 is deployed as illustrated in fig2 . the deployed flanges 20 , 22 may be annular ring shaped or conical in shape . the first and second linkages 16 , 18 are connected by a central connecting portion 24 . in use , a graft vessel 30 is inserted through a center of the tubular anastomosis device 10 and is everted over the first linkage 16 at the first end of the device . the first end of the device may puncture part way or all the way through the graft vessel wall to hold the graft vessel 30 on the device . an opening 34 is formed in the target vessel 32 to receive the graft vessel 30 and anastomosis device 10 . once the anastomosis device 10 with everted graft vessel 30 are inserted through the opening 34 in the target vessel 32 , the inner and outer flanges 20 , 22 are formed as shown in fig2 to secure the graft vessel to the target vessel by trapping the wall of the target vessel between the two flanges . the anastomosis device 10 forms a smooth transition between the target vessel 32 and the graft vessel 30 which helps to prevent thrombi formation . the inner and outer flanges 20 , 22 are formed by radial expansion of the anastomosis device 10 as follows . the first and second linkages 16 , 18 are each made up of a plurality of axial members 12 and struts 14 . the struts 14 are arranged in a plurality of diamond shapes with adjacent diamond shapes connected to each other to form a continuous ring of diamond shapes around the device . one axial member 12 extends through a center of each of the diamond shapes formed by the struts 14 . a reduced thickness section 26 or hinge in each of the axial members 12 provides a location for concentration of bending of the axial members . when an expansion member of a deployment tool such as a rod or balloon is inserted into the tubular anastomosis device 10 and used to radially expand the device , each of the diamond shaped linkages of struts 14 are elongated in a circumferential direction causing a top and bottom of each of the diamond shapes to move closer together . as the top and bottom of the diamond shapes move closer together , the axial members 12 bend along the reduced thickness sections 26 folding the ends of the device outward to form the inner and outer flanges 20 , 22 with the result that the wall of the target vessel 32 is trapped between the flanges and the everted graft vessel 30 is secured to the target vessel . in the anastomosis device 10 shown in fig1 and 2 , the struts 14 may be straight or curved members having constant or varying thicknesses . in addition , the axial members 12 may have the reduced thickness sections 26 positioned at a center of each of the diamond shapes or off center inside the diamond shapes . the positioning and size of the reduced thickness sections 26 will determine the location of the flanges 20 , 22 and an angle the flanges make with an axis of the device when fully deployed . a final angle between the flanges 20 , 22 and longitudinal axis of the device 10 is about 40 - 100 degrees , preferably about 50 - 90 degrees . fig3 - 7 illustrate a deployment system 150 and sequence of deploying an anastomosis device 120 such as the device shown in fig1 - 2 with the deployment system . in fig3 - 5 the graft vessel 30 has been eliminated for purposes of clarity . as shown in fig3 - 7 , the deployment system 150 includes a hollow outer trocar 152 ( not shown in fig3 ), a holder tube 154 positioned inside the trocar , and an expander tube 156 slidable inside the holder tube . as can be seen in the detail of fig4 the anastomosis device 120 is attached to a distal end of the holder tube 154 by inserting t - shaped ends 112 of pull tabs 110 in slots 158 around the circumference of the holder tube . the trocar 152 , holder tube 154 , and expander tube 156 are all slidable with respect to one another during operation of the device . a device handle 160 is provided for moving the tubes with respect to one another will be described in further detail below with respect to fig8 - 11 . as shown in fig5 initially , the holder tube 154 , expander tube 156 , and the anastomosis device 120 are positioned within the trocar 152 for insertion . the trocar 152 has a hollow generally conical tip with a plurality of axial slots 162 which allow the conical tip to be spread apart so that the anastomosis device 120 can slide through the opened trocar . the trocar 152 , acting as a tissue retractor and guide , is inserted through the wall of the target vessel 32 forming an opening 34 . as shown in fig6 the anastomosis device 120 is then advanced into or through the target vessel wall 32 with the holder tube 154 . the advancing of the holder tube 154 causes the distal end of the trocar 152 to be forced to spread apart . once the anastomosis device 120 is in position and the trocar 152 has been withdrawn , the inner annular flange 20 is deployed by advancing the expander tube 156 into the anastomosis device . the advancing of the expander tube 156 increases the diameter of the anastomosis device 120 causing the inner flange to fold outward from the device . this expanding of the inner flange may be performed inside the vessel and then the device 120 may be drawn back until the inner flange abuts an interior of the target vessel wall 32 . as shown in fig8 after the inner flange has been deployed , the holder tube 154 is advanced forming the outer flange . as the holder tube 154 is advanced , the anastomosis device 120 drops into a radial groove 157 on an exterior of the expander tube 156 which holds the anastomosis device stationary on the expander tube 156 . the holder tube 154 is then moved forward to detach the entire anastomosis device by disengaging the pull tabs 130 from the slots 158 in the holder tube and causing the outer flange to be deployed . during deployment of the outer flange , shoulders 134 on the device , shown most clearly in fig5 and 6 , engage a tapered distal end of the holder tube 154 causing the pull tabs 130 to be released from the slots 158 . alternatively , and as will be explained in connection with a frangible anastomosis device according to the invention , movement of the holder tube 154 can detach a deployed portion of the device from a discard portion of the device which remains attached to the holder tube . one alternative embodiment of the holder tube 154 employs a plurality of flexible fingers which receive the pull tabs 130 of the anastomosis device 120 . according to this embodiment each pull tab 130 is received by an independent finger of the holder tube 154 . to deploy the second or outer flange of the anastomosis device 120 , the flexible fingers flex outward bending the pull tabs 130 outward . for instance , the flexible fingers can be designed to flex when the pull tabs and fingers are put under axial compression in which case the fingers and tabs buckle outwards together to deploy the outer flange and release the anastomosis device from the holder tube . fig9 - 12 illustrate the operation of the handle 160 to move the trocar 152 , the holder tube 154 , and the expander tube 156 with respect to one another to deploy the anastomosis device 120 according to the present invention . the handle 160 includes a grip 170 and a trigger 172 pivotally mounted to the grip at a pivot 174 . the trigger 172 includes a finger loop 176 and three contoured cam slots 178 , 180 , 182 corresponding to the trocar 152 , holder tube 154 , and expander tube 156 , respectively . each of these tubes has a fitting 184 at a distal end thereof . a pin 186 connected to each of the fittings 184 slides in a corresponding one of the cam slots 178 , 180 , 182 . a fourth cam slot and tube may be added to control deployment of the outer flange . alternatively , the handle can be modified to include fewer cam slots for deployment of the inner and outer flanges . the handle 160 is shown in fig8 in an insertion position in which the trocar 152 extends beyond the holder tube 154 and the expander tube 156 for puncturing of the target vessel wall 32 . optionally , a flexible seal ( not shown ) such as heat shrinkable plastic or elastomeric tubing can be provided on the outer surface of the trocar 152 such that the seal covers the axial slots 162 at a location spaced from the tip of the trocar to prevent leaking of blood from the target vessel after the incision is formed . in a preferred embodiment , the trocar is actuated by a mechanism which causes the trocar to penetrate the aorta wall at a high rate of speed to minimize deformation of the aorta and maintain a fluid tight seal at the puncture site in a manner similar to biopsy gun . for instance , the spring mechanism attached to the trocar and / or the handle can be used to fire the trocar at the incision site . any suitable actuating mechanism can be used to fire the trocar in accordance with the invention . as the trigger 172 is rotated from the position illustrated in fig9 to the successive positions illustrated in fig1 - 12 , the pins 186 slide in the cam slots 178 , 180 , 182 to move the trocar 152 , holder tube 154 and expander tube 156 . fig1 shows the handle 160 with the trigger 172 rotated approximately 30 degrees from the position of fig9 . this rotation moves the holder tube 154 and expander tube 156 forward into the wall of the target vessel 32 spreading the trocar 152 . the anastomosis device 120 is now in position for deployment . fig1 shows the trigger 172 rotated approximately 45 degrees with respect to the position of fig9 and the cam slot 182 has caused the expander tube 156 to be advanced within the holder tube 154 to deploy the inner flange . the trocar 152 has also been withdrawn . fig1 shows the handle 160 with the trigger 172 pivoted approximately 60 degrees with respect to the position shown in fig9 . as shown in fig1 , the expander tube 156 has been withdrawn to pull the inner flange against the vessel wall 32 and the holder tube 154 is moved forward to deploy the outer flange and disengage the holder tube 154 from the anastomosis device 120 . the handle 160 also includes a first channel 188 and a second channel 190 in the grip 170 through which the graft vessel ( not shown ) may be guided . the grip 170 also includes a cavity 192 for protecting an opposite end of the graft vessel from the attachment end . according to one embodiment of the invention , the anastomosis device includes a frangible linkage which allows an implant to separate from the remainder of the device upon formation of the outer flange . according to a preferred linkage design , the frangible linkage can be radially expanded and axially compressed to fracture the frangible linkage . the inner flange can be formed during radial expansion of the device and the implant can be severed while forming the outer flange . fig1 shows a device 200 which cooperates with a deployment tool 300 for delivering and deploying an implant 204 at a site in a living body . the device includes a frangible linkage 202 connecting the implant 204 to a discard portion 206 . as explained below , after the device is positioned at a desired location , the implant 204 can be expanded to deploy an inner flange and subsequently axially compressed to deploy an outer flange while severing the implant 204 from the discard portion 206 . the deployment tool can then be withdrawn along with the discard portion 206 which remains attached to the distal end of the deployment tool 300 . fig1 shows the device 200 in the radially expanded condition but prior to being axially compressed . during radial expansion of the device , axially extending barbs 208 ( fig1 ) are pivoted outwardly by struts 210 such that the outwardly extending barbs 208 and struts 210 form the inner flange . to facilitate bending of the barbs , the barbs 208 comprise points on the ends of axially extending members 212 which have narrow sections 214 located a desired distance from the free ends of the barbs 208 . for instance , the narrow sections 214 can be located at axial positions along the device corresponding approximately to the axial midpoint of the struts 210 connecting adjacent members 212 when the device is in the pre - expanded condition shown in fig1 . to facilitate easier bending of the struts 210 during radial expansion of the device , the distal ends of the struts can be curved at their points of attachment to the members 212 . likewise , a curved bend can be provided at the intersection where the proximal ends of the struts are attached together . when the device is radially expanded , the members 212 move radially outward and circumferentially apart as the struts 210 move radially outward until a force on the barbs 208 by the struts 210 causes the struts to become bent at the narrow sections 214 , after which the barbs extend outwardly to form the inner flange . in this deployed condition , the barbs 208 are locked into position by an x - shaped frame formed by struts 210 and additional struts 216 . the struts 216 are similar in configuration to the struts 210 with respect to how they are shaped and attached to the members 212 . short axially extending members 218 connect the intersection of the struts 210 to the intersection of the struts 216 . the frangible section 202 is located at the proximal ends of axially extending members 220 which are connected to the members 212 by u - shaped links 222 . the members 220 are arranged in pairs which are attached together at only their distal ends . in particular , the distal ends of the links 222 are attached to proximal ends of the members 212 and the midpoint of each link 222 is attached to the distal ends of a respective pair of members 220 . as shown in fig1 , during radial expansion of the device , the individual links 222 are plastically deformed from their u - shaped configuration to form segments of a circumferentially extending annular ring . as a result , the device becomes shorter in the axial direction as links 222 form the annular ring and the distal ends of the members 220 move radially outward but not apart in the circumferential direction . at the same time , the proximal ends of the members 220 move radially outward and circumferentially apart . fig1 shows an expanded view of the circled portion a in fig1 and fig1 shows how the frangible section 202 can be bent to fracture connection points between members 220 and axial extending members 224 . as shown in fig1 and 15 , proximal ends of the members 224 are attached to u - shaped links 226 which allow the proximal ends of the members 224 to move radially outward but not circumferentially apart when the device is expanded . as shown in fig1 , the distal ends of members 224 and connected to the proximal ends of the members 220 by a frangible joint comprised of shearable connections 228 . in the embodiment shown , the members 220 are connected at their proximal ends by a cross piece 230 and the members 224 are connected at their distal ends by a cross piece 232 . the cross piece 230 includes a recess 234 and the cross piece 232 includes a projection 236 located in the recess 234 . the frangible joint is preferably formed from a unitary piece of material ( e . g ., stainless steel , nickel titanium alloy , etc .) such as a laser cut tube wherein the shearable connections 228 comprise thin sections of material extending between opposite sides of the projection 236 and opposing walls of the recess 234 . as shown in fig1 , the recess 234 contains the projection 236 as the members 220 and 224 are pivoted about the joint formed by the shearable connections 228 . when the members 220 and 224 are pivoted to a sufficient extent , the shearable connections 228 are fractured allowing the implant to separate from the discard portion of the device . the frangible link shown in fig1 - 16 can be modified in various ways . for instance , as shown in fig1 , the projection can have a slot 238 extending from the free end thereof towards cross piece 232 . the slot 238 allows the portions of the projection on either side of the slot 238 to move closer together as the proximal ends of members 224 bend away from each other during radial expansion of the device 200 . likewise , the proximal ends of the members 220 on either side of the projection 236 can move closer together as the distal ends of the members 220 move apart during the radial expansion . another variation is shown in fig1 wherein two projections 236 a and 236 b extend from cross piece 232 and two projections 236 c and 236 d extend from cross piece 230 , projections 236 a and 236 d being connected by a first shearable connection 228 and projections 236 c and 236 d being connected by a second shearable connection 228 . as with the arrangement in fig1 , the arrangement in fig1 allows the projections 236 a - d to become squeezed together during radial expansion of the device 200 . the device 200 can be deployed using deployment tool 300 as follows . as shown in fig1 and 14 , the device 200 includes a crown 240 attached to a distal end 302 of the tool 300 . the crown includes axially extending members 242 with tabs ( not shown ) on the proximal ends thereof , the members 242 being held in slots 304 of the tool 300 by the tabs . a plastic sleeve ( not shown ) can be placed over the slots 304 to prevent the members 242 from coming out of the slots . as shown in fig1 , the crown is flared outwardly such that the members 242 are fully radially expanded at their proximal ends . during radial expansion of the device 200 , the diamond shaped linkage of the crown 240 is expanded from the configuration shown in fig1 to the expanded configuration shown in fig1 . in the embodiment shown in fig1 - 14 , the device 200 is attached to the tool 300 in a manner such that the discard portion 206 stays with the tool during deployment of the implant 204 and removal of the tool from the implant site . as previously described , the discard can include tabbed members fitted in grooves of the tool . other suitable attachment techniques include welding the proximal end of the device to the tool using resistance welding , ultrasonic welding or the like , molding the proximal end of the device into the distal end of the tool such as by insert molding , mechanically fastening the proximal end of the device to the tool , adhesive bonding , etc . in the foregoing embodiment , the device is deployed by radial expansion and axial compression . the axial compression can be accomplished by pushing the holder tube while the expander tube is held in a fixed position or vice versa . according to a further embodiment , the axial compression can be accomplished by rotation of the device . for instance , fig1 , showing a buckling crown 240 a which includes helical members 244 extending from a ring 246 attached to the distal end 302 of the tool 300 . additional helical members 248 which form the outer flange of the implant are connected to the helical members 244 by shearable connections 250 . during deployment of the outer flange , the tool 300 is rotated while preventing the implant 204 from rotating with the result that the helical members 244 and 248 bend outwardly at the location of the shearable connections 250 and form the outer flange . after formation of the outer flange , the shearable connections 250 fracture releasing the implant 204 from the crown 240 a which remains attached to the tool . as with the previously described device , the crown 240 a can be attached to the tool in any desired manner , e . g . welding , molding , etc . according to the next embodiment , the device can be designed so as to be released from the tool without use of fracture elements . for example , the tool can include a deforming crown which mechanically disengages with the device after forming the outer flange . the device and tool can incorporate any suitable release mechanism which , for example , connects the crown to the deployment tool when a tensile force is applied to the connection but which disconnects when a compressive force is applied to the connection , e . g ., hooks , tabs , spring clips , etc . fig2 shows an embodiment of a tool with a deforming crown 306 comprised of struts 308 and tabs 310 connected to the struts 308 by thin necks 312 . the device 200 a is similar to device 200 except that device 200 a does not include frangible links . instead , device 200 a includes bendable members 252 which are bent outwardly by the deforming crown 306 to form the outer flange . as shown in fig2 , each of the members 252 includes a hole 254 sized larger than the tabs to allow the tabs to be released from the holes after the outer flange is formed . when the device 200 a is attached to the tool 300 , the tabs 310 are fitted in the holes with the necks 312 received in the slots 256 . the struts 308 can be shorter than the members 252 so that when the outer flange is formed the members 252 extend outwardly further than the struts 308 . as a result , the necks 312 slide out of the slots 256 and the tabs 310 slide out of the holes 254 as the outer flange is formed and the implant is released from the tool . fig2 shows a device 400 ( illustrated in planar form for ease of description but which would be used in a tubular shape ) which cooperates with a deployment tool ( as described earlier ) for delivering and deploying an implant 404 at a site in a living body . the device includes a frangible linkage 402 connecting the implant 404 to a discard portion 406 . as explained with reference to the embodiment shown in fig1 - 14 , after the device is positioned at a desired location , the implant 404 can be expanded to deploy an inner flange and subsequently axially compressed to deploy an outer flange while severing the implant 404 from the discard portion 406 . the deployment tool can then be withdrawn along with the discard portion 406 which remains attached to the distal end of the deployment tool . during radial expansion of the device , axially extending barbs 408 are pivoted outwardly by struts 410 such that the outwardly extending barbs 408 and struts 410 form the inner flange . to facilitate bending of the barbs , the barbs 408 comprise points on the ends of axially extending members 412 which have narrow sections 414 located a desired distance from the free ends of the barbs 408 . for instance , the narrow sections 414 can be located at axial positions along the device corresponding approximately to the axial midpoint of the struts 410 connecting adjacent members 412 when the device is in the pre - expanded condition . to facilitate easier bending of the struts 410 during radial expansion of the device , the distal ends of the struts can be curved at their points of attachment to the members 412 . likewise , a curved bend can be provided at the intersection where the proximal ends of the struts are attached together . when the device is radially expanded , the members 412 move radially outward and circumferentially apart as the struts 410 move radially outward until a force on the barbs 408 by the struts 410 causes the struts to become bent at the narrow sections 414 , after which the barbs extend outwardly to form the inner flange . in this deployed condition , the barbs 408 are locked into position by an x - shaped frame formed by struts 410 and additional struts 416 . the struts 416 are similar in configuration to the struts 410 with respect to how they are shaped and attached to the members 412 . short axially extending members 418 connect the intersection of the struts 410 to the intersection of the struts 416 . the frangible section 402 is located at the proximal ends of axially extending members 420 which are connected to the members 412 by u - shaped links 422 . the members 420 are arranged in pairs which are attached together at midpoints of links 422 . during radial expansion of the device , the individual links 422 are plastically deformed from their u - shaped configuration to form segments of a circumferentially extending annular ring . as a result , the device becomes shorter in the axial direction as links 422 form the annular ring and the distal ends of the pairs of members 420 attached to an individual link 422 move radially outward but not apart in the circumferential direction . at the same time , the proximal ends of the members 420 move radially outward and circumferentially apart . the frangible section 402 is located between axial members 420 and axially extending members 424 . as shown in fig2 , the members 420 are closer together at their distal ends and this condition remains after expansion of the device . the proximal ends of the members 424 are attached to mid - points of u - shaped links 426 by a pair of short and closely spaced apart axially extending links 427 . the distal ends of members 424 are connected to the proximal ends of the members 420 by a frangible joint comprised of shearable connections 402 which operate in a manner similar to the previously discussed connections 228 , i . e ., as shown in fig2 , the members 420 are connected at their proximal ends by a cross piece 430 and the members 424 include a projection 436 received in a recess 434 . the frangible joint is formed from a unitary piece of material such as a laser cut tube wherein the shearable connections 402 comprise thin sections of material extending between opposite sides of the projection 436 and opposing walls of the recess 434 . when the members 420 and 424 are pivoted to a sufficient extent , the shearable connections 402 are fractured allowing the implant to separate from the discard portion of the device . the device 400 can be deployed in the same manner that the device 200 is deployed using deployment tool 300 . that is , the device 400 includes a crown attached to a distal end of the deployment tool . the crown includes axially extending members 442 with tabs 443 on the proximal ends thereof , the members 442 being held in slots 304 of the tool 300 by the tabs 443 . a plastic sleeve ( not shown ) can be placed over the slots 304 to prevent the members 442 from coming out of the slots . when mounted on the deployment tool , the crown is flared outwardly such that the members 442 are fully radially expanded at their proximal ends . during radial expansion of the device 400 , the diamond shaped linkage of the crown 440 is expanded from an unexpanded condition like the configuration shown in fig1 to an expanded condition like the expanded configuration shown in fig1 . fig2 shows a device 500 ( illustrated in planar form for ease of description but which would be used in a tubular shape ) which cooperates with a deployment tool ( as described earlier ) for delivering and deploying an implant 504 at a site in a living body . the device includes a frangible linkage 502 connecting the implant 504 to a discard portion 506 . as explained with reference to the embodiment shown in fig1 - 14 , after the device is positioned at a desired location , the implant 504 can be expanded to deploy an inner flange and subsequently axially compressed to deploy an outer flange while severing the implant 504 from the discard portion 506 . the deployment tool can then be withdrawn along with the discard portion 506 which remains attached to the distal end of the deployment tool . during radial expansion of the device , axially extending barbs 508 are pivoted outwardly by struts 510 such that the outwardly extending barbs 508 and struts 510 form the inner flange . to facilitate bending of the barbs , the barbs 508 comprise points on the ends of axially extending members 512 which have narrow sections 514 located a desired distance from the free ends of the barbs 508 . for instance , the narrow sections 514 can be located at axial positions along the device corresponding approximately to the axial midpoint of the struts 510 connecting adjacent members 512 when the device is in the pre - expanded condition . to facilitate easier bending of the struts 510 during radial expansion of the device , the distal ends of the struts can be curved at their points of attachment to the members 512 . likewise , a curved bend can be provided at the intersection where the proximal ends of the struts are attached together . when the device is radially expanded , the members 512 move radially outward and circumferentially apart as the struts 510 move radially outward until a force on the barbs 508 by the struts 510 causes the struts to become bent at the narrow sections 514 , after which the barbs extend outwardly to form the inner flange . in this deployed condition , the barbs 508 are locked into position by an x - shaped frame formed by struts 510 and additional struts 516 . the struts 516 are similar in configuration to the struts 510 with respect to how they are shaped and attached to the members 512 . short axially extending members 518 connect the intersection of the struts 510 to the intersection of the struts 516 . the frangible section 502 is located at the proximal ends of axially extending members 520 which are connected to the members 512 by u - shaped links 522 . the members 520 are arranged in pairs which are attached together at only their distal ends . in particular , the distal ends of the links 522 are attached to proximal ends of the members 512 and the midpoint of each link 522 is attached to the distal ends of a respective pair of members 520 . during radial expansion of the device , the individual links 522 are plastically deformed from their u - shaped configuration to form segments of a circumferentially extending annular ring . as a result , the device becomes shorter in the axial direction as links 522 form the annular ring and the distal ends of the members 520 move radially outward but not apart in the circumferential direction . at the same time , the proximal ends of the members 520 move radially outward and circumferentially apart . the frangible section 502 is located between pairs of the axial members 520 and pairs of axially extending members 524 . as shown in fig2 , each pair of members 520 attached to an individual link 522 are closer together at their distal ends and this condition remains when the device is expanded . the proximal ends of pairs of the members 524 are attached at locations intermediate mid - points and ends of u - shaped links 526 by a pair of curved links 527 . during expansion of the device , the u - shaped links 526 deform into a circumferentially extending ring and cause the proximal ends of the members 524 to spread apart such that a gap 528 between the members 524 becomes wider at the proximal ends of the members 524 . to aid spreading of the members 524 , the members include a curved recess 529 at the distal ends thereof . the distal ends of members 524 are connected to the proximal ends of the members 520 by a frangible joint comprised of shearable connections 502 which operate in a manner similar to the previously discussed connections 228 , i . e ., as shown in fig2 , the members 520 are connected at their proximal ends by a cross piece 530 and the members 524 are connected by a cross piece 535 which includes a projection 536 received in a recess 534 . the frangible joint is formed from a unitary piece of material such as a laser cut tube wherein the shearable connections 502 comprise thin sections of material extending between opposite sides of the projection 536 and opposing walls of the recess 534 . when the members 520 and 524 are pivoted to a sufficient extent , the shearable connections 502 are fractured allowing the implant to separate from the discard portion of the device . the device 500 can be deployed in the same manner that the device 200 is deployed using deployment tool 300 . that is , the device 500 includes a crown attached to a distal end of the deployment tool . the crown includes axially extending members 542 with tabs 543 on the proximal ends thereof , the members 542 being held in slots 304 of the tool 300 by the tabs 543 . a plastic sleeve ( not shown ) can be placed over the slots 304 to prevent the members 542 from coming out of the slots . when mounted on the deployment tool , the crown is flared outwardly such that the members 542 are fully radially expanded at their proximal ends . during radial expansion of the device 500 , the diamond shaped linkage of the crown 540 is expanded from an unexpanded condition like the configuration shown in fig1 to an expanded condition like the expanded configuration shown in fig1 . fig2 shows a device 600 ( illustrated in planar form for ease of description but which would be used in a tubular shape ) which cooperates with a deployment tool ( as described earlier ) for delivering and deploying an implant 604 at a site in a living body . the device includes a frangible linkage 602 connecting the implant 604 to a discard portion 606 . as explained with reference to the embodiment shown in fig1 - 14 , after the device is positioned at a desired location , the implant 604 can be expanded to deploy an inner flange and subsequently axially compressed to deploy an outer flange while severing the implant 604 from the discard portion 606 . the deployment tool can then be withdrawn along with the discard portion 606 which remains attached to the distal end of the deployment tool . during radial expansion of the device , axially extending barbs 608 are pivoted outwardly by struts 610 such that the outwardly extending barbs 608 and struts 610 form the inner flange . to facilitate bending of the barbs , the barbs 608 comprise points on the ends of axially extending members 612 which have narrow sections 614 located a desired distance from the free ends of the barbs 608 . for instance , the narrow sections 614 can be located at axial positions along the device corresponding approximately to a position slightly distal of the axial midpoint of the struts 610 connecting adjacent members 612 when the device is in the pre - expanded condition . to facilitate easier bending of the struts 610 during radial expansion of the device , the distal ends of the struts can be curved at their points of attachment to the members 612 . likewise , a curved bend can be provided at the intersection where the proximal ends of the struts are attached together . when the device is radially expanded , the members 612 move radially outward and circumferentially apart as the struts 610 move radially outward until a force on the barbs 608 by the struts 610 causes the struts to become bent at the narrow sections 614 , after which the barbs extend outwardly to form the inner flange . in this deployed condition , the barbs 608 are locked into position by an x - shaped frame formed by struts 610 and additional struts 616 . the struts 616 are similar in configuration to the struts 610 with respect to how they are shaped and attached to the members 612 . short axially extending members 618 connect the intersection of the struts 610 to the intersection of the struts 616 . the frangible section 602 is located at the proximal ends of axially extending members 620 which are connected to the members 612 by u - shaped links 622 . the members 620 are arranged as circumferentially spaced apart pairs which are attached together at midpoints of links 622 . during radial expansion of the device , the individual links 622 are plastically deformed from their u - shaped configuration to form segments of a circumferentially extending annular ring . as a result , the device becomes shorter in the axial direction as links 622 form the annular ring . at the same time , the proximal ends of each pair of members 620 attached to an individual link 622 move radially outward and apart in the circumferential direction . the frangible section 602 is located between pairs of the axial members 620 and pairs of axially extending members 624 . as shown in fig2 , the members 620 are substantially parallel to each other when the device is in its unexpanded condition , i . e ., prior to formation of the inner flange . however , when the device is radially expanded the distal ends of the members 620 will remain closer together than their proximal ends since the distal ends are attached to a midpoint of the links 622 . the proximal ends of pairs of the members 624 are attached at mid - points of u - shaped links 626 by a pair of thin links 627 . during expansion of the device , the u - shaped links 626 deform into a circumferentially extending ring while proximal ends of pairs of the members 624 spread apart such that a gap 628 between the pairs of members 624 becomes wider at the proximal ends of the members 624 . to aid spreading of the pairs of members 624 , the members 624 include a curved recess 629 at the distal ends thereof . the distal ends of members 624 are connected to the proximal ends of the members 620 by a frangible joint comprised of shearable connections 602 which operate in a manner similar to the previously discussed connections 228 , i . e ., as shown in fig2 , the members 620 are connected at their proximal ends by a cross piece 630 and the members 624 are connected by a cross piece 635 which includes a projection 636 received in a recess 634 . the frangible joint is formed from a unitary piece of material such as a laser cut tube wherein the shearable connections 602 comprise thin sections of material extending between opposite sides of the projection 636 and opposing walls of the recess 634 . when the members 620 and 624 are pivoted to a sufficient extent , the shearable connections 602 are fractured allowing the implant to separate from the discard portion of the device . the device 600 can be deployed in the same manner that the device 200 is deployed using deployment tool 300 . that is , the device 600 includes a crown attached to a distal end of the deployment tool . the crown includes axially extending members 642 with tabs 643 on the proximal ends thereof , the members 642 being held in slots 304 of the tool 300 by the tabs 643 . a plastic sleeve ( not shown ) can be placed over the slots 304 to prevent the members 642 from coming out of the slots . when mounted on the deployment tool , the crown is flared outwardly such that the members 642 are fully radially expanded at their proximal ends . during radial expansion of the device 600 , the diamond shaped linkage of the crown 640 is expanded from an unexpanded condition like the configuration shown in fig1 to an expanded condition like the expanded configuration shown in fig1 . fig2 shows a device 700 ( illustrated in planar form for ease of description but which would be used in a tubular shape ) which cooperates with a deployment tool ( as described earlier ) for delivering and deploying an implant 704 at a site in a living body . the device includes a frangible linkage 702 connecting the implant 704 to a discard portion 706 . as explained with reference to the embodiment shown in fig1 - 14 , after the device is positioned at a desired location , the implant 704 can be expanded to deploy an inner flange and subsequently axially compressed to deploy an outer flange while severing the implant 704 from the discard portion 706 . the deployment tool can then be withdrawn along with the discard portion 706 which remains attached to the distal end of the deployment tool . during radial expansion of the device , axially extending barbs 708 are pivoted outwardly by struts 710 such that the outwardly extending barbs 708 and struts 710 form the inner flange . to facilitate bending of the barbs , the barbs 708 comprise points on the ends of axially extending members 712 which have narrow sections 714 located a desired distance from the free ends of the barbs 708 . for instance , the narrow sections 714 can be located at axial positions along the device corresponding approximately to the axial midpoint of the struts 710 connecting adjacent members 712 when the device is in the pre - expanded condition . to facilitate easier bending of the struts 710 during radial expansion of the device , the distal ends of the struts can be curved at their points of attachment to the members 712 . likewise , a curved bend can be provided at the intersection where the proximal ends of the struts are attached together . when the device is radially expanded , the members 712 move radially outward and circumferentially apart as the struts 710 move radially outward until a force on the barbs 708 by the struts 710 causes the struts to become bent at the narrow sections 714 , after which the barbs extend outwardly to form the inner flange . in this deployed condition , the barbs 708 are locked into position by an x - shaped frame formed by struts 710 and additional struts 716 . the struts 716 are similar in configuration to the struts 710 with respect to how they are shaped and attached to the members 712 . short axially extending members 718 connect the intersection of the struts 710 to the intersection of the struts 716 . the frangible section 702 is located at the proximal ends of axially extending members 720 which are connected to the members 712 by u - shaped links 722 and u - shaped links 723 . the members 720 are arranged in pairs which are attached at their distal ends to proximal ends of the links 723 and the midpoints of the links 723 are attached to midpoints of the links 722 . the ends of the links 722 are attached to the proximal ends of adjacent members 718 . during radial expansion of the device , the individual links 722 , 723 are plastically deformed from their u - shaped configuration to form segments of two circumferentially extending annular rings . as a result , the device becomes shorter in the axial direction as links 722 , 723 form the annular rings and the distal ends of each pair of the members 720 attached to an individual link 723 move radially outward but not apart in the circumferential direction . at the same time , the proximal ends of pairs of the members 720 move radially outward and circumferentially apart . the frangible section 702 is located between pairs of the axial members 720 and pairs of axially extending members 724 . as shown in fig2 , the members 720 attached to an individual link 722 are somewhat closer together at their distal ends than their proximal ends , a condition which remains after expansion of the device . the proximal ends of pairs of the members 724 are attached to mid - points of u - shaped links 726 by a pair of short links 727 . during expansion of the device , the u - shaped links 726 deform into a circumferentially extending ring and cause the proximal ends of the members 724 to spread apart such that a gap 728 between the members 724 becomes wider at the proximal ends of the members 724 . to aid spreading of the members 724 , the members include a curved recess 729 at the distal ends thereof . the distal ends of members 724 are connected to the proximal ends of the members 720 by a frangible joint comprised of shearable connections 702 which operate in a manner similar to the previously discussed connections 228 , i . e ., as shown in fig2 , the members 720 are connected at their proximal ends by a cross piece 730 and the members 724 are connected by a cross piece 735 which includes a projection 736 received in a recess 734 . the frangible joint is formed from a unitary piece of material such as a laser cut tube wherein the shearable connections 702 comprise thin sections of material extending between opposite sides of the projection 736 and opposing walls of the recess 734 . when the members 720 and 724 are pivoted to a sufficient extent , the shearable connections 702 are fractured allowing the implant to separate from the discard portion of the device . the device 700 can be deployed in the same manner that the device 200 is deployed using deployment tool 300 . that is , the device 700 includes a crown attached to a distal end of the deployment tool . the crown includes axially extending members 742 with tabs 743 on the proximal ends thereof , the members 742 being held in slots 304 of the tool 300 by the tabs 743 . a plastic sleeve ( not shown ) can be placed over the slots 304 to prevent the members 742 from coming out of the slots . when mounted on the deployment tool , the crown is flared outwardly such that the members 742 are fully radially expanded at their proximal ends . during radial expansion of the device 700 , the diamond shaped linkage of the crown 740 is expanded from an unexpanded condition like the configuration shown in fig1 to an expanded condition like the expanded configuration shown in fig1 . fig3 and 31 show details of a tissue anchoring arrangement which can optionally be incorporated in the anastomosis device according to the invention . in particular , fig3 shows a distal end of a device 800 ( illustrated in planar form for ease of description but which would be used in a tubular shape ) wherein axially extending members 802 having points 804 for penetrating the graft vessel ( as described earlier ) also include a tissue anchoring arrangement 806 . the tissue anchoring arrangement 806 comprises one or more projections ( e . g ., tangs or barbs ) extending from one or both sides of the members 802 , the projections providing anchor points against the inner surface 810 of the target vessel 812 , as shown in fig3 ( wherein illustration of the graft vessel has been omitted ). the projections 806 can include points 808 which embed themselves in the tissue of the target vessel with or without penetrating the tissue . it is desirable that the projections provide enough of an anchoring effect to prevent sudden increases in blood pressure in the target vessel ( after the anastomosis operation ) from rupturing the seal between the graft vessel and the target vessel created by the anastomosis device . the outer flange can also include anchoring projections which can be used in lieu of or addition to anchoring projections on the inner flange . a preferred method of loading an expander 156 in a holder tube 154 and placing a graft vessel over the anastomosis device is explained with reference to fig3 , wherein expander 156 has been inserted in holder tube 154 . however , prior to insertion of the expander , the barbed ends 824 of device 820 preferably are bent outwardly so as to form an angle such as 5 to 60 ° to the central axis of the device . afterwards , the expander 156 can be advanced within the holder tube 154 to a location at which a proximal portion 822 of anastomosis device 820 is expanded over the expander . as a result of contact of the beveled end of the expander 156 with axial members 826 , the barbed ends 824 can be rotated inwardly somewhat to form a smaller angle with the central axis of the device 820 . then , after a graft vessel is threaded through the anastomosis device 820 , the end of the graft vessel can be everted over the distal end of the anastomosis device and the barbed ends 824 can be poked through the graft vessel . details of how this eversion process can be carried out are set forth in commonly assigned u . s . patent . application ser . no . 09 / 440 , 116 filed on nov . 15 , 1999 . with the anastomosis device and everted graft vessel in such a condition , the holder tube 154 can be loaded in a trocar ( not shown ). details of preferred trocar designs and an explanation of how the trocar creates an incision in a target vessel can be found in commonly assigned u . s . patent application ser . no . 09 / 440 , 263 . in order to deploy the device 820 , the inner flange can be expanded by pushing the expander 156 a set distance while maintaining the holder tube 154 in a fixed position . as a result , the linkage of the inner flange rotates the barbed ends 824 about the hinged connections 828 such that the barbed ends 824 from an angle of 40 to 140 ° with the central axis . then , the holder tube 154 is pushed a set distance while holding the expander 156 in a fixed position to deploy the outer flange . as a result , the linkage of the outer flange and the discard portion of the anastomosis device is axially compressed such that the linkage fractures as the outer flange is rotated outwardly and towards the already deployed inner flange . each of the anastomosis devices described above are preferably single piece devices which are formed by laser cutting or punching from a tube or sheet of material . the devices may be provided in varying sizes to join vessels such as arteries , veins , bile ducts , etc ., of different sizes . although various linkage arrangements have been shown wherein the devices include struts which extend between two circumferentially spaced apart locations and axial members which extend between two axially spaced apart locations , the linkages which form the flanges could also be formed by v - shaped links arranged in diamond like patterns . for example , fig3 shows an example of a tubular mesh 830 which can be axially compressed to form an outwardly extending flange . the mesh 830 includes short links 832 and 838 and long links 834 and 836 , the links 832 and 834 being joined to form a first diamond shaped pattern , the links 834 and 836 being joined to form a second diamond shaped pattern , and the links 836 and 838 being joined to form a third diamond shaped pattern . with such an arrangement , axial compression of the tubular mesh 830 will cause the links 834 and 836 to pivot about joints 835 connecting the links 834 to the links 836 and thus form a flange as illustrated in fig3 . the mesh 830 can be joined to another mesh with the same or different linkage arrangement with or without a connecting linkage therebetween . if the same linkage arrangement is used , in order to obtain deployment of one flange prior to deployment of the other flange , one of the linkages can be made with wider and / or thicker links . for example , by using a distal linkage of thin links and a proximal linkage of thick links , it is possible to deploy the inner flange prior to deployment of the outer flange . in other words , axial compression of the tubular mesh can cause the weaker distal linkage to deploy first and form the inner flange after which the outer flange can be formed by axial compression of the stronger proximal linkage . although the invention has been principally discussed with respect to coronary bypass surgery , the anastomosis devices of the present invention may be used in other types of anastomosis procedures . for example , the anastomosis device may be used in femoral - femoral bypass , vascular shunts , subclavian - carotid bypass , organ transplants , and the like . the anastomosis devices may be made of any known material which can be bent and will retain the bent shape such as stainless steel , nickel titanium alloys , and the like . the hinges or pivot joints which have been discussed above in the various embodiments of the present invention may be designed to concentrate the bending at a desired location . while the invention has been described in detail with reference to the preferred embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made and equivalents employed , without departing from the present invention .	0
referring to fig1 , a wellbore 10 is shown having an upper horizontal section 12 and a lower horizontal section 14 . a casing 16 lines upper section 12 and lower section 14 is shown as an open hole , though casing 16 could be placed in lower section 14 as well . to the extent casing 16 covers any producing formations , casing 16 must be perforated to provide fluid communication between the formations and wellbore 10 . a packer 18 is attached to an upper tubular 20 , and generally run into wellbore 10 until properly positioned and set near the lower end of upper section 12 . when packer 18 is set , it engages and seals against casing 16 , as is well known in the art . packer 18 has an extension / crossover 21 to which other lower completion equipment such as a conveyance device 22 and a screen 24 can attach . screen 24 is preferably disposed adjacent a producing formation in lower section 14 . in the embodiment of fig1 , conveyance device 22 is an inner tubular within an outer tubular forming an annular flow path between the inner and outer tubulars . the inner and outer tubulars may be concentrically or eccentrically aligned axially and held apart using conventional means such as spars or spacers . a partial or total restrictor 23 may be placed between the outer tubular of conveyance device 22 and casing 16 to confine or encourage fluid flow through conveyance device 22 . the inner tubular of conveyance device 22 can comprise various structures including blank pipe , screen on perforated pipe , or screen on unperforated pipe . the outer tubular is preferably unperforated pipe . in an alternate embodiment ( fig2 ), conveyance device 22 may be one or more discreet flow tubes 25 placed around a lower tubular 27 . again , restrictor 23 may be used to increase flow through the discreet flow tubes 25 of conveyance device 22 . wellbore 10 often has enlarged regions 26 in various locations within wellbore 10 . for example , region 26 may be the result of washout , where the formation has eroded or collapsed . region 26 may also be intentionally milled to accommodate a window for a lateral bore , or region 26 may occur when the wellbore diameter is reduced at some depth and casing 16 is not landed completely on the bottom or lower end of the larger diameter portion of wellbore 10 . for example , in subsea wells , it is very common to drill a larger diameter upper section 12 and a smaller diameter lower section 14 . typically , the larger diameter section 12 is drilled , and casing 16 is set in place with concrete before drilling the reduced - diameter lower section 14 . it is very difficult to land casing 16 exactly on the bottom of upper section 12 , and the concrete may not fill in much below casing 16 . thus , an enlarged region 26 is created . the enlarged region 26 can be a problem when an operator seeks to gravel pack the annulus between screen 24 and wellbore 10 . the gravel tends to settle out in region 26 , stopping the progress of the gravel pack alpha wave . that can cause the portion of lower section 14 below region 26 not to be packed with gravel . in operation , gravel is normally transported through a central passageway of upper tubular 20 until it reaches crossover 21 just below packer 18 . gravel exits crossover 21 and tends to pile up and form dunes until it reaches a certain height , depending on slurry speed , sand concentration , and other factors . if restrictors 23 are used , the slurry is discouraged or perhaps even restricted from entering region 26 . instead , the slurry enters and travels through conveyance device 22 until it emerges below region 26 . in this way slurry is conveyed past the troublesome region 26 and a more complete gravel pack is achieved in lower section 14 . once lower section 14 is packed with gravel , region 26 may also be filled if sufficient gravel slurry is pumped . though described in specific terms using specific components , the invention is not limited to those components . other elements may be interchangeably used , perhaps with slight modifications to account for variations . although only a few example embodiments of the present invention are described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the example embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention as defined in the following claims . it is the express intention of the applicant not to invoke 35 u . s . c . § 112 , paragraph 6 for any limitations of any of the claims herein , except for those in which the claim expressly uses the words ‘ means for ’ together with an associated function .	4
the following examples serve to illustrate the present invention and more particularly the preparation of the novel compounds of formula i without , however , being limited thereto . the composition and strucure of the resulting novel compounds are ascertained by spectroscopic investigations especially by an exact analysis of the nmr spectra . the amide - c ═ o - band is determined in the infrared spectrum within the range of 1630 - 1650 cm - 1 . the composition , salts , and melting points of the novel compounds are given in the table of examples . in this table any enclosed amounts of water , acetone , ethanol , or the like which are incorporated in the respective acid addition salts , are listed . ( a ) 50 . 5 g . of n 1 - benzoyl - n 2 - methyl - n 2 - phenyl - 2 - hydroxy - 1 , 3 - diamino propane are boiled under reflux with 250 ml . of phosphorus oxychloride for 21 / 2 hours . afer working up the reaction mixture in a manner known per se , 48 g . of a mixture of 1 - methyl - 2 - chloro methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine and 1 - methyl - 3 - chloro - 6 - phenyl - 1 , 2 , 3 , 4 - tetrahydrobenzodiazocine are obtained as residue . said mixture is boiled with 34 . 6 g . of potassium phthalimide and 9 . 6 g . of potassium iodide in 350 ml . of methanol for 22 hours . thereby 64 . 1 g . of 1 - methyl - 2 - phthalimido methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are obtained . without further purification said compound is heated under reflux with 17 . 8 g . of hydrazine hydrate in 800 ml . of ethanol . the resulting 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine is converted in the usual manner into its di - hydrochloride of the melting point 209 °- 213 ° c . ( b ) 19 . 3 g . of the above mentioned di - hydrochloride are dissolved in 260 ml . of methylene chloride . 26 ml . of tri - ethyl amine are added to said solution . a solution of 7 . 3 ml . of benzoyl chloride in 40 ml . of methylene chloride is added drop by drop thereto while cooling the reaction mixture with ice . the solution is then stirred at room temperature for 2 more hours and is washed first with 100 ml . of water , then with 100 ml . of a 20 % ammonia solution , followed by washing with 50 ml . of water and twice , each time with 50 ml . of a saturated sodium chloride solution . the organic phase is dried over anhydrous sodium sulfate and is filtered . the resulting filtrate is freed from its solvent by distillation in a vacuum . 16 . 3 g . of the crude base as given hereinabove are obtained as residue . said base is dissolved in ether and an ethereal solution of hydrochloric acid is added thereto . the precipitated hydrochloride crystals are filtered off and are stirred several times with hot acetone . 8 . 4 g . of 1 - methyl - 2 - benzoyl amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine di - hydrochloride are obtained in the form of yellow crystals of the melting point : 217 °- 218 ° c . 10 . 0 g . of 8 - methoxy - 1 - methyl - 2 - amino methyl - 5 -( 4 &# 39 ;- fluoro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are dissolved in 200 ml . of methylene chloride and 5 . 26 ml . of tri - ethyl amine are added thereto . thereupon a solution of 3 . 8 ml . of benzoylchloride in 50 ml . of methylene chloride is added drop by drop at a temperature of - 5 ° c . on working up the reaction mixture , there are obtained 6 . 8 g . of 8 - methoxy - 1 - methyl - 2 - benzoyl amino methyl - 5 -( 4 &# 39 ;- fluoro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine di - hydrochloride containing 0 . 8 moles of water . its melting point is 219 °- 222 ° c . 14 . 4 g . of 7 - bromo - 1 - methyl - 2 - amino methyl - 5 -( 2 &# 39 ;- chloro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are dissolved in 200 ml . of methylene chloride and 6 . 1 ml . of tri - ethyl amine are added thereto . thereupon a solution of 8 . 5 g . of 3 - sulfinyl imino benzoyl chloride in 50 ml . of methylene chloride is added drop by drop thereto while cooling with ice . the 3 - sulfinyl imino benzoyl chloride is obtained by reaction of thionyl chloride with 3 - amino benzoic acid . the reaction mixture is then stirred at room temperature overnight . the resulting methylene chloride phase is then worked up by extracting it by shaking with dilute 12 % hydrochloric acid . the base is then set free by the addition of 50 % sodium hydroxide solution , and is extracted with methylene chloride . 17 . 1 g . of the crude base , identified hereinabove , are obtained on working up the methylene chloride extract in a manner known per se . preliminary purification of said base is effected by conversion of the base into its di - hydrochloride . after reconversion of said salt into the base , whereby 8 . 5 g . thereof are obtained , the base is further purified by thin layer chromatography over silica gel by means of an eluting agent consisting of chloroform , ethanol , and concentrated ammonia solution in the proportion of 90 : 5 : 1 parts by volume . the di - hydrochloride produced from the thus purified base in a yield of 4 . 0 g . contains 1 mole of ethanol and 1 mole of water per mole of salt and has a melting point of 231 °- 235 ° c . 12 . 8 g . of benzoic acid are dissolved in 300 ml . of methylene chloride . the resulting solution is cooled to a temperature between 0 ° c . and 5 ° c . 24 . 6 ml . of tri - ethyl amine are added thereto . thereupon 10 ml . of chloro formic acid ethyl ester are added drop by drop thereto within about 5 to 10 minutes . the reaction solution is then stirred at a temperature between 0 ° c . and 5 ° c . for 30 more minutes and is then added drop by drop , while cooling and excluding moisture , to a solution of 38 . 2 g . of 8 - methoxy - 1 - methyl - 2 - amino methyl - 5 -( 2 &# 39 ;, 4 &# 39 ;- dichloro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in 200 ml . of methylene chloride in such a manner that the temperature is kept between 0 ° c . and 5 &# 39 ; c . the reaction solution is then stirred at room temperature for 4 more hours . after working up the reaction solution , there are obtained 50 . 3 g . of the crude above identified base which is converted into its hydrochloride of a melting point of 246 °- 248 ° c . yield : 35 . 5 g . 9 . 19 g . of 2 - chloro - 1 - methyl pyridinium iodide are suspended in 300 ml . of methylene chloride at room temperature and under exclusion of moisture , while stirring . 10 ml . of tri - ethyl amine and 4 . 56 g . of 3 - methoxy benzoic acid are added thereto . after 15 minutes there is added drop by drop a solution of 7 . 7 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in 100 ml . of methylene chloride within 15 minutes . after stirring for 30 more minutes there are admixed thereto 300 ml . of water and such a small amount of an aqueous ammonia solution that the reaction mixture is adjusted to slightly ammoniacal reaction . 12 . 5 g . of an oily residue are obtained from the methylene chloride phase . said residue is chromatographically purified over 150 g . of technical grade silica gel by successive elution with ether , methylene chloride , and ethanol . the hydrochloride obtained from the resulting , above identified base , is recrystallized from isopropanol . the thus purified hydrochloride has a melting point of 205 °- 210 ° c . the yield amounts to 10 . 8 g . 1 - methyl - 2 -[( 2 - acetoxy benzoyl ) amino methyl ]- 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine is produced from 15 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine and 10 g . of acetyl salicylic acid in accordance with the procedure as described in example 5 . the resulting reaction product is saponified to the above identified compound of saponification with a 20 % solution of sodium hydroxide in methanol within 30 minutes . the crude product obtained as an oily residue by extraction with methylene chloride , is dissolved in isopropanol and is converted into its hydrochloride by introduction of hydrogen chloride . the resulting hydrochloride is precipitated by the addition of ether . on recrystallization from a mixture of isopropanol and methanol , there are recovered 12 . 2 g . of the hydrochloride of the melting point 221 - 224 ° c . a mixture of 1 - methyl - 2 - chloro methyl - 5 -( 2 &# 39 ;- fluoro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine and 1 - methyl - 3 - chloro - 6 -( 2 &# 39 ;- fluoro phenyl )- 1 , 2 , 3 , 4 - tetrahydrobenzodiazocine is produced by cyclization of n 1 -( 2 - fluoro benzoyl )- n 2 - methyl - n 2 - phenyl - 2 - hydroxy - 1 , 3 - diamino propane by means of phosphorus oxychloride . 30 . 3 g . of said mixture in 300 ml . of methylene chloride are boiled under reflux with 17 . 8 g . of n - bromo succinimide for 24 hours . the brominated reaction product is reacted in a manner known per se with potassium phthalimide in methanol to yield 1 - methyl - 2 - phthalimido methyl - 7 - bromo - 5 -( 2 &# 39 ;- fluoro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine . after cleavage of said compound by means of hydrazine hydrate , there are obtained 17 . 3 g . of 7 - bromo - 1 - methyl - 2 - amino methyl - 5 -( 2 &# 39 ;- fluoro phenyl )- 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine . said compound is dissolved in 250 ml . of methylene chloride together with 6 . 7 ml . of tri - ethyl amine . the resulting solution is reacted with 7 . 6 g . of 2 - fluoro benzoyl chloride . after working up the reaction mixture in a manner known per se , the resulting base as identified hereinabove is converted into its hydrochloride of the melting point 238 °- 242 ° c . 10 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are heated in 40 ml . of 67 % hydrogen iodide at 80 ° c . for 4 hours , while stirring . thereupon the reaction solution is neutralized by means of solid sodium carbonate , with the addition of 500 g . of ice . after addition of 50 ml . of concentrated sodium hydroxide solution , the mixture is extracted with methylene chloride . working up of the resulting methylene chloride phase in the usual manner yields 9 . 0 g . of 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in the form of an oil . said compound is dissolved in 150 ml . of methylene chloride together with 4 . 2 ml . of tri - ethyl amine . the resulting solution is reacted with 4 . 2 g . of benzoyl chloride . 7 . 1 g . of 2 - benzoyl amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are obtained in the from of an oily crude product . the pure compound is isolated by recrystallization from a mixture of methylene chloride and ether as base . 0 , 005 hcl , fp 168 °- 169 ° c . to a solution of 11 . 1 g . of 1 - methyl - 2 - chloro methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in 100 ml . of glacial acetic acid there are added 30 ml . of concentrated sulfuric acid . thereafter a solution of 9 . 6 g . of potassium nitrate in 21 ml . of concentrated sulfuric acid is added at a temperature of 5 ° c . stirring of the reaction mixture is continued for one more hour . the mixture is then poured on ice , dilute sodium hydroxide solution is added , and the mixture is extracted with chloroform . on working up the extract in the usual manner , there are obtained 4 . 3 g . of 7 - nitro - 2 - chloro methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine . the melting point of its hydrochloride is 212 °- 215 ° c . by reacting said compound with potassium phthalimide and splitting up the resulting reaction product by means of 24 % hydrochloric acid , it is converted into 7 - nitro - 1 - methyl - 2 - amino methyl - 5 - phenyl - 1 - h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine . said compound is reacted with benzoylchloride and trie - ethyl amine in methylene chloride solution . on working up the reaction mixture , there are obtained 1 . 1 g . of 7 - nitro - 1 - methyl - 2 - benzoyl amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in the form of an oil . said oil is converted into its hydrochloride which has a melting point of 212 °- 215 ° c . 9 . 3 g . of 1 - methyl - 2 - benzoyl amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are dissolved in 100 ml . of tetrahydrofurane . 0 . 75 g . of sodium hydride in the form of an 80 % solution in paraffin oil are added to the resulting solution of the benzo diazepine compound in tetrahydrofurane at room temperature , while stirring . thereupon a solution of 1 . 55 ml . of methyl iodide in 10 ml . of tetrahydrofurane is slowly added drop by drop at 5 ° c . to the reaction mixture . the resulting mixture is stirred at 5 ° c . to 10 ° c . for 2 hours and is then worked up in a manner known per se after the addition of toluene and ice water . 7 . 2 g . of 1 - methyl - 2 -[ benzoyl -(- methyl ) amino methyl ]- 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are obtained in the form of an oily base . to a mixture of 33 . 8 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine di - hydrochloride and 25 . 1 g . of tri - ethyl amine in 460 ml . of methylene chloride there is added drop by drop a solution of 23 . 3 g . of 2 - chloro phenacetyl chloride in 140 ml . of methylene chloride while cooling with ice . thereafter the reaction mixture is stirred at room temperature for one more hour . after working up the reaction mixture in the usual manner with ice and water , there are obtained 54 . 2 g . of the crude compound as designated hereinabove . said compound is purified by means of 200 ml . of ether and 50 g . of γ - alumina . the purified base yields 17 . 5 g . of 1 - methyl - 2 -( 2 - chloro phenacetyl amino methyl )- 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine hydrochloride of the melting point 163 °- 164 . 5 ° c . 14 . 5 g . of 3 - phenyl propionic acid are dissolved in 250 ml . of methylene chloride and 14 . 5 ml . of tri - ethyl amine are added thereto . to the resulting mixture there are added drop by drop 10 ml . of chloro formic acid ethyl ester , while cooling with ice so as to maintain an internal temperature of 2 ° c . to 5 ° c . thereupon the reaction solution is stirred at said temperature for 30 more minutes . a solution of 26 . 5 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine in 200 ml . of methylene chloride is added to the solution of 3 - phenyl propionic acid and tri - ethyl amine in such a manner that the temperature is maintained between 0 ° c . and 5 ° c . after stirring the reaction mixture at room temperature for 4 more hours , it is worked up in the usual manner . 21 . 5 g . of 1 - methyl - 2 -( 3 - phenyl propional amino methyl )- 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are obtained in the form of an oily base . said base is converted into its hydrochloride salt which crystallizes . the salt is composed of 1 mole base , 1 . 8 moles hydrochloric acid , and 0 . 5 mole water . its melting point is 112 °- 114 ° c . 26 . 5 g . of 1 - methyl - 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are heated with an excess of benzoic acid methyl ester ( 100 ml .) to 120 ° c . for 2 hours . thereupon excess ester and the methanol formed during the reaction are slowly distilled off in a vacuum . a residue in the amount of 36 g . of crude reaction product is obtained thereby . on working up the same in the usual manner and converting it into its hydrochloride , there are obtained 24 . 7 g . of 1 - methyl - 2 - benzoyl amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine hydrochloride . its melting point is 217 °- 218 ° c . 15 . 4 g . of 1 - methyl - 2 -( n - n - propyl ) amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are dissolved in 250 ml . of ether . 2 . 8 g . of quinuclidine are added to said solution . to the resulting mixture there are added drop by drop 7 . 1 g . of benzoyl chloride dissolved in 100 ml . of ether , while cooling with ice . as soon as the benzoyl chloride has been added , the resulting reaction mixture is worked up in the usual manner . 11 . 2 g . of 1 - methyl - 2 -[ benzoyl -( n - n - propyl ) amino methyl ]- 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine are obtained in the form of the oily base . by proceeding as described in the foregoing examples 1 to 14 , there can be produced the following compounds of formula i in which the substituents r 1 , r 2 , r 4 , r 5 , n , r 6 , r 7 , r 8 , and r 9 indicate the substituents given in the following table . the compounds are obtained by acylation of correspondingly substituted 2 - amino methyl - 5 - phenyl - 1h - 2 , 3 - dihydro - 1 , 4 - benzo diazepine compounds with correspondingly substituted acylating compounds of formula iii : __________________________________________________________________________ex - am - substitution substitution acidple in ring a in ring b additionno . r . sub . 1 r . sub . 2 r . sub . 6 r . sub . 7 r . sub . 8 r . sub . 9 n r . sub . 4 r . sub . 5 salt m . p . __________________________________________________________________________ ° c . 15 ch . sub . 3 h h h h h 0 2 - cl h hcl 195 - 19716 ch . sub . 3 h h h h h 0 2 - f h hcl 189 - 19317 ch . sub . 3 h h h h h 0 2 - och . sub . 3 h hcl 196 - 19918 ch . sub . 3 h h h h h 0 2 , 4 - di - cl hcl 254 - 26019 ch . sub . 3 h h h h h 0 3 , 4 - di - cl hcl 172 - 17520 ch . sub . 3 h h h h h 0 4 - och . sub . 3 h hcl 215 - 22021 ch . sub . 3 h h h h h 0 4 - cf . sub . 3 h p - tos . 169 - 17422 ch . sub . 3 h h h h h 0 4 - oh h hcl 260 - 26523 ch . sub . 3 h h h h h 0 3 , 4 - di - och . sub . 3 hcl 214 - 21824 ch . sub . 3 h h h h h 0 3 , 5 - di - och . sub . 3 hcl 215 - 21725 ch . sub . 3 h h h h h 0 4 - ch . sub . 3 h hcl 195 - 19926 ch . sub . 3 h h h h h 0 3 - ch . sub . 3 h hcl 199 - 20127 ch . sub . 3 h h h h h 0 2 - ch . sub . 3 h hcl 189 - 19328 ch . sub . 3 h h h h h 0 4 - no . sub . 2 h hcl 216 - 22029 ch . sub . 3 h h h 2 - f h 0 4 - cn h hcl 239 - 24230 ch . sub . 3 h h h 2 - f h 0 2 - och . sub . 3 h hcl . 0 . 2 213 - 216 h . sub . 2 o . 0 . 1 i - c . sub . 3 h . sub . 7 oh31 ch . sub . 3 h h h 2 - f h 0 3 - och . sub . 3 h hcl 225 - 22832 ch . sub . 3 h h h 2 - f h 0 4 - och . sub . 3 h hcl . 0 , 4 201 - 205 i - c . sub . 3 h . sub . 7 oh33 ch . sub . 3 h h h 2 - f h 0 4 - cf . sub . 3 h hcl 184 - 18834 ch . sub . 3 h h h 2 - f h 0 4 - oh h hcl 253 - 25735 ch . sub . 3 h h h 2 - f h 0 3 - cn h hcl 185 - 18836 ch . sub . 3 h 8 - ch . sub . 3 h 4 - f h 0 4 - och . sub . 3 h hcl 255 - 25937 ch . sub . 3 h h h 2 - f h 0 3 - oh h base 200 - 20138 ch . sub . 3 h h h 2 - f h 0 3 , 4 - o -- ch . sub . 2 -- o hcl 190 - 19239 ch . sub . 3 h h h 4 - f h 0 2 - och . sub . 3 h hcl 175 - 18140 ch . sub . 3 h h h 4 - f h 0 4 - och . sub . 3 h hcl 147 - 15441 ch . sub . 3 h h h 4 - f h 0 2 - ch . sub . 3 h hcl 125 - 12842 ch . sub . 3 h h h 4 - f h 0 3 - ch . sub . 3 h hcl 199 - 20343 ch . sub . 3 h h h 4 - f h 0 4 - ch . sub . 3 h base 77 - 8344 ch . sub . 3 h h h h h 0 4 - oc . sub . 2 h . sub . 5 h 1 , 05 196 - 20145 ch . sub . 3 h h h 2 - f h 0 2 - oh h hcl 219 - 22346 ch . sub . 3 h 7 - ch . sub . 3 h 2 - f h 0 3 , 4 - di - cl hcl 220 - 22547 ch . sub . 3 h 7 - ch . sub . 3 h 2 - f h 0 h h hcl 249 - 25448 ch . sub . 3 h 8 - och . sub . 3 h 4 - f h 0 2 - cl h hcl 236 - 23949 ch . sub . 3 h 7 , 8 - o -- ch . sub . 2 -- o h h 0 h h hcl 253 - 26250 ch . sub . 3 h 7 , 8 - o -- ch . sub . 2 -- o h h 0 2 - cl h hcl 246 - 25351 ch . sub . 3 h 7 , 8 - o -- c . sub . 2 h . sub . 5 -- o h h 0 3 , 4 - di - cl hcl 263 - 26652 ch . sub . 3 h 7 , 8 - o -- c . sub . 2 h . sub . 5 -- o h h 0 h h hcl 267 - 27453 ch . sub . 3 h 7 - och . sub . 3 h h 0 h h hcl 252 - 25754 ch . sub . 3 h 8 - och . sub . 3 h 4 - cf . sub . 3 h 0 h h hcl 239 - 24155 ch . sub . 3 h 8 - och . sub . 3 h 3 - cf . sub . 3 h 0 h h hcl 211 - 21356 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 0 3 , 4 - di - cl hcl 202 - 20357 ch . sub . 3 h 8 - och . sub . 3 h 3 - f h 0 3 , 4 - di - cl hcl 215 - 21758 ch . sub . 3 h 8 - och . sub . 3 h 3 - f h 0 h h hcl 200 - 232 ( z ) 59 ch . sub . 3 h 8 - f h h h 0 h h hcl 214 - 21760 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 0 h h hcl 216 - 21961 ch . sub . 3 h h h 2 - f h 1 2 - f h base 146 - 14762 ch . sub . 3 h 7 - br h 2 - cl h 0 3 - f h hcl 243 - 24563 ch . sub . 3 h 7 - br h 2 - cl h 0 2 - f h hcl 215 - 217 . 564 ch . sub . 3 h 7 - br h 2 - cl h 0 3 , 4 - o -- ch . sub . 2 -- o hcl 250 - 25165 ch . sub . 3 h 7 - br h 2 - cl h 0 3 , 4 - di - och . sub . 3 hcl 237 - 23966 ch . sub . 3 h 7 , 8 - di - och . sub . 3 3 , 4 - di - och . sub . 3 0 2 - f h hcl . h . sub . 2 o 167 - 17067 ch . sub . 3 h 7 - br h 2 - cl h 0 4 - f h hcl 226 - 22968 ch . sub . 3 h 7 - br h 2 - cl h 0 2 - cl h hcl 205 - 20869 ch . sub . 3 h h h 2 - f h 0 2 , 4 - di - cl hcl 180 - 18570 ch . sub . 3 h h h 4 - f h 0 4 - f h hcl 182 - 18771 ch . sub . 3 h 8 - f h 2 - f h 0 h h hcl 191 - 19472 ch . sub . 3 h 7 - f 8 - ch . sub . 3 h h 0 h h hcl 112 - 11673 ch . sub . 3 h 7 - ch . sub . 3 8 - f h h 0 h h hcl 233 - 23774 ch . sub . 3 h h h 4 - br h 0 4 - c ( ch . sub . 3 ). sub . 3 h base 174 - 17575 ch . sub . 3 h h h 4 - br h 0 h h base 168 - 17176 ch . sub . 3 h h h 4 - f h 0 3 - och . sub . 3 h hcl 199 - 20477 ch . sub . 3 h h h 4 - f h 0 4 - oh h 1 , 25 184 - 189 hcl . 0 , 65 c . sub . 2 h . sub . 5 oh78 ch . sub . 3 h h h 4 - br h 0 3 , 5 - di - ch . sub . 379 ch . sub . 3 h 8 - ch . sub . 3 h 2 - f h 0 h h base o80 ch . sub . 3 h 8 - ch . sub . 3 h 4 - f h 0 h h base . 1 h . sub . 2 91 - 9381 ch . sub . 3 h 8 - ch . sub . 3 h 4 - f h 0 4 - ch . sub . 3 h base . 1 h . sub . 2 93 - 9682 ch . sub . 3 h 8 - ch . sub . 3 h 2 - ch . sub . 3 h 0 h h hcl 231 - 23583 ch . sub . 3 h h h 2 - f h 0 3 - f 6 - nh . sub . 2 base o84 ch . sub . 3 h h h 2 - f h 0 4 - nh . sub . 2 h hcl 115 - 11985 ch . sub . 3 h h h 4 - f h 0 4 - nhcoch . sub . 3 h base 122 - 12686 ch . sub . 3 h h h 4 - f h 0 4 - nhch . sub . 3 h hcl 165 - 17087 ch . sub . 3 h h h 4 - f h 0 4 - n ( ch . sub . 3 ). sub . 2 h hcl 162 - 16688 ch . sub . 3 h 8 - ch . sub . 3 h 2 , 4 - di - cl 0 h h hcl 252 - 25689 ch . sub . 3 h h h 4 - ch . sub . 3 h 0 4 - f h hcl 206 - 21090 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 0 4 - ch . sub . 3 h hcl 160 - 16291 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 0 h h p - tos 182 - 18392 ch . sub . 3 h 8 - och . sub . 3 h 4 - br h 0 h h hcl 239 - 24193 ch . sub . 3 h h h 2 , 4 - di - ch . sub . 3 0 h h hcl 195 - 19794 ch . sub . 3 h h h 4 - oh h 0 4 - oh h hcl 105 - 10995 n - c . sub . 4 h . sub . 9 h 8 - br h 4 - och . sub . 3 h 0 4 - no . sub . 2 h base o96 n - c . sub . 4 h . sub . 9 h 8 - br h 4 - f h 0 4 - no . sub . 2 h hcl 197 - 20097 ch . sub . 3 h 7 - ch . sub . 3 h 4 - f h 0 h h hcl 194 - 19798 ch . sub . 3 h 7 - ch . sub . 3 h 4 - f h 0 4 - och . sub . 3 h hcl 208 - 21199 ch . sub . 3 h 7 - ch . sub . 3 h 2 - f h 1 h h base o100 ch . sub . 3 h 7 - ch . sub . 3 h 2 - ch . sub . 3 h 0 h h base o101 ch . sub . 3 h 7 - ch . sub . 3 h h h 0 h h base o102 ch . sub . 3 h 8 - ch . sub . 3 h h h 0 h h hcl 248 - 252103 ch . sub . 3 h h h h h 0 3 - oh 4 - ch . sub . 3 hcl 173 - 178104 ch . sub . 3 h 8 - no . sub . 2 h h h 0 4 - ch . sub . 3 h hcl 241 - 245105 ch . sub . 3 h h h 2 - f 5 - no . sub . 2 0 h h 1 , 2 hcl . 119 - 123 0 , 2 h . sub . 2 o106 ch . sub . 3 h h h h h 0 2 - ococh . sub . 3 h base o107 ch . sub . 3 h 8 - oh h h h 0 4 - ch . sub . 3 h 1 . 15 127 - 131 0 , 25 c . sub . 2 h . sub . 5 oh108 ch . sub . 3 h h h 2 - cl 6 - f 0 4 - cn h hcl 236 - 250 ( z ) 109 ch . sub . 3 h h h 2 - ch . sub . 3 h 0 4 - cn h hcl . 0 , 35 174 - 180 ( ch . sub . 3 ). sub . 2 co . 0 , 15 h . sub . 2 o110 ch . sub . 3 h h h h h 0 4 - cn h hcl 208 - 212111 ch . sub . 3 h 7 - cl h h h 1 h h hcl 218 - 220112 ch . sub . 3 h 7 - cl h h h 1 3 , 4 - di - och . sub . 3 hcl 192 - 195113 ch . sub . 3 h 7 , 8 - o -- ch . sub . 2 -- o h h 1 3 , 4 - di - och . sub . 3 hcl 178 - 180114 ch . sub . 3 h h h h h 1 4 - br h 1 , 15 194 - 197 0 , 3 h . sub . 2 o115 ch . sub . 3 h h h h h 1 4 - cl h hcl . 0 , 7 h . sub . 2 98 - 102116 ch . sub . 3 h h h 4 - br h 1 4 - br h hcl . 0 , 3 h . sub . 2 179 - 182117 ch . sub . 3 h h h 2 - f h 1 2 - cl h hcl 171 - 174118 ch . sub . 3 h h h 4 - f h 1 2 - cl h base . 143 - 145 0 , 15 h . sub . 2 o119 ch . sub . 3 h h h 2 - f h 1 4 - cl h hcl . 0 . 6 h . sub . 2 99 - 105120 ch . sub . 3 h h h 4 - f h 1 3 - cl h base 141 - 145121 ch . sub . 3 h h h 4 - f h 1 4 - cl h hcl 205 - 209122 ch . sub . 3 h h h 2 - f h 1 h h 0 , 875 107 - 122 1 h . sub . 2 o123 ch . sub . 3 h h h 2 - f h 1 3 - cl h base 169 - 170124 ch . sub . 3 h 7 , 8 - di - och . sub . 3 h h 1 2 - cl h hcl 211 , 5 - 212125 ch . sub . 3 h 7 - br h 2 - cl h 1 3 , 4 - o -- c . sub . 2 h . sub . 2 -- o hcl 177 - 179126 ch . sub . 3 h 7 - br h 2 - cl h 1 3 , 4 - di - och . sub . 3 hcl 190 - 191127 ch . sub . 3 h h h h h 1 3 - cl h 1 , 1 hcl . 92 - 96 0 , 6 h . sub . 2 o128 ch . sub . 3 h h h 2 - f h 1 2 , 4 - di - cl base . 109 - 112 0 , 15 hcl129 h h h h h h 1 h base o130 ch . sub . 3 h 8 - f h 2 - f h 1 h h hcl 88 - 90131 ch . sub . 3 h 7 - f 8 - ch . sub . 3 h h 1 h h hcl . 0 . 4 h . sub . 2 95 - 99132 ch . sub . 3 h 7 - ch . sub . 3 8 - f h h 1 h h hcl 120 - 125133 ch . sub . 3 h 8 - ch . sub . 3 h 2 - f h 1 h h base 151 - 154134 ch . sub . 3 h 8 - ch . sub . 3 h 4 - f h 1 4 - och . sub . 3 h 1 , 1 hcl . 110 - 115 0 , 4 h . sub . 2 o135 ch . sub . 3 h 8 - ch . sub . 3 h 2 , 4 - di - cl 1 h h hcl . 0 , 5 h . sub . 2 123 - 127136 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 1 h h hcl . 0 , 5 h . sub . 2 113 - 117137 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 1 2 - cl h 1 , 55 123 - 128 0 , 3 h . sub . 2 o . 0 , 25 ( ch . sub . 3 ). sub . 2 co138 c . sub . 2 h . sub . 5 h h h 2 - f h 1 2 - cl h base 147 - 150139 c . sub . 2 h . sub . 5 h h h 2 - f h 1 2 - f h base 90 - 96140 n - c . sub . 4 h . sub . 9 h h h 2 - f h 1 2 - cl h base 174 - 176141 n - c . sub . 3 h . sub . 7 h h h 2 - f h 1 2 - cl h base 167 - 172142 ch . sub . 3 h h h h h 1 4 - och . sub . 3 h base o143 ch . sub . 3 h h h 2 - ch . sub . 3 h 1 2 - cl h hcl . 0 , 1 110 - 115 ( ch . sub . 3 ). sub . 2 co . 0 , 05 ch . sub . 3 cooc . sub . 2 h . sub . 5 . 0 , 25 h . sub . 2 o144 ch . sub . 3 h h h 4 - f h 2 4 - oh h 1 , 75 125 - 128 0 , 4 h . sub . 2 o145 ch . sub . 3 h h h h h 2 4 - oh h 1 , 9 hcl . 136 - 139 0 , 9 h . sub . 2 o146 ch . sub . 3 h h h 2 - f h 2 h h 1 , 6 hcl . 94 - 101 1 , 2 h . sub . 2 o147 ch . sub . 3 h 7 - f 8 - ch . sub . 3 h h 2 h h base o148 ch . sub . 3 h 7 - ch . sub . 3 8 - f h h 2 h h base o149 ch . sub . 3 h 8 - ch . sub . 3 h 2 - f h 2 h h base . 128 - 130 0 , 1 c . sub . 2 h . sub . 5 oh150 ch . sub . 3 h 8 - och . sub . 3 h 2 - f h 2 h h 1 , 65 112 - 116 0 , 45 h . sub . 2 o151 ch . sub . 3 h 8 - ch . sub . 3 h 2 - f h 2 4 - och . sub . 3 h hcl . 87 - 93 0 , 39 h . sub . 2 o152 n - c . sub . 4 h . sub . 9 h h h 2 - f h 0 4 - cf . sub . 3 h hcl . 128 - 131 0 , 3 i - c . sub . 3 h . sub . 7 oh . 0 , 2 h . sub . 2 o153 n - c . sub . 4 h . sub . 9 h h h h h 0 4 - cf . sub . 3 h hcl 188 - 190154 c . sub . 2 h . sub . 5 h h h 2 - f h 0 4 - cf . sub . 3 h p - tos . 170 - 172 0 , 1 h . sub . 2 o . 0 , 4 i - c . sub . 3 h . sub . 7 oh155 c . sub . 2 h . sub . 5 h h h h h 0 4 - cf . sub . 3 h p - tos 210 - 212156 c . sub . 2 h . sub . 5 h h h 2 - f h 0 2 - oh h cyclam 155 - 157157 c . sub . 2 h . sub . 5 h h h h h 0 2 - oh h hcl . 0 , 05 183 - 185 i - c . sub . 3 h . sub . 7 0 , 1 - h . sub . 2 o158 ch . sub . 3 ( ch . sub . 3 ). sub . 2 ch h h h h 0 2 - cl h base 152 - 154159 ch . sub . 3 h 7 - f h h h 0 4 - cn h base 166 - 167160 ch . sub . 3 h 7 - f h 2 - f h 0 4 - cn h base 146 - 148161 ch . sub . 3 h 7 - f h 2 - f h 1 3 , 4 - di - och . sub . 3 base 75 - 81162 ch . sub . 3 h 8 - ch . sub . 3 h 2 - f h 1 3 , 4 - di - och . sub . 3 base 118 - 121163 ch . sub . 3 h h h 2 - cl h 1 4 - och . sub . 3 h hcl 177 - 179164 ch . sub . 3 h 8 - ch . sub . 3 h 4 - no . sub . 2 h 0 4 - och . sub . 3 h hcl 212 - 216165 ch . sub . 3 h 7 - ch . sub . 3 h 4 - f h 0 4 - f h hcl 225 - 227__________________________________________________________________________ z = decomposition hcl = hydrochloric acid ptos = ptosylate - base = free base cyclam = cyclamate the following examples serve to illustrate processes of preparing pharmaceutical compositions containing compounds of formula i according to the present invention without , however , being limited thereto : ______________________________________1 - methyl - 2 -( 3 , 4 - dichloro benzoyl amino methyl )- 15 mg . 5 - phenyl - 1h -- 2 , 3 - dihydro - 1 , 4 - benzo diazepinehydrochloridecorn starch 60 mg . lactose 140 mg . gelatine ( 10 % solution ) 6 mg . ______________________________________ the active compound , corn starch , and lactose are thickened with the 10 % gelatine solution and the paste obtained thereby is triturated . the resulting granulated material is placed upon a suitable metal plate and is dried at a temperature of 45 ° c . the resulting dried granular material is conducted through a comminuting device . then the following agents are admixed to the resulting powder in a mixing device : the resulting mixture is then compressed to tablets each weighing 240 mg . analoguously tablets are prepared which contain an analgesically active compound of formula i in an amount of 1 mg / tablet , 2 mg / tablet , 5 mg / tablet , 10 mg / tablet , 25 mg / tablet or 50 mg / tablet . the active agent and the finely grated suppository material are thoroughly mixed and the mixture is then molten . suppositories , each weighing 2 g ., are cast from the resulting melt which is maintained in homogeneous condition by stirring . a formulation which is used for parenteral administration and which has the following composition is produced as follows : ______________________________________1 - methyl - 2 - benzoyl amino methyl - 5 - phenyl 10 % 1h -- 2 , 3 - dihydro - 1 , 4 - benzo diazepinedimethyl acetamide 10 % propylene glycol 50 % benzyl alcohol 1 . 5 % ethanol 10 % water for injection purposes up to 100 % ______________________________________ the active compound is dissolved in dimethyl acetamide . benzyl alcohol , propylene glycol , ethanol , and water are then admixed to the solution . the resulting mixture is filtered through a candle filter and filled into suitable ampoules which are sealed and sterilized . of course , many changes and variations in the starting materials used , in the reagents employed , in the reaction conditions , temperature , pressure , duration , in the solvents used , in the methods of working up the reaction mixtures and solutions , in purifying the reaction products , in separating the optically active isomers , in producing the acid addition salts , in formulating pharmaceutical preparations containing the novel compounds according to the present invention , and the like may be made by those skilled in the art in accordance with the principles set forth herein and in the claims annexed hereto .	2
in fig1 , a sterile filling machine (“ sfm ”) embodying the present invention is indicated generally by the reference numeral 10 . in the currently preferred embodiment of the invention , the sfm 10 is used to fill vials or syringes for containing medicaments , such as vaccines or pharmaceutical products . however , as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , the sfm 10 equally may be used for filling any of numerous other types of containers or delivery devices with the same or other substances , such as cosmetics and food products . the sfm 10 comprises an infeed unit 12 for holding the vials , syringes or other containers 14 to be delivered into the sfm . in the illustrated embodiment of the present invention , the infeed unit 12 is in the form of a rotary table that holds a plurality of vials , syringes or other containers 14 , and delivers the containers at a predetermined rate into the sfm . as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , the infeed unit 12 may take the form of any of numerous devices that are currently , or later become known for performing the function of the infeed unit 12 , such as any of numerous different types of vibratory feed drives , or “ pick and place ” robotic systems . prior to installing the vials or other containers 14 on the infeed unit 12 , the sealed containers ( e . g ., the empty vials with the stoppers sealed thereto ) are preferably sterilized , such as by exposing the containers to gamma radiation , in a manner known to those of ordinary skill in the pertinent art . in addition , the vial assemblies or other sealed , empty containers , may be enclosed , sterilized , and transported to the sfm 10 in accordance with the teachings of u . s . pat . no . 5 , 186 , 772 , entitled “ method of transferring articles , transfer pocket and enclosure ”, and u . s . patent application ser . no . 10 / 241 , 249 , filed sep . 10 , 2002 , entitled “ transfer port and method for transferring sterile items ”, each of which is assigned to the assignee of the present invention and is hereby expressly incorporated by reference as part of the present disclosure . once loaded onto the sfm 10 , the vials or other containers 14 are sterilized again by e - beam radiation in order to further ensure absolute sterility of the requisite surfaces prior to filling and sealing , as described further below . a conveyor 16 is coupled to the infeed unit 12 for receiving the vials or other containers 14 delivered by the infeed unit and for transporting the vials or other containers at a predetermined rate through the sfm 10 in the directions indicated by the arrows in fig1 . in the illustrated embodiment of the present invention , the conveyor 16 preferably transports the containers 14 in a single file relative to each other . in the event the containers 14 are vials , each vial preferably defines a substantially “ diabolo ” shape formed by a base , a cap and a body extending between the base and cap , wherein the base and cap define a diameter or width that is greater than that of the body . the diabolo shape may facilitate securing and otherwise transporting the vials through the sfm 10 . vials of this type are disclosed in co - pending u . s . provisional patent application ser . no . 60 / 408 , 068 , filed sep . 3 , 2002 , entitled “ sealed containers and methods of making and filling same ”, and u . s . patent application ser . no . 29 / 166 , 810 , filed sep . 3 , 2002 , entitled “ vial ”, each of which is assigned to the assignee of the present invention and is hereby expressly incorporated by reference as part of the present disclosure . the conveyor 16 may take the form of any of numerous different types of conveyers that are currently , or later become known , for performing the functions of the conveyor described herein . for example , the conveyor may take the form of a vibratory feed drive , or may take the form of an endless conveyor belt including , for example , a plurality of receptacles , such as cleats , for receiving or otherwise holding the vials or other containers 14 at predetermined positions on the conveyor . the conveyor 16 is drivingly connected to a motor or other suitable drive source 15 , which is controlled by a computer or other control unit 17 to start , stop , control the speed , and otherwise coordinate operation of the conveyor with the other components of the sfm . the sfm 10 further includes an e - beam and needle filling assembly 18 comprising an e - beam housing 20 , at least one e - beam source 22 , and a needle filling station 24 mounted within the e - beam housing . the e - beam source 22 may be any of numerous different types of e - beam sources that are currently , or later become known , for performing the function of the e - beam source 22 described herein . e - beam radiation is a form of ionizing energy that is generally characterized by its low penetration and high dose rates . the electrons alter various chemical and molecular bonds upon contact with an exposed product , including the reproductive cells of microorganisms , and therefore e - beam radiation is particularly suitable for sterilizing vials , syringes and other containers for medicaments or other sterile substances . as indicated by the arrows in fig1 , the e - beam source 22 produces an electron beam 26 that is formed by a concentrated , highly charged stream of electrons generated by the acceleration and conversion of electricity . preferably , the electron beam 26 is focused onto a penetrable surface of each container 14 for piercing by a needle to thereby fill the container with a medicament or other substance . for example , in the case of vials , such as the vials including resealable stoppers as described , for example , in the above - mentioned co - pending patent applications , the electron beam 26 is focused onto the upper surface of the stopper to sterilize the penetrable surface of the stopper prior to insertion of the filling needle therethrough . in addition , reflective surfaces may be mounted on opposite sides of the conveyor relative to each other , or otherwise in a manner known to those of ordinary skill in the pertinent art based on the teachings herein , to reflect the e - beam , and / or the reflected and scattered electrons of the e - beam , onto the sides of the vials or other containers 14 to sterilize these surfaces as well . alternatively , or in combination with such reflective surfaces , more than one e - beam source 22 may be employed , wherein each e - beam source is focused onto a respective surface or surface portion of the vials or other containers 14 to ensure sterilization of each surface or surface area of interest . the e - beam housing 20 is constructed in a manner known to those of ordinary skill in the pertinent art based on the teachings herein to define an e - beam chamber 28 and means for preventing leakage of the electrons out of the chamber in accordance with applicable safety standards . as shown in fig1 , the conveyor 16 defines an approximately u - shaped path within the e - beam chamber 28 , wherein the first leg of the u defines an inlet section and the portion of the chamber onto which the e - beam 26 is directed . in the currently preferred embodiment of the present invention , the current , scan width , position and energy of the e - beam 26 , the speed of the conveyor 16 , and / or the orientation and position of any reflective surfaces , are selected to achieve at least about a 3 log reduction , and preferably at least about a 6 log reduction in bio - burden testing on the upper surface of the vial &# 39 ; s or other container &# 39 ; s resealable stopper , i . e ., the surface of the stopper defining the penetrable region that is pierced by a filling needle to fill the vial . in addition , as an added measure of caution , one or more of the foregoing variables also are preferably selected to achieve at least about a 3 log reduction on the sides of the vial or other container , i . e ., on the surfaces of the vial that are not pierced by the needle during filling . these specific levels of sterility are only exemplary , however , and the sterility levels may be set as desired or otherwise required to validate a particular product under , for example , united states fda or applicable european standards , such as the applicable sterility assurance levels (“ sal ”). the e - beam and needle filling assembly 18 also preferably includes means 25 for visually inspecting the filling station 24 . this means may take the form of a beta - barrier window ( i . e ., a window that blocks any e - beam radiation but permits visual inspection therethrough ), and / or a ccd , video or other camera mounted within the housing for transmitting to an external monitor ( not shown ) images of the filling station 24 . as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , these particular devices are only exemplary , and any of numerous other devices that are currently , or later become known , for performing the function of permitting visual inspection equally may be employed . as shown in fig1 , the needle filling station 24 is mounted on the opposite leg , or outlet side of the u - shaped conveyor path within the e - beam chamber 28 . in the illustrated embodiment of the present invention , the needle station 24 includes a plurality of needles 30 or other filling members mounted over the conveyor 16 , wherein each needle is drivingly mounted over the conveyor in the same manner as described , for example , in the above - mentioned co - pending patent applications . accordingly , each needle 30 is movable into and out of engagement with the resealable stoppers to pierce the stoppers and fill the vials or other containers 14 with a medicament or other substance to be contained therein , and to then withdraw the needle upon filling the vial or other container . in the illustrated embodiment , the needle filling station 24 includes a bank of six needles 30 mounted in line with each other and overlying the conveyor 16 to allow the simultaneous piercing and in - line filling of six vials or other containers . the needles 30 may be mounted on a common drive unit , or each needle may be individually actuatable into and out of engagement with the resealable stoppers of the vials or other containers 14 . as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , the needle filling station 24 may include any desired number of needles 30 , or may be mounted or driven in any of numerous different ways that are currently , or later become known , for performing the functions of the needle filling station described herein . similarly , the sfm 10 may include a plurality of needle filling stations 24 mounted within the same e - beam chamber 28 , or a plurality of e - beam and needle filling assemblies , in order to increase or otherwise adjust the overall throughput of the sfm 10 . preferably , the e - beam housing 20 defines a port 31 or other removable passageway to allow access to and / or repair and replacement of the needle filling station 24 . each needle 30 is connected in fluid communication to a substance source 33 by one or more filling lines 35 for receiving therefrom a medicament of other substance to be filled into the vials or other containers 14 . the substance source 33 is preferably mounted external to the e - beam chamber 28 , and the filling line ( s ) 35 connected between the substance source 33 and needles 30 are protected by suitable shielding , an electron trap , and / or other arrangement that is currently , or later becomes known to those of ordinary skill in the pertinent art , to prevent radiation within the e - beam chamber 28 from degrading or otherwise damaging the substance flowing through the line ( s ) 35 from the substance source 31 to the needles 30 . as can be seen in fig1 , the e - beam and needle filling assembly 18 is configured so that the needles 30 of the needle filling station are mounted within the e - beam chamber 28 . as a result , the free electrons within the e - beam chamber will impinge upon the needles 30 . this , in combination with operation of the e - beam 26 which sterilizes the air throughout the e - beam chamber , functions to sterilize the needles and / or maintain the sterility of the needles throughout the filling process . preferably , the current , scan width , relative position and energy of the e - beam 26 , and / or the orientation and position of any reflective surfaces , are selected to achieve at least about a 3 log reduction , and preferably at least about a 6 log reduction in bio - burden testing on the external surfaces of the needles 30 , including but not necessarily limited to , the surfaces of the needles that contact the resealable stoppers of the vials or other containers 14 . further , these levels of sterility are achievable within the shadows of the needles 30 relative to the e - beam source 22 due to the electronic cloud of e - beam radiation formed within and around the needles . these specific levels of sterility are only exemplary , however , and the sterility levels may be set as desired or otherwise required to validate a particular product under , for example , united states fda or applicable european standards , such as the applicable sal . since the containers or other vials are filled within the e - beam chamber 28 , there is virtually no risk that the containers will become contaminated between e - beam sterilization and filling . if desired , the air within the e - beam chamber may be ionized to promote multiplication of the free electrons and further enhance the sterility of the filling station . another advantage of the sfm of the present invention is that a laminar flow of air over the needles during filling may be unnecessary to achieve the requisite level of sterility . in addition , this feature of the present invention may further obviate the need for a laminar flow of air over the resealable stoppers during laser or other thermal sealing of the stoppers . in the illustrated embodiment of the present invention , there may be little , if any concern , that the filled vials or other containers will become contaminated during the brief period of transportation between the needle filling and laser sealing stations . furthermore , this feature of the invention obviates any need for an isolator , as found in many prior art sterile filling machines . the sfm 10 further includes a laser sealing station 32 mounted over the conveyor 16 immediately downstream the outlet of the e - beam and needle filling assembly 18 . in the illustrated embodiment of the invention , the laser sealing station 32 preferably includes a plurality of lasers , each mounted over a respective vial or other container 14 for transmitting a respective laser beam 34 onto the vial to heat seal the needle aperture in the resealable stopper . in the illustrated embodiment of the present invention , each laser is a diode laser fiber - optically coupled to a respective outlet port overlying the conveyor and focused onto a respective stopper position on the conveyor . for example , the lasers may take the form of the fiber coupled diode laser units manufactured by semiconductor laser international corp . of binghamton , n . y ., usa . a significant advantage of this type of laser system is that the lasers may be mounted remote from the laser sealing station 32 and mounted , for example , outside of any enclosure for the laser sealing station . as a result , any laser repair or replacement may be performed outside of the laser sealing or other enclosure facilitating a significantly less expensive and time consuming procedure than if the laser were mounted within the enclosure . the laser sealing station 32 also preferably includes a smoke removal unit of a type known to those of ordinary skill in the pertinent art for removing any smoke , vapors or gases generated upon heat sealing the stoppers . as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , other types of laser , radiation , or other energy sources that are currently or later become known equally may be used to heat seal the penetrated regions of the stoppers . in the illustrated embodiment of the invention , each resealable stopper is formed of a thermoplastic material defining a needle penetration region that is pierceable with a needle to form a needle aperture therethrough , and is heat resealable to hermetically seal the needle aperture by applying laser radiation at a predetermined wavelength and power thereto . each stopper comprises a thermoplastic body defining ( i ) a predetermined wall thickness in an axial direction thereof , ( ii ) a predetermined color and opacity that substantially absorbs the laser radiation at the predetermined wavelength and substantially prevents the passage of the radiation through the predetermined wall thickness thereof , and ( iii ) a predetermined color and opacity that causes the laser radiation at the predetermined wavelength and power to hermetically seal the needle aperture formed in the needle penetration region thereof in a predetermined time period and substantially without burning the needle penetration region ( i . e ., without creating an irreversible change in molecular structure or chemical properties of the material ). in a currently preferred embodiment , the predetermined time period is approximately 2 seconds , and is most preferably less than or equal to about 1 . 5 seconds . also in a currently preferred embodiment , the predetermined wavelength of the laser radiation is about 980 nm , and the predetermined power of each laser is preferably less than about 30 watts , and most preferably less than or equal to about 10 watts , or within the range of about 8 to about 10 watts . also in the currently preferred embodiment , the predetermined color of the material is gray , and the predetermined opacity is defined by a dark gray colorant added to the stopper material in an amount within the range of about 0 . 3 % to about 0 . 6 % by weight . in addition , the thermoplastic material may be a blend of a first material that is preferably a styrene block copolymer , such as the materials sold under either the trademarks kraton or dynaflex , and a second material that is preferably an olefin , such as the materials sold under either the trademarks engage or exact . in one embodiment of the invention , the first and second materials are blended within the range of about 50 : 50 by weight to about 90 : 10 by weight ( i . e ., first material : second material ). in one embodiment of the invention , the blend of first and second materials is about 50 : 50 by weight . the benefits of the preferred blend over the first material by itself are improved water or vapor barrier properties , and thus improved product shelf life ; improved heat sealability ; a reduced coefficient of friction ; improved moldability or mold flow rates ; and a reduction in hystereses losses . further , if desired , the material may include a medical grade silicone or other suitable lubricant to facilitate preventing the formation of particles upon penetrating the resealable stoppers with the needles . as may be recognized by those skilled in the pertinent art , however , these numbers and materials are only exemplary , and may be changed if desired or otherwise required in a particular system . as shown in fig1 , the sfm 10 includes one or more other stations 36 located downstream of the laser sealing station 32 . the other stations 36 may include a vision system of a type known to those of ordinary skill in the pertinent art for inspecting each laser or other seal , a level detection system for detecting the level of fluid or other substance within each vial or other container 14 to ensure that it is filled to the correct level , and a labeling station . in addition , as shown in fig1 , the sfm 10 includes a rejection unit 38 for pulling off of the conveyer any vials or other containers 14 that are defective as detected , for example , by the laser or other seal inspection , level detection inspection , or due to mislabeling or defective labeling . then , the acceptable vials or other containers are removed by a discharge unit 40 for discharging the vials or other containers into a collection unit 42 for packing and shipping . the rejection and discharge units may take the forms of star wheels , pick and place robots , or any of numerous other devices that are currently or later become known for performing the functions of these units described herein . a significant advantage of the present invention is that it enables true sterile filling and not only aseptic filling . another advantage of the present invention is that the medicament or other substance is filled after subjecting the containers to gamma and direct e - beam radiation , thus preventing the radiation from degrading the medicament or other substance to be contained within the container . yet another advantage of the present invention is that there is substantially zero possibility of contaminating the vials or other containers between the sterilization and filling steps . as may be recognized by those of ordinary skill in the pertinent art based on the teachings herein , numerous changes and modifications may be made to the above - described and other embodiments of the invention without departing from its scope as defined in the claims . for example , the form and configuration of many of the components of the sfm disclosed herein may change , or any number of stations may be added to the sfm to provide additional functionality . in addition , the containers may take the form of any of numerous different vials , syringes or other containers . accordingly , this detailed description of preferred embodiments is to be taken in an illustrative as opposed to a limiting sense .	0
referring initially to fig1 - 7 of the drawings , a stacked tooling apparatus which is suitable for implementation of the composite fabrication method is generally indicated by reference numeral 1 . the stacked tooling apparatus 1 may include a first die frame 2 and a second die frame 8 . a first tooling die 3 may be provided on the first die frame 2 , and a second tooling die 9 may be provided on the second die frame 8 . the first tooling die and the second tooling die 9 may be hydraulically - actuated to facilitate movement of the first tooling die 3 and the second tooling die 9 toward and away from each other . the first tooling die 3 may have a first contoured die surface 4 , whereas the second tooling die 9 may have a second contoured die surface 10 which is complementary to the first contoured die surface 4 of the first tooling die 3 . as shown in fig6 , multiple induction coils 26 may extend through each of the first tooling die 3 ( and the second tooling die 9 , not shown ) to facilitate selective heating of the first tooling die 3 and the second tooling die 9 . a thermal control system 27 may be connected to the induction coils 26 . a first die susceptor 20 may be thermally coupled to the induction coils 26 of the first tooling die 3 . a second die susceptor 21 may be thermally coupled to the induction coils 26 of the second tooling die 9 . each of the first die susceptor 20 and the second die susceptor 21 may be a thermally - conductive material such as , but not limited to , a ferromagnetic material , cobalt , nickel , or compounds thereof . in some embodiments , each of the first die susceptor 20 and the second die susceptor 21 may be made of alloys including one or more of the ferromagnetic elements iron , nickel and cobalt plus other elements of lesser fractions such as molybdenum , chromium , vanadium and manganese , for example and without limitation . as shown in fig1 - 5 , the first die susceptor 20 may generally conform to the first contoured die surface 4 and the second die susceptor 21 may generally conform to the second contoured die surface 10 . as shown in fig6 , an electrically and thermally insulative coating 30 may be provided on the first contoured die surface 4 of the first tooling die 3 , as shown , and on the second contoured die surface 10 of the second tooling die 9 ( not shown ). the electrically and thermally insulative coating 30 may be , for example , alumina or silicon carbide . the first die susceptor 20 may be provided on the electrically and thermally insulative coating of the first tooling die 3 , as shown , and the second die susceptor 21 may be provided on the electrically and thermally insulative coating 30 of the second tooling die 9 ( not shown ). as shown in fig1 - 5 , a cooling system 14 may be provided in each of the first tooling die 3 and the second tooling die 9 . the cooling system 14 may include , for example , coolant conduits 15 which have a selected distribution throughout each of the first tooling die 3 and the second tooling die 9 . as shown in fig4 , the coolant conduit 15 may be adapted to discharge a cooling medium 17 into the first tooling die 3 or the second tooling die 9 . the cooling medium 17 may be a liquid , gas or gas / liquid mixture which may be applied as a mist or aerosol , for example . each of the first tooling die 3 and the second tooling die 9 may each include multiple stacked metal sheets 28 such as stainless steel which are trimmed to the appropriate dimensions for the induction coils 26 . this is shown in fig6 and 7 . the stacked metal sheets 28 may be oriented in generally perpendicular relationship with respect to the first contoured die surface 4 and the second contoured die surface 10 . each metal sheet 28 may have a thickness of from about 1 / 16 ″ to about ½ ″, for example and preferably ⅛ ″. an air gap 29 may be provided between adjacent stacked metal sheets 28 to facilitate cooling of the first tooling die 3 and the second tooling die 9 ( not shown ). the stacked metal sheets 28 may be attached to each other using clamps ( not shown ), fasteners ( not shown ) and / or other suitable technique known to those skilled in the art . the stacked metal sheets 28 may be selected based on their electrical and thermal properties and may be transparent to the magnetic field . an electrically insulating coating ( not shown ) may , optionally , be provided on each side of each stacked sheet 28 to prevent flow of electrical current between the stacked metal sheets 28 . the insulating coating may be a material such as ceramic , for example , or other high temperature resistant materials . however , if an air gap exists inbetween the stacked sheets , then no coating would be necessary . multiple thermal expansion slots 40 may be provided in each stacked sheet 28 , as shown in fig6 , to facilitate thermal expansion and contraction of the stacked tooling apparatus 1 . in typical implementation of the composite fabrication method , molding compounds 24 are initially positioned between the first tooling die 3 and the second tooling die 9 of the stacked tooling apparatus 1 , as shown in fig1 . the first tooling die 3 and the second tooling die 9 are next moved toward each other , as shown in fig2 , as the induction coils 26 ( fig6 ) heat the first tooling die 3 and the second tooling die 9 as well as the first die susceptor 20 and the second die susceptor 21 . therefore , as the first tooling die 3 and the second tooling die 9 close toward each other , the first die susceptor 20 and the second die susceptor 21 rapidly heat the molding compounds 24 . thus , the molding compounds 24 which may be thermally molded as the first tooling die 3 and the second tooling die 9 continue to approach and then close against the molding compounds 24 , as shown in fig2 , forming the molding compounds 24 to the configuration of a composite sheet 25 ( shown in fig3 - 5 ) which may be defined by the first contoured surface 4 of the first tooling die 3 and the second contoured surface 10 of the second tooling die 9 . as shown in fig4 , the cooling system 14 is next operated to apply the cooling medium 17 to the first tooling die 3 and the second tooling die 9 and to the first die susceptor 20 and the second die susceptor 21 . therefore , the cooling medium 17 actively and rapidly cools the first tooling die 3 and the second tooling die 9 as well as the first die susceptor 20 and the second die susceptor 21 , also cooling the composite sheet 25 sandwiched between the first die susceptor 20 and the second die susceptor 21 . the composite sheet 25 remains sandwiched between the first tooling die 3 and the second tooling die 9 for a predetermined period of time until complete cooling of the composite sheet 25 has occurred . this allows the molded and consolidated composite sheet 25 to retain the structural shape which is defined by the first contoured surface 4 and the second contoured surface 10 after the first tooling die 3 and the second tooling die 9 are opened , as shown in fig5 . the formed and cooled composite sheet 25 is removed from the stacked tooling apparatus 1 without loss of dimensional accuracy or delamination of the composite sheet 25 when it is cooled at an appropriate property - enhancing rate . referring next to fig8 , a block diagram 800 which illustrates an exemplary composite fabrication method is shown . in block 802 , a stacked tooling apparatus comprising a first tooling die and a second tooling die may be provided . in block 804 , molding compounds may be placed between the first tooling die and the second tooling die . in block 806 , the first tooling die and the second tooling die may be heated . in block 808 , the first tooling die and the second tooling die may be moved into contact with the molding compounds . in block 810 , the first tooling die and the second tooling die may be cooled . in block 812 , a molded composite sheet is removed from between the first tooling die and the second tooling die . referring next to fig9 and 10 , embodiments of the disclosure may be used in the context of an aircraft manufacturing and service method 78 as shown in fig9 and an aircraft 94 as shown in fig1 . during pre - production , exemplary method 78 may include specification and design 80 of the aircraft 94 and material procurement 82 . during production , component and subassembly manufacturing 84 and system integration 86 of the aircraft 94 takes place . thereafter , the aircraft 94 may go through certification and delivery 88 in order to be placed in service 90 . while in service by a customer , the aircraft 94 is scheduled for routine maintenance and service 90 ( which may also include modification , reconfiguration , refurbishment , and so on ). each of the processes of method 78 may be performed or carried out by a system integrator , a third party , and / or an operator ( e . g ., a customer ). for the purposes of this description , a system integrator may include without limitation any number of aircraft manufacturers and major - system subcontractors ; a third party may include without limitation any number of vendors , subcontractors , and suppliers ; and an operator may be an airline , leasing company , military entity , service organization , and so on . as shown in fig1 , the aircraft 94 produced by exemplary method 78 may include an airframe 98 with a plurality of systems 96 and an interior 100 . examples of high - level systems 96 include one or more of a propulsion system 102 , an electrical system 104 , a hydraulic system 106 , and an environmental system 108 . any number of other systems may be included . although an aerospace example is shown , the principles of the invention may be applied to other industries , such as the automotive industry . the apparatus embodied herein may be employed during any one or more of the stages of the production and service method 78 . for example , components or subassemblies corresponding to production process 84 may be fabricated or manufactured in a manner similar to components or subassemblies produced while the aircraft 94 is in service . also , one or more apparatus embodiments may be utilized during the production stages 84 and 86 , for example , by substantially expediting assembly of or reducing the cost of an aircraft 94 . similarly , one or more apparatus embodiments may be utilized while the aircraft 94 is in service , for example and without limitation , to maintenance and service 92 . referring next to fig1 - 15 of the drawings , an induction forming apparatus which is suitable for implementation of the metal induction forming method is generally indicated by reference numeral 101 . the apparatus 101 may include a first die frame 102 and a second die frame 108 . a first tooling die 103 may be provided on the first die frame 102 , and a second tooling die 109 may be provided on the second die frame 108 . the first tooling die 103 and the second tooling die 109 may be hydraulically - actuated to facilitate movement of the first tooling die 103 and the second tooling die 109 toward and away from each other . the first tooling die 103 may have a first contoured die surface 104 , whereas the second tooling die 109 may have a second contoured die surface 110 which is complementary to the first contoured die surface 104 of the first tooling die 103 . as shown in fig1 , at least one set of induction coils 126 may extend through each of the first tooling die 103 ( and the second tooling die 9 , not shown ) to facilitate selective heating of the first tooling die 103 and the second tooling die 109 . in some embodiments , the induction coils 126 may be solenoid - shaped . a thermal control system 127 may be connected to the induction coils 126 . a first die susceptor 120 may be thermally coupled to the induction coils 126 of the first tooling die 103 . a second die susceptor 121 may be thermally coupled to the induction coils 126 of the second tooling die 109 . each of the first die susceptor 120 and the second die susceptor 121 may be a thermally - conductive material such as , but not limited to , a ferromagnetic material , cobalt , nickel , or compounds thereof . in some embodiments , each of the first die susceptor 120 and the second die susceptor 121 may be made of alloys including one or more of the ferromagnetic elements iron , nickel and cobalt plus other elements of lesser fractions such as molybdenum , chromium , vanadium and manganese , for example and without limitation . as shown in fig1 - 14 , the first die susceptor 120 may generally conform to the first contoured die surface 104 and the second die susceptor 121 may generally conform to the second contoured die surface 110 . as shown in fig1 - 14 , a cooling system 114 may be provided in each of the first tooling die 103 and the second tooling die 109 . the cooling system 114 may include , for example , coolant conduits 115 which have a selected distribution throughout each of the first tooling die 103 and the second tooling die 109 . as shown in fig1 , the coolant conduit 115 may be adapted to discharge a quenching medium 117 into the first tooling die 103 or the second tooling die 109 . the quenching medium 117 may be a liquid , gas or gas / liquid mixture which may be applied as a mist or aerosol , for example . in some applications , the quenching medium 117 may be water . each of the first tooling die 103 and the second tooling die 109 may each include multiple laminated metal sheets 128 such as stainless steel which are trimmed to the appropriate dimensions for the induction coils 126 . the stacked metal sheets 128 may be oriented in generally perpendicular relationship with respect to the induction coils 126 . an air gap ( not shown ) may be provided between adjacent stacked metal sheets 128 to facilitate cooling of the first tooling die 103 and the second tooling die 109 ( not shown ). the laminated metal sheets 128 may be attached to each other using clamps ( not shown ), fasteners ( not shown ) and / or other suitable technique known to those skilled in the art . the laminated metal sheets 28 may be selected based on their electrical and thermal properties and may be transparent to the magnetic field . an electrically insulating coating ( not shown ) may , optionally , be provided on each side of each laminated sheet 128 to prevent flow of electrical current between the laminated metal sheets 128 . the insulating coating may be a material such as ceramic , for example , or other high temperature resistant materials . however , if an air gap exists in between the stacked sheets , then no coating may be necessary . multiple thermal expansion slots ( not shown ) may be provided in each stacked sheet 128 to facilitate thermal expansion and contraction of the apparatus 101 . in typical implementation of the metal induction forming method , a metal plate 124 is initially positioned between the first tooling die 103 and the second tooling die 109 of the stacked tooling apparatus 101 , as shown in fig1 . in some applications , the metal plate 124 may be aluminum , magnesium or alloys thereof , for example and without limitation . the first tooling die 103 and the second tooling die 109 are next moved toward each other , as shown in fig1 , until the metal plate 124 is initially partially formed between the first die susceptor 120 and the second die susceptor 121 . once the cold forming limit of the metal plate 124 is reached , the induction coils 126 are energized to heat the first die susceptor 120 and the second die susceptor 121 to the induction forming temperature . in aluminum alloy applications , the induction forming temperature may be between about 900 ˜ 1000 degrees f . accordingly , the induction coils 126 heat the first die susceptor 120 and the second die susceptor 121 , which form or shape the metal sheet 124 to the contour of the first contoured die surface 104 and the second contoured die surface 110 . this step may also include the stamping / flow ( molding ) of material for thickness changes in portions of the metal sheet 124 in which thickness reducing and thickness increases are needed . as shown in fig1 , the cooling system 114 is next operated to apply the quenching medium 117 between the laminated sheets 128 of the first tooling die 103 and the second tooling die 109 and directly against the first die susceptor 120 and the second die susceptor 121 . therefore , the quenching medium 117 may impinge directly against the first die susceptor 120 and the second die susceptor 121 and actively and rapidly cool the first tooling die 3 and the second tooling die 109 as well as the first die susceptor 120 and the second die susceptor 121 . in turn , the first die susceptor 120 and the second die susceptor 121 quench the formed metal panel 132 sandwiched between the first die susceptor 120 and the second die susceptor 121 . the formed metal panel 132 may remain sandwiched between the first tooling die 103 and the second tooling die 10 for a predetermined period of time until complete cooling or quenching of the formed metal panel 132 has occurred . this may allow the formed metal panel 132 to retain the structural shape which is defined by the first contoured surface 104 and the second contoured surface 110 after the first tooling die 103 and the second tooling die 109 are opened , as shown in fig1 . once cooled to room temperature , the formed metal panel 132 may be removed from the apparatus 101 without loss of dimensional accuracy or stability of the formed metal panel 132 when it is cooled at an appropriate property - enhancing rate . the formed metal panel 132 may be subsequently aged to achieve maximum strength by any number of heating methods known to those skilled in the art . the first tooling die 103 and the second tooling die 109 may be made dimensionally thin and capable of being cooled at rates that enable the formed metal panel 132 to be solution treated . the method may have the capability to form complex components in addition to performing the solution treatment of these components in the same rapid thermal cycle . the process may use induction heating with smart susceptors in conjunction with laminate tooling designs to create a forming tool that exhibits very little thermal inertia and heats rapidly and exactly to optimum forming / solution - treatment temperatures for the various aluminum alloys ( between 900 f and 1000 f ). this same process may be used to form and heat - treat magnesium alloys . these components may have very complex geometries as enabled by the ability to use gas forming and also molded in changes in thickness due to the ability to mold in changes in materials thicknesses . therefore , high quality , complex , lightweight aluminum and magnesium near net shaped solution treated components may be fabricated rapidly and the needed dimensional control may still be achieved . a graph 136 which illustrates the effect of susceptor thickness on quenching rates of the shaped metal panel is shown in fig1 . the elapsed time after quenching water is turned on ( in seconds ) is plotted along the x - axis 137 . the temperature of the metal sheet mid - plane ( degrees c .) is plotted along the y - axis 138 . a graph 142 which illustrates the required cooling rates needed to meet full alloy strength potentials is shown in fig1 . typical heat treatment response of standard aluminum alloys given quenching rates shows that for thinner susceptors , adequate quenching for most alloys is attainable . referring next to fig1 , a block diagram 1800 which illustrates an exemplary metal forming induction method is shown . in block 1802 , an induction forming apparatus comprising a first tooling die and a second tooling die may be provided . in block 1804 , a metal sheet may be placed between the first tooling die and the second tooling die . in some applications , the metal sheet may be aluminum , magnesium or alloys thereof . in block 1806 , the first tooling die and the second tooling die may be moved into contact with the metal sheet . in block 1808 , the first tooling die and the second tooling die may be heated once the cold forming limit of the first tooling die and the second tooling die has been reached . in block 1810 , forming or shaping of the metal sheet may be completed . in block 1812 , the resulting formed metal panel may be quenched by cooling the first tooling die and the second tooling die . the first tooling die and the second tooling die may be cooled by spraying a quenching medium against the first tooling die and the second tooling die . in some applications , the quenching medium may be water . in block 1814 , the formed metal panel is removed from between the first tooling die and the second tooling die . in block 1816 , in some embodiments the panel may be subjected to pressurized gas forming which follows hot die forming . this may enable a die design that need not be as exacting but can also leverage the speed and thinning pattern attributed to hot matched die forming ( opposite that of hot forming ). referring next to fig1 , a flow diagram 1900 which illustrates an exemplary thixoforming process is shown . the process 1900 may be suitable for large thixoforming operations using thoxitropic blocks as the starting material . the process 1900 may be particularly suitable for magnesium due to the difficulty in producing sheet materials with magnesium . in block 1902 , a thixotropic bar of aluminum or magnesium may be loaded into a cold die . in block 1904 , the tooling surface and the thixotropic bar workpiece may be rapidly heated to facilitate flowing of the workpiece and enable formation of a large thin structure in block 1906 . in block 1908 , the tooling surface and the structure may be cooled . in block 1910 , the formed structure may be removed from the die . although the embodiments of this disclosure have been described with respect to certain exemplary embodiments , it is to be understood that the specific embodiments are for purposes of illustration and not limitation , as other variations will occur to those of skill in the art .	1
as foreshadowed above , the present invention minimizes corrosion of corrodible structures in inkjet printheads which are exposed to certain dye - based inks . the corrodible structures are typically silicon nitride , bpsg and , to a lesser extent , silicon oxide . initially , the present applicant observed print defects in certain color channels of its inkjet printheads , most noticeably in black color channels . forensic examination of such printheads using sem microscopy revealed that a degree of roof delamination was occurring and it was posited that the dye - based ink was responsible for corroding silicon nitride structures in the nozzle chamber . significantly , in printheads having a bilayered roof ( an upper layer of silicon oxide and a lower layer of silicon nitride ), the corrosion was most evident in the silicon nitride layer . silicon surfaces in the printhead were observed to be resistant to corrosion by the dye - based inks . following these observations , the applicant conducted a comprehensive series of experiments in order to elucidate more fully the nature of the corrosion and to find possible solutions to this problem . to this end , silicon nitride coupons were fabricated having a layer of silicon nitride deposited onto a blanket silicon substrate . the thickness of silicon nitride was accurately measured before and after soaks tests in various ink formulations using a uv interferometer . in this way , the corrosiveness of a range ink formulations towards silicon nitride could be determined . it was found that the rate of corrosion was strongly dependent on the particular ink formulation . those inks containing potassium salts of sulfonate groups ( e . g . food black 2 ) were found to be highly corrosive . corresponding sodium salts were still corrosive but to a lesser extent than potassium salts . these observations were broadly consistent with sem observations on actual printheads . initial experiments showed that aluminium additives in the ink ( e . g . aluminium nitrate nonahydrate , alumina , elemental aluminium etc .) were remarkably effective in suppressing silicon nitride corrosion in otherwise highly corrosive inks . in many cases , even at very low concentrations ( e . g . 10 ppm ), the aluminium additive was highly effective in suppressing corrosion of silicon nitride therefore , it was concluded that treatment of dye - based inks with a small concentration of an aluminium additive ( e . g . aluminium nitrate nonahydrate ) was an effective method of minimizing the roof delamination observed in the applicant &# 39 ; s printheads . iron additives in the form of soluble iron ( iii ) salts were also shown to reduce the rates of silicon nitride corrosion , although aluminium additives were generally more effective in most inks . combinations of aluminium and iron additives were , likewise , effective in suppressing silicon nitride corrosion . it was further observed that the corrosive effects of ‘ untreated ’ inks could be suppressed merely by exposing these inks to an aluminium metal surface . presumably , a trace amount of an aluminium additive is infused into the ink by the aluminium surface , which is sufficient to suppress corrosion of silicon nitride . these observations have important implications for the design of inkjet printers . if an aluminium metal surface is incorporated into the ink pathway upstream of the printhead , then untreated inks may be used in the applicant &# 39 ; s printers without corroding silicon nitride structures therein . it will be appreciated that an aluminium surface may be readily incorporated anywhere into the ink pathway , for example , in ink cartridges , ink lines , filters , pressure - regulating chambers or even the printhead itself . with the silicon nitride corrosion results in hand , the applicant then investigated another known failure mechanism in its inkjet printheads — that is , corrosion of a bpsg layer in the cmos layers . during the course of printhead testing , it had become evident from sem microscopy that an exposed edge region of a bpsg layer was corroded and led to electrical failure once ink was allowed to reach cmos metal layer ( s ). accordingly , bpsg test coupons were fabricated by analogy with the silicon nitride coupons described above . a layer of bpsg was deposited onto a blanket silicon substrate and the thickness of bpsg layer was accurately measured before and after soaks tests in various ink formulations using a uv interferometer . in this way , the corrosiveness of a range ink formulations towards bpsg could be determined . once again , it was found that the rate of corrosion of bpsg was strongly dependent on the particular ink formulation . those inks containing potassium salts of sulfonate groups were found to be highly corrosive . on the other hand , inks having a metal counterion which formed relatively insoluble phosphates ( e . g . lithium ) were found to be much less corrosive . in virtually all cases , the addition of an aluminium and / or iron additive ( in the form of a soluble al ( iii ) or fe ( iii ) salt ) was effective in suppressing the bpsg corrosion . other metal additives , such as copper , bismuth , magnesium and silver salts were also shown to reduce the rate of bpsg corrosion . typically , in order to suppress a rate of bpsg corrosion the metal additive comprises one or more metals wherein the metal has a corresponding metal phosphate solubility of less than 1 gram per liter . the most effective metals for suppressing bpsg corrosion rates had a corresponding metal phosphate solubility of less than 10 − 5 grams per liter . the applicant &# 39 ; s studies have shown that silicon oxide appears to corrode at a relatively slower rate than either silicon nitride or bpsg . nevertheless , silicon oxide structures are still somewhat corrodible upon prolonged exposure to certain dye - based inks and it has been found , through suitable silicon oxide coupon testing , that this relatively slow corrosion can also be suppressed using the metal additives describe above . a detailed description of the applicant &# 39 ; s experiments demonstrating the effects of the present invention are presented in the experimental section hereinbelow . the inkjet inks described herein minimize corrosion of exposed corrodible structures in inkjet printheads . there now follows a brief description of some examples of inkjet printheads , which incorporate such corrodible structures . referring to fig1 , there is shown part of printhead comprising a plurality of nozzle assemblies as described in u . s . pat . no . 7 , 303 , 930 , the contents of which is herein incorporated by reference . fig2 and 3 show one of these nozzle assemblies in side - section and cutaway perspective views . each nozzle assembly comprises a nozzle chamber 24 formed by mems fabrication techniques on a silicon wafer substrate 2 . the nozzle chamber 24 is defined by a roof 21 and sidewalls 22 which extend from the roof 21 towards the silicon substrate 2 . as shown in fig1 , each roof is defined by part of a nozzle plate 56 , which spans across an ejection face of the printhead . the nozzle plate 56 and sidewalls 22 are formed of the same material , which is deposited by pecvd over a sacrificial scaffold of photoresist during mems fabrication . the nozzle plate 56 and sidewalls 21 are formed only of silicon nitride in the printhead shown in fig1 to 3 . silicon nitride is chosen , because it is readily deposited by pecvd and has the characteristics of hardness , robustness and resistance to cracking . moreover , the inherently relative hydrophilic nature of silicon nitride is advantageous for supplying ink to the nozzle chambers 24 by capillary action . however , sem microscopy has revealed corrosion of these silicon nitride structures in some color channels of used printheads . returning to the details of the nozzle chamber 24 , it will be seen that a nozzle opening 26 is defined in a roof of each nozzle chamber 24 . each nozzle opening 26 is generally elliptical and has an associated nozzle rim 25 . the nozzle rim 25 assists with drop directionality during printing as well as reducing , at least to some extent , ink flooding from the nozzle opening 26 . the actuator for ejecting ink from the nozzle chamber 24 is a heater element 29 positioned beneath the nozzle opening 26 and suspended across a pit 8 . current is supplied to the heater element 29 via electrodes defined by an exposed region of a metal 4 cmos layer 9 a . in these regions , the metal 4 cmos layer 9 a is exposed through a passivation layer 10 covering the underlying cmos layers . the pit 8 is defined in a cvd oxide layer 5 positioned beneath the uppermost metal 4 cmos layer 9 a . when a current is passed through the heater element 29 , it rapidly superheats surrounding ink to form a gas bubble , which forces ink through the nozzle opening 26 . by suspending the heater element 29 , it is completely immersed in ink when the nozzle chamber 24 is primed . this improves printhead efficiency , because less heat dissipates into the underlying substrate 2 and more input energy is used to generate a bubble . as seen most clearly in fig1 , the nozzles are arranged in rows and an ink supply channel 27 , which extends longitudinally along the row , supplies ink to each nozzle in the row . the ink supply channel 27 delivers ink to an ink inlet passage 15 , which , in turn , supplies ink to an ink conduit 23 extending parallel with the nozzle rows . the ink conduit 23 supplies ink into a side of each nozzle chamber 24 . returning to fig2 and 3 , the ink inlet passage 15 is defined by an opening through the cmos layers and an upper portion of the silicon substrate 2 . the cmos layers are comprised of a lower bpsg layer 11 and four metal layers 9 a , 9 b , 9 c , 9 d which are separated from each other by dielectric cvd oxide layers 5 . it will be noted that the bpsg layer 11 and the cvd oxide layers 5 have edge portions defining sidewalls of the ink inlet passage 15 . hence , these layers define potentially corrodible structures which are exposed to ink flowing through the ink inlet passage 15 . sem microscopy of used printheads has revealed notches in the bpsg layer 11 as a result of corrosion ; these notches can eventually grow to expose the metal 1 cmos layer 9 d , resulting in printhead failure . the mems fabrication process for manufacturing such printheads was described in detail in u . s . pat . no . 7 , 303 , 930 , the contents of which are herein incorporated by reference . the operation of printheads having suspended heater elements is described in detail in the applicant &# 39 ; s u . s . pat . no . 7 , 278 , 717 , the contents of which are incorporated herein by reference . the applicant has also described thermal bubble - forming inkjet printheads having embedded heater elements . such printheads are described in , for example , u . s . pat . no . 7 , 246 , 876 and us 2006 / 0250453 , the contents of which are herein incorporated by reference . it will be appreciated that the advantages of the present invention are realized irrespective of whether the heater element is suspended or embedded in the nozzle chamber . referring to fig4 , there is shown a printhead having a bilayered nozzle plate . a lower layer 101 a of the nozzle plate is comprised of silicon nitride and an upper layer 101 b of the nozzle plate is comprised of silicon oxide . all other features of the printhead shown in fig4 are the same as the printhead shown in fig1 , and it will be appreciated that all like structures have been given the same reference numerals in fig1 to 4 . the fabrication and advantages of printheads having a bilayered nozzle plate are described in u . s . pat . no . 7 , 658 , 977 , the contents of which are herein incorporated by reference . however , when the printhead shown in fig4 is exposed to certain dye - based inks , a degree of roof delamination is observed due to corrosion of the silicon nitride layer 101 a in the uppermost corners of each nozzle chamber . referring to fig5 , there is shown a nozzle assembly 100 for a thermal bend - actuated printhead , as described in us 2011 / 0050806 , the contents of which is incorporated herein by reference . the nozzle assembly 100 is comprised of a substrate 101 having electrodes 102 formed in an upper portion thereof ( for clarity , the cmos layers and passivation layer are not shown in fig5 ). the electrode 102 shown in fig5 is one of a pair of adjacent electrodes ( positive and earth ) for supplying power to a thermoelastic active beam 110 disposed on a roof of the nozzle chamber 105 via connector posts 108 . the connector posts 108 extend linearly between the electrodes 102 and the active beam 110 , and the electrodes receive power from cmos drive circuitry ( not shown ) in upper layers of the substrate 101 . the connector posts 108 are encased in sidewalls 104 of the nozzle chamber 105 . the sidewalls may be comprised of silicon oxide or silicon nitride . as shown in fig5 , the sidewalls are comprised of silicon nitride . a bilayered roof of the nozzle chamber 105 is comprised of a lower layer of silicon nitride 107 and an upper layer of silicon oxide 106 . part of the roof defines a passive beam 116 for the thermoelastic beam 110 disposed on the roof ( see fig6 ). the thermoelastic beam 110 and bilayered passive beam 116 together define a thermal bend actuator . upon actuation , the thermoelastic beam 110 expands relative to the passive beam 116 causing a moveable part of the roof to bend towards the substrate 110 resulting in ejection of ink from the nozzle opening 113 . silicon nitride is employed in the passive beam 116 , because it is less susceptible to cracking than silicon oxide and allows a greater range of residual stresses — both compressive and tensile stresses . furthermore , silicon nitride is completely impermeable , which minimizes nozzle failure via leaching of ions from ink in the nozzle chamber to the active beam 110 . since silicon nitride has a much higher thermal conductivity than silicon oxide , the passive beam 116 employs an insulating layer of silicon oxide between the silicon nitride and the thermoelastic active beam 110 . however , it will be appreciated that the exposed silicon nitride layer in the passive beam 116 is potentially corrodible by certain dye - based inks as described herein . the thermoelastic active beam member 110 may be comprised of any suitable thermoelastic material , such as titanium nitride , titanium aluminium nitride or aluminium alloys . as explained in the applicant &# 39 ; s earlier us publication no . 2008 / 0129793 ( the contents of which are herein incorporated by reference ), vanadium - aluminium alloys are a preferred material , because they combine the advantageous properties of high thermal expansion , low density and high young &# 39 ; s modulus . still referring to fig5 , a polymer coating 80 covers the roof of the nozzle assembly 100 . the polymer coating 80 extends over the entire nozzle plate of the printhead and provides a hydrophobic ink ejection surface . the polymer layer 80 also fills a perimeter region around a moveable part of the roof to provide a mechanical seal for the moveable part of the roof . the polymer has a sufficiently low young &# 39 ; s modulus to allow the actuator to bend towards the substrate 101 during actuation . the polymer coating 80 is typically comprised of a polymerized siloxane , which may be deposited in a thin layer ( e . g . 0 . 5 to 2 . 0 microns ) using a spin - on process . examples of suitable polymeric materials are poly ( alkylsilsesquioxanes ), such as poly ( methylsilsesquioxane ); poly ( arylsilsesquioxanes ), such as poly ( phenylsilsesquioxane ); and poly ( dialkylsiloxanes ), such as a polydimethylsiloxane . it will be appreciated that the printheads described in connection with fig1 to 4 may comprise a polymer coating 80 to provide a desirably hydrophobic ink ejection surface . although the present invention has been developed for use in some of the applicant &# 39 ; s mems inkjet printheads , as described above , it will be appreciated that the invention is not so limited in scope . piezoelectric printheads may include corrodible structures ( e . g . silicon nitride , bpsg ) and the present invention is equally applicable to such printheads . an example of a piezo printhead incorporating an exposed silicon nitride surface is described in u . s . pat . no . 4 , 992 , 808 , assigned to xaar limited . other microfluidic devices , such as lab - on - a - chip devices useful for the analysis of biological fluids , may also include silicon nitride or bpsg structures . it will be appreciated that such devices will also benefit from the methods of minimizing corrosion described herein . by way of example , the applicant &# 39 ; s microfluidic devices described in u . s . pat . no . 7 , 887 , 756 , the contents of which are herein incorporated by reference , may comprise exposed silicon nitride surfaces . the inks employed in connection with the present invention typically comprise 0 . 01 - 25 wt . % of a dye , a metal additive additive and an ink vehicle as the balance . the amount of metal additive may vary depending on the type of additive present . for example , soluble trivalent aluminium may be present in an amount ranging from 0 . 01 to 200 ppm . on the other hand , insoluble metal additives ( e . g . alumina particles , elemental aluminium particles etc ) may be present in the ink in larger amounts as described herein . inkjet dyes will be well - known to the person skilled in the art and the present invention is not limited to any particular type of dye . by way of example , dyes suitable for use in the present invention include azo dyes ( e . g . food black 2 ), metal complex dyes , naphthol dyes , anthraquinone dyes , indigo dyes , carbonium dyes , quinone - imine dyes , xanthene dyes , cyanine dyes , quinoline dyes , nitro dyes , nitroso dyes , benzoquinone dyes , naphthoquinone dyes , phthalocyanine dyes ( including naphthalocyanine dyes ), and metal phthalocyanine dyes ( including metal naphthalocyanine dyes , such as those described in u . s . pat . no . 7 , 148 , 345 , the contents of which is herein incorporated by reference ). examples of suitable dyes include : ci direct black 4 , 9 , 11 , 17 , 19 , 22 , 32 , 80 , 151 , 154 , 168 , 171 , 194 and 195 ; ci direct blue 1 , 2 , 6 , 8 , 22 , 34 , 70 , 71 , 76 , 78 , 86 , 142 , 199 , 200 , 201 , 202 , 203 , 207 , 218 , 236 and 287 ; ci direct red 1 , 2 , 4 , 8 , 9 , 11 , 13 , 15 , 20 , 28 , 31 , 33 , 37 , 39 , 51 , 59 , 62 , 63 , 73 , 75 , 80 , 81 , 83 , 87 , 90 , 94 , 95 , 99 , 101 , 110 , 189 , 225 and 227 ; ci direct yellow 1 , 2 , 4 , 8 , 11 , 12 , 26 , 27 , 28 , 33 , 34 , 41 , 44 , 48 , 86 , 87 , 88 , 132 , 135 , 142 and 144 ; ci food black 1 and 2 ; ci acid black 1 , 2 , 7 , 16 , 24 , 26 , 28 , 31 , 48 , 52 , 63 , 107 , 112 , 118 , 119 , 121 , 172 , 194 and 208 ; ci acid red 4 , 14 , 18 , 23 , 27 , 73 , 87 , 88 , 114 , 131 , 138 , 151 ; ci acid blue 1 , 7 , 9 , 15 , 22 , 23 , 27 , 29 , 40 , 43 , 55 , 59 , 62 , 78 , 80 , 81 , 90 , 102 , 104 , 111 , 185 and 254 ; ci acid yellow 1 , 3 , 4 , 7 , 11 , 12 , 13 , 14 , 19 , 23 , 25 , 34 , 38 , 41 , 42 , 44 , 53 , 55 , 61 , 71 , 76 and 79 ; ci reactive blue 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 13 , 14 , 15 , 17 , 18 , 19 , 20 , 21 , 25 , 26 , 27 , 28 , 29 , 31 , 32 , 33 , 34 , 37 , 38 , 39 , 40 , 41 , 43 , 44 and 46 ; ci reactive red 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 11 , 12 , 13 , 15 , 16 , 17 , 19 , 20 , 21 , 22 , 23 , 24 , 28 , 29 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 49 , 50 , 58 , 59 , 63 , 64 , and 180 ; ci reactive yellow 1 , 2 , 3 , 4 , 6 7 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 22 , 23 , 24 , 25 , 26 , 27 , 37 and 42 ; ci reactive black 1 , 3 , 4 , 5 , 6 , 8 , 9 , 10 , 12 , 13 , 14 and 18 ; pro - jet ® dyes available from fuji film imaging colorants , inc . ( e . g . pro - jet ® cyan 1 ; pro - jet ® cyan glf ; pro - jet ® fast cyan 2 ; pro - jet ® fast black 1 ; pro - jet ® fast black 2 ; pro - jet ® black 168 ; pro - jet ® magenta 1 ; pro - jet ® magenta 432 ; pro - jet ® fast magenta 2 ; pro - jet ® violet 631 ; pro - jet ® yellow 1 ; pro - jet ® fast yellow 2 ; pro - jet ® yellow 1g ; pro - jet ® yellow 746 ; and pro - jet ® yellow 492 ). the present invention is particularly efficacious when used in connection with sodium or potassium salts of sulfonated dyes ( e . g . food black 2 ). such dyes , and potassium salts in particular , have been shown to be very aggressive towards exposed corrodible structures in the printhead , such as silicon nitride nozzle roofs and the bpsg layer in cmos . ink vehicles for inkjet inks will be well known to the person skilled in the art and the ink vehicles used in the present invention are not particularly limited . the present applicant has recently described non - aqueous inkjet inks for thermal inkjet printheads ( see u . s . application ser . no . 12 / 577 , 517 filed on sep . 11 , 2009 , the contents of which are herein incorporated by reference ), and such non - aqueous inks are also within the ambit of some aspects of the present invention . non - aqueous ink vehicles for use in thermal inkjets typically comprise a n —( c 1 - 6 alkyl )- 2 - pyrrolidinone ( e . g . n - methyl - 2 - pyrrolidinone ) and a c 1 - 6 alcohol ( e . g . ethanol ). however , the ink vehicles used in the present invention are typically conventional aqueous ink vehicles comprising at least 40 wt % water , at least 50 wt % water or at least 60 wt % water . usually , the amount of water present in the inkjet ink is in the range of 50 wt % to 90 wt %, or optionally in the range of 60 wt % to 80 wt %. aqueous inkjet inks compositions are well known in the literature and , in addition to water , may comprise other components , such as co - solvents ( including humectants , penetrants , wetting agents etc . ), surfactants , biocides , sequestering agents , ph adjusters , viscosity modifiers , etc . co - solvents are typically water - soluble organic solvents . suitable water - soluble organic solvents include c 1 - 4 alkyl alcohols , such as ethanol , methanol , butanol , propanol , and 2 - propanol ; glycol ethers , such as ethylene glycol monomethyl ether , ethylene glycol monoethyl ether , ethylene glycol monobutyl ether , ethylene glycol monomethyl ether acetate , diethylene glycol monomethyl ether , diethylene glycol monoethyl ether , diethylene glycol mono - n - propyl ether , ethylene glycol mono - isopropyl ether , diethylene glycol mono - isopropyl ether , ethylene glycol mono - n - butyl ether , diethylene glycol mono - n - butyl ether , triethylene glycol mono - n - butyl ether , ethylene glycol mono - t - butyl ether , diethylene glycol mono - t - butyl ether , 1 - methyl - 1 - methoxybutanol , propylene glycol monomethyl ether , propylene glycol monoethyl ether , propylene glycol mono - t - butyl ether , propylene glycol mono - n - propyl ether , propylene glycol mono - isopropyl ether , dipropylene glycol monomethyl ether , dipropylene glycol monoethyl ether , dipropylene glycol mono - n - propyl ether , dipropylene glycol mono - isopropyl ether , propylene glycol mono - n - butyl ether , and dipropylene glycol mono - n - butyl ether ; formamide , acetamide , dimethyl sulfoxide , sorbitol , sorbitan , glycerol monoacetate , glycerol diacetate , glycerol triacetate , and sulfolane ; or combinations thereof . other useful water - soluble organic solvents , which may be used as co - solvents , include polar solvents , such as 2 - pyrrolidone , n - methylpyrrolidone , ε - caprolactam , dimethyl sulfoxide , sulfolane , morpholine , n - ethylmorpholine , 1 , 3 - dimethyl - 2 - imidazolidinone and combinations thereof . the inkjet ink may contain a high - boiling water - soluble organic solvent as a co - solvent , which can serve as a wetting agent or humectant for imparting water retentivity and wetting properties to the ink composition . such a high - boiling water - soluble organic solvent includes one having a boiling point of 180 ° c . or higher . examples of the water - soluble organic solvent having a boiling point of 180 ° c . or higher are ethylene glycol , propylene glycol , diethylene glycol , pentamethylene glycol , trimethylene glycol , 2 - butene - 1 , 4 - diol , 2 - ethyl - 1 , 3 - hexanediol , 2 - methyl - 2 , 4 - pentanediol , tripropylene glycol monomethyl ether , dipropylene glycol monoethyl glycol , dipropylene glycol monoethyl ether , dipropylene glycol monomethyl ether , dipropylene glycol , triethylene glycol monomethyl ether , tetraethylene glycol , triethylene glycol , diethylene glycol monobutyl ether , diethylene glycol monoethyl ether , diethylene glycol monomethyl ether , tripropylene glycol , polyethylene glycols having molecular weights of 2000 or lower , 1 , 3 - propylene glycol , isopropylene glycol , isobutylene glycol , 1 , 4 - butanediol , 1 , 3 - butanediol , 1 , 5 - pentanediol , 1 , 6 - hexanediol , glycerol , erythritol , pentaerythritol and combinations thereof . other suitable wetting agents or humectants include saccharides ( including monosaccharides , oligosaccharides and polysaccharides ) and derivatives thereof ( e . g . maltitol , sorbitol , xylitol , hyaluronic salts , aldonic acids , uronic acids etc .) the inkjet ink may also contain a penetrant , as one of the co - solvents , for accelerating penetration of the aqueous ink into the recording medium . suitable penetrants include polyhydric alcohol alkyl ethers ( glycol ethers ) and / or 1 , 2 - alkyldiols . examples of suitable polyhydric alcohol alkyl ethers are ethylene glycol monomethyl ether , ethylene glycol monoethyl ether , ethylene glycol monobutyl ether , ethylene glycol monomethyl ether acetate , diethylene glycol monomethyl ether , diethylene glycol monoethyl ether , ethylene glycol mono - n - propyl ether , ethylene glycol mono - isopropyl ether , diethylene glycol mono - isopropyl ether , ethylene glycol mono - n - butyl ether , diethylene glycol mono - n - butyl ether , triethylene glycol mono - n - butyl ether , ethylene glycol mono - t - butyl ether , diethylene glycol mono - t - butyl ether , 1 - methyl - 1 - methoxybutanol , propylene glycol monomethyl ether , propylene glycol monoethyl ether , propylene glycol mono - t - butyl ether , propylene glycol mono - n - propyl ether , propylene glycol mono - isopropyl ether , dipropylene glycol monomethyl ether , dipropylene glycol monoethyl ether , dipropylene glycol mono - n - propyl ether , dipropylene glycol mono - isopropyl ether , propylene glycol mono - n - butyl ether , and dipropylene glycol mono - n - butyl ether . examples of suitable 1 , 2 - alkyldiols are 1 , 2 - pentanediol and 1 , 2 - hexanediol . the penetrant may also be selected from straight - chain hydrocarbon diols , such as 1 , 3 - propanediol , 1 , 4 - butanediol , 1 , 5 - pentanediol , 1 , 6 - hexanediol , 1 , 7 - heptanediol , and 1 , 8 - octanediol . glycerol may also be used as a penetrant . typically , the amount of co - solvent present in the ink is in the range of about 5 wt % to 40 wt %, or optionally 10 wt % to 30 wt %. a specific example of a co - solvent system , which may be used in the present invention , comprises ethylene glycol , 2 - pyrrolidone and glycerol . the inkjet ink may also contain one or more surface active agents (“ surfactant ”), such as an anionic surface active agent , a zwitterionic surface active agent , a nonionic surface active agent or mixtures thereof . useful anionic surface active agents include sulfonic acid types , such as alkanesulfonic acid salts , α - olefinsulfonic acid salts , alkylbenzenesulfonic acid salts , alkylnaphthalcncsulfonic acids , acylmethyltaurincs , and dialkylsulfosuccinic acids ; alkylsulfuric ester salts , sulfated oils , sulfated olefins , polyoxyethylene alkyl ether sulfuric ester salts ; carboxylic acid types , e . g ., fatty acid salts and alkylsarcosine salts ; and phosphoric acid ester types , such as alkylphosphoric ester salts , polyoxyethylene alkyl ether phosphoric ester salts , and glycerophosphoric ester salts . specific examples of the anionic surface active agents are sodium dodecylbenzenesulfonate , sodium laurate , and a polyoxyethylene alkyl ether sulfate ammonium salt . examples of zwitterionic surface active agents include n , n - dimethyl - n - octyl amine oxide , n , n - dimethyl - n - dodecyl amine oxide , n , n - dimethyl - n - tetradecyl amine oxide , n , n - dimethyl - n - hexadecyl amine oxide , n , n - dimethyl - n - octadecyl amine oxide and n , n - dimethyl - n —( z - 9 - octadecenyl )- n - amine oxide . examples of nonionic surface active agents include ethylene oxide adduct types , such as polyoxyethylene alkyl ethers , polyoxyethylene alkylphenyl ethers , polyoxyethylene alkyl esters , and polyoxyethylene alkylamides ; polyol ester types , such as glycerol alkyl esters , sorbitan alkyl esters , and sugar alkyl esters ; polyether types , such as polyhydric alcohol alkyl ethers ; and alkanolamide types , such as alkanolamine fatty acid amides . specific examples of nonionic surface active agents are ethers such as polyoxyethylene nonylphenyl ether , polyoxyethylene octylphenyl ether , polyoxyethylene dodecylphenyl ether , polyoxyethylene alkylallyl ether , polyoxyethylene oleyl ether , polyoxyethylene lauryl ether , and polyoxyalkylene alkyl ethers ( e . g . polyoxyethylene alkyl ethers ); and esters , such as polyoxyethylene oleate , polyoxyethylene oleate ester , polyoxyethylene distearate , sorbitan laurate , sorbitan monostearate , sorbitan mono - oleate , sorbitan sesquioleate , polyoxyethylene mono - oleate , and polyoxyethylene stearate . acetylene glycol surface active agents , such as 2 , 4 , 7 , 9 - tetramethyl - 5 - decyne - 4 , 7 - diol ; ethoxylated 2 , 4 , 7 , 9 - tetramethyl - 5 - decyne - 4 , 7 - diol ; 3 , 6 - dimethyl - 4 - octyne - 3 , 6 - diol or 3 , 5 - dimethyl - 1 - hexyn - 3 - ol , may also be used . specific examples of nonionic surfactants , which may be used in the present invention , are surfynol ® 465 and surfynol ® 440 ( available from air products and chemicals , inc ) the surfactant ( s ) are typically present in the aqueous inkjet ink in an amount ranging from 0 . 1 wt % to 10 wt %, or optionally in the range of 0 . 2 wt % to 5 wt %. the aqueous inkjet ink may also include a ph adjuster or buffer , such as sodium hydroxide , potassium hydroxide , lithium hydroxide , sodium carbonate , sodium hydrogencarbonate , potassium carbonate , potassium hydrogencarbonate , lithium carbonate , sodium phosphate , potassium phosphate , lithium phosphate , potassium dihydrogenphosphate , dipotassium hydrogenphosphate , sodium oxalate , potassium oxalate , lithium oxalate , sodium borate , sodium tetraborate , potassium hydrogenphthalate , and potassium hydrogentartrate ; ammonia ; and amines , such as methylamine , ethylamine , diethylamine , trimethylamine , triethylamine , tris ( hydroxymethyl ) aminomethane hydrochloride , triethanolamine , diethanolamine , diethylethanolamine , triisopropanolamine , butyldiethanolamine , morpholine , propanolamine , 4 - morpholineethanesulfonic acid and 4 - morpholinepropanesulfonic acid . the ph adjuster or buffer may be present in the aqueous inkjet ink in an amount ranging from 0 . 01 to 5 wt . %, or optionally 0 . 05 to 1 wt . %. the aqueous inkjet ink may also include a biocide , such as benzoic acid , dichlorophene , hexachlorophene , sorbic acid , hydroxybenzoic esters , sodium dehydroacetate , 1 , 2 - benthiazolin - 3 - one (“ proxel ® gxl ”, available from arch chemicals , inc . ), 3 , 4 - isothiazolin - 3 - one or 4 , 4 - dimethyloxazolidine . the biocide may be present in the aqueous inkjet ink in an amount ranging from 0 . 01 to 5 wt . %, or optionally 0 . 05 to 1 wt . %. the aqueous inkjet ink may also contain a sequestering agent , such as ethylenediaminetetraacetic acid ( edta ). the sequestering agent may be present in the aqueous inkjet ink in an amount ranging from 0 . 01 to 5 wt . %, or optionally 0 . 05 to 1 wt . %. the following experiments demonstrate the corrosiveness of certain dye - based inks with respect to silicon nitride , bpsg and silicon oxide . the experiments further demonstrate the advantageous effects of metal additives in suppressing this corrosion . silicon nitride of the exact composition , formulation and thickness of a typical printhead roof structure was deposited onto blanket silicon wafers without an oxide overcoat . the wafer was diced into 10 mm × 10 mm coupons and each was rinsed with di water and ethanol then dried with compressed air . the thickness of the nitride layer was measured precisely three times at the centre of each coupon using a nanometrics 210 uv interferometer film thickness system . a refractive index of 2 . 00 was used for all measurements and typically a consistent value of within +/− 10 angstroms was recorded . coupons were placed with the nitride layer uppermost in a soak vessel into which was carefully added 20 g of test fluid . the soak vessels were made of plastic ( polystyrene sample jars ), because initial experiments using soda glass jars and scintiallation vials gave appreciable background corrosion rates , even with deionized water . ensuring the tile remained face up , the vessel was sealed and placed in an oven at 70 ° c . after a period of time , typically ˜ 100 hrs , the vessels were removed from the oven and cooled to room temperature . the coupons were retrieved , rinsed with di water and ethanol then dried with compressed air . the thickness of the nitride layer at the centre of the coupon was again measured precisely three times using the same interferometer . differences in film thicknesses were calculated and a corrosion rate , expressed in angstroms per hour , was obtained by dividing the average thickness of the film lost by the duration of the soak test in hours . the corrosion rate for three coupons was measured for each fluid of interest . for tests requiring aluminium , squares of 0 . 3 mm thick aluminium foil measuring 10 mm × 10 mm were placed in the vessel close to the coupon . initially , a range of colored ink formulations were tested for their silicon nitride corrosion rates . the inks had the following formulations : all inks formulated had a ph in the range of 6 - 8 . all dyes contained a mixture counterions , which include sodium and potassium ions . table 1 shows the corrosion rates for the five inks tested . deionized water ( diw ) was also tested by way of a control . from table 1 , it can be seen that black ink 1 , cyan ink 1 and black ink 2 are the most corrosive towards silicon nitride . yellow ink 1 had a moderate corrosion rate while the magenta ink and deionized water did not corrode silicon nitride by any appreciable amount . these results were broadly consistent with sem observations of printheads , in which cyan and black ink channels appeared to show the most corrosion of the silicon nitride roof layer . the effect of ph on silicon nitride corrosion rates was investigated . accordingly , the black ink and deionized water were tested at ph10 ( by the addition of ammonium hydroxide ) and ph1 ( by the addition of hydrochloric acid ). table 2 shows the corrosions rates at these extreme phs ( test nos . 1 and 6 from table 1 have been included for comparison ). as expected , the high ph test fluids were very corrosive towards silicon nitride whereas the low ph test fluids were not corrosive at all . table 3 shows the corrosions rates for black ink 1 spiked with varying amounts of aluminium by the addition of water - soluble aluminium nitrate nonahydrate ( test no . 1 from table 1 has been included for comparison ). as can be seen from the data in table 1 , the addition of soluble trivalent aluminium ions to black ink 1 surprisingly produces a dramatic effect in reducing the corrosion rate of silicon nitride . at an al concentration of 1 ppm or more , corrosion of silicon nitride is completely inhibited . even at lower concentrations of al , the rate of corrosion is markedly diminished . with this positive result using black ink 1 , the other colored inks described above were tested to investigate the effects of adding aluminium nitrate nonahydrate on corrosion rates . table 4 shows the test results for cyan , magenta and yellow inks ( test nos . 2 , 3 and 4 from table 1 have been included for comparison ). as evidenced by the data in table 5 , the corrosiveness of all inks tested was minimized by the addition of relatively small quantities of aluminium . the effect of aluminium nitrate spiking was also investigated on the particularly corrosive black ink 2 . hitherto , black ink 2 had been considered as potentially too corrosive towards silicon nitride to be used in printheads . table 5 shows the test results for black ink 2 , both untreated and spiked with aluminium nitrate nonahydrate . although , compared to other inks tested , higher quantities of aluminium were required in order to fully inhibit silicon nitride corrosion , table 5 demonstrates the effectiveness of aluminium spiking even in highly corrosive inks given the positive results from al ( iii ), it was anticipated that other al ( iii ) sources would be effective in reducing the rate of silicon nitride corrosion . alternative al ( iii ) sources include common alum and aluminium sulfate . other al ( iii ) sources will be readily apparent to the person skilled in the art . soluble borax ( sodium tetraborate decahydrate ), insoluble alumina and soluble iron were investigated as alternative additives for inhibiting corrosion of silicon nitride . the test results for borax , alumina and iron are shown in tables 6 , 7 and 8 , respectively . ( test nos . 1 , 2 and 5 from table 1 have been included for comparison , where appropriate ). table 8 demonstrates that fe ( iii ) is effective in suppressing silicon nitride corrosion , irrespective of the iron salt used as the additive . however , fe ( iii ) is generally not as effective as al ( iii ) in suppressing silicon nitride corrosion . mixtures of 100 ppm fe ( iii ) and 100 pm al ( iii ) were also found to be highly effective in reducing the rate of silicon nitride corrosion , presumably due to the presence of al ( iii ). notably , the inhibiting effects of al ( iii ) were not diminished by the presence of fe ( iii ). whilst spiking inks with aluminium ( e . g . aluminium nitrate ) is an attractive means for inhibiting silicon nitride corrosion , the effectiveness of such low quantities of aluminium led the present applicant to investigate aluminium foil as a possible means for inhibiting silicon nitride corrosion . it was considered that aluminium foil could infuse sufficient quantities of al ( iii ) ions into the ink in order to suppress silicon nitride corrosion . such an approach would potentially obviate the need to formulate customized inks spiked with aluminium , or at least provide an alternative to these customized inks various test fluids were immersed in the plastic soak vessel together with aluminium foil , in accordance with the methodology described above . table 9 shows the results of these tests . ( test nos . 1 and 5 from table 1 have been included for comparison ). the data presented in table 9 demonstrate that exposure of test fluids to aluminium metal is highly effective in inhibiting corrosion of silicon nitride . for example , inks formulated with elemental aluminium particles are very effective in minimizing corrosiveness . more significantly , the data presented in table 9 has ramifications for the design of inkjet printers and cartridges . if ink is exposed to an aluminium surface upstream of a printhead , then this ink will have minimal corrosiveness towards silicon nitride in the printhead , even if it is an ‘ untreated ’ ink ( i . e . an ink not specifically formulated with any aluminium additives ). there are potentially many different parts of a printer &# 39 ; s fluidic pathway where an aluminium surface may be incorporated . for example , aluminium may be incorporated into an ink cartridge , ink lines / couplings , inline filter ( s ), pump ( s ), a pressure - regulating chamber positioned between the ink cartridge and the printhead , an ink manifold for delivering ink to inlets of the printhead , or the printhead itself ( e . g . an aluminium layer in each nozzle chamber , which can be deposited by pecvd during mems fabrication ). although a laminar sheet of aluminium foil was employed in test nos . 51 - 54 , it will be appreciated that the aluminium may have any suitable configuration provided that is exposed to the ink . for example , an aluminium mesh or sponge may be preferred in some instances for maximizing a surface area of aluminium exposed to the ink . inkjet printers incorporating the applicant &# 39 ; s inkjet printheads are described in , for example , u . s . pat . nos . 7 , 201 , 468 ; 7 , 360 , 861 ; 7 , 380 , 910 ; and u . s . pat . no . 7 , 357 , 496 , the contents of each of which are herein incorporated by reference . fig7 shows a thermal inkjet printer comprising a print engine 203 , as described in applicant &# 39 ; s u . s . application ser . no . 12 / 062 , 514 , the contents of which is herein incorporated by reference . the printer includes a removable print cartridge 202 , comprising a pagewidth printhead , and a bank of user - replaceable ink cartridges 228 . each color channel typically has its own ink reservoir 228 and a corresponding pressure - regulating chamber 206 for regulation of a hydrostatic pressure of ink supplied to the printhead . hence , the printer has five ink reservoirs 228 and five corresponding pressure - regulating chambers 206 . typical color channel configurations for this five - channel print engine 203 are cmykk or cmyk ( ir ). each ink cartridge 228 may comprise an inkjet ink as described herein . although fluidic connections between the various components are not shown in fig7 , it will be appreciated that these connections are made with suitable hoses in accordance with the fluidics system described in , for example , u . s . application ser . no . 12 / 062 , 514 . fig8 shows schematically a fluidics system 200 of the printer shown in fig7 . several components of the fluidics system 200 have been modified to incorporate aluminium , which is exposed to ink delivered by the system to the print cartridge 202 . referring then to fig8 , the pressure - regulating chamber 206 supplies ink 204 to an ink inlet 208 of the print cartridge 202 via an upstream ink line 234 . the pressure - regulating chamber 206 is positioned below the print cartridge 202 and maintains a predetermined set level 210 of ink therein by means of a float valve . 216 the pressure - regulating chamber 206 includes a layer of aluminium 292 , which is exposed to the ink 204 contained in the chamber . ink 204 is supplied to the pressure - regulating chamber 206 by the ink reservoir 228 positioned at any height h above the set level 210 . the ink reservoir 228 is typically a user - replaceable ink tank or ink cartridge , which connects with an ink supply line 230 when installed in the printer . the ink supply line 230 provides fluidic communication between the ink reservoir 228 and an inlet port of the pressure - regulating chamber 206 . the ink reservoir 228 comprises an aluminium sponge 290 , which provides a large surface area of aluminium exposed to ink contained therein . of course , other configurations of aluminium ( e . g . sheet , mesh etc ) are equally possible . the printhead cartridge 202 shown in fig8 also has an ink outlet 236 , which is connected to a downstream ink line 238 . the downstream ink line 238 is connected to a return port of the chamber 206 and comprises an inline ink pump 240 and filter 282 . the filter 282 may comprise an aluminium mesh , which is exposed to ink returned to the chamber 202 . equally , the ink pump 240 may comprise aluminium exposed to the ink 204 . from the foregoing , it will be appreciated that one or more components of the fluidic system 200 may be modified to incorporate aluminium which is exposed to ink supplied to the printhead . likewise , the nozzle assembly shown in fig2 may be modified to incorporate a layer of aluminium metal 294 inside the nozzle chamber 24 . a suitably modified nozzle assembly is shown in fig9 having a layer of aluminium metal 294 deposited in the pit 8 below the heater element 29 . however , it will be appreciated that aluminium may be incorporated anywhere inside the nozzle chamber 24 , or indeed the print cartridge 202 comprising the printhead and ink manifold . an advantage of incorporating aluminium into the nozzle chamber 24 is its proximity to the silicon nitride structures . a disadvantage of incorporating aluminium into the nozzle chamber 24 is that it requires modification of established mems fabrication processes , albeit a relatively minor modification which does not significantly change the nozzle design . the corrosiveness of certain dye - based inks towards bpsg was investigated . further , the advantageous effects of metal additives in suppressing this corrosion were demonstrated . bpsg coupons were prepared analogously to the silicon nitride coupons described above . the bpsg coupons were exposed to a variety of dye - based inks using the same methodology described above in connection with silicon nitride coupons . initially , the range of colored ink formulations were tested for their bpsg corrosion rates . table 10 shows the bpsg corrosion rates for the inks tested . table 11 shows the corrosions rates for the range of colored inks when spiked with varying amounts of aluminium by the addition of water - soluble aluminium nitrate nonahydrate . as evidenced by the data in table 11 , the corrosiveness towards bpsg of all inks tested was minimized by the addition of relatively small quantities of aluminium . at 20 ppm aluminium and above , all inks tested were rendered benign towards bpsg . table 12 shows the corrosions rates towards bpsg for the range of colored inks when spiked with varying amounts of iron by the addition of water - soluble ammonium iron sulfate . as evidenced by the data in table 12 , the corrosiveness towards bpsg of all inks tested was minimized by the addition of relatively small quantities of iron . at 100 ppm iron , all inks tested were rendered benign towards bpsg . table 13 shows the corrosion rates towards bpsg for the cyan ink when spiked with 100 ppm of fe ( iii ) from different soluble iron salts . table 13 demonstrates that the cyan ink was rendered benign towards bpsg by the addition of 100 ppm fe ( iii ), irrespective of the source of the fe ( iii ) ions . as foreshadowed above , it was postulated that the mechanism of corrosion inhibition relied on the formation of insoluble phosphate salts at the bpsg surface , which form a passivating layer that protects the bpsg from corrosion . to this end , a number of other metal additives were surveyed in accordance with their known metal phosphate solubilities . table 14 shows the corrosions rates towards bpsg for the magenta ink when spiked with 100 ppm of metal from a variety of different metal salts . the solubility of the corresponding metal phosphate is also shown in table 14 . ( the results from test nos . 56 , 72 and 100 have been included in table 14 by way of comparison ) from table 14 , it can be seen that the most effective metal additives for suppressing bpsg corrosion have highly insoluble phosphates . notably , aluminium , iron , copper and bismuth salts were all highly effective in suppressing bpsg corrosion . moreover , examination of the bpsg surface after exposure to these inks revealed a smooth glossy surface , indicating that a uniform passivation layer had formed on the bpsg surface . on the other hand , exposure of the bpsg surface to inks spiked with silver and sodium salts tended to result in a more pitted , non - uniform bpsg surface . this may indicate that the passivation layer was somewhat brittle and less effective in suppressing corrosion . the inks tested contained off - the - shelf dyes supplied with a mixture of counterions . the evidence from metal phosphate solubility studies led the present applicant to consider the nature of the dye counterion as being responsible for the corrosiveness of certain dyes . specifically , it was postulated that counterions which form relatively soluble phosphates ( e . g . ammonium , potassium and sodium ) would be more corrosive towards bpsg than counterions which form relatively insoluble phosphates ( e . g . lithium and tetramethylammonium ). further , the benefits of metal additives in the ink would be best realized in inks containing counterions which form relatively soluble phosphates . accordingly , black ink 2 and magenta ink 1 were modified by ion exchange to produce inks containing only a single counterion . table 15 shows the bpsg corrosion rates for mono - counterion black inks in the presence of varying amounts of an aluminium additive ( aluminium nitrate nonahydrate ). table 16 shows the bpsg corrosion rates for mono - counterion magenta inks in the presence of varying amounts of the aluminium additive . the results in tables 15 and 16 both demonstrate that the dye counterion is a significant factor controlling bpsg corrosion rates . the evidence from these experiments shows an order of bpsg corrosivity as follows : a key finding is that inks containing potassium ions are highly corrosive towards bpsg . furthermore , this corrosivity can be suppressed with the addition of sufficient quantities of a metal additive , such as aluminium nitrate . commercial inkjet dyes are often supplied with a mixture of dye counterions . dyes containing potassium counterions in significant amounts are expected to be highly corrosive towards bpsg , whereas those containing , for example , only lithium ions are expected to be much less corrosive towards bpsg . the dye counterions have an important role in the overall balance of ink formulations . in many instances , it is not possible simply to switch to a less corrosive counterion ( e . g . lithium ) because this affects the solubility of the dye and may cause undesirable side - effects , such as precipitation of the dye in a printhead . it is an advantage of the present invention that inks containing corrosive counterions can be used without changing the composition of the dye . the addition of metal additives to the ink formulation in relatively small quantities has been shown to be remarkably effective in suppressing corrosion of bpsg structures . the corrosiveness of a dye - based ink towards silicon oxide was investigated . further , the advantageous effects of metal additives in suppressing this corrosion was demonstrated . silicon oxide coupons were prepared analogously to the silicon nitride coupons described above . the silicon oxide coupons were exposed to a variety of dye - based inks using the same methodology described above in connection with silicon nitride coupons . the cyan ink formulation was tested for its silicon oxide corrosion rate with and without an aluminium nonahydrate additive . the results are shown in table 17 . from table 17 , it can be seen that the cyan ink has some corrosivity towards silicon oxide , albeit less than its corrosivity towards silicon nitride and bpsg . the additional of 10 ppm al ( iii ) was sufficient to suppress this corrosivity completely . it will , of course , be appreciated that the present invention has been described by way of example only and that modifications of detail may be made within the scope of the invention , which is defined in the claims appended hereto .	2
for a general understanding of an electrostatic processing system in which the invention may be incorporated , reference is had to fig1 . in the illustrated machine , an original d to be copied is placed upon a transparent support platen p fixedly arranged in an illumination assembly generally indicated by the reference numeral 10 . while upon the platen , an illumination system flashes light rays upon the original thereby producing image rays corresponding to the information areas on the original . the image rays are projected by means of an optical system 11 to an exposure station a for exposing the photosensitive surface of a moving xerographic plate in the form of a flexible photoconductive belt 12 . in moving in the direction indicated by the arrow , prior to reaching exposure station a , that portion of the belt being exposed would have been uniformly charged by a corona device 13 located at the belt run extending between belt supporting rollers 14 and 16 . the exposure station extends between the roller 14 and a third support roller 15 . the exposure of the belt surface to the light image discharges the photoconductive layer in the areas struck by light , whereby there remains on the belt a latent electrostatic image in image configuration corresponding to the light image projected from the original on the supporting platen . as the belt surface continues its movement , the electrostatic image passes around the roller 15 and through a developing station b located at a third run of the belt wherein there is provided a developing apparatus generally indicated by the reference numeral 17 . the developing apparatus 17 comprises a plurality of brushes 17 &# 39 ; which carry developing material to the adjacent surface of the upwardly moving inclined photoconductive belt 12 in order to provide development of the electrostatic image . the developed electrostatic image is transported by the belt 12 to a transfer station c located at a point of tangency on the belt as it moves around the roller 16 whereat a sheet of copy paper is moved at a speed in synchronism with the moving belt in order to accomplish transfer of the developed image . there is provided at this station a transfer roller 18 which is arranged on the frame of the machine for contacting the non - transfer side of each sheet of copy paper as the same is brought into transfer engagement with the belt 12 . the roller 18 is electrically biased with sufficient voltage so that a developed image on the belt 12 may be electrostatically transferred to the adjacent side of a sheet of paper as the same is brought into contact therewith . there is also provided a suitable sheet transport mechanism 19 adapted to transport sheets of paper seriatim from a first paper handling mechanism 20 or a second paper handling mechanism 21 to the developed image on the belt as the same is carried around the roller 16 . a programming device operatively connected to the mechanisms 20 , 21 and the illumination device for producing an electrostatic latent image on the belt 12 , is effective to present a developed image at the transfer station c in time sequence with the arrival of a sheet of paper . the sheet is stripped from the belt 12 after transfer of the image thereto by a stripper transport 23 and thereafter conveyed by the stripper transport into a fuser assembly generally indicated by the reference numeral 25 wherein the developed and transferred xerographic powder image on the sheet is permanently affixed thereto . after fusing , the copy is either discharged from the reproduction machine into the collator 24 or routed back to paper handling mechanism 21 in a manner to be hereinafter described . the toner particles remaining as residue on the developed image , background particles , and those particles otherwise not transferred are carried by the belt 12 to a cleaning apparatus positioned on the run of the belt between rollers 14 and 16 adjacent the charging device 13 . the cleaning device , comprising a rotating brush 26 and a corona emission device 27 for neutralizing charges remaining on the particles , is connected to a vacuum source ( not shown ) for removing the neutralized toner particles from the belt prior to the formation of subsequent images thereon . referring now to fig1 and 2 , there is illustrated an inverter - reverser mechanism adapted to receive copy sheets from the fuser 25 and route the fused copies either to the paper handling mechanism 21 or the collator 24 . the inverter - reverser mechanism includes a first transport 30 adapted to receive fused copies from the fuser for transport to the collator . when the reproduction system is being utilized to produce one - sided copy , the sheets from the fuser are transported by transport 30 directly to the collator 24 as illustrated in fig1 . when double - sided or duplex copies are to be produced , copies on the transport 30 are intercepted by a deflector 32 which is adapted for movement into the sheet path as illustrated in dotted line position to direct the sheets through a return path to paper handling mechanism 21 in a manner to hereinafter explained . with the deflector 32 in the intercept position , the sheets are fed into the nip of a first roll pair formed by a drive roll 34 and an idler roll 36 . idler roll 36 is mounted on lever arm 38 which is pivotally anchored to the frame of the machine on a pivot pin 40 . lever arm 38 is biased toward roll 34 by a suitable means such as spring 39 . a third roll pair downstream from the first roll pair is formed by an idler roll 42 mounted on lever arm 38 and a driven roll 44 disposed opposite thereto . roll 44 is adapted to be driven in a direction to move sheets to the paper handling mechanism 21 . a fourth roll pair comprising idler roller 46 and a driven roller 48 are adapted to receive sheets from roll pair 34 , 36 and feed the sheets to transport belts 50 for forwarding the sheets to mechanism 21 . when the desired number of one - sided copies have been produced and delivered to the paper handling mechanism 21 , the paper handling mechanism 20 may be inactivated and the paper handling mechanism 21 activated . it should be understood that in following the paper path around roller 34 and between feed roll pair 34 , 36 , the copy sheets are turned over , i . e ., the printed material is on the top of the sheets in paper handling mechanism 21 . upon re - energization of the machine , the sheets from paper handling mechanism 21 are fed through the reproduction machine for copying on the blank side of the sheet in the same manner as described heretofore . as the duplex copy is exited from the fuser it is carried by the transport 30 and deflected around roll 33 in the same manner as heretofore described and illustrated in fig1 . simultaneously with the activation of the machine for producing the duplex copy , roll 44 would be energized for continuous rotation in the direction illustrated by the arrow thereon . further , roll 48 would be inactivated and moved out of contact with idler roll 46 to prevent interference with the lead edge of sheets passing therebetween . with the machine operating to print on the second side of the sheets , entrance of a sheet between roll pair 34 , 36 will cause roll 36 to be displaced a distance equal to the thickness of the sheet . through the mechanical advantage obtained by lever arm 38 , roll 42 will be displaced a distance from roll 44 greater then the thickness of the sheet passing between rolls 34 , 36 and allow free movement of the leading edge of the sheet therebetween . stated another way , since roll 42 is mounted on lever 38 at a greater distance from pivot 40 than roll 36 , displacement of roll 36 caused by passage of a sheet between rolls 34 , 36 will cause a greater displacement of roll 42 to prevent the lead edge of the sheet from being pinched therebetween . as the trailing edge of the sheet leaves roll pair 34 , 36 , roll 36 will be moved into contact with roll 34 thereby causing roll 42 to move towards roll 44 and pinch the sheet therebetween to drive the sheet toward a second roll pair formed by roll 34 and an idler roll 52 disposed opposite thereto . it can be seen that the upper guide members between rolls 52 , 44 , and 48 are disposed in a relatively straight line offset from the path of sheet travel through rolls 34 , 36 . as the trailing edge of the paper leaves rolls 34 , 36 , the main body of the sheet will be disposed in the guide between roll pair 42 , 44 and roll pair 46 , 48 . due to the orientation of the guides , the beam strength of the paper will cause the trailing edge thereof to lift up toward the nip of roll pair 34 , 52 . further , in the event there is a slight sag in the trailing edge of the paper , the contact of the trailing edge with rotating rolls 34 , which are coated with a high friction material such as rubber , will also act to help lift the lead edge into the nip of roll pair 34 , 52 . as stated heretofore , as the trail edge of the sheet leaves roll pair 34 , 36 , roll pair 42 , 44 will pinch the paper to drive the paper toward the left as illustrated in the drawings . to provide a slight delay in the drive provided by roll 44 and prevent the sheet from being prematurely driven to the left before the trailing edge thereof has time to reach the nip between roll 34 and 52 , the drive for roll 44 may have a time delay mechanism built therein . by reference to fig3 , and 5 there is illustrated a simple , trouble - free mechanism to provide this time delay . in the disclosed mechanism the drive shaft 54 for roll 44 is provided with drive lugs 56 solidly affixed thereto . the inner portion of roll 44 is provided with a plurality of wheel lugs 58 solidly affixed thereto adapted for cooperation with drive lugs 56 . suitable springs 57 are connected between shaft 54 and roll 44 to maintain the drive lugs in engagement with the wheel lugs as illustrated in fig3 when roll pair 42 , 44 are separated . when roll 42 is initially moved into contact with roll 44 , the resistance to rotation generated by the inertia of idler roll 42 and the passage of a sheet in the direction opposite to the feed direction of roll 44 will cause the roll 44 to begin to rotate away from the drive lug against the force of the springs as illustrated in fig4 into a final position illustrated in fig5 and thereafter provide a solid drive in the reverse direction to feed the sheet to the left into the nip between roll 34 and 52 . while coil springs 57 are illustrated , it should be understood that other biasing means such as torsion springs connected between roll 44 and shaft 54 could be utilized . the sheets exiting from roll pair 34 , 52 are directed by guides 60 to the exit transport 62 of the processor for forwarding to collator 24 . in the illustrated embodiment , the collator of the type illustrated in u . s . pat . no . 3 , 830 , 590 mentioned heretofore , is adapted to receive single - sided copies face down for collation purposes . stated another way , single - sided copy entering the collator is deposited in the collator trays face down so that the informational material on page 1 is at the bottom followed by the informational area on the succeeding page etc . to provide collated booklets or reports having the proper page orientation . thus , when employing the collator with duplex copies , page 1 must also be presented to the collator face down . since the duplex copy exits from the fuser with page 2 down , the inverter inverts the copy to present the duplex copy to the collator with page 1 down . the subsequent sheets having pages 3 and 4 thereon would be presented to the collator with page 3 down etc . to provide correct numerical order of the sheets in the tray . the disclosed reverser - inverter device is capable of extremely high speed operation since in the reversing roll 44 is constantly driven and does not need to be programmed on and off as each sheet appears thereat . further , irrespective of the sheet dimension presented to the inverter the controlling factor is the exit of the trailing edge from roll pair 34 , 36 which &# 34 ; actuates &# 34 ; roll pair 42 , 44 for the reversing action . thus , the inverter is capable of handling sheets of any length greater than the distance between roll pair 34 , 36 and roll pair 42 , 44 without changes in machine timing or other adjustments . further , since the inverter does not rely on a stop to physically contact the lead edge of the sheets prior to the reversing operation , the device is capable of extremely high speed operations without producing damage to the sheets . while i have described a preferred embodiment of my invention , it is to be understood that the invention is not limited thereto but may be otherwise embodied within the scope of the following claims .	1
the disclosure is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean “ at least one .” fig1 and fig2 show one embodiment of an electronic device enclosure for securing an electronic module ( not shown ). the electronic device enclosure includes a chassis 10 , a cover 20 , a handle 30 , and a securing assembly 100 . the chassis 10 includes a bottom plate 11 , a front plate 12 , and two side plates 13 . the two side plates 13 are opposite to each other . in this embodiment , the bottom plate 11 is substantially perpendicular to the front plate 12 and the side plates 13 , and the front plate 12 is substantially perpendicular to the side plates 13 . two flanges 15 extend from opposite side edges of the front plate 12 , respectively . the flanges 15 are substantially perpendicular to the bottom plate 11 . each flange 15 is riveted to a corresponding side plate 13 . a holding plate 16 extends from a top edge of the front plate 12 , which is substantially parallel to bottom plate 11 . in this embodiment , the flanges 15 are substantially parallel to each side plate 13 , and the holding plate 16 is substantially perpendicular to bottom plate 11 . a pivoting shaft 151 is located on the flange 15 . the cover 20 includes a top wall 21 and two sidewalls 23 . the top wall 21 defines a through hole 211 . a pair of pivoting pieces 213 extends from a bottom surface of the top wall 21 . each pivoting piece 213 defines a pivoting hole 2131 . in this embodiment , the top wall 21 is substantially perpendicular to each sidewall 23 , and each pivoting piece 213 is substantially perpendicular to the top wall 21 and the sidewall 23 . a resilient piece 25 extends from each sidewall 23 . the resilient piece 25 extends slantingly out of the cover 20 . the handle 30 includes a mounting plate 31 and two rotating arms 33 connected to the mounting plate 31 . a latching piece 310 is secured to the mounting plate 31 . the latching piece 310 defines a latching slot 311 . the latching slot 311 extends from a side edge of the latching piece 310 . each rotating arm 33 defines a pivoting hole 331 . in this embodiment , the latching piece 310 is substantially perpendicular to the mounting plate 31 . the securing assembly 100 includes a latching member 50 and a resilient member 60 . the latching member 50 includes a holding piece 51 , a connecting piece 53 , and a limiting piece 55 . the holding piece 51 and the limiting piece 55 extend from opposite edges of the connecting piece 53 . the connecting piece 53 is slanted relative to the holding piece 51 and the limiting piece 55 . in one embodiment , the holding piece 51 is substantially parallel to the limiting piece 55 . a pressing portion 511 extends from a top surface of the holding piece 51 . a positioning post 513 extends from a bottom surface of the holding piece 51 . the pressing portion 511 is received in the through hole 211 . a pivoting shaft 56 is located in an intersection of the holding piece 51 and the connecting piece 53 . a limiting block 551 extends downwards from the limiting piece 55 . in this embodiment , the resilient member 60 is a coiled spring and a compression spring . fig3 and fig4 show that in assembly , the resilient member 60 is placed on the holding plate 16 . the positioning post 513 is inserted in the resilient member 60 . each end of the pivoting shaft 56 is pivotably received in the pivoting hole 2131 by elastically deforming the pivoting pieces 213 . the pressing portion 511 extends out of the top wall 21 through the through hole 211 . the cover 20 covers the chassis 10 . the sidewall 23 is secured to the flange 15 by riveting , soldering , or other securing methods . the cover 20 covers the chassis 10 . the top wall 21 is substantially parallel to the holding plate 16 . a first end of the resilient member 60 abuts a bottom surface of the holding piece 51 , and a second end of the resilient member 60 abuts the holding plate 16 . thus , when the pressing portion 511 is pressed downwards , the latching member 50 is rotated about the pivoting shaft 56 to press the resilient member 60 . the pivoting shaft 56 is substantially parallel to the top wall 21 and the sidewall 23 . the pivoting shaft 151 is inserted through the pivoting hole 331 , to rotatably mount the rotating arm 33 to the flange 15 . in this position , the resilient member 60 and the latching member 50 are in an initial position . in assembly of the handle 30 , the handle 30 is rotated towards the holding plate 16 , until blocked by the limiting block 551 . the handle 30 is further rotated to rotate the limiting piece 55 away from the holding plate 16 . the holding piece 51 is rotated towards the holding plate 16 and elastically deform the resilient member 60 . when the limiting block 551 is aligned with the latching hole 311 , the mounting plate 31 resists and elastically deforms the resilient piece 25 , the handle 30 is released , the resilient member 60 rebounds to engage the limiting block 551 in the latching hole 311 , to secure the handle 30 to the chassis 10 . in this position , the latching member 50 is in a closed position , and the limiting piece 55 is substantially parallel to the latching piece 310 . fig5 shows that to open the handle 30 , the pressing portion 511 is pressed downwards to rotate the holding piece 51 towards the holding plate 16 and elastically deform the resilient member 60 . at the same time , the limiting piece 55 is rotated away from the holding plate 16 , until the limiting block 551 is disengaged from the latching hole 311 . the resilient member 25 rebounds to extend the mounting plate 31 outwards , thereby releasing the handle 30 from the cover 20 , and the operation member 50 is in an open position . it is to be understood , however , that even though numerous characteristics and advantages have been set forth in the foregoing description of embodiments , together with details of the structures and functions of the embodiments , the disclosure is illustrative only and changes may be made in detail , especially in the matters of shape , size , and the arrangement of parts within the principles of the disclosure , to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .	7
fig1 shows a sectional view of a rule 1 of a length measurement system used for a machine tool to sense the movement of a machine head relative to a machine bench . the rule 1 is inserted into a capsule profile 2 surrounding said rule 1 on three sides for protection . a receiving portion 3 into which the rule 1 is inserted ( arrow 4 ) is provided inside the capsule profile 2 for mounting the rule 1 . a rubber band 5 acting as a bracing means is inserted into the receiving portion 3 in order to secure the rule 1 within the receiving portion 3 . since the rule 1 is later sensed in the measuring process ( for which purpose it is suitably structured ) and its position is , therefore , important for a precise measurement , the receiving portion 3 comprises a lower reference surface 6 as well as a lateral reference surface 7 which align the rule 1 in an exact position within the capsule profile 2 when the rubber band 5 , acting as a bracing means , urges the rule 2 against the reference surfaces . the capsule profile 2 has a u - shaped cross - section , comprising a base 8 as well as a lid 9 . the capsule profile 2 surrounding the rule 1 on three sides provides good protection for the sensitive rule 1 . the sensed structure of the rule 1 is located on the oblique surface of the rule 1 pointing downward in the fitting position , thus further reducing depositions of dust . the base 8 of the capsule profile 2 is provided for mounting on the machine bench of a machine tool . fig2 shows the rule 1 , incorporated into the capsule profile 2 . it is clearly visible that the rule 1 in the capsule profile 2 is accessible only through an opening 10 . of course , said opening 10 is a slot , because the rule 1 extends perpendicularly to the drawing plane , and so does the capsule profile 2 , which is produced , for example , from a suitably profiled aluminum strand . the legs of the capsule profile 2 , i . e . the base 8 and the lid 9 , comprise holding grooves , so that an upper holding groove 11 is formed in the lid 9 and a lower holding groove 12 is formed in the base 8 . these holding grooves 11 , 12 , in combination with a certain elasticity of the lid 9 , serve to secure a sensing head inserted into the capsule profile , as will be explained below . fig3 schematically shows the sensing head 13 . the sensing head 13 comprises a measuring gap 14 which , in the assembled state , trilaterally surrounds the rule 1 in a non - contacting manner and on which the measuring means ( not shown ) are arranged , which sense the structure ( also not shown ) on the rule 1 in a non - contacting manner . the sensing head 13 has a mounting surface 15 by which it is securely mounted on the machine head of the tool machine . further , the sensing head 13 comprises an upper groove 16 as well as a lower groove 17 , which cooperate with the holding grooves 11 and 12 in the legs of the capsule profile 2 so as to ensure that the assembled capsule profile 2 , comprising the rule 1 and the sensing head 13 , is securely locked during transport , with the sensing head 13 and the rule 1 being locked in a predetermined , adjusted position relative to each other . for this purpose , an upper fitting cylinder 18 and a lower fitting cylinder 19 are provided , whose diameter is dimensioned such that , inserted into the upper holding groove 11 or the lower holding groove 12 , they are fixed in the groove 16 or 17 by the spring action of the lid 9 , when the sensing head 13 is inserted into the capsule profile 1 . for example , the fitting cylinders 18 and 19 may be provided as suitable steel wires . the insertion operation is schematically represented by an arrow in fig3 , wherein the rule 1 is , of course , inserted into the measuring gap 14 of the sensing head 13 after assembly of the rule 1 and the capsule profile 2 , by a movement perpendicular to the drawing plane . that is , the sensing head 13 is slid over the rule 1 at an open end of the capsule profile 2 . thereafter , the fitting cylinder 18 or 19 is introduced into the gap formed by the upper holding groove 11 and the upper groove 16 or into the gap formed by the lower holding groove 12 and the lower groove 17 . the fitting cylinders are clamped by the spring action of the leg of the capsule profile 2 forming the lid 9 . the capsule profile 2 securely holds the sensing head 13 between the base 8 and the lid 9 , and a predetermined orientation of the sensing head 13 relative to the rule 1 is provided within narrow , precisely dimensioned tolerances . the unit of sensing head 13 , capsule profile 2 and rule 1 pre - mounted in this manner can then simply be attached to the machine by mounting the sensing head 13 and the capsule profile 2 on the machine head and the machine bench , respectively . in one embodiment , said mounting is effected according to the steps shown in fig4 to 7 . the figures show a top view of the pre - mounted unit consisting of the capsule profile 2 , the rule 1 and the sensing head 13 , viewed from above ( with reference to fig3 ). for mounting on the mounting surface 15 , the sensing head 13 is provided with a mounting plate 22 whose design will be explained in detail hereinafter . the sensing head 13 is mounted on the machine part 21 via the mounting plate 22 . the mounting plate 22 need not yet be provided on the sensing head 13 when mounting the capsule profile 2 . as will be explained hereinafter , the mounting plate 22 is only required for securely mounting the sensing head 13 on the machine head 21 . the capsule profile 2 , on the inside of which the rule 1 ( not shown in fig4 to 7 ) is located , is aligned exactly in parallel with the machine run - off , i . e ., the longitudinal movement of the machine head 21 . for this purpose , use is made of a mounting gauge 20 which aligns the capsule profile 2 at a predetermined distance d from the machine head 21 . by moving the machine head 21 along the machine run - off direction and simultaneously applying the mounting gauge 20 , an adjustment of the capsule profile 2 in parallel with the moving direction of the machine head 21 is achieved . fig5 shows this operation , wherein the machine head 21 effects alignment of the capsule profile 2 by means of the mounting gauge 20 . the adjusted capsule profile 2 is mounted on the machine bench . said mounting can be effected in many ways . the embodiment described herein uses a two - step method , wherein , first of all , a coarse alignment of the capsule profile 2 relative to the machine run - off is effected . the machine head 21 is moved to the corresponding ( final ) positions , and the capsule profile is aligned with the mounting gauge 20 at two points , which are as far apart as possible . after this coarse alignment , a first fixation of the capsule profile 2 may be effected , for example , by loosely tightening a screw connection . then , the machine head 21 including the mounting gauge 20 is moved slowly along the machine run - off and the capsule profile 2 is simultaneously fixed securely on the machine bench ( not shown ). in an embodiment where the capsule profile 2 is screwed on , this may be effected by securely tightening the screw connections . in embodiments where jointing of the capsule profile 2 to the machine bench is effected , said jointing may be gradually effected , for example , by removing a protective sheet from a suitable double - sided adhesive tape , which is attached to the base 8 of the capsule profile 2 , as the movement of the machine head 21 progresses , so that the capsule profile 2 is securely adhered to the machine bench . the sensing head 13 , with the mounting plate 22 mounted thereon , is securely connected with the capsule profile 2 via the fitting cylinders 18 and 19 , as described with reference to fig3 . thus , the alignment of the capsule profile 2 in parallel with the run - off of the machine head 21 does not influence the preadjusted position of the capsule profile 2 , comprising the rule 1 , relative to the sensing head 13 . if the capsule profile 2 is mounted on the machine bench in exact parallel alignment with the run - off of the machine head 21 ( fig6 ), the machine head 21 is moved to the sensing head 13 . in doing so , a predetermined gap 45 is formed between the mounting plate 22 , which contacts the mounting surface 15 of the sensing head 13 , and the machine head 21 . the mounting plate 22 , which was hitherto secured on the sensing head 13 , is now released therefrom and screwed onto the machine part 21 . the gap 45 , which previously existed between the mounting plate 22 and the machine head 21 , is thus shifted to between the mounting plate 22 and the sensing head 13 . said gap serves as an adhesive gap 30 , which is then filled with adhesive in order to securely mount the mounting head 13 on the mounting plate 22 , which is screwed onto the mounting element 21 ( see fig7 ). in doing so , the adhesive can cure free from stresses . upon curing of the adhesive , the connection between the mounting head 13 and the capsule profile 2 is released by pulling the fitting cylinders 18 and 19 out of the gaps formed by the upper holding groove 11 and the upper groove 16 as well as by the lower holding groove 12 and the lower groove 17 . fig8 shows a sectional view of the mounting gauge 20 . said mounting gauge 20 is placed on the capsule profile 2 , for which purpose it comprises a first reference arm as well as a second reference arm 24 . on its side facing the capsule profile 2 , the reference arm 24 has a reference surface 25 , which externally contacts the capsule profile 2 approximately at the level of the rule 1 . the mounting gauge 20 is supported on the lid 9 of the capsule profile 2 by a supporting surface 27 , which is located on the interior surface of the first reference arm 23 , said interior surface facing the capsule profile 1 . an adjusting arm 26 of the mounting gauge 20 ensures that the desired distance d to the machine head 21 is present when the mounting gauge 20 is placed on the capsule profile . thus , the adjusting arm 26 is located between the free ends of the capsule profile 2 and the machine part 21 . fig9 shows a sectional view of the mounting condition of the measurement system as shown in the top view of fig7 . in this case , the capsule profile 2 is adhered to the machine bench 28 by its base 8 , using an adhesive tape 29 having predetermined properties . the mounting plate 22 is securely mounted on the machine head 21 ( in a manner not further shown in fig9 ), with the gap dimension d , which is predetermined by the mounting gauge 20 , resulting in a predetermined adhesive gap 30 between the mounting surface 15 of the sensing head 13 and the mounting plate 22 . at its bottom , the mounting plate 22 comprises a projecting edge protrusion which limits the adhesive gap 30 towards the bottom . fig1 shows the measurement system upon completion of the mounting , the adhesive tape 29 not being represented for a simplified view . the adhesive gap 30 was filled with adhesive 31 which could not run out of the adhesive gap 30 at the bottom of the mounting plate 22 , due to the edge protrusion 32 . upon removal of the upper fitting cylinder 18 from the gap formed by the upper holding groove 11 and the upper groove 16 , as well as of the lower fitting cylinder 19 from the gap formed by the lower groove 17 and the lower holding groove 12 , the sensing head 13 is freely movable along the run - off direction of the machine head 21 ( the direction perpendicular to the drawing plane ). in this case , the sensing head 13 protrudes into the capsule profile 2 and is surrounded thereby on three sides in a non - contacting manner . thus , good protection of the sensing head 13 against soiling or mechanical damage is achieved . the sensing head 13 , in turn , trilaterally surrounds the rule 1 and senses it in a non - contacting manner . due to the alignment of the capsule profile 1 and the sensing head 13 , no guiding of the sensing head 13 in the capsule profile 2 is required . the sensing head 13 is neither supported on the capsule profile 2 nor on the rule 1 . fig1 shows a perspective view of an embodiment example of the mounting plate 22 , wherein the side on which the sensing head 13 is mounted by the mounting surface 15 points to the right in the illustration . the mounting plate 22 has an edge protrusion 32 circumferentially extending in a u - shaped manner , which serves as a sealing means in order to prevent the adhesive running out , which adhesive is filled in through an opening 34 formed at the top surface , between the sensing head 13 and the mounting plate 22 , in order to adhere the sensing head 13 to the mounting plate 22 . for easier filling , the mounting plate 22 has a funnel tube 35 comprising a filling opening 36 through which adhesive may be injected from a nozzle . moreover , the mounting plate 22 has two slotted holes 37 allowing the mounting plate 22 to be screwed onto the machine part 21 . this screw connection can be released if the sensing head 13 is to be removed again from the machine head 21 after an adhesive joint has been produced . without this releasable connection between the mounting plate 22 and the machine head 21 , removal of the sensing head after producing said adhesive joint would be possible only with a great effort and at the risk of damaging the machine head 21 . in this case , one of said slotted holes 27 is located in a flange 38 , thus achieving particularly good access even after jointing of the sensing head 13 . moreover , providing said holes as slotted holes 37 has the advantage that greater tolerances can be allowed for the corresponding threaded holes on the machine head 21 without having to expect any effects on the precise mounting of the sensing head . in order to secure the mounting plate 22 on the sensing head 13 , until mounting of the mounting plate 22 and the subsequent jointing of the sensing head 13 have been completed , the mounting plate 22 comprises suitable holding noses 39 engaging in corresponding holding openings on the sensing head 13 . in this manner , the mounting plate 22 can be fitted onto the sensing head 13 , and is secured thereon against falling off until mounting is completed . the holding openings 42 are clearly visible on the sensing head 13 in the perspective view of fig1 , which shows the mounting head 13 in a perspective view , as viewed from the mounting surface 15 . as can be seen , a u - shaped recess 40 is provided on the mounting surface 15 , into which recess 40 the edge protrusion 32 of the mounting plate 22 protrudes , so that a volume 33 for adhesive formed between the mounting plate 22 and the mounting surface 15 , serving to receive the adhesive 31 , is sealed at its bottom and lateral surfaces . due to the viscosity of the adhesive used , it suffices , in this case , if the edge protrusion 32 simply contacts the vertical wall surface formed by the recess 40 in order to produce the desired sealing effect . for easier filling of the adhesive 31 into the volume 33 for adhesive , the sensing head 13 has oblique inlet surfaces 42 . said oblique inlet surfaces 42 are located such that adhesive filled into the funnel tube 35 flows into the volume 33 for adhesive via the oblique inlet surface 42 . this operation is shown in fig1 , which shows the mounting plate 22 mounted on the machine part 21 ( not shown ) via screws 43 . a nozzle 44 is fitted into the funnel tube 35 , said nozzle 44 serving to introduce adhesive into the volume 33 for adhesive , via the oblique inlet surface 42 , so as to adhere the sensing head 13 to the mounting plate 22 . the u - shaped circumferential edge 32 of the mounting plate 22 , which protrudes into the recess 40 on the mounting surface 15 of the sensing head 13 , ensures that the adhesive introduced does not flow out of the bottom or the sides of the volume 33 for adhesive . in the embodiment described herein , the sensing head 13 is secured , by the capsule profile 2 , in the position adjusted relative to the machine part 21 ( not shown ) during jointing . however , for a better overview , the capsule profile 2 is not represented in fig1 . fig1 shows the condition after jointing , just before completion of the final assembly , now representing the capsule profile 2 including the rule 1 . as can be seen , the sensing head 13 protrudes deeply into the capsule profile 2 . the sensing head 13 embraces the rule 1 on three sides , without contacting it or being supported thereon , upon completion of the final assembly , i . e . upon removal of the fitting pieces . in fig1 , the upper fitting cylinder 18 has already been withdrawn from the upper holding groove 11 and fro the upper grooves 16 ( hidden in this view ) of the sensing head 13 , whereas the lower fitting cylinder 19 has not yet been withdrawn . upon removal of the lower fitting cylinder 19 from the lower holding groove 12 and from the lower groove 17 , the sensing head 14 mounted on the machine head 21 is freely movable along the rule 1 , the path of its movement being defined by the movement of the machine head 21 . in case the sensing head 13 is to be released from the machine head 21 , the screws 43 may be screwed out , thus enabling removal of the sensing head 13 , together with the mounting plate 22 , from the machine head 21 .	6
before explaining the disclosed embodiments of the present invention in detail , it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . as earlier recited this application has been filed in order to both disclose new methyl esters of substituted 4 - oxo - 2 - butenoic acids and to facilitate a fuller understanding of the chemical scope of the methyl esters of substituted 4 - oxo - 2 - butenoic acids . the methyl esters can be synthesized according to the amination / dehydration steps designated as scheme i . more specifically this application is for anti - mycobacteria compounds of - 12 , of - 13 , of - 15 , which have been structurally shown in fig1 - 3 , respectively . to facilitate a full understanding of the invention : these compounds are highly active against mycobacterium tuberculosis and have a very low toxicity , a lethal dose 50 ( ld 50 ) in animals . the percent activity and animal toxicity for each compound is as follows : of - 12 ( 81 % and ld 50 & gt ; 1500 mg / kg ), of - 13 ( 88 % and ld 50 & gt ; 1500 mg / kg ), and of - 15 ( 98 % and ld 50 & gt ; 1500 mg / kg ), the preparation of 4 -( 4 - ethoxyphenyl )- 2 -( n ′- fluoren - 9 - ylidene - hydrazino )- 4 - oxobut - 2 - enoic acid methyl ester ( of - 12 ). a solution of 5 . 0 g ( 0 . 02 moles ) of methyl 4 - p - ethoxyphenyl - 2 - hydroxy - 4 - oxo - 2 - butenoate ( 1 ) and 3 . 88 g ( 0 . 02 moles ) of hydrazone fluorenone ( 2 ) in 80 ml of absolute toluene was refluxed for 3 hr 30 min with a dean - stark trap ( control for the end of the reaction was carried by tlc ). the solution was cooled and the precipitate was filtered and recrystallized from absolute benzene - hexane ( 1 : 1 ) to give 3 . 4 g ( 68 % yield ) of yellow crystals , mp 135 - 137 ° c . solubility : highly soluble in dmso , dmfa , dichloroethane , acetonitrile ; slightly soluble in ethanol , tetrachloromethane ; insoluble in hexane and water . the preparation of 4 -( 4 - ethoxyphenyl )- 2 -( n ′- fluoren - 9 - ylidene - hydrazino )- 2 - hydroxy - 4 - oxobutyric acid methyl ester ( of - 13 ). a solution of 5 . 0 g ( 0 . 02 moles ) of methyl 4 - p - ethoxyphenyl - 2 - hydroxy - 4 - oxo - 2 - butenoate ( 1 ) and 3 . 88 g ( 0 . 02 moles ) of fluorene - 9 - ylidene - hydrazine ( 2 ) in 80 ml of absolute benzene and absolute toluene ( 1 : 1 ) was refluxed for 1 hr 30 min with a dean - stark trap ( the end of the reaction was determined by tlc ), cooled and the precipitate was filtered and recrystallized from benzene - diethyl ether - hexane mixture ( 1 : 3 : 2 ) to give 2 . 65 g ( 53 % yield ) of colorless crystals with mp 114 - 116 ° c . solubility : highly soluble in dmso , dmfa , dichloroethane , acetonitrile , insoluble in hexane . the compound is not stable in solutions and decomposes quickly when the solution is heated or stored for a long time with the formation of of - 12 . the synthesis of ( of - 12 ) and ( of - 13 ) has been designated as scheme i and is further illustrated by the preparation set forth below . it is seen from the scheme 1 that of - 13 is an intermediate product during the synthesis of of - 12 . a solution of 5 . 25 g ( 0 . 028 moles ) of methyl 2 - hydroxy - 5 , 5 - dimethyl - 4oxo - 2 - hexenoate ( 1 ) and 4 . 85 g ( 0 . 028 moles ) of p - bromoaniline ( 2 ) in 30 ml of absolute benzene was refluxed for 2 hr with a dean - stark trap ( scheme 2 ). the solution was cooled and the resulting precipitate of of - 15 was filtered and recrystallized from methanol to give 8 . 30 g ( 87 %) of yellow crystals with mp of 75 - 76 ° c . the earlier referenced decarbonylation / transesterification reactions designated as scheme ii is readily seen from the following illustrated synthesis of of - 15 . the bacteriostatic activity against mycobacterium tuberculosis of the novel compounds ( as earlier reported ) was realized by the following procedure . compound processing : synthetic compounds of - 12 , of - 13 , of - 15 , were each first dissolved in 500 ul of dimethylsulfoxide ( dmso ) in individual beakers and each placed on a rotary shaker overnight . distilled water was added to each to provide a final concentration of 10 mg / ml . each solution was filter - sterilized using becton dickinson 5 ml sterile syringes and whatman 22 um sterile filters . each of the filtered sterilized synthetic test solutions ( designated as synthons hereafter ) were stored at − 20 degrees centigrade until used . culture media and bioassay analytical techniques : bactec 12b mycobacteria also known as middlebrook 7h12 medium was purchased from becton dickinson ( pittsburgh , pa .). it contains 7h9 broth base , casein hydrolysate , bovine serum albumin , catalase and palmitic acid labeled with 14 c . it is specific for growing mycobacteria and is used in conjunction with the bactec brand 460 tb analyzer . this middlebrook 7h9 broth base media consist of 4 ml of broth mixture included in a sealed bottle . the culture used in the bioassay was m . tuberculosis ( atcc 25177 ). the synthons were added to bactec 7h12 b + bottled liquid media using becton dickinson 1 ml sterile syringes to a final concentration of 0 . 1 mg / ml . to each of these bactec bottles , 100 ul of bactec 7h12 b + cultured m . tuberculosis was inoculated using becton dickinson 1 ml sterile syringes . microbial growth activity in this culture medium is indicated by the release of 14 co 2 into the atmosphere of the sealed vial following the hydrolysis of 14 c - labeled palmitic acid by the microorganism . the bactec 460 tb analyzer : the gas in the atmosphere of the sealed bactec 12b vial is aspirated from the vial via a sterile needle attached to a robotic inside the bactec 460 tb analyzer system . the bactec analyzer operates by initially drawing room air through a dust filter , a flush valve , and an ion chamber transferring all 14 co 2 into co 2 trap where it is retained . this process cleans the electrometer and leaves it ready to start the next cycle . during the next cycle , a pair of 18g needles are heated . a pump produces a partial vacuum in the ion chamber used to lower the testing needles through the rubber septum of the vial being tested . a vacuum draws culture gas from the vial to the ion chamber . the electrometer measures the very small current that the radioactive 14 co 2 produces in the ion chamber . following removal of the radioactive culture gas , fresh 5 % co 2 is introduced into the medium headspace every time a vial is tested , enhancing the growth of mycobacterium . the current measured by the electrometer is amplified and displayed as a growth index ( gi ). the growth index is measured on a scale of 0 to 999 and is an indication of microbial growth activity in the bottle . usually , a gi of 10 or higher is an indication of definite microbial growth . the percent growth , and the percent inhibition in the presence of extract was calculated by the following formulas : %  gr = gi  ( with   no   extract ) gi  ( with   the   extract ) × 100  % %  in = 100  % - %  gr gr  :   percent   growth , gi  :   growth   index , in  :   percent   inhibition . animal toxicity bioassay . acute toxicity was studied on white mice of both sexes with weight ranging between 18 - 26 grams under intraperitoneal injection of 2 % solution of tested compound in starch ( the compound was dissolved in starch slime and injected ) on the basis of 0 . 1 ml of solution per 10 g of the animal weight . each dose was tested on the group of 6 animals that were observed during 14 day period . ( this method was approved by the pharmacology committee of russian ministry of health and has been widely used since 1968 .) averaged lethal dose ( ld 50 ) of the compound was computed using results of experiments on 5 - 7 groups of animals using the method of litchfield and wilkinson . ( belenkii m . l . “ elements of quantative determination of the pharmacological effect ,” leningrad , 1963 , 71 pages ). the disclosed invention makes it possible to produce and isolate oxo - heterocyclics , which have the property of a bacteriostatic agent toward mycobacterium tuberculosis and other mycobacteria . this discovery has several advantages . in the background there was a short description of one of the most used first - line antimicrobial agents for prophylaxis and treatment of tuberculosis since 1952 . the name of this drug is isoniazid ( isonicotinic acid hydrazide [ inh ]). patients with a recently positive protein positive derivative ( ppd ) skin test and a normal chest x - ray routinely are given a 6 - 9 month course of isoniazid . liver dysfunction is one of known complications of antituberculosis chemotherapy caused by this drug among a great number of other complications when isoniazid is co - administrated with other drugs ( w . w . yew , clinica chimica acta 313 ( 2001 ) 31 - 36 ). the toxicity issue is also a serious problem . in the us : a surveillance of cases of isoniazid poisoning by the american association of poison control centers from 1985 - 1993 revealed a low number of 138 cases in 1985 , with no fatalities , and a high number of 2656 cases in 1991 , with 6 fatalities . mortality / morbidity : acute ingestion by adults with as little as 1 . 5 g of isoniazid can lead to mild toxicity . ingestion of 6 - 10 g may be fatal , while ingestion of 15 g is usually fatal if not appropriately treated . the overall mortality rate for acute isoniazid toxicity has been estimated to be 19 %. with current methods of supportive care , however , this figure may be high . from 1972 - 1988 , an estimated 152 fatalities were caused by isoniazid - related hepatitis . the overall hepatitis - related death rates among patients using isoniazid prophylaxis is approximately 0 . 001 %. among individuals who complete a full course of prophylaxis , the hepatitis - related death rate has been calculated to be 23 . 2 - 57 . 9 / 100 , 000 . the mortality rate among individuals who develop overt isoniazid - induced hepatitis is 10 %. isoniazid is also known to be an acute / chronic hazard . this compound is an irritant of the skin , eyes , mucous membranes and upper respiratory tract . it can cause harm by ingestion , inhalation and skin absorption [ lenga , robert e . the sigma - aldrich library of chemical safety data . edition 1 . sigma - aldrich corporation . milwaukee , wis . 1985 . p . 1114 , # a .]. the acute toxicity of isoniazid is as following : lclo ( lowest published lethal concentration ) for man is 100 mg / kg . in animal testing with white mouse ld 50 ( lethal dose 50 percent kill ) for isoniazid was shown to be 100 mg / kg ( the same intraperitoneal injection method ( krasil &# 39 ; nikov , i . i . ; parfenov , a . i . ; strel &# 39 ; nikov , yu . e . ; smirnova , s . m . radiobiologiya ( 1973 ), 13 ( 4 ), 551 - 4 ), which was used by us to determine ld 50 dose ). all toxicity information about isoniazid can also be found on the web site : http :// ntp - server . niehs . nih . gov / htdocs / chem h & amp ; s / ntp chem5 / radian54 - 85 - 3 . html in addition there are a number of reports in recent literature which suggest the importance of developing a new treatment to combat strains of the deadly disease tuberculosis which have become resistant to current drugs . by reference to page 6 first paragraph and in the following it is seen that all of the specific compounds of the invention exhibit at least 10 times lower acute toxicity compare to isoniazid and high activity values . these compounds are highly active against mvcobacterium tuberculosis and have a very low toxicity , a lethal dose 50 ( ld 50 ) in animals . the percent activity and animal toxicity for each compound is as follows : of - 12 ( 81 % and ld 50 & gt ; 1500 mg / kg ), of - 13 ( 88 % and ld 50 & gt ; 1500 mg / kg ), and of - 15 ( 98 % and ld 50 & gt ; 1500 mg / kg ), the methyl esters of substituted 4 - oxo - 2 - butenoic acid compounds of the invention , which are unique in their anti - tubercular activity , can be used in a pharmaceutical composition comprising a non - toxic effective amount of the referenced compound or a tautomeric form thereof or a pharmaceutically acceptable salt thereof or pharmaceutically acceptable solvate thereof , and a pharmaceutically acceptable carrier thereof . for administration to man in the curative or prophylactic treatment of tuberculosis , in vitro dosages of compounds of the invention will generally be in the range of from 5 to 500 mg daily for an average adult patient ( 70 kg ). thus for a typical adult patient , individual tablets or capsules contain from 2 - 500 mg of active compound , in a suitable pharmaceutically acceptable vehicle or carrier , for administration in single or multiple doses , once or several times per day . dosages for intraveneous , buccal or sublingual administration will typically be within the range of from 5 - 1000 mg per single dose as required . in practice the physician will determine the actual dosing regimen which will be most suitable for an individual patient and it will vary with the age , weight and response of the particular patient . the above dosages are exemplary of the average case but there can be individual instances in which higher or lower dosage ranges may be merited , and such are within the scope of this invention . the maximum non - toxic one time administration dose for the compound ( s ) of the invention appears to be 1500 mg . for human use , the compounds of the invention can be administered alone or jointly , but will generally be administered in admixture with a pharmaceutical carrier selected with regard to the intended route of administration and standard pharmaceutical practice . for example , they may be administered orally , buccally or sublingually , in the form of tablets containing excipients such as starch or lactose , or in capasules or ovules either alone or in admixture with excipients , or in the form of elixirs or suspensions containing flavouring or colouring agents . the compounds may also be injected parenterally , for example intraveneously , intramuscularly , subcutaneously or intracoronarily . for parenteral administration , they are best used in the form of a sterile aqueous solution which may contain other substances , for example enough salts or glucose to make the solution isotonic with blood . thus in a further aspect the invention provides a method for the treatment and / or prophylaxis of mycobacterium tuberculosis and related mycobacteria in a human or non - human which comprises administering an effective , non - toxic amount of a specific compounds according to the invention or a tautomeric form thereof and / or a pharmaceutically acceptable salt thereof and / or a pharmaceutically acceptable solvate thereof , to a tubercular human or non - human mammal in need thereof . tables 1 , 2 and 3 disclose additional methyl esters of 4 - oxo - butenoic acids while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .	2
fig1 illustrates , in block diagram form , the major components of an exemplary stirring hot plate . a control panel 104 provides the interface to a user operating the hot plate . an exemplary control panel is shown in fig4 and includes input devices , such as control knobs 402 , 404 , that permit a user to adjust the heat and stirrer settings of the hot plate . by using these knobs , a desired temperature and rpm setting can be input to the controller 102 . the control panel 104 also includes output devices , such as leds 406 , 410 , 412 and 7 - segment displays 408 , that provide to a user indication of how the hot plate is operating . for example , the control panel 104 can display the current temperature of the hot plate or the temperature set point , the stirrer setting , or whether the hot plate is on or off . one particularly useful display is an indicator of whether the hot plate &# 39 ; s surface remains hot even though the hot plate has been turned off . one of ordinary skill will readily appreciate that not all the leds in the control panel are required ; for example , leds 410 and 412 can be omitted and replaced by appropriate graphical symbols to assist a user in identifying the controls . the hot plate includes a programmable controller 102 that manages the operation of the hot plate according to an embedded software routine . one of ordinary skill will appreciate that controller 102 can be implemented using a variety of equivalent hardware devices and software applications . based on the temperature setting , or set point , entered via the control panel 104 , the controller 102 energizes a heater 106 that warms the hot plate &# 39 ; s surface . a temperature sensor 108 , such as an rtd or a thermocouple , can be used to sense the temperature and provide feedback to the controller 102 . in this way the controller 102 can maintain the proper temperature of the hot plate . the control of the motor 112 may be accomplished in a number of ways in order to operate the hot plate at the desired rpms . the present invention does not require any specific method for controlling the motor 112 ; however , an exemplary motor control embodiment is described below that provides a number of advantages and benefits . typically , the controller 102 controls the speed of the motor 112 by turning on and off a triac 110 . one exemplary embodiment of the present hot plate uses a triac 110 along with a shaded pole motor 112 to rotate the magnets within the hot plate at a desired speed . the rotating magnets couple with a magnetic stir bar in a container on top of the hot plate so that a mixture in that container will be stirred as well . in some embodiments , unlike the schematic drawing of fig1 , the triac 110 may be a part of the programmable control 102 . fig2 depicts an ac waveform 202 that could be used to energize the motor 112 . however , to obtain accurate and stable control of the motor speed , phase control can be introduced through the use of the triac 110 . the triac can be turned on ( i . e ., allowing current flow ) for a portion of the waveform of fig2 and then switched off at a zero crossing . a phase controlled waveform 302 is illustrated in fig3 a . in particular , the waveform 302 has a 50 % duty cycle . the power to the motor 112 is a ratio of the area under the waveform 302 versus that of the full ac waveform 202 , which in this case is 50 %. speed is not linearly related to the power supplied to the motor so the motor speed resulting from waveform 302 will be less than 50 % of that which would result from waveform 202 . embodiments of the present invention permit the stirrer speed to be adjusted from approximately 50 rpm to approximately 1200 rpm . this range of speeds corresponds to a duty cycle range of approximately 25 % to approximately 95 %. however , one of ordinary skill will appreciate that other duty cycles and speed ranges are contemplated within the scope of the present invention . the specific correlation between duty cycle and speed depends on a number of factors , however , such as the fluid &# 39 ; s viscosity , the temperature of the fluid , motor efficiency , the stir bar mass and shape , the flask shape and the material of the flask . in addition to this usable duty cycle range , the triac and motor can be utilized to brake a magnetic stir bar . with known hot plates , the stirring action is terminated by disconnecting power from the motor thereby stopping the rotating magnets which results in the magnetic stir bar slowly spinning down within whatever mixture is on the hot plate . however , embodiments of the present invention include an operational mode in which the motor is rapidly braked so as to quickly slow the magnets and any coupled magnetic stir bar . in particular , when a user turns off the stirrer control , the controller 102 detects this condition and operates the triac accordingly . in particular , the waveform 312 , of fig3 b is a positively rectified waveform having substantially a 50 % duty cycle . the exemplary waveform 312 is a positively rectified version of the waveform 202 of fig2 ; however , a negatively rectified waveform can also be used . additionally , the exemplary waveform 312 is cut - off around region 313 slightly before a zero - crossing . by doing so , the programmable control 102 can ensure that no power of the opposite polarity is inadvertently applied to the motor 106 due to the finite timing constraints of real - world triacs and control circuitry . allowing anywhere from 70 % to 90 % of the possible waveform 312 to be applied to the motor 106 before cutting it off is sufficient to prevent unintended application of power to the motor 106 . in alternative embodiments of the present invention , no portion of the exemplary waveform 312 is cutoff thereby providing 100 % of the positively rectified waveform . in other embodiments , waveforms having less than 70 % duty cycle can accomplish the braking action as well . alternatively , instead of a rectified waveform , a dc waveform may be applied to the motor as well to initiate braking action . operating the motor according to the waveform 312 for approximately one to four seconds , such as 1 . 6 seconds , can quickly stop the motor rotation even from a high speed setting , such as , for example , 1200 rpm . as a result , a magnetic stir bar can be quickly stopped and a vortex within a stirrer mixture can be quickly collapsed if needed . if desired , a speed sensor 114 can be coupled with the rotating shaft ( not shown ) to sense the motor &# 39 ; s speed and provide it as feedback to the controller 102 . the motor speed can be used , for example , to determine when braking action can be terminated . for example , when a desired speed is reached ( such as 0 rpm ), the controller 102 can cease applying the braking action . as previously mentioned , an exemplary control panel 104 is illustrated in fig4 . the knob 402 on the left adjusts the temperature setting while the knob 404 on the right adjusts the stirrer speed . an indicator 406 , for example the international symbol for a hot surface , is shown that is illuminated when the hot plate surface is above a predetermined temperature , such as 50 ° c . a more detailed view of this indicator is shown in fig7 in which the symbol is accompanied by the text “ caution hot top .” this indicator alerts a user of the hot surface . also , a seven segment display 408 or other equivalent display is provided that shows either a temperature set point or the current temperature of the hot plate surface . other leds 410 and 412 can be used to alert a user that the heat and stirrer controls are active . in the past , hot plates have relied on a single indicator to remind a user that even though the hot plate may be turned off , the surface may still be hot . embodiments of the present invention include additional indicators as more fully described with respect to the flow chart of fig5 and illustrated in fig6 a and 6b . when the hot plate is powered on , in step 502 , the various display windows of the control panel become active as well . these displays can include , for example , the temperature set point display ( e . g ., 408 ). the displays are initialized , or zeroed , in step 504 , as part of the power - on sequence of the hot plate . the controller causes the display of zeroes or some other indication ( e . g ., dashes ) to inform the user that while the hot plate has been turned on , a temperature set point has not yet been entered by a user . if a stirrer speed display is present , it can be zeroed in step 504 as well . as part of its operation , the controller ( e . g ., 102 ) samples , in step 506 , the temperature setting , or set point , to determine if the heater needs to be turned on . for example , the temperature setting is controlled by a knob attached to the shaft of a potentiometer . as the shaft is rotated , the controller senses the change is resistance and converts it into a corresponding temperature control setting . alternatively , digital or other input devices could be used to provide the controller with the desired temperature setting . in response to the set point being entered by a user , the controller will turn on the heater and adjust , in step 508 , the heater to maintain the hot plate &# 39 ; s temperature according to the set point . the controller accomplishes this function by comparing a temperature sensor value of the hot plate &# 39 ; s surface with the control setting sensed , for example , from the potentiometer . based on this comparison , the controller adjusts the operation of the heater appropriately . concurrently with the adjustment of the heater , the controller also updates , in step 510 , the temperature set point display ( e . g . 408 ) so that the user can be informed of the temperature which will result from the current knob position . this display can be a seven - segment display , an lcd screen , or other similar displays . often , the display increments in five - degree steps as the user turns the knob up and decrements in five - degree steps when the user turns the knob down . five - degree steps are exemplary in nature and embodiments of the present invention contemplate other step sizes such as one - degree or even step sizes greater than five degrees . when the hot plate is initially turned on , there will be a warm - up period before the hot plate can attain the desired set point . in step 512 , the controller determines if the hot plate temperature has yet to reach the set point so that this condition can be visually conveyed to a user . to indicate that the hot plate surface has not yet reached the temperature control setting and , therefore , that the temperature control setting is different than the actual hot plate temperature , the controller can cause the display to blink or flash . once the hot plate temperature reaches the set point , then the controller , when performing step 512 , will determine that the set point has been reached and cause the display to stop blinking and become solidly lit . the steps of sampling the temperature setting and updating the display are continually repeated by the controller so that the user &# 39 ; s input via the control knob appears to change the display almost immediately . the temperature of the hot plate surface is sensed , in step 514 , to determine if it is above a certain temperature , such as 50 ° c . if so , then a “ hot ” indicator on the control panel ( e . g . 406 ) can be activated . if not , the controller can repeatedly sense the temperature until a determination is made that the “ hot ” indicator should be activated . as shown in fig7 , the “ hot ” indicator may include both a graphical symbol and words . accordingly , both the words and the symbol , or simply one of them , may be constructed so as to be backlit , or illuminated , to become more visible when activated . additionally , intermittently blinking the indicator 406 will enhance its visibility as well . the controller continually monitors the operation of the hot plate so that it can detect , in step 516 , when a user turns the power off to the heater or to the entire hot plate . eventually , upon completion of a desired hot plate operational routine , the user will want to turn off the heater and the controller will determine when the heater knob has been turned off . once the power is turned off , the controller will continue to operate in order to determine , in step 518 , if the hot plate &# 39 ; s surface has cooled to a safe temperature . if the hot plate has not cooled sufficiently , then the potentially dangerous condition is visually displayed , in step 522 , to the user . once the plate has cooled , however , the display can be shutdown , in step 520 . for example , the hot plate surface temperature is sensed to determine if it is above a certain temperature , such as 50 ° c . if so , then the “ hot ” indicator ( e . g ., 406 ) can be caused to blink , in step 522 , thereby making it more visually noticeable than simply a static display element . also , the temperature display window ( e . g ., 408 ) can have a blinking or scrolling message as an additional indicator that the hot plate surface remains hot even though the hot plate has been turned off . for example , the display could alternate displaying the words “ hot ” and “ off ”. other types of appropriate displays and phrases could be used as well to alert a user to the hot plate &# 39 ; s condition . in addition to using words other than “ hot ” and “ off ” to indicate the hot condition of the hot plate ( e . g ., words in a foreign language ); an even longer message could be displayed that scrolls across the display 408 . additionally , a temperature other than 50 ° c . can be selected as the threshold for determining whether or not to power off the displays in step 520 without departing from the scope of the present invention . the display 408 may be a multi - character display comprised of one or more multi - segment displays , such as a seven - segment display , or some other type of multi - character display . accordingly , the specific characters that can be displayed on the display 408 partially depends on the display &# 39 ; s attributes . for example , in the exemplary display 408 of fig6 a , the letter “ t ” in “ hot ” has a vertical line in its center . a conventional seven - segment display does not have these center segments and if one were used in the display 408 , then some other recognizable “ t ” character would need to be used . referring to fig6 a and 6b , an exemplary hot plate control panel is depicted at two different instances in time . assuming the temperature knob 402 has recently been turned off , the surface of the hot plate will be hot . accordingly , the indicator 406 blinks or flashes to alert a user . in addition , the display window changes periodically so as to draw the user &# 39 ; s attention to the hot plate &# 39 ; s condition . at one moment in time , the display 408 can display the phrase “ hot ” while at another moment it can display the phrase “ off ”. thus , the dynamic nature of the display 408 is visually effective at getting the user &# 39 ; s attention while also informing them of both the condition of the temperature setting ( i . e ., off ) and the current safety concern over the hot plate &# 39 ; s temperature ( i . e ., hot ). the displays in the above - mentioned figures are exemplary in nature and may be comprised of all capital letters , small , letters , a mixture of upper - case and lower - case letters , non - letter characters , and various words and phrases . in addition to the temperature control of the hot plate , the controller also samples , in step 550 , a stirrer control setting which can again be a potentiometer or some more complex input device . in response to the stirrer control setting , the controller adjust the stirrer motor , in step 552 . as explained previously , phase control can be implemented using a triac so that the duty cycle of the voltage waveform powering the motor can be adjusted to generate the desired motor speed . eventually , the controller detects , in step 554 , when a user has turned off the stirrer and initiates braking of the motor . as explained earlier , a rectified phase - controlled signal is used , in step 556 to brake the motor , duty cycles from approximately 3 % to as high as 100 % may be used to accomplish the braking . in one embodiment , this duty cycle is applied for a predetermined period of time , such as 1 . 6 seconds . alternatively , the motor speed could be sensed and a feedback loop used to the controller such that the controller applies the reduced duty cycle based on the shaft speed and stops applying it once the shaft speed reaches a threshold . in step 558 , the motor is powered off once braking is complete . while the invention has been illustrated by the description of one embodiment and while the embodiment has been described in considerable detail , there is no intention to restrict nor in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those who are skilled in the art . therefore , the invention in its broadest aspects is not limited to the specific details shown and described . consequently , departures may be made from the details described herein without departing from the spirit and scope of the claims which follow .	1
referring to the drawings in particular , fig1 shows a schematic view of the arrangement of the device in the case of a one - part spring element 1 . a chassis 2 of the motor vehicle and one of the axle components 3 form here support surfaces 4 of the spring element 1 , which is inserted with a prestress between the chassis 2 and the axle components 3 . the axle components 3 are connected to a wheel 6 via a steering knuckle 5 . a magnet array 7 is fastened directly to the spring element 1 in the upper area of the spring element 1 , which is designed as a coil spring in the exemplary embodiment . opposite hereto , a magnetic field sensor 8 is fastened to the chassis 2 such that the magnetic field sensor 8 is located in the area between two magnetic poles 9 of the magnet array 7 , which , facing each other , form an air gap 10 . the magnetic poles 9 are arranged facing each other as like poles , so that the magnetic field intensity becomes zero in one place in the air gap 10 formed by the magnetic poles . if the magnetic field sensor 8 is located in the area of this plane , for example , when the motor vehicle is in the normal position , no field intensity is detected by the magnetic field sensor 8 . the magnetic field sensor 8 in the form of a linear hall ic is able to detect an increase in the intensity of the field ( field intensity ) in case of the slightest shift from this normal position . fig2 shows a schematic view of the arrangement of the device , in which the spring element 1 has a multipart design . the spring element is composed in this exemplary embodiment of a coil spring 11 and a plurality of plate springs 12 as well as a mounting point 13 arranged between the coil spring 11 and the plate spring 12 . the coil spring 11 and the plate springs 12 are connected in series with one another . the axle component 3 of the motor vehicle , which is in turn connected to the wheel 6 via the steering knuckle 5 , and the mounting point 13 form the support surfaces 4 for the coil spring 11 , and the mounting point 13 as well as the chassis 2 form the support surfaces 4 for the plate springs 12 . the magnet array 7 is fastened at the mounting point 13 , as a result of which the mounting of the magnetic field sensor 8 is simplified , on the one hand , and , on the other hand , the risk that the magnet array 7 is shifted from the position of the magnet array 7 and the magnetic field sensor 8 relative to one another , which position is optimal for the detection , in case of a possible twisting due to compression of the coil spring 11 forming the one - part spring element ( see fig1 ), is minimized . the magnetic field sensor 8 is arranged in the air gap 9 of the magnet array 7 . on the other side , it is fastened to the chassis 2 of the motor vehicle . fig3 shows an enlarged sectional view of the schematic view of the multipart spring strut with the magnetic poles 9 and the magnetic field sensor 8 . a lowermost turn of the coil spring 11 lies on the mounting point 13 in this case as well . for example , the magnetic poles 9 are fastened to the mounting point 13 . the magnetic field sensor 8 arranged between the magnetic poles 9 is connected to the axle component 3 on its side facing away from the magnetic poles 9 . it is also conceivable to arrange the magnetic field sensor 8 at the mounting point 13 while the magnetic poles 9 are fastened at the same time to the axle component 3 . five plate springs 12 are connected in series with the coil spring 11 via the mounting point 13 under the mounting point 13 , the plate springs 12 being arranged such that the smallest and largest diameters of the individual plate springs 12 touch each other . the magnetic field sensor 8 is arranged in the exemplary embodiment according to fig1 such that in the normal position of the motor vehicle , it is in the plane of the air gap 10 , in which the intensity of the field ( field intensity ) equals zero . the magnetic field sensor 8 detects no magnetic field in this position . if the vehicle is , for example , loaded , the spring element 1 is compressed more . the magnet array 7 moves as a result upward relative to the chassis 2 simultaneously with the spring element 1 . since the magnetic field sensor 8 is fastened to the chassis 2 of the motor vehicle , the position of the magnetic field sensor does not change in space . by contrast , the smallest change in the position of the magnet array 7 shifts the position of the two magnetic poles 9 , as a result of which an increase in the intensity of the magnetic field is immediately detected by the magnetic field sensor 8 . if the vehicle is again unloaded , the spring element 1 expands and the magnet array 7 moves downward together with the spring element 1 relative to the magnetic field sensor 8 , which in turn brings about a shift of the magnetic poles 9 and thus a reduction of the intensity of the magnetic field in the air gap 10 . it is also conceivable to arrange the magnetic field sensor 8 on the spring element 1 while the magnet array 7 is fastened at the same time to the chassis 2 of the motor vehicle . a change in the load relative to the vehicle would then bring about a change in the position of the magnetic field sensor 8 within the air gap 10 formed by the magnetic poles 9 of the magnet array 7 , as a result of which a change in the intensity of the magnetic field could likewise be detected by the magnetic field sensor 8 . the coil springs 11 and the plate springs 12 are also compressed greatly corresponding to their characteristics in the case of the multipart spring element 1 according to fig2 . a spring excursion performed by the coil spring 11 now represents a main spring excursion δs 1 , and a spring excursion of the plate springs 12 represents a spring excursion δs 2 . since the characteristics of the plate springs 12 are substantially harder than those of the coil spring 11 , the spring excursion deltas 1 performed by the coil spring 11 is substantially greater than the spring excursion deltas 2 of the plate springs 12 . the spring excursion of the actual spring compression process of the spring element of the motor vehicle is thus shown in a transmission ratio that can be selected by selecting the spring rate and the number of the plate springs 12 . the magnet array 7 and the magnetic field sensor 8 are thus exposed to the smaller spring excursion δs 2 only , which is equivalent to a smaller installation space . due to the magnetic field sensor being fastened to the axle component 3 according to fig3 , the change in the intensity of the magnetic field is caused by the fact that the coil spring is loaded more heavily and applies a stronger force on the mounting part 13 , for example , during the loading of the vehicle , as a result of which the plate springs 12 located under the mounting part 13 are likewise compressed and the relative distance between the axle component 3 and the mounting point 13 decreases corresponding to the particular characteristics of the plate springs 12 . this in turn brings about a change in the position of the magnetic field sensor 8 between the magnetic poles 9 , and a change in the intensity of the magnetic field can thus be detected by the magnetic field sensor 8 . if the vehicle is unloaded , the relative distance between the mounting point 13 and the axle component 3 increases correspondingly . the spring excursion of the spring compression process proper of the spring element of the motor vehicle can thus be represented by the plate springs 12 in a transmission ratio that can be set by selecting the spring rate and the number of plate springs 12 in this exemplary embodiment as well . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the principles of the invention , it will be understood that the invention may be embodied otherwise without departing from such principles .	6
fig1 illustrates the fundamental construction of a voltage follower circuit according to a first embodiment of the invention . the voltage follower circuit , as designated at reference numeral 101 , in the present embodiment comprises a differential amplifier 102 , first and second buffer circuits 103 and 104 , a resistor 105 and two compensating capacitances ( for example , capacitors ) 106 and 107 . this circuit construction is featured in that outputs of the first and second buffer circuits 103 and 104 are connected to each other through the resistor 105 , with the output of first buffer circuit 103 being fed back to one input of the differential amplifier 102 and the output of the second buffer circuit 104 being connected to serve as an output of the voltage follower circuit 101 . by providing the resistor 105 between the output of voltage follower circuit 101 and a node for feedback to the differential amplifier 102 in this manner , the phase margin can be increased to stabilize output operation . in addition , since the output of second buffer circuit 104 can directly drive a load , the time constant can be reduced and the recovery time from voltage variations can be shortened . in other words , the first buffer circuit 103 has a high phase margin to function to prevent oscillation . the second buffer circuit 104 has a high through rate to function to reduce the feedback time . the differential amplifier 102 receives at the other input an input from the outside of the voltage follower circuit 101 and , at one input , the fed back input . the output of differential amplifier 102 connects to ground through the compensating capacitor 107 . the first and second buffer circuits 103 and 104 receive the output of the differential amplifier 102 . the compensating capacitor 106 is connected in parallel with the first buffer circuit 103 . the output of the second buffer circuit 104 serves as the output of the voltage follower circuit 101 . the output of first buffer circuit 103 and the output of second buffer circuit 104 routing through the resistor 105 are fed back to the differential amplifier 102 . the first embodiment of the invention will now be described with reference to fig2 to 7 . the first embodiment of the invention is directed to a voltage follower circuit dispensing with the aforementioned stabilizing capacitor , the detailed circuit construction of which is exemplified in fig2 and 3 . in fig2 , a voltage follower circuit 201 comprises mos transistors 202 to 211 , a resistor 212 and compensating capacitances ( for example , capacitors ) 213 and 214 . for the correspondence with components of fig1 , it will be appreciated that the differential amplifier 102 corresponds to a component constituted by the mos transistors 202 to 205 , the first buffer circuit 103 corresponds to a component constituted by the mos transistor 206 and the second buffer circuit 104 corresponds to a component constituted by the mos transistors 207 to 211 . a voltage follower circuit 301 shown in fig3 differs from the voltage follower circuit 201 shown in fig2 in that interchange of p channel with n channel of the mos transistors and interchange of connection of power supply voltage are carried out . when considering the range of available voltage level , the voltage follower circuit 201 has the output range close to ground voltage gnd ( low voltage ) and the voltage follower circuit 301 has the output range close to power supply voltage vdv ( high voltage ). accordingly , it is desirable that the two circuits be used purposively in accordance with the level of a gray scale voltage to be delivered . a voltage follower circuit with stabilizing capacitor based on a so - called class “ a ” amplifier has a wider output range than that of the voltage follower circuit of the present invention . therefore , for only a gray scale voltage at a level close to the power supply voltage vdd or ground voltage gnd , the voltage follower circuit with stabilizing capacitor may be used . an example of the circuit construction based on this idea and used for generating 64 kinds of gray scale voltages will be described . fig4 is a circuit diagram showing the construction of a gray scale voltage generating circuit 401 . comprises voltage follower circuits with stabilizing capacitors 402 , 403 and 408 , 409 based on so - called class “ a ” amplifiers , voltage follower circuits 404 , 405 each implemented with the aforementioned voltage follower circuit 301 according to the present embodiment and voltage follower circuits 406 , 407 each implemented with the aforementioned voltage follower circuit 201 also according to the present embodiment . as will be seen from fig4 , the voltage follower circuits 402 to 409 are arranged in such a manner that the levels of voltages delivered out of these circuits become lower in this order . more particularly , the voltage level gradually decreases from the voltage follower circuit 402 to the voltage follower circuit 409 . a ladder resistor 410 divides outputs of the voltage follower circuits 402 to 409 to generate gray scale voltages v 0 to v 63 . in the gray scale voltage generating circuit 401 of the present invention , reference voltages , generally designated at vref , are not inputted externally but are generated by inputting a 2 - level reference voltage of reference voltage vh at a high level and reference voltage vl at a low level and dividing the 2 - level reference voltage by a ladder resistor 411 . advantageously , this can reduce the number of wiring lines leading to the outside . with the circuit construction described above , the gray scale voltage generating circuit 401 can generate 64 kinds of gray scale voltages . in each of the voltage follower circuits with stabilizing capacitor 402 , 403 , 408 and 409 , the differential amplifier has its output fed back to its input . the output of the differential amplifier is connected on the other hand to ground through a stabilizing capacitance 412 ( for example , capacitor ). next , construction and operation of a drain drive circuit including the gray scale voltage generating circuit 401 will be described by taking an instance where so - called vcom modulation drive s carried out . fig5 is a block diagram of the drain drive circuit designated at 501 . the circuit 501 comprises a data latch circuit 502 for latching display data for one line , a data inversion circuit 503 for inverting the polarity of the display data , and gray scale voltage selecting circuits 504 each adapted to select a gray scale voltage matching with the data from a plurality of gray scale voltages v 0 to v 63 generated by the gray scale voltage generating circuit 401 . firstly , the drain drive circuit 501 receives from an external liquid crystal controller a signal of cl1 indicative of one scanning period ( one horizontal period ), a signal of en indicative of a period for transfer of effective display data , a signal of m indicative of the polarity of alternation ( making it alternate ), a signal of cl2 indicative of a transfer clock of the display data and a signal of data indicative of the display data . in the present embodiment , it is assumed that the data has gray scale information of plural bits ( for example , 6 bits ) in respect of each pixel . fig6 shows an example of operation of the drain drive circuit 501 . the data latch circuit 502 repeats an operation in which it stores data for one line during a period of the en being high (= 1 ) by using the cl2 as fetching clock and delivers , as ld ( line data ), the stored data at a time in synchronism with the cl1 . the data inversion circuit 503 receives inputs of the ld and m and delivers a pd while keeping the ld unchanged when the m is at low level (= 0 ) or after inverting the ld when the m is at high level (= 1 ). each of the gray scale voltage selecting circuits 504 selects one gray scale voltage from the inputted gray scale voltages v 0 to v 63 in accordance with a value of the pd so as to deliver a vd . fig7 shows a timing chart useful to sum up the operation of the drain drive circuit 501 . as will be seen from fig7 , voltage levels matching with the display data are delivered in accordance with the cl1 , thus realizing driving waveforms of general vcom modulation drive . the drain drive circuit 501 described herein was made in the form of an ic and actual characteristics were measured . firstly , as for the output range , the voltage follower circuits 404 and 405 of the invention had ( vdd − 0 . 6v ) or less and the voltage follower circuit 406 and 407 of the embodiment had ( gnd + 0 . 8v ) or more . in addition , when a 2 - inch tft liquid crystal device of 120 × 160 pixels was connected to the drive circuit to carry out the vcom modulation drive at a frame frequency of 60 hz , all gray scale voltages can be freed from adversity such as oscillation and an excellent display can be obtained . as will be seen from the above , the voltage follower circuits 404 to 407 of the present embodiment can provide good characteristics even without resort to the stabilizing capacitor 412 and therefore , in comparison with the conventional drain drive circuit , can reduce the number of parts of stabilizing capacitor . in the gray scale voltage generating circuit 401 in the present embodiment , the voltage follower circuits with stabilizing capacitor are used in combination but this construction is not limitative . for example , if the ranges close to the power supply voltage vdd and the ground voltage gnd are not used , the circuit may be constructed of only the voltage follower circuits 201 and 301 in the present embodiment . next , other embodiments of the invention will be described with reference to fig8 to 10 . in other embodiments , gray scale voltage generating circuits are provided which can realize suppression of charge / discharge of a stabilizing capacitor during asymmetrical drive . like the foregoing , voltage follower circuits for positive and negative polarities are provided and they are used in switching fashion . fig8 illustrates a circuit diagram showing the construction of a gray scale voltage generating circuit according to a second embodiment of the invention . the circuit comprises switches for switching gray scale voltages for positive and negative polarities , a ladder resistor 803 for generating gray scale voltages for positive polarity , and a ladder resistor 804 for generating gray scale voltages for negative polarity . other components are identical to those of the gray scale voltage generating circuit 401 shown in fig4 . this circuit construction is featured in that there are provided two kinds of ladder resistors 803 and 804 for positive and negative polarities and two kinds of voltage follower circuits 402 and 408 for positive polarity and voltage follower circuits 403 and 409 for negative polarity and that switches are provided which respond to an a . c . signal from the liquid crystal controller to switch the two kinds of ladder resistors and the two kinds of voltage follower circuits . in connection with the voltage follower circuits 402 , 403 and 408 , 409 , outputs of these circuits are switched by means of the switches . the switches 801 succeed the voltage follower circuits with stabilizing capacitors 402 , 403 and 408 , 409 whereas the switches 802 precede voltage follower circuits without stabilizing capacitors 404 to 407 in this embodiment . for example , during a period for the a . c . signal to be low (= 0 ), the switch 801 selects a reference voltage obtained by dividing a potential difference between reference voltages vhp and vlp by means of the ladder resistor 803 for positive polarity and during a period for the a . c . signal to be high (= 1 ), selects a reference voltage obtained by dividing a potential difference between reference voltages vhn and vln by means of the ladder resistor 804 for negative polarity . with this construction , the outputs of the voltage follower circuits 402 , 403 and 408 , 409 can be unvarying and charge / discharge of the stabilizing capacitor 412 can be avoided . on the other hand , for the voltage follower circuits 404 to 407 dispensing with stabilizing capacitor in this embodiment , the switches 802 precede amplifier inputs . this is because the number of amplifiers to be used can be decreased in comparison with the construction in which the amplifier input is followed by the switch . like the foregoing , during a period for the a . c . signal to be low (= 0 ), the switch 802 selects a reference voltage obtained by dividing a potential difference between reference voltages vhp and vlp by means of the ladder resistor 803 for positive polarity and during a period for the a . c . signal to be high (= 1 ), selects a reference voltage obtained by dividing a potential difference between reference voltages vhn and vln by means of the ladder resistor 804 for negative polarity . fig9 illustrates a circuit diagram showing the construction of a gray scale voltage generating circuit according to a third embodiment of the invention . the circuit comprises switches 901 each adapted to selectively switch connection between a voltage follower circuit and two stabilizing capacitors 412 and switches 902 each adapted to make a choice of a reference voltage generated by a ladder resistor for positive polarity or a reference voltage generated by a ladder resistor for negative polarity . it will be seen from fig9 that with this circuit construction , only the stabilizing capacitors 412 are provided for positive and negative polarities and the switch is provided which selectively switches connection of each of the voltage follower circuits 402 , 403 and 408 , 409 to each of the stabilizing capacitors . this construction is advantageous over the gray scale voltage generating circuit in the second embodiment shown in fig8 in that the number of the voltage follower circuits 402 , 403 and 408 , 409 can be one for one reference voltage to reduce the circuit scale . the switches 902 precede the voltage follower circuits . the switch 901 selects one , for positive polarity , of the two stabilizing capacitors 412 during a period for the a . c . signal to be low (= 0 ) and selects the other , for negative polarity , of the two stabilizing capacitors during a period for the a . c . signal to be high (= 1 ). fig1 illustrates a circuit diagram showing the construction of a gray scale voltage generating circuit according to a fourth embodiment of the invention . the circuit comprises resistors 1001 for positive polarity , resistors 1002 for negative polarity , and switches 1003 each adapted to selectively switch connection between a ladder resistor for generation of reference voltages and each of the resistors 1001 and 1002 for positive and negative polarities . the circuit construction shown in fig1 intends to singularize the ladder resistor for generation of reference voltages . specifically , any one of the ladder resistors 803 and 804 in the gray scale voltage generating circuit shown in fig8 can be unneeded . namely , by making resistance of the resistor 1001 different from that of the resistor 1002 , gray scale voltages at different levels can be generated at positive and negative polarities . this construction is preferably applied to upper and lower ends of the ladder resistor so as to enhance the degree of freedom of adjustment . the switch 1003 selects the resistor 1001 for positive polarity during a period for the a . c . signal to be low (= 0 ) and selects the resistor 1002 for negative polarity during a period for the a . c . signal to be high (= 1 ). in the gray scale voltage generating circuits according to the second to fourth embodiments of the invention set forth so far , even when the so - called asymmetric drive is carried out , charge / discharge of the stabilizing capacitor connected to the voltage follower circuit can be avoided . accordingly , a drain drive circuit of more reduced consumption power can be provided . fig1 illustrates a circuit diagram showing the construction of a gray scale voltage generating circuit according to a fifth embodiment of the invention . in the fifth embodiment of the invention , a method is disclosed which can optimize steady current flowing through a ladder resistor in match with the number of colors possessed by display data with the aim of eliminating any consumptive steady current flowing the through the ladder resistor . in the fifth embodiment , color number information possessed by display data is of multiple bits ( for example , plural bits amounting to 6 bits ) or is of minor bits ( for example , a single bit amounting to one bit ) and it is assumed that either state is determined by information supplied from the external liquid crystal controller . it is also assumed that when the color number information possessed by the display data is of 6 bits , all of 64 kinds of gray scale voltages ( v 0 to v 63 ) are used and in case of one bit , only gray scale voltages at opposite ends ( v 0 and v 63 ) are used . the circuit of fig1 comprises resistors 1101 for 6 bits , resistors 1102 for one bit , and switches 1103 each adapted to switch connection to the resistor 1101 for 6 bits and connection to the resistor 1102 for one bit in accordance with the color number information . for example , when the color number information is high (= 1 ), the switch 1103 recognizes a 6 - bit display mode to select the resistor 1101 for 6 bits and when the color number information is low (= 0 ), it recognizes a one - bit display mode to select the resistor 1102 for one bit . here , the resistance of the one - bit display resistor 1102 is so determined in advance as to be sufficiently larger than that of the 6 - bit resistor 1101 in order that when the resistor 1102 is selected , the current flowing through the ladder resistor can be reduced . this takes advantage of the fact that in the display mode of the color number being one bit , only the gray scale voltages at opposite ends ( v 0 and v 63 ) are used as described previously and consequently , even if the levels of other gray scale voltages vary , this variation does not affect display . in case the display data is of minor bits , the number of gray scales of the display data is small but in case the display data is of multiple bits , the number of gray scales of the display data is large . in place of the resistor 1101 for 6 bits , resistor 1102 for one bit and switch 1103 , a variable resistor can be used and in place of the switch 1103 , a variable resistor control circuit can be used . for example , if the color number information is high (= 1 ), the variable resistor control circuit recognizes the 6 - bit display mode to decrease the resistance of the variable resistor and if the color number information is low (= 0 ), it recognizes the one - bit display mode to increase the resistance of the variable resistor . as described above , the gray scale voltage generating circuit according to the fifth embodiment of the invention can control the value of current flowing through the ladder resistor for generation of gray scale voltages in accordance with the color number information . accordingly , a drain drive circuit of more reduced consumption power can be provided . in the fifth embodiment of the invention , two kinds of resistors for 6 bits and one bit are provided but this is not limitative and for example , in the one - bit display mode , v 0 and v 63 can be completely disconnected from the ladder resistor . thus , in an application of the gray scale voltage generating circuit according to the fifth embodiment of the invention to a handy phone or an information processing apparatus requiring low power such as pda , when the information processing apparatus is in waiting condition , the mpu of the information processing apparatus may command information purporting that the number of colors is small to the gray scale voltage generating circuit and when the information processing apparatus is in call condition ( during communication ), the mpu of the information processing apparatus may command information purporting that the number of colors is large to the gray scale voltage generating circuit . in other words , the information processing apparatus gives a display of multiple gray scale when the user makes use of it but gives a display of minor gray scale when the user does not make use of it . through this , power consumption in the gray scale voltage generating circuit can be reduced when the user does not make use of it , thus reducing power consumption in the information processing apparatus . fig1 illustrates a block diagram of an information processing apparatus provided with the gray scale voltage generating circuit according to the invention . the information processing apparatus , as generally designated at reference numeral 1 , comprises a display apparatus 2 for displaying display data and a mpu 3 for performing operation processing . the display apparatus 2 includes a display panel 4 having display pixels arranged in matrix , a drain drive circuit 501 for generating gray scale voltages corresponding to the display data and applying the gray scale voltages to the display panel 4 , a gate drive circuit 5 for selecting a line of pixels to be applied with the gray scale voltages , and a system power supply generating circuit 6 for generating operating power supply for the drain drive circuit 501 and gate drive circuit 5 . the system power supply generating circuit 6 generates reference voltages vh , vl , vhp , vlh , vhn and vln and a power supply voltage vdd for the drain drive circuit 501 . the drain drive circuit 501 includes a gray scale voltage generating circuit 401 for generating a plurality of gray scale voltages v 0 to v 63 , a gray scale voltage selecting circuit 504 for selecting one gray scale voltage matched with the display data from the plurality of gray scale voltages v 0 to v 63 , a system interface 505 for receiving the display data and control signals from the mpu 3 , a display memory 506 ( for example , ram ) for temporarily storing one frame of the display data , and a control register 507 for setting gray scale voltage characteristics matching with characteristics of the display panel 4 . the control register 507 includes a register for adjusting the amplitude , a register for adjusting the gradient and a register for performing fine adjustment , in the relation between gray scale number and gray scale voltage . the first to fifth embodiments of the invention have been described by way of example of the vcom modulation drive but this is not limitative and the invention may also be applied , on the basis of a similar idea , to dot inversion drive and column inversion drive known as other drive methods . advantageously , the drain drive circuit according to the invention can reduce the number of external stabilizing capacitors used or dispense with the external stabilizing capacitor to thereby attain cost reduction . further , even when external stabilizing capacitors are provided , the circuit can be so constructed as to prevent the stabilizing capacitor per se from being charged / discharged and consequently , consumption power can be reduced . further , the necessary steady current can be controlled in match with the number of colors possessed by input display data , thereby making it possible to further reduce consumption power . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .	6
various tracked robotic vehicles have been developed that are the subject of , for example , u . s . pat . nos . 6 , 431 , 296 , 6 , 263 , 989 , 6 , 668 , 951 and 6 , 615 , 885 . these patents are instructive on the construction of tracked robotic vehicles having driven flippers , and means of articulation of robotic components , and are hereby incorporated by reference in their entirety into this application . autonomous control routines and control systems useful , for example , to avoid an obstacle , escape an area , or navigate an area , optimize communications or coverage or seek radio performance are disclosed in u . s . patent application ser . no . 11 / 633 , 869 filed dec . 4 , 2006 and titled “ autonomous coverage navigation system ,” and u . s . patent application ser . no . 12 / 100 , 782 , filed apr . 10 , 2008 and titled “ robotics systems ,” the entire contents of which are incorporated herein in their entirety by reference . for example , to avoid an obstacle , a control routine can cause the robot to travel in an outward spiral or to bounce and recoil from obstacles making random turns . with reference to fig1 , a mobile robotic vehicle or robot 2 is operable via an operator control unit ( ocu ) or remote control system 4 . remote communications can be transmitted via radio signal , infrared signal , wi - fi signal , cellular signal , or other suitable signal . in some circumstances , robot 2 can perform automated routines without remote use intervention . in other cases , a combination of automated routines and user controls are used to maneuver robot 2 . remote control system 4 can include any number of radio transceivers or other communications links and can interface with any number of robots or though any number of robots as mesh network nodes or other parts of a communications network . this version of robot 2 is sized to be portable , and to substantially fit within a bounding volume approximately 18 cm ( 7 in .) long , 12 cm ( 5 inches ) wide and 6 cm ( 2 inches ) tall . the overall dimensions of a particular embodiment are about 16 cm × 12 cm × 6 cm excluding the antenna and camera protruding from the chassis , with a total mass of about 0 . 5 kg and a top speed of about 0 . 6 m / s over a smooth surface . in some embodiments , the vehicle is configured to fit in a combat uniform cargo pants pocket . multiple robots 2 can be stacked to fit in a backpack . compactness and portability allow robot 2 to be easily transported by an individual and to be deployed into an area by simply tossing the robot . the robot is removed from a carrying compartment , is activated by pulling a grenade - style pull pin , and is then tossed down a corridor , up a stairwell or into a window . the platform can be thrown by a single person or launched into an upper window or rooftop using an improvised slingshot . landing on a top floor , the remotely operated platform may be able to bypass some typical obstacles and travel down stairs . the operator can evaluate the resultant video before determining the next course of action . the robot can also be used to search for and assess booby traps , enemy personnel , and improvised explosive devices ( ieds ). in a particular embodiment , each of the robot 2 and remote controller 4 and weight less than eight pounds . in some cases the robot is between 0 . 5 and 1 . 0 kg and the remote control 4 is a small pda with a mass less than 0 . 5 kg . a separate charging station can be used for both the remote control 4 and robot 2 . remote control system 4 allows an operator to control robot 2 from a distance . the operator can select different levels of human control over the robot , ranging from a teleoperation mode , in which the operator directly controls the motors and actuators on the robot , to autonomous operation , in which the operator passes higher - level command to the robot . in partially autonomous operation , robot 2 can perform tasks such as following a wall , avoiding an obstacle , surmounting an obstacle , avoiding a drop off or “ cliff ,” avoiding becoming high centered , evading a moving object , positioning a transceiver , self - righting , repositioning to optimize communication network coverage , and the like . alternative versions of the remote control system 4 support teleoperation as well as a means of switching between teleoperation and autonomous control . the user can interrupt autonomous operation of the robot at any time to give commands and direction , and the robot can operate autonomously when not receiving particular directions from the user . the system provides predetermined warning signals to the operator , for instance if it is unable to operate autonomously , possibly by means of a vibrating unit that could be worn by the operator and which would be effective in a noisy environment . in addition , the user can add additional tasks to the robot &# 39 ; s mission and request notification from the robot when milestone tasks have been achieved . versions of the robot can perform various autonomous tasks which can be initiated by the operator from remote control system 4 . these include obstacle avoidance , wall following , climbing stairs , recovery from high centering , self - righting , returning “ home ,” searching for a designated object , mapping , and establishing a communications network . the robot can use the various mobility modes described above in these autonomous operations , and if necessary , can call for operator assistance during its execution of a task . alternative configurations of pivotal arms can be used . for example , a single central “ arm ” can be used . with reference to fig2 a - d , robot 2 includes a body portion or chassis 6 housing , inter alia , drive components , a power supply , control system and communication module . a pair of drive wheels 8 is positioned at a forward end of chassis 6 and a pair of idler wheels 10 is positioned at a rearward end of chassis 6 . wheels 8 and 10 can include spiral spokes to provide additional impact resistance . a pair of resilient tracks 12 is trained about wheels 8 and 10 on opposing sides of chassis 6 extending from the sides of the chassis to provide a driven support surface for robot 2 . tracks 12 are continuous flexible belts with interior surface features for engaging drive wheels 8 and exterior surface features for gaining traction over various terrains . first and second rotatable arms or flippers 14 extend radially from a common drive axle 16 . in the illustrated embodiment , idle wheels 10 free spin about flipper drive axle 16 . flippers 14 are configured to extend through a 360 degree range of motion to allow robot 2 to perform various positioning , obstacle surmounting and self - righting maneuvers . in other embodiments , a single rotatable arm can accomplish these functions . in a particular embodiment , flippers 14 are made from a flame rated advanced formula polymer with 85d shore hardness available from quantum cast , part number afp3100fr , ul 94 fr and far 25 . 853 . through holes or other features can be provided on flippers 14 for attachment of flipper accessories , e . g ., cameras , sensors , or wheels positioned at the flipper tip or along the flipper length . for example , a camera , antenna or sensor can be mounted on the end of the arm to provide better exposure or higher vantage point . flippers 14 can be rotated to any desired angle relative to chassis 6 . robot 2 is designed to move about in a variety of environments , including an urban environment of buildings ( including staircases ), streets , underground tunnels , as well as in vegetation , such as through grass and around trees . robot 2 has a variety of features which provide robust operation in these environments , including impact resistance and tolerance of debris entertainment . wheels 8 and 10 are positioned on chassis 6 to provide greater ground clearance when right side up , yet can provide sufficient clearance in some embodiments for operation when robot 2 is inverted . in the present embodiments , robot 2 preferably recovers from a tumble or fall in which it is inverted by a self - righting function . chassis 6 and other rigid robot components are designed for strength and low weight and are made from durable plastic , polymer , composites , 7075 - t6 aluminum or other suitable lightweight , impact resistant materials . tracks 12 , wheels 8 and 10 and flippers 14 are also configured to be impact resistant . for example , wheels 8 and 10 can be a pliable material and can include spiraled spokes to provide a degree of resilience . impact resistance is accomplished , in part , by surrounding much of the vehicle with compliant tracks 12 with pliable cleats . tracks 12 and cleats provide a first layer of impact protection . tracks 12 are configured to provide skid steering and include compliant belts made of polyurethane or a similar flexible material . the belts are abrasion resistant and have high strength and minimal stretch due to internal steel or fiber cording . tracks 12 define a left - right alternating tread to smooth successive impacts on most surfaces with a spacing between successive edges on the sides to catch larger terrain features for traction . without a bogey rail , the robot tends to tread on the portion of the tracks at wheels &# 39 ; bottom dead center . tracks 12 can be stretched over wheels 8 and 10 and driven primarily by friction . the surfaces of wheels 8 and 10 contacting tracks 12 can be provided with a fine knurl pattern to enhance friction with tracks 12 and prevent slippage from formation of water films between wheels 8 and 10 and tracks 12 . alternatively , tacks 12 and drive wheels 8 can be formed with complementary features to provide positive drive engagement . for example , wheels 8 and 10 can have v - shaped grooves around their circumference to receive an integral v - shaped rib on the inside of track 12 . alternative embodiments of the robot can use other types of tracks , such as tracks made up of discrete elements . however , debris may be caught between elements and such tracks are generally heavier than flexible belts . other flexible materials can also be used for continuous belt tracks . tracks 12 can include cleats , ridges , or other projections for additional traction . such cleats can be angled to divert debris away from chassis 6 . flippers 14 can be can be continuously rotated around axle 16 . flippers 14 can be rotated to a forward “ stowed ” position next to chassis 6 . alternatively , flippers 14 can be rotated to a rearward trailing position to prevent catching of the ends of flippers 14 on terrain , for example in tall grass . in some embodiments , to prevent possible damage , flippers 14 can automatically return to a stowed position when robot 2 detects that it is in free fall . with reference to fig3 a - p and fig4 , flippers 14 are further configured to be driven to rotate at predetermined intervals in stair or obstacle surmounting maneuvers . flipper positioning angles are stated with reference to the horizontal axis of chassis 6 as shown in fig4 with 0 degrees being the stowed flipper position , 90 degrees being a vertical position , 180 being a trailing position and 270 being a downward position . an obstacle surmounting control routine is initiated by detection of an obstacle or predetermined scenario or by operator input . in state 1 of the routine , shown in fig3 a , robot 2 approaches a stair with flippers 14 is a forward stowed position substantially parallel to the ground at 0 degrees . during obstacle surmounting maneuvers , a main obstacle surmounting control routine 100 is run on a controller at 64 mhz while sampling accelerometer data at 16 hz and updating the flipper position at 16 hz . upon detection of the stair or other obstacle , the control routine enters state 2 , in which flippers 14 are rotated upward and rearward between approximately 45 and 90 degrees , as shown if fig3 b . in state 3 shown in fig3 c , the forward end of robot 2 begins to ascend the front face or riser of a stair . once the robot has ascended to a predetermined position shown in fig3 c as detected by an accelerometer , e . g ., between about 15 and 45 degrees or a sensor reading of about 0 . 75 g , the routine enters state 4 . passage of a predetermined time since entering state 3 , e . g ., 3 seconds , can also trigger the fourth state . in the fourth state , flippers 14 are rotated further counterclockwise or rearward between the positions shown in fig3 d - 3g , e . g ., between about 90 - 125 degrees , as tracks 12 are further driven such that the forward end continues to ascends the stair riser and rearward end of robot 2 approaches the stair riser . after a predetermined time , e . g ., 1 second , and as robot 2 approaches a substantially vertically position shown in fig3 g , flippers 14 contact the underlying surface at approximately 125 degrees and the routine enters a fifth state . in the fifth state , flippers 14 are rotated quickly counterclockwise to lift the rearward end of robot 2 through the range shown in fig3 g - m , e . g ., between about 125 and 275 degrees , while tracks 12 are driven until the center of gravity of robot 2 clears the nose of the stair as shown in fig3 n . flippers 14 further serve to resist back sliding or any wheelie tendency as robot 2 clears the stair nose . in an optional sixth state , if flippers reach about 275 degrees and the accelerometer has not detected that the center of gravity of the robot has cleared the nose of the stair , flippers 14 are kicked backward from about 275 degrees , e . g ., to less than about 235 degrees , in an effort to topple robot 2 forward from a possible teetering position . once the accelerometer detects that the center of gravity of robot 2 has cleared the nose of the stair , the routine enters a seventh state . in state 7 , robot 2 overcomes the stair and tips forward as the center of gravity clears the stair nose as shown in fig3 m . upon entering state 7 , or after a short time delay , e . g ., 1 second , flippers 14 are rotated clockwise towards a trailing position as shown in fig3 o . this prevents flippers 4 from catching on the surmounted obstacle as the robot is driven forward . once the accelerometer detects that the robot has settled atop the stair or after a predetermined period of state 7 , e . g ., 1 second , an eighth routine state causes flippers 14 to return to a default position , e . g ., substantially vertical , to prepare to surmount a second stair . flipper position is determined in the different states using a flipper position sensor . states 1 - 8 and the various maneuvers shown in fig3 b - p are then repeated as needed to surmount successive stairs or other obstacles . another obstacle surmounting routine 200 is described with reference to fig5 a - r and fig6 . when the front wheels encounter a vertical stair riser , there may not be sufficient ground friction to allow the wheel / tracks to climb the riser . this is particularly true in dusty or sandy environments where the floor friction can be substantially less than that of the cleaner stair riser . to assist the front wheels in initiating climbing , flippers 14 are used to initially raise the forward end of the robot 2 . this can also be particularly helpful if a stair riser is angled outward . in state 1 , the robot advances forward towards the stair riser as shown in fig5 a . tracks 12 are driven forward until the robot reaches the riser . in state 2 , flippers 14 are rotated to the stowed position , e . g ., 0 degrees in preparation for lifting the nose of the robot . in state 3 , flippers 14 are rotated “ clockwise ” downward such that the distal ends of flippers 14 contact the underlying surface forward of the center of gravity of robot 2 as shown in fig5 b . tracks 12 are advanced to ascend the stair riser . in state 4 , continued clockwise rotation of flippers 14 causes the forward end of robot 2 to raise up off the underlying surface at to a predetermined angle , e . g ., about 15 - 45 degrees , as shown in fig5 c . if the angle is not reached within a preset time , e . g ., 1 . 5 seconds , the routine advances to the next state . the predetermined angle is selected to approximate the angle at which the frictional forces between the tracks and the floor and the tracks and the stair riser are sufficiently balanced to prevent back - sliding of the robot . balance of the frictional forces between the track the riser and underlying surface enables the track to ascend the riser without continued clockwise rotation of flippers 14 . the routine can periodically test to see if the friction balance point has been achieved by slightly lifting the flippers and using the accelerometers to detect backsliding . once it is determined that the balance point has been reached or passed , the flipper is no longer needed to raise the forward end of the robot . if the accelerometer detects slippage or backsliding of the robot , previous states can be repeated as needed . in some embodiments , the track velocity is coordinated with the flipper motions to help maintain traction and frictional balance . in state 5 , flippers 14 are rotated clockwise to an “ upwards ” position as shown in fig5 e - f , e . g ., to 90 degrees , to prevent the robot from flipping over backwards as the wheels continue to climb . this movement is preferably performed without substantially shifting the center of gravity or introducing disturbances that would upset the frictional balance . it is advantageous for flippers 14 to be long enough to extend forward of the center of gravity , yet short enough to not get caught under a stair nose when later rotating counterclockwise , as shown in fig5 d - e to prepare to raise the rearward end of the robot . an estimated maximum flipper length is calculated by adding the wheel radius to the product of the length of the robot chassis and cosine of the angle at which the frictional forces are sufficiently balanced to enable continued climbing by the tracks . this flipper length provides sufficient clearance for retraction of the flippers from a forward to a rearward position after partial ascend of a stair rise by the robot . of course , flipper length can be dictated by anticipated obstacle profiles including more aggressive forward riser angles . in state 6 , tracks 12 are advanced to position the chassis substantially vertically against the stair riser with flippers rotated counterclockwise to a point adjacent to or contacting the ground as shown in fig5 g - j . in state 7 , flippers 14 are extended , e . g ., from about 100 degrees to 175 degrees , while tracks 12 are driven at a “ matched ” velocity as shown in fig5 j - o , or slightly faster as dictated by the geometry of the problem , to allow the track to evenly surmount the stair nose as the robot is pushed upward by flippers 14 . matching of the track velocity to the flipper rotation means that the tracks are advancing a distance equal to the amount of extension provided by rotation of flippers 14 . velocity matching can also be used to maintain an angle of incline of chassis 6 as the robot surmounts the stair nose . in state 8 , tracks 12 are driven while flippers 14 simply drag behind to prevent backsliding or wheelies as shown in fig5 n . flippers 14 are paused momentarily at the point of maximum extension , e . g ., when the flipper tip is farthest away from the track / step corner , while the tracks continue to be driven forward . as the track cleats bounce over the stair nose , the flipper tips will bounce and drag along the ground closer to the step wall . the track speed can be varied to achieve a desire bouncing pattern . in state 9 , flippers 14 are again rotated counterclockwise to provide an extra extension to slightly level out the robot . this “ over extension ” of the flippers can also help tip the robot center of gravity over the stair nose . in state 10 , tracks 12 are driven quickly while flippers 14 are slowly rotated clockwise back to the full extension point to climb onto the top of the step as shown in fig5 p - r . in this position , the flippers can catch the robot should it happen to back slide or tumble backwards . once the center of mass of the robot extends forward of the stair nose , the robot falls forward on top of the step . once the vehicle tips forward of the step nose ( as indicated by the accelerometers showing the tilt angle going back to level ) flippers 14 are restored to a default driving or stowed position . in another control routine , flippers 14 can be continuously rotated to overcome a high centered position . a high centered position can be detected in multiple ways . for example , monitoring of video data , monitoring accelerometer data , comparing odometer and navigational data , gps data discrepancies . track motions can be coordinated with flipper motions to pull the vehicle forward , e . g ., by driving the tracks when the flipper is in contact with the surface at the same rate that the flipper is expected to pull the vehicle forward . flipper rotation rates can depend on the expected or detected terrain , e . g ., whether the flipper tips will penetrate the terrain surface . the effective flipper radius can be dynamically determined by signal processing the accelerometer signals after repeated rotations of the flipper as a function of flipper tip penetration into the underlying surface . to prevent “ digging in ,” the tracks can be driven when the flippers are in contact with the underlying surface . the flipper rotational rate can be selected as a function of surface penetration and movement of the robot over the terrain and baseline data for behavior of the robot driving over different terrains . in the depicted embodiment , the flippers extended substantially the distance between the drive wheel axle and the idler wheel axle . in some cases , the flipper length is selected to fit entirely within the length of the chassis and to extend forward of the robot center of gravity . in some cases the flippers are at least as long as the idler wheel radius . the flippers or flipper length can be selected based on the dimensions of anticipated obstacles . with reference to fig7 , flippers 14 are configured to extend from axle 16 centrally to a point beyond the center of gravity of robot 2 . this allows robot 2 to be inverted or self - righted simply by rotation of flipper 14 through an arc of 90 degree beyond contact with an underlying surface . rotation past a vertical stability point causes the robot to fall over completing the inversion . self - righting is often required after tumbling down stairs or other inclines , or from atop other obstacles . robot 2 can descend stairs forwards or backwards with flippers 14 in a stowed position , driving tracks 12 either direction and tumbling or rolling to a resting position . in some embodiments , robot 2 has more ground clearance in one orientation than another . in some cases , a camera , antenna , sensor or robot accessory may need to be reoriented upward if robot 2 lands upside down after a descent from an obstacle . with reference to fig8 , flippers 14 can also be rotated to partially elevate the rearward end of robot 2 . in some cases , flippers 14 can be used to raise or upend robot 2 to position a camera , antenna , sensor , munitions or the like at a desired height or angle or for helping to pull robot 2 from a high centered position . flippers 14 can be repeatedly or continuously rotated in either direction to provide a “ swimming ” motion to help propel robot 2 through loose debris , gravel , sand and the like . flippers 14 can raise the nose of the vehicle , to both help start a climb and to elevate a fixed camera . with reference to fig9 robot chassis 6 houses , inter alia , wheel drive motors 20 and 22 for powering drive wheels 8 and a flapper drive motor 24 . chassis 6 also houses an electrical subassembly 26 and battery ( not shown ) positioned below electrical subassembly . the battery is a significant portion of the total weight of robot 2 and is positioned substantially centrally front to back and towards the bottom of chassis 6 . a clamshell chassis body design allows provides sufficient volume for electronics and mechanical drive mechanisms within a protective cover . flipper drive motor 24 is used to control the angle between flappers 14 and chassis 6 . flipper drive motor 24 is coupled via a gear reduction train to axle 16 . a slip clutch can be used to transfer output torque from flipper drive motor 24 to axle 16 . a slip clutch can be adjustable to set a predetermined slip torque . flippers 14 are connected via solid axle 16 and an optic sensor on axle 16 provides for detection of the position of flippers 14 regardless of clutch slippage . one clutch embodiment includes two beveled gears engaged with a spring , similar to a cordless drill clutch . axle 16 passes through a central opening in idler wheels 10 and fixedly connects to flippers 14 . at the rear of the robot are two flippers 14 with the ability to rotate 360 ° continuously to flip the robot over when inverted . the flippers also assist the robot in climbing and negotiating small obstacles . also integrated into the flipper mechanism is a slip clutch to protect the gearing in case of impact . drive motors 20 , and 22 are 1 watt dc brushed motors . in other versions of the robot , brushless motors can be used . drive motors 20 and 22 turn output drive gears that attach to the wheels via integral splines . output drive gears are retained via brass or delrin bushings that register and align complementary portions of the chassis body . drive motors 20 and 24 are geared down 29 : 1 to drive wheels 8 . steering is accomplished using differential speed of the tracks 14 on either side of the robot by varying the speed of drive motors 20 and 22 . the robot will , in principle , skid around the center of chassis 6 approximately at the midpoint of the length of tracks allowing complete turning with the extremes of the robot staying within a 23 cm ( 9 ″) diameter circle . in some cases , tracks 14 can be driven while flippers 14 maintain an end of robot 2 elevated above an underlying surface , for example to reposition an elevated antenna or camera . other preprogrammed flipper or robot positions can include fully extended , stowed , inclined , upright , and “ wheelie .” in addition , robot 2 can perform several maneuvers including self righting , stair climbing , and recovery from high centering . the chassis body can further serve to retain bushings for moving parts and as a mounting surface for an antenna , camera , microphone , sensors and the like . dust and moisture seals can be provided where axles or other components pass through the chassis body . for example , brass bushing securing at openings around chassis body 6 serve to support axle 16 and the idler wheel axles . chassis body 6 can also carry an antenna connector base ( e . g ., standard sma antenna connector ). with reference to fig1 , flippers 14 are rotated by drive motor 24 ( 0 . 4 watt dc brushed motor ) via gear train 26 . flipper drive motor 24 is geared down 298 : 1 to axle 16 to provide a torque of approximately 400 mnm (˜ 2 × required to lift vehicle weight ). clutch can be adjusted to provide up to 700 mnm of slip torque . a slip clutch prevents overloading of flipper drive motor 24 and gearing , for example due to an impact on the arms . flippers 14 can be stowed parallel to chassis 6 and tracks 12 when it is deployed by tossing or dropping it through a window or door or when the robot tumbles . in some embodiments , a mechanical energy storage provides for sudden release to move the flippers to allow the robot to perform a small leap motion . an example energy storage system can be a spring , flywheel or other mechanical energy storage mechanism . with reference to fig1 and 12 , a slip clutch 70 is provided on axle 16 between drive motor 24 and flippers 14 . slip clutch 70 includes a first sprocket 72 carrying a series of drive teeth 74 on a first rotary surface 76 . first sprocket 72 is fixedly attached to axle 16 . a second sprocket 78 defines a series of slots 80 in a second rotary surface 82 for receiving the drive teeth 74 of first sprocket 72 . drive teeth 74 and slots 80 remain engaged so long as first and second rotary surfaces 76 and 82 remain substantially in contact . under sufficient toque , the tapered surfaces of teeth 74 cam rotary surfaces 76 and 82 apart allowing teeth 74 to slip one or more slots . sprockets 72 and 78 are biased towards engagement via a spring 84 retained on axle 16 . spring 84 provides an axial force to slip clutch 70 to resist separation of surfaces 76 and 82 . first sprocket 72 is connected to axle 16 while second sprocket 78 spins freely about axle 16 when disengaged from sprocket 72 . second sprocket 78 includes gear teeth about its circumference to engage drive motor 24 . during obstacle surmounting maneuvers , drive motor 24 turns second sprocket 78 which in turn rotates first sprocket 72 and axle 16 to rotate flippers 14 . alternatively , a slip clutch can be formed of sufficiently pliable material to allow flexure of rotary surfaces 76 and 82 under sufficient torque . any number of frictional or cammed surfaces or other known types of slip clutches can be substituted for slip clutch 70 . with reference to fig1 , robot 2 is provided with a pair of end sensors 28 and side sensors 30 . sensors 28 can be positioned on one or both ends of robot 2 and sensors 30 can be positioned on one or more sides of robot 2 . sensors 28 and 30 include ir emitter / detector pairs . sensors 28 are directed substantially parallel in front of tracks 12 to act as cliff detectors to detect and avoid falls and sensors 30 are directed outward from chassis 6 to act as wall detectors . sensors 28 and 30 can include filtering features to accommodate ambient sunlight . sensors 28 and 30 provide feedback that is used by robot 2 , for example , to follow a wall or avoid a drop off . sensors 28 and 30 can include sonar , infra red , proximity , impact or other sensor suitable to detect the presence or absence of an object in the sensor range . additional sensor based autonomous robot behavior routines are disclosed in u . s . pat . no . 6 , 883 , 201 , titled “ robot obstacle detection system ” which is incorporated herein by reference in its entirety . additional autonomous behavior routines and control systems are disclosed in u . s . pat . no . 6 , 809 , 490 titled “ method and system for multi - mode coverage for an autonomous robot ” and u . s . pat . no . 7 , 459 , 871 titled “ debris sensor for cleaning apparatus ,” which are incorporated herein by reference in their entirety . the routines include motion control and coverage behaviors such as spiral coverage , cruising , bounce and recoil from an obstacle , wall following , self - alignment , and escape behaviors as selected by an arbiter according to principles of behavior based robotics . additional reactive controls and behavior routines are provided for reacting to and concentrating on a point of interest in the coverage space . similar behaviors can be used to seek out a peak signal strength peak or radio hot spots or to reposition a robot as a node in a mesh network . sensors can be shielded within the track volume , within the protective shell of chassis 6 or positioned on the front and rearward ends of the vehicle . the top and bottom portions of chassis 6 can be fitted with any number of sensors , cameras , antennae , chemical sensors , bio - sensors , radiation sensors and the like . additional robot sensors provide input regarding flipper rotation position , connector to a charging station , presence of a deactivation plug ( pull pin ). for example , robot 2 can be powered off if sensors detect that drive motors 20 or 22 have stalled of if the robot is otherwise stuck . chassis 6 also supports a camera 32 and antenna 34 to provide video telemetry and other communications data . camera 32 is depicted positioned slightly rear of center , with the lens angled up to minimize the field of view obstructed by the robot vehicle itself . flippers 14 can be rotated to raise the nose of the vehicle further if the camera view is insufficiently high . to look over an edge , flippers 14 can be used to raise the rear of the vehicle to depress the camera view angle . transmission of video telemetry data or other sensor data from within a building can enable a small force to quickly and safely assess a location or situation . for example , a camera can be used to quickly and safely determine the presence and location of an adversary or explosive in a building robot 2 includes the capability of carrying a variety of accessories or sensors , including cameras , sonar sensors , infra - red detectors , inertial sensors , motor position , velocity and torque sensors , inclinometers , a magnetic compass , microphones , sound generator , or small weapon . sensors can be placed on all surfaces of the robot . for example , night time or low light operation can be performed using onboard light such as an infra - red ( ir ) array with a useful range of several meters . a small white light can also be provided for up close color identification of objects . a multi camera array can provide stereoscopic vision for navigation and video transmission back to remote control system 4 . for example , multiple cell phone style cameras , each with multi - megapixel accuracy and a 90 ° field of view , to provide full 360 ° field of view . the robot can be configured to monitor for motion and alert the operator if motion is detected . similarly , an onboard microphone can enable an alert to be sent to the operator if sound above a designated threshold is detected . onboard computing coupled with a multi megapixel imager can provide high resolution image capture and digital pan tilt zoom of the digitally compressed and encrypted video stream . this minimizes the mechanical complexity of the system by eliminating the need for a mechanical pan - tilt assembly , and allows the use of image processing for unattended operation such as change detection and digital video recording of motion . integrated infrared illuminators can provide sufficient illumination for navigation in an urban environment , while white light illuminators can be used to identify targets up close . one example is a 1 . 3 megapixel camera with mpeg4 compression capabilities . with reference to fig1 a - b , electrical subassembly 26 is mounted between the flipper drive motor 24 and wheel drive motors 20 , 22 above batteries 52 . electrical subassembly includes a main printed circuit board ( pcb ) 40 to which are electrically connected a removable mass memory 44 , usb communication module 46 : sdio communication module 48 , sdio port 50 . the battery , drive motors 20 , 22 and 24 , camera 32 and antenna 34 are operably coupled to electrical subassembly 26 . pcb 40 also carries end sensors 28 and side sensors 30 . pcb 40 can include rigid circuit boards , flexible polyimide circuits , or other circuit modules or combinations thereof , and may provide power regulation , motion control , sensors , and other functions . battery 52 includes a lithium ion battery pack with three 18650 cells in series . each cell has a capacity of 2 . 6 ahr , and contains 0 . 78 grams / cell of lithium , or 2 . 3 g of lithium per assembled robot . internal rechargeable li - ion battery pack 52 has a two hour charge time via 110 v or 220 v circuits . both robot 2 and the ocu remote control 4 can be charged by a single adapter capable of accepting universal power ( 100 - 240 vac 50 / 60 hz ). optional charge adapters can be used for charging at 12 - 24 vdc . battery 52 can be attached directly to pcb 40 via vhb tape . solar power can be used to charge the battery or provide for extended duration low power surveillance . a substantial capacitor bank is used to minimize the ripple in the battery draw in powering the drive motors . it may be desirable in some cases to destroy internal circuits by reversing the polarity of the capacitor bank into the lithium batteries to ignite the batteries . a sudden reversal of the energy from the capacitors creates a large current surge sufficient to cause an electrical fire . this would help frustrate the ability of hostile warfighters from re - using any of the components . pcb 40 includes one or more computer processors and associated memory systems . pcb 40 is coupled to communication modules 46 , 48 , which include , for example , a radio for exchanging control and feedback information with remote control system 4 . communications range with usb and sdio radios was experimentally found to be approximately 40 meters of open area or through two cinderblock walls of a building . odometry sensors detect a pattern referenced to axle 16 , such as a slotted or patterned strip secured to an axle , e . g ., via a piece of clear heat shrink tubing , or a slotted disc attached to an axle or driven wheel 8 . the odometry sensor is located on the idler wheel to account for track slippage on drive wheel 8 . odometry reading accuracy may be increased by harder turns as opposed to sweeping turns . additional sensors determine the angle between flippers 14 and chassis 6 and the rate of rotation of flippers 14 or wheels 8 or 10 . an angular rate sensor is placed near the center of gravity of the robot 2 to track the bearing of the robot and provide increased positioning accuracy , facilitating movement in areas with few visual landmarks . optional accelerometers can be located near the angular rate sensor . these inputs are used during full or partial autonomous robot operation . with reference to fig1 , a functional block diagram of electrically connected system components of an embodiment of a robot is shown . pcb 40 is electrically connected to an imx31 processor 54 , usb communication module 46 , sdio communication module 48 , flash memory 44 , infrared sensors 28 , proximity sensors 30 , stmicro lis344alh three axis accelerometer 56 , flipper rotary position sensor ( rps ) 58 , sdio / usb payload pcb 42 , and stmicro lisy300al angular right sensor , camera 32 , battery 52 , drive motors 20 , 22 and 24 with appropriate interfaces , controllers and the like . the electrical components may also include one or more of the following : microphone , yaw sensor , active / passive analog ir led and phototransistors , sdio radios , 802 . 11b / g / n radio , satellite phone , evdo cellular phone , usb peripherals , additional batteries , bluetechnix imx , gps transponders and the like . in various embodiments , communications modules 46 and 48 serve to provide multi - hop style communications chains , to extend the usefulness of the robots deep into radio frequency ( rf ) denied areas using standard optimized link state routing daemon ( olsrd ) software mesh networking . the robots can be repositioned to maintain a self healing communications network according to one method of establishing a mesh network , the deactivation plug is removed to activate each robot . the robots are then placed in approximate locations for autonomous mesh networking . the robots automatically reposition to maintain the mesh network . advantageous mesh network capabilities are disclosed generally in the landroids bidders day briefing , document number baa 07 - 46 , released jul . 6 , 2007 and available from darpa . when the mission is over , the robots can be recovered as required and charged to be ready for the next mission . when the robots are not in use and not being charged , the deactivation plugs are installed into the charge connectors to power off the robots and keep the batteries from draining prior to the next mission . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , alternative embodiments can include four or six driven wheels and a single or multiple trailing pivoting arms . accordingly , other embodiments are within the scope of the following claims .	1
the method of manufacturing a plate - shaped bonded body , the bonding device and the plate - shaped bonded body to which the present invention is applied will now be explained in details while referring to the drawings . the present bonding device 1 for a plate - shaped body is used for manufacturing a liquid crystal display panel for use as a large - sized tv monitor or the like in which a cover glass is bonded onto a display surface using transparent resin . a plate - shaped bonded body 2 is suitable for use as a large - sized tv monitors having a size larger than , for instance , 32 inches , but it is also applicable for smaller sizes . in the present embodiment , explanations will be made as one example about a plate - shaped bonded body 2 as shown in fig1 in which a cover glass 6 made of a tempered glass plate having a diagonal dimension of 40 inches and a thickness of 0 . 7 mm is bonded onto a polarizing plate 5 having a diagonal dimension of 40 inches that is provided on a display surface of a liquid crystal display panel 4 comprised of a liquid crystal layer and oriented film and others by using a transparent resin 7 having a refractive index equivalent to that of the cover glass 6 . the transparent resin 7 is , for instance , a transparent ultraviolet curing type elastic resin with a refractive index that is controlled to restrict scattering of light such that the visibility of the liquid crystal panel 2 is not harmed even when the resin is filled between the polarizing plate 5 and the cover glass 6 . the viscosity of the transparent resin 7 is selected to be in a range of , for example , 700 mpa · s to 5000 mpa · s which is a viscosity with which the resin can be filled while adhering simultaneously to the polarizing plate 5 and the cover glass 6 and with which a condition in which the resin adheres to the polarizing plate 5 and the cover glass 6 held at a specified clearance can be maintained . in accordance with such a viscosity of the transparent resin 7 , a clearance dimension of the polarizing plate 5 and the cover glass 6 is set to be in a range of 3 . 5 mm to 10 mm . more particularly , in the present embodiment , a transparent elastic resin of ultraviolet curing type having a viscosity of 3500 mpa · s is used as the transparent resin 7 and , as it will be described later , the clearance of a position at which the polarizing plate 5 and the cover glass 6 are most approximate is maintained to be 5 . 5 mm whereupon the transparent resin 7 is injected to this position . according to this plate - shaped bonded body 2 , by bonding the polarizing plate 5 and the cover glass 6 by means of the transparent resin 7 , it is possible to achieve improvements in picture qualities such as contrast , color and clearness and to improve the shock resistance of the liquid crystal display panel . a bonding device 1 for bonding the polarizing plate 5 and the cover glass 6 by means of the transparent resin 7 comprises , as shown in fig2 and fig3 , a mounting portion 10 on which the polarizing plate 5 is mounted , a cover glass supporting portion 11 for supporting the cover glass 6 while making the cover glass face the polarizing plate 5 that is supported by the mounting portion 10 , a dispensing nozzle 12 for injecting the transparent resin 7 between the polarizing plate 5 and the cover glass 6 that are held to face each other by means of the mounting portion 10 and the cover glass supporting portion 11 , and laminating rollers 13 that are rolled on the cover glass 6 to make the transparent resin 7 fit and spread between the polarizing plate 5 and the cover glass 6 . the bonding device i further comprises a nozzle moving mechanism 15 for moving the dispensing nozzle 12 , a pressing mechanism 16 for making the transparent resin 7 be discharged from a discharge outlet 22 of the dispensing nozzle 12 , an elevating mechanism 17 for elevating the cover glass supporting portion 11 , a roller driving mechanism 18 for driving the laminating rollers 13 , and a control portion 20 for controlling these mechanisms 15 to 18 , all of which are arranged on a table 19 . the mounting portion 10 on which the polarizing plate 5 is mounted is fixed on the table 19 and the polarizing plate 5 is held to face vertically upward such that its adhesive surface faces the cover glass 6 by means of vacuum holding or the like . the cover glass supporting portion 11 for supporting the cover glass 6 holds the cover glass 6 such that its adhesive surface at which it adheres to the polarizing plate 5 faces upward by engaging outer peripheral edges of the cover glass 6 or by means of a holding means such as vacuum holding or the like . with this arrangement , a central portion of the cover glass 6 in the longitudinal direction is warped towards the polarization plate 5 over a width direction so that a curve top portion of the cover glass 6 becomes a most approximate position a with the polarizing plate 5 . the most approximate position a has a clearance at which the transparent resin 7 having a specified viscosity adheres to the polarizing plate 5 and the curve top portion of the cover glass 6 at the most approximate position a upon inserting the dispensing nozzle 12 ( to be described later ) and injecting the transparent resin 7 . for instance , when the viscosity of the transparent resin 7 is 3500 mpa · s , the clearance at the most approximate position a is set to be 5 . 5 mm . further , at the most approximate position a , the laminating rollers 13 descend and roll in a longitudinal direction of the cover glass 6 such that transparent resin 7 is dispersed while adhering to the polarizing plate 5 and the cover glass 6 . the cover glass supporting portion 11 is supported above the mounting portion 10 to be elevating by means of the elevating mechanism 17 . the elevating mechanism 17 is comprised of a power means such as an actuator and elevates the cover glass supporting mechanism 11 in vertical directions which is a direction in the arrow z or a direction against the arrow z in fig2 . the elevating mechanism 17 elevates the cover glass supporting portion 11 when the polarizing plate 5 or the cover glass 6 is supported by the mounting portion 10 or the cover glass supporting portion 11 . when injecting the transparent resin 7 between the polarizing plate 5 and the cover glass 6 for bonding , the elevating mechanism 17 descends the cover glass supporting portion 11 so that the cover glass 6 approximates the polarizing plate 5 and holds the polarizing plate 5 and the cover glass 6 at a specified clearance through which the dispensing nozzle 12 can be inserted and the transparent resin 7 can be applied while contacting the polarizing plate 5 and the cover glass 6 . after filling the transparent resin 7 , the elevating mechanism 17 further descends the cover glass supporting portion 11 in accordance with the rolling of the laminating rollers 13 ( to be described later ) and holds the cover glass 6 in parallel to the polarizing plate 5 so as to expand the transparent resin 7 over the entire surfaces of the polarizing plate 5 and the cover glass 6 without mixing air bubbles therein . the dispensing nozzle 12 for discharging the transparent resin 7 between the polarizing plate 5 and the cover glass 6 has a cylindrical body that is supported in parallel to a main surface of the polarizing plate 5 held by the mounting portion 10 . the dispensing nozzle 12 is further connected to a pressurizing means 21 such as a syringe or tank for supplying the transparent resin 7 . the dispensing nozzle 12 is supported by the nozzle moving mechanism 15 at a height at which it is movable back and forth through the clearance between both substrates along the most approximate position a of the polarizing plate 5 and the cover glass 6 without contacting both substrates . the dispensing nozzle 12 moves in a direction against the arrow x in fig3 , in a direction of arrow z in fig2 and in a direction that is orthogonal to the sheet for drawing a specified discharge pattern by the transparent resin 7 along the most approximate portion a within the clearance between the polarizing plate 5 and the cover glass 6 . as shown in fig4 , the dispensing nozzle 12 is comprised of a nozzle main body 12 a made of metal or industrial plastic and a soft resin layer 12 b for coating the nozzle main body 12 a so as not to damage the polarizing plate 5 and the cover glass 6 . the resin layer 12 b is formed by , for instance , baking finishing resin exhibiting superior low frictional , wear - resistant , water - repellent and corrosion - resistant characteristics such as fluorine resin onto the surface of the nozzle main body 12 a . it should be noted that the dispensing nozzle 12 is not limited to one having a circular sectional shape and it might also have a flat circular or rectangular shape . there is no fear that the dispensing nozzle 12 damages the polarizing plate 5 and the cover glass 6 even if the nozzle comes into sliding contact with the polarizing plate 5 and the cover glass 6 due to the formation of the resin layer 12 b when the nozzle discharges the transparent resin 7 while moving through the clearance between the polarizing plate 5 and the cover glass 6 . more particularly , the discharge nozzle is formed of metal or industrial plastic and applies the transparent resin 7 while moving through the clearance between the polarizing plate 5 and the cover glass 6 along the most approximate position a by means of the nozzle moving mechanism 15 . at this time , the dispensing nozzle 12 is moved so as not to abut the polarizing plate 5 and the cover glass 6 ; however , even if the nozzle abuts the polarizing plate 5 and the cover glass 6 due to oscillation or warping , there is no fear that the polarizing plate 5 and the cover glass 6 are damaged since the nozzle is coated by the resin layer 12 b . further , the provision of the resin layer 12 b that exhibits superior water - repelling and corrosion - resistant properties for the dispensing nozzle 12 also prevents so - called dripping in which the transparent resin 7 drips from the discharge outlet 22 even after termination of discharge . the dispensing nozzle 12 is accordingly capable of applying transparent resin 7 to only specified portions while preventing conditions in which the transparent resin 7 is adhered to unexpected portions . moreover , since the dispensing nozzle 12 can prevent damages caused through contact with the polarizing plate 5 and the cover glass 6 , it is possible to apply the transparent resin 7 without reducing the moving speed by the nozzle moving mechanism 15 . accordingly , the time during which the transparent resin 7 discharged at an earlier time and the transparent resin 7 discharged at a later time is exposed to air will not differ largely and no differences in filling characteristics or curing characteristics will be caused . while it is desirable to finish application of the transparent resin 7 quickly without reducing the nozzle moving speed while the time required for the application step of the transparent resin 7 increases the larger the substrate becomes , the bonding device 1 is advantageously capable of applying the transparent resin 7 without reducing the moving speed of the nozzle moving mechanism 15 . the dispensing nozzle 12 might also be arranged as shown in fig4 a and fig4 c in that the discharge outlet 22 faces vertically upward by cutting an upper surface of its tip end to be oblique . with this arrangement , upon start of discharge of the transparent resin 7 , the dispensing nozzle 12 first adheres the transparent resin 7 onto the cover glass 6 that is located upward and then to the lower polarizing plate 5 through gravity . the dispensing nozzle 12 then moves through the clearance between the polarizing plate 5 and the cover glass 6 while discharging the transparent resin 7 and applies the resin in a condition in which the transparent resin 7 is constantly adhering to both of the surfaces of the polarizing plate 5 and the cover glass 6 as shown in fig5 . in this manner , the bonding device 1 directs the discharge outlet 22 of the dispensing nozzle 12 upward while it applies the transparent resin 7 such that it continuously adheres to both of the surfaces of the polarizing plate 5 and the cover glass 6 so as to prevent air bubbles from remaining in the transparent resin 7 . such a dispensing nozzle 12 is inserted by the nozzle moving mechanism 15 into a range between the curve top portion of the cover glass 6 that is held by the cover glass supporting portion 11 and the polarizing plate 5 . this position is the most approximate position a at which the polarizing plate 5 and the cover glass 6 are most approximate , and the transparent resin 7 is injected into this position a . when the dispensing nozzle 12 is inserted into the most approximate position a of the polarizing plate 5 and the cover glass 6 from the side as shown in fig7 c , the nozzle discharges the transparent resin 7 while moving back from one end side in the width direction towards the inserting end side ( direction against arrow x ). with this arrangement , the dispensing nozzle 12 can discharge the transparent resin 7 while adhering the resin to both of the surfaces of the polarizing plate 5 and the cover glass 6 at the most approximate position a . in this respect , the nozzle moving mechanism 15 moves the dispensing nozzle 12 and the pressurizing means 21 in parallel to the polarizing plate 5 mounted on the mounting portion 10 upon receiving control signals from the control portion 20 and is comprised with , for instance , a mutually crossing rail mechanism . the nozzle moving mechanism 15 holds the dispensing nozzle 12 in a width direction of the polarizing plate 5 as shown by arrow x in fig3 and is freely movable back and forth in the direction of arrow x and against the direction of arrow x . the nozzle moving mechanism is also movable in a longitudinal direction of the polarizing plate 5 ( a direction orthogonal to the direction of arrow x in fig3 and a direction parallel to the polarizing plate 5 ) and it is also capable of positioning the dispensing nozzle 12 at the most approximate position a . the pressurizing means 21 for supplying the transparent resin 7 stores therein the adhesive 7 that is discharged from the dispensing nozzle 12 . the pressurizing means 21 is further connected to a pressing mechanism 16 for making the stored transparent resin 7 be discharged by the dispensing nozzle 12 , and control of discharge and discharge termination of the transparent resin 7 and control of discharge pressure is performed . as for the pressing mechanism 16 , it is , for instance , possible to use a compression dry air cylinder wherein control of supply and termination of supply of gas into the pressurizing means 21 as well as of supply pressure is performed by the control portion 20 , and by supplying gas into the pressurizing means 21 at a specified pressure , the transparent resin 7 is discharged from the dispensing nozzle 12 . the laminating rollers 13 are for fitting and spreading the transparent resin 7 between the polarizing plate 5 and the cover glass 6 into which the transparent resin 7 has been injected through the dispensing nozzle 12 . the laminating rollers 13 have a columnar shape and are arranged to be elevating above the cover glass 6 and to be rolling in a longitudinal direction of the cover glass 6 by being supported by the roller driving mechanism 18 . the laminating rollers 13 are supported by the roller driving mechanism 18 such that their longitudinal direction is parallel to the most approximate position a of the polarizing plate 5 and the cover glass 6 while they are descended to the most approximate position a and are rolled from the most approximate position a in the longitudinal direction of the polarizing plate 5 and the cover glass 6 . with this arrangement , the laminating rollers 13 fit and spread the transparent resin 7 over the rolling direction so as to fill the resin over the entire range between the polarizing plate 5 and the cover glass 6 . the laminating rollers 13 are comprised of a first roller 13 a that rolls from the most approximate position a of the polarizing plate 5 and the cover glass 6 towards one side in the longitudinal direction and a second roller 13 b that rolls from the most approximate position a of the polarizing plate 5 and the cover glass 6 towards the other side in the longitudinal direction . the roller driving mechanism 18 descends the first roller 13 a to the most approximate position a to make the roller roll towards one side in the longitudinal direction and descends the second roller 13 b to the most approximate position a to make the roller roll towards the other side in the longitudinal direction . with this arrangement , the first and second rollers 13 a , 13 b can fill the transparent resin 7 over the entire range between the polarizing plate 5 and the cover glass 6 . in accordance with the rolling of the laminating rollers 13 by the roller driving mechanism 18 , the above - described elevating mechanism 17 descends the cover glass supporting portion 11 and descends the outer peripheral edge portions of the cover glass 6 to the polarizing plate 5 side . with this arrangement , the cover glass 6 that had been supported in a warped manner is gradually flattened towards the one or the other end in the longitudinal direction from the most approximate position a to become parallel to the polarizing plate 5 so that it does not receive the load caused through the rolling of the laminating rollers 13 . further , since the cover glass 6 is supported to keep a specified clearance with respect to the polarizing plate 5 in accordance with the rolling of the laminating rollers 13 , it is possible to exhaust air in the clearance with the polarizing plate 5 to the exterior through adhesion of the fitting and spreading transparent resin 7 and no air bubbles will remain in the clearance with the polarizing plate 5 . next , steps of manufacturing a plate - shaped bonded body 2 in which the polarizing plate 5 and the cover glass 6 are bonded using such a bonding device 1 will be explained while referring to fig6 and fig7 . in the present embodiment , explanations will be made as one example about manufacturing the above - described plate - shaped bonded body 2 in which a cover glass 6 made of a tempered glass plate having a diagonal dimension of 50 inches and a thickness of 0 . 7 mm is bonded onto a rectangular polarizing plate 5 having a length of 900 mm , a width of 500 mm and a diagonal dimension of 40 inches that is provided on a display surface of a liquid crystal display panel using a transparent resin 7 having a refractive index equivalent to that of the cover glass 6 . first , the polarizing plate 5 is mounted onto the mounting portion 10 . at this time , the polarizing plate 5 is held by means of vacuum holding or the like after positioning on the mounting portion 10 , and its adhesive surface at which it is adhered to the cover glass 6 is made to face vertically upward . then , as shown in fig6 a and fig7 a , a pattern p is drawn onto the polarizing plate 5 onto its adhesive surface at which it is adhered to the cover glass 6 by applying the transparent resin 7 thereon . while it is preferable that the transparent resin 7 is the same resin as the transparent resin 7 that is injected by the dispensing nozzle 12 in a later step , it might also be a transparent adhesive having the same refractive index as that of the transparent resin 7 , an equivalent viscosity ( 3500 mpa · s ) and hardly different physical properties . in the application step of the transparent resin 7 , a pattern is drawn by the rolling of the laminating rollers 13 in which the transparent resin 7 is fit and spread over the entire surfaces of the polarizing plate 5 and the cover glass 6 without mixing air bubbles therein . for instance , in the present embodiment , a pattern p that is comprised of a plurality of lines extending in longitudinal directions at specified intervals in the width direction of the polarizing plate 5 is drawn as shown in fig7 a . the amount of application of the transparent resin 7 is adjusted with regards to the thickness of the resin layer after curing . for instance , in the pattern p , there are drawn 13 lines at intervals between respective line centers being 33 mm and such that the amount of application of the transparent resin 7 is 14 g , and the thickness of the resin layer after curing becomes 400 μm . in this respect , the drawing step of the pattern p might also be performed using the dispensing nozzle 12 and it is also possible to employ other means . the cover glass 6 is supported by the cover glass supporting portion 11 . at this time , the cover glass supporting portion 11 is elevated by the elevating mechanism 17 to be above the mounting portion 10 . the cover glass supporting portion 11 holds the outer peripheral edges on both sides of the cover glass 6 in the longitudinal direction by about 20 mm by means of suction from above or other means . with this arrangement , the cover glass 6 is made to warp by its own weight at its central portion in the longitudinal direction over its width direction towards the polarizing plate 5 side . at this time , a height of an end portion of the cover glass 6 to its curve top portion will be approximately 100 mm as shown in fig2 . while maintaining this condition , the elevating mechanism 17 descends the cover glass supporting portion 11 as shown in fig6 b and fig7 b to hold the cover glass 6 at a height at which the clearance between the curve top portion and the polarizing plate 5 becomes a specified distance ( 5 . 5 mm ). then , this position at which the curve top portion of the cover glass 6 and the polarizing plate face each other will be the most approximate position a at which the dispensing nozzle 12 is inserted and at which the laminating rollers 13 descend . next , the nozzle moving mechanism 15 inserts the dispensing nozzle 12 into the most approximate position a from the side of the polarizing plate 5 and the cover glass 6 and while moving the nozzle back from the one end side in the width direction to the inserting end side ( against direction of arrow x ), the pressing mechanism 16 makes the transparent resin 7 within the pressurizing means 21 be discharged through the dispensing nozzle 12 . as shown in fig6 c and fig7 c , the dispensing nozzle 12 draws an approximate pattern n at which the transparent resin 7 adheres over both of the surfaces of the polarizing plate 5 and the cover glass 6 with the nozzle discharging the transparent resin 7 while moving back against the direction of arrow x in fig5 and fig7 c along the most approximate position a at which the curve top portion of the cover glass 6 and the polarizing plate 5 are held at a specified clearance . since the approximate pattern n is drawn along the most approximate position a over the width direction of the polarizing plate 5 and the cover glass 6 so that it crosses the pattern p that has been preliminarily drawn onto the polarizing plate 5 . in this respect , the amount of application of the transparent resin 7 for the approximate pattern n is set to be , for instance , 15 g . upon completion of injection of the transparent resin 7 at the most approximate position a , the nozzle moving mechanism 15 moves the dispensing nozzle 12 back from between the polarizing plate 5 and the cover glass 6 . next , the elevating mechanism 17 descends the cover glass supporting portion 11 , approximates the cover glass 6 to the polarizing plate 5 and presses the transparent resin 7 whereas the roller driving mechanism 18 descends the laminating rollers 13 to be on the most approximate position a of the cover glass 6 . the roller driving mechanism 18 first descends , as shown in fig6 d and fig7 d , the first roller 13 a to be on the most approximate position a of the cover glass 6 and makes it roll towards the one end side in the longitudinal direction of the cover glass 6 . with this arrangement , the transparent resin 7 that had been preliminarily applied on the polarizing plate 5 in form of lines and the transparent resin 7 that has been injected by the dispensing nozzle 12 along the most approximate position a will become uniform in accordance with the rolling of the first roller 13 a towards the one end side in the longitudinal direction between the polarizing plate 5 and the cover glass 6 to be fit and spread . at this time , the elevating mechanism 17 operates the cover glass supporting portion 11 in accordance with the rolling of the first roller 13 a such that the one end side of the cover glass 6 in the longitudinal direction descends . accordingly , the cover glass 6 will become flat at its one end side in the longitudinal direction to be parallel to the polarizing plate 5 such that no load is applied by the first roller 13 a . more particularly , since the transparent resin 7 that is inserted into the most approximate position a and adhered to both of the surfaces of the polarizing plate 5 and the cover glass 6 fits and spreads uniformly with the transparent resin 7 that had been preliminarily applied on the polarizing plate 5 accompanying the rolling of the first roller 13 a and since the cover glass 6 is made to be parallel to the polarizing plate 5 in accordance with the first roller 13 a , the transparent resin 7 is fit and spread without air mixing into the clearance with the cover glass and the polarizing plate 5 . moreover , since the transparent resin 7 is applied in form of lines at specified intervals in the longitudinal direction of the polarizing plate 5 and the cover glass 6 , an escape path of air is secured along the rolling direction of the first roller 13 a and since the transparent resin 7 is fit and spread accompanying the rolling of the first roller 13 a , air will not be surrounded by the transparent resin 7 but exhausted from between the polarizing plate 5 and the cover glass 6 . further , since the transparent resin 7 is fit and spread accompanying the rolling of the first roller 13 a , the resin is filled at a uniform thickness over the entire surfaces between the polarizing plate 5 and the cover glass 6 . more particularly , the first roller 13 a is made to roll at a constant height on the cover glass 6 by means of the roller driving mechanism 18 while the cover glass 6 is made to be parallel to the polarizing plate 5 by means of the elevating mechanism 17 so that the thickness between the polarizing plate 5 and the cover glass 6 can be made uniform over the entire surfaces . as shown in fig6 e and fig7 e , following the rolling of the first roller 13 a , the roller driving mechanism 18 descends the second roller 13 b to be on the most approximate position a of the cover glass 6 for rolling the roller towards the other end side in the longitudinal direction of the cover glass 6 . with this arrangement , the transparent resin 7 that had been preliminarily applied onto the polarizing plate 5 in form of lines and the transparent resin 7 that is injected into the most approximate position a by the dispensing nozzle 12 are fit and spread between the polarizing plate 5 and the cover glass 6 towards the other end side in the longitudinal direction in accordance with the rolling of the second roller 13 b . at this time , the elevating mechanism 17 operates , similarly to the case with the first roller 13 a , the cover glass supporting portion 11 such that the other end side in the longitudinal direction of the cover glass 6 descends in accordance with the rolling of the second roller 13 b . with this arrangement , the transparent resin 7 is fit and spread at a uniform thickness without air mixing to the other end side in the longitudinal direction of the cover glass 6 accompanying the rolling of the second roller 13 b . as shown in fig6 f and fig7 f , descending and rolling of the first and second rollers 13 a , 13 b is continuously performed , and as shown in fig6 g and fig7 g , filling of the transparent resin 7 over the entire range between the polarizing plate 5 and the cover glass 6 is completed almost simultaneously . thereafter , ultraviolet rays are irradiated onto the transparent resin 7 filled between the polarizing plate 5 and the cover glass 6 for curing and accordingly manufacturing the plate - shaped bonded body 2 . according to such a method of manufacturing a plate - shaped bonded body 2 , the transparent resin 7 is adhered to both of the surfaces of the polarizing plate 5 and the cover glass 6 by injecting the transparent resin 7 into the most approximate position a of the polarizing plate 5 and the cover glass 6 , and the transparent resin 7 is fit and spread from this position by means of the laminating rollers 13 . at this time , according to the present method of manufacturing , since an end portion of the cover glass 6 is descended to the polarizing plate 5 side in accordance with the rolling of the laminating rollers 13 , no air bubbles will be mixed into the transparent resin 7 and since the transparent resin 7 is fit and spread in accordance with the rolling of the laminating rollers 13 , it is possible to perform filling over the entire surfaces in a short time even if the size of the polarizing plate 5 and the cover glass 6 is increased . in this respect , while the cover glass 6 has been set such that both ends thereof are held by the cover glass supporting portion 11 in an even manner while its central portion becomes lowest in the above manufacturing step , it is also possible that injection of the transparent resin 7 by the dispensing nozzle 12 and descending of the laminating rollers 13 is performed by providing a curve top portion in a region other than the central portion by differing heights for holding both ends of the cover glass 6 and setting a clearance between the curve top portion and the polarizing plate 5 as the most proximate position a . in the above manufacturing step , while the pattern p is preliminarily drawn onto the polarizing plate 5 and the approximate pattern n is drawn at the most approximate position a by the dispensing nozzle 12 after descending the cover glass 6 , it is also possible to draw the pattern p and the approximate pattern n by the dispensing nozzle 12 after descending the cover glass 6 without preliminarily drawing the pattern p onto the polarizing plate 5 . in the above manufacturing step , while both ends of the cover glass 6 are held by the cover glass supporting portion 11 to bend the cover glass towards the polarizing plate 5 side through warping by its own weight , it is possible to further warp the cover glass when compared to warpage by its own weight or to decrease the amount of warpage when compared to warpage by its own weight by taking measures other than bending through its own weight such as adjusting the holding clearance of both ends of the cover glass 6 through the cover glass supporting portion 11 provided that the clearance between the curve top portion and the polarizing plate 5 can be adjusted . in the above manufacturing step , while ultraviolet rays are irradiated after filling the transparent resin 7 over the entire surfaces of the polarizing plate 5 and the cover glass 6 , it is also possible to irradiate ultraviolet rays during rolling of the laminating rollers 13 provided that the transparent resin is filled over the entire surfaces of the polarizing plate 5 and the cover glass 6 without mixing air bubbles therein and the thickness is controlled to be uniform . in the present invention , while the first roller 13 a and the second roller 13 b are used as the laminating rollers 13 that are mutually rolled in opposite directions from the most approximate position a , other arrangements are also possible in which , for instance , one laminating rollers is rotated from the most approximate position a towards one end side of the cover glass 6 whereupon the rolling direction is inversed so as to roll the roller towards the other end side of the cover glass 6 for fitting and spreading the transparent resin 7 over the entire surfaces of the polarizing plate 5 and the cover glass 6 . in the present invention , it is also possible to employ three or more laminating rollers 13 in accordance with the shape or size of the plate - shaped bonded body 2 . in the present invention , it is possible to drive the laminating rollers 13 to reciprocate between the most approximate position a and the one end or the other end of the cover glass 6 if required . moreover , in the present invention , it is possible to make a plurality of rollers roll from the most approximate position a to the one end or other end of the cover glass 6 . in the present invention , it is further possible to make a pressing means other than the rollers wing or move from the most approximate position a to the one end or the other end on the cover glass 6 as long as the liquid filler can be fit and spread between a pair of substrates that constitute the plate - shaped bonded body 2 in a short time without mixing air bubbles therein . 1 . . . bonding device , 2 . . . plate - shaped bonded body , 5 . . . polarizing plate , 6 . . . cover glass , 7 . . . transparent resin , 10 . . . mounting portion , 11 . . . cover glass supporting portion , 12 . . . dispensing nozzle , 13 . . . laminating rollers , 13 a . . . first roller , 13 b . . . second roller , 15 . . . nozzle moving mechanism , 16 . . . pressing mechanism , 17 . . . elevating mechanism , 18 . . . roller driving mechanism , 20 . . . control portion , 21 . . . pressurizing means , 22 . . . discharge outlet	1
a series of preferred features that may apply equally to both the system , garment and method embodiments of the invention will now be described . the ability of the sensor to not cause an increase in pressure at the surface of a user subject to loads or pressure may be achieved by a number of ways . for example , the substrate may contain recesses that house the sensors so as to provide a continuous smooth outer surface and the housing and sensors have substantially the same hardness or compression characteristics so as to maintain a relative smooth surface when the substrate is under load . however , rather than providing recesses in the substrate that accommodate the sensors , preferably the sensors have a low profile that is equal to or less than 5 . 0 mm in thickness , even more preferably equal to or less than 3 . 0 mm in thickness , and suitably less than or equal to 1 . 0 mm in thickness . even more preferably , the sensors have a thickness that is equal to or less than 0 . 5 mm , 0 . 05 mm , or suitably equal to or less than to 0 . 01 mm . preferably , the area of the sensors facing the user is equal to or less than 400 mm 2 , and suitably equal to or less than 100 mm 2 , or even more preferably less than 50 mm 2 . in the situation where the sensors are removably attached to the substrate , suitably , the sensors can be held in position on the substrate using either one or a combination of adhesive materials including releasable adhesives or sticky adhesives , hook and loop type fasteners , clasps or any other mechanical fasteners that has a lower profile or does not have an adverse effect on the user by creating an increase in pressure at a particular point . according to an alternative embodiment , it is also possible for the sensors to be integrally incorporated in the structure of the substrate . for example , the sensors may be in the form of material located in discrete areas or selective areas that have been physically or chemically treated so as to be able to behave as a pressure sensor . pressure sensitive material may be in the form of foam or fibrous material coated with conductive material , or pressure sensitive conductive fibers or yarns that are either added to a garment or form an integral part of the garment . for example , the substrate or a portion of the substrate may behave as a pressure sensor as a result of being treated with a conductive material in the form of a polymeric material such as polypyrrole or poly ( ethylenedioxythiophene ) pedot . the substrate may be any substrate including woven fabrics , non - woven fabrics , knitted fabrics such as single or double knitted jersey , terry knits and alike . the substrate or the portion of the substrate treated with the conductive polymeric material may include electrodes in the form of two conductive threads , such as metal coated threads and suitably silver coated threads that measure changes in electrical potential difference between the threads . suitably , the threads are spaced apart by a spacing in the range of 2 to 15 mm and ideally approximately 5 mm in a direction transverse to the direction in which the substrate compresses when a pressure is applied to the substrate . suitably the substrate when treated with conductive materials behaves as a pressure sensor whereby pressure applied to the substrate is proportional to the inverse of voltage change across the sensor . in the situation where the sensors measure are used for monitoring the biomechanical movement of a user &# 39 ; s foot , for example as may be useful for podiatry , neuropathy or orthotics investigations , analysis and treatment , preferably , the sensors are able to be located at the heel and metatarsal region of the foot . for example , the sensors may be located in a triangular formation at the heel of the user and located in alignment with the 1st , 3rd and 5th metatarsal of the foot . one or more sensors may also be located in the arch of the user foot . although it is possible that the sensors may be located between layers of the substrate , or embedded in the substrate , preferably , the sensors are located on an inner surface of the substrate that directly faces the surface of the user or an outer surface of the substrate that faces away from the user . the substrate may be any form of garment depending on the particular application and body part being monitored such as socks , stockings , underpants , long johns , a singlet or a tubular sleeve . in the situation where feet of a diabetic or the stumps of an amputee are being monitored to prevent , for example , the formation of ulcers , preferably the substrate is in the form of a sock or stocking . the sock or stocking may be made from any suitable material and have any structure including knitted , woven or non - woven structures . it is also possible that the substrate may be in the form of an insert , bandage , sleeve , flexible planar materials , pads or inner garments that covers a foot or limb of a user . one of the advantages of this embodiment is that pressure sensors can be used to effectively measure the pressures applied by the bandages and thus provide a valuable means to determine the pressure gradient created by any pressure bandaging system . applications involving monitoring and controlling pressure gradients produced through pressure bandages can be used for treating venous leg ulcers or lymphoedema . in addition , the pressure sensors can also provide a means to determine the performance of pressure bandaging on patients while the bandages are in use and the effect on the patient when moving from supine to standing positions . according to another embodiment of the present invention , the garment may be in the form of a sleeve , suitably , a high stretch low pressure sleeve having pressure and temperature sensors . once in place on a patient &# 39 ; s limb , preferred pressure bandages can then be applied over the sleeve in a manner to produce the desired pressure gradient that is readily displayed as the bandages are applied . in another example the garment can be used to monitor the pressure on a user &# 39 ; s foot . the substrate , when used for this application and in other applications may be in the form of an insert that covers particular sections of a foot such as the metatarsal area of a foot , the heel of the foot , the arch of the foot , or the upper face of the foot . according to one particular embodiment , the substrate may be in the form of an inner sock that covers the foot up to the ankle and not the lower calf of the user and a conventional sock , covering the inner sock , ankle and calf of the user may be worn over the inner sock . preferably , the electrical circuitry is made up of at least two separable parts . preferably the circuit includes a first part of the circuit that is disconnectable from the substrate such that it can be disconnected and reconnected from the substrate as desired . in the situation where the substrate is in the form of a sock , preferably the first part of the circuit includes valuable reusable components of the electrical circuit including : signal conditioning or manipulation for example to counteract noise from mains electricity , data storage , data processing units , data transmission units and optionally power sources such as batteries . depending on the particular application , the batteries may be rechargeable . ideally , the components are contained in a housing that can be detachably connected to the substrate . fastening means such as hook and loop type fasteners , couplings , clasps and press fasteners may be used to secure the housing in position to the substrate . preferably , the second part of the electrical circuit includes the sensors and leads that extend from the sensors to first part of the circuit . preferably , first part of the circuit and housing weighs less than 300 grams , suitably less than 200 grams and even more preferably less than 100 grams . preferably the first and second parts of the circuit contain co - operating pairs of contacts that electrically interconnect the first and second parts of the circuit . for example , the leads of the second part of the circuit terminate in pairs of contact surfaces , hereinafter referred to as the second contact surfaces and the housing containing the first part of the circuit also has a co - operating pair of contact surfaces , hereinafter referred to as the first contact surfaces . suitably , the first contact surfaces face outwardly from the back or underside of the housing that is positioned against the substrate . in the situation where the substrate is in the form of a sock , ‘ preferably the second contact surfaces are located at the upper section or adjacent to the opening of the sock . the leads may be in the form of conductive fibers , yarns or threads or ribbon and bus connections that are supported by the substrate . although it is possible that the leads may be incorporated in the substrate preferably , the leads are sewn , knitted or woven to the substrate so that the substrate can flex and / or stretch in substantially the same manner as if the conductive yarns were absent . for instance leads in the form of ribbon and bus connections may flex and stretch in an elastic or resiliently deformable manner . alternatively , in the situation in which the leads such as ribbon and bus connectors are not elastic or resiliently deformable , it is possible that the leads may be supported on the substrate so as to move between a corrugated or tortuous condition , while the substrate is not flexed or stretched , to an at least partially or fully straightened condition , when the substrate is flexed or stretched . preferably , the system and garment of the present invention may also include any one or a combination of sensors for monitoring or sensing temperature of the user , stress and strain of parts of the user , angulation of particular parts of the user or sensors for monitoring physiological conditions such as the make up of the sweat or exudate of the user . the temperature sensor may be any suitable thermocouple . similarly , the biomechanical angulation sensor and the stress and strain sensors may be any suitable sensor including a conductive polymeric material or resistive change sensors that change in electrical resistance as a result of changes in angulation of parts of the body or forces such as the forces in posterior and anterior sections of a ankle or knee joint . an embodiment of the present invention will now be described with reference to the accompanying drawings , of which : fig1 is a perspective view of a sock having a detachable housing containing re - useable components of an electrical circuit that is fitted to the sock ; fig2 is an underneath view of a pair socks that are substantially the same as the sock shown in fig1 , each sock having a set of sensors that are located on the sock so that , when the sock is worn , the sensors align with the metatarsal and heel of the foot ; fig3 is an enlarged cross - sectional view of one of the sensors of the sock shown in fig1 or 2 ; fig4 is a perspective view of the sock shown fig1 without the detachable housing fitted to the sock ; fig5 is a back view of the detachable housing shown in fig1 ; fig6 is a photograph of a sock substantially the same as that shown in fig1 to 5 ; fig7 is a graph illustrating a set of results obtained using the sock shown in fig6 ; fig8 is a graph illustrating the changes in voltage measured across a wool polypyrrole pressure sensor ; fig9 is a chart showing the compression properties of a range of fabrics measured using a hounsfield jaw ; fig1 is a graph illustrating the relationship between the pressure measurements and an inverse of voltage squared of a fabric sample treated with pedot ; fig1 is a graph illustrating changes in voltage across a sensor in the form of a wool fabric treated with pedot located on the ball of a foot of a wearer during a trial ; fig1 is a graph illustrating an enlarged view of the graph of fig1 over the time interval between 45 and 60 seconds ; fig1 is a graph illustrating changes in voltage across a sensor in the form of wool fabric treated with pedot located on the heel of a foot of wearer during a trial ; fig1 is a graph illustrating an enlarged view of the graph of fig1 over the time interval between 40 and 60 second ; fig1 schematically illustrates a series of steps for manufacturing a fabric sensor treated with pedot ; fig1 schematically illustrates the sole of a foot and toes as if fitted with a series of pressure sensors ; and ; fig1 is a bar graph illustrating a set of signals of the sensors shown in fig1 during a trial . an embodiment of the present invention will now be described in detail with reference to a sock shown in the figures . however , it will be appreciated that the present invention may be embodied in any type of garment including , but by no means limited to stockings , leggings , underpants , long johns , singlets , inserts , inner socks , inner garments , under garments or bandages and may also be applicable in situations where the garment is used to cover the stump or terminated limb of the amputee that is fitted into a prosthetic limb . the sock 10 according to the preferred embodiment has been specifically configured to be a comprehensive analytical and monitoring tool for patients having neuropathic or orthotic conditions . the sock has been devised with sensors that monitor biomedical movement and in particular measure force or pressure at desired positions on the load bearing surface , temperature of the patient &# 39 ; s foot and optionally , stress or strain of the foot . although it is beyond the scope of the present invention , the data obtained from the sensors can be analyzed by a qualified health care practitioner . the sock shown in fig1 comprises conductive yarns 11 such as silver coated yarns sewn to the outside face of the sock , sensors 12 located at the base of the sock 10 that may align with the heel and metatarsal regions of a foot wearing the sock 10 , and a detachable housing 13 containing the electrical circuitry located on the upper end of the sock 10 . although it is possible that the yarns 11 may be elasticized which will allow the sock 10 to stretch and flex , in the situation where the yarns 11 are not elasticized , preferably the yarns 11 are sewn to the sock in a manner that allows stretching , for example , in a zig - zag or s - shaped pattern that allows the sock 10 to stretch and flex in the usual manner . the yarns 11 extend from the upper band of the sock 10 where the yarns 11 are arranged in pairs of terminating points 14 to the sensors 12 located on the base of the sock 10 . as can be best be seen in the fig3 , the yarns 11 are sewn , knitted or otherwise incorporated into the sock 10 save for a length 15 of the yarn closest to the sensors 12 that is free from the base of the sock 10 . in essence , the free length 15 of the conductive yarn allows the sensors 12 to be moved and positioned on the sock 10 at desired locations . the sensors 12 may be fixed in position using releasable adhesive , micro hook and loop type fasteners or an overlapping cover such as an adhesive tape that retains the sensors 12 in the desired position . as can be seen in fig2 and 16 , preferably three pressure sensors 12 a , 12 b and 12 c are located in the triangular formation at the heel of the sock 10 and , in addition , three separate sensors 12 d , 12 e and 12 f are located on the sock 10 that align with the first , third and fifth metatarsal of a patient wearing the sock 10 . in our view an important characteristic of the sensors 12 that they have a low or thin profile , preferably in approximately 0 . 5 mm or less and have surface area in the range of 50 to 100 mm 2 . one example of a pressure sensor 12 is a thin film sensors sold under the trade name flexiforce ® by tekscan , inc . an advantage in the using a thin film sensor 12 is that the presence of the sensor 12 on the sock 10 does not cause an increase in pressure in the foot , stump or any other loading bearing surface that could cause an adverse physical effect to a medical condition such as neuropathy . although not shown in the figures , temperature sensors or sensors for measuring any other physical or physiological condition may also be fitted to the sock . examples of suitable temperature sensors are semiconductor type sensors or rtd type sensors or yarn and / or fabric type sensors . the conductive yarns 11 extend from the sensors 12 at the base of the sock 10 to an upper edge of the sock 10 where the yarns end in pairs of terminating points 14 . the terminating points 14 are arranged side - by - side and align with co - operating pairs of contact points 16 located on the underneath side of the detachable housing 13 . although not shown in the figures , an electrical conductive adhesive sold under the trade name arclad ™ 8001 by adhesive research , inc . glen rock pa . 17327 is applied to either one or both of the terminating points or the contact points of the detachable housing 13 . in addition to electrical coupling , the detachable housing 13 is also secured to the upper portion of the sock 10 using any conventional securing means such as buttons , straps and buckles , cooperating hook and loop type fasteners and , as illustrated in the fig4 and 5 press studs 17 . in order to allow the sock 10 to be worn by elderly , frail and patients with impaired or compromised bodily movement , preferably the detachable housing 13 is light weight and suitably less than 200 grams in weight . if necessary , the top band of the sock 10 can be reinforced with additional elastic to prevent movement of the sock 10 and housing during walking . other means such as releasable adhesive or sticky adhesive may also be employed to ensure that the top band of the sock stays in a comfortable and working position . the detachable housing 13 contains electrical circuitry suitable for supply power to the sensors and receiving signals from the sensors . for example , the housing 13 contains a rechargeable battery , a processing unit that can be programmed with suitable algorithms able to be customized for particular applications , data storage and if desired , a transmitter that wirelessly sends signals to a host device or computer that the can further process data of the sensors worn by one patient or multiple patients wearing the sock simultaneously . the circuitry contained in the housing 13 may be made using any standard hardwiring . although it is ultimately dependent on the condition that is being monitored , in the situation where the sensors are monitoring pressure we have found that a primary data sampling rate of the sensors in the range of 500 to 1 , 500 hz and suitably approximately 1 , 000 hz to provide ample data . the optimal rate at which data from the sensors is sampled is dependant on a number of factors including : the size of the power source available ; and the nature of the data required to provide meaningful feedback to the health care practitioner . in addition , the processing unit may carry out data modification or manipulation , for example , noise reduction , to moderate the amount of the data required to be stored . in any event , ideally the available data memory and power supply are capable of the continuous operation for a period of at least one day . the status of the patient &# 39 ; s condition can change over the course of a day and , therefore , the device should be able to operate for a period of at least one day . the sock will have immediate application in the podiatry and orthopedic fields to provide extensive data regarding walking behavior with and without footwear and on all surfaces . the sock may also be applied to specialized limb socks in the prosthetic field . this data could be used to diagnose the onset of problems related to particular parts of the foot or limb . in neuropathic conditions , where there is a decline in the efficiency of the venous system due to disease , the indication from temperature and pressure sensors may be effective in diagnosing problems . a change in walking behavior , as a person becomes less conscious about foot movement , due to fatigue , or a decline in nervous response as a consequence of their neuropathy , or certain risk walking patterns , is either not detectable or not easily detectable by present devices . there also may be footwear related issues that are not apparent from current measuring systems . long term , time based , measuring of actual pressure at key indicating points of a foot combined with temperature measurements and other measurements like strain could provide a strong indication of a degenerating condition that could result in a pressure ulcer . in addition to the diagnostic function of the sock there is provided a monitoring function via a means to wirelessly transmit the data to local or remote systems . this could provide warnings to the wearer or to care providers about at risk conditions . fig7 is a graph illustrating a set of data obtained using the sock shown in fig6 . the graph illustrates data obtained from pressures sensors located at the heel , fifth metatarsal , third metatarsal , first metatarsal and big toe . the date shown in the graph was obtained by the patient walking from a hard concrete floor to a soft carpeted surface . the different sensor responses provide a clear indication of the walking behavior and characteristics . in addition , the sock could also provide a means to analyze athletic behavior for running , walking and jumping in time based pressure , temperature and strain measurements . for example running patterns under stress may provide an insight into endurance levels , the onset of physical problems or a means to correct or improve running action . this type of analysis may assist in developing corrective solutions . the data may also provide an analysis of the physical capability of athletes as it could indicate a change in running or walking patterns as the limits of endurance are reached . this could provide valuable information for coaches . in another example , rather than using the thin film sensor described above it is possible for the 35 sensor to be a substrate having surfaces that are treated with a conductive polymer such as polypyrrole or poly ( ethylenedioxythiophene ) ( pedot ) and has variable conduction or resistance depending on the force applied to the substrate . those skilled in the art will appreciate that many modifications and variations may be made to the preferred embodiment described above without departing from the spirit and scope of the present invention . the sock 10 may be any conventional sock 10 that has been retro - fitted with the required elements according to the present invention or alternatively a specialized sock that has been purposely built . moreover , the sensors may be fitted or removably connected to a substrate in any form including bandages , inserts that are worn under or over a conventional item of clothing such as socks , stockings , underpants and alike . for example , in the situation where the sensors are monitoring pressure on a wearer &# 39 ; s feet , the substrate may be in the form of a mini sock or ankle sock that only comes up to the ankle of the wearer and a conventional sock is then fitted over the mini or ankle sock . according to another embodiment , any one or a number of sensors for monitoring physical conditions such as temperature , stress , strain or angulation and / or sensors for monitoring physiological conditions such as the make up or properties of sweat and body exudate may be included . according to yet another embodiment , it is possible that the part of the electronic circuitry contained in the housing 13 may be in the form of printed electronic circuitry . the printed circuitry may be contained wholly or partly within the housing or partly or wholly on the substrate . as described above , the present invention may be embodied in any type of garment including , but by no means limited to stockings , leggings , underpants , long johns , singlets , inserts , inner socks , inner garments , under garments or bandages and may also be applicable in situations where the garment is used to cover the stump or terminated limb of the amputee that is fitted into a prosthetic limb . in addition to the analysis of foot or limb related activity , the garment may also be used in a broad range of analysis or monitoring of medical conditions . an effective and widely used means for treating venous leg ulcers and various wounds is application of pressure bandages . as an example leg ulcers are a chronic condition caused by a range of clinical disorders , either individually or in combination but to a large extent are associated with underlying venous / arterial disease . the incidence of ulceration in the population increases with ageing . diabetes is a condition that is a significant cause of ulceration . another condition where use of pressure garments or bandages are useful is lymphoedema , a chronic swelling of the limbs due either to a poor lymphatic system that fails to adequately drain fluids or can be the result of surgery or radiotherapy . there is a high potential for development of leg ulcers known as lymphatic obstruction oedema . the use of compression bandages is now generally accepted as an effective means to minimize or reverse the negative vascular changes by forcing fluid from the interstitial spaces back into the vascular and lymphatic systems . generally though , the correctly applied pressure will be reduced progressively up the limb or leg and it is usual that external compression bandages are applied in a graduated fashion , with the highest pressure at the ankle . however the actual pressure required remains a matter of some debate as there is not currently a means to effectively measure and monitor the pressure at the skin once bandages have been applied and patients leave a clinician . pressures ranging from 15 to 50 mm of hg have been described although there is debate on what is appropriate for various patients an ˜ their conditions . pressures of about 40 mmhg at the ankle are widely quoted in the literature for the prevention or treatment of venous leg ulcers , but some authorities recommend values significantly higher than this . the pressure exerted by any pressure bandage is determined by the elasticity of the fabric , the physical shape of the limb , the number of fabric layers applied to the limb and the manner of application . there are many bandage systems , comprising 1 or more layers , available for providing a pressure gradient . a bandage correctly applied with constant tension to a limb of normal proportions will automatically produce graduated compression with the highest pressure at the ankle . this pressure will gradually reduce up the leg as the circumference increases . however there is no uniformity in limb shapes and dimensions so that there are great variations for patients that can only be controlled by the expert experience of the clinician applying the bandages . too little pressure or an inadequate gradient will be ineffective in the healing process , too high a pressure can result in localized pressure points that could lead to complications . there is little actual pressure data to determine the effects of pressure on the wide population affected by such conditions and even less data available on the effect when an individual moves from a supine to a standing position or sits for extended time . for example if blood collects in the vessels and sinuses of the lower leg , under the influence of gravity , causes the volume of the leg to increase and is associated with the formation of oedema , leg volume will increase and lead to pressure changes . it is dependent on clinicians who are expert in the choice of products for particular patients and the optimum means for applying any particular product to avoid these complications . the present invention may be used in a broad range of applications including bandages or pressure bandages in the sense described above . one of the advantages provided by this particular embodiment of the present invention is that effective measurement of the pressures applied by pressure bandages and a valuable means to determine the pressure gradient created by any pressure bandaging system . in addition it can also provide a means to determine the performance of pressure bandaging on patients while the bandages are in use and the effect on the patient when moving from supine to standing positions . according to another embodiment of the present invention , the garment may be in the form of a high stretch low pressure producing fabric sleeve that can be readily applied to a patient . the sleeve has a number of pressure and temperature sensors and conducting circuits from each sensor to a common termination point at one end of the sleeve . as with the sock the sensors / sleeve is able to be readily connected , or disconnected from , to a removable electronics band or small device that provides power for the sensors and is able to then transmit the sensor data to a remote device for data analysis or simple display . in another form the pressure and temperature sensors are contained in a wrap around fabric to be used as a first layer prior to application of the pressure producing bandages . once in place on a patient &# 39 ; s limb preferred pressure bandages are applied in a manner to produce the desired pressure gradient that is readily displayed as the bandages are applied . it should be appreciated that this approach is not limited to fabrics or sleeves directed at limbs but can be applied to other garments . for example the sensors could be incorporated into undergarments for use by paraplegics or quadriplegics to sense the contact with seat or other surfaces to determine and alert whether there are risks for developing pressure points that could lead to complications . the pressure sensors used in the present invention may be in a number of different forms . for example , pressure sensors from tekscan are one form of sensor that can be used . an alternative sensor is the type of sensor in which a substrate , such as a substrate made from wool fibre , is treated with conductive polymers such as polypyrrole or poly ( ethylenedioxythiophene ) ( pedot ). techniques for applying conductive polymers to flexible substrates include , but are by no means limited to the following known techniques : roll to roll coating , inkjet printing dispersions and physical vapor deposition . furthermore , examples of two journal articles that describe techniques for applying conductive poly . mers to a base fabric substrate suitable for use as a pressure sensor are as follows . 1 . advances and applications of inherently conductive polymer technologies based on poly ( 3 , 4 - ethylenedioxythiophene ) by simpson et al , 2005 aimcal fall technical conference and 19fu international vacuum web coating conference , oct . 16 - 20 , 2005 2 . application of polypyrrole to flexible substrates by winter - jensen , clark et al . the performance of fabric samples treated with a polypyyrole and pedot will now be described in further detail . fig8 illustrates the test results of a wool fabric sensor treated with a polypyrrole conductive polymer . the test was carried out using a labjack data collector to detect relative responses between gentle taps , thumb pressure and sharp taps applied to the fabric . as can be seen , the conductivity of the material increases and thus the potential difference reduces with pressure applied to the fabric . the pressure sensing performance of a fabric treated with a conductive poly . mer is to an extent dependent on the compressibility performance of a fabric . the compression of fabric can be measure in two forms , namely a static test in which a weight is placed 30 on the fabric and a dynamic test whereby a weight is dropped onto the fabric . a variety of fabric types were trialed to determine the relative compression characteristics , with the thought that the more compressible fabrics would have a better range as conductive pressure sensors . a hounsfield test equipment apparatus h5000m was used to exert a controlled pressure ( maximum applied weight = 50 kg or 530 n ) onto the chosen fabric pieces and the compression noted . a calibration graph was first prepared for jaw separation distance , to enable the relative fabric compressions to be calculated from the resultant mv readings obtained at maximum possible compressions . once the device was calibrated the compression characteristics for a set of different fabrics was measured . the compression characteristics of a set of fabrics tested is set out in fig9 . fabrics having poor total compression were determined to be unsuitable for treatment with a conductive polymer . absolute compression heights of at least 1 . 0 mm where determined to be the most suitable . a pedot wool sensor was constructed in accordance with the sequence of steps set out in fig1 and then tested . the step 1 involves applying a conductive poly . mer a section of sock fabric identified by reference numeral 20 in accordance with techniques such as those discussed in the above journal articles . conductive threads in the form of silver coated threads 21 are spaced approximately 5 mm apart are then sewn into the conductive poly . mer section and non - conductive thread 22 is sewn around the outside of the conductive material . a lightweight greaseproof paper 23 is then folded over the sensor to form a paper envelope over the sensor . a waterproof medical gown fabric 24 is then wrapped around the sensor . finally excess material is cut away from the sensor . static tests were then conducted on the sensor shown in fig1 over a range of different pressures using a hounsfield jaw apparatus . the results obtained show a relationship between the pressure applied and 1 / v 2 which is illustrated by the graph in fig1 . two identical sensors constructed in accordance with fig1 were then located in the ball and heel of a wearer in the weight range of 65 to 70 kg and then asked to perform a series of separate movements . fig1 illustrates the results obtained of a sensor located at the ball of the wearer &# 39 ; s foot when requested to carry out activities . specifically , the initial dips between 10 and 15 seconds indicate the wearer transferring all of their weight between standing on two feet and standing on one foot fitted with the sensor . the interval between 30 and 40 seconds represent a wearer taking the weight off their heels and the interval from 40 to 60 seconds represents a wearer marching while the interval from 63 second to 70 seconds presents the wear hopping . fig1 is an enlarged view of fig1 over the interval 45 to 60 seconds . fig1 illustrates the response obtained from a sensor located at the heel of the wearer while the wearer perfor . ms a series of different movements . in particular , during the interval 15 to 25 seconds , the wearer transfers their weight from a position in which their weight is evenly distributed on their feet to a position in which their weight is unevenly distributed to the heel followed by a rocking motion forward and then finally back again onto the back of the heel . the interval from 28 to 35 seconds represents the wearer rocking from side to side . the interval from 40 to 50 seconds represents the response from the marching and 30 the interval from 55 to 60 seconds represents the response obtained during hopping on two feet . fig1 is an enlarge view of the response during marching and hopping activities during the interval from 40 to 55 seconds . a trial was then run in which both pedot fabric sensors and tekscan flexiforce sensors were operated simultaneously . the trial involved 3 single pedot jersey sensors placed on the inner and outside heel positions , namely positions h1 and h2 in fig1 and a double interlock knit pedot sensor placed in the middle heel position h3 . tekscan sensors were placed on the remaining foot pad and big toe position , identified in fig1 as m1 , m2 , m3 and bt . the trial was carried out by the sock being worn around the laboratory , for a period of 1 . 5 hours . fig1 is a graph showing an instantaneous output for the sensors in order of left to right : h3 , 15 h2 , h1 , m3 , m2 , m1 and bt . at the end of the trial all sensors were tested using the hounsfield jaw apparatus and all were measured as having pressure responses as a function which caused an inverse voltage change . thus , all sensors were shown to be responsive and still in working order after the trial .	0
in an example embodiment a predictive model for hospital readmissions is integrated in a model software application for use by a health benefits provider with a covered patient - member population . referring to fig1 , a block diagram illustrating development and application of a hospital readmission predictive model and model application according to an example embodiment is shown . historical clinical data such as administrative claims data for medical and / or pharmacy claims and clinical / health program participation data as well as consumer data such as contact data , demographic data , and financial data 100 is input to a predictive model . the data may be cleansed 102 and mined 104 according to various well - known techniques . a hospital readmission predictive model 106 is developed using various well - known techniques as listed in table 1 . the predictive model is then incorporated into a model application 108 that is applied to a member population . members of the population that are at risk for readmission are selected for proactive clinical interventions and programs 110 . the use of the model with proactive clinical programs and interventions helps to improve outcomes for members 112 and to reduce hospital - related costs for the health benefits provider 114 . referring to fig2 , a diagrammatic representation of data complexities for a hospital readmissions predictive model according to an example embodiment is shown . as indicated in fig2 , various factors may increase the likelihood that a member 200 is readmitted or rehospitalized . the likelihood of readmission may be expressed as a score 218 assigned to a member in relation to various factors such as : clinical diagnosis 202 ; age 204 ; gender 206 ; previous admissions 208 ( e . g ., any prior admissions , number of previous admissions , days since last admission ); medications and surgery 210 ; length of stay 212 ; bed type 214 ; and comorbidities 216 . although many factors may contribute to a patient &# 39 ; s readmission , some factors may be better “ predictors ” than others and therefore , incorporated into the model application applied to the member population . fig2 further illustrates the elements of administrative claims data and current treatment data that may be relevant to a patient &# 39 ; s readmission score . for example , diagnosis 202 , age 204 , gender 206 , number of previous admissions 208 , days from last admission 208 , and comorbidity 216 data may be discerned from member profile and administrative claims data while medication / surgery 210 , length of stay 212 , and bed type 214 may be discerned from a current medical record or treatment data . one of skill in the art would recognize that relevant input may be obtained from various databases and sources and may be provided to a readmissions predictive model as described herein . referring to fig3 , a block diagram illustrating development details of a predictive model according to an example embodiment is shown . as illustrated in fig3 , membership and medical / pharmacy claims data for a covered population may be used as input to a predictive modeling system . the use of claims data provides the predictive modeling system with multiple years of data experience for millions of lives . additionally , the input data may comprise medical records and other related demographic and financial data for the covered population . in the example shown , medicare claims data for members discharged from a hospital and returned to a home or home healthcare setting is analyzed . one record for each initial admission may be analyzed . the model generates data of hospital readmissions and a variety of potential signals of readmissions from the database . in the example shown , 417 , 638 original admissions were considered 300 . a random sample of 70 % of the entire data table was used to build and tune the model and 30 % of the data table was used to test the model . for the medicare population , 40 % of all initial admissions were randomly assigned to the training dataset 302 and 30 % to the validating ( tuning ) dataset 304 . the model was built on the training dataset and subsequently validated . the model was then executed on the remaining 30 % of the data ( testing dataset 306 ) to assess the model &# 39 ; s performance . the predictive modeling system identifies and captures statistical relationships between potential signals and readmissions . referring to fig4 , a diagram of variables considered and associated probability of readmission according to an example embodiment are shown . the chi square value shown in fig4 is a statistical measure representing the relationship between the variables . as shown in fig4 , the three strongest predictors of a hospital readmission are “ days between previous and current admission ,” the charlson comorbidity index , and “ admission count in past six months .” details of the numbers associated with the top three predictors are shown in tables 2 , 3 , and 4 . referring to fig5 , a comparison of actual to predicted readmission rates according to an example embodiment is shown . fig5 illustrates the performance of the predictive model by comparison with actual rates and indicates a strong correlation between the predictive rates and actual rates . referring to fig6 a , a block diagram of a readmissions predictive model system according to an online example embodiment for a health benefits provider is shown . the readmissions predictive model 602 may be integrated in a model software application used in real - time and applied to patient data on demand . in the “ online ” example embodiment , the model software application executes on a server and receives data from a clinical profile database and / or clinical care advance system 600 in response to a user request . the clinical profile database comprises a complete profile for a covered member including contact information , demographic profile data such as age and gender , claims data for medical and / or pharmacy claims submitted by the member to the health benefits provider , a contact history with details regarding communications between the member and the health benefits provider ( e . g ., mailings , telephone calls , emails , web site visits , and other outreach efforts ), and participation data related to clinical programs and interventions in which the member has been enrolled and / or participated . a clinical care advance system may be used by nurses and clinical specialists to access the member &# 39 ; s clinical profile and claims data and to assist them in providing services to members . nurses , clinical specialists , and other representatives of the health benefits provider may interact with members to provide information about programs and interventions and other assistance related to the member &# 39 ; s health conditions or problems . an admission trigger from the clinical profile data and / or clinical care advance system database 600 may be used to invoke the readmission predictive model 602 and to estimate a readmission probability score for a member . in an example embodiment , the readmission predictive model is triggered by specified events during the admission stay in the hospital such as admission to the hospital , discharge from the hospital , or a major status change such as transfer to an intensive care unit . data related to these events is entered in a clinical care advanced system database , and triggers the model to make predictions based on the most up - to - date information . a customer care representative from the health benefits provider may interact with an online clinical care advance system 604 and may request a readmission score in connection with assisting the member while using the clinical care advance system 604 . the clinical care advance system allows a representative to access the member &# 39 ; s profile data and see details that may assist the representative in providing information and services to the member . the model 602 is applied to the member &# 39 ; s clinical profile data 600 , which is refreshed periodically , to generate a readmission score . the score may then be compared against a threshold value 606 . patients with scores above the threshold may be considered for further action 608 while patients with scores below the threshold are not considered for further action 612 . one of skill in the art would recognize that the score threshold may be established in such a way that a certain percentage of the covered population ( e . g ., 20 %) is selected for further action . one of skill in the art would also recognize that score ranges ( e . g ., 0 - 100 , 101 - 250 , 251 +) may be established , each of which is associated with a different intervention action . in some instances , no additional action or limited action may be taken ( e . g ., a phone call ) as the readmission score is within an acceptable or low risk range . the scores may be used in a variety of ways to determine whether certain members are directed to additional programs and interventions . members with scores that exceed a threshold 606 may be considered for additional clinical programs or interventions . additional filters 608 may be applied to the member &# 39 ; s profile data to identify appropriate clinical programs or interventions . the programs and / or interventions may be selected based on the member &# 39 ; s health conditions or problems . members that have been diagnosed with certain diseases or conditions ( e . g ., asthma , coronary artery disease , depression , diabetes ) may be enrolled in a disease management program . other programs may not be directed to a specific disease or condition but may be available to members to help them with various issues or concerns as they arise ( e . g ., nurse services , chronic care management , pharmacy counseling and education ). each program or intervention may have associated selection criteria 608 that are applied to member clinical data to determine whether a member is a candidate for a program or intervention . example programs and interventions are identified in table 5 . readmission scores may also be used to develop a risk stratification strategy . in a risk stratification strategy , interventions are determined according to score ranges rather than individual scores . following application of filters or selection criteria , members with readmission scores that exceed a threshold may be referred to specific programs and / or interventions 614 that help them manage their health condition or problem and more importantly , help them to avoid a subsequent hospital visit or admission . for example , some members may receive instructions on taking prescribed medications and possibly avoid an adverse drug event that could result in a hospitalization . other members may be assigned a personal nurse who answers the member &# 39 ; s questions related to various areas of medical care . in many instances , the access to additional information and support related to the member &# 39 ; s health condition or problem reduces the likelihood of another hospital admission . member participation in the recommended interventions or programs may be tracked in the member &# 39 ; s clinical profile . for example , attendance at consultations for a disease management program may be recorded . each member contact with the health benefits provider may be recorded . for example , participation data for members that are asked to periodically report health status indicators may be tracked . members that do not report in when expected may be contacted by a representative of the health benefits provider . referring to fig6 b , a block diagram of a readmissions predictive model system according to an offline example embodiment for a health benefits provider is shown . the readmission predictive model 602 operates in the manner described in relation to fig6 a , but is applied to batched data rather than in response to an online request . in the offline embodiment , the clinical profile / clinical care advance system databases 600 and claims / clinical care advance table 604 may be updated daily through batch updates . the readmission predictive model 602 may be applied to member data to identify members at risk that will soon be discharged from the hospital . a threshold score comparison is made 606 , program and / or intervention filter criteria are applied 608 , and a daily referral list is generated 616 . the referral list 616 is generated in connection with member hospital discharges so that , as appropriate , each member may be enrolled in or start participating in a program or intervention as soon as possible after leaving the hospital . because many readmissions occur within a few weeks or days of a patient &# 39 ; s discharge from the hospital , timely intervention is important in reducing the likelihood of a readmission . the daily referral list 616 allows the health benefits provider to identify members that are leaving the hospital , and high risk candidates for readmission . appropriate programs and interventions may be defined at the time of discharge so that the likelihood of readmission is reduced . the computerized system and method may be used by a healthcare payor such as a health benefits provider to identify the right members of a covered population for the right clinical interventions and programs , and the right time . the computerized system and method supports early , proactive intervention , and therefore , reduces costs and improves outcomes . models are built from large amount of historical and clinical data . the use of comprehensive data , including all relevant data elements and derived signals , provide higher prediction accuracy than prior art systems and methods . the statistical data patterns captured in the model provide objective and unbiased predictions . furthermore , the model is suitable for risk stratification . the outcome is a number that is representative of a level of risk . the health benefits provider can then determine what actions to take based on each member &# 39 ; s risk level . while certain embodiments of the present invention are described in detail above , the scope of the invention is not to be considered limited by such disclosure , and modifications are possible without departing from the spirit of the invention as evidenced by the claims . for example , readmission thresholds and ranges as well as associated actions may be varied and fall within the scope of the claimed invention . other aspects of the readmission predictive model may be varied and fall within the scope of the claimed invention . one skilled in the art would recognize that such modifications are possible without departing from the scope of the claimed invention .	6
referring now to the drawings in detail , wherein like numerals represent like structure and elements throughout , fig1 illustrates a first preferred embodiment of the trailer hitch receiver cover , generally identified 10 , that is constructed in accordance with the present invention . the cover 10 comprises a unitary structure having a front face 12 . extending rearwardly of the front face 12 is a top wrap - around edge 13 and a bottom wrap - around edge 15 , as well as a first side edge 16 and a second side edge 18 . all of the edges 13 , 15 , 16 , 18 are integrally formed with the front face 12 . the cover 10 is intended to be placed over the end of a trailer hitch receiver tube 1 . see fig2 through 4 . the receiver tube 1 is a typical square - shaped elongate metal tube having a square cross - section and further having a first side wall 2 and a second side wall 3 . the first side wall 2 includes a first side wall aperture 4 and the second side wall 3 includes a second side wall aperture 5 . the apertures 4 and 5 are linearly aligned . forwardly of the receiver hitch tube 1 , and at its distal - most portion relative to the vehicle ( not shown ) that it is attached to , is a peripheral collar or flange 8 . at the first side wall 2 , the flange 8 includes a rearwardly - facing first flange surface 6 . at the second side wall 3 , the flange 8 includes a similar rearwardly - facing second flange surface 7 . although identified as separate structures for purposes of explanation only , it is to be understood that the rearwardly - directed surfaces 6 , 7 of the flange 8 are actually part of the same structure , the flange 8 completely encircling the receiver 1 . it is to be understood that the lips 24 , 34 discussed above form portions of a continuous lip structure that completely encircles and captures the peripheral collar or flange 8 of the receiver tube 1 . it is also to be understood that the inner capture cavity 14 is also a structure that completely encircles and captures the peripheral collar or flange 8 of the receiver tube 1 . in this first preferred embodiment , a pair of rearwardly - directed side extension members 20 , 30 extend rearwardly from the front face 12 of the cover 10 . more specifically , the extension members 20 , 30 extend rearwardly from the first side edge 16 and the second side edge 18 , respectively , of the front face 12 . the first extension member 20 includes an inner surface 26 . extending perpendicularly inward from the inner surface 26 is a lip 24 and a tab 28 , the tab 28 being disposed further rearwardly of the lip 24 relative to the front face 12 . similarly , the second extension member 30 includes an inner surface 36 having a lip 34 and a tab 38 extending perpendicularly inward from it . forwardly of the lips 24 , 34 is an inner capture cavity 14 . this inner capture cavity 14 is defined at a portion by a first capture cavity recess 22 and by a second capture cavity recess 32 at the lip 24 of the first extension member 20 and at the lip 34 of the second extension member 30 , respectively . in application , as shown in fig3 , the cover 10 is urged towards the receiver 1 such that the tabs 28 , 38 of the extension members 20 , 30 , respectively , pass over the collar or flange 8 of the receiver 1 . as the inner capture cavity 14 and the lips 24 , 34 are urged towards the flange 8 , the cover 10 will have enough resiliency to allow the lips 24 , 34 to pass over the flange 8 thereby allowing the capture cavity recess 22 of the first extension member 20 to engage the rearwardly - facing surface 6 of the receiver flange 8 . similarly , the capture cavity recess 32 of the second extension member 30 will engage the rearwardly - facing surface 7 of the receiver flange 8 , thereby fully engaging the cover 10 with the collar or flange 8 and preventing any debris , water or other foreign matter from entering the receiver tube 1 at that end . with the capture cavity 14 fully engaged with the collar or flange 8 , the tab 28 of the first side extension member 20 is a position that it can be urged into the first side wall aperture 4 . at the same time , the tab 38 of the second side extension member 30 is in a position that it can be urged into the second side wall aperture 5 , thereby preventing the entry of debris , water and other foreign matter into the receiver tube 1 at those apertures 4 , 5 as well . this functionality allows the interior of the receiver tube 1 from becoming contaminated by dirt and corrosive agents , thus preserving the integrity of the inside surfaces of the tube 1 under all adverse conditions . the fully engaged cover 10 is illustrated in fig4 . to remove the cover 10 from the receiver tube 1 , the reverse of the steps identified above are performed by the user . it is the intention of these inventors , and it is also to be understood by one skilled in the art , that the cover 10 of the first preferred embodiment be constructed of a single piece of material , preferably a resilient and weather - resistant rubber or other flexible material . furthermore , the cover may be made of other materials and may be fabricated in virtually any color that is available for molding of such products . it should also be noted that the first preferred embodiment of the cover 10 includes a pull tab 17 disposed immediately below the bottom edge 15 of the front face 12 . the pull tab 17 may be used to aid in removal of the cover 10 . it may also be used to house the face of an electrical plug ( not shown ) that normally extends from the rear of the towing vehicle ( also not shown ) to prevent its contamination and exposure to the elements when the trailer is disconnected from the towing vehicle . while this is an added feature of the preferred embodiment of the present invention , such is not a limitation of the invention . referring now to fig5 , it illustrates a second preferred embodiment of the trailer hitch receiver cover , generally identified 100 , that is constructed in accordance with the present invention . the cover 100 similarly comprises a unitary structure having a front face 112 . extending inwardly of the front face 112 is a top wrap - around edge 113 and a bottom wrap - around edge 115 , as well as a first side edge 116 and a second side edge 118 . as with the first preferred embodiment , the cover 100 of the second embodiment is intended to be placed over the end of a trailer hitch receiver tube 1 . see fig6 through 8 . again , the receiver tube 1 is a typical square - shaped elongate metal tube having a square cross - section and further having side walls 2 , 3 and side wall apertures 4 , 5 , respectively , and a collar or flange 8 , the flange 8 having a front face 9 . in this second preferred embodiment , a pair of rearwardly - directed first and second extension members 120 , 130 extend rearwardly from the front face 112 of the cover 100 . as compared to the first embodiment , however , the extension members 120 , 130 are disposed to the inside of the hitch receiver 1 , the extension members 120 , 130 being resiliently flexible toward and away from one another . the first extension member 120 includes an outer surface 126 . extending perpendicularly outward from the outer surface 126 is a tab 128 . similarly , the second extension member 130 includes an outer surface 136 having a tab 138 extending perpendicularly outward from it . rearwardly of the front face 112 is an inner capture cavity 114 . this capture cavity 114 is defined , in part , by the first side edge 116 and a proximal portion 122 of the first extension member 120 and by the second side edge 118 and a proximal portion 132 of the second extension member 130 . it is to be noted that the same structure exists as to the top and bottom side edges 113 , 115 , respectively , as well . as shown in fig7 , the cover 100 is urged towards the receiver 1 such that the tabs 128 , 138 of the extension members 120 , 130 , respectively , slide into the receiver 1 . as the inner capture cavity 114 is urged towards the peripheral collar or flange 8 , the cover 100 will have enough resiliency to envelop flange 8 , thereby urging the front face 9 of the flange 8 to engage a resilient gasket 140 that is held in place adjacent the front face 112 of the cover 10 . the gasket 140 prevents any debris , water or other foreign matter from entering the receiver tube 1 at that end . at the same time that the capture cavity 114 and gasket 140 become fully engaged with the flange 8 , the tab 128 of the first extension member 120 is urged into the first side wall aperture 4 and the tab 138 of the second extension member 130 is urged into the second side wall aperture 5 , thereby preventing the entry of debris , water and other foreign matter into the receiver tube 1 at those apertures 4 , 5 as well . this functionality allows the receiver tube 1 from becoming contaminated by dirt and corrosive agents , thus preserving the integrity of the inside surfaces of the tube 1 under adverse conditions . the fully engaged cover 100 is illustrated in fig8 . to remove the cover 100 from the receiver tube 1 , the reverse of the steps identified above are performed . referring now to fig9 , it illustrates yet a third preferred embodiment of the trailer hitch receiver cover , generally identified 210 , that is constructed in accordance with the present invention . the cover 210 comprises a unitary structure having a front face 212 . extending inwardly of the front face 212 is a top wrap - around edge 213 and a bottom wrap - around edge 215 , as well as a first side edge 216 and a second side edge 218 . in this third embodiment , note that the second side edge 218 is configured with a pair of slits 217 which define the edges of a side edge finger 219 . though not shown in fig9 , it is intended that this structure exists at the first side edge 216 of the cover 210 as well . as with the two other prior embodiments , the cover 210 is intended to be placed over the end of a trailer hitch receiver tube 1 . see fig1 through 12 . the receiver tube 1 is the same square - shaped elongate metal tube as previously described . in this third preferred embodiment , a single hollow extension member 250 protrudes rearwardly of the face 212 of the cover . the extension member 250 includes a pair of rearwardly - directed side walls 220 , 230 . the first side wall 220 includes an outer surface 226 . extending outwardly of the outer surface 226 is a tab 228 . similarly , the second side wall 230 includes an outer surface 236 having a tab 238 extending outwardly from it . an inner capture cavity 214 is defined between a proximal portion 222 of the first side wall 220 and the cover first side edge 216 and by a proximal portion 232 of the second side wall 230 and the cover second side edge 218 . additionally , the catch tab 219 includes a lip 211 , the catch tab 219 and lip 211 structure existing to each side 216 , 218 of the cover 210 . as shown in fig1 , the cover 210 is urged towards the receiver 1 such that the hollow extension member 250 is introduced into the receiver 1 . as the inner capture cavity 214 and the lips 211 are urged towards the flange 8 , the cover 210 and the catch tabs 219 will have enough resiliency to allow the lips 211 to pass over the peripheral collar or flange 8 . note also that the lips 211 have a ramped outer surface that facilitates movement over the flange 8 . as the lips 211 continue to pass over the flange 8 , the front face 9 of the flange will come into contact with a gasket 240 disposed within the capture cavity 214 . ultimately , the lips 211 will snap into place thereby engaging the rearwardly - facing surfaces 6 , 7 of the front flange 8 . as the capture cavity 214 becomes fully engaged with the hitch receiver flange 8 , the tab 228 of the first side wall 220 will seat into the first side wall aperture 4 and the tab 238 of the second side wall 230 will seat into the second side wall aperture 5 , thereby preventing the entry of debris , water and other foreign matter into the receiver tube 1 at those apertures 4 , 5 as well . as described earlier , this allows the receiver tube 1 from becoming contaminated by dirt and corrosive agents and preserves the integrity of the inside surfaces of the tube 1 under adverse environmental conditions . the fully engaged cover 210 is illustrated in fig1 . to remove the cover 210 from the receiver tube 1 , the lips 211 must be lifted to disengage them from the flange 8 and then the reverse of the other steps identified can be performed . accordingly , it will be seen that there has been provided a new and useful trailer hitch receiver cover that effectively wraps around the peripheral collar or flange of the hitch receiver to prevent the exposure of the hitch receiver interior to the elements . the cover also incorporates means for sealing the lateral holes in the hitch receiver and provides both features in a single unitary device . the cover can be fabricated of a resilient and flexible material .	1
the detailed description and the following examples are given for illustration and should not be interpreted as further limiting the scope of the invention . the term “ about ” as used in the present document means approximately , in the region of , around . when the term “ about ” is used in connection with a numerical value , it modifies it by increasing or decreasing it by a 10 % variation with respect to the nominal value . this term can also take into account , for example , the experimental error of a measurement apparatus . when a range of values is mentioned in the present application , the lower and upper limits of the range are always included in the definition , unless indicated otherwise . the polymers described here are useful as lubricating agents used in rolling alkali metal films . these agents are alkyl succinimide polyether copolymers of formula i : m and denote the number of repeated units a and b , respectively , in the polymer , m being a positive whole number and n being a positive whole number or zero when the repeated unit b is absent , and where m and n are selected such that the molecular weight of the polymer of formula i is in the range from 1000 to 10 6 , from 2000 to 250 , 000 , from 2000 to 100 , 000 , from 2000 to 50 , 000 , or even from 50 , 000 to 200 , 000 , limits included ; r 1 , independently at each occurrence , is selected from the linear or branched monovalent hydrocarbon radicals , preferably from the linear or branched monovalent hydrocarbon radicals of formula c r h 2r + 1 , where 4 ≦ r ≦ 24 , preferably where 8 ≦ r ≦ 18 ; r 2 , independently at each occurrence , is selected from — ch 2 ch 2 o — and — ch 2 ch 2 ch 2 o —, where r 2 is bound to n by a carbon atom , or r 2 is absent and n is covalently bound to r 4 ; r 3 , independently at each occurrence , is selected from the linear or branched monovalent hydrocarbon radicals , preferably from the linear or branched monovalent hydrocarbon radicals of formula c t h 2t + 1 , where 4 ≦ t ≦ 24 , preferably where 8 ≦ t ≦ 18 ; r 4 , independently at each occurrence , is a polyether residue of formula —[ ch ( r 5 ) ch 2 o ] s ch 3 , where 5 ≦ s ≦ 100 , preferably where 8 ≦ s ≦ 50 ; and r 5 , independently at each occurrence , is a hydrogen atom or a ch 3 group . according to an embodiment , the ratio of the repeated units a : b expressed as mole percent in the lubricating agent is between 100 : 0 and 10 : 90 , preferably between 100 : 0 and 20 : 80 , limits included . according to another embodiment , the ratio of the repeated units a : b expressed as mole percent in the lubricating agent is between 60 : 40 and 10 : 90 . according to an embodiment , r 4 is a polyether residue of formula —[ ch ( r 5 ) ch 2 o ] s ch 3 , in which 5 ≦ s ≦ 100 , and r 5 is ch 3 at each occurrence , preferably where 8 ≦ s ≦ 50 . in another embodiment , r 4 is a polyether residue of formula —[ ch ( r 5 ) ch 2 o ] s ch 3 , in which 5 ≦ s ≦ 100 , and r 5 is a hydrogen atom at each occurrence , preferably where 8 ≦ s ≦ 50 . according to a different mode , r 4 is a polyether residue of formula a polyether residue of formula —[ ch ( r 5 ) ch 2 o ] s ch 3 , in which 5 ≦ s ≦ 100 , and r 5 , independently at each occurrence , is ch 3 or hydrogen , preferably where 8 ≦ s ≦ 50 , r 4 thus being a polyether chain having repeated units of propylene oxide ( po ) and of ethylene oxide ( eo ) ( also referred to here as a polyether chain po / eo ). according to an embodiment , r 4 is a polyether chain po / eo covalently bound to n ( the nitrogen atom of a succinimide group ). examples of these polyether chains po / eo include , without limitation , the polyethers having a molar ratio po / eo varying from about 20 : 1 to about 1 : 30 , or from about 10 : 1 to about 1 : 10 , preferably having a molecular weight between about 300 and about 5000 , preferably about 500 and about 2500 . examples of r 4 also include the polyether chains po / eo of amine polyethers , the amine group being part of the succinimide of the unit a , such as the monoamines jeffamine ® of the “ m ” series , for example , the m - 600 , m - 1000 , m - 2005 and m - 2070 ( huntsman corporation , texas , u . s . a . ), having a respective molar content of po : eo of 9 : 1 , 3 : 19 , 29 : 6 and 10 : 31 . according to an aspect , the content of repeated unit b in the polymer of formula i is adjusted in order to obtain a polymer that is soluble in a solvent or an apolar solvent system , for example , such a solvent or system of solvents includes hydrocarbon solvents ( for example , hexane , heptane ), aromatic solvents ( for example , toluene ), or mixtures thereof . nonlimiting examples of lubricating agent polymers of formula i are as specified in table 1 . for example , the lubricating agents of formula i can be prepared by : ( a ) the obtention of an alternating ( alt ) copolymer of alkylene r 1 chch 2 and of maleic anhydride , r 1 being as defined above . this copolymer is then reacted with an amine of formula r 4 — r 2 — nh 2 , optionally at the same time , beforehand or subsequently with an amine of formula r 3 — nh 2 , where r 2 , r 3 , and r 4 are as defined above . examples of methods for producing lubricating agents are illustrated here in further detail in synthesis examples 1 to 4 . the compositions described here include at least one lubricating agent of formula i . these compositions can also include additional components such as solvents that are inert with respect to the alkali metals . examples of solvents include , without limitation , the hydrocarbon solvents ( for example , hexane , heptane , etc . ), the aromatic solvents ( for example , toluene , etc . ), or mixtures thereof . the alkali metal films consist , for example , of lithium or of a lithium alloy , of sodium or a sodium alloy , preferably of lithium or an alloy in which lithium is the major component , preferably lithium having a purity of at least 99 % by weight , or a lithium alloy including less than 3000 ppm of impurities by weight . according to an embodiment , the alkali metal films as produced here includes on one of the two surfaces thereof or on said two surfaces , a thin layer of lubricating agent of formula i or of a composition including it . for example , the lithium films including on one surface or one of the surfaces at least one lubricating agent or a composition of the invention can generally have a lower impedance in comparison to lithium films produced with the use of other lubricating additives . other improved properties of these films can also comprise a more stable and more uniform passivation layer , and improved cycling properties . when the method for producing the thin lithium film is performed in an essentially anhydrous air atmosphere , the passivation layer on the lithium film includes lithium carbonate , lithium oxide and / or lithium hydroxide . the alkali metal films as described here are produced by rolling or calendering between rollers using the lubricating agents of formula i and the compositions including them . the methods for preparing lithium films by metal rolling are illustrated , for example , in the u . s . pat . no . 5 , 837 , 401 and u . s . pat . no . 6 , 019 , 801 ( both issued in the name of gauthier et al .). the methods described in gauthier et al . can be carried out using the lubricating agents and compositions as described here ( for example , see section i above ). for example , a lithium strip having a thickness of about 250 μm is used in the rolling process in order to produce a lithium film . the lithium strips can be obtained , for example , by extrusion of commercially available ingots or rods made of lithium . in general , a lithium strip , mounted beforehand on an unwinder , is passed between two work rollers . a lubricant is added ( for example , by means of a pouring spout onto the strip and / or by prior coating of the work rollers ) at the point of insertion of the lithium strip between the two rollers , that is to say immediately before the rolling step . according to an embodiment , the lithium film that comes out of the work rollers can be wound on a winder for later use . in this particular mode , the lubricant acts , at least in part , so as to prevent the adhesion of the lithium film to itself . according to another embodiment , the lubricated lithium film produced is used directly for other rolling steps ( for example , by continuous or series rolling ) with a layer of solid polymer electrolyte , a protective layer , and / or a current collector ( for example , in a current collector / lithium film / electrolyte configuration or in a current collector / lithium film / protective layer / electrolyte ) configuration . in each case , the winders or rollers arranged in series supply a sufficient tension to the lithium film in order to reduce the adhesion of the lithium film to the work rollers , but without excessive tension so as to prevent the tearing of the lithium film . for example , the step of rolling between rollers can produce an alkali metal film at a rate in the range from about 10 m / min to about 50 m / min of alkali metal film . it is obvious that the work rollers have to consist of and / or be coated with a material that is inert with respect to the alkali metal ( such as metal lithium ) in the presence of the lubricating agent and / or the composition of the invention . for example , the rollers can consist of hard polymers such as plastics , metal rollers coated with plastic material , rollers made of stainless steel , etc . the method of the invention can be carried out in an anhydrous atmosphere , preferably in an essentially dry air atmosphere , for example , in an anhydrous chamber or a chamber with controlled humidity , for example , with a dew point between − 45 and − 55 ° c ., for a relative humidity from 0 . 7 to 2 . 2 %, preferably a dew point of about − 50 ° c . for 1 . 3 % of relative humidity . the alkali metal films as produced here are useful for producing electrochemical cells . for example , the electrochemical cells include at least one electrode having an alkali material film , such as lithium , as active electrode material , a counterelectrode , and an electrolyte between the electrode and the counterelectrode . an option concerns the electrochemical cells including a plurality of arrangements ( for example , a plurality of electrode / electrolyte / counterelectrode or counterelectrode / electrolyte / electrode / electrolyte / counterelectrode arrangements ). for example , the cell can be a multilayer material which can be folded or rolled the form of a cylinder . electrochemical cells in which the lithium films described here could also be used also comprise the lithium - air electrochemical cells such as those described in the pct application published under number wo2012 / 071668 ( zaghib et al .). according to an aspect , the polymer of formula i or the composition thereof can be present on the surface between the lithium film and the adjacent layer thereof ( for example , the current collector , the electrolyte , etc . ), or it can be in part or completely diffuse , dispersed or dissolved in the electrolyte . according to another aspect , the lubricating agent ( or the composition thereof ) is present between the electrode and the electrolyte and is ion conductive , for example , due to its dissolving the lithium salts present in the electrolyte . according to a preferred embodiment , the electrochemical cell including a lithium film as described here , is sealed or included in the interior of a sealed compartment . an electrode includes at least one alkali metal film as described in section ii or as prepared by the process of section iii . preferably , the alkali metal film of the electrode is an active lithium film or an alloy in which lithium is the majority component , preferably lithium having a purity of at least 99 % by weight , or a lithium alloy including less than 3000 ppm of impurities by weight . according to an embodiment , the electrode includes , in addition , a current collector made of a metal layer such as , for example , a nickel or copper layer adhering to the surface of the alkali metal film opposite the surface that faces or will face the electrolyte layer . optionally , an ion conductive protective layer can be present between the alkali metal film ( for example , li , na , or an alloy of either ) and the electrolyte , for example , in order to protect the lithium film against degradation and / or in order to prevent the formation of dendrites . an ion conductive protective layer , for example , an ion conductive polymer , a ceramic ( for example , a lithium and phosphorus oxynitride ( upon ), etc . ), glass , or a combination of two or more of said materials can be applied to the surface of the lithium film or of the electrolyte layer ( for example , of a solid polymer electrolyte ) before the assembly . the vitreous or ceramic protective layers are applied using standard processes such as cathodic atomization , ablation by laser or plasma . examples of protective layers are described in the pct application published under number wo2008 / 009107 ( zaghib et al .). the electrolytes used in these electrochemical cells include any electrolyte compatible with the use of electrodes made of active lithium film or of another alkali metal . examples of such electrolytes include , without limitations , nonaqueous liquid electrolytes , gel polymer electrolytes , and solid polymer electrolytes . the following electrolytes are given as illustrative examples and should not be interpreted to be limiting . for example , the compatible liquid electrolytes comprise the organic liquid electrolytes including an aprotic polar solvent such as ethylene carbonate ( ec ), diethyl carbonate ( dec ), propylene carbonate ( pc ), dimethyl carbonate ( dmc ), ethyl methyl carbonate ( emc ), γ - butyrolactone ( γ - bl ), vinyl carbonate ( vc ), and mixtures thereof , and lithium salts such as litfsi , lipf 6 , etc . other examples of compatible liquid electrolytes comprise the molten salt electrolytes including lithium salts such as lithium chloride , lithium bromide , lithium fluoride , and compositions including them , or organic salts . nonlimiting examples of liquid electrolytes of molten salts can be found in us2002 / 0110739 ( mcewen et al .). the liquid electrolyte can impregnate a separator such as a polymer separator ( for example , made of polypropylene , polyethylene or of a copolymer thereof . the compatible gel polymer electrolytes can include , for example , polymer precursors and lithium salts ( such as litfsi , lipf 6 , etc . ), an aprotic polar solvent as defined above , a polymerization / crosslinking initiator when they are needed . examples of such gel electrolytes comprise , without limitations , the gel electrolytes described in the pct applications published under numbers wo2009 / 111860 ( zaghib et al .) and wo2004 / 068610 ( zaghib et al .). a gel electrolyte can also impregnate a separator as defined above . the solid polymer electrolytes ( spe ) can generally include one or more polar solid polymers which can be crosslinked or not , and salts , for example , lithium salts such as litfsi , lipf 6 , lidcta , libeti , lifsi , libf 4 , libob , etc . polyether type polymers such as polymers based on polyethylene oxide ( peo ) can be used , but several other polymers compatible with lithium are also known for producing spe . examples of such polymers include the multi - branch polymers in the shape of a star or comb , such as those described in the pct application published under no . wo2003 / 063287 ( zaghib et al .). the counterelectrodes include at least one electrochemically active material ( eam ) compatible with the use of alkali metal electrodes and , in particular , metal lithium . any counterelectrode eam known from the field can be used in these electrochemical cells . for example , the counterelectrode eam can operate at a voltage within the range of about 1 v to about 5 v . examples of counterelectrode eam can be found , for example , in whittingham m . s . ( 2004 ), chem . rev ., 104 , 4271 - 4301 , which is incorporated here by reference in its entirety and for all purposes . for an electrode including a lithium film , nonlimiting examples of counterelectrode eam include the lithium titanates ( for example : li 4 ti 5 o 12 ), sulfur or materials including sulfur , the lithium and metal phosphates ( for example , lim ′ po 4 where m ′ is fe , ni , mn , co , or combinations thereof ), the vanadium oxides ( for example : liv 3 o 8 , v 2 o 5 , etc . ), and the lithium and metal oxides , such as limn 2 o 4 , lim ″ o 2 ( m ″ being mn , co , ni or combinations thereof ), li ( nm ′″) o 2 ( m ′″ being mn , co , al , fe , cr , ti , zr , etc ., or combinations thereof . similarly , the eam of the counterelectrode , when the electrode includes a sodium film , are known to the person skilled in the art . for example , they include sulfur or a material including sulfur , sodium phosphates , and one or more metals ( for example : na 2 fepo 4 f , na 2 fep 2 o 7 f , navpo 4 f , nav 1 - x cr x po 4 f , where x & lt ; 1 , for example , 0 & lt ; x & lt ; 0 . 1 ), or sodium and metal sulfates ( for example : na 2 fe 2 ( so 4 ) 3 ). the counterelectrode eam can also be oxygen in a lithium - air or sodium - air cell depending on the alkali metal of the electrode . the counterelectrode can also include an electronic conducting material such as a carbon source , including , for example , ketjen ® carbon , shawinigan carbon , graphite , vapor grown carbon fibers ( vgcf ), non - powder carbon obtained by the carbonization of an organic precursor , and a combination of two or more of said materials . the carbon used can be of natural or synthetic origin . the counterelectrode can be a composite counterelectrode that includes , in addition , a polymer binder , and , optionally , an alkali metal salt such as the lithium salts ( for example : litfsi , lidcta , libeti , lifsi , lipf 6 , libf 4 , libob , etc .) or the sodium salts ( for example : naclo 4 , napf 6 , etc .). the following examples illustrate the invention and should not be interpreted as limiting the scope of the invention as described . in order to evaluate the effect of the lubricant on the surface of a lithium film , and the resulting properties , lithium films having a thickness of 27 μm , produced according to the procedure described in the u . s . pat . no . 6 , 019 , 801 were immersed in the lubricants tested . the lubricated films were then inserted in electrochemical cells and their properties were measured . the components used in the examples below are defined as follows : peo ( 200 ) distearate : peo - 200 distearate as described in the u . s . pat . no . 6 , 019 , 801 . spe : “ solid polymer electrode ” based on a polyether polymer as described in the u . s . pat . no . 6 , 903 , 174 and u . s . pat . no . 6 , 855 , 788 including litfsi as lithium salt in a ratio of 30 / 1 ( oxygen v . li ). polymer 1 : is a polymer of formula i having a molecular weight of about 5000 , in which the unit b is absent , le is c 16 h 33 , r 2 is absent , and r 4 is covalently bound to n and represents the jeffamine ® m - 1000 residue , a polyetheramine having a ratio po / eo of 3 / 19 . polymer 2 : is a polymer of formula i having a molecular weight of about 5000 , in which the unit b is absent , le is c 16 h 33 , r 2 is absent , and r 4 is covalently bound to n and represents the jeffamine ® m - 2070 residue , a polyetheramine having a ratio po / eo of 10 / 31 . a lubricant was prepared by the addition of 1 % by weight of peo ( 200 ) distearate to a mixture of toluene and hexane ( 80 : 20 ( vol : vol ), both anhydrous ). a lithium film having a thickness of 27 μm is then immersed in this lubricant for 5 minutes . a 4 cm 2 cell was assembled in the laboratory according to the configuration li / spe / li the initial impedance of the li / spe / li cell at 80 ° c . was 15 ohms . after six weeks , the impedance reached 111 ohms , showing a 640 % increase of the impedance . a 4 cm 2 cell was assembled in the laboratory according to the configuration c — lifepo 4 / spe / li . the cell was then discharged at a c / 4 rate and charged at a c / 4 rate to a voltage of 2 . 5 v to 3 . 8 v at 80 ° c . the initial capacity of the cell was 158 mah / g . after 350 cycles , the capacity reached 80 % of the initial capacity . the lubricant was prepared by the addition of 1 % by weight of polymer 1 to a mixture of toluene and hexane ( 80 : 20 ( vol : vol ), both anhydrous ). a lithium film having a thickness of 27 μm was then immersed into this lubricant for about 5 minutes . a 4 cm 2 cell was assembled in the laboratory according to the configuration li / spe / li . the initial impedance of the cell of configuration li / spe / li at 80 ° c . was 22 ohms . after six weeks , the impedance reached 48 ohms , showing a 120 % increase of the impedance . a 4 cm 2 cell was assembled in the laboratory according to the configuration c — lifepo 4 / spe / li as in example 1 ( b ). the cell was then discharged at a c / 4 rate and charged at a c / 4 rate to a voltage of 2 . 5 v to 3 . 8 v at 80 ° c . the initial capacity of the cell was 160 mah / g . after 1100 cycles , the capacity reached 80 % of the initial capacity . the increase of the impedance is lower in this cell than in that of example 1 , where a lubricant based on peo ( 200 ) distearate was used . the use of a lubricant based on polymer 1 results in a stable and more uniform passivation layer on the surface of the lithium . the cell incorporating the lithium film including a thin layer of polymer 1 resulted in an improved life span in cycles compared to the cell described in example 1 . the lubricant was prepared by the addition of 1 % by weight of polymer 2 to a mixture of toluene and hexane ( 80 : 20 ( vol : vol ), both anhydrous ). a lithium film having a thickness of 27 μm was then immersed in this lubricant for about 5 minutes . a 4 cm 2 cell was assembled in the laboratory according to the configuration li / spe / li . the initial impedance of the cell having the configuration li / spe / li at 80 ° c . was 23 ohms . after six weeks , the impedance reached 45 ohms , showing a 96 % increase of the impedance . a 4 cm 2 cell was assembled in the laboratory according to the configuration c — lifepo 4 / spe / li as in example 1 ( b ). the cell was then discharged at a c / 4 rate and charged at a c / 4 rate to a voltage of 2 . 5 v to 3 . 8 vat 80 ° c . the initial capacity of the cell was 161 mah / g . after 1300 cycles , the capacity reached 80 % of the initial capacity ( a 20 % lowering ). the increase of the impedance is lower for this cell than for that of example 1 ( b ), where the lubricant based on peo ( 200 ) distearate was used . the use of the lubricant based on polymer 2 also results in a very stable and more uniform passivation layer on the lithium surface . this cell also resulted in an improved life span in cycles compared to the cell described in example 1 ( b ). 36 . 26 g of a commercial poly ( octadecene - alt - maleic anhydride ) polymer ( m w ≈ 65 . 000 ) are dissolved in 250 ml of toluene under stirring at room temperature . octadecylamine ( 18 g ) in 100 ml of toluene is added dropwise to the solution under stirring over a time period of 2 hours . then , 40 g of jeffamine ® of type m - 1000 ( xtj - 506 ) with a ratio po / eo of 3 : 19 diluted in 50 ml of toluene are added rapidly and still under stirring . the resulting ternary solution is then placed in a 500 ml round - bottom flask equipped with a dean - stark apparatus and a condenser . the solution is heated at reflux for 8 hours , a time period during which the water released during the formation of the imide gradually appears in the burette of the dean - stark apparatus . the resulting viscous polymer solution is then filtered and evaporated in a rotary evaporator . the sticky substance obtained is redissolved in 625 ml of heptane and washed 5 times with a volume of 100 ml of an aqueous solution of sulfuric acid ( h 2 so 4 ) at 0 . 1 m in order to eliminate the excess of jeffamine ®. the extraction of the jeffamine ® is then followed by a rinsing with 5 portions of demineralized water . the drying of the heptane solution is carried out by the addition of 40 g of 4 å molecular sieve which was treated beforehand under a vacuum at 200 ° c . the solution at 10 % ( weight / volume ) of polymer 3 in heptane thus obtained is ready for dilution and / or subsequent use in the rolling of an alkali metal such as lithium . 36 . 26 g of a commercial poly ( octadecene - alt - maleic anhydride ) polymer ( m w ≈ 65 . 000 ) and 11 g of trimethylamine are dissolved in 250 ml of toluene under stirring at room temperature . octadecylamine ( 21 . 5 g ) in 100 ml of toluene is added dropwise to the solution under stirring over a time period of 2 hours . then , 45 g of jeffamine ® of type m - 2070 with a ratio po / eo of 10 : 31 dissolved in 100 ml of toluene are added rapidly and still under stirring . the resulting quaternary solution is then placed in a 500 ml round - bottom flask equipped with a dean - stark apparatus and a condenser . the solution is heated at reflux for 8 hours , a time period during which water released during the formation of the imide gradually appears in the burette of the dean - stark apparatus . the resulting viscous polymer solution is then filtered and evaporated . the waxy substance obtained is redissolved in 900 ml of heptane and washed 5 times with a volume of 200 ml of an aqueous sulfuric acid solution ( h 2 so 4 ) at 0 . 1 m in order to eliminate the jeffamine ® and trimethylamine excess . the extraction is then followed by a rinsing with 5 portions of demineralized water . the drying of the heptane solution is carried out by adding 40 g of 4 å molecular sieve treated beforehand under a vacuum at 200 ° c . the solution at 10 % ( weight / volume ) of polymer 4 in heptane thus obtained is ready for dilution and / or subsequent use in the rolling of an alkali metal such as lithium . 10 g of commercial maleic anhydride ( aldrich ) are added to a solution of 105 g of jeffamine ® m - 1000 ( huntsman corporation ) in 300 ml of toluene . the reaction mixture is submitted to a dean - stark dehydration in order to carry out the imidization of the terminal nh 2 groups of the jeffamine for 5 hours . the clear solution obtained is cooled to a temperature of 0 ° c ., and 25 . 8 g of 1 - octadecene and 1 . 3 g of azobis ( isobutyronitrile ) are added . the mixture is deaerated by nitrogen bubbling ( 100 ml / min ) for one hour . the neutral gas sweeping is stopped , and the reaction mixture is heated to 80 ° c . for 24 hours . the solution which has a slightly brown coloration is washed three times with a 0 . 1 m sulfuric acid solution , then it is washed again three times with pure water . the supernatant solution is separated , and the toluene is evaporated . the result is a viscous liquid having a molecular weight of about 5000 g / mol ( polymer 1 ) which can be used in a rolling process . in a manner similar to synthesis example 3 , 10 g of commercial maleic anhydride ( aldrich ) are added to a solution of 210 g of jeffamine ® m - 2070 ( huntsman corporation ) in 500 ml of toluene . the reaction mixture is subjected to a dean - stark dehydration for 5 hours . the clear solution obtained is cooled to a temperature of 0 ° c ., and 25 . 8 g of 1 - octadecene and 1 . 6 g of azobis ( isobutyronitrile ) are added . the mixture is deaerated by nitrogen bubbling ( 100 ml / min ) for one hour . the neutral gas sweeping is stopped , and the reaction mixture is heated to 80 ° c . for 24 hours . the solution which has a slightly brown coloration is washed three times with a 0 . 1 m sulfuric acid solution , then again three times with pure water . the supernatant solution is separated , and the toluene is evaporated . the result is a viscous liquid having a molecular weight of about 5000 g / mol ( polymer 2 ) which can be used in a rolling process . numerous modifications could be made to any of the embodiments described above without going beyond the scope of the invention as conceived . the references , patents or documents of the scientific literature mentioned in the present application are incorporated here by reference in their entirety and for all purposes .	2
please refer to fig1 illustrating a terminal 14 communicating to a base station 12 in a communication system 10 , e . g ., a 3g wireless mobile communication system . the invention can be applied to the terminal 14 , which includes an inner receiver 16 , an outer receiver 18 , an sir estimation unit 20 , a mapping module 22 , a second estimation unit 24 and an adaptation module 26 . for downlink communication , data to be transmitted to the terminal 14 are arranged into data blocks ( transport blocks ) in the base station 12 , and the base station 12 transmits to the terminal 14 with data blocks carried in the high speed downlink shared channel ( hs - dsch ) and with control information carried in the high - speed shared control channel ( hs - scchs ), including tfrc . the terminal 14 decodes the data and control information by the inner receiver 16 and the outer receiver 18 . the inner receiver 16 behaves like an inverse function of the fading channel effect , or called the equalization , to get the estimation of transmitted symbols from the base station 12 . these symbols are further decoded and transformed into the information bits by the outer receiver 18 . the inner receiver 16 performs the functionalities of filtering , frequency and timing synchronization , removal of channel effects , etc . the outer receiver 18 executes the operation of physical channel and constellation de - mapping , de - interleaving , de - rate - matching , harq combining , channel decoding , bit descrambling , and crc ( cycle redundancy check ) de - attachment , etc . according to signals received by the inner receiver 16 , the sir estimation unit 20 provides sir to reflect a signal to interference quality of the communication channel . for cqi reporting , a common way is to determine the received quality by estimating sir . for example , in the 3gpp technical specification 25 . 214 , a cqi mapping table defines 30 cqis ( cqi1 to cqi30 ); their required sirs for supporting a bler of 0 . 1 are monotonically increasing by a step of 1 db sir differences in the static channel condition . among the cqi1 to cqi30 , cqi1 and cqi30 respectively represent the tfrc with the lowest and highest required channel quality for reliable reception with bler = 0 . 1 . hence , the mapping of reported cqi and sir is also a linear relation under a static channel . however , when the communication channel from the base station 12 to the terminal 14 acts like a fading channel instead of a static channel , the linear relation is no longer valid , and proper cqi reporting can not be accomplished . please refer to fig2 which illustrates sir to cqi mapping relation according to an embodiment of the invention . the sir to cqi mapping relation works with a plurality of thresholds th ( i − 2 ), th ( i − 1 ), th ( i ), th ( i + 1 ), th ( i + 2 ) etc , and a plurality of piecewise mapping functions such as g ( i − 1 ,.) and g ( i ,). every two adjacent thresholds form a bin , such as the bin b ( i ) has an upper threshold th ( i ) and a bottom threshold th ( i − 1 ), and the bin b ( i − 1 ) has thresholds th ( i − 2 ) and th ( i − 1 ) as its bottom and upper thresholds , respectively . each of the bin corresponds to a mapping function ; for example , the bin b ( i ) corresponds to the mapping function g ( i ,. ), and the bin ( i − 1 ) is in association with the mapping function g ( i − 1 ,.). while mapping a given sir of value x to a corresponding cqi , the sir value x is first matched to a bin . for example , if the sir value x is less than the threshold th ( i ) but greater than the threshold th ( i − 1 ), it is matched to the bin b ( i ); and therefore the mapping function g ( i ,.) which corresponds to the bin b ( i ) is used to map the sir value x to a mapped cqi value y by y = g ( i , x ). the cqi value y can be further quantized to one of the cqi1 to cqi30 if necessary . in an embodiment , each of the mapping function g ( i ,.) is a linear function defined over thresholds th ( i − 1 ) to th ( i ), e . g ., g ( i , x )= cqi ( i − 1 )+( x − th ( i − 1 ))( cqi ( i )− cqi ( i − 1 ))/( th ( i )− th ( i − 1 )) with cqi ( i − 1 ) and cqi ( i ) being two constants . as previously discussed , communication channel has its own characteristics dependent on many factors , such as propagation delay spread , doppler and / or multiple - path fading . there is a mutual correlation between sir , bler , throughput supported by the channel , channel characteristics , and communication parameter combination adopted to establish the channel . for example , with given ( fixed ) bler and channel characteristics , a communication parameter combination delivering higher throughput needs higher sir . with given bler and throughput , a fading channel demands better sir than a static channel . as the channel characteristics vary , a fixed sir to cqi mapping relation cannot reflect the mutual correlation . to address the issue , the invention provides an adaptation technique for updating the sir to cqi mapping according to channel characteristics . as shown in fig2 , the adaptation is achieved by adjustment of the thresholds . in an embodiment , each of the thresholds can be individually updated with distinct adjustment . with adjusted thresholds , bins and corresponding mapping functions work differently to meet nature of channel characteristics . for example , the sir value x originally matched to the bin b ( i ) now falls in the bin b ( i − 1 ) between the updated threshold th ( i − 2 ) and th ( i − 1 ), and it will be mapped to a new lowered cqi value by the mapping function g ( i − 1 ,.). the threshold th ( i ) for a fading channel can be greater than that for a static channel ; it reflects the correlation : with given sir , the fading channel suffers from lower throughput of lower cqi ; or equivalently , if the fading channel and the static channel adopt the same cqi ( and therefore the same throughput ), the fading channel demands better sir than the static channel . in two embodiments of the invention , two criterions are provided to update the thresholds . please refer to fig3 which illustrates a threshold decision according to one embodiment of the invention . for a given communication parameter combination and a given channel characteristics , bler increases as sir decreases . this correlative relation is illustrated by two curves cv ( i ) and cv ( i + 1 ) respectively corresponding to two different communication parameter combinations . the two communication parameter combinations are respectively categorized to combination schemes mcs ( i ) and ncs ( i + 1 ), each combination scheme generally refers to a collection of communication parameter combinations which have similar sir / bler / throughput performances . for example , the combination scheme mcs ( i ) associated with the curve cv ( i − 1 ) can correspond to a lower cqi , so the combination scheme mcs ( i ) delivers lower throughput but gains better ( lower ) bler with a given sir . the sir to bler curves of different mcss can be used to decide the thresholds of fig2 . by setting a target value target_bler for bler performance , intersection of the target_bler and each curve cv ( i ) can be used to define corresponding threshold th ( i − 1 ). that is , the threshold th ( i − 1 ) acts as a bottom threshold for combination scheme mcs ( i ) to reflect whether the combination scheme mcs ( i ) can properly work under a given sir ; if sir of the communication channel is lower than the threshold th ( i − 1 ), the combination scheme mcs ( i ) suffers bler higher than the target value target_bler , and therefore the cqi corresponding to the combination scheme mcs ( i ) is not preferred ; instead , the mapping function defined between thresholds th ( i − 1 ) and th ( i − 2 ) can be applied to decide a suitable ( lower ) cqi for the given sir . different channel characteristics lead to different curve cv ( i ) and different threshold th ( i − 1 ). to approach the ideal bottom threshold th ( i − 1 ) at intersection of the curve cv ( i ) and the target value target_bler , measured sir and measured bler are referred to track actual behavior of the curve cv ( i ). following discussion of fig3 , please refer to fig4 illustrating threshold updating according to an embodiment of the invention . when the terminal 14 is working with a given combination scheme mcs ( i_op ) ( an operating combination scheme ), a measured sir and a measured bler are used for adjustment of the corresponding bottom threshold th ( i_op − 1 ). to update a current threshold th ( i_op − 1 ) toward the ideal threshold th ( i_op − 1 ), a neighborhood around the current threshold th ( i_op − 1 ) is defined . if the measured sir falls in the neighborhood , the curve cv ( i_op ) corresponding to the ideal threshold th ( i_op − 1 ) can be well tracked ; and the pair of the measured sir and the measured bler will effectively indicate a point on the curve cv ( i_op − 1 ). if the measured bler is higher than the target value target_bler like the scenario shown in fig4 , it is implied that the current threshold th ( i_op − 1 ) is less than the ideal threshold th ( i_op − 1 ); so the current threshold th ( i_op − 1 ) is adjusted by increasing its value . on the contrary , if the measured bler is lower than the target value target_bler , the current threshold th ( i_op − 1 ) is too high and it is adjusted by lowering its value . following the discussion of fig4 , please refer to fig5 illustrating a flow 100 for adjust the thresholds according to an embodiment of the invention . the flow 100 includes the following steps . step 102 : while a measured sir is obtained , the flow 100 can start . first , quantize ( categorize ) the currently adopted communication parameter combination , e . g ., tfrc , by finding which combination scheme the currently adopted communication parameter combination belongs to . the found combination scheme is identified as the operating combination scheme mcs ( i_op ). corresponding to the operating combination scheme mcs ( i_op ), adjustment for the current bottom threshold th ( i_op − 1 ) ( as an operating bottom threshold ) is considered . step 104 : if the measured sir is in the neighborhood of the current threshold th ( i_op − 1 ), go to step 106 ; otherwise go to step 114 . step 106 : update measured bler for the operating combination scheme mcs ( i_op ). in an embodiment , when the terminal 14 works under a given combination scheme mcs ( i ), the estimation unit 24 of fig1 can measure a short - term bler by crc information for the combination scheme mcs ( i ), and then collect and accumulate a long - term measured bler ( i ) for the combination scheme mcs ( i ) according to short - term measured bler of the combination scheme mcs ( i ). as the terminal 14 works with different combination schemes mcs ( i 1 ), mcs ( i 2 ), . . . etc over time , it collects corresponding long - term measured bler ( i 1 ), bler ( i 2 ), . . . etc . when the terminal 14 again works with the combination scheme mcs ( i 1 ) and obtains a new short - term measured bler , the long - term measured bler ( i 1 ) of the combination scheme mcs ( i 1 ) is updated . in another embodiment , the measured bler used in step 106 is a short - term measurement . step 108 : if the measured bler is lower than the target value target_bler , go to step 110 ; otherwise go to step 112 . step 110 : update the current threshold th ( i_op − 1 ) by lowering its value . for example , the current threshold th ( i_op − 1 ) can be lowered by a predetermined decrement . then the flow 100 can proceed to step 114 . step 112 : update the current threshold th ( i_op − 1 ) by increasing its value . for example , the current threshold th ( i_op − 1 ) can be increased by a predetermined increment . then the flow 100 can proceed to step 114 . the increment can be equal to or different from the decrement of step 110 . the increment and / or the decrement can be constant , or can be dynamically set . the flow 100 can be regularly or periodically executed based on either short or long intervals , and / or it can be executed whenever necessary . for the first execution , the flow 100 can start with the thresholds set to predetermined initial values ( e . g ., thresholds designed for channel of predetermined characteristics , such as thresholds for a static channel ) as initial guess . as the terminal 14 communicates with different combination schemes at different times , different thresholds respectively corresponding to the adopted combination schemes can be respectively adjusted toward their ideal values which adapt actual channel characteristics . because the flow 100 works with a target value of bler , it implements a target bler criterion for threshold adjustment . please refer to fig6 illustrating another threshold decision criterion . for a given communication parameter combination and a given channel characteristics , throughput increases as sir increases . this correlative relation is illustrated by curves tp ( i − 1 ), tp ( i ) and tp ( i + 1 ) respectively corresponding to combinations schemes mcs ( i − 1 ), mcs ( i ) and mcs ( i + 1 ). the curves tp ( i − 1 ), tp ( i ) and tp ( i + 1 ) respectively have maximum throughputs tpmax ( i − 1 ), tpmax ( i ) and tpmax ( i + 1 ), as well as a minimum throughput tpmin . the maximum throughput tpmax ( i ) is achieved when bler is 0 , i . e ., a perfect transmission without any error ; on the other hand , the minimum throughput tpmin corresponds to bler of 0 , i . e ., transmitted data are all incorrect . the combination scheme msc ( i + 1 ) corresponds to a higher cqi , so it has a higher maximum throughput tpmax ( i + 1 ). however , the higher maximum throughput tpmax ( i + 1 ) demands higher sir . therefore , intersections of the curves tp ( i − 1 ), tp ( i ) and tp ( i + 1 ) can be utilized to indicate ideal thresholds : intersection of the curves tp ( i ) and tp ( i + 1 ) defines an ideal value for the threshold th ( i ), and the intersection of the curves tp ( i − 1 ) and tp ( i ) defines an ideal value for the threshold th ( i − 1 ). with sir lower than the threshold th ( i ), throughput by communication adopting the combination scheme mcs ( i + 1 ) becomes lower than that of the combination scheme mcs ( i ), so the cqi corresponding to the combination scheme mcs ( i + 1 ) is not preferred ; instead , the mapping function defined between the thresholds th ( i − 1 ) and th ( i ) is used for proper sir to cqi mapping . for a inside understanding , notice that a long - term overall throughput of correct data , t ( th ( 0 ), th ( 1 ), . . . , th ( i ), . . . , th ( n − 1 )), can be expressed as : t ⁡ ( th ⁡ ( 0 ) , th ⁡ ( 1 ) , … ⁢ , th ⁡ ( n - 1 ) ) = ∑ i = 0 n ⁢ r ⁡ ( i ) · ∫ th ⁡ ( i - 1 ) th ⁡ ( i ) ⁢ [ 1 - e ⁡ ( i , z ) ] · f ⁡ ( z ) ⁢ ⅆ z . where −∞= th (− 1 )= th ( 0 )=−∞≦ th ( 1 )≦ th ( 2 )≦ . . . ≦ th ( n − 1 )≦ th ( n )=∞, r ( i ) is a nominal throughput ( e . g ., throughput regardless whether data are correct or not ) corresponding to the combination scheme mcs ( i ), and e ( i , z ) is an error rate ( e . g ., bler ) corresponding to the combination scheme mcs ( i ) under sir of value z . along with r ( i ) and ( 1 − e ( i , z )), throughput of correct data while communicating by the combination scheme mcs ( i ) is obtained by integration over sir valued from the thresholds th ( i − 1 ) to th ( i ). to optimize the overall throughput t ( th ( 0 ), th ( n − 1 )), the optimization condition r ( i )[ 1 − e ( i , th ( i ))]= r ( i + 1 )[ 1 − e ( i + 1 , th ( i ))] has to be satisfied for i = 1 to ( n − 1 ). that is , throughput of correct data during the combination scheme mcs ( i ) under sir of value th ( i ) must equal that during the combination scheme mcs ( i + 1 ) under sir of value th ( i ) to fulfill the optimization condition . since threshold decision of fig6 sets ideal value of the threshold th ( i ) to the sir value corresponding to the intersection of the curves tp ( i ) and tp ( i + 1 ), the optimization condition can be satisfied . different channel characteristics lead to different curve tp ( i ) and different threshold th ( i − 1 ). to approach the ideal threshold th ( i − 1 ) at intersection of the curves tp ( i − 1 ) and tp ( i ) as well as the ideal threshold th ( i ) at intersection of the curves tp ( i ) and tp ( i + 1 ), measured sir , measured bler and measured throughput of the combination schemes mcs ( i − 1 ), mcs ( i ) and mcs ( i + 1 ) are referred to follow actual behavior of the curves tp ( i − 1 ), tp ( i ) and tp ( i + 1 ). to implement the adjustment , the estimation unit 24 ( fig1 ) collects measured bler ( i ) and measured throughput u ( i ) ( of long - term or short - term ) for different scheme combination msc ( i ). following discussion of fig6 , please refer to fig7 and fig8 respectively illustrating threshold updating according to embodiments of the invention . as shown in fig7 , when the terminal 14 communicates with a given operating combination scheme mcs ( i_op ) and a measured sir is obtained , if the measured sir fall into a neighborhood around the current threshold th ( i_op − 1 ), measured throughput u ( i_op ) of the operating combination scheme mcs ( i_op ) can be updated , and adjustment of the threshold th ( i_op − 1 ) can be considered ; if the measured bler ( i_op ) is neither close to 0 nor close to 1 , the current threshold th ( i_op − 1 ) can be updated by increasing its value if the measured throughput u ( i_op ) of the operating combination scheme mcs ( i_op ) is lower than the measured throughput u ( i_op − 1 ) corresponding to the combination scheme mcs ( i_op − 1 ), like the scenario shown in fig7 . on the contrary , if the measured throughput u ( i_op ) is higher than the measured throughput u ( i_op − 1 ), the current threshold th ( i_op − 1 ) is higher than the ideal threshold th ( i_op − 1 ), so the current threshold th ( i_op − 1 ) is adjusted by lowering its value . on the other hand , if the measured bler ( i_op ) is close to 1 , i . e ., falls in a predetermined proximity of the upper bound of bler , the current threshold th ( i_op − 1 ) is too small ; the current threshold th ( i_op − 1 ) intersects the curve tp ( i_op ) or tp ( i_op − 1 ) at minimum throughput tpmin . then the current value of the threshold th ( i_op − 1 ) can be adjusted by increasing . if the measured bler ( i_op ) is close to 0 , a lower bound of bler , the adjustment can proceed following the target bler criterion . notice when bler ( i_op ) is 0 , the optimization condition becomes r ( i_op − 1 )= r ( i_op )[ 1 − e ( i_op , th ( i_op − 1 ))]; or equivalently , e ( i_op , th ( i_op − 1 ))= 1 − r ( i_op − 1 )/ r ( i_op ). that is , the optimization condition suggests a target bler of value ( 1 − r ( i_op − 1 )/ r ( i_op )) for adjusting the threshold th ( i_op − 1 ) with the target bler criterion . since the threshold th ( i_op ) can be considered as an upper threshold of the operating combination scheme mcs ( i_op ), adjustment for the threshold th ( i_op ) can be considered if the measured sir fall into a neighborhood around the current threshold th ( i_op ), as shown in fig8 . if the measured bler ( i_op ) is neither close to 0 nor close to 1 , the current threshold th ( i_op ) can be updated by lowering its value if the measured throughput u ( i_op ) of the operating combination scheme mcs ( i_op ) is lower than the measured throughput u ( i_op + 1 ) corresponding to the combination scheme mcs ( i_op + 1 ), like the scenario shown in fig8 . on the contrary , if the measured throughput u ( i_op ) is higher than the measured throughput u ( i_op + 1 ), the current threshold th ( i_op − 1 ) is lower than the ideal threshold th ( i_op − 1 ), so the current threshold th ( i_op − 1 ) is adjusted by increasing its value . following the discussion of fig7 and fig8 , please refer to fig9 illustrating a flow 200 for adjust the thresholds according to an embodiment of the invention . the flow 200 includes the following steps . step 202 : while a measured sir is obtained , the flow 200 starts . first , quantize ( categorize ) the currently adopted communication parameter combination , e . g ., tfrc , by finding which combination scheme the currently adopted communication parameter combination belongs to . the found combination scheme is identified as the operating combination scheme mcs ( i_op ). corresponding to the operating combination scheme mcs ( i_op ), adjustment for the current bottom threshold th ( i_op − 1 ) ( as an operating bottom threshold ) and the top threshold th ( i_op ) can be considered in the following steps . step 204 : if the measured sir is in the neighborhood of the current threshold th ( i_op − 1 ), go to step 206 ; otherwise go to step 218 . step 206 : update the measured throughput u ( i_op ) for the operating combination scheme mcs ( i_op ). in an embodiment , when the terminal 14 works under a given combination scheme mcs ( i ), the estimation unit 24 of fig1 can measure a short - term throughput for the combination scheme mcs ( i ), and then collect and accumulate a long - term throughput u ( i ) for the combination scheme mcs ( i ) according to the short - term measured throughput of the combination scheme mcs ( i ). as the terminal 14 works with different combination schemes mcs ( i 1 ), mcs ( i 2 ), . . . etc , it collects corresponding long - term throughput u ( i 1 ), u ( i 2 ), . . . etc . when the terminal 14 again works the combination scheme mcs ( i 1 ) and obtains a new short term measured throughput , the long term measured throughput u ( i 1 ) of the combination scheme mcs ( i 1 ) is updated . in another embodiment , the measured throughput used in step 206 is a short - term measurement . step 208 : if the measured bler ( i_op − 1 ) is close to 0 or 1 , go to step 216 , otherwise proceed to step 210 . step 210 : if the measured throughput u ( i_op ) is higher than the measured throughput u ( i_op − 1 ), proceed to step 212 , otherwise proceed to step 214 . step 212 : lower the threshold th ( i_op − 1 ) for adjustment and then proceed to step 234 . for example , the threshold th ( i_op − 1 ) can be decreased by subtracting a decrement from its current value . step 214 : increase the threshold th ( i_op − 1 ) and the proceed to step 234 . for example , the threshold th ( i_op − 1 ) can be increased by adding a increment to its current value . step 216 : execute an exception processing . the detail will be discussed in fig1 . step 218 : if the measured sir is in the neighborhood of the threshold th ( i_op ), go to step 220 ; otherwise go to step 234 . notice that the range covered by the neighborhood of the threshold th ( i_op ) does not have to overlap that of the threshold th ( i_op − 1 ). step 220 : update the measured throughput u ( i_op ) for the operating combination scheme mcs ( i_op ). step 222 : if the measured bler ( i_op ) is close to 0 , proceed to step 234 , otherwise proceed to step 224 . step 224 : if the measured bler ( i_op ) is close to 1 , proceed to step 232 , otherwise proceed to step 226 . step 226 : if the measured throughput u ( i_op ) is higher than the measured throughput u ( i_op + 1 ), proceed to step 228 , otherwise proceed to step 230 . step 228 : increase the threshold th ( i_op ), then proceed to step 234 . step 230 : decrease the threshold th ( i_op ), then proceed to step 234 . step 232 : execute an exception procedure which will be discussed with fig1 . please refer to fig1 illustrating the exception processing of the step 216 , which includes the following steps . step 300 : if the measured bler ( i_op − 1 ) is close to 0 , proceed to step 302 , otherwise go to step 304 . step 302 : follow the target bler criterion of fig5 for adjustment of the threshold th ( i_op − 1 ), i . e ., update the operating bottom threshold th ( i_op − 1 ) according to a comparison between a target value ( target bler ) and the measured bler ( i_op ). as discussed above , the target bler can be set to ( 1 − r ( i_op − 1 )/ r ( i_op )). step 304 : if the measured bler ( i_op − 1 ) is close to 0 , go to step 306 ; otherwise proceed to step 234 . step 306 : adjust the threshold th ( i_op − 1 ) by increasing its value . the value of the threshold th ( i_op − 1 ) can be boosted by an increment larger than that used in step 214 and / or step 228 of fig9 . the exception procedure of step 232 ( fig9 ) is similar to step 306 of fig1 ; the threshold th ( i_op ) can be boosted if the measured bler ( i_op ) is close to 1 . the flow 200 can be regularly or periodically executed based on either short or long intervals ; and / or it can be executed whenever necessary . as the terminal 14 communicates with different combination schemes at different times , different thresholds respectively corresponding to the adopted combination schemes can be respectively adjusted toward their ideal values . because the flow 200 works based on maximizing throughput , it implements an optimum ( maximum ) throughput criterion for threshold adjustment . for implementation of the threshold setting according to fig3 and / or fig6 , the adaptation module 26 of fig1 executes the flow 100 of fig5 and / or the flow 200 of fig9 . the adaptation module 26 can be implemented by hardware , firmware and / or software . for example , the terminal 14 can include a memory ( volatile or nonvolatile ) which records codes , and a processor which executes the codes to implement the flow 100 and / or 200 . to sum up , for adaptation of channel characteristics , the invention provides cqi reporting which dynamically updates sir to cqi mapping relation by adjusting thresholds of the piecewise mapping functions . comparing arts with constant thresholds which are vulnerable to variation of channel characteristics , the thresholds decision of the invention not only tracks actual channel characteristics , but also achieves target bler and / or optimum throughput . though some technique terms used in discussion are similar to those used in 3gpp standards / specifications , the invention can be generalize to communication systems which need channel quality reporting for setting of communication parameters . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention needs not be limited to the disclosed embodiment . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures .	7
referring initially to fig1 and 2 , passive current deflector 12 for raising water and embedded nutrients from a lower region of a large body of water , including an ocean , having a current , is shown . deflector 12 is submerged in a suitable location in ocean 14 positioned between the ocean surface 16 and the ocean seabed 18 . deflector 12 includes a longitudinal body 20 having lower end 22 with a lower opening 24 at one end and an upper end 26 and upper opening 28 at its upper end . body 20 forms a conduit 30 through which ocean water may pass . body 20 is also tapered with a larger cross - sectional area adjacent end 22 tapering to a smaller cross - sectional area as one moves toward upper end 26 . thereby , conduit 30 is larger at lower end 22 as compared to upper end 26 . preferably body 20 is made from an impervious synthetic woven fabric of at least 420 denier . also further preferably lower end 22 is elliptical in shape with a horizontal diameter of about 50 metres and a vertical diameter of about 70 metres . it is also preferred that the upper opening 26 be circular with a diameter of about 30 metres . alternatively , the cross - sectional area of lower opening 22 is preferably between 1 . 5 to 2 times as large as the cross - sectional area of upper opening 26 . as seen best in fig2 , openings 22 and 26 define respective planes at about a 45 degree angle in relation to the sides of body 20 . anchor 36 is secured to the ocean seabed 18 in a manner which prevents movement of anchor 36 in relation to seabed 18 . anchor line 38 connects anchor 36 to body 20 , described in more detail below . anchor 36 may consist of two 1000 kg spade type anchors separated by a ten metre length of 1¼ inch open link iron chain . another ten metre length of chain will attach the down stream anchor to the anchor line . the connections between anchors and chain is by 1½ inch rated shackles . the anchor line 38 is made of synthetic fibre rope . it will be attached to the anchor chain by soft splice . some options are super dan - line , polysteel , and sea steel . they will be three strand and have a diameter of between 2 and 2½ inches . anchor line 38 is continuous to an attachment point adjacent upper end 26 where it is attached to a one inch stainless steel wire cable of 10 metres in length , identified as the buoy line 42 , that attaches to the compensator buoy 40 . compensator buoy 40 floats on ocean surface 16 . buoy 40 is connected to body 20 by means of buoy line 42 . buoy 40 includes a solar powered lamp combination 44 to warn shipping of the location of a deflector 2 when submerged in ocean 14 . gps transponder 46 is also positioned on buoy 40 to ensure that the location of deflector 12 in ocean 14 can be determined at all times by satellite . buoy 40 is made of ¼ inch mild steel plate , sandblasted and painted . it has a displacement sufficient to maintain upper opening 28 close to surface 16 . preferably , deflector 12 is positioned in ocean 14 at an ocean location wherein lower ocean current 32 is less than upper ocean current 34 . for example , deflector 12 may be placed where lower ocean current 32 is about two knots and upper ocean current 34 is about four knots . as best seen in fig2 , because anchor 36 is fixed in place on seabed 18 and buoy 40 is free to move with ocean current 34 , deflector 12 is forced into an angled position , angled from the vertical by about 45 degrees , in the embodiment depicted in fig1 and 2 . when angled in that manner , lower end 22 and lower opening 24 define a plane which is generally vertical in orientation . similarly , when deflector 12 is so oriented in ocean 14 , upper end 26 and upper opening 28 form a plane which is also generally vertical in orientation . body 20 includes several rib lines 48 generally at every 30 degrees of arc about body 20 . rib lines 48 extend from lower end 22 to upper end 26 and are continually attached to the conduit 30 . as seen best in fig3 and 5 , a plurality of minute lines 50 are positioned about opening 24 along lower end 22 in groups of nine converging to apex 52 . apex 52 is attached to convergence line 54 which converge at anchor apex 56 . each minute line 50 is positioned about opening 24 at approximately every three degrees of arc . between each rib line 48 , at every approximately three degrees of arc , a minute line 50 is attached to the frame line . they converge to a single point about half way from the body 20 to the point of intersection on anchor line 38 where the rib lines 48 are connected . a single line connecting nine minute lines 50 ( each at approximately three degrees of arc ) runs from the connection to the point of intersection of the rib lines 48 , referred to as the convergence line 54 . these lines are connected to the anchor line 38 along with the rib lines 48 at apex 56 . minute lines 50 are of ¼ inch diameter , synthetic fibre rope . anchor line 38 is attached along the entire length of conduit 30 . it forms a continuous line from anchor 36 at its lower end to the lower end of buoy line 42 at its upper end , thereby supporting the body 20 . deep trawl floats 60 are attached to the anchor line 38 about every 10 metres to maintain body 20 in an upright position , with anchor line 38 at the top of body 20 . body 20 further includes lead line 62 positioned opposite to anchor line 38 . lead line 62 is weighted sufficiently to almost neutralize the buoyancy force of floats 60 thereby stabilizing body 20 when submerged and maintaining lead line 62 separate from anchor line 38 thereby maintaining conduit 30 within body 20 in the upright position . lower end 22 also includes circumferential frame 64 of generally more rigid material as compared to body 20 . frame 64 may be formed by folding back material from body 20 thereby doubling that material to form a more rigid frame 64 . minute lines 50 are all attached to frame 64 about the circumference of opening 24 . referring to fig4 a and 4b , upper end 26 is depicted with opening 28 . anchor line 38 is shown connected at 10 metre intervals continuously along body 20 . lead line 62 is positioned on the opposite side of body 20 from anchor line 38 . opening 28 is surrounded by upper circumferential frame 66 to which lines 38 , 48 and 62 are attached . frame 66 generally maintains opening 28 in a circular or elliptical orientation assisted by the buoyancy of floats 60 acting on anchor line 38 and the weight of lead line 62 acting against that buoyancy . this is further assisted by the pressure differential between the inside of conduit 30 and the outer ocean 14 . referring initially to fig3 and 5 , a plurality of paravanes 68 are positioned about the circumference of frame 64 . fig6 , 7 and 8 depict close - up views of one paravane 68 . paravane 68 are pivotally attached to frame 64 . paravane 68 are generally straight and follow the contour of frame 64 at the inner end . outer periphery of paravane 68 is generally curved with an apex 70 . paravane line 72 is connected to paravane 68 adjacent apex 70 at one end and to a rib line 48 at the other end . paravane line 72 generally maintains paravane 68 in an angled orientation extending outwardly from frame 64 and also angled generally toward anchor 36 in relation to the plane defined by frame 64 . ocean current flow 32 pushes against paravane 68 which maintains paravane 68 in that angled position held in place by paravane lines 72 . thereby ocean currents flowing in the direction of arrow 74 provide a current force against each paravane 68 of the plurality about frame 64 thereby maintaining opening 24 in a generally elliptical orientation as depicted in fig5 . as depicted in fig8 , preventor web 76 is attached to minute lines 50 , rib lines 48 and circumferential frame 64 . preventor web 76 consists of interlocking and crossed lines forming a plurality of openings , similar in orientation as with a fishing web . preventor web 76 prevents fouling of paravanes 68 with lines 48 and 50 . when in use deflector 12 is placed in ocean 14 in the manner depicted in fig1 and 2 . anchored to the seabed 18 by anchor 36 at a lower end , which is positioned below the euphotic zone , and attached to a free - floating buoy at the other . ocean currents 34 near the upper end 26 push buoy in a downstream direction to orient deflector 12 at an angle that is preferably about 45 degree . ocean water driven by lower ocean currents 32 are forced into opening 24 to travel upwardly through conduit 30 and out upper opening 26 into the upper ocean water which is in the euphotic zone . cooler water rich in nutrients is thereby brought into the euphotic zone where sunlight is available to permit photosynthesis by sea life which feeds on those nutrients . while this invention has been described as a having a preferred embodiment , it is understood that it is capable of further modifications , uses and / or adaptations of the invention following in general the principle of the invention and including such departures from the present disclosure has come within the known or customary practice in the art to which the invention pertains and as may be applied to the central features herein before set forth , and fall within the scope of the invention and of the limits of the appended claims . as will be apparent to those skilled in the art to which the invention is addressed , the present invention may be embodied in forms other than those specifically disclosed above , without departing from the spirit or essential characteristics of the invention . the particular embodiments of the invention described above and the particular details of the processes described are therefore to be considered in all respects as illustrative or exemplary only and not restrictive . the scope of the present invention is as set forth in the complete disclosure rather than being limited to the examples set forth in the foregoing description .	4
for performing ultrafiltration or nanofiltration various types of membranes made of various materials are known that can be used for carrying out the present invention . for example molecular filters made of polysulfones , especially polyethersulfones ( pes ), perfluorinated polymers and ceramics made advantageously be applied . for the selection of the type to be used for carrying out the present invention it has proven that it depends only on a sufficient stability of the membrane material towards the liquid to be treated , for example the activating solution which may contain up to 15 wt .-% hydrochloric acid . surprisingly it has further been found out that the porosity of the molecular filter is not critical at all for the performance of separation of the palladium particles from the liquid if a molecular filter is chosen with an exclusion pore size of from 200 dalton to 10 . 000 dalton , since in this case the palladium particles completely remain in the concentrate liquid . in order to separate the palladium colloid particles molecular filters are used that preferably have an exclusion pore size of from 200 dalton to 10 . 000 dalton . if a molecular filter with an exclusion pore size of less than 200 dalton is used , palladium is still able to pass through the filter membrane , but in this case a considerable amount of tin compounds is held back by the membrane . therefore under these conditions separation efficiency of palladium particles versus tin compounds is very low . if molecular filters are used that have an exclusion pore size of considerably more than 10 . 000 dalton , the palladium particles pass through the membrane . therefore in this case the palladium particles can no longer be separated from the residual liquid and its components , namely the tin compounds . the range of from 200 dalton to 10 . 000 dalton therefore is an optimum with respect to the selectivity of separation of palladium particles from the other components of the solution to be treated , namely the tin compounds . an exclusion pore size of at least 500 dalton is especially preferred . most advantageous has proven an exclusion pore size of at least 2 . 000 dalton . these further lower limits of the range represent preferred embodiments of the present invention , presenting an even better selectivity of separation between palladium particles and tin compounds under the circumstances mentioned . the molecular filters are preferably made of a material , selected from the group comprising polysulfones , especially polyethersulfones ( pes ), perfluorinated polymers , for example polytetrafluorethylene ( for example teflon ®, trade name of dupont de nemours ), and ceramics . these materials are sufficiently chemically resistant towards the strongly acidic solutions containing hydrochloric acid . observations and investigations made in favor of the present invention have led to the conclusion that it is possible to recover palladium particles from liquids , especially from rinsing liquid s , by means of molecular filters . for this purpose the following method steps are carried out : a . the work pieces are brought into contact with the colloid solution for activating the work pieces . b . after the activating treatment has been carried out the colloid solution adhering to the surfaces of the work pieces is removed from the surfaces with a rinsing liquid . c . the rinsing liquid is pressurized und thus led through the molecular filter , the liquid being led through the molecular filter being a permeate liquid and the liquid not being led through the molecular filter being a concentrate liquid . d . preferably a palladium colloid solution is produced by using the concentrate liquid and adding suitable replenishment agents to the concentrate liquid in appropriate amounts . after activating treatment has been carried out the work pieces , preferably made from nonconducting material , are rinsed with a rinsing liquid in an appropriate device . rinsing is preferably performed by spraying in order to minimize the volume of rinsing liquid . prior to separating the colloid particles from the liquid by means of the molecular filter hydrochloric acid can be added to the solution even during spraying the rinsing liquid to the work pieces . if a sufficient amount of hydrochloric acid is added to the liquid , the tin compounds contained in the liquid do not hydrolyze so that cloudiness does not occur and precipitates are not formed due to these compounds . subsequently the rinsing liquid is pressed through the selective molecular filter membrane by means of a pressurized pump , the membrane holding back the palladium particles und letting pass the rinsing liquid , especially rinsing water , and all other components contained in the rinsing liquid . the permeate liquid can then be led to waste water treatment . the palladium being held back and present as a homogeneous metal dispersion concentrate can be used to produce an activating solution . according to the composition of the concentrate tin ( ii ) or tin ( iv ) salts and hydrochloric acid in higher or lower amounts are to be added to the concentrate liquid . in another alternative the palladium held back may be dissolved und be used as a solution , for example a palladium chloride solution , in order to produce an activating solution or alternatively to use this solution for any other purpose . for clarification of the method according to the present invention reference is made to fig1 which shows a schematic drawing of an apparatus , that may be used for carrying out the ultrafiltration or nanofiltration of a palladium colloid solution . after treatment in the palladium colloid solution has been cariied out the work pieces ( not shown ) are transferred to a spraying container 1 in which the work pieces are held vertically and are rinsed by spraying rinsing water to the pieces . spraying is carrier out by using spray nozzles 2 which are located are the lateral side walls of the rinsing spraying container 1 . the water being sprayed to the surfaces of the work pieces wet the surfaces of the work pieces so that the colloid solution is rinsed off the surfaces . for this purpose used rinsing liquid z from a further rinsing station is used , in which the work pieces being rinsed in this spraying container 1 will be rinsed again with rinsing liquid . the spent rinsing liquid is led to the spray nozzles 2 via a pipeline 4 by means of a pump 3 . the liquid will only be sprayed into the spraying container 1 if work pieces are present in this container 1 . regulation of the rinsing liquid is performed by means of a valve 5 which only allows the liquid to pass to the container 1 is work pieces are to be treated . the rinsing liquid running down at the surfaces of the work pieces and containing colloid solution due to the rinsing treatment accumulate at the bottom of the rinsing container 1 . this liquid is removed from the rinsing container 1 via a pipeline 6 . concentrated hydrochloric acid contained in the container 7 is admixed via a further pipeline 8 to the rinsing liquid coming out from the container 1 , thereby lowering the ph of the rinsing liquid . due to this lowering cloudiness does not occur and precipitates do not form in the rinsing liquid though tin compounds are present in the liquid . the rinsing liquid made acidic with hydrochloric acid is afterwards led to the molecular filter unit 10 via a pump 9 . a filter membrane is arranged inside the molecular filter 10 . the liquid present in the region in front of the filter membrane in the molecular filter is pumped in a circuit ( not shown ). therefore the colloid particles are permanently in motion in the region in front of the filter membrane , so that the pores of the membrane may not be clogged ( cross - flow ). the part of the liquid that has passed through the filter membrane represents the permeate liquid p . the part of the liquid that has not passed through the filter membrane represents the concentrate liquid k . this part k is intermittently or continuously removed from the filtration unit 10 . in the following examples are given to more clearly describe the present invention : by means of cross - flow technique a solution containing 200 mg / l colloidal palladium , 330 ml / l hydrochloric acid ( 37 wt .-%) and 34 g / l tin ( as a mixture of tin ( ii )- chloride and tin ( iv )- chloride ) was pressed through a filter membrane made from polyvinylidenfluorides ( pvdf ) with an exclusion pore size of 6 . 000 dalton at a pressure of 10 bar ( δ10 6 pa ). the permeate liquid that had passed through the filter membrane was colorless and clear without any cloudiness . the concentrate liquid remained black due to the colloidal palladium particles . it was found out that the flux through the filter membrane diminished after a few minutes because the colloid had entered the membrane . the experiment of example 1 was repeated by using a membrane made of polysulfone ( pes ). this membrane had an exclusion pore size of 1000 dalton . the flux through this membrane was less than that experienced from example 1 though the same pressure was applied ( 10 bar δ10 6 pa ). however a decrease of flux during the experiment , which lasted 1 hour , could not be detected . since a larger pore size would allow a higher flux , the experiment was repeated with a membrane with an exclusion pore size of 55 . 000 dalton . in this case the filtrate ( permeate ) liquid was also black . this pointed at the fact that colloidal metal could pass the membrane . example 1 was repeated with three further membranes which were made from pvdf . the exclusion pore size of these three membranes were 250 dalton , 400 dalton and 6 . 000 dalton , respectively . after execution of the separation of the palladium particles from the liquid the concentrations of palladium , tin ( ii ), tin ( iv ) and hydrochloric acid were determined and the total tin content was calculated from the tin ( ii ) and tin ( iv ) concentrations . the results are given in table 1 . moreover in this table the ratios of the tin concentration in the concentrate liquid to the tin concentration in the permeate liquid as well as the respective ratio for the hydrochloric acid concentations are given . the data presented in table 1 indicate that the total amount of palladium remains in the concentrate liquid irrespective of the exclusion pore size of the membranes , whereas no palladium could be detected in the permeate liquid . furthermore the ratios for the tin concentrations and for the hydrochloric acid concentrations drop as the exclusion pore size increases . this points at the fact that these substances arrive easier into the permeate liquid and remain to a smaller extent in the concentrate liquid as the exclusion pore size increases . by using a membrane with an exclusion pore size of 6 . 000 dalton the concentrate liquid therefore contained the lowest amount of tin and hydrochloric acid .	2
many of the functional units described in this specification have been labeled as modules , in order to more particularly emphasize their implementation independence . furthermore , the described features , structures , or characteristics of the invention may be combined in any suitable manner in one or more embodiments . in the following description , numerous specific details are provided to facilitate a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that the invention may be practiced without one or more of the specific details , or with other methods , components , materials , and so forth . in other instances , well - known structures , materials , or operations are not shown or described in detail to avoid obscuring aspects of the invention . fig1 is a cross - section diagram of one embodiment of an assembled modular backpressure sensor 100 . as depicted , the modular backpressure sensor 100 comprises a modular housing 102 , a backpressure piston 104 , a piston spring 106 , a piston spring retainer 108 , a housing head 110 , a fluid pressure chamber 112 , a piston rod 114 , a longitudinal bore 116 , a forward radial bore 118 , a fluid pressure chamber radial bore 120 , a backpressure piston extension 122 , a lateral groove 124 , a housing head aperture 126 , and a bushing 128 . the modular housing 102 contains the backpressure piston 104 and the piston spring 106 . the backpressure piston 104 forms a fluid impermeable seal with the walls of the modular housing 102 . the piston spring retainer 108 confines the piston spring 106 within the modular housing 102 . the housing head 110 seals the forward end of the modular housing 102 and cooperates with a wall of the modular housing 102 and the piston 104 to define the fluid pressure chamber 112 between the backpressure piston 104 and the housing head 110 . as depicted , the modular housing 102 has a circular cross - section . in alternative embodiments , the modular housing 102 may have an elliptical or other non - circular cross - section . in the illustrated embodiment the piston rod 114 passes through the cylinder head aperture 126 and connects to the backpressure piston 104 . the bushing 128 aligns the piston rod 114 with a longitudinal axis 115 of the modular housing 102 . fluid enters the piston rod 114 through the forward radial bore 118 and flows through the longitudinal bore 116 and enters the fluid pressure chamber 112 through the fluid pressure chamber radial bore 120 . the flowing fluid fills the fluid pressure chamber 112 and the pressure moving the fluid begins to build in the fluid pressure chamber . alternatively , a flexible diaphragm in the housing head 110 may transfer pressure from a fluid in the piston rod 114 to a fluid such as a gas within the fluid pressure chamber 112 . in yet another embodiment , the pressure of the fluid in the piston rod 114 is registered by an electronic pressure sensor in communication with the fluid flowing in the piston rod 114 . increasing pressure within the fluid pressure chamber 112 drives the backpressure piston 104 back against the resistance of the piston spring 106 . in a further embodiment , a compressible solid , gas , liquid , or other resilient material may be used in place of the piston spring 106 to provide resistance . the movement of the backpressure piston 104 retracts the piston rod 114 in direction 130 . the piston extension 122 , with its lateral groove 124 serves as an attachment site for an activation handle ( see fig3 ). fig2 is an exploded view of the modular backpressure sensor 100 illustrated in fig1 . as depicted , in addition to the parts identified in fig1 , the modular backpressure sensor 100 comprises snap rings 202 and 204 , o - ring channels 206 , o - rings 208 , bushing snap ring 210 , and backpressure piston seal 212 . in the depicted embodiment snap ring 202 engages an interior channel in the modular housing 102 and secures the piston spring retainer 108 . snap ring 204 engages an interior channel in the modular housing 102 and secures the housing head 110 . the snap rings 202 , 204 prevent internal components within the housing 102 from escaping in response to the forces imposed by the spring 106 and fluid force within the fluid pressure chamber 112 . the o - ring channels 206 receive and retain the o - rings 208 . the o - rings 208 retain the modular housing 102 within an opening within a fluid nozzle . the bushing snap ring 210 engages a channel 127 in the bushing 128 . the bushing snap ring 210 secures the bushing 128 to the housing head 110 . the backpressure piston 104 incorporates an annular channel to accept a backpressure piston seal 212 that forms a fluid impermeable seal with the interior wall of the modular housing 102 such that fluid is retained within the fluid pressure chamber 112 . in an alternative embodiment , the housing head 110 may be formed as an integral part of the modular housing 102 . additionally , the housing head 110 maybe formed as a cap that attaches to the modular housing body by means of threads , grooves , flanges , clips , or other fastening means . in another embodiment , the piston spring retainer 108 may be formed as an integral part of the modular housing 110 . the piston spring 106 may be removed from the modular housing 110 through an opening configured to accommodate a removable housing head 110 . the piston spring retainer 108 may also be formed as a cap that attaches to the modular housing body by means of threads , grooves , flanges , clips , or other fastening means . in embodiments with an integrated housing head 110 or piston spring retainer 108 , snap rings 202 or 204 may not be required . fig3 is a cross - section diagram illustrating one embodiment of a combined fluid delivery apparatus 300 comprising a fluid delivery nozzle 301 configured to receive a modular backpressure sensor 100 . as depicted , the combined apparatus 300 comprises a modular backpressure sensor 100 , an actuator handle 302 , a nozzle body 304 , a removable back plate 306 , a piston rod 114 , a sealing poppet 308 , a fluid intake port 310 , a fluid flow channel 312 , a fluid outlet port 314 , a pull - back handle 318 , a carry handle 320 , a fluid shut - off valve 322 and a nozzle pressure cavity 324 . in operation , the fluid intake port 310 connects to a fluid conductor hose . the pull back handle 318 cocks the fluid outlet port 314 for connection to a receptacle connector . the carry handle 320 facilitates transport of the nozzle 301 . the activator handle 302 cooperates with the modular backpressure sensor 100 to extend the piston rod 114 , pushing the sealing poppet 308 forward to open the fluid shut - off valve 322 . the removable back plate 306 detaches to allow withdrawal of the modular backpressure sensor 100 from the nozzle pressure cavity 324 . the back plate 306 may be removed with standard tools , permitting access to the modular backpressure sensor 100 . preferably , the back plate 306 is secured to the nozzle 301 by way of common fasteners such as screws , nuts , thumb - screws , thumb - nuts , or the like . the sealing poppet 308 may also be removed using standard tools such as needle nose pliers , a screw driver , or , alternatively , a poppet spanner wrench . when the back plate 306 and poppet 308 have been removed , the modular backpressure sensor 100 can be withdrawn from the rear of the nozzle body 301 . the modular housing 102 , the housing head 110 , and the piston spring retainer 108 are preferably made of rigid , fluid insoluble , materials of sufficient size and thickness to withstand the pressure exerted by the piston spring 106 and by fluid within the pressure sensing chamber 112 . in one embodiment , the modular housing 102 , the housing head 110 , and the piston spring retainer 108 are made of hard plastic , aluminum , stainless steel , or the like . the robust nature of the modular housing 102 , the housing head 110 and the piston spring retainer 108 facilitate the modular nature of the modular backpressure sensor 100 . moreover , the modular backpressure sensor 100 can be safely and conveniently removed and replaced . in standard existing fluid delivery nozzles , the piston spring sits directly within the nozzle backpressure chamber and is retained by a back plate . however , the back plate must be removed using specialized tools . due to the bias forces within the spring of conventional fluid delivery nozzles , removal of the back plate without the special tools can cause the piston spring to violently ejects from the nozzle body creating a risk of potentially serious injury , especially to the eyes and face of a user . alternatively , the fluid delivery nozzle 301 may lack a nozzle pressure cavity 324 and the modular backpressure sensor 100 may engage the fluid delivery nozzle 301 directly , with the modular housing 102 exposed . additionally , the modular backpressure sensor 100 may be connected to substantially any external surface of the fluid delivery nozzle 301 . in a further embodiment the modular backpressure sensor 100 may incorporate electronic , digital , or analog elements to supplement or replace the mechanical elements . in such an embodiment the modular backpressure sensor 100 may interact with the fluid delivery nozzle 301 through a sensing and communication element and may directly connect to the fluid delivery nozzle 301 or reside in a remote location . such an embodiment would include a power source , an electronic modular backpressure sensor , and a shut - off switch . the shut - off switch may be configured to trigger an electronic or mechanical shut - off mechanism within the fluid delivery nozzle . fig4 is a cross - section diagram illustrating a lateral section of one embodiment of a combined fluid delivery apparatus 300 . as depicted , the combined apparatus 300 comprises a fluid delivery nozzle 301 , a modular backpressure sensor 100 , a cam 402 , a piston pin 404 , a cam cavity 406 , a valve spring 408 , a pull - back spring 410 , a release dog 412 , a sleeve spring 414 , a pull - back sleeve 416 , a dog ring 418 , an axle 422 , a nub 426 , and a tooth 428 . the pull - back handle 318 cocks the nozzle 301 for attachment to a receptacle connector ( not shown ). cocking the nozzle 301 prepares the nozzle 301 for engaging the receptacle connector . pulling back on the pull - back handle 318 moves the attached pullback sleeve 416 toward the rear of the nozzle 301 . backward movement of the pullback sleeve 416 releases the release dogs 412 that extend around the inner circumference of the fluid outlet port 314 of the nozzle body . a nub 426 on the inside wall of the pullback sleeve 416 slides along a release dog 412 and forces the release dog 412 to pivot and extend a tooth 428 of the release dog 412 . the release dogs 412 open to increase the effective diameter between release dogs 412 . the pull - back motion of the pullback sleeve 416 biases the sleeve spring 414 which facilitates return of the pull - back sleeve 416 . once , the nozzle 301 is inserted into a receptacle connector , the pull - back handle 318 is moved forward with assistance from the pull - back spring 410 . the nub 428 forces the release dogs 412 to close causing the release dogs 412 to clamp down on the receptacle connector and engage the receptacle connector . the dog ring 418 locates the release dogs 412 in either an open when the pull - back handle 318 is moved backward and in a closed position when the pull - back handle 318 is moved forward . cocking the pull - back handle 318 locks the release dogs 412 in open position , allowing the nozzle 300 to be attached to or removed from a receptacle connector . the activator handle 302 turns on axle 422 which in turn actuates cam 402 within cam chamber 406 , exerting pressure on the piston pin 404 and on the backpressure piston extension 122 . moving the activator handle 302 to pivot in a counter - clockwise direction about the cam 402 allows the piston spring 106 to move the backpressure piston extension 122 , the backpressure piston 104 , the piston rod 114 and associated poppet 308 forward , opening the fluid shut - off valve 322 . the fluid shut - off valve 322 is pressed against the valve spring 408 into a retracted position by the receptacle connector to which the nozzle 301 is attached for operation . therefore , removal of the receptacle connector closes the valve spring 408 . downward pressure on the activator handle 302 retracts the piston extension 122 and its associated structures including the poppet 308 . this allows the poppet 308 to seal against the fluid shut - off valve 322 which in turn stops fluid flow through the nozzle . such downward pressure causes the activator handle 302 to pivot in a counter - clockwise direction about the cam 402 and retracts the piston extension 122 and the poppet 308 to close the fluid shut - off valve 322 . downward pressure on the activator handle 302 retracts the piston extension 122 and its associated structures including the poppet 308 . fig4 also illustrates the cross - section shape of the piston pin 404 . in particular the piston pin 404 includes two opposing flattened edges 430 . these edges 430 , together with linkage 432 translate the rotational movement of the handle 302 about the cam 402 into lateral movement to move the poppet 308 . fig5 is a schematic block diagram illustrating one embodiment of a system 500 for fluid delivery using a modular backpressure sensor . as depicted , the system 500 comprises a fluid source 502 , a fluid conductor 504 , a nozzle connection 506 , a fluid delivery nozzle 301 , a modular backpressure sensor 100 , a receiver connection 508 , a fluid receiver 510 , and a replacement modular backpressure sensor 512 . the fluid source 502 may be a fuel , oil , water , or other fluid storage tank . in addition , the fluid in the fluid source 502 may comprise a material in a liquid , gas , or semi - solid state . the fluid conductor 504 transfers the fluid from the fluid source 502 to the nozzle connection 506 . the fluid conductor 504 may be a hose , conduit , pipe , or other conducting apparatus . the fluid delivery nozzle 301 and associated modular backpressure sensor 100 ( discussed above ) are removably connected or coupled to the fluid conductor 504 by way of the nozzle connection 506 . the nozzle connection 506 may be fixed to the fluid conductor 504 . the receiver connection 508 may be fixed or removably connected to the fluid receiver 510 . the fluid delivery nozzle 301 starts and stops fluid delivery to the fluid receiver 510 . the modular backpressure sensor 100 cooperates with the fluid delivery nozzle 301 to automatically shut - off fluid flow in response to detected back pressure in the fluid delivery nozzle 301 . consequently , the modular backpressure sensor 100 is in fluid communication with the fluid flow path 514 such that the backpressure is detectable . preferably , the modular backpressure sensor 100 is removably connectable to the fluid flow path 514 . in certain embodiments , the modular backpressure sensor 100 is in mechanical communication with the fluid delivery nozzle 301 in order to activate a mechanical shut - off valve 322 . alternatively , the modular backpressure sensor 100 may send an electrical signal that activates an electronic shut - off valve in the fluid delivery nozzle 301 . advantageously , the modular backpressure sensor 100 can be readily removed using common tools including a phillips screw driver , a crescent wrench , or the like . consequently , when an operator determines that the modular backpressure sensor 100 should be rebuilt due to wear of the spring 106 , a certain number of uses , or passage of a certain amount of time , the modular backpressure sensor 100 can be readily replaced by the replacement modular backpressure sensor 512 . alternatively , the modular backpressure sensor 100 may be removed , rebuilt on site , and reinstalled . on site rebuilding of the modular backpressure sensor 100 may be accomplished using additional tools such as snap - ring pliers , needle nose pliers . the piston spring 106 , o - rings 208 , and the piston ring 212 comprise the principle points of wear on the modular backpressure sensor . pre - calibrated springs are available for various levels of shut - off pressure . therefore , rebuilding of the depicted embodiment of the modular backpressure sensor 100 would usually comprise removal of the snap ring 202 , the piston spring retainer 208 , and the piston spring 106 , and replacement of the piston spring 106 with a new , pre - calibrated spring 106 . new snap rings 202 , 204 may be installed . the snap rings 202 , 204 may serve as a replacement fastener . additionally , the piston 104 may be removed for seating of a new sealing ring within the piston channel 212 and the external modular housing o - rings 208 may be replaced . the piston spring retainer 108 and snap ring 202 would then be reinserted into the modular housing 110 and the modular backpressure sensor 100 reengaged with the nozzle body 301 . the poppet 308 would be reinstalled on the piston rod 114 , the activation handle 302 reengaged with the piston extension 122 by means of the piston pin 404 and the back plate 306 reattached . fig6 is a block diagram illustrating one embodiment of modular backpressure sensor kit 600 . a typical kit 600 could include a pre - calibrated modular backpressure sensor unit 100 and associated seals 208 required for installation of the modular backpressure unit . the associated seals 208 may comprise rubber or plastic o - rings or may comprise the piston seal 212 . in another embodiment , the kit 600 may include several pre - calibrated modular backpressure sensor units 100 each calibrated for different backpressure levels . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	1
embodiments of the present invention are described below with reference to fig4 , fig7 , and fig8 . in a first embodiment of the present invention , the present invention is applied to the modulator - integrated laser with ridge waveguide structured as described above . as the growth method , the metal - organic vapor phase epitaxy ( movpe ) is used . as source materials which supply the group iii elements , triethyl garium ( teg ), trimethyl indium ( tmi ), and trimethyl aluminum ( tma ) are used . as source materials which supply the group v elements , arsine ( ash 3 ) and phosphine ( ph 3 ) are used . as a source material for n - type dopant , disilane ( si 2 h 6 ) is used , and as a source material for p - type dopant , dimethyl zinc ( dmz ) is used . the growth method is not restricted to the movpe method , and it is allowable to employ any other method including the molecular beam epitaxy ( mbe ) method , the chemical beam epitaxy ( cbe ) method , the metal - organic molecular bean epitaxy ( mombe ) method . fig4 a is a perspective view of the device . in this figure , a optical window section and electrodes are omitted for simplification . a flow of fabricating the device is as shown in fig2 a to fig2 g as well as in fig5 h ′ to fig5 l ′. at first , an mqw 1 layer in the laser section 402 made of an ingaalas - based material is formed on an n - inp substrate 401 . in this step , for protection of the surface , a p - inp cap layer is formed in most cases . then a bj mask 1 is formed at a desired portion of the wafer , and extra part of the p - inp layer and the ingaalas mqw 1 layer 402 are removed using the bj mask 1 as an etching mask . then , the wafer is introduced into a growth furnace , and an mqw 2 layer in the modulator section made of an ingaalas - based material 404 and the p - inp cap layer are regrown . then the bj mask 1 formed as described above is removed , and bj masks 2 are formed at desired position on the laser section and the modulator section , and extra parts of the mqw 1 layer 401 , mqw 2 layer 404 , and p - inp cap layer are removed by etching . furthermore , a wg layer 407 made of an ingaasp - based material and a p - inp layer are regrown . in this step , each of mqw 1 layer in the laser section 401 and mqw 2 layer in the modulator section 404 is bj - connected to the wg layer 407 simultaneously . the wafer is once taken out from the growth furnace , the bj mask 2 is removed once , and then a mask for the protection layer is formed in the inner side of the region where the previous bj mask 2 was present . the wafer is again introduced into the furnace for re - growth , and after the p - inp layer is removed with a gas containing chlorine , the bj protection layer 403 made of the same ingaasp having the same composition as that for the wg layer 407 and the p - inp layer are successively grown . after the wafer is taken out from the growth furnace , the mask for the protection layer is removed , and a diffraction grating 408 is formed on the mqw 1 layer 402 in the laser section . then , the wafer is introduced into the furnace to growth the p - inp cladding layer 406 and the p + - ingaas contact layer 405 are grown , and then the crystal growth process comes to the end . then a stripe - like mesa mask is formed . in succession , the p + - ingaas contact layer 405 and the p - inp cladding layer 406 are removed in this order by etching to form a mesa . subsequently , by using the usual method , the device is completed by forming a passivated film , and planarizing polyimide , and forming electrodes . the threshold current for the device fabricated as described above was 15 ma , and the device shows the excellent modulation performance of 10 ghz without the thermal electric cooler at the temperature in the range from 20 to 85 degrees c ., and the device performance is not degraded even when the device is used for a long period of time , which indicates high reliability of the device . in addition a yield in fabrication of devices is high . it is possible to use not only the ingaalas - based material described above , but also the ingaasp - based material , or materials containing sb or n atoms . in a second embodiment of the present invention , the present invention is applied to a short cavity distributed bragg reflector ( dbr ) laser . this laser is novel light source in which a cavity length is extremely short and a high speed operation is possible with a low threshold current as described in the report by aoki et al , 7p - zn - 18 , page 1016 of collection of 66 - th assembly of draft report for symposium of applied physics . the movpe method is used as a growth method also in this embodiment , but the growth method is not restricted to the movpe method , and any other method may be employed so long as the same effect is provided . the source materials used in the second embodiment are the same as those used in the first embodiment . fig7 a is a perspective view of the device . in fig7 a , the optical window section and the electrodes are omitted for simplification . the flow of fabricating the device is similar to that in the first embodiment . at first , mqw layer in the laser section 702 made of an ingaalas - based material is grown on an n - inp layer 701 . in this step , for protection of a surface thereof , a p - inp cap layer is formed in most cases . then a bj mask is formed at a desired portion of a wafer , and extra parts of the p - inp cap layer and mqw layer in the laser section 702 are removed by using the bj mask as an etching mask . then , the wafer is introduced into the growth furnace to form a wg layer 707 made of an ingaasp - based material . in the second embodiment , bj connection is provided only at one part in the laser section . the wafer is taken out from the furnace once , and the bj mask is removed once and a mask for the protection layer was formed where the bj portion is exposed to the air then , the wafer is again introduced into the growth furnace , and the p - inp cap layer is removed by using a gas containing chlorine . then a bj protection layer 703 made of ingaasp and a p - inp layer are formed to override the bj portion . after the wafer is taken out from the growth furnace , the mask for the protection layer is removed , and a diffraction grating 704 is formed on the wg layer 707 . then , the wafer is introduced into the furnace to grow a p - inp cladding layer 706 and a p + - ingaas contact layer 705 , thus the crystal growth process coming to the end . then a stripe - like mesa mask is formed . then the p + - ingaas contact layer 705 and the p - inp cladding layer 706 are removed in this order by etching to form a mesa . subsequently , by using the usual method , the device is completed by forming a passivated film , and planarizing polyimide , and forming electrodes . in the device , a length of the laser cavity is 50 μm , and a length of the device is 200 μm . the device operates with threshold current of 10 ma and at a high modulation frequency of 10 ghz at the temperature of 100 degrees c . even when the device is used for a long time , the device performance is not degraded , indicating high reliability of the device . in addition , the yield in fabrication of devices is high . in a third embodiment of the present invention , the present invention is applied to an arrayed optical integrated device . fig8 is a perspective view illustrating the device . in fig8 , the optical window section and the electrodes are omitted for simplification . this device is an example of a device in which laser beam emitted from the one laser among four - channel lasers arrayed in parallel and is guided to the modulator section by a optical multiplexer via a waveguide and is modulated by modulator . in fig8 , reference numeral 803 denotes an mqw 1 ayer in the laser section ; and 807 , an mqw 2 layer in the modulator section . the mqw 1 layer in the laser section 803 and the mqw 2 layer in the modulator section 807 are connected with an optical multiplexer 808 and a waveguide 810 . in the third embodiment , the movpe method is employed as a growth method , but the growth method is not restricted to the movpe method , and any other method may be employed so long as the same effect can be achieved . the ferrocene is used as source material for iron in this embodiment in addition to those used in the first embodiment . at first , mqw 1 layer in the laser section 803 made of ingaasp - based material is grown on an n - inp substrate 801 . in this step , for protection of a surface , the p - inp layer is formed in most cases . then a bj mask is formed at a desired position on the wafer , and extra part of the p - inp cap layer and an ingaasp - mqw 1 layer 803 are removed by etching using the bj mask as an etching mask . since there are four channels of lasers , it is necessary to form masks at four positions . then , the wafer is introduced into a growth furnace , and an mqw 2 layer in the modulator section 807 made of an ingaasp - based material and the p - inp cap layer are regrown . then , after the previous bj masks are removed , and bj masks are formed again at desired positions on the laser section and the modulator section , and extra part of the mqw 1 layers , mqw 2 layer and the p - inp cap layer are removed by etching . further , the wg layer 802 and the p - inp cap layer are regrown successively by using bj technique . in this embodiment , five sections , namely the four channels of lasers and one modulator , are bj - connected simultaneously . the wafer is once taken out from the furnace , and also the mask is once removed , and then a mask for the protection layer is formed in the side inner region where the removed mask was present . after the p - inp cap layer is removed by wet etching using the mask for the protection layer as an etching mask , the wafer is again introduced into the growth furnace to grow the bj protection layer 806 made of ingaasp having the same composition as that for the wg layer 802 and the p - inp cap layer . the wafer is taken out from the furnace and the mask is removed , and a diffraction grating is formed on the four mqw 1 layers in the laser section 803 . then , the wafer is introduced into the furnace to grow a p - inp cladding layer 804 and a p + - ingaas contact layer 805 . next , to form a waveguide 810 and an optical multiplexer 808 , entire surfaces of the laser section and the modulator section are covered with a mask . in the exposed region , p + - ingaas contact layer 805 is removed , and then a bh mask having the shape as indicated by a dotted line in fig8 is formed , and the extra parts of the p - inp cladding layer 804 , the bj protection layer 806 , and the wg layer 802 is removed by dry etching by using the bh mask as an etching mask . then , an fe - doped inp - buried layer 809 is grown . after the masks on the laser section and the modulator section are removed , masks are formed on the entire surfaces of the waveguides and the optical multiplexer region to cover the inp - buried layer 809 with the mask , and then stripe - like mesa masks are formed at five positions on the region including the laser section and the modulator section . the p + - ingaas contact layer 805 and the p - inp cladding layer 804 are removed in this order by etching to form a mesa . subsequently , by using the usual method , the device is completed by forming a passivated film , and planarizing polyimide , and forming electrodes . laser beam emitted from the one laser among four channel lasers arrayed in parallel is introduced via a waveguide 802 and an optical multiplexer 808 into the modulator , and are modulated therein . in the third embodiment , wavelengths of laser beams emitted from the lasers in the first to fourth channels are differentially set to 1540 μm , 1545 μm , 1550 μm , and 1555 μm respectively . by employing the parallel structure as described above , a laser beam having a desired wavelength can be taken out by injecting the current to desired channel . in the third embodiment , the number of channels is four , and a difference in the wavelength is 5 nm , but by using a required number of channels and setting the difference in the wavelength to a required value , the number of selectable wavelengths and the tuning wavelength can be set to desired values respectively . with the device according to the present invention , it is possible to select a laser beam having a desired wavelength and to modulate a laser beam at the frequency of 10 ghz . although the number of bj connections is high , the yield in fabrication of device is high . 101 : n - inp substrate 102 : multiple quantum well 1 layer in the laser section 103 : waveguide layer 104 : multiple quantum well 2 layer in the modulator section 105 : p + - ingaas contact layer 106 : p - inp cladding layer 107 : diffraction grating 201 : n - inp substrate 202 : p - inp cap layer 203 : multiple quantum well 1 layer in the laser section 204 : butt - joint mask 1 205 : inp cap layer 206 : multiple quantum well 2 layer in the modulator section 207 : butt - joint mask 2 208 : inp cap layer 209 : waveguide layer 210 : p + - ingaas contact layer 211 : p - inp cladding layer 212 : mesa mask 301 : inp substrate 302 : waveguide 303 : inp cap layer 304 : insulating mask 305 : inp cap layer 306 : multiple quantum well layer 401 : n - inp substrate 402 : multiple quantum well 1 layer in the laser section 403 : butt joint protection layer 404 : multiple quantum well 2 layer in the modulator section 405 : p + - ingaas contact layer 406 : p - inp cladding layer 407 : waveguide layer 408 : diffraction grating 501 : n - inp substrate 502 : insulating mask for the protection layer 503 : inp cap layer 504 : waveguide layer 505 : multiple quantum well layer in the modulator section 506 : inp cap layer 507 : butt joint protection layer 508 : p + - ingaas contact layer 509 : p - inp cladding layer 510 : mesa mask 511 : multiple quantum well 1 layer in the laser section 601 : inp substrate 602 : waveguide layer 603 : butt joint protection layer 604 : multiple quantum well layer 701 : n - inp substrate 702 : multiple quantum well layer in the laser section 703 : butt joint protection layer 704 : diffraction grating 705 : p + - ingaas contact layer 706 : p - inp cladding layer 707 : waveguide layer 801 : n - inp substrate 802 : waveguide layer 803 : multiple quantum well 1 layer in the laser section 804 : p - inp cladding layer 805 : p + - ingaas contact layer 806 : butt joint protection layer 807 : multiple quantum well 2 layer in the modulator section 808 : optical multiplexer 809 : fe - doped inp buried layer 810 : waveguide layer	6
the preferred embodiment of the present invention will be described below in detail with reference to fig1 to 3 . components which are the same as those of the above - described conventional examples are given the same reference numerals . detailed description of these common components is omitted . a multilayer - type chip inductor 21 is formed in such a way that each one of first green sheets 2 a to 2 e has electrode films 3 a to 3 e formed respectively thereon , and each one of second green sheets 22 a to 22 e has electrode films 23 a to 23 e formed respectively thereon . these green sheets are alternately multilayered and sintered . external electrodes 28 and 29 are formed at both ends of this sintered body . in the same manner as the first green sheets 2 a to 2 e , the second green sheets 22 a to 22 e are formed into sheets from an insulating ceramic slurry , such as ferrite or a dielectric or other suitable material . these sheets have electrode films 23 a to 23 e , which become internal conductors , respectively formed by printing or other suitable technique on one surface thereof . the respective electrode films 23 a to 23 e are formed symmetrically with respect to the electrode films 3 a to 3 e when they face the electrode films 3 a to 3 e . further , in the second green sheets 22 a to 22 d , via holes 24 a to 24 d are formed at one end of each of the electrode films 23 a to 23 e . in parts of the electrode films 23 a and 23 e , one end of each film is extended to the ends of the green sheets 22 a and 22 e so as to conduct to the external electrodes , forming extension electrodes 26 a and 26 e . the multilayer - type chip inductor 21 is obtained in the following way . as shown in fig1 a predetermined number of dummy green sheets 2 f , on the surface of which no electrode film is formed , are multilayered in sequence to form a bottom portion of the device . next , the first green sheet 2 a , the second green sheet 22 a , the first green sheet 2 b , the second green sheet 22 b , . . . , the first green sheet 2 e , and the second green sheet 22 e are overlaid and multilayered in such a way that each pair of electrode films ( the electrode film 3 a and the electrode film 23 a , . . . , the electrode film 3 e and the electrode film 23 e ) face each other . further , a predetermined number of dummy green sheets 2 f are multilayered on top of the body , and then the body is contact - bonded and sintered . then , external electrodes 28 and 29 are formed at both ends of this sintered body . alternatively , the external electrodes can be applied before sintering . since the first green sheets 2 a to 2 e and the second green sheets 22 a to 22 e shown in fig1 are formed with the electrode films 3 a to 3 e and the electrode films 23 a to 23 e of a ¾ turn , respectively , in the multilayer - type chip inductor 21 , an inductor 25 of 3 . 5 turns is formed inside the multilayered body . one external electrode 28 is made to conduct with the extension electrodes 6 a and 6 a of the inductor 25 , and the other external electrode 29 is made to conduct to the extension electrodes 6 e and 6 e of the inductor 25 . therefore , in the multilayer - type chip inductor 21 , as shown in fig3 an inductor 25 , whose internal conductor is thicker than the thickness of the internal conductor of the multilayer - type chip inductors 1 and 11 shown in fig5 and 7 , that is , having a larger cross - sectional area , is formed inside the multilayered body . the multilayer - type chip inductor in accordance with the multilayer - type manufacturing method of the present invention is not limited to this embodiment , and various modifications are possible within the spirit and scope of the invention . for example , although an electrode film of a ¾ turn is shown , in addition to this , the electrode film may be of a ½ turn . further , the shape of the electrode film is not limited to a coil shape , and may be a rectangular parallelepiped which connects the section between the two external electrodes by a straight line . further , the total number of windings of the inductor may be changed to any desired number of windings by increasing or decreasing the number of multilayers of the first and second green sheets . as described above , in the method of manufacturing a multilayer - type chip inductor according to the present invention , since green sheets are multilayered so that surfaces on which electrode films are formed face each other in order to form an inductor , the thickness of the internal conductor is large , and the cross - sectional area increases accordingly . therefore , in the multilayer - type chip inductor according to the present invention , it is possible to reduce the dc resistance of the inductor without decreasing the inductance or the impedance . further , the multilayer - type chip inductor according to the present invention becomes capable of withstanding a high - current load , and the allowable current value increases . many different embodiments of the present invention may be constructed without departing from the spirit and scope of the present invention . it should be understood that the present invention is not limited to the specific embodiment described in this specification . to the contrary , the present invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention as hereafter claimed . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications , equivalent structures and functions .	7
referring to the drawings , and more particularly to fig1 , a watercraft supporting a water sport tower in accordance with the present invention is generally shown at 10 . the watercraft 10 includes a bow b , a stern s , a port p and a starboard d . the watercraft 10 has two main parts , namely hull 12 and deck 14 . the hull 12 buoyantly supports the watercraft 10 in the water . the deck 14 has a recessed passenger area 16 designed to accommodate a driver and passengers . the hull 12 and the deck 14 meet at bond line 18 . an engine ( not shown ) is disposed between the hull 12 and the deck 14 . the engine is operatively coupled to a propulsion unit ( not shown ) to propel the watercraft 10 . a water sport tower in accordance with the present invention is generally shown at 20 . the water sport tower 20 has a main frame member 22 . the frame member 22 consists of a generally inverted u - shaped body , having a pair of legs 24 interconnected by horizontal member 26 . it is pointed out that letters “ d ” and “ p ” will be affixed to like elements of the tower 20 in the figures , “ d ” and “ p ” respectively specifying whether the element is on the starboard side d or the port side . p of the watercraft 10 . connector portions 28 ( only one of which is shown in fig1 ) are provided at lower free ends of the legs 24 , for releasable engagement with corresponding connector portions on the watercraft 10 . the horizontal member 26 is transversely positioned with respect to a longitudinal axis of the watercraft 10 , this longitudinal axis extending from bow b to stern s . referring to fig1 and 2 , the tower 20 has a pair of support members 30 , each connected to a respective one of the legs 24 of the frame member 22 . lower free ends of the support members 30 are provided with connector portions 32 ( only one of which is shown in fig1 ), so as to be releasably engaged to corresponding connector portions on the watercraft 10 . the support members 30 cooperate with the frame member 22 to form a self - standing structure , having four contact points ( at connector portions 28 and 32 ) by which it will be releasably secured to the watercraft 10 . a secondary frame member 34 has an inverted u - shaped body , having a pair of legs 36 interconnected by horizontal member 38 . lower free ends of the legs 36 are fixed to respective ones of the support members 30 . the horizontal member 38 of the secondary frame member 34 is generally parallel to the horizontal member 26 of the main frame member 22 , and spaced apart therefrom by spacers 40 ( as best seen in fig3 ). a central one of the spacers 40 supports towline connector 42 . the towline connector 42 protrudes upwardly from the central spacer 40 , and has a pair of flanges defining therebetween an annular groove 44 in which a connector end of a towline will be attached . referring to fig1 and 2 , support struts 46 interconnect the legs 24 of the frame member 22 and the support members 30 , whereas support plates 48 interconnect the support members 30 with the legs 36 of the secondary frame member 34 and / or with the legs 24 of the frame member 22 . the support struts 46 and support plates 48 strengthen the tower 20 . the overall structural configuration of the tower 20 , with the various components forming a horizontal structural member ( e . g ., the horizontal members 26 and 38 , etc .) and a vertical structural member ( e . g ., the legs 24 , the support members 30 , etc . ), ensures that the tower 20 will remain rigid through any force exerted thereon by the performer . it should be noted that other structural configurations of tower 20 are possible without deviating from the scope of the invention . for example , support plates 48 could be replaced by support struts , or the tower 20 could be made of a fore frame member and an aft frame member , each having an inverted u - shaped body , with support struts between the two frame members . the tower 20 is optionally provided with additional features . for instance , the support members 30 may be detached from legs 24 , as shown by connector 50 of fig2 , so as to reduce the height of the tower 20 when not in use thus preventing to have to completely remove the tower 20 from the watercraft 10 . the connector portions 28 and 32 are preferably part of quick - release connectors that will facilitate the removal or the installation of the tower 20 on the watercraft 10 . other features may be added , as long as the tower 20 can withstand the forces exerted by the performer being towed . according to the present invention and as shown in fig1 to 3 , pivot brackets 52 are provided on each of the legs 24 , and are positioned slightly below the junction of the support members 30 with the legs 24 . the pivot brackets 52 consist of pairs of spaced apart plates having bores in register so as to receive a pivot . referring to fig4 and 5 , a retractable top is generally shown at 100 . the retractable top 100 has an inverted u - shaped member 102 , which represents a top structural member . the u - shaped member 102 has legs 104 , which are pivotally connected to the respective pivot brackets 52 , such that the retractable top can pivot about the pivot brackets 52 . in a retracted position thereof , the retractable top 100 has the member 102 superposed with the main frame member 22 . a soft ( i . e ., flexible ) panel , not yet visible in fig4 and 5 , as it is optionally concealed in envelope 106 , is wrapped around a horizontal portion of the u - shaped member 102 . the envelope 106 has straps 108 , preferably made of velcro ™, by which the u - shaped member 102 is securable to the main frame member 22 in the retracted position . the retractable top 100 is kept in the retracted position , for instance , when passengers of the watercraft 10 want to be exposed to the sun , or when the tower 20 is removed from the watercraft 10 and stored away . the straps 108 are preferably an integral part of the envelope 106 . the straps 108 are detached to allow the retractable top 100 to be pivoted away from the main frame member 22 . this is illustrated in fig6 , wherein the straps 108 hang loosely , and the member 102 is away from the retracted position . in this position , the envelope 106 can be removed to uncover the panel that is concealed thereby . referring to fig7 , the soft panel is generally shown at 110 in a covering position of the retractable top 100 . in this position , the soft panel 110 is stretched between the member 102 and the secondary frame member 34 . as shown in fig8 , a slit 112 is provided in the soft panel 110 , such that the towline connector 42 can pass therethrough . this enables the soft panel 110 to be wrapped around the horizontal members 26 and 38 of the main frame member 22 and the secondary frame member 34 , respectively , as shown in fig9 . the soft panel 110 has suitable connection means such that the aft end thereof can be rigidly secured to the horizontal members 26 and 38 . more precisely , once the soft panel 110 conceals the horizontal members 26 and 38 , its aft end is attached to its bottom face . various systems can be used for securing the free aft end of the soft panel 110 to the bottom face thereof in the manner shown in fig9 , such as snap - fasteners preferably made of stainless steel , a zipper line , etc . on the other hand , the fore end of the soft panel 110 permanently defines a tubular portion 113 , into which the member 102 has been slipped into , before being connected to the main frame member 22 . once the aft end of the soft panel 110 is secured to the horizontal members 26 and 38 , the soft panel 110 is tensioned , by way of tensors 114 ( fig7 ) biasing the u - shaped member away from the horizontal member 26 of the main frame member 22 . the tensors 114 , or other suitable biasing means , must provide suitable tension such that the soft panel 110 remains stretched irrespective of the air resistance when the watercraft 10 is operated . as shown in fig7 , the tensors 114 may be adjusted in length so as to modify the amount of tension they will exert on the soft panel 110 . the tensors 114 are hooked to loops 116 on the legs 24 of the main frame member 22 , and are preferably sewn to the soft panel 110 . other mechanisms could be used to stretch the soft panel 110 . for instance , locking devices or other similar mechanisms may be provided at the pivot between the u - shaped member 102 and the main frame member 22 . such mechanisms have the advantage of being discrete , as visible from fig1 , where the soft panel 110 is tensioned without visible tensors . to cover the passenger area 16 with the retractable top 100 , the following steps are taken . firstly , the retractable top 100 is displaced from its retracted position illustrated in fig4 and 5 . more precisely , the retractable top 100 is pivoted away from horizontal member 26 , so as to be separated therefrom , as illustrated in fig6 . in the preferred embodiment , the straps 108 of the envelope 106 must be undone . the soft panel 110 , rolled on the u - shaped member 102 , must be unwrapped therefrom . in the preferred embodiment , the soft panel 110 is concealed in the envelope 106 , which must be removed . the soft panel 110 is then secured to the horizontal members 26 and / or 38 . in the preferred embodiment , the aft end of the soft panel 110 surrounds both the horizontal members 26 and 38 , to then be secured to a bottom face thereof , by suitable connection means , as best shown in fig9 . in order to do so , the slit 112 defined in the soft panel 110 accommodates the towline connector 42 , as best shown in fig8 and 10 . the soft panel 110 is then tensioned , so as to have the stretched shape illustrated in fig1 and 11 . in the preferred embodiment , the tensors 114 are connected to the loops 116 to bias the u - shaped member 102 of the retractable top 100 away from the horizontal members 26 and 38 . the soft panel 110 may be any type of fabric or polymer offering the various following characteristics : a suitable rigidity to keep its integrity irrelevant of the air resistance , resistance to the sunlight and to the uv rays ( e . g ., the soft panel must not prematurely change colors under sun exposure ), impermeability , etc . moreover , although preferable , the panel 110 does not need to be flexible . the main advantage of the soft panel 110 is that it may be wrapped around the u - shaped member 102 when the retractable top 100 is in its retracted position , and does not require additional storage space . it is also advantageous that the top 100 be retractable , as passengers of the watercraft 10 may selectively cover the passenger area 16 with the top to provided a shaded area , or to get protection from rain . the present invention uses the horizontal structural member ( i . e ., the horizontal members 26 and 38 and spacers 40 supporting the towline connector 42 ) of the water sport tower 20 as support for the top 100 . accordingly , the retractable top 100 will not create the sensation of confinement typical of tops connected below the horizontal structural member . although the above description contains specific examples of the present invention , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . thus , the scope of the invention should be determined by the appended claims and their legal equivalents rather than by the examples given .	1
fig1 is a diagram showing a configuration of a schedule management system according to an embodiment . a schedule management system 101 comprises schedule management clients 102 , a schedule management server 103 and a communication network 110 connecting the server and the clients . the clients 102 - 1 , 102 - 2 are each assigned a user id such as “ user 001 ”, “ user 002 ”, and are connected with the schedule management server 103 via the communication network 110 . although two clients are shown in fig1 , the number of clients connected to the server is not limited to two . each client transmits the input data or a request to the server via the communication network and also displays the information transmitted from the server . the schedule management server 103 comprises a schedule data storage unit 106 , a definition data storage unit 107 , a schedule data operating unit 108 , and a definition data operating unit 109 . the schedule data storage unit 106 stores the schedule data for persons and facilities , and the schedule data operating unit 108 operates ( registration , reference , change and deletion ) the data in the schedule data storage unit . the definition data storage unit 107 stores the definition data for defining the manner of handling the schedule data for registration and display , and the definition data operating unit 109 sets the definition data . the schedule management server 103 and the clients 102 each includes a computer such as a personal computer or a work station including an input / output unit , a cpu , a memory and a communication network interface . the transmission of requests and data from the clients , the display of the information sent from the schedule management server and the user interface are realized by software executed by the cpu of the clients . the schedule data operating unit 108 and the definition data operating unit 109 of the schedule management server are realized by software executed by the cpu of the schedule management server , and the data storage units 106 , 107 are realized by a memory ( a main memory and / or an external memory ) in the schedule management server . the communication network 110 is a general - purpose network such as a lan ( local area network ). the communication between the server and the clients is effected in accordance with the protocol used by the communication network 110 . in the case where the network is a lan , the protocol is tcp / ip . fig2 shows an example of a record format and a record in the schedule data storage unit 106 . the record includes a user id , a reservation state , a starting time , an ending time , an activity , a schedule no . and a registrant id . the schedule no . is an identifier of the schedule data . the user id represents the owner of the schedule and is information for identifying the clients . the user id may be the name of a facility such as a first meeting room or a guest room a . in this case , the schedule is adjusted by the facility manager . the user ids and the facility names are unique in the system . the reservation state is the state of the schedules reserved and registered , and includes “ approved ”, “ disapproved ”, “ suspended ” and “ unread ” ( described later ). the symbol “-” in fig2 indicates the schedule data registered locally , that is , registered by the schedule owner . the starting time is the time when the schedule starts , the ending time is the time when the schedule ends , and the activity indicates the business of the schedule . the registrant id indicates a person who has registered a reservation . further , the schedule data can include additional information such as the object of the schedule , the place and participants . in the example shown in fig2 , the schedule data for a plurality of user ids are stored sequentially in a single table for facilitating the understanding . actually , however , each user id has a pointer indicating the earliest - registered record of the schedule data owned by the particular user id . also , each record has a pointer indicating the next - registered record , so that the schedule data are chained sequentially in the order of registration . the table of fig2 can be realized by other than this format . fig3 shows an example of definition in the definition data storage unit 107 . the definition data defines the manner in which a schedule data display request or a reservation registration request is processed upon receipt thereof , in accordance with the schedule reservation state . in the case of fig3 , the system displays the schedule data approved or unread , but does not display the schedule data disapproved or suspended , upon receipt of a request for displaying the schedule data . also , the schedule management system according to this embodiment has the function of searching for an unoccupied time , and upon receipt of an unoccupied time search request , the search result is displayed in accordance with the definition of fig3 . specifically , a schedule is assumed to exist for the schedule data approved or not read , and the time zone for the schedule data disapproved or suspended is kept unoccupied . also , the definition data registration unit 107 defines whether or not a new reservation registration request from another client is accepted in the case where a schedule already exists in the same time zone . in the embodiment , if the existing schedule data is approved , the new registration request is rejected , whereas if the existing schedule is disapproved , suspended or unread , the new schedule data is registered . the system has one definition data 107 of fig3 which can be applied to all the users or facilities . as another method , the definition data is produced for each user or each facility , so that a corresponding data can be referred to at the time of registration or display of a schedule owned by a user or a facility . in the former case , the definition data is produced by the system manager on the schedule management server 103 . in the latter case , on the other hand , the definition data is produced on the clients 102 and sent to the server 103 by each user or facility manager . in either case , the definition data is produced and updated through the definition data operating unit 109 . fig1 shows an ordinary method of use and an example operation of the schedule management system 101 . in this case , a user having id user 001 ( hereinafter referred to as user 001 ) reserves a schedule of a user having id user 002 ( hereinafter referred to as user 002 ). a menu is displayed on the client 102 - 1 of user 001 , and user 001 selects the schedule reservation registration process . then , the screen switches to the one for inputting the record items of fig2 . upon complete record item input by user 001 and selection of the transmission button , the client 102 - 1 transmits the input items as a reservation registration request 1001 to the server 103 . the schedule data operating unit 108 of the server 103 checks the reservation registration request ( described later ), registers it in the schedule data storage unit 106 as the schedule data of user 002 , and transmits a registration ok 1002 to the client 102 - 1 together with the schedule number . in the process , the reservation state of this data is “ unread ”. though not shown in fig1 , the server 103 can notify user 002 that the reservation of the schedule has been registered anew . a menu is displayed on the client 102 - 2 of user 002 . upon selection of a schedule display by user 002 , the client 102 - 2 transmits a schedule display request 1003 . the server 103 selects a part of the schedule data associated with user 002 ( described later ). the “ unread ” record then selected is changed to “ suspended ” in reservation state . the server 103 transmits the selected schedule data as display data to the client 102 - 2 ( 1004 ). the client 102 - 2 displays the transmitted display data in the form shown in fig5 . user 002 selects a “ suspended ” schedule ( say , 502 ), and approves / disapproves the schedule using the pull - down menu . the approval / disapproval is transmitted as an approved request ( 1005 ) or a disapproved request to the server 103 from the client 102 - 2 . the server 103 changes the reservation state of the record to “ approved ” or “ disapproved ”, and notifies the change to the client 102 - 2 ( 1006 ). though not shown in fig1 , the server 103 can notify user 001 as to whether the schedule of which the reservation has been registered is approved or not . when user 001 selects the reservation check from the menu on the client 102 - 1 again , the client 102 - 1 transmits a reservation check request 1007 to the server 103 together with the schedule number of the schedule data of which the reservation has been registered . the server 103 checks the schedule data having the schedule number sent to him , and transmits the reservation state (“ approved ” 1008 in the case of fig1 ) to the client 102 - 1 . an explanation will be given of the operation of the schedule data operating unit 108 of the schedule management server 103 . assume that the server 103 has received from a client 102 a schedule display request for displaying the schedule data of the 7 - day period from jun . 30 , 1997 , of the user having the user id “ user 001 ”. the schedule display process of the schedule data operating unit 108 starts as shown in fig4 . first , in step 401 , the display process sets “ user 001 ”, “ jun . 30 , 1997 ” and “ 7 days ” in the received schedule display request as the search keys for the referred user id , the starting date and the number of days , respectively . the data ( record ) conforming to the conditions of the search keys are acquired from the schedule of the user id “ user 001 ” in the schedule data storage unit 106 . in the example record of fig2 , nos . 1 to 8 are acquired ( step 402 ). the user id of the request source is compared with the referred user id ( step 403 ). if the user id of the request source coincide with the referred user id , it indicates that the display is requested by the owner of the schedule . therefore , the reservation state of the record in the schedule data storage unit 106 corresponding to the record having the reservation state “ unread ” in the data acquired at step 402 is changed to “ suspended ” ( step 410 ). after that , the schedule data acquired at step 402 are all transmitted to the client as display data ( step 409 ). at step 410 , only the data reservation state in the schedule data storage unit 106 is updated , and therefore the reservation state “ unread ” in the display data transmitted to the client is not changed . an example display of the display data on the client is shown in fig5 . numeral 501 in fig5 corresponds to record no . 1 in fig2 , 502 to record no . 2 , 503 to record no . 3 , 504 to record no . 8 and 505 to record no . 4 . if the user id of the request source and the user id of the reference fail to coincide with each other at step 403 , the number of schedule data acquired at step 402 is substituted into the variable count ( step 404 ), and the leading data of the schedule data list acquired is compared to see whether the reservation state of the schedule data is “-” or not ( step 405 ). if it is “-”, the data is not the reservation schedule data but a schedule set by the referred user himself , and therefore the schedule data is added unconditionally to the display data ( step 407 ). in the case where the data is found to be the reservation schedule data at step 405 , on the other hand , the display or no - display is determined from the reservation state of the schedule data and the data in the definition data storage unit 107 ( step 406 ). in the case where the system has only one definition data under this condition , the particular definition data is referred to . in the case where the definition data is produced for each user id , on the other hand , the definition data for the schedule owner ( user 001 ) is referred to . the “ display ” data in the definition data is compared with the reservation state of the schedule data , and only the schedule data of “ o ” is selected ( step 407 ). in the example of fig3 , only the record with the reservation state of “ approved ” and “ unread ” are the object to be displayed . thus , nos . 1 , 2 and 5 of the schedule data for “ user 001 ” in fig5 are selected . the variable count is decremented by one ( step 408 ), and as long as the variable count is larger than zero , the process of steps 405 to 408 is repeated . once the schedule data to be displayed is determined , the schedule data is transmitted to the display request source client ( step 409 ). an example of display on the client is shown in fig6 . numeral 601 in fig6 , corresponds to record no . 1 in fig2 , 602 to record no . 2 , and 603 to record no . 8 . on the other hand , fig5 shows an example display of the schedule data list as seen on the client 102 by the user “ user 001 ” himself of the reference for comparison . numeral 503 in fig5 represents the reservation state “ suspended ” of the schedule . once the definition data is acquired in fig3 , therefore , “ no display ” is indicated for the state . thus , the schedule data corresponding to 503 is not displayed in “ the schedule list referred to by another client ”. also , when one of the schedule data displayed as shown in fig5 and 6 on the client is selected by the user and detailed information display is designated by the pull - down menu or the like , the client displays all the items available in fig2 . assume that the server 103 has received from the user ( user 002 ) of the client 102 an unoccupied time search request for another user ( user 001 ). the schedule search process of the schedule data operating unit 108 starts as shown in fig7 . assume that user 002 has set one hour on jun . 30 , 1997 , as a condition for the search . at step 701 , the search process sets the referred user id , the date and the search time zone as “ user 001 ”, “ jun . 30 , 1997 ” and “ one hour ” in the received unoccupied time search request , respectively , as search keys . then , the client 102 acquires the schedule data including the user id of “ user 001 ” and the date of “ jun . 30 , 1997 ” from the schedule data storage unit 106 . in the example of the record shown in fig2 , nos . 1 to 8 are acquired ( step 702 ). the number of the schedule data acquired is substituted into the variable count ( step 703 ), and from the leading data in the schedule data list acquired , the reservation state of the schedule data is compared to see whether it is “-” or not ( step 704 ). if it is “-”, it indicates that the schedule is set by the referred user himself . therefore , the process unconditionally proceeds to step 706 , and the time zone of the schedule data is stored as an occupied time zone ( a time zone not unoccupied ), and the process proceeds to step 707 . in the case where the result of comparison is not “-”, the display / no - display information is acquired from the definition data in the definition data storage unit 107 using the reservation state of the schedule data . which definition data is referred to is determined at step 705 in the same manner as the schedule display process . if the reservation state of the schedule data is defined as displayable , the particular reservation schedule is handled as established . in other words , the time zone of the schedule data is stored at step 706 as an occupied time zone , and the process proceeds to step 707 . in the case where the reservation state of the schedule data is defined as non - displayable , on the other hand , the process proceeds directly to step 707 . in other words , the time zone of the schedule data is handled as an unoccupied time . at step 707 , the variable count is decremented by one , after which the process of steps 704 to 707 is repeated as long as the variable count is larger than zero . next , at step 708 , the unoccupied time is searched for by reflecting the stored data in the occupied time zone . specifically , during the designated period , i . e . from 0000 hours until 2400 hours on jun . 30 , 1997 , the time zone lasting at least one hour continuously in other than the stored unoccupied time zone is used as an unoccupied time . once the unoccupied time is determined , an unoccupied time list is transmitted to the client ( step 709 ). an example of display of the unoccupied time list on the client is shown in fig8 . on the client , the user selects one of the unoccupied times displayed as shown in fig8 , and designates the reservation registration by a pull - down menu or the like . thus , a reservation registration request can be transmitted to the server 103 . assume that the server 103 has received a reservation registration request for the schedule data from a client 102 . the schedule reservation registration process in the schedule data operating unit 108 starts as shown in fig9 . a case in which the user of “ user 002 ” registers the reservation of the schedule data of the user of “ user 001 ” will be described . at step 900 , the reservation registration process sets the user id ( user 001 ) to be schedule - registered and the search date ( jun . 30 , 1997 ) in the received reservation registration request as search keys . a list of the schedule data on the search date of the user id “ user 001 ” is acquired from the schedule data storage unit 106 of the server 103 . in the example of the record shown in fig2 , the schedule data nos . 1 to 8 are acquired ( step 901 ). then , in step 902 , the number of the schedule data acquired is substituted into the variable count . next , at step 903 , from the received reservation registration request the starting time and the ending time of the new schedule data to be registered are obtained . the schedule data acquired at step 901 are checked sequentially from the leading data to see whether the new schedule data is registered without any problem . first , step 904 checks whether the time zone of the new schedule to be registered is overlapped with the time zone of the existing schedule data . if the time zones are not overlapped , the process immediately proceeds to step 907 . if the time zones are overlapped even partially , the process proceeds to step 905 for checking whether the existing schedule data is for a reservation schedule or not . if it is not a reservation schedule , i . e . if the reservation state of the schedule data is “-”, the process proceeds to step 907 . in the case where the existing schedule data is for a reservation schedule , on the other hand , the process proceeds to step 906 , where the possibility of registration is determined from the reservation state of the existing schedule data and the data in the definition data storage unit 107 . in the case where the system has one definition data , the particular definition data is referred to . in the case where the definition data is produced for each user id , on the other hand , the definition data for the user id ( user 001 in this case ) to be schedule - registered is referred to . the “ registration ” data in the definition data is compared with the reservation state of the existing schedule , and if the result is “ o ”, the registration of the new schedule data is permitted . if the definition shown in fig3 is involved , the registration of a new schedule is not permitted only when the reservation state of the existing schedule data is “ approved ”, and the new schedule can be registered in cases other than “ approved ”. when the registration is permitted , the process proceeds to step 907 . at step 907 , 1 is decremented from the variable count . after that , the next existing schedule data are checked repeatedly at steps 904 to 906 . when the variable count reaches 0 as a result of the repetition , it is determined that none of the existing schedule data on the search date is adversely affected by the registration of a new schedule data . thus , the new schedule data is registered at step 908 , and the completion of the reservation registration is notified to the client , then ending the whole process . in the case where the reservation state of the existing schedule data does not permit the registration of a new schedule data in step 906 during the repetition , on the other hand , the process immediately proceeds to step 909 , and the client is notified that the new schedule data could not be registered , then ending the whole process . step 909 can be modified in such a manner that a notice prompting the input of a correction of the time zone of the new schedule data is transmitted to the client and when a correction input is received , the process is repeated from step 900 . the schedule data operating unit 108 of the server 103 performs the following additional tasks . as shown in fig1 , upon receipt of an approval / disapproval request ( 1005 ) of a schedule data in “ suspended ” state from a client , the schedule data operating unit 108 checks the request source user id and the user id of the owner of the particular schedule data . only when both are coincident with each other and the reservation state of the schedule data is “ suspended ”, the reservation state is updated in accordance with the received request , and the request source is notified of the complete updating ( 1006 ). in the case where a request ( 1007 ) for checking the reservation state of the schedule data of which the reservation has been registered is received from the client as shown in fig1 , the schedule data operating unit 108 reads the reservation state of the particular schedule data and transmits it to the request source ( 1008 ). also , the schedule data operating unit 108 checks the schedule data in the schedule data storage unit 106 regularly , and deletes the schedule data for which a predetermined storage period is overdue . in the case where the storage period is determined as three months , for example , the data that have passed three months from the date of the schedule data are deleted . for deletion of old schedule data , the storage period can be set for each user id or such data can be deleted in response to a schedule data delete request from a client . when checking the schedule data in the schedule data storage unit 106 regularly , the schedule data operating unit 108 can transfer the past schedule data to a place other than the storage unit 106 and store them there . in the embodiments , a system for communication between clients and a server via a communication network is described . as an alternative , the functions of the server and the clients can be integrated so that a system may be configured of one computer and more than one terminals or remote terminals . in fig9 , a registered schedule is always permitted to overlap with an existing schedule in the reservation state of “-”, i . e . an existing schedule set by the schedule owner . this can be modified in such a way that the established state of the schedule set by the schedule owner is also classified and registered in the definition data as additional data . in the schedule registration process , an overlapped reservation registration of a new schedule requested from a different client may not be permitted in the case where the degree of established state is high in the classification . the four reservation states were described above as “ approved ”, “ disapproved ”, “ suspended ” and “ unread ”. in addition , the states such as “ provisionally approved ” and “ delegated ” can be defined . in such a case , a similar determination is possible if “ provisionally approved ” and “ delegated ” are additionally defined as the items of fig3 . the permission of display and registration is determined in accordance with the definition in the definition data storage unit 107 . therefore , if the process corresponding to the reservation state is added to the definition , it can be reflected in the determination process of steps 406 , 705 and 906 . in the embodiment , when the schedule display request from the schedule owner is received , the schedule display process ( fig4 ) updates the schedule data from “ unread ” to “ suspended ” at step 410 . alternatively , the schedule data may not be updated when the display request is received . and when the detailed information display request from the schedule owner is received , the schedule data may be updated from “ unread ” to “ suspended ”.	6
various embodiments of the invention are discussed in detail below . while specific implementations are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the relevant art will recognize that other components and configurations may be used without parting from the spirit and scope of the invention . as noted , one of the security issues that has faced increased scrutiny is the risks associated with assets ( e . g ., containers , deployments , shipments , trailers , heavy equipment , vehicles , and other mobile assets ) that cross u . s . borders . security for these assets is a natural hazard due to the inherent inability to control access to these assets along their entire journey into and through a u . s . port . typically , these assets are brought to a foreign port , loaded onto a ship , transported to a u . s . port , and loaded onto rail or semi - trailer transport to a domestic destination . throughout this journey , the asset is susceptible to potential terrorist elements that seek to subvert the asset shipment to their own purposes . securing and tracking these assets throughout their journey into the u . s . is therefore a necessary task in reducing the likelihood of asset - borne security threats . in this environment , maintaining continuous tracking and monitoring visibility of an asset is of paramount importance . a loss of visibility provides terrorist elements with an unchecked opportunity to access and subvert an asset . thus , one of the objectives of the present invention is to provide a framework that enables an asset to be tracked and monitored whether or not the asset is sitting in a rail or ship yard , or sitting on a train or ship during transport . as would be appreciated , each of these environments can present their own challenges in providing proper communication facilities that enable real - time or near real - time reporting of position , status , and alert information from the asset . in designing a proper security framework where it is possible to maintain contact with an asset during all phases of shipment from origin to destination , it has become apparent that a single monitoring mechanism may not be sufficient to satisfy the security objectives . in accordance with the present invention , a multi - mode asset monitoring capability is envisioned to provide high - availability coverage over a range of transport phases . for example , satellite - based communications and positioning means operate with relatively small link margins and can therefore require relatively unimpaired paths from the terminal to the satellite . such paths , however , may not be available within container yards , where assets are often stacked . this problem can also exist in those asset environments where assets are stored within the bowels of a ship . terrestrial mode communications also have their limitations . for example , cellular systems offer much better link margins than satellite communications means except in fringe and shadowed areas . however , once out of cellular coverage terrestrial mode communications does not work . the unfortunate consequence is that terrestrial mode communications would not supply coverage over many rail routes , and certainly not on offshore shipping routes . notwithstanding the limitations of satellite and terrestrial communication systems , it is recognized that local monitoring networks seem to offer strengths precisely where satellite networks fall short ( i . e ., in relatively confined yard and shipboard environments ). here , local monitoring networks can represent those networks that are largely directed to the operating area of the supported operation , such as in a marine terminal , a truck terminal , aboard a ship , on a train , in a rail yard , in a shipping depot , in a tunnel , etc . in one embodiment , the local network collects information from terminals scattered within the local area , processes and screens the data , and presents it to a communications node within the local area for routing to a remote central data collection facility . in this manner , a local wireless network simplifies the communications problem at the operating site ( i . e ., yard or ship ) by enabling a single , central communications means from the site to the central facility . in various embodiments , this could be done by internet , leased line , wireless telephone or data services ( e . g ., pcs ), another satellite network , or a combination of the above . it is a feature of the present invention that a local monitoring network can be used in combination with a wide area monitoring network ( e . g ., satellite ) to produce a multi - mode solution . this multi - mode solution would facilitate complete coverage across an asset &# 39 ; s international route . in this framework , the local monitoring network can be used to report tracking and monitoring information to a central facility when out of contact with a satellite network , while the wide area satellite network can be used to report tracking and monitoring information to a central facility when out of contact with a local monitoring network . here , each mode would use a different communications network to report asset position , status , and alert information . as would be appreciated , the various communications networks would have different performance characteristics , to thereby complement each other for a particular monitoring application . thus , in accordance with the present invention , distinct modes of network communications can be used to monitor assets . in one embodiment , complementary modes of communication can also be used simultaneously or in sequence when multiple modes are available . further , in one embodiment , one network &# 39 ; s availability can preempt report via another network , thereby increasing efficiency in communications network use . in another embodiment , each network could be used to provide reports whenever available regardless of the status of another network , thereby providing improved reliability through redundancy . in general , any one network could facilitate control operations in another network , or for configuration of devices in another network . information from the various monitoring networks can then be combined or otherwise integrated at a remote central information processing and delivery facility to produce a continuous tracking and monitoring log during the asset &# 39 ; s entire international journey . to illustrate the features of the security framework of the present invention , reference is now made to the system diagram of fig1 . as illustrated , the security framework includes asset 111 that is contained within a local area 110 ( e . g ., ship , ship yard , rail yard , or the like ). position , status , and alert information can be communicated to service operations center ( soc ) 140 via satellite 120 and antenna 130 . in one embodiment , soc 140 is built around a relational data base managing all relevant system , user , terminal , and transaction data . several back end servers manage internal system functions , such as terminal and protocol management and position solving , while front - end servers manage applications and web delivery . soc 140 can deliver information to customers in a number of ways , including by web account , url query , xml data delivery ( including the xml trailer tracking standard ), email , and file transfer protocol ( ftp ). as further illustrated in fig1 , asset 111 can include sensors 114 that are used to detect various conditions at asset 111 . in various examples , sensors 114 can be used to detect intrusion , light , movement , heat , radiation , or any other characteristic that would bear on the container &# 39 ; s security . events detected by sensors 114 are communicated to service operations center 140 using mobile terminal ( mt ) 112 and / or local network terminal ( lnt ) 113 . it should be noted that while mt 112 and lnt 113 are illustrated as separate devices , they can be combined into a single multi - mode device . more generally , the multi - mode device can be designed to communicate in any number of modes dictated by a particular implementation . in general , mt 112 can be used to communicate tracking and monitoring information to soc 140 directly via satellite 120 . lnt 113 , on the other hand , can be used to communicate tracking and monitoring information to soc 140 through local area terminal ( lat ) 116 . in the embodiment illustrated in fig1 , lat 116 would forward information communicated by lnt 113 to soc 140 through satellite 120 . in an alternative embodiment , lat 116 can communicate information to soc 140 using a leased line , internet or other land - based connection scheme . the operation of the alternative communication paths reflected by mt 112 and lnt 113 will now be described in greater detail with reference to the flowchart of fig2 . as illustrated , the flowchart of fig2 begins with the detection by sensor 114 of an event . as noted , sensor 114 can be designed to detect various conditions such as intrusion ( e . g ., door sensor ), light , heat , motion , radiation , or the like . as would be appreciated , asset 111 can be configured to include any number or combination of sensors depending on the particular application and level of security desired . once sensor 114 detects an event , it would then alert at least one of mt 112 and lnt 113 at step 204 . in various embodiments , sensors 114 can be coupled directly to mt 112 and / or lnt 113 . for example , if sensors 114 are coupled directly only to mt 112 , then a connection may also be established between mt 112 and lnt 113 , to thereby facilitate an effective connection between lnt 113 and sensors 114 . after mt 112 and / or lnt 113 has been alerted to the detected event , mt 112 and / or lnt 113 would then proceed to communicate the detected event information to soc 140 . considering first mt 112 , when any of sensors 114 activates , sensor 114 awakens mt 112 and causes it to enter a mode to report immediately on sensor status and activation . this process is represented by step 206 where mt 112 would attempt to report the event to soc 140 through a direct connection to satellite 120 . in one embodiment , mt 112 is represented by the mt developed by skybitz , inc . for use in their global locating system ( gls ). the skybitz mt is built to mil - std 810f and sae - j1077 environmental specifications , and is built as a software - configurable radio . eight aa lithium batteries give it a battery lifetime of 4500 position reports combined with a shelf - life of over 10 years . the combination of the protocol and mobile terminal design enables the mobile terminal to support position reports , mt paging ( unscheduled requests for information from the mt ), event reports ( unscheduled , real time reporting of events detected by the mt ), and low bandwidth data traffic . the mt can accommodate multiple simultaneous assignments , and can be configured remotely over the air . it also automatically adapts to changes in the network , and roams automatically among beams within a satellite footprint and among satellites . the gls system is configured to use transponding satellites using the international geostationary l - band mobile satellite allocation . the mt supports a number of local interfaces through a single weather - tight , triply - sealed connector . through this connector the mt can monitor two simple contact closure sensors and operates two internal switches to control local external devices . it accepts external power and uses it when present in preference to internal batteries . and it controls an rs - 485 data bus , enabling communications with up to six simultaneously connected intelligent devices . referring back to fig2 , if mt 112 determines that satellite 120 is not in view , it would then set a timer at step 210 for a short delay ( e . g ., seconds to minutes ), go back to sleep , and reawaken when the timer expires to try again . when the timer has expired , the process would continue back to step 208 , where mt 112 would again determine if satellite 120 is in view . this process will repeat until it is successful . in one embodiment , timer intervals will increase with successive failures to receive the satellite signal in order to conserve battery when blocked from satellite 120 for an extended period . if mt 112 determines at step 208 that the satellite is in view , then mt 112 would then proceed to report the event to soc 140 through satellite 120 . in one embodiment , mt 112 reports the event by seeking an event timeslot or otherwise unoccupied timeslot ( as evidenced by the forward link on that timeslot ), and transmits a position and sensor status report over the corresponding return timeslot . it then proceeds to a slightly later timeslot to receive an acknowledgement . mt 112 will retry if it receives no acknowledgement . as fig2 further illustrates , a sensor alert provided to lnt 113 will also cause lnt 113 to report the event to soc 140 . this process is represented by step 214 where lnt 113 reports the event using a local area network . in one embodiment , lnt 113 receives the alert by sensor 114 directly . in another embodiment , lnt 113 is awakened by mt 112 . here , when mt 112 initially awakens due to a sensor alert , it can be designed to also close an appropriate contact controlling lnt 113 to alert lnt 113 as well of the event . in one embodiment , lnt 113 can then send “ blinks ”, or brief emissions , on an ongoing basis at regular settable intervals ( e . g ., up to four minutes ) between blinks if a sensor contact is closed , lnt 113 can immediately send a set of blinks with the change in status . as illustrated in fig1 , lnt 113 can be generally designed to communicate with lat 116 via a local network connection . lat 116 can then proceed to communicate information generated by lnt 113 to soc 140 via satellite 120 . in one embodiment , lat 116 is embodied as a similar unit to mt 112 . in this embodiment , the primary difference between lat 116 and mt 112 would be the item to which the units are fixed . mt 112 would be fixed to an asset being tracked and monitored , while lat 116 would be fixed to an element within local area 110 . as would be appreciated , the specific method by which lnt 113 would communicate with lat 116 would be implementation dependent . one embodiment of a communication mechanism between lnt 113 and lat 116 is illustrated in fig3 . in this embodiment , location sensor 320 is operative to listen to emissions by tags 310 , which are individually fixed to the plurality of container assets that are distributed in a local area 110 . location sensor 320 would then report inform server 330 of the presence and status of tags 310 in local area 110 . any location sensor 320 able to hear tag 310 in turn reports the change in tag status to server 330 . in one embodiment , several sensors 320 can be arranged around a local area 110 ( e . g ., ship yard , rail yard , ship , or the like ) to locate each tag 310 using time difference of arrival techniques . one example of tags 310 and location sensor 320 are the tags and location sensors manufactured by wherenet , inc . in general , wherenet &# 39 ; s local wireless locating and monitoring system has been used for locating and monitoring tags within a yard , depot , or plant environment . wherenet &# 39 ; s wheretags operate in the 2 . 4 ghz industrial , scientific , and medical band , and can be set up to emit periodically from every few seconds to every few minutes . tag emissions are spread spectrum , spread across 30 megahertz , and operate either at 2 . 5 milliwatts or 50 milliwatts , depending on the model . each emission contains data on tag identity , tag state , the state of various sensor inputs , and other information . emissions last only several milliseconds each , permitting very long battery life , up to seven years depending on type and report rate . after server 330 collects reported information from tags 310 , server 330 would then proceed to report this information back to soc 140 . in the illustrated embodiment , server 330 communicates with mt 340 , which is operative to transmit information to the soc via satellite 350 . in one embodiment , communication between server 330 and mt 340 is enabled using the local rs - 485 data bus of mt 340 . in general , the rs - 485 data bus supports among other things an rs - 485 interface to local digital devices . in this embodiment , the rs - 485 interface is used to transport packets from server 330 to the soc using satellite 350 . here , a software application hosted on server 330 extracts data from the database on server 330 , formats it , adds the necessary rs - 485 communications protocol layers , and deliver it to mt 340 . at the soc , application software would then extract the data from the incoming packets . it will be appreciated by those skilled in the art that the system and method of the present invention can be used in environments other than those disclosed herein . it will thus be appreciated by those skilled in the art that other variations of the present invention will be possible without departing from the scope of the invention as disclosed . these and other aspects of the present invention will become apparent to those skilled in the art by a review of the preceding detailed description . although a number of salient features of the present invention have been described above , the invention is capable of other embodiments and of being practiced and carried out in various ways that would be apparent to one of ordinary skill in the art after reading the disclosed invention , therefore the above description should not be considered to be exclusive of these other embodiments . also , it is to be understood that the phraseology and terminology employed herein are for the purposes of description and should not be regarded as limiting .	6
the instrument which realizes the intended objects of the present invention has been provided on the basis of the experience below . in consideration of the combined operation of quantitative sampling and liquid level detection , the pipet is indispensably brought into contact with the liquid in the liquid sampling operation . the contact of a body with a liquid is conducted also in the liquid level detection with an electrode and in the detection with a contact type optical liquid level detecting device in different application fields . having noticed this fact , the inventors of the present invention intended to utilize a pipet simultaneously for a constituting member of a liquid level detecting device , although the pipet is a tool for sucking a liquid and is normally not for liquid level detection . as the results , the inventors have succeeded in using the liquid - sampling pipet simultaneously as a constituting member of a liquid level detecting device . consequently , the following facts were confirmed : the numbers of the constituting members of the devices are reduced ; a liquid level can be detected in high accuracy and further , quantitative sampling of a liquid in high accuracy are made feasible ; the operations of liquid level detection and quantitative liquid sampling are unified to result in quickening of the operations ; the contamination between samples is readily prevented by use of a pipet of a disposable type ; and the unified constitution of the device is highly useful for quantitative sampling of a micro - quantity of liquid such as a biological sample . the instrument of the present invention may be simplified by unifying the pipet tip with the main pipet instrument in one body and combining a washing means for washing the liquid - contacting portion of the pipet tip . such a simplified instrument of the present invention requires less work for washing operations with less liability of contamination because the liquid - contacting member is limited only to the sampling pipet which serves also as a contact type of liquid level detecting device . in the instrument of the present invention , the shape of the pipet tip of the pipet device is not limited provided that its lower end is capable of being inserted into a small container ( such as a cup - shaped container and a test tube ) and is capable of sucking a liquid into the pipet . generally those in a shape approximately of an inverted truncated cone are preferably used . the shape of the lower end face of the pipet tip is not specially limited but is preferably designed such that the face functions as a total reflection surface for a downward light beam from the top in a non - liquid - contacting state , typically being formed as a horizontal plain end face . the lower end face of the pipet tip in the present invention naturally includes the end faces visible to naked eyes , but is not limited thereto . for example , a pipet tip , which is made of a thermoplastic material and is stretched with heating into a sharp needle shape , has no distinct end face to the naked eyes . such a pipet tip is shown experimentally to be useful for the liquid level detection by use of reflected light from the pipet lower end face of the present invention . accordingly , the above - mentioned &# 34 ; lower end face &# 34 ; denotes collectively the interface between the lower end portion of the pipet tip and the surrounding space . the material for the pipet tip includes materials which are transparent as well as semi - transparent excluding opaque bodies which intercept light . particularly preferred materials specifically include polypropylene , polystyrene , acrylics polymethacrylates , polyethylene , and poly - 4 - methyl - 1 - pentene . an example of a tip made of such a material is a crystal long tip ( 1 to 200 μl ) made by wakenyaku k . k . other examples of disposable type of tips are those made of a commercial polypropylene such as standartips ( 1 to 100 μl ) made by eppendorf co . with a pipet instrument having a pipet tip of such a shape and material , light projected toward the lower end face of the pipet tip is strongly reflected ( e . g ., reflected totally ) at the lower end face to be detected by a light - receiving means as large reflection intensity . when this pipet tip is brought into contact with a liquid , the interfacial condition changes to decrease the difference of the refractive indexes , thereby abruptly decreasing the reflective light intensity . as a typical example in which the refractive index of the material of the pipet tip is nearly equal to that of the liquid , almost all of the light totally reflected in the non - liquid contacting state comes to be introduced into the liquid on contact with the liquid , whereby the intensity of the reflected light abruptly drops from a certain level . the instrument of the present invention is constituted by applying this principle to the pipet of the instrument for quantitative sampling of micro - quantity of liquid . in practical operations of the quantitative liquid sampling instrument of the present invention , a diluting liquid may be preliminarily ( or later ) sucked into the pipet without any inconvenience in operation of the instrument since the diluting liquid is normally light - transmissive . further , as described later , an instrument which is not affected by existence of a liquid in the pipet tip can be constituted by establishing a selective light path for light projection and light receiving . in the case where a transparent dilution liquid is sucked firstly into the pipet and liquid sample is sucked subsequently therein , the intensity of the received light is larger advantageously owing to the light reflected by the lower interface of the diluting liquid . otherwise with a light source provided inside a pipet tip , the light efficiency of the light source is advantageously higher because the light from the light source is readily introduced by the upper interface of the diluting liquid into the tip material . the instrument of the present invention is particularly effective in taking out quantitatively a sample in an extremely small amount of from 1 to 1000 μl , particularly from 1 to 150 μl , but is not limited by the handling volume of samples in principle . in many cases , apparatuses for treating an extremely small amount of liquid like an apparatus for immune measurement handle a number of sample containers holding about 200 μl of a sample and about 1 cm in diameter . in such cases , it is practically not feasible to bring a pipet together with a separate liquid - level detecting member simultaneously close to the liquid face in the container . however , the above constitution of the present invention enables detection of the liquid level and suction of the liquid practically in one step , since only a pipet tip which serves both to suck the liquid and to detect the liquid face has to be brought close to or contact with the liquid face in a container having a small inside diameter . the instrument of the present invention having the above - mentioned arrangement includes various embodiments in practical uses . for example , the container may be moved vertically to bring the pipet tip into contact with the sample in the container without any inconvenience , although a pipet vertical - driving mechanism is generally employed . the path of the light projected to or reflected by the pipet tip end face for liquid level detection may be either in the inside of the tube shell of the pipet tip or in the outside thereof . particularly preferred is the type utilizing the pipet tip tube shell as the light transmitting medium . in the case where the pipet tube shell which is made of a highly light - transmissive material is utilized as the light transmitting material to transmit the projected light or reflected light , the influence such as diffusion of light is reduced , enabling decrease of light intensity of the light source . further in that case , the mechanical constitution may be made spatially roomy by arranging the received light sensor in opposition to the upper end face of the pipet tip as the light transmitting medium . further , in addition to the use of the pipet tip as the light - transmitting medium , particularly a preferred arrangement includes a light - transmitting medium having a columnar portion and an annular portion opposed to the annular upper end face of the pipet tip , and a received - light sensor provided at the upper end face of the columnar light - transmitting medium . with such a constitution , the reflected light from the lower end face of the pipet tip is effectively utilized as the light for received - light sensor , thereby the abrupt change of the reflected light intensity being detectable more precisely , or the intensity of the light source being reduced . for the light source of the light projecting means and the received light sensor mentioned above , a light emitting element such as various led and semiconductor laser , and photodiode and the like are appropriately employed without limitation . the projection of light may be continuous or in pulse . the use of optical fiber for projection and reception of light is often preferred for securing freeness of mechanical design of the instrument . the light for liquid level detection is not limited , but is preferably the light in the region of ultraviolet light of from 200 to 1100 nm , visible light , and infrared light , particularly preferably in infrared region . in a bright place like a bright room where the usual operation of the instrument is conducted , the received light sensor may react to room illumination or other light . therefore the wavelength of light is selected as above to stabilize the operation of the apparatus and to improve the accuracy without external light disturbance . if a sample to be sucked into the pipet tip is turbid , a longer wavelength of light is generally advantageous since it causes less light scattering . the selection of the wavelength can be made by selection of the light source and the received light sensor , or by use of an appropriate light filter . the computing means for detecting the pipet liquid contact from the detection information of abrupt change ( or abrupt fall ) of the reflected light intensity is generally constituted from a microprocessor , but is not limited thereto . the time of the abrupt change is judged from various phenomena such as a fall of the reflected light intensity below a predetermined threshold value , and a rise of the decreasing rate of the reflected light intensity above a predetermined rate . the end point of the downward movement of the pipet can be designed so as to be sufficient for taking out the sample . specifically the quantitative liquid sampling instrument of the present invention is particularly useful , for example , for immune diagnosis apparatuses which conduct diagnosis by determining quantitatively a minute quantity of protein or the like in blood by immune reaction , and biochemical reaction apparatuses and analysis apparatuses which require quantitative sampling of an extremely small amount of liquid . the instrument of the present invention , in which a pipet tip only is brought into contact with a liquid , enables simultaneous operations of a contact type liquid level detection and of liquid sucking with high accuracy . the present invention is described in reference to examples shown in the drawings . fig1 illustrates an outline of the arrangement of the quantitative liquid sampling instrument of the present invention employing a disposable type of pipet tip used , for example , for immune reaction measurement . fig1 ( a ) shows the state of the instrument before the pipet tip is inserted into a sample solution ( namely a solution to be detected ). fig1 ( b ) shows the state that the lower end of the pipet tip is inserted into the liquid sample and is sucking the liquid sample . in the drawings , the sample container 1 contains liquid sample 2 such as a small amount of blood , for example , about several μl . the liquid sample 2 is introduced into the quantitative liquid sampling instrument which is incorporated in an immune reaction measurement apparatus not shown in the drawing . a pipet tip fitting tube portion 4 and a frame 6 integrated therewith make - up the main body of the pipet instrument . a disposable type pipet tip 3 is fitted detachably to the pipet tip fitting tube portion 4 of the main body of the instrument , and is attached to and detached from the pipet tip fitting tube portion 4 at a predetermined waiting position by an attaching - detaching device not shown in the drawing . the pipet tip 3 is made of a light transmissive material as described above . a light source 5 is fixed to the frame 6 at the inside of the pipet tip fitting tube portion 4 such that a ray of light of a predetermined wavelength is emitted downward from a light - emitting diode inside the pipet tip . the light source 5 is connected electrically to a lighting circuit 7 so as to conduct pulse - lighting . a vertical movement mechanism 11 moves the frame 6 of the main body of the pipet instrument from an upper waiting position ( see fig1 ( a )) downward to a lower movement end point ( see fig1 ( b )) by a pulse - motor type mechanism ( or a turning screw type , or cylinder type ), and then returns it to the waiting position , by control of a driving control device 12 . an optical fiber 9 is a portion of a light receiving means hanging down from the frame 6 . the light - receiving end face at the lower end of the optical fiber 9 is opposed to the pipet tip 3 at the obliquely upper position so as to take out the reflected light at the lower end face of the pipet tip 3 . the upper end of the optical fiber 9 is connected to a photodiode 10 installed on the frame 6 . the photodiode 10 generates an electromotive force in accordance with the intensity of the received light . a detection circuit 8 detects the signal derived from the electromotive force , outputs a signal to the driving control device 12 . in this example , a light - emitting element as the light source 5 is made to emit light in pulse which is synchronized with the detection timing of the above detection circuit 8 to cancel the influence of external disturbance such as room illumination and the like . a volume controller 14 , such as an air cylinder , is connected to the cavity in the pipet tip 3 through a tube 13 to generate a negative pressure for sucking liquid and a positive pressure for discharging the liquid . the stroke length of the piston in the air cylinder is adjustable . the operation of the above - mentioned quantitative liquid sampling instrument is described below . first , the instrument waits at the state shown in fig1 ( a ). in this state , pipet tip 3 is attached to the pipet tip fitting tube portion by a pipet tip attaching - detaching device not shown in the drawing . the instrument is waiting in this state at the upper waiting position ( see fig1 ( a )). thereto a predetermined sample container 1 is introduced and placed at the lower position for taking the liquid by means of a suitable conveyer or the like . subsequently , the frame 6 starts its downward movement with the aid of the vertical movement mechanism 11 , and the light - emitting source 5 starts pulse - lighting . a portion of the light emitted downward from the light - emitting source 5 is transmitted through the inside of the pipet tip 3 and is reflected by the lower end face . the reflected light is transmitted through the optical fiber 9 which is placed in an obliquely upper position in opposition to the lower end of the pipet tip 3 , and is received by the photodiode 10 , causing detection of constant intensity of light in the detection circuit 8 . as the pipet moves downward , the light reflected by the liquid surface comes to be introduced to the photodiode 10 , thus increasing gradually the received light intensity in the detection circuit 8 . when the lower end of the pipet tip 3 is brought into contact with the liquid sample as the result of further downward movement , the reflection condition abruptly changes because of the decrease of the refractive index difference at the interface caused by the change from the refractive index of air with which the lower end of the pipet tip was surrounded to the refractive index of the liquid sample brought into contact . therefore , the reflection at the lower end face of the pipet tip is practically canceled , resulting in the reflected light intensity of nearly zero at the photodiode 10 . therefore the contact of the pipet tip 3 with the liquid can be readily detected by the abrupt decrease of the reflected light intensity . the pipet device brought into contact with the liquid is further moved downward and stopped at a predetermined depth of the tip . at this position , the liquid is sucked by driving the air cylinder ( volume controller 14 ). the liquid suction is stopped by the stopping of the cylinder drive . with the above arrangement , the liquid sample can be sucked into the pipet accurately by the air cylinder stroke at the position where the downward movement of the pipet tip has been stopped . the predetermined distance of the downward movement of the pipet after the contact with the liquid is decided also in consideration of avoiding the contamination of the subsequent sample caused by contact of the optical fiber 9 of the light - receiving means with the liquid sample . this distance of the downward movement cannot be determined independently of the amount of the sample , the diameter of the container , the amount of the liquid to be taken out , and so forth . in immune reaction measurement apparatuses , for example , the distance is about several mm in many cases for the purpose of obtaining a high accuracy of detection . when a relatively large dipping distance from the contact point is required , such a constitution may be adopted in which the downward movement of the optical fiber 9 is stopped on contact with the liquid and the pipet tip 3 only is moved downward . fig2 illustrates the plots of the measurement results of the intensity of the reflected light detected by the detection circuit 8 as a function of time with a pipet instrument having a pipet tip moving downward as mentioned above . this drawing shows clearly that the intensity of the reflected light abruptly falls at the time of contact with the liquid surface . fig3 ( a ) to 3 ( d ) schematically illustrate the change of reflection at the lower end of the pipet tip 3 . fig3 ( a ) shows that a part of the light projected to the inside of the pipet tip is reflected at the lower end thereof and the rest of the light passes through the tip cavity . the intensity of the portion of the light reflected at the lower end face of the tip is detected by the detection circuit 8 . fig3 ( b ) schematically shows the reflection at the lower end of the pipet tip 3 which is holding a solution ( in such a case where a dilution liquid is sucked in prior to sucking a liquid sample ). the light having passed through the solution is reflected also at the end face of the solution , so that the intensity of the reflected light is larger than that shown in fig3 ( a ), especially when the light is less absorbed or less scattered by the solution . fig3 ( c ) schematically shows the intensity of the reflected light at the time when the pipet tip 3 shown in fig3 ( b ) is brought close to the liquid surface . the light reflected at the liquid surface gives influence in addition to the reflected light at the tip lower end and the face of the solution held in the tip , increasing further the intensity of the reflected light . fig3 ( d ) schematically shows the reflection of light at the time when the pipet tip 3 is brought into contact with a liquid sample . in this state , the reflected light has become remarkably decreased since the difference of refractive indexes between the pipet tip and the surrounding external medium becomes less by the contact with the liquid . the instrument of this example ( the situation is the same in other examples ) gives an advantageous effect in that the position of the lower end of the pipet tip in the liquid sample is precisely decided at the start of the liquid suction , and enables accurate quantitative sampling of a liquid . the instrument of this example gives an additional effect that the excess or insufficiency of the amount of the taken - out liquid can be confirmed by confirming the starting time and the finishing time of the liquid suction . this is explained by reference to fig4 . in fig4 the abscissa shows the lapse of time , and the ordinate shows the detected intensity of reflected light . both fig4 ( a ) and fig4 ( b ) illustrate real measurement results of certain samples . in fig4 ( a ), the reflected light intensity gradually increases as the pipet tip is moved down toward the liquid sample . at the time when the tip comes to touch the liquid sample ( at the time t 1 in the drawings ), the light to be reflected comes to penetrate into the liquid sample , resulting in rapid fall of the light detection intensity . then liquid suction is conducted at a predetermined negative pressure for a predetermined time t . after the lapse of the time t ( the time t 2 in the drawings ), the suction is stopped , and the pipet is moved up to become apart from the liquid sample , resulting in the abrupt rise of the intensity of the detected reflected light up to the intensity level before the time t 1 . in fig4 ( b ), a case is shown where the pipet tip comes to be separated from the liquid sample by some reason during the suction ( at the time t s ). this separation of the pipet tip from the liquid sample is readily confirmed by restoration of the intensity of the detected reflected light at the time t s . in this case , the amount of the sucked liquid becomes insufficient in correspondence with the shortage of time in comparison with the predetermined time t ( as shown by the shadowed portion in the drawing ). in such a manner , the time length of the contact with the liquid is controlled and confirmed by measuring the change pattern of detected reflected light in applying negative pressure to the inside of the pipet tip contacting with the liquid sample , whereby sufficiency or insufficiency of the sucked amount of the liquid sample to be measured is confirmed in comparison with the predetermined sucked amount . thus the instrument of the present invention gives excellent effect that an influence of a sampling error can be avoided practically which affects , for example , the result of diagnosis by an immune reaction measurement using liquid sample taken with this instrument , since the operation is conducted with confirmation of quantitative sampling of each liquid sample . fig5 illustrates the instrument of this example , which has a further characteristic with respect to the light - receiving means of the liquid level detecting device in comparison with example 1 . the instrument of example 2 is basically the same as that of example 1 in that the main body of the pipet instrument is made up of a frame 6 , and a pipet tip fitting tube portion 4 , and a disposable type of pipet tip 3 is fitted detachably to the pipet tip fitting tube portion 4 . however , the instrument of this example is different in that the pipet fitting tube portion 4 is fixed to the frame 6 through the light transmitting body 22 . the light transmitting body 22 in this example has a columnar portion 221 as the upper portion which is fixed to the frame 6 , and an annular portion 222 which extends downward from the lower end periphery of the columnar portion 221 . the pipet tip fitting tube portion 4 and a light - emitting element ( led ) constituting a light - projection means are fixed in the inside of the annular portion 222 . the lower end face of the annular potion 222 is opposed to the upper end face of the pipet tip 3 fitted to the pipet tip fitting tube portion 4 . a cover 223 is provided to cover the light transmitting body 22 . the pipet tip fitting tube 4 has a through - hole 41 . a photodiode 10 which is a light - receiving element of the light receiving means is fixed on the top of the frame 6 so as to confront the upper end face of the columnar portion 221 of the light - transmitting body 22 . it is preferable that the photodiode 10 contacts face - to - face with its surface . other constitutions are nearly the same as in example 1 , so that the designations of necessary portions only are shown here , other designations being omitted . in the pipet instrument having the arrangement described above , the light reflected by the lower end face of the pipet tip is transmitted through the inside of the pipet tip to the upper end thereof , introduced to the annular portion 222 of the light transmitting body 22 , and then transmitted through the columnar portion 221 of the light - transmitting body to the photodiode 10 . with such an arrangement , the light reflected by the entire bottom end face of the pipet tip is to be received by the photodiode 10 through the above - mentioned path , whereby the utilization rate of the reflected light is greatly increased in comparison with the case where only a portion of the light reflected at the annular portion is detected ( for example , the case where the photodiode is directly opposed to a limited portion of the annular upper end portion of the pipet tip ). accordingly , a more clear detection of the abrupt change of the intensity of the reflected light is made feasible , or intensity of the light of the light source may be decreased for obtaining the same level of detection accuracy , advantageously . the quantitative liquid sampling instrument of the present invention provides for the following advantages by solving various problems which are present in conventional instruments . the instrument enables the accurate detection of the liquid surface level of a sample or the like in a container , realizing high accuracy in quantitative liquid sampling , which makes it possible to provide a quantitative liquid sampling instrument of high accuracy suitable , for example , for an immune diagnosis apparatus . the instrument enables liquid level detection and liquid sucking simultaneously in one step with a micro quantity of sample as a measurement object , realizing rapid operation , which makes it feasible to constitute a quantitative liquid sampling instrument of automated or mechanized immune diagnosis apparatuses . the instrument can prevent contamination between samples by use of a disposable type of pipet tip . in the preferable constitution of the present invention , utilizing the tube shell of the pipet tip , the arrangement of the constituting members can be designed with high freedom , since a mechanical member for liquid level detection need not be placed around the pipet tip of the pipet instrument and interference of the pipet tip with other circumferential devices and members . in another preferable arrangement utilizing a light - transmitting body of the type of collecting light transmitted to the upper end face through the columnar portion , almost all of the reflected light is utilized for detection , giving high detection sensitivity and enabling a decrease of intensity of the light source . in an embodiment utilizing , for detection , light of a nonvisible wavelength region such as light of infrared light region , the detection is not affected by external disturbance like room illumination , realizing a high accuracy of detection . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .	8
in the following a particular example will be described in order to gain an understanding of relevant techniques of the present invention . such details that may be known by one skilled in the art have been omitted . apparently , there are many other embodiments of the invention that may depart from specific details in this particular description . one such example is the fabrication of a p - type device by reversing all dopings . in fig1 a high resistivity p - type silicon substrate 1 is illustrated that is prepared for a shallow trench isolation ( sti ) process and comprises etched trenches 2 . the trenches surround an area inside of which a mos transistor will be formed . outside the trenches , further etched areas have been produced , leaving a non - etched strip also extending around the area in which the transistor is to be formed . an sti liner oxide 3 has been grown over the surface of the substrate and a mask 4 of silicon nitride has been applied on top thereof to provide for the subsequent filling of the trenches 2 by silicon oxide as illustrated in fig2 . after the filling of this oxide has been carried out , producing inner and outer areas 5 ′ and 5 ″ of sti oxide , respectively , a chemical mechanical planarization ( cmp ) of the substrate surface is performed . following the cmp step , a thin oxide 6 is grown on the exposed silicon areas as illustrated in fig3 . also as shown in fig3 , another mask 7 is then applied having a window in the area in which the mos transistor is to be formed and phosphorus of relatively high energy , 900 kev , and a dose of 2 × 10 13 cm − 2 , is implanted as indicated by the arrows 9 . the implantation is made in the conventional way , in a small tilt angle such as 7 ° to the normal of the surface of the substrate 1 to avoid channeling . the implantation produces a deep n - well 11 in the window of the mask . the depth of the n - well peak profile is about 1 μm , which is determined by the implantation energy . the mask 7 is then removed . as seen in fig4 a mask 15 is then applied defining an opening inside that of the previous mask 7 for the deep n - well region 11 , the opening having e . g . edges located at the approximate center lines of the top surfaces of the inner sti oxide areas 5 ′. boron is then implanted as indicated by arrows 17 in a dose of 1 × 10 13 cm − 2 , an energy of 220 kev and a tilt angle of 7 °. the parameters of this implanting step are thus set to produce a high voltage p - well 19 located above the deep n - well 11 as seen in fig4 . in this way , the p - well 19 obtains a high electric isolation from electronic currents and voltages outside the doped areas . also , the extended drain described hereinafter will protect the gate and source of the transistor to be produced against high voltages of the p - well . the p - well can have its vertical sides located at the approximate center lines of the bottom surfaces of the inner sti areas 5 ′. the mask layer 15 is then removed . as a next step , a mask 21 is applied according to fig5 . this mask has openings only in those areas which are located right above the end portions of the deep n - well region 11 including those parts of the substrate surface which are located between the inner 5 ′ and the outer 5 ″ sti areas . phosphorus is implanted through the openings of the mask as indicated by arrows 23 . this implantation step is divided into three substeps having different characteristics . in the first substep , phosphorus having a dopant dose of 2 × 10 13 cm − 2 , an energy of 490 kev and a tilt angle of 0 ° is implanted , and it thus penetrates deep into the substrate . in the second substep , the phosphorus has a dose of 4 × 10 12 cm − 2 , an energy of 140 kev and a tilt of 7 ° and in the third substep 3 . 7 × 10 12 cm − 2 , 50 kev and 7 °, respectively . this implantation thus produces relatively highly n - doped areas 25 located in the surface regions of the p - substrate between the inner and outer sti areas 5 ′, 5 ″ and extending down to the deep n - well 11 and acting as contact plugs for the deep n - well . the result after removing the mask layer 21 is shown in fig6 . contact regions of type n + will be implanted at the top of these plug regions for connection of a bias voltage to the deep n - well 11 , as will be described below . this n - type doping step is identical to the n - well formation when combining the manufacture of the device into a standard cmos process flow . two alternatives in forming the gates and the associated channels are next to be described . the first alternative begins with the channel formation by applying a mask 27 according to fig7 . this mask exposes the strip - shaped regions extending between the inner sti oxide areas 5 ′ and the areas where the gates subsequently are to be located , the regions extending also some distance over the inner sti oxide areas . the implantation , illustrated by arrows 29 , is made in two substeps . in the first substep , only boron is used for implantation and in the second substep boron difluoride bf 2 is used . the characteristics of these implantations are , for only boron , a dopant dose of 6 × 10 12 cm − 2 , an energy of 60 kev and a tilt angle of 7 °, and , correspondingly , for boron difluoride , 5 × 10 12 cm − 2 , 50 kev and 7 °. the implantations create p - doped channel areas 31 , self - aligned with the inner edge of the inner sti field oxide areas 5 ′. the mask 27 is then removed . at this stage , all the needed well areas for the device have been formed , and the thin oxide 6 is stripped off all over the surface . this oxide layer has been renewed in the exposed areas before each of the implantation steps described above has been carried out . then , as shown in fig8 , a thin gate oxide 33 is grown over the whole surface of the substrate , and a highly doped polysilicon layer for the gates is deposited on top thereof . a mask , not shown , is used to define the gates 35 . in the sectional view of fig8 two symmetrically located gate areas are seen , either being parts of two individual mos transistors or being joined to form a single , connected area and then belonging to the same mos transistor . these gates are produced by etching through the openings of the mask and the mask is then removed . the thin gate oxide layer located outside the gate is kept in order to protect against breakdown between gate and source / drain . in the second alternative , as shown in fig9 , the channel implant is performed subsequently to the gate formation . the latter step is the same as described above , illustrated in fig8 , but now excluding the p - channel regions . for the subsequent channel formation a mask 37 which extends up to the center line of the gates 35 is used to protect the drain area . an angled implant 36 of boron is used to place the junction edge under the gate 35 . an advantage of this method is the improved control of the channel length determined by the implant energy and angle . the tilt angle can here be chosen to be substantially 48 ° in four independent directions relative to the normal of the substrate surface , i . e . the tilt angle is achieved in a so called quad arrangement . the implantation is otherwise performed in two substeps , the first substep involving a dose of 6 × 10 12 cm − 2 and an energy of 60 kev and the second substep a dose of 4 × 10 12 cm − 2 and an energy of 10 kev . having performed either of these two alternatives of channel formation , a new mask 39 is thereupon applied having a window placed substantially centrally above the p - well 19 , its edges being located on top of the gate areas 35 , as shown in fig1 . next , phosphorus is implanted in the window as indicated by the arrows 41 , the implanting being made with a dopant dose of 6 × 10 12 cm − 2 , a particle energy of 50 kev and a tilt angle of 10 ° in a quad configuration as defined above . the result of the implantation is an extended drain region 45 , which is a weakly doped n - region located at the surface , centrally in the p - well , and extending from one side of , in the example shown between , and partly below the gate areas 35 , this doped region having a relatively small depth . after removing the mask 39 , as shown in fig1 , a new mask 47 is applied to prepare for an n - doped lightly doped drain and a pocket implant of weakly doped n - regions , the opening of the mask defining where the source , drain and sinker connections are to be located . thus , phosphorus is first implanted in a dose of 5 × 10 12 cm − 2 , an energy of 30 kev and a tilt angle of 10 ° in a quad configuration , and then arsenic of dose 2 × 10 14 cm − 2 , energy 20 kev and a tilt angle of 7 °, also in a quad configuration , the implanting being indicated by arrows 49 . the resulting n - regions 51 , 53 and 55 for source , drain and sinker , respectively , are also seen in fig1 . the mask 47 is then removed . in connection with the implanting of the source , drain and sinker regions , thin oxide is always deposited in the exposed regions . also silicon nitride is now to be deposited , all steps not shown . most of the nitride is then removed by anisotropic etching , only leaving spacers 56 on the sidewalls of the gate areas . another selective step using a mask 57 is then performed as shown in fig1 , followed by a p + - type implantation of boron in the openings of the mask , indicated by the arrows 59 . the characteristic data of the implantation are a dopant dose of 2 × 10 15 cm − 2 , an energy of 5 kev and a quad tilt angle of 7 °. as a result , contacts to the channel areas 61 are obtained . this implant is identical to the p + source / drain implant in a standard cmos process flow . the mask 57 is then removed . after that , a mask 63 for the combined n + implant and diffusion is applied . arsenic is now implanted as indicated by arrows 65 in fig1 , producing the final shapes of the source 51 , drain 53 and sinker 55 regions . the corresponding implant characteristics in this case are 4 × 10 15 cm − 2 , 60 kev and 7 ° quad . the final structure after having removed the mask 63 is shown in fig1 . it is advantageous to create a layer of silicide , a metal - silicon compound , on top of the implanted gate , source , drain and sinker regions . by e . g . using a salicide ( self - aligned silicide ) process the silicide becomes self aligned with the earlier formed spacers and the series resistance to the regions covered is also reduced . after that , contacts are applied to the gate , source , drain and sinker areas . as mentioned above , the relatively highly n - doped areas 25 in the surface regions of the p - substrate act as contact regions for the deep n - well . thus , by providing a positive voltage + v cc to the sinker contacts on top of the n - region 25 , the parasitic pnp - transistor defined by the p - well 19 , the deep n - well 11 and the p - substrate 1 becomes reverse biased , which improves the isolation characteristics of the mos structure .	7
in a preferred embodiment of the invention , a scanning probe microscope ( spm ) is used to obtain information about a sample through harmonic resonance imaging ( hri ). the spm may comprise any instrument that utilizes a tip - bearing probe to obtain information concerning a sample and that is capable of oscillating the tip . it may , for instance , comprise a scanning tunneling microscope ( stm ), a scanning magnetic force microscope ( mfm ), a scanning capacitance microscope ( scm ), a scanning near - field optical microscope ( nsom ), a scanning thermal microscope ( sthm ), or an atomic force microscope ( afm ). an embodiment of the invention in the form of an afm will now be disclosed , it being understood that the invention applies to all other spms as well . referring now to fig1 , a schematic diagram of a nanoscale sub - surface metrology ( nsm ) instrument 100 is shown , according to an exemplary embodiment . a scanning probe microscope , such as an atomic force microscope ( afm ) operates by providing relative scanning movement between a measuring probe device 112 and a sample 122 while measuring one or more properties of the sample . a typical afm system is shown schematically in fig1 . an afm 110 employing a probe device 112 including a probe 114 and having a cantilever 115 is coupled to an oscillating actuator or drive 116 that is used to drive probe 114 , in this case , at or near a resonant frequency of the probe ( e . g ., at resonance or a harmonic frequency thereof ). commonly , an electronic signal is applied from an ac signal source 118 under control of an afm controller 121 ( including , e . g ., a comparator / pi gain stage 123 ), to cause actuator 116 to drive the probe 114 to oscillate , preferably at free oscillation amplitude a o , described in further detail below with reference to fig2 . probe 114 is typically actuated toward and away from sample 122 using a suitable actuator 124 or scanner controlled via feedback by controller 121 . notably , the actuator 124 may be coupled to the scanner ( e . g ., translation stage ) 129 and probe 114 but may be , and often preferably is , formed integrally with the cantilever 115 of probe device 112 as part of a self - actuated cantilever / probe . moreover , though the actuator 124 is shown coupled to the probe 114 , the actuator 124 may alternatively be employed to move sample 122 in three orthogonal directions as an xyz actuator , i . e ., both z motion , and x - y scanning motion such as a raster scanning . for use and operation , one or more probes 114 may be loaded into the afm 110 and the afm may be equipped to select one of several loaded probes . selection among the differing probes may be implemented based on the required spring constant and resonance frequency range . typically , the selected probe 114 is oscillated and brought to interact with sample 122 and sample characteristics are monitored by detecting changes in one or more characteristics of the oscillation of probe 114 , as described above . in this regard , a deflection detection apparatus may be employed to direct a beam 117 towards the backside of probe 114 , the beam then being reflected towards a detector 126 , such as a four quadrant photodetector . as the beam translates across detector 126 , appropriate signals are transmitted to controller 121 , which processes the signals to determine changes in the oscillation of probe 114 . commonly , controller 121 generates control signals to maintain a constant force between the tip and sample , typically to maintain a setpoint characteristic of the oscillation of probe 114 . for example , controller 121 may be used to maintain the oscillation amplitude at a setpoint value , a s , to insure a generally constant average interaction between the tip and sample . alternatively , a setpoint phase or frequency may be used . notably , this control of tip - sample separation using a feedback loop preferably operates to maintain a nonlinear probe response to tip - sample interaction . referring now to fig6 , a graph 600 illustrates the probe response to tip / sample interaction is shown , according to an exemplary embodiment . the tip approaches the sample from the left and enters a proximity contact zone 604 where interaction is initiated ( before snap to contact ). in this case , the force is controlled by the afm using a feedback loop with an appropriate set point to maintain operation in the nonlinear portion of cantilever response at approximately point 602 . the boundary zone , near the x axis , corresponds to the response exhibiting the highest nonlinearity . preferably , the system optimizes response by tuning the nonlinear probe response to generate the beat signal required to use ghz frequencies in the preferred embodiments , described further herein . an exemplary desired response corresponds to a particular tip - sample separation that can be maintained by a constant average vertical deflection through the feedback loop . in an alternative operation , such separation can also be maintained by keeping a constant torsional resonance signal , which is a readily available signal at the detector 126 . referring again to fig1 , a sample 122 may be an entire 300 mm silicon wafer , according to an exemplary embodiment . sample 122 may be held on a sample holder 128 having an internal cavity 130 and an air bearing surface 131 , further discussed below with reference to fig3 . air bearing surface 131 may be provided to facilitate easy transportation between a translation stage 129 and a base 135 ( e . g ., afm superstructure ). an ultrasonic transducer 132 may be mounted inside this cavity 130 . the transducer 132 may be configured to generate an ultrasonic wave in response to being driven by a source 120 . notably , the ultrasonic transducer 132 may provide continuous wave laser acoustic excitation . the ultrasonic wave is then coupled into the backside of sample 122 , preferably via a liquid interface such as a drop of ultra pure water 134 between the transducer 132 and the backside of the sample 122 . this permits efficient ultrasonic coupling and minimal backside contamination of the sample 122 . although a pure water coupling is described , it should be understood that the above system and method may provide alternative liquid couplings between the sample 122 and the ultrasonic source 132 . in this way , the ultrasonic source may be releasably coupled to the sample 122 , contrary to known systems and methods that fixedly couple the source to the sample via , for example , a permanent or semi - permanent adhesive . the ultrasonic waves may further be focused or otherwise projected onto an area of interest of sample 122 . the area of focus may further be correlated to the location of probe 114 . the ultrasonic wave may be focused with an acoustic lens , such as a refractive element or a fresnel lens . alternatively , the ultrasonic transducer 132 may generate a plane wave that uniformly illuminates a larger area of the sample 122 . a focused actuator has the advantage of more efficiently concentrating a given input energy into a smaller area . additionally , the converging and then diverging beam reduces the energy density of background reflections . a plane wave source may have the advantage of a simpler process to invert the amplitude and phase information to obtain structure and composition information . one advantage of the system of the present application is that the ultrasonic source ( s ) can be rapidly and non - destructively coupled to successive locations on a sample . by non - destructively , we mean that a sample can be imaged by this technique and still be used for its intended purpose without scrapping the part . ( many prior art techniques have required destructive sample processing and / or bonding an ultrasonic actuator with a contaminating adhesive or other material .) as a result of the current approach , the backside contamination of the sample 122 is minimized , especially in the case that the sample 122 is a semiconductor wafer or computer hard disk head wafer . in one embodiment , the reduction in backside contamination is achieved using ultra - pure water 134 to couple the acoustic energy into the sample 122 . to facilitate the coupling , plumbing and controls may be provided to the ultrasonic actuator 132 to generate and maintain drop of water 134 between the probe 114 and sample 122 . such techniques are employed , for example , in immersion lithography employed by the semiconductor industry . a water level sensor may be employed to trigger refilling of the drop 134 to compensate for evaporation . alternatively , the humidity of the cavity 130 may be elevated to reduce evaporation to acceptable levels . according to an alternative embodiment , cavity 130 may be filled with liquid . this arrangement further provides the benefit of effectively stiffening the sample 122 and damping any unwanted vibrations of the sample 122 . according to yet another alternative embodiment , an ultrasonic actuator 132 may be used that directly contacts the back side of the sample 122 . direct contact has the same result of effectively stiffening the area of the sample 122 being measured by the afm 110 . however , such direct contact requires a lower positioning tolerance to ensure both good mechanical coupling and low particle contamination . in one embodiment , the top surface of the ultrasonic actuator 132 may be covered with a high molecular weight polymer , for example , polyimides materials like kapton ® or vespel ®. high molecular weight polymers are both somewhat compliant and also good choices for limiting particle shedding and wafer contamination . in the case of a mechanical contact , an additional positioner , not shown , may be used to make and break contact between the bottom of the sample 122 and the ultrasonic actuator 132 . this ability to quickly reposition the ultrasonic source at different sample sections or points , using any of the above described couplings and positioning methods for the interaction between the sample , the probe device 112 , and the transducer 132 provides advantages over previous systems . further , movement of the ultrasonic source allows excitation of particular sections of the sample 122 that are currently being measured without concern regarding a distance between the section and the ultrasonic source . accordingly , a section of the sample may be an area affected by the ultrasonic source wherein the ultrasonic energy applied to the sample 122 is relatively constant . the present system and method may be used to scan large , arbitrarily sized samples without requiring that the sample be permanently fixed in the sample holder to provide adequate ultrasonic coupling . the arrangement shown and described herein with reference to fig1 has the advantage of enabling excellent coupling from the bottom surface of the sample , while allowing high - q resonant operation of the cantilever 115 in air above the sample 122 . alternatively , the excitation of the surface of sample 122 may be made from above using a variety of schemes . for example it is possible to build a fluid or mechanically coupled actuator surrounding the afm cantilever 115 and probe 114 . alternatively , laser pulses can be used to generate thermoacoustic waves that can be imaged in the near field by the afm probe 114 . it is also possible to use air - coupled actuators and / or electromagnetic acoustic transducers ( emats ) above or below the sample . referring now to fig2 , a schematic illustration of the interaction of an ultrasonic wave produced by a transducer of the invention and sub - surface sample features is shown , according to an exemplary embodiment . sub - surface features 210 inside the sample 122 interact with the ultrasonic waves according to the acoustic impedance of the different features 210 . these interactions produce signal attenuation and / or phase delays in the propagation of ultrasonic wavefronts 214 . these wavefront distortions may then detected in the near field using the probe 114 of an afm cantilever 115 . the afm probe 114 monitors the ultrasonic energy 214 that propagates to the surface of sample 122 . notably , interaction between ultrasonic energy ( e . g ., incident ultrasonic wave ) and sub - surface features can result in attenuation , reflection , retardation , refraction and / or diffraction of the ultrasonic energy . if the sample 122 is being observed in ambient environment , the air - sample interface at the sample &# 39 ; s top surface may reflect the vast majority of the incident ultrasonic energy . in some cases , a surface acoustic wave 212 may be generated at the surface of sample 122 that can be directly detected by the afm . in addition , a small decaying field 216 , called the “ evanescent field ” extends above the sample surface . when the afm tip of probe 114 is placed in this evanescent field 216 , the ultrasonic energy 214 can couple to the tip of probe 114 generating measurable motion of the cantilever 115 . the presence of a fluid meniscus layer that forms between the tip and sample surface likely enhances the degree of this coupling . measuring the evanescent field with the afm tip of probe 114 overcomes far field diffraction resolution limit and allows mapping of ultrasonic wavefronts with nm - scale resolution . the ultrasonic excitation frequency f 1 of source 120 used to drive transducer 132 may be in the range of 2 - 200 mhz , and more preferably larger , depending on penetration depth and resolution required . since the frequency f 1 is often above the typical detection bandwidth of conventional afms , a “ down conversion ” scheme may be employed to enable detection of the ultrasonic wavefront . down conversion is implemented by converting a signal at a high frequency to a lower frequency that is more easily measured by the system 100 . down conversion is achieved in system 100 by applying an additional ultrasonic oscillating signal at frequency f 2 to , for example , the base of the afm cantilever 115 , or more preferably nearer the tip when using a self - actuated probe . in the case that there is a nonlinear interaction between the afm tip of probe 114 and the sample 122 , this interaction generates a force on the tip of probe 114 that is proportional to the difference between f 1 and f 2 . specifically , there is a time varying force component on the tip of probe 114 equal to f t : f t = γa c a s cos ( 2π ( f 1 − f 2 ) t + φ ); where γ is the strength of the nonlinear interaction , a s is the amplitude of the sample surface motion at frequency f 1 , a c is the amplitude of the cantilever motion at f 2 , and φ is the accumulated phase delay during the propagation of the wavefront . super - wavelength resolution is achieved using one or more of the following techniques . it has been shown that the ability to achieve resolution in excess of the diffraction limit by employing high energy ultrasonic excitation that elicits nonlinear material responses . the nonlinear response creates a harmonic distortion to elastic waves propagating through the material . this harmonic distortion is equivalent to the generation and propagation of higher harmonics of the original excitation . since the higher harmonics have shorter wavelengths the diffraction limited resolution can be higher than the fundamental excitation . more specifically , if a high intensity ultrasonic wave is launched into the sample at frequency f 1 , the harmonic distortion will create harmonics at frequencies nf 2 , when n is an integer multiple . with the afm cantilever detection , it is possible to arrange for amplified detection of a selected harmonic by arranging nf 2 − f 1 ≈ f 0 , where f 0 is the cantilever resonant frequency . for example , if f 2 is 200 mhz , and f 1 is 1001 mhz , the 5 th harmonic of f 2 will generate a beat frequency of nf 2 − f 1 = 1 mhz . if the afm cantilever is arranged to have a resonant frequency of 1 mhz and a q of 1000 , for example , this will enhance the detection sensitivity of the ultrasound harmonic by 1000 ×, while simultaneously increasing the 3d spatial resolution of the excitation wave . when this is combined with near field detection by the nm scale afm tip interaction it provides unprecedented 3d sub - surface resolution . notably , though the beat signal is preferably tuned to a resonance of the probe ( fundamental or harmonic ), the frequency can be anywhere in the detectable region of the resonance , i . e ., it need not be at the peak . referring again to fig1 , a lock - in amplifier 125 may be used to extract the amplitude and phase of these time varying forces . the lock - in amplifier 125 can be implemented in analog electronics , through digital computation , or a combination of both . a frequency mixer 127 generates a signal at the frequency f 1 - f 2 that is then sent to the lock - in amplifier 125 as a reference signal . the lateral extent of the nonlinear interaction γ may be confined to a very small area roughly corresponding to the contact or near - contact radius of interaction between the tip of probe 114 and sample 122 . according to one exemplary embodiment , a 1 ghz wave may be launched from the sample 122 with a displacement field of 0 . 01 nm under the probe 114 . another wave may be excited by the ghz actuator on the afm probe 114 apex with the frequency of 1 . 001 ghz . this second wave may be referred to as an ultrasonic drive wave and be configured to create a beat signal having a beat frequency . the difference of these two frequencies may be chosen to be the contact resonance frequency of 1 mhz with a cantilever spring constant of 40 n / m and tip radius 10 nm . for this reason , ultrasonic forces that act on the apex of the tip 114 contribute substantially to the measured signals and may be quantified . the tip 114 may be scanned relative to the sample 122 and the amplitude and phase information may be recorded as a function of lateral position . this scanning mechanism is not shown in fig1 for clarity , but may be implemented using one or more piezoelectric scanning devices that scans the sample 122 , the tip 114 , or a combination thereof . the scanner may also employ an alternative fine translation mechanism , such as magnetostrictive , electrostrictive , capacitive , inductive , thermal , or other motion inducing mechanisms . referring now to fig3 , a side elevation 300 of a sample holder 128 , illustrating the sequential observation of widely separated areas on a large sample 122 , is shown , according to an exemplary embodiment . the side elevation 300 shows the process of observing widely separated areas on a large sample 122 . as mentioned above with reference to fig1 , the sample holder 128 contains an internal cavity 130 to allow the placement of the ultrasonic actuator 132 under the sample 122 . the sample holder 128 may be translated laterally so that the afm probe 114 and the acoustic actuator 132 are aimed at different areas of the sample 122 . two such example positions are shown in fig3 below , but this technique allows an arbitrary array of sample areas to be observed . in fact , the ultrasonic actuator 132 below the sample and the optical detection laser 117 and detector 126 can be used to quickly scan large areas of the sample 122 using traditional acoustic microscopy techniques . this scanning method can provide coarse preview scans to allow the afm 110 to focus on areas of particular interest , for example a suspect region identified in the acoustic survey scan . according to an exemplary embodiment , the sample holder 128 may be translated using a translation stage 129 . one suitable translation stage is a high speed air bearing stage . other examples include crossed roller - bearing stages , ball bearing stages , drag stages , flexure stages or other mechanical translation devices with a range of motion matching the area of the samples desired to be accessible . alternately , the translation stage could be a gimbaled or tilt stage that changes the angle of the ultrasonic source and the direction of its output . these stages can be driven with stepper motors , servo motors , linear motors , piezoelectric devices or other devices capable of moving the stage over the desired range . for simplicity in the drawings , the bottom of the sample holder 128 is shown as the air bearing surface 131 . while this is a feasible implementation , in practice the sample holder 128 and the translation stage may be separate units . the translation stage typically allows translation in at least two lateral axes ( e . g ., xy plane ) and can include an additional vertical translation stage to adjust the height of the sample 122 . the amplitude and phase data as a function of lateral position over the sample may then used to reconstruct sub - surface structure for sample 122 . this inversion process calculates the most likely structure and composition that would match the measured distribution of amplitude and phase . when possible , information about the sample &# 39 ; s expected composition and structure may be used to make the inversion of amplitude and phase data faster and more accurate . the resulting data may be stored and displayed , for example showing the structural and or compositional details in each vertical layer of the sample 122 . additional information about the composition and structure of sample 122 may be obtained by measuring the dispersion of amplitude and phase delays as a function of different frequencies f 1 and f 2 . these multi - spectral measurements can be made by sweeping or chirping the excitation frequencies over a desired range . in cases of ambiguity about the depth of a sub - surface feature 210 , one of several techniques can be employed , particularly when the ultrasonic source 132 is coupled to the sample from the top surface , the same side of the secondary ultrasonic source coupled through the tip . first , the use of a focused ultrasonic actuator can limit the depth of focus and hence the region of a sample that is excited . second , pulse - echo / time of flight measurements from the ultrasonic transducer can be used to locate the vertical position of interface layers . existing acoustic microscopy techniques , for example , allow the localization of buried interface layers with nm or sub - nm scale precision . for this purpose , a pulse generator may be connected to the ultrasonic actuator and the resulting echo detected by an echo receiver 133 . the time delay between the pulse and echo indicate the distance traveled by the ultrasonic wave , thus localizing the vertical position of a sub - surface interface . additionally , it is possible to use the cantilever tip to detect the transmission time of the pulses through the body of the sample . such time of the flight exhibits itself as the phase delay in the beat signal , yielding the depth information through the phase changes . for additional assistance in reconstructing the sub - surface structure accurately , it is possible to use tomographic techniques , for example by adjusting the angle of the incident ultrasonic wave . this can be done by rotating the ultrasonic source , or for example , by using a phased array of actuators to guide the direction of the outgoing ultrasonic wave . by assembling multiple 2d projections of amplitude and phase at multiple incidence angles it is possible to accurately reconstruct the details of sub - surface structure . referring now to fig4 , a system 400 for achieving the nonlinear tip - sample mixing by creating a local ghz level excitation right above the afm probe 114 is shown , according to an exemplary embodiment . afm probes 114 with integrated zinc oxide tips ( zno ) may be couple to a high frequency ultrasonic source . drive voltages will be delivered to a ghz tip actuator 410 by way of a coplanar waveguide 420 . coplanar waveguide 320 may be configured to include a base 424 having an electrode 422 . a zinc oxide thickness of about 2 . 9 μm may be provided to achieve a 1 ghz frequency . the shape of the actuator 420 plate pattern determines the occurrence of the power maximum at the tip apex . modeling of the acoustic emission and the process design of the tip geometry will help to optimize the ultrasonic output power at the apex . the mixing of the two waves z tip and z s , as shown in fig4 , will result in a beat force f t at the cantilever resonance frequency . the magnitude of the beat force is a function of the tip - sample interaction controlled by the afm . referring now to fig5 , a graph 500 displaying the variation of the beat force as the tip interacts with the sample from non - contact ( positive separation ) to repulsive contact ( negative separation ) is shown , according to an exemplary embodiment . as shown in graph 500 , only very modest intensity of the tip wave z tip is required . the response curve 500 illustrates that a maximum beat force was determined near the zero separation . this maximum corresponds to a desired operating condition for the beat signal detection . afm can maintain such separation either by maintaining a constant vertical deflection ( contact mode ) or constant torsional resonance amplitude ( trmode ™) with a feedback loop . notably , including the ultrasonic drive at or near the base of the probe or cantilever has the disadvantage of not efficiently coupling the ultrasonic energy to the probe tip given that the lever is soft , i . e ., it operates as a low pass filter in this regard . driving the probe with this second source 410 of ultrasonic energy using a self - actuated probe including an integrated piezoelectric element ( e . g ., zno ), on the other hand , operates to more efficiently couple the ultrasonic energy to the tip . this facilitates generation of the beat signal . advantageously , the above described system and method provides for numerous advantages over existing systems . using a laser acoustic source collocated with afm tip 114 , the system allows for arbitrary positioning of ultrasonic excitation . further , using a high harmonic ultrasound source 132 and near field afm detection , the above described system and method allows for higher subsurface lateral resolution which is at least 2 times better than the diffraction limit . although the best mode contemplated by the inventors of carrying out the present invention is disclosed above , practice of the present invention is not limited thereto . it will be manifest that various additions , modifications and rearrangements of the features of the present invention may be made without deviating from the spirit and scope of the underlying inventive concept . the scope of still other changes to the described embodiments that fall within the present invention but that are not specifically discussed above will become apparent from the appended claims and other attachments .	6
the apparatus of this invention chops continuous fibers into discrete fiber lengths . the chopper comprises at least one fixed head having a first side , a second side and at least one aperture therethrough . a means feeds at least one continuous fiber through an aperture from the first side of the fixed head . an end mill on the second side of the fixed head engages the continuous fiber and chops them into discrete lengths . preferably , the fixed head has a plurality of apertures therethrough and a plurality of means feed continuous fibers through the apertures . preferably , the chopper also has a plurality of end mills for engaging the continuous fibers . preferably , the fixed head has a circular shape and the end mill rotates in a circular path . preferably , the apertures in the fixed head are a slot or circular hole . the means for feeding the continuous fiber generally is a pair of nip rollers . in general , the means for feeding the continuous fiber aligns the fiber transverse to the end mill . a hollow tube between the nip rollers and fixed head may be used to feed and align the continuous fibers . [ 0016 ] fig1 shows chopper 10 having nip rollers 12 feeding continuous fibers 14 through apertures 16 of fixed head 18 . end mill 20 engages fibers 14 and chop them into discrete fiber lengths . tube 22 aids in feeding fibers 14 to apertures 16 . preferably , tube 22 extends into aperture 16 . end mill 20 has movement in a horizontal or perpendicular direction with respect to fibers 14 as indicated by the arrows . this movement increases the cutting edge of mill 20 . tube 22 is an adjustable tube and moves in a vertical direction as indicated by the arrows . adjustable tube 22 aids in the chopping process of fibers 14 . tube 22 oscillates up and down and coordinates with the revolution of end mill 20 . end mill 20 also revolves to prevent the cutting edge from heating up . revolutions typically are about 60 rpm &# 39 ; s . the tube &# 39 ; s inside diameter usually rasnges from { fraction ( 1 / 1000 )} to a few 10000 &# 39 ; s of an inch . [ 0018 ] fig2 and 3 show a conventional end mill tool with flat cutting edges . end mill 30 is made of cylindrical rod stock which has been ground to form distinctive portions . at one end of tool 30 is shank portion 32 , suitable for chucking to the spindle of a milling machine ( not shown ) for rotating and advancing tool 30 . at the other end of tool 30 is cutting end 34 which is provided with flat cutting edges 36 and 38 . between shank portion 32 and cutting end 34 is body portion 40 which is helically ground to have a number of flutes 42 and 44 . a “ boundary ” between body portion 40 and shank portion 32 is designated 46 in the drawing . any of the end mills used in this invention may be made of polycrystalline diamond ( cbn ) or polycrystalline cubic boron nitride ( pcbn ) and may be manufactured using conventional methods . [ 0020 ] fig4 shows ball nose end mill 50 using these materials . mill 50 comprises end mill body 52 having four helical flutes 54 circumferentially and equidistantly spaced around body 52 . body 52 of ball nose end mill 50 may be fabricated from a hard and tough material such as cemented tungsten carbide . the term “ diamond ” is used herein interchangeably to denote polycrystalline diamond , polycrystalline cubic boron nitride , or both . groove 56 is formed in leading edge 58 adjacent flutes 54 . a sintered polycrystalline diamond or pcbn 60 is formed in situ in the helically formed groove 58 . cutting edges 62 are ground into the sintered diamond material 60 in grooves 58 in end mill body 52 . tungsten carbide end mill body 52 may then be metallurgically bonded to a steel or carbide shank 64 along juncture 66 . the metallurgical bond may , for example , be a braze . [ 0021 ] fig5 shows end 68 of ball nose end mill 50 and further illustrates grooves 58 adjacent leading edge 58 of flutes 54 . polycrystalline diamond or polycrystalline cubic boron nitride 60 is compacted and sintered within the grooves 58 . flutes 54 and cutting edge 62 are ground into the pcd or pcbn material after the sintering process is complete . the pcd or pcbn cutting edge can be formed by methods which include grinding , wire electrical discharge cutting ( wire edm ), and electrical discharge grinding ( edg ). [ 0022 ] fig6 and 7 show end mill 80 having multiple cutting edges . fig6 and 7 show end mill 80 including shank portion 82 , point 84 and body portion 86 . end mill 80 has two flutes 88 and 90 extending from point 84 towards shank portion 82 . first flute 88 and second flute 90 are formed at a helix angle extending the length of body 86 of end mill 80 . at point 84 , flutes 88 and 90 terminate and define a pair of flat cutting edges 92 and 94 , commonly referred to as end teeth cutting edges . end mill 80 has two additional end teeth cutting edges 96 and 98 which extend from two ears 100 and 102 at an angle 90 e from the body 86 . cutting edges 96 and 98 are formed without a first or second flute as provided with cutting edges 92 and 94 . it will be appreciated by those skilled in the art that the specific number of additional cutting edges 96 and 98 are largely a matter of design choice and subject to variation . additional cutting edges originate from grinding off two flutes ( not shown ) of a four flute tool and leaving the end teeth or cutting edges . cutting edges 96 , 98 extend to outside diameter 104 of shank 82 and body 86 . when the flutes ( not shown ) are ground down , a length of outer diameter 104 preferably is left extending downward from the cutting edge 96 , 98 to form ear 106 and 108 . this unique chopper was designed for processing reinforcements having a specific coating thereon . preferably , the mixture is an epoxy / polystyrene mixture developed for coating glass fiber reinforcements for thermoset resins such as polyesters . first , the glass is coated and dried . after drying , the roving then is wrapped around chilled mandrels and chopped into an appropriate length . these after coated reinforcements are described in u . s . patent application ser . no . 09 / 829 , 095 , filed apr . 9 , 2001 and herein incorporated by reference . in addition to these embodiments , persons skilled in the art can see that numerous modifications and changes may be made to the above invention without departing from the intended spirit and scope thereof .	1
fig1 illustrates an embodiment of an oximetry system incorporating the present invention . a sensor 10 includes red and infrared leds and a photodetector . these are connected by a cable 12 to a board 14 . led drive current is provided by an led drive interface 16 . the received photocurrent from the sensor is provided to an i - v interface 18 . the ir and red voltages are then provided to a sigma - delta interface 20 incorporating the present invention . the output of sigma - delta interface 20 is provided to a microcontroller 22 . microcontroller 22 includes flash memory for a program , and sram memory for data . the processor also includes a microprocessor chip 24 connected to a flash memory 26 . finally , a clock 28 is used and an interface 30 to a digital calibration in the sensor 10 is provided . a separate host 32 receives the processed information , as well as receiving an analog signal on a line 34 for providing an analog display . fig2 is a block diagram illustrating the location of the filter according to an embodiment of the invention . shown is a sensor 10 that is driven by an led drive circuit 16 . the led drive circuit 16 alternately drives an ir led 40 and a red led 42 . a photodetector 44 provides a signal to a current - to - voltage ( i - v converter 46 ). the voltage signal is provided to high pass and anti - aliasing filter 48 . this block includes the band pass filter according to an embodiment of the invention . the output signal is then provided to a sigma - delta modulator 50 . the output of sigma - delta modulator 50 is provided to a demodulator 52 , which is then provided to filtering and decimating blocks 54 and 56 . fig3 illustrates a band pass filter 60 according to an embodiment of the invention . the filter includes an amplifier 62 and a resistor and capacitor circuit comprising capacitors c 2 , c 110 , c 111 , and c 40 and resistors r 7 , r 111 , r 112 , r 110 , and r 109 . an input to this circuit is provided from i - v converter 46 along a line 64 to a first switch 66 for an offset correction not relevant to the present invention . the signal is then provided to a second switch 68 , which is used for a calibration mode according to the present invention . a cross - talk control signal 70 couples the switch to an led current sense line 72 for calibration mode . in the design and manufacture of the band pass filter of fig3 , the corner frequencies are adjusted by varying the capacitor and resistor values to offset and minimize the cross - talk effect . the corner frequencies are the high pass and low pass ends of the band pass filter , which is in place to filter out ambient interferences . there is a major trade off involved in the design of the band pass filter . it is desirable to have the filter corners as close to the modulation frequency as possible . raising the frequency of the high pass corner makes the filter better able to reject any ac portion of ambient light . typically in the us , fluorescent lights have strong ac component at 120 hz and the harmonics of 120 hz . it is desirable to filter this out of the signal . lowering the cut off frequency of the low pass filter limits the high frequency noise from the i - v converter , and provides some anti - aliasing to keep ambient noise out of the system . however , any filtering spreads out the signal in the time domain , for example some of the ir pulse will leak into the dark pulse following it . this has two drawbacks . the first is cross - talk where the ir signal “ leaks ” into the red signal , and vice versa . the second is an offset resulting from a transient that occurs due to capacitances in the patient cable between the led wires and the detector wires . when this transient is filtered , part of it leaks into the sampled part of the signal causing an offset . both of these effects get worse as the corners of the filters are pulled closer to the modulation frequency . tuning the band pass filter to optimize for cross - talk is done when it is designed by adjusting the high pass filter corner and the low pass corner to force the cross - talk to be zero . the size of the red pulse is measured by comparing the sample p 5 ( see fig4 ) to the samples taken in the dark states p 4 and p 6 . since the signal from the ir pulse is still decaying in the dark 2 time period , the p 4 sample will be higher due to the low pass response and the lower due to the high pass response . the effect of the ir pulse on p 4 will affect the size of the measured red signal . this is a cause of cross - talk where the ir signal leaks into the red signal and vice versa . this effect is minimized if the filter is a band pass , with both high pass and low pass effects . the effect of the high pass filtering compensates for the effect of the low pass filtering . thus , the corners are adjusted so that the high pass and low pass signals shown in fig5 are adjusted so that the effect of the high pass filtering compensates for the effect of the low pass filtering to minimize cross - talk . the low pass filter causes a positive cross - talk , and the high pass filter causes an offsetting negative cross - talk . in one embodiment , the band pass filter consists of an rc high pass followed by a salen - key low pass configured as a second order butterworth filter . the impedance of the rc high pass section will have an effect on the transfer function of the salen - key circuit , however this effect is negligible if capacitance c 2 is much larger than c 110 and c 111 . the high pass filter cut off frequency is 32 hz ., and the low pass filter cut off frequency is 12 . 7 khz . in addition to designing the hardware of the band pass filter to reduce cross - talk , a calibration mode allows a further correction for cross - talk using a cross - talk calibration test . a subtle cross - talk effect arises from the filtering in the circuit causing light and dark pulses to spread out into each other in the time domain . fortunately the effects from the band pass filter are linear and measurable , and so can be compensated for in software . since this is the result of the filtering , the magnitude of the effect is known ahead of time . a constant is used to subtract the effects of the ir signal from the red signal and vice versa : fig5 is a circuit diagram of an embodiment of led drive circuit 16 of fig2 . included in the circuit are a connection to the red led on a line 80 , and a connection to the ir led on a line 82 . these are provided through mosfet transistors 84 and 86 to a 1 ohm resistor 88 . in the calibration mode , the led current sense signal on line 72 is taken from the current through this 1 ohm resistor with line 72 of fig5 connected to line 72 of fig3 as an input through switch 68 to the band pass filter . in addition to designing the hardware of the band pass filter to reduce cross - talk , the connection of line 72 in fig5 during a calibration mode allows a further correction for cross - talk using a cross - talk calibration test . while doing the cross - talk test , most of the analog circuits on the board are used and so this is a good test to check the integrity of the analog hardware . this test connects the 1ω current sense resistor 88 to the input to the band pass filter . this way a fixed led current can inject a signal into the signal acquisition circuits . this allows the operation of the led drive 16 , the band pass filter 60 and the sigma - delta modulator 50 to be verified . in addition , measuring the led current using the 1ω resistor allows the led &# 39 ; s current sense circuit to be calibrated more accurately than the 10 % tolerance capacitors in the circuit would ordinarily allow . thus , during the calibration mode , current is shunted into the current sense input from the led drive current . the only analog circuitry not being used is the photodetector and the i - v converter . in a preferred embodiment , whenever a sensor is connected , this is detected and the software automatically does the cross - talk calibration test . a 50 % drive signal is applied to the leds during the calibration circuit to give a sufficiently large signal without going to full range and risking too high of a signal being provided . alternately , other percentages of the drive current could be used . 1 ) set ir led to 50 %, red led to 0 ; then measure the 0 red signal ; 2 ) set red led to 50 %, ir led to 0 ; then measure the 0 ir signal . subsequently , during actual operation , the red cross - talk effect is determined by multiplying the percentage cross - talk times the red signal , and then it is subtracted from the ir signal . the corresponding action is done for the red signal . as will be understood by those of skill in the art , the present invention could be embodied in other specific forms without departing from the essential characteristic thereof . for example , the drive current could be obtained in a different manner and a different design could be used for the band pass filter . alternately , the band pass filter could be used alone , without the software calibration added . accordingly , the foregoing description is intended to be illustrative , but not limiting , on the scope of the invention which is set forth in the following claims .	0
fig1 is a perspective view of a portion of a front suspension system of an automotive vehicle , illustrating the prior art . the prior art front suspension system includes an automotive vehicle frame 2 shown in dotted line , with various elements secured thereto . among the elements secured to the frame 2 is a lower control arm 4 which is appropriately secured to the frame by a pivoting connection which allows the lower control arm , and the wheel , to move relative to the frame . a stabilizer link 6 is also shown extending from the front wheel assembly forwardly . secured to the lower control arm 4 , and extending upwardly toward the frame 2 , is a coil spring 8 . disposed within the coil spring 8 is a shock absorber 10 . also secured to a portion of the frame 2 for pivoting action is an upper control arm 12 . the distal end of the upper control arm 12 , remote from the frame 2 , is secured to a steering knuckle 16 through an upper ball joint 14 . the knuckle 16 is in turn secured to the front wheel hub , as in a disc brake assembly 18 . fig2 is a perspective view of a portion of a front suspension system of an automotive vehicle illustrating the apparatus of the present invention . some of the elements in fig2 correspond to elements illustrated in fig1 . a portion of a frame 22 of an automotive vehicle is shown , with a lower control arm 24 pivotally secured thereto . a shock absorber 26 is secured at its lower end to the lower control arm 24 and is secured to the frame 22 at its upper end . a composite control arm 50 of the present invention is shown secured to the frame 22 at one end and to a ball joint 28 at its outer or distal end . the ball joint 28 is in turn secured to a steering knuckle 30 . the steering knuckle is in turn secured to a front wheel hub . a disc brake assembly 32 is also secured to the front wheel hub . the distal end of the lower control arm 24 is also secured to the front wheel hub through a lower ball joint ( not illustrated ). the wheel hub is thus suspended at the outer end of the lower control arm 24 and the composite control arm 50 . the composite control arm 50 replaces the upper control arm 12 and the coil spring 8 of fig1 . fig3 is a view in partial section of the composite control arm 50 , taken generally along line 3 -- 3 of fig2 . fig4 is a perspective view of the composite control arm 50 , with a portion broken away . for the following discussion , reference will primarily be made to fig2 , and 4 . the composite control arm 50 includes an upper base plate 52 and a lower base plate 54 which comprise one end , a first end , of the arm 50 , and which are appropriately secured to the automotive frame 22 , as by a plurality of upper bolts 56 and lower bolts 58 . a core or first portion 60 , which is preferably a relatively flat element or first layer of uniform thickness having the characteristic of dimensional integrity , is secured at the one end between the upper and lower base plate elements 52 and 54 . appropriate fastening elements , such as cap screws 62 , may be used to secure the core 60 to the upper and lower base plates . the same fastening elements 62 are also used to secure the upper and lower base plates together . at the distal end of the composite control arm apparatus 50 , remote from the base plates 52 and 54 , is an outer or second end 70 . the outer end 70 is of constant thickness to facilitate the securing of the control arm apparatus 50 to the ball joint 28 and to the steering knuckle 30 . the outer end 70 includes a generally flat upper surface 72 and a generally flat , planar bottom surface , parallel to the top surface 72 . as shown in fig2 , and 4 , there is a generally flat outer surface 74 . extending through the outer or second end 70 is a plurality of apertures , including a central aperture 76 which receives the ball joint 28 , or other appropriate elements for securing the composite control arm 50 to the steering knuckle 30 , such as a sleeve , a bearing housing , or the like . in fig2 and in fig3 the upper ball joint 28 is shown secured to the outer end 70 . in fig4 the outer end 70 is shown without the upper ball joint 28 . four bolt or rivet holes are shown spaced apart from the central aperture 76 and extending downwardly through the outer end from the top surface 72 . two of the holes 78 are outboard at the outer end 70 , adjacent to the outer surface 74 , and two of the holes or apertures 80 are shown inboard or inwardly from the outer apertures 78 and the outer surface 74 . the fastening elements which extend through the apertures 78 and 80 extend through the distal end of the core 60 , and help to secure the core 60 to the outer end assembly 70 , thus helping to insure the structural integrity of the composite control arm apparatus 50 . disposed on the upper portion of the core 60 is an upper lamination or top or second layer 80 . a mirror image of the upper lamination , a lower lamination or bottom layer 90 , is disposed on the bottom of the core 60 . the two laminations , the upper lamination 80 and the lower lamination 90 , meet or blend together at the apertures 64 in the core 60 . the upper and lower laminations 80 and 90 , respectively , are virtual mirror images of each other with respect to the center or core 60 . as best shown in fig3 the thickness of the upper and lower laminations is not uniform throughout the length of the composite control arm apparatus 50 . rather , the laminations include varying thicknesses . the thickness varies from the upper and lower base plates 52 , 54 , to the outer end assembly 70 . the thickness of the upper and lower laminations 80 and 90 is perhaps maximum at the area of the base plates 52 , 54 , and tapers to a transversely extending trough 82 in the upper lamination 80 and a transverse lower trough 92 in the lower lamination 90 . the thickness then increases to a maximum mid - point thickness or transversely extending hump 84 on the top lamination 80 and a similar , mirror image hump 94 on the bottom lamination 90 . from the midpoint thickness 84 , 94 , the laminations taper to a minimum at outer or distal ends 86 and 96 of the upper and lower laminations 80 and 90 , respectively . the outer and lower laminations , outer ends 86 , 96 , respectively , terminate at the outer surface 74 at the outer end 70 . the purpose for the varying thickness of the upper and lower laminations is to provide for and define the flexibility of the composite control arm 50 and the areas of minimum and maximum flexure , and the like . for example , at the area of minimum thickness of the upper and lower laminations , flexibility will be maximum . at the area of maximum thickness of the laminations , flexibility will be minimum . flexibility thus varies according to lamination thickness . while the core material or first portion 60 includes the qualities or the characteristics of dimensional integrity , it is the upper and lower laminations 80 and 90 comprise a second portion that provide the flexing and springy quality or characteristics for the composite control arm apparatus 50 . thus , dimensional integrity of the arm 50 is maintained primarily by the core material 60 , while the flexibility or springy characteristics are provided by the upper and lower laminations . obviously , in the area of maximum lamination thickness , such as at the inner end of the control arm apparatus , adjacent to the upper and lower base plates 52 and 54 , respectively , the flexing of the control arm apparatus 60 is minimum . however , at the outer or distal ends of the upper and lower laminations 86 and 96 , respectively , flexing may be at a maximum , with less flexing occurring at the depressions 82 and 92 . the composite control arm apparatus 50 takes the place of both the upper control arm 12 and the coil spring 8 , illustrated in fig1 . the qualities of dimensional control and flexibility are built into the composite control arm apparatus 50 to allow the control arm 50 to replace the structure and the functions of both the upper control arm 12 and the spring 8 of the prior art , as illustrated in fig1 . in the embodiment shown in fig2 , and 4 , the upper lamination 80 and the lower lamination 90 are preferably made of the same material . the core 60 is preferably made of material different from the material of the upper and lower laminations . for example , the core 60 may be made of material that is more dense than the material of which the upper and lower laminations 80 and 90 , respectively , are fabricated . since the primary purpose of the core material is to provide dimensional integrity , the density of the material may be substantially greater than the upper and lower laminations . the upper and lower laminations are appropriately bonded to the core material , and to each other , as through the apertures 64 in the core 60 , to provide the necessary springy characteristics for the composite control arm 50 . thus , the upper and lower laminations 80 , 90 , in a sense replace the coil spring , while the core 60 replaces the upper control arm . the coil spring and the upper control arm are the corresponding prior art elements , as discussed in conjunction with fig1 . in typical applications of contemporary technology , the core 60 may be made of a metal , while the upper and lower laminations may be made of an elastomeric material or the like . however , it is obvious that as technology changes , the relative density of the materials out of which a composite control arm may be made will vary . for example , for certain applications , the core may be made of stranded elements , such as fiberglass or carbon strands , secured together with an appropriate adhesive or resin , with the strands extending longitudinally between the base plates and the outer end assembly . the upper and lower laminations may be made of similar material , but with the strands extending transversely or substantially perpendicularly to the strands of the core material . this is shown in fig5 . for certain applications it may not be necessary to have both an upper and a lower lamination . thus , what is illustrated in fig2 , and 4 as a core may comprise either an upper or a lower lamination , the primary purpose of which is to provide dimensional integrity . a second lamination , the primary purpose of which is to provide the flexure capability , may be appropriately secured to the dimensional integrity layer either above it or below it . accordingly , only two layers are needed . this is illustrated in fig6 . fig5 is a schematic representation , in partial section , of a portion of an alternate embodiment of composite control arm apparatus 110 . fig5 shows the composite control arm apparatus 110 made of resin impregnated fibers extending longitudinally and transversely in three layers . the composite control arm apparatus 110 includes a core 112 in which the fibers extend longitudinally for dimensional integrity , and a pair of laminations disposed on opposite sides of the core 112 . the laminations comprise an upper lamination 114 and a lower lamination 116 . in both the upper lamination 114 and the lower lamination 116 , the fibers are extending crosswise or transversely to the fibers in the core 112 . the axis of the fibers in the core 112 and in the upper and lower laminations 114 and 116 , respectively , are accordingly substantially perpendicular to each other . fig6 is a view in partial section of an alternate embodiment of the apparatus of the present invention , comprising a two layer composite control arm apparatus 130 . the control arm apparatus 130 includes a layer 132 of relatively uniform thickness . the purpose of the layer 132 is to provide dimensional integrity for the control arm apparatus 130 . a single layer 134 is laminated to the uniform thickness layer 132 . the thickness of the layer 134 varies , as discussed above in conjunction with the embodiments of fig2 - 4 and also as shown in fig5 . the purpose of the layer 134 is to provide for the flexibility or springiness of the composite control arm 130 . in all of the above discussion , it will be noted that the core layer , or one of the composite layers , is discussed as providing dimensional integrity . the other layer or layers is referred to as providing the flexing capability or springiness . as shown in fig2 , and 4 , the flexing or springy layers vary in thickness . the core material , or dimensional integrity layer , is shown as being uniform in thickness throughout its length . while this may be preferable , it may not be necessary , depending on the materials actually used . however , for most applications , a uniform thickness for the dimensional integrity layer may be preferable . whether or not the flexing or springy layer needs to vary in thickness perhaps depends most on the actual type of material used and the extent of its flexing capabilities . fig7 is a view in partial section of an alternate embodiment of the apparatus of the present invention . the apparatus of fig7 comprises a composite control arm 150 which is preferably made of resin impregnated material 152 in a single , continuous layer , or without layer differentiation . it has a varying outer ( top and bottom ) contour , similar to the apparatus of fig2 - 5 . the apparatus 150 of fig7 varies from the apparatus 110 of fig5 in that the apparatus 110 of fig5 includes a central core having stranded material extending in transverse directions , with a center core or layer 112 extending in one dimension or direction and the upper and lower laminations 114 and 116 having their stranded material extending substantially perpendicularly to the core material 112 . the strands in arm 150 preferably extend in one direction , all parallel to each other . the control arm apparatus 150 of fig7 is preferably molded of stranded material , such as fiberglass strands or carbon strands , or the like , impregnated with a resin . after curing , the resulting apparatus provides both flexing ability and dimensional integrity . the stranded material 152 may include relatively long strands and relatively short strands , if so desired . the long strands may provide particularly advantageous characteristics for dimensional integrity , while the relatively short strands may enhance the flexing capabilities . however , the strands may also be uniform in length , if desired . under some circumstances , random orientation of the fibers may produce satisfactory or desired properties . obviously , the actual makeup of the strands and of the resin may vary as improvements and advancements in chemistry , particularly polymer chemistry , are made . in keeping with the embodiments of fig2 - 6 , the thickness of the composite control arm apparatus 150 may vary along the length between the inner or proximal end of the control arm ( not shown ), secured to a frame ( not shown ) and the distal or outer end ( not shown ) which is secured to appropriate mechanical elements associated with the front end suspension of the vehicle . in areas of maximum thickness , the flexing is minimum . the flexing between the minimum and maximum thickness areas varies , all as discussed above . the outer , contoured portions of the arm 150 thus determine the areas and extent of flexibility while the center portion of the arm 150 provides overall strength and dimensional integrity . if desired , the arm 150 may be configured with only one of its outer sides , either the top or the bottom , contoured , as opposed to both the top and the bottom sides being contoured , as shown in fig7 . the single contoured side concept is shown in fig6 . similarly , the transversely layered composite arm 110 of fig5 may also include only two layers , the core 112 and an outer , contoured layer , either layer 114 or 116 . in the embodiment of fig2 - 4 , there are metal mountings secured to the control arm apparatus at both the inner and outer ends . for the embodiments of fig5 and 7 , which are resin impregnated fiber or stranded arms , such end mountings may not be required . rather , the ends may be appropriately machined after the resin has cured . such is well known and understood in the art . for the control arm apparatus 130 of fig6 if one of the layers is metal , and the other layer is some other material , end mountings may be required . however , if both the dimensional integrity layer 132 and the flexure layer 134 are made of resin impregnated fiber or stranded material , then , as with the composite control arms 110 and 150 of fig5 and 7 , respectively , the control arm apparatus 130 may not require separate end mountings , but rather the end mountings may simply be machined at the outer ends of the control arm apparatus from the cured , resin impregnated material . it will be noted that the composite control arms 50 of fig2 , and 4 and also the control arms 110 , 130 , and 150 of fig5 , and 7 , respectively , are shown relatively straight , lengthwise , which is their loaded or weighted positions . in their unloaded positions , the arms will include a slight convex curvature in the overall length of the arm . when loaded , or weighted , the arms would extend relatively straight , as shown in the drawings . in fig2 , 4 , 5 , and 7 , both the top and the bottom layers are contoured . in fig6 only the top layer is contoured . however , all of the contours shown are substantially identical . this is for illustrative purposes only . the actual contouring may vary from application to application . moreover , instead of a variable contour , as shown in fig2 - 5 , a straight taper may be used , or a curve , or any combinations , depending on the material used , the particular use application , and other variables and desiderata . the term &# 34 ; dimensional integrity &# 34 ; used herein refers to the concept of maintaining predetermined dimensions . that is , the composite control arms will not elongate or shrink under usage . the flexing discussed refers to the arms flexing or moving vertically upwardly and downwardly in the vertical plane in response to various forces . however , the arms generally will not flex to any great extent in the horizontal plane forwardly or rearwardly . the outer or distal ends of the arms move relative to the inner or fixed ends of the arms vertically but not horizontally . it will be noted that the composite arms of the present invention are fixedly secured to a frame member of a vehicle . in the prior art the control arms are pivotally secured to a frame member , and thus require some type of bushing for the relative movement . since the composite control arms of the present invention flex instead of pivot , the requirement for bushings or other elements required for pivoting connections is obviated . while the principles of the invention have been made clear in illustrative embodiments , there will be immediately obvious to those skilled in the art many modifications of structure , arrangements , proportions , the elements , materials , and components used in the practice of the invention , and otherwise , which are particularly adapted for specific environments and operative requirements without departing from those principles . the appended claims are intended to cover and embrace any and all such modifications , within the limits only of the true spirit and scope of the invention . this specification and the appended claims have been prepared in accordance with the applicable patent laws and the rules promulgated under the authority thereof .	1
the elements identified throughout are exemplary and may include various alternatives , equivalents , or derivations thereof . various combinations of hardware , software , and computer - executable instructions may be utilized . program modules and engines may include routines , programs , objects , components , and data structures that effectuate the performance of particular tasks when executed by a processor , which may be general purpose or application specific . computer - executable instructions and associated data structures stored in a computer - read able storage medium represent examples of programming means for executing the steps of the methods and / or implementing particular system configurations disclosed herein . fig1 illustrates an exemplary system 100 for ranking and managing user - generated game play advice . the system 100 of fig1 includes a game play advice submission engine 120 , game play advice database 130 , ranking engine 140 , game play advice display engine 150 , feedback engine 160 , feedback database 170 , and ranking database 180 . in some embodiments ( like that illustrated in fig1 ), the system 100 may also include an optional weighting engine 190 . while various engines and databases are described in the context of fig1 , an embodiment of the present invention may offer the functionality of each or certain of these engines and databases in a single ‘ game play advice management ’ engine or database . system 100 may be implemented in a network environment 110 such as the internet , a proprietary communications environment , or a combination of the two . in one example , system 100 is an integrated component of the playstation ® network . system 100 ( or components thereof ) may communicate with the network environment 110 utilizing any number of network interfaces as are known in the art . examples of such interfaces include a 1000base - t ethernet port or an ieee 802 . 11 b / g network wifi interface . system 100 may be implemented in a computing device such as a server dedicated to managing user - generated game play advice including maintenance of various databases . alternatively , system 100 may be implemented in a computing device hosting a number of applications such as community maintenance , admission , and network game data distribution . system 100 may be dedicated to a single network game , a genre of games , or any number of games having no particular affiliation at all . system 100 may also be implemented in a distributed peer - to - peer environment . in such an implementation , certain , applications and / or responsibilities may be managed by a group of computing devices in the environment . a first computing may be represented by a game platform such as the playstation ® 3 . this particular computing device may be responsible for ranking operations that take place via a ranking engine and maintaining a database of related information . a second computing device such as a desktop or laptop computer may be responsible for feedback operations that take place via a feedback engine and maintaining a database of related information . various engines may be distributed to a community of users ( e . g ., players of a particular game or users in a general gaming network ) through a push operation from a tasked server in the game community . alternatively , various engines may be embodied in a computer - readable storage medium that also includes a particular game application ( e . g ., a disc ). distributed applications and engines may communicate directly via a group of peers or may be administered by a management server . game play advice submission engine 120 is configured to allow a user to communicate with the system 100 over network 110 for submission of game play advice . game play advice submission engine 120 may generate a user - interface for allowing user interaction with the system 100 . the interface may be a simple text - entry screen where users identify a game title , user identity ( i . e ., who is submitting the advice ) in the form of a ‘ real name ’ or ‘ screen name ,’ and particular game play advice . game play advice submission engine 120 may generate a ‘ drop down ’ menu to allow for easy entry of information . drop - down menus may identify a variety of game titles ( in order to maintain consistency of game title naming ). drop down menus may also allow for identification of particular types of advice such as special moves , easter eggs , unlocking weapons , or defeating particular enemies . drop down menus may also identify particular portions of an interactive gaming environment by level or environmental description ( e . g ., level 1 or ‘ the volcano ’). similar identification may occur with respect to particular objects , weapons , or enemies . menus generated by the game play submission engine 120 may be level - based . a level - based menu configuration may cause the selection of one item at a first level of a menu to branch out into a series of options concerning a second level of related menu items . selection of an entry at the second level may spawn a third - level and so on . spawning of various levels may continue until there is no further information to be entered . entry of the game play advice may be textual where a user enters a written description of the game play advice ( e . g ., ‘ at the castle gate , look behind the statute for a hidden treasure ’). text - entry may occur through a virtual keyboard manipulated by a game controller coupled to a gaming platform . the gaming platform , in turn , is coupled to the system 100 via network 110 . submission of game play advice may be audible and provided by speaking into a usb microphone headset . in some embodiments , video clips or still - frame images of game play may be submitted in the context of or as game play advice . combinations of game play advice submissions are also within the scope of the present invention ( e . g ., a video clip with audible narration ). game play advice database 130 is configured to manage user - generated game play advice submitted through an interface generated by the submission engine 120 . game play advice database 130 may manage submitted game play advice by user , game title , nature of the advice , date , size , content of the advice ( e . g ., video , audio , text , combinations of content ), and so forth . game play advice database 130 may include non - user generated game play advice ( e . g ., pre - stocked game play advice from the game publisher ) that may also be ranked and displayed by system 100 . game play advice database 130 may be configured to store all game play advice received through an interface generated by game play advice submission engine 120 . alternatively , certain game play advice may expire over time or upon the occurrence of certain events . for example , the game play advice database 130 may only retain the top - 100 ranked game play advice submissions . once a particular instance of game play advice falls below a top - 100 threshold , that particular instance may be deleted from the game play advice database 130 . expiration may be temporal such that instances of game play advice that are not accessed for a particular period of time are removed from the game play advice database 130 . instances of game play advice may also be removed from the game play advice database 130 a predetermined number of days after having been submitted to the system 100 . ranking engine 140 is configured to manage the ranking of game play advice stored , in game play advice database 130 . when new game play advice is received , the ranking engine 140 of fig1 will assign a default ranking to that new instance of game play advice . this default ranking and any other ranking ( including those generated as a result of user feedback ) may be measured utilizing any rubric capable of distinguishing one instance of user - generated game play advice from another . rankings may be numeric ( e . g ., 1 , 2 , 3 . . . 101 , 102 , etc .) or characteristic ( e . g ., poor , good , very good , excellent , etc .). simplistic rankings may also be used such as a binary indication of ‘ good ’/‘ bad ’ or ‘ thumbs up ’/‘ thumbs down ’. a percentage value may also be used by ranking engine 140 . for example , an ‘ 86 % ranking ’ may reflect that 86 percent of all user feedback received with respect to a particular instance of game play designated the advice as ‘ good or better .’ tie - breakers may be utilized by the ranking engine 140 with respect to multiple instances of game play advice that are allocated rankings of equal value . equally - ranked game play advice may be distinguished by an alphabetical ordering of the screen name or real name of the user submitting the game play advice . equally - ranked game play advice may also be displayed , based on the time the game play advice was submitted . previously received and equally ranked game play advice may be moved to the bottom of a ranking ladder versus more recently received ( and equally ranked ) game play advice . equally - ranked game play advice may also be displayed in a random order albeit in the context of other equally - ranked advice . ranking engine 140 may operate in conjunction with ranking database 180 to maintain a record of a current or prior ranking of any particular instance of game play advice . ranking engine 140 may also work in conjunction feedback engine 160 , feedback database 170 , and , in some embodiments , optional weighting engine 190 to more accurately identify the perceived quality of game play advice as adjudicated by a community of users . game play advice display engine 150 is configured to display user - generated game play advice in accordance with a ranking result generated by ranking engine 140 . game play advice display engine 150 acquires information from the game play advice database 130 ( the advice ) and the ranking database 180 ( the ranking of the game play advice as determined by ranking engine 140 ) and displays the game play advice in accordance with an allocated ranking . the game play advice display engine 150 may utilize an asynchronous programming language to provide real - time ( or substantially near real - time ) updates to ranked game play advice for display to a community of users . game play advice display engine 150 may utilize a ladder ranking of game play advice . in such an embodiment , the highest quality advice is presented at the top of a ladder and the worst advice is relegated to the bottom of the ladder . the quality of the advice decreases as a user moves from the top of the ladder to the bottom . in some embodiments , the particular arrangement of the advice may be subject to user or system preferences ( e . g ., the advice may be listed in an inverse order where the best advice is listed at the bottom of the ladder and the worst advice at the top ). fig5 a illustrates an exemplary ladder ranking 500 of user - generated game play advice ( 510 a . . . f ). in fig5 a , the ladder 500 includes six exemplary instances of user - generated game play advice ( 510 a . . . f ). each instance of game play advice identifies a title of the interactive game for which the advice is rendered 520 ( i . e ., socom 3 ); the nature of the advice 530 ( i . e ., pertaining to ‘ unlockable ’ weapons ); and the particular unlockable weapon at issue 540 ( e . g ., an iw - 80 a2 , an stg - 77 , a medium scope , and a front grip ). each instance also includes the advice itself 550 ( e . g ., “ complete the poland theater of operations ” in the case of instance 510 a ). the information displayed in each instance of game play advice ( e . g ., game title , nature of the advice , etc .) and the format of the same ( e . g ., text entries versus graphical illustrations ) may vary depending on a particular embodiment of system 100 and game play advice display engine 150 . additional information may also be displayed in each instance of game play advice . for example , an embodiment of ladder 500 may include the screen name of the user submitting particular information , the date the advice was submitted , a visible indication of the ranking of the instance of game play information ( e . g ., 1 of 6 ; 86 % approval ; thumbs up ), or the number of times feedback has been rendered with respect to that particular instance of game play advice . an indication that a particular ranking is the result of a default ranking may also be displayed . in fig5 a , the best quality game play advice is displayed at ( or near ) the top of the ladder 500 . with respect to this particular game title , the iw - 80 a2 may represent a particularly desirable weapon . information regarding acquisition of this weapon may , therefore , be highly valued ( i . e ., to obtain this weapon “ complete the poland theater of operations ” as reflected by advice 550 of instance 510 a ). in another instance of game play advice ( 510 f ), the weapon is the same as that discussed in the most highly ranked instance ( 510 a ) ( i . e ., the aforementioned iw - 80 a2 ) but the advice is of such poor quality that the advice is located at the lower - most rung of the ranking ladder 500 . with respect to game play advice instance 510 f , the user submitting the ‘ advice ’ has just begun playing this particular game title and does not know what an iw - 80 a2 is or how to acquire the same . as such , this unhelpful instance of game play advice is appropriately ranked , and subsequently displayed at the bottom of the ranking ladder 500 . as a result of this ranking , a user searching for information concerning the acquisition of an iw - 80 a2 saves time by avoiding review of unhelpful information . further , the user searching for advice on acquiring the iw - 80 a2 is more likely to receive complete and accurate advice . game play advice display engine 150 may display advice in the context of a real - world virtual environment and / or a first - or third - person avatar . in such an embodiment , an avatar may move about a virtual environment like that offered by sony computer entertainment inc .&# 39 ; s “ home .” “ home ” is a three - dimensional online user community service that may be accessed utilizing the playstation ® 3 entertainment system . the “ home ” virtual environment offers a “ hall of fame ,” two examples of which are illustrated in fig5 b and fig5 c , and that could be used in conjunction with the display of user - generated game play advice . for example , display area 560 could be used to display a ladder ranking 500 like that discussed in the context of fig5 a . virtual objects associated with a reward or particular achievement may also be displayed such as a trophy . game play advice may be displayed in the context of particular game titles or users . in a virtual environment like that shown in fig5 b and fig5 c , game play advice display engine 150 may be integrated with the host of the virtual environment . game play advice display engine 150 may also access the virtual environment through an application programming interface ( api ) native to the environment . other means of display of game play advice beyond the aforementioned ladder and virtual environment are within the scope of the present invention . game play advice may be listed as a series of entries in a ‘ chat ’ string . game play advice may be displayed and detailed commentary ( in addition to ranking feedback ) concerning the quality of that advice may be provided by the community of users . game play advice may also be provided through , a series of hyperlinks . graphic images may also be utilized , especially in the context of game play advice that incorporates full motion video or still images . links to audio files may be appropriate in the ease of audio - rendered advice . all of the aforementioned means of providing game play advice to a community of users ( and in accordance with an assigned default or feedback controlled ranking ) may be managed by the game play advice display engine 150 . feedback engine 160 is configured to accept feedback from other game players following their viewing and subsequent use of game play advice provided via the game play advice display engine 150 . feedback engine 160 may be integrated or work in conjunction with game play advice display engine 150 with respect to receiving feedback . for example , feedback engine 160 may generate a prompt for receiving user - generated feedback . the prompt may be displayed in the immediate context of particular instances of game play advice , which are displayed by game play advice display engine 150 . user feedback may be any subjective assessment capable of distinguishing one instance of user - generated game play advice from another . user feedback may be numeric ( e . g ., 1 to 10 , with 10 being high quality and 1 being low ) or characteristic ( e . g ., good , very good , excellent , etc .). simplistic binary indications of ‘ good ’ or ‘ bad ’ or a ‘ thumbs up ’ or ‘ thumbs down ’ may also be used . feedback may include a textual ( or spoken ) assessment of the user - generated game play advice . feedback may be entered manually ( e . g ., entry of a ‘ 10 ’ through a virtual keyboard ), selected from drop down menus , or submitted via graphic representations such as on - screen icons ( e . g ., selecting a ‘ thumbs up ’). feedback engine 160 may also be configured to request and accept a grade for a particular user from a community of users , the user having submitting game play advice to the system 100 . the user grade may be a subjective assessment of a particular user registered with system 100 . other users in a community may grade a particular user based on their knowledge of the graded user &# 39 ; s in - game exploits in a manner similar to providing feedback with respect to game play advice . user grades may also be assessed automatically by the ranking engine 140 or an independent user grade engine ( not shown ). a grade for a particular user may be allocated with respect to the time that a user has been registered with the system 100 or played a particular game title ( thus suggesting experience ). grades may also be assessed based on the number of tasks that a user has completed in a particular game or the number of levels that the user has ‘ conquered .’ user grades may be particular to game , geographic region , or the entirety of the gaming network . the game community may also be defined by various tiers of experience ( e . g ., beginners , intermediate users , and experts ). user grades may also be allocated within the delineation of a particular tier to which a graded user belongs . feedback database 170 is configured to manage user feedback to game play advice submitted through feedback engine 160 . feedback database 170 may be configured to store all community generated feedback as it pertains to game play advice . certain feedback may expire over time ( e . g ., a predetermined number of days after having been submitted to the system 100 ). feedback database 170 may track the nature of the feedback ( e . g ., a subjective assessment ) with respect to a particular instance of game play advice . feedback database 170 may further track the identity of the user submitting user feedback via the feedback engine 160 . ranking database 180 is configured to manage ranking of user - generated game play advice as ranked by the feedback engine 140 . ranking database 180 may also store user grade information generated by the ranking engine 140 . ranking database 180 may be updated in real - time ( or substantially in real - time ) in order to provide game play advice display engine 150 with the most up - to - date and available ranking information as it pertains to particular instances of game play advice . ranking information stored in the ranking information database 180 may expire after a set period of time . lower ranked game play advice ( e . g ., advice falling below a certain minimum ranking ) may be removed from the ranking database 180 while higher ranked information is maintained in the database 180 . optional weighting engine 190 may be used for ranking user - generated game play advice based on the quality of the advice and the reputation or experience of the user submitting the advice . optional weighting engine 190 is configured to introduce a weighting algorithm that allocates a particular value to the grade of a user submitting game play advice and another value to the actual game play advice . for example , if the user is regarded by the game community ( i . e ., the user has a higher user grade ) but the game play advice submitted by the player is of low quality ( as reflected by user feedback ), the optional weighting engine 190 may apply a first weighting value to the user grade ( e . g ., 75 %) and a second weighting value to the game play advice ( e . g ., 25 %) to formulate ( in conjunction with the ranking engine 140 ) a ranking of the game play advice . the game play advice is then displayed , through the game play advice display engine 150 whereby the first and second weighting values allocated by the optional weighting engine 190 proportionally affect the ranking of the game play advice . the actual weighting valuations applied to the user grade and the game play advice may be set and adjusted by an administrator of the system 100 . fig2 illustrates an exemplary method 200 for ranking user - generated game play advice based on the quality of the advice . the steps identified in fig2 ( and the order thereof ) are exemplary and may include various alternatives , equivalents , or derivations thereof including but not limited to the order of execution of the same . the steps of the process of fig2 ( and its various alternatives ) may be embodied in hardware or software including a computer - readable storage medium ( e . g ., optical disc , memory card , or hard drive ) including instructions executable by the processor of a computing device . in step 210 , user - generated game play advice is received from a user in the community via an interface generated by the game play advice submission engine 120 . upon receipt of the user - generated game play advice in step 210 , the advice is processed by the system 100 as described in the context of fig1 and assigned a default ranking by ranking engine 140 . the game play advice may be stored in game play advice database 130 . the default ranking may be stored in ranking database 180 . the processed and default ranked game play advice is subsequently displayed via the game play advice display engine 150 in step 220 . upon display in step 220 , the user - generated game play advice is available for viewing by other members of the gaming community . the members of the community may then act upon that advice during the course of game play . the newly received and default ranked game play advice is also displayed in conjunction with previously received game play advice , which is also stored in game play advice database 130 . the previously received game play advice may have been previously displayed and ranked or may be displayed for the first time with a default ranking ( i . e ., multiple instances of game play advice are being displayed for the first time ). the newly received game play advice may also be displayed with pre - packaged game play advice from the game publisher . a user acting upon any displayed game play advice may return to the ranking system 100 and provide feedback as to the quality of that particular game play advice in step 230 . the feedback may be provided via a prompt generated by feedback engine 160 . the nature of the feedback may be like that described in the context of fig1 with respect to feedback engine 160 ( e . g ., a number of ‘ stars ’ or ‘ thumbs up ’ or ‘ thumbs down ’). advice that resulted in better game play may receive a higher ranking than advice that resulted in lesser game play . the presentation of the game play advice may also affect the ranking . for example , if the advice was presented in such a way as to make the advice confusing notwithstanding the validity of the advice , the particular instance may receive a lesser ranking . after having received feedback in step 230 , the ranking engine 140 of system 100 will rank the new game play advice against previously received ( and possibly ranked ) game play advice in step 240 . ranking of the new game play advice with respect to the previously received ( and perhaps ranked ) game play advice will take into account the feedback received by the feedback engine 160 and stored in feedback database 170 . after having received an initial indication of quality based on user feedback , game play advice will lose its ‘ default ’ ranking and move up or down a ladder of all available game play advice based on its valuation against other game play advice . following the ranking operation of step 240 , the results of which may be stored in ranking database 180 , the new game play advice and previously received game play advice will be ( redisplayed by the game play advice display engine 150 in step 250 . the ( re ) display of the game play advice will reflect any received user feedback from step 230 and the subsequent ranking operation of step 240 . based on the ranking operation of step 240 , quality game play advice will rise to the top of a list of game play advice or be communicated to the community of users such that they know the advice that has received high approval from the community versus game play advice perceived to have little or no value . the method 200 of fig2 may operate in real - time ( or substantially in real - time ) using an asynchronous programming language such as ajax . in an asynchronous language like ajax , small amounts of data are continually exchanged , with a database so that an entire user interface need not be reloaded , in response to each user interaction . in such an embodiment , an xmlhttprequest object may be utilized to fetch the most recent game play advice rankings from the ranking database 180 of fig1 . this ranking information , and the corresponding game play advice retrieved from game play advice database 130 , may then be displayed via an interface generated by the game play advice display engine 150 . relationships between rankings , user feedback , and game play advice may be reflected by metadata or header data stored in the various databases of system 100 . game play advice rankings may thus be updated as feedback is received and new rankings are calculated . the method 200 of fig2 may also operate subject to a predetermined schedule . for example , the ranking engine 140 may update the ranking database 180 at five minute intervals ( or any other time period as may be determined by a system administrator ). once the ranking database 180 is updated as a result of a regularly scheduled ranking operation , the newly updated ranking information may be pushed to the game play advice display engine 150 for display to the community of users in conjunction with the game play advice retrieved from game play advice database 130 . the updated ranking information in the ranking database 180 may also be available for access in response to a user request or query . a user request for ranking information may instantiate the ranking operation and the subsequent display of ranked game play advice . fig3 illustrates an exemplary method 300 for ranking user - generated game play advice based on the reputation of the user submitting the advice . the steps identified in fig3 ( and the order thereof ) are exemplary and may include various alternatives , equivalents , or derivations thereof including but not limited to the order of execution of the same . the steps of the process of fig3 ( and its various alternatives ) may be embodied in hardware or software including a computer - readable storage medium ( e , g ., optical disc , memory card , or hard drive ) including instructions executable by the processor of a computing device . in step 310 , user - generated game play advice is received at the system 100 from a user in a game community . receipt of game play advice may occur through a user interface generated by the game play advice submission engine 120 . the submitting user may be identified as part of the submission process . identification may occur through manual entry of a screen name . identification may also occur via a user profile accessed when the user logged into the gaming community . automated grading of the submitting user by the ranking engine 140 takes place in step 320 such that a determination as to the authority of the provided game play advice may be made . for example , if a user is playing a particular game for the first time , any advice proffered by that player is likely of little value due to that player &# 39 ; s general inexperience with the game . if a user is experienced with respect to that game , however , then any advice provided by that user may be of greater value due to their vast experience with game play . experience may be derived from game play statistics or other data , which may be associated with a user profile . alternatively , the submitting user may be graded based on their actual performance in a particular game . a particular user may play a game numerous times but lack any exceptional ability with respect to that particular game . in these instances , grading the user based on the number of times that they have played the game may be misleading . grading the user based on performance in the game may be more indicative of the quality of the advice the user might offer . user performance may be based on any variety of factors . for example , a user may be graded based on a score achieved , a level reached , or a length of the user existed in a particular game environment without being ‘ killed .’ performance may also be based on objectives completed , items obtained , weapons mastered , enemies killed , and so forth . once the user is graded in step 320 , the ranking engine 140 will rank new game play advice against previously received ( and perhaps ranked ) game play advice in step 330 . after having received an initial indication of quality based on grading of the user , game play advice will be ranked and that ranking information will be stored in ranking database 180 while the game play advice is stored in game play advice database 130 . following the ranking operation of step 330 , the new game play advice and previously received game play advice will be displayed in step 340 by the game play advice display engine 150 . the display of the game play advice will reflect the grading of the user with respect to the game play advice as occurred in steps 320 and the subsequent ranking operation of step 330 . based on the ranking operation of step 330 , quality game play advice will rise to the top of a list of game play advice or be communicated to the community of users such that they know the advice was offered by a game player of exceptional ability versus having come from a user with little to no experience or ability . the method 300 of fig3 may operate in real - time or substantially in real - time . like the method of fig2 ( 200 ), such real - time functionality may be effectuated using an asynchronous programming language whereby the most recent game play advice rankings vis - à - vis a user grade are retrieved from the ranking database 180 and displayed via the game play advice display engine 150 . in this matter , game play advice rankings are updated as user grading is calculated . like the method of fig2 ( 200 ), the method of fig3 ( 300 ) may also operate subject to a predetermined schedule whereby the ranking engine 140 updates the ranking database 180 at regular intervals . once the ranking database 180 is updated as a result of a regularly scheduled ranking operation , the newly updated ranking information may be pushed to the game play advice display engine 150 for display to the community of users in conjunction with the game play advice retrieved from game play advice database 130 . alternatively , the updated information in the ranking database 180 may available for access in response to a user request or query . a user request for ranking information may instantiate the ranking operation and the subsequent display of ranked game play advice . user grading may also be in response to feedback received from the gaming community . in such an embodiment , user grading step 320 will involve feedback engine 160 calculating a community valuation of a particular user based on information retrieved from the feedback database 170 and prior ranking information retrieved from the ranking database 180 . steps 330 and 340 of the method 300 of fig3 will proceed as described above with the exception that the ranking of game play advice is now based on user feedback rather than an automated determination made solely by ranking engine 140 . in a still further embodiment , the user grade may involve a weighting algorithm imposed by optional weighting engine 190 . in such an embodiment , community feedback may be assigned a first weighting value by the weighting algorithm of weighting engine 190 . the automated ranking generated by the ranking engine 140 may be allocated a second weighting value . these weighted values may proportionally affect a final ranking ( also calculated by the ranking engine 140 ) that is ultimately stored in the ranking database 180 for retrieval by the game play advice display engine 150 . fig4 illustrates an exemplary method 400 for ranking user - generated game play advice based on the quality of the advice and the reputation of the user submitting the advice . the steps identified in fig4 ( and the order thereof ) are exemplary and may include various alternatives , equivalents , or derivations thereof including but not limited to the order of execution of the same . the steps of the process of fig4 ( and its various alternatives ) may be embodied in hardware or software including a computer - readable storage medium ( e . g ., optical disc , memory card , or hard drive ) including instructions executable by the processor of a computing device . in step 410 , user - generated game play advice is received at the system 100 from a user in a game community . upon receipt of the user - generated game play advice in step 410 , the advice is processed by the system 100 and assigned a default ranking . game play advice may be initially received through an interface generated by the game play submission engine 120 and stored in the game play advice database 130 . allocation of a default ranking may be allocated by ranking engine 140 . the processed and default ranked game play advice is subsequently displayed by the game play advice display engine 150 in step 420 . the game play advice display engine 150 retrieves the default ranking information from ranking database 180 and the game play advice from the game play advice database 120 . upon display in step 420 , the user - generated game play advice is available for viewing by other members of the gaming community who may then act upon that advice during the course of game play . the newly received and default ranked game play advice may also be displayed in conjunction with previously received game play advice . the previously received game play advice may have been previously displayed ( and ranked ) or may be displayed for the first time with a default ranking . display may take place concurrent with pre - packaged game play advice from the game developer , which may also be ranked . in step 430 , the submitting user is graded . grading of the submitting user takes place such that a determination as to the authority of the game play advice provided may be made as was the case in fig3 . as was the case in fig3 , a user may be graded based on experience playing a particular game or performance with respect to a particular game . grading may also be based on community feedback . in step 440 , feedback as to the quality of particular game play advice may be provided by users in the community via feedback engine 160 . advice that results in better game play may receive better feedback than advice that resulted in lesser game play or that was perhaps presented in such as way as to make the advice confusing and otherwise ineffective . feedback may be stored in feedback database 170 . in step 450 , the grading of the user as occurred in step 430 and the feedback provided with respect to particular game play advice as occurred in step 440 may be weighted . weighting of the user grade and advice feedback may occur through optional weighting engine 190 . as noted in the context of fig1 , the ratio of importance of the user grade versus the user feedback may be allocated as to best overall evaluate the advice provided by the user . following weighting of the user grade and the user feedback in step 450 , the ranking engine 140 will rank the new game play advice against previously received game play advice in step 460 . after having received an initial indication of quality based on user feedback and the user grade , game play advice will lose its ‘ default ’ ranking and move up or down a ladder of ail available game play advice based on its valuation against other advice as a whole . following the ranking operation of step 460 , the new game play advice and previously received game play advice will be ( redisplayed in step 470 by game play advice display engine 150 . the ( re ) display of the game play advice will reflect the results of the ranking operation of step 460 , which may be retrieved from ranking database 180 in conjunction with the actual game play advice from game play advice database 130 . based on the ranking operation of step 460 , qualify game play advice from knowledgeable game players will rise to the top of a list of game play advice or be communicated to the community of users such that they know the advice that has received a combination of high approval from the community and was offered by an otherwise experienced or well qualified game player . while the present invention has been described with reference to exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the true spirit and scope of the present invention . for example , the aforementioned system 100 and methods discussed therein ( e . g ., fig2 - 4 ) may be utilized to receive submissions , rank , display , accept feedback , and ( re ) rank and ( re ) display various forms of information other than game play advice . for example , the present system and methods may be employed in the context of search engine results or queries for on - line audio and video content . the aforementioned system and methods may also be used with respect to ( reverse ) auctions and bidding based on valuation / feedback of a seller , vendor , and / or product . in addition , modifications may be made without departing from the essential teachings of the present invention . various alternative systems may be utilized to implement the various methodologies described herein and various methods may be used to achieve certain results from the aforementioned systems .	0

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.