Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 is a view showing an external appearance of a golf club display supporting device for displaying golf clubs , which is an embodiment of the present invention , a wood golf club being hung from the golf club display supporting device . in the figure , reference numeral 2 designates a flat bar , and 4 is a fixing part 4 . the flat bar and the fixing part cooperatively form coupling part 1 . reference numeral 6 is a hooking part , 8 is a wood golf club , 10 is a face part of the wood golf club , and 12 is a wood head thereof on which advertisement information is stamped . reference numeral 14 indicates a club shaft of the wood golf club , and 16 is a joint part connecting the club head and the club shaft . fig2 is a view showing a picture of a golf club display supporting device from which a wood golf club is hung , which is shown in fig1 . reference numerals used in the figure indicate the same portions as in fig1 . fig3 is a view showing the details of a hooking part 6 shown in fig1 . in the figure , reference numeral 18 designates a concavity 18 for receiving a wood head ( convex part ), and 20 is a guide part for receiving the club shaft of the wood golf club . 22 and 24 designate guide holes in which the flat bar of the coupling part is inserted for coupling . the guide hole 22 is coupled to the flat bar being horizontal to the floor surface . the guide hole 24 is coupled to the flat bar slanted . in fig1 , one hooking part 6 is coupled to the coupling part 1 for simplicity and ease of explanation . multiple hooking parts may be coupled to the coupling part , if necessary . the hooking part 6 is made of resilient rubber or plastic material . accordingly , if the guide holes 22 and 24 are applied to the coupling part , those are firmly coupled , thereby to form a golf club display supporting device from which multiple golf clubs are hung . the concavity 18 of the hooking part 6 , which receives the wood head ( convex part ), is configured so that when the head ( convex part ) of each predetermined kind of wood golf clubs is hung , the convex part fits into the concavity and the head is stably placed therein . in a state that the hooking part 6 is attached to the coupling part 1 as shown in fig1 , an entrance of the guide part 20 to which the club shaft 14 will enter , is opened to the front side to allow the customer to access and to hang the wood golf club 8 from the hooking part , from the front side . accordingly , as shown in fig3 , the openings of the guide holes of the hooking part 6 , which are provided for the coupling to the coupling part , and the opening of the guide part for club shaft hanging operation are oriented in substantially the same directions . in another example of the structure , another flat bar , which is short in length and similar in shape to the flat bar 2 of the coupling part 1 shown in fig1 , is mounted to the flat bar 2 by , for example , welding , at an angle of 90 °. also , the hooking part is coupled to this flat bar . in this example , the openings of the guide holes , which are provided for the coupling to the coupling part , and the opening of the guide part for club shaft hanging operation are substantially orthogonal in direction to each other . in this case , the structure of the coupling part is complicated , and the cost becomes high . to avoid such disadvantages , structures having the openings oriented in substantially the same directions , which is shown in fig1 and 2 , is most reasonable in manufacture in light of cost and space saving . the hooking part 6 shown in fig1 and 3 is provided with the concavity 18 for receiving the reverse side ( convex part ) of the wood golf club , to stably hold the hung wood golf club and to prevent the wood golf club from coming off through the opening of the guide part 20 for holding the club shaft . the concavity 18 includes a support surface 19 for directly receiving the wood head ( reverse side ), a support surface 26 for supporting the face part 10 of the wood golf club 8 , and a support surface 29 for supporting the joint part 16 which couples the wood head 12 with the club shaft 14 ( reverse side of a surface 28 in fig3 ). the hooking part 6 is configured in such way that the gravity center of the wood golf club lies on an extended line of the club shaft vertically raised or the club shaft is slightly pressed against the wall of the guide part 20 , which is opposite to the wall thereof defining the opening of the guide part . with this structure of the hooking part 6 , to hang the wood golf club 8 on the hooking part 6 , the customer places the golf club head upwards , holds and moves the club shaft 14 toward the opening of the guide part 20 from the front side , puts the club shaft 14 in the guide part 20 , makes sure the club shaft 14 is in the guide part 20 , and then gently drops down the wood golf club 8 . in this way , the wood golf club 8 is hung on the hooking part 6 of the golf club display supporting device . at this time , the reverse side ( convex part ) of the wood head 12 of the wood golf club 8 is supported by the support surface 19 of the hooking part 6 , and the entire wood head 12 is hung while being supported by the support surface 19 , a support surface 26 , and a support surface 29 . the joint part 16 connecting the wood head 12 of the wood golf club 8 to the club shaft 14 is seen from the front , and the characteristics of the wood golf club 8 can be seen easily and instantly . the wood head 12 is hung in a state that it is placed firmly within the concavity 18 of the hooking part 6 . the gravity center of the wood golf club 8 lies substantially on the club shaft 14 . however , the club shaft 14 is guided toward the back wall of the guide part 20 of the hooking part 6 . the wood golf club 8 , which has been hung on the hooking part 6 , is stably hung . in the case of fig1 and 2 , the flat bar 2 of the coupling part 1 is oriented parallel to the floor surface . some display locations require the following display of golf clubs . the fore end of the flat bar 2 is slanted toward the floor , and multiple golf clubs are displayed at multiple levels of height from low to high level , in order to provide better visual presentation of golf clubs . the height level of the golf club stepwise increases from the fore end of the flat bar to the rearmost end thereof . specifically , a golf club that is hung at the fore end position of the flat bar is located at the lowest height level , and another golf club that is hung at the rearmost position of the flat bar is at the highest height level . in an actual display , when the golf clubs displayed are of the same kind , there is no problem in using the horizontal type of flat bar to show the golf clubs in the same height . when the golf clubs displayed vary in types , the slanted type of flat bar is much easier to see each piece of golf club and also easy to pick out a desired golf club by making undulation . the hooking part 6 of fig3 is designed such that it is applicable to both the flat bars 2 , which are horizontal and slanted to the floor surface . this feature successfully provides enhancement of production efficiency and cost efficiency , and better merchandise management of the hooking parts . the guide hole 22 is provided for the horizontal type of flat bar , and the guide hole 24 is for the slanted type of flat bar . fig4 is a view showing an external appearance of a golf club display supporting device for hanging iron clubs , which is an embodiment of the present invention . in the figure , reference numeral 30 stands for a flat bar of a coupling part 31 , and 32 is a hooking part . fig5 a - 5c each show a view showing an external appearance of the hooking part shown in fig4 , each view drawn by a trigonometry . in the figure , reference numerals 34 and 36 are guide parts on which club shafts are hung ; 38 is a guide part connecting to the flat bar 30 ; and 40 , 42 and 44 are support surfaces for receiving the iron clubs . fig6 is a view showing the golf club display supporting device shown in fig4 on which an iron club is actually hung . in the figure , reference numeral 46 is an iron club and 483 is a club shaft . other reference numerals indicate like portions in fig4 and 5 a - 5 c . as seen from fig5 a - 5c and 6 , the hooking part 32 is constructed such that when the customer holds the iron club 46 with the club shaft 483 placed at the upper position , and hangs on the guide parts 34 and 36 , the entrances of the guide parts 34 and 36 are faced to the front . usually , the flat bar 30 of the coupling part is oriented to the front . accordingly , the guide part 38 into which the flat bar is inserted for coupling , and the guide parts 34 and 36 are opened in the same directions . the guide parts 34 and 36 face front , so that the traffic line of returning action is short . after the customer picks off the iron club 46 from the golf club display supporting device and examines it by practice swinging and detailed inspection , the customer can easily see the guiding opening during put back action , and all of such matters make it very easy for a customer to put back the golf club in the original position . formerly , the guided opening was located on the right side as viewed from the front . therefore , the customer could not see the opening , and thus it is very inconvenient for the customer to put back the used golf club in the original position . especially , when the customer is aged or left - handed , it was very difficult for the customer to return the used golf club to the original position . in this connection , in the invention , the opening is placed at the front . this feature enables such people to easily put the golf club back to the original position . when the opening was placed in the side , like previously , a message that the customer can pick up the golf club himself / herself was not transmitted to the customer , and even in case that the message did transmit to the customer , the customer could not understand how to pick it off . thus , in this invention , the customer can very easily understand that the customer can easily pick up the golf club by himself , and can quite easily pick it out or put it back in the original position . as a result , the customer could pick up the golf club without any hesitation , and try its swing and inspect the golf club . the customer will highly probably put it back to the original position . this leads to much saving of salesperson &# 39 ; s labor to reorganize the displayed golf clubs . the hooking part 32 includes three support surfaces 40 , 42 , and 44 for receiving the club head 47 of the iron club 46 , and the three surfaces of the club head which come into contact with the support surfaces when it is hung are supported by points , lines or surfaces . particularly , those supporting surfaces 40 , 42 , and 44 are curved in cross section from a v - shape to a u - shape and are slanted toward the guide parts 34 and 36 . accordingly , the iron club , when it is hung , is supported by the supporting surfaces 40 , 42 , and 44 . force acts on the iron club and the iron club slides down to the guide part located on the right side as viewed from the front , while being regulated . finally , the club shaft is brought into contact with the two guide parts 34 and 36 to be held thereat . after all , the iron club 46 is hung so that it is supported by three support surfaces 40 , 42 , and 44 at points , along lines , or on surfaces , and the club shaft is regulated at the two points of the guide parts 34 and 36 . accordingly , the iron club does not come off from the front where the opening parts of the guide parts 34 and 36 are located . one complete set of iron clubs consists of ten pieces of iron clubs # 3 , 4 , 5 , 6 , 7 , 8 , 9 , pw , aw , and sw . the shapes of those clubs and the joint parts to the club shafts are different from one another . in the invention , the way of supporting by the support surfaces 40 , 42 , and 44 of the hooking part is based on points , lines , or surfaces . furthermore , the hanging spaces of the guide parts 34 and 36 are large enough to receive any kind of iron clubs . as a total function , the iron club is roughly controlled by the guide part 34 for controlling the club shaft , and the support surfaces 40 and 44 for controlling the club head direction , and the club shaft slides down into the guide part 36 on the slanted support surface 42 . as a result , the golf club is vertically and firmly hung with no worry that the golf club shaft will fall from the front . fig7 is a view showing an external view of a hooking part of a wood golf club , which is coupled to the coupling part 1 shown in fig1 , which is an embodiment of the present invention . in this embodiment , characters are printed on the surface of the coupling part made of rubber or plastic . a mini - information plate is attached adjacent to the guide part coupled to the coupling part 1 . in fig7 , reference numeral 50 is a hooking part ; 52 is a display surface faced to the front ; 54 is a manufacturer name ; 56 is a concavity for receiving the head ( convex part ) of the wood golf club ; 58 is a printed mark indicating “ rent ” printed on the concavity ; 60 is a guide part for receiving the coupling part ; and 62 is a guide part for receiving an insert piece of a mini - information plate . fig8 is a view showing an external view showing the mini - information plate for presenting an advertisement to be inserted into the guide part 62 of the hooking part 50 . in the figure , reference numeral 64 is a mini - information plate , 66 is an advertisement surface ; and 68 is the insert piece to be inserted into the guide part 62 . the hooking part 50 shown in fig7 posts the name of the golf club manufacturer and the brand name of the golf club to make easy understanding of the displayed item . also , when the customer picks up the golf club , the printed mark 58 of “ rent ” appears , and by this , the customer is guided to put them back naturally in the original position after use . it is very important to show information , such as manufacturer &# 39 ; s names , brand names , and the kinds of the golf clubs , which are displayed on the multiple hooking parts coupled to the coupling part of the golf club display supporting device . nevertheless , those are displayed floating , and thus indication by each coupling part was formerly very difficult . the front piece of the hooking parts coupled to the coupling part is constructed as shown in fig7 . the insert piece 68 of the mini - information plate 64 shown in fig8 is inserted into the guide part 62 , and the manufacturer name , brand name , kind of golf club , and additional catch - copies , cm , and the like are displayed on the advertisement surface 66 of the mini - information plate 64 . such display helps the customers for selection of golf clubs by clearly telling the difference . the golf club display fixture shown in jp - a 2004 - 136069 is already widely used in golf shops , for sales promotion purposes , and in display units . as introduced above , it is certain that the invention of the present patent application will be further enforced and utilized in the golf club display world . it should be understood that the present invention is not limited to the embodiments described above , but the invention may be changed , modified , and altered within the true spirit of the invention .	0
please refer to fig1 , which shows a heating chamber having a non - reactive layer of the instant disclosure . the heating chamber can be adapted in a variety of heating devices . for explaining purposes , a box - shaped heating device is disclosed herein . the heating device having a main body 1 , a door 2 , and a heating chamber 11 formed inside the main body 1 for receiving loads to undergo thermal treatment . the door 2 is hinged on the front edge portion of the main body 1 for opening and closing the heating chamber 11 . the heating chamber 11 may be a variety of geometric shapes , including rectangular , circular , or polygonal . the heating chamber 11 can also include furnace tubes or working tubes . for the instant embodiment , the heating chamber 11 is rectangular - shaped . at least one heater ( not labeled ) is arranged on the main body 1 for heating . please refer to fig2 , which shows the heating chamber 11 having at least one metal layer 111 coated with at least one non - reactive layer 112 . the metal layer 111 can be made of stainless or other metallic materials . the non - reactive layer 112 can be made of nitride , carbide , oxide , or boride . in other words , the non - reactive layer 112 may be a nitride , carbide , oxide , or a boride film . for the instant embodiment , the non - reactive layer 112 is made of titanium nitride ( tin ), but is not restricted thereto . the thickness of the non - reactive layer 112 is not restricted , which can be a thin or thick film depending on the application . the non - reactive layer 112 can be coated onto the metal layer 111 by spraying , thermal spraying , plasma spraying , or physical / chemical deposition . the non - reactive layer 112 can have plate - like shape and be arranged onto the metal layer 111 . the technique of disposing the non - reactive layer 112 is not restricted . please refer to fig3 , which shows the heating chamber 11 can further include a protecting layer 113 . the protecting layer 113 can be a glaze , which is shiny , wear - resistant , and high - temperature resistant . the protecting layer 113 is disposed on the non - reactive layer 112 and can be bonded by heat treatment . the protecting layer 113 increases the protection capability and fills any potential surface crevices of the non - reactive layer 112 . other benefits include enhancing high - temperature resistance and anti - corrosion capability . please refer to fig4 and 5 , which show two embodiments of the heating chamber 11 having a tubular shape and an inverted bucket - like shape , respectively . each heating chamber 11 has at least one metal layer 111 covered with at least one non - reactive layer 112 . please refer to fig6 , which shows the steps of a method for forming the non - reactive layer for the heating chamber . the method mainly utilizes the chemical vapor deposition technique with the following steps ( please refer to fig1 , 2 , and 6 ). first , use weak acid or weak base to wash and clean the bonding surface of the metal layer 111 ( step s 1 ). next , use nitrogen , argon , or dry air to dry the bonding surface by forced convection ( step s 2 ). then , the heating chamber 11 is vacuumed ( step s 3 ), followed by introducing various reactive gases into the heating chamber 11 ( step s 4 ). the gases include hydrogen ( h 2 ), nitrogen ( n 2 ), titanium tetrachloride ( ticl 4 ), and ammonia ( nh 3 ). for each preceding gas , the ratio is 30 ˜ 50 vol . % for hydrogen ( e . g . 35 ˜ 40 vol . %), 30 ˜ 50 vol . % for nitrogen ( e . g . 35 ˜ 40 vol . %), 0 . 1 ˜ 5 . 0 vol . % for titanium tetrachloride ( e . g . 0 . 5 ˜ 1 . 0 vol . %), and 1 ˜ 25 vol . % for ammonia ( e . g . 5 ˜ 10 vol . %). then , these reactive gases are heated to a reactive temperature of 600 ˜ 700 degree celsius ( step s 5 ). at this temperature , the metal layer 111 of the heating chamber 11 would react with the reactive gases in forming the titanium nitride layer , or the non - reactive layer 112 , above its surface ( step s 6 ). the abovementioned steps can be completed prior to assemble the heating chamber 11 to the heating device . if such option is chosen , the vacuuming and delivering / heating of reactive gases need to be completed by other apparatuses . alternatively , these steps can also be carried out after the heating chamber 11 has been assembled to the heating device . with such option , the procedures of vacuuming and delivering / heating of reactive gases can be done with the heating device itself . please refer to fig7 , which explains an alternative method for forming the non - reactive layer . the method involves spray coating and sintering with the following steps ( please refers to fig1 , 2 , and 7 ). first , use weak acid or weak base to wash and clean the bonding surface of the metal layer 111 ( step s 1 ). next , use nitrogen , argon , or dry air to dry the bonding surface by forced convection ( step s 2 ). then , ceramic powders are sprayed over the metal layer 111 of the heating chamber 11 ( step s 3 ). the composition of the ceramic powders may include kaolin ( 5 ˜ 10 wt . %), feldspar ( 20 ˜ 80 wt . %), limestone ( 1 ˜ 40 wt . %), dolomite ( 1 ˜ 15 wt . %), wollastonite ( 5 ˜ 10 wt . %), corundum ( 1 ˜ 15 wt . %), and quartz ( 1 ˜ 50 wt . %). these ceramic raw materials are grind into fine powders and mixed uniformly . then , the ceramic powders are heated to a sintering temperature of approximately 1000 ˜ 1400 deg . celsius ( step s 4 ). for example , the non - reactive layer 112 ( glazed layer ) can be formed at a sintering temperature of 1200 deg . celsius ( step s 5 ). by overlaying the metal layer 111 for the heating chamber of the heating device with the non - reactive layer , the heating chamber can be protected from chemical reaction . the anti - corrosion capability of the heating chamber is enhanced . when special gases or inert gases are introduced , the heating chamber is better protected against chemical reactions . in addition , the non - reactive layer 112 enhances the structural strength of the heating chamber by preventing the formation of cracks due to brittleness , thus a longer service life can be expected . the descriptions illustrated supra set forth simply the preferred embodiments of the instant disclosure ; however , the characteristics of the instant disclosure are by no means restricted thereto . all changes , alternations , or modifications conveniently considered by those skilled in the art are deemed to be encompassed within the scope of the instant disclosure delineated by the following claims .	2
now , preferred embodiments of the present invention will be described in detail with reference to the annexed drawings . for the purposes of clarity and simplicity , a detailed description of known functions and configurations incorporated herein will be omitted as it may make the subject matter of the present invention unclear . in order to not only create a logical link using point - to - point emulation but to create a logical link in the form of an exclusive private link in a point - to - multipoint epon system , which is comprised of a single olt 100 and a plurality of onus 110 - 1 to 110 - 3 connected to the olt 100 , the present invention adapts individual logical links as granularity of a security service to encrypt the logical links , such that the system allows the transmission of confidential data . further , the present invention implements logical virtual lan topology in a physical network using a vlan technique and further provides basic a qos ( quality of service ) and a sla ( service level agreement ). according to the teachings of the present invention , an llid ( logical link id ) for use in point - to - point emulation is inserted into an ethernet frame . to assign a group id to several vlans using the llid and to perform a rate limiting function and a service segregation function using the llid , the present invention provides an encryption operation by considering the llid to be a combination of vlans or similar ids , then performs an encryption operation . further , the present invention provides a mechanism to insert either a predetermined field for checking data integrity or a predetermined field for checking data origin integrity into the ethernet frame , then encrypts the fields along with a predetermined message . [ 0030 ] fig2 illustrates a message format of an epon ethernet frame in accordance with a preferred embodiment of the present invention . as shown in fig2 an ethernet message frame according to the present invention includes a pa ( preamble ) field 200 , a da ( destination address ) field 202 , a sa ( source address ) field 204 , a clear pon tag header field 206 , a protected tag header field 208 , a pdu field 210 , a pad field 212 , an icv ( integrity check value ) 214 , and a fcs ( frame check sequence ) field 216 . the clear pon tag header field 206 functions as a security frame and indicates transmission of security data . the clear pon tag header field 206 will be described later with reference to fig3 . the protected tag header field 208 is an optional field and functions as an encryption field . the protected tag header field 208 is used to transmit various optional information associated with a data originating station , for example , integrity check information , security label information , fragment id information , and flag information , etc . the pad field 212 is an optional field . provided that a confidentiality algorithm or an integrity algorithm used in a system need data of a prescribed length , the pad field 212 may be added to the ethernet message frame according to the data length . in the embodiment , there is no need for the pad field 212 to use a mechanism for maintaining a prescribed packet length , for example , an ocb ( offset code back ) mode , and a csr ( counter ) mode , etc . of cryptology . in the case of an algorithm for requiring a padding process , a prescribed field for indicating a pad length must be added to the last area of the pad field 212 . the icv field 214 is adapted to check message integrity . for example , if an ocb mode using an aes ( advanced encryption standard ) is adapted as an encryption algorithm , the icv field 214 has a predetermined check sum of either 4 bytes or 10 bytes . the range of the integrity check may also be applied to even a protected tag header field 208 , a pdu ( packet data unit ) field 210 , and a pad field 212 . [ 0035 ] fig3 is a view illustrating a detailed configuration of the clear pon tag header field 206 contained in the ethernet message frame format shown in fig2 in accordance with a preferred embodiment of the present invention . as shown in fig3 the clear pon tag header 206 used for a security purpose includes a designator 300 for indicating the ethernet frame serving as a particular tagged frame , a paid ( pon association id ) field 302 , and an optional field 304 . the mdf ( management defined field ) serving as an optional field 304 is shown in fig3 . in operation , the designator 300 can be set to a prescribed value ‘ 0a0a03 ’ by concatenating a hexadecimal value ‘ oa0a0a ’ being a redundant lsap ( link service access point ) of 2 bytes and an uic ( unnumbered information control ) value ‘ ox03 ’ of 1 byte , such that it can be compatible with the ieee 802 . 10 . the paid field 302 includes identifiers ( ids ) for identifying individual onus ( 110 - 1 to 110 - 3 ) to perform peer - to - peer communication . the ids classify services associated with the onus ( 110 - 1 to 110 - 3 ) into services for every user group in order to perform a service segregation function or a traffic segregation function . here , the ids may be assigned different keys , respectively , such that it can be considered to be an entity object needed for performing a security service . the paid field 302 further includes an llid field 312 for identifying the onus ( 110 - 1 to 110 - 3 ) or management entities , such as different service providers , and an sid ( security id ) field 314 for adapting the llid field 312 as a group id to create a plurality of entities controlled by a single onu 110 - 1 , 110 - 2 , or 110 - 3 . here , a variety of classes are provided according to the total number of the sids controlled by the management entity , and the number of llid fields 312 and the number of sid fields 314 can be limited in the classes . it is preferable that a 3 - bit group bit 310 having a prescribed value ‘ 101 ’ adapts the llid field 312 of 17 bits and the sid field 314 of 12 bits to establish compatibility with the ieee 802 . 10 . in this case , an llid field 312 may be comprised of a mode bit of 1 bit for indicating a broadcast / unicast mode , and a real llid 312 of 16 bits . the sid field 314 corresponds to a vlan id in the case of using a conventional vlan technique . i the embodiment , a combination of 65 , 536 numbers of different onus 110 - 1 to 110 - 3 and a manager can support 4096 number of different vlans . provided that a destination is a multicast group id , the paid field 302 may be set to a common value of all users contained in a corresponding group . in more detail , the management entity allocates a single multicast group paid to a multicast group address , and a prescribed key is assigned members of the group to perform a security service in such a way that multicast data can be managed and controlled . finally , the mdf ( management defined field ) 304 is an optional field to store various mib ( management information base )— associated information or protocol information associated with the mib information . as illustrated above , the present invention creates a security data transmission frame shown in fig2 and 3 , and transmits the created frame in such a way that security data can be transmitted over the epon . [ 0043 ] fig4 is a view illustrating an epon protocol stack in accordance with a preferred embodiment of the present invention . in particular , fig4 shows a layered configuration displayed in the form of a protocol stack to perform a security communication function in the epon system . as shown , the epon protocol stack includes a plurality of mac ( media access control ) client layers 400 - 1 and 400 - 2 , a mpcp ( multi - point control protocol or mac control ) layer 402 , a mpcp work layer 420 for performing a variety of mac control functions such as key management , llid allocation , and db management , etc ., an encryption layer 404 , a mac layer 406 , an rs layer 408 , a pcs layer 410 , a pma layer 412 , and a pmd layer 414 . the security data transmission frame shown in fig2 and 3 is created from the encryption layer 404 . [ 0044 ] fig5 is a view illustrating an encryption layer contained in the epon protocol stack in accordance with a preferred embodiment of the present invention . in particular fig5 shows a detailed diagram of a primitive of the encryption layer 404 contained in the epon protocol stack shown in fig4 . referring back to fig3 and 5 , a plurality of paid fields 302 are adapted to identify entities for performing service / traffic segregations and may indicate entities assigned with different keys . alternatively , the paid fields 302 allocate different keys to group ids for every onu and may perform the service / traffic segregation for every sid . if there is no security service , a prescribed value for indicating an ieee 802 . 10 vlam frame is recorded in the designator field 300 , then a real vlan id is recorded in the sid field 314 contained in the paid field 302 . as such , vlan spaces for every service provider or every onu can be extensively created without using an overhead associated with an encryption process , thus avoiding any limitations in a qos , a sla , and a transfer rate . note that encryption information for indicating encryption completion or unused encryption may change an rtt ( round trip time ), which is consumed during a round trip of a real packet due to an encryption processing time . therefore , it is preferable for an encryption engine to perform a parallel processing such that a processing time is consumed irrespective of a packet length . the same delay time as the encryption process must be created to guarantee a fixed rtt even in the case of an encryption - disabled packet . in the case of supporting a security service , a transmitted message is triggered at the mac clients 400 - 1 and 400 - 2 and is then transmitted to the encryption layer 404 . in this case , the clear tag header 206 is inserted from the mac upper layer 402 to the encryption layer 404 . thereafter , as shown in fig5 a plurality of messages such as a da message , a sa message , an m_sdu message , etc . are transmitted to the encryption layer 404 . the protected tag header field 208 and the pad field 212 associated with a security mechanism are inserted into the encryption layer 404 according to the encryption information . the encryption layer 404 contains an integrity check field for performing an integrity check operation and encrypts the protected tag header field 208 , the pad field 212 , the fault check field , and the icv field 214 along with their messages . that is , the encryption fields of the ethernet frame ranges from the protected tag header field 208 to the icv field 214 . the ma_unidata . request field 501 is equal to an ethernet frame other than the fcs field 216 in an ethernet message frame format defined in fig2 . for error correction , the fcs field 216 for checking whether a physical error occurs in a mac frame having encrypted data is added to the mac layer 406 . the mac layer 406 performs an fcs check operation on the received message in association with all the ethernet frame fields ( da ˜ icv ) 202 to 214 having encrypted data of ethernet frames transferred to the mac layer 406 . the mac layer 406 receiving the ethernet frame using the above method compares its own fcs result value with a value of the fcs field 216 contained in the received ethernet frame , and then transmits the resultant value to the upper layer as a receive_status signal . in this case , the mac layer 406 removes the fcs field 216 from the ethernet frame . thereafter , a decryption process and an integrity check process are sequentially performed and their result values are compared with a value of the icv field 214 . if the result values are different from the value of the icv field 214 , information indicating such information is recorded in a message integrity break count field . provided that the fcs check procedure is performed completely as a check sum of the encryption field is equal to the fcs value and the fcs , this condition indicates that there is no error due to faults of a link or process . meanwhile , if a check sum of the icv field decrypted by a decryption process is equal to a value of the icv field , this condition indicates that the check sum value is encrypted using a correct key , such that it can be recognized that a message has integrity . therefore , the fcs check is adapted to check an error of a link or a process , and the icv check is adapted to check integrity of either a message contained in an ethernet frame or a message source . therefore , the pad field 212 , the encryption tag , and the icv field 214 are removed to prevent unnecessary data transmission to mpcp , and the present invention transmits the clear tag header field 206 containing the paid field 302 , the pdu field 210 , the da field 202 , the sa field 204 to the mac clients 400 - 1 and 400 - 2 . as apparent from the above description , the present invention inserts an llid field 312 serving as a logical link into the ethernet message frame and transmits the ethernet message frame having the llid field 312 , thereby implementing a phy ( physical layer )— independent technique . therefore , the present invention can be compatible with various physical environments associated with other physical layers and network topology . in addition , because a group id is assigned the llid field 312 in association with individual onus ( 110 - 1 to 110 - 3 ) or service providers , the magnitude of vlan space is extended and interoperability among vlans is implemented . as a result , the present invention can implement service segregation , traffic segregation , and transfer rate limitation services using the paid field 302 if needed . furthermore , the present invention performs key management services for every llid field 312 or every paid field 302 , such that security services associated with data integrity , data source integrity , and confidentiality are available . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .	7
a preferred embodiment of the invention will now be described by reference to the figures of the drawing . looking at fig1 and 2 , the basic structure of the toy cash register may be seen . reference numeral 1 indicates the device , which is provided with a cash drawer 2 , operating keys 3a , 3b , 3c and 3d which may have any predetermined value of money printed thereon or formed therein in the case of for example , plastic keys . in the present showing , u . s . values of ten cents , twenty - five cents , fifty cents , and one dollar respectively are provided on these keys . an open key 4 is provided which when depressed , will effect positive opening of the cash drawer . furthermore , if the total number of items on a given program plate have been already &# 34 ; rung up &# 34 ; by an operator of the device by depressing the correct keys 3a - 3d , then the plate will be ejected . simultaneously , a bell will be rung , and a &# 34 ; thank you !&# 34 ; will appear in the window 5 . reference numeral 6 indicates a slot at the top of the device into which a program plate is inserted . a plurality of different program plates are normally provided with each toy cash register . looking at fig3 and 4 , the operating mechanism of the device may be seen , in these figures the outside cover which normally encloses the upper portion of the device has been omitted . a base 100 has provided thereon a vertical support 102 . the device is preferably made of plastic with the base 100 being formed thereof . the vertical support portion 102 consists of separate pieces which are assembled together and then inserted into the base . conventional fabrication techniques are used in forming these parts . the vertical support portion 102 , preferably formed of several basic components , when assembled provides a vertical channel 6 for reception of the program plates 7 . also mounted within this channel is an actuating traverse plate 8 provided with a pin 8a extending rearwardly therefrom for attachment of one end of spring 12 . spring 12 in turn passes around a direction changing pulley 13 and the other end thereof is attached to a pin 10a provided on the rear portion of the vertical support structure 102 . a slide rod 46 is mounted upon suitable support projections provided on the rear of the vertical support structure 102 . as can be seen in fig4 this slide rod 46 diverges at an angle from the vertical center line of the device . a slide plate 50 is supported by means of right angle projections 53 upon this diverging rod 46 . suitable apertures are provided in the projection 53 slightly larger in size than the diameter of rod 46 to permit this sliding function as indicated by the double headed arrow a . protrubances 52 are also provided on the slide plate 50 , as well as a projecting arm 54 with a horizontal plate 55 integrally therewith . the purpose of the horizontal plate 55 is to engage the end of a pin hammer 58 . this pin hammer 58 is suitably mounted in apertures provided in the projections 57 also integral with the vertical support structure 102 . the pin hammer 58 is provided with an enlarged head portion 59 which in turn strikes the bell 60 when moved in the upward direction as indicated by the double headed arrows b . thus , as can be easily visualized , each time the slide plate 50 moves upwardly with corresponding upward movement of horizontal plate 55 , the lower end of the pin hammer 58 will be engaged , thus lifting same with a sharp upward movement into striking engagement with bell 60 , and thus ringing same . an extending projection 48 mounted on the back of traverse plate 8 will engage with the respective protrubances 52 on slide plate 50 each time the traverse plate 8 moves vertically upwardly . this movement occurs in a step by step manner as determined by the control abutments 72 of a program plate inserted in the channel 6 of the support structure 102 . each time the projection 48 engages with the next protrubance 52 and lifts the slide plate 50 vertically , the slide plate 50 also moves to the right as seen in fig4 along slide rod 46 until the projection 48 disengages from the respective protrubance 52 . thus , a bell ringing function is effected each time a correct key , or proper combination of keys are depresssed in order to permit the associated program plate movement upwardly to the next program abutment , to be described below . thus , a single ding of the bell 60 occurs for each correct key ring up . a stop 154 provided on the support structure 102 limits total upward movement of slide plate 50 by means of engagement with the portion 54 of the slide plate . double headed arrow c indicates this movement . another projection 56 also mates with a limit stop 156 in similar manner to limit the downward movement of the slide plate 50 . looking at fig5 - 7 , the individual program plate structure and associated latching pawl structure will be described in detail . as seen in fig5 a program plate 7 has been inserted into the channel 6 of the support structure 102 and moved downwardly against traverse plate 8 to tension the spring 12 . latching pawls 123a , 123b , 123c , and 123d respectively normally project into the areas of the program plate side channels 7a - 7d . each of the respective pawls are provided with an upward tapered surface to permit ready and easy insertion of a program plate into channel 6 and past the pawls , but the sharp pointed lower edge portion of each pawl preventing upward movement of the program plate when in engagement with a suitable abutment 72a , 72b , 72c , or 72d as provided in the program plate side channels . each pawl 123 is suitably mounted on a flexible arm 121 from the main latching plate 21 . each latching plate 21 is provided with a suitable bearing portion 221 which is provided with a central aperture therethrough for pivotally mounting upon shaft 20 . shaft 20 being in turn suitably supported from support portions 120 provided on the vertical support structure 102 ( see fig7 ). each flexible portion 121 of the latching structure is tensioned by a small spring 91 . the spring 91 provided for each of the latching pawl key plates 21 maintains the tips of the latching pawls in a normally horizontal position . however , whenever a respective tip engages with an abutment 72 of a program plate , the respective spring 91 will permit a slight upward movement of the pawl and allow flexibility of operation thereof . each pawl latching plate 21 is provided with a lower portion 24 configured as shown having both a projecting pin 24a and a projecting right angle plate 24b integral therewith . suitable projections on the plates 24b and on the support structure 102 maintain bias springs 23 in place for their respective latching pawl plates 21 . a support shaft 25 , suitably mounted on the support structure 102 by integral projections 125 support the plurality of keys for pivotable movement . in the four key device shown , the first key 3a having the money value of ten cents is shown as mounted for pivotable rotation upon shaft 24 . a portion 126 of each key engages with the respective pins 24 as provided on each of the pawl key latching plates 21 . thus , each of the springs 23 , in this example four in total number , will keep the respective keys 3a - 3d in the normal horizontal position as best seen in the views of fig1 and 5 . however , when a key is depressed , the key member 26 will move downwardly as indicated by arrows e in fig5 and 7 to actuate the latch pawl plate 21 in the direction f of fig5 . in the examples of fig5 and 6 , the latch pawl 123a is in engagement with the abutment 72a as shown in fig5 . another abutment in the next program channel 72b is indicated in dotted lines in fig5 . when key 3a is depressed , latch pawl 123a will be moved towards the right as indicated by arrow g in fig5 . when the latch pawl 123a is moved to the far right as shown in fig6 the program plate 7 will be moved vertically upwardly because of the traverse plate a and spring 12 until latch pawl 123b engages with the obstruction 72b in program plate channel 7b . at this point , the vertical upward movement of program plate 7 will be stopped . thus , as can be readily visualized , only when the correct key is depressed , will the proper latching pawl be disengaged from its respective program channel abutment . of course , if two keys are needed for a correct total value such as twenty - five cents and fifty cents for the value of seventy - five cents , appropriate abutments 72b and 72c will have been provided in the channels 7b and 7c of the program plate and thus both keys will necessarily have to be depressed in order to remove both latching pawls 123b and 123c from engagement with their corresponding abutments . this simple , yet effective structure provides the very important feature of requiring correct ring up for each item of merchandise before the next item will appear in the viewing window for an operator . thus , while being a fun toy , it is also a very educational one . the bell 60 also is utilized for a long ringing cycle whenever the open button 4 is depressed with simultaneous opening of the cash drawer and ejection of the program plate if merchandise totalization has been effected . the mechanism for accomplishing this is best seen in the perspective of fig8 . the &# 34 ; open &# 34 ; button 4 is mounted upon a pivot member 40 having provided at the opposite end thereof with a pawl 41 . the pivot member 40 is also provided with a bearing aperture 43 therethrough for mounting thereof upon the same shaft 20 as the key pawl plate members are mounted . a spring 63 is attached between a pin 62 on the vertical support 102 and a pin 64 on the pivot member 40 to bias this member in the locking position of pawl 41 . pawl 41 will engage a suitable projecting lip 71 on the lower portion of each program plate when the plate moves upwardly to the totalization position thereof . thus , after all the proper money value keys 3a - 3d have been correctly depressed and the program plate is in the upmost totalization position for the total times rung up , the pawl 41 will retain the plate in this final position . then , when the open button 4 is depressed , member 40 will be rotated about shaft 20 against the bias tension of spring 63 , and the pawl 41 will be removed from blocking engagement with the botton lip 71 of a program plate , and at this point the program plate will be completely released . then because of traverse plate 8 and the remaining tension of spring 12 , it will be forceably ejected upwardly in a &# 34 ; pop - up &# 34 ; manner . this of course , creates excitement similar to a &# 34 ; jack - in - the - box &# 34 ; type device for an operator of the register . simultaneously with the ejection of the program plate , the transverse plate 8 will move to the top position within the guide channel 6 in support structure 102 . the front side of the traverse plate 8 preferably is provided with wording such as &# 34 ; thank you !&# 34 ; which then becomes visible in the viewing aperture 5 for easy reading by an operator . a projection portion 45 provided on member 40 and almost directly below the open button 4 is designed for engagement with the cash drawer latch plate 70 . the cash drawer release pawl 74 is mounted on the other end of plate 70 which is freely pivotally mounted upon a shaft 80 . shaft 80 is mounted from the main base frame by supports 82 in a conventional manner . a projection 162 on the base frame retains one end of a bias spring 163 , while the other end of the spring is retained by a projection 164 on pivot plate 70 . a side extension 61 assures alignment of the projection 45 of the open key member with the tip end of plate 70 . also mounted on one side of the shaft 80 is a coiled spring 84 having one end retained by a pin 83 on support 82 . the other end of spring 84 is fastened to a pin 85 on the small gear 86 . the teeth of gear 86 mate with rack teeth 88 provided on the cash drawer . thus , as can be readily visualized , when the open button is depressed , the pawl 41 permits the program plate ( if at the total position ) to be forceably ejected , and the pawl 74 being released from the panel 79 of the cash drawer permits the cash drawer to be automatically opened because of the coil spring 84 , the gear 86 and the rack 88 . the gear 86 is pinned or secured to the shaft 80 , so that when the spring 84 effects rotation of the gear 86 to open the cash drawer , it also positively rotates the shaft 80 . secured at the opposite end of the shaft 80 from the gear 86 is another larger gear 90 fixed to shaft 80 . the gear 90 thus will turn whenever shaft 80 is rotated . mating with the gear 90 is a small pinion 92 freely rotatably supported from the frame structure , and having secured thereto parallel support plates 94 . these support plates 94 have pinned therebetween at each of the respective ends thereof metal discs 96 . these metal discs 96 have enlarged central apertures therein slightly larger than the pins which retain them . thus as the parallel plates 94 are rapidly rotated by means of the drive from shaft 80 to gear 90 and pinion 92 , the discs 96 will move slightly outwardly because of centrifugal force and thus engage with the bell 60 . this will create a relative long continuous ringing of the bell as the cash drawer is opened and the program plate is ejected in &# 34 ; pop - up &# 34 ; manner . since the discs 96 are loosely mounted on their pivot axis they will move inwardly as necessary to bypass the bell after hitting same , and thus not be stopped from rotation thereby . thus , the toy cash register of this invention will permit times to be rung up only by depression of the correct money key or keys , which when depressed in the correct manner , will permit the program plate to move upwardly to show the next item of merchandise in window 5 and also the corresponding dollar and cents amount therefore . then , when the next correct key or keys are depressed , the program plate will once again move upwardly to show the next item of merchandise and the correct dollar figure . upon completion of all of the items depicted on a program plate , in this example five items of merchandise , when the last item is added the total amount of all items will appear in the viewing window . thus , an operator will have an informative correct amount of all items added appearing in the window . at this point , the educational part of the device ceases and everything is ready for the entertainment and excitement phase . nothing further will happen until the open key . when the open key is depressed , then the program plate will be forceably ejected upwardly in a vigorous manner , the &# 34 ; thank you !&# 34 ; sign will appear , the cash drawer 2 will be opened quickly and positively to the front , and the bell 60 will be rung for a substantial period of time . all of these occuring simultaneously add a great deal of excitement and suspense to the overall device . while in fig1 and 2 of the drawings a program plate is shown having meats depicted thereon with a total sum therefore of $ 4 . 20 , many other types of food merchandise , as well as other items of merchandise may be depicted on different program plates . for example , in fig5 - 7 , a program plate depicting various types of flowers with the money values therefore and a total of $ 3 . 45 is shown . program plates depicting merchandise such as toys , fruits , cakes , and the like are envisioned for the toy cash register of this invention . normally , different items are depicted on both the front and back surfaces of a program plate with the program channels , preferably two along each of the side edges of the program plates , with corresponding abutments as described previously being provided . the size of the program plates normally are just slightly smaller than the interior of the cash drawer so that for storage purposes , the plates may be stored within the cash drawer , and with the cash drawer closed , form a compact item for shipping , distribution , and selling . of course , for this function of the device to be available , the cash drawer must be openable by pushing the open button without a program plate being in place . the aforedescribed mechanism is thus so designed . another important feature of the toy cash register of this invention is in the fact that all of the operating springs are tensioned and cocked by the operator of the toy . that is , no batteries , motors , or any other type of replaceable energy sources are necessary . this is a great advantage when toys are to be operated by young children and the like who may inadvertently leave them on and thus quickly run down the usual battery of such powered devices . thus , in this invention by inserting the program plate into the device , the traverse plate with bias mechanism therefore is tensioned and cocked . similarly , when closing the cash drawer , the spring for the positive operation and opening of the cash drawer as well as for ringing the bell in the loud signalling manner is also tensioned and cocked . the spring for the traverse plate also is used for actuating the signal bell each time an item is rung up . thus , all of the moving mechanisms being operated by various spring structure , are tensioned and put into operating condition by the operator . a very important advantage in such a toy . thus , this invention provides both an accurate and correct educational feature as well as one of high entertainment and pleasure value . the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	0
fig1 shows a dynamic frequency hopping system 100 that makes frequency hopping pattern assignments based on information that is detected by terminals throughout the system , information derived from the detected information and / or information resulting from decisions made throughout the system . the dynamic frequency hopping system 100 includes a network 102 and base stations 110 , 112 and 114 . the base stations 110 - 114 are coupled to the network 102 which provides inter - base station communication for allocating wireless network resources for frequency hopping . the dynamic frequency hopping system 100 also includes terminals 134 - 136 wirelessly communicating with the base stations 110 - 1 14 via links 104 - 108 , respectively . associated with each of the links 104 - 108 is a link neighborhood 116 - 120 . fig1 shows the link neighborhoods 116 - 120 as contours which may be defined based on parameters such as geographic areas , interference and / or noise thresholds , n largest interference / noise sources , etc . as an example , fig1 shows link neighborhood 118 of link 106 including link 104 while excluding link 108 . each of the terminals 134 - 136 may detect or measure information such as path gain between each of the terminals 134 - 136 and the base stations 110 - 114 and transmit the detected information to a select one of the base stations 110 - 114 . the terminals 134 - 136 may select a respective base station 110 - 114 based on path gain information . for example , the terminal 134 may detect signal strength from control signals being transmitted by each of the base stations 110 - 114 and select the base station 112 because the path gain with the base station 112 is the largest . then the terminal 134 transmits all the detected information or information derived from the detected information to the base station 112 . the control signal transmitted by the base station 110 - 112 may include a base station identification , an identification of a channel on which a terminal 134 - 136 may transmit the detected information , etc . as is well known in the art . when a request for a link 106 for the terminal 134 is received ( e . g ., the terminal 134 makes a call or the terminal 134 receives a call ), the base station 112 may allocate wireless communication resources to the link 106 based on resource allocation techniques disclosed in u . s patent applications entitled “ allocation of wireless network resources ” filed by chawala et al ., on dec . 3 , 1999 , having ser . no . 09 / 453 , 565 ; and “ wireless resource allocation ” filed by chawala et al ., on dec . 3 , 1999 , having ser . no . 09 / 453 , 566 , for example . both of the above - two u . s . applications are hereby incorporated by reference . instead of a single frequency or channel as discussed in the above applications , a frequency hopping pattern is allocated that optimizes the system . the dynamic frequency hopping system 100 assigns the frequency hopping pattern to the terminal 134 based on the techniques applied to channels in the above applications . fig2 shows an example of a frequency hopping pattern 200 that may be assigned to the terminal 134 . the frequency hopping pattern 200 includes a pattern of eight different frequencies 202 - 216 where each frequency is used for transmission for a duration ( or dwell ) of 10 milliseconds ( ms ). the sequence of frequencies is the hopping pattern that is assigned and transmitted to the terminal 134 . the terminal 134 communicates with the base station 112 by transmitting information in the frequency sequence and duration of each frequency as specified by the frequency hopping pattern . thus , the terminal 134 may begin by transmitting information using frequency 202 for a duration of 10 ms and then transmits information using frequency 204 for the next 10 ms , and so on . when transmission using the frequency 216 is completed , the terminal 134 repeats the frequency hopping pattern until either the communication is completed or until the frequency hopping pattern is changed by the base station 112 . while the exemplary frequency hopping pattern 200 shows eight frequencies of 10 milsecs per frequency and a frequency range varying between 810 mhz to 880 mhz , the particulars of a frequency hopping pattern may be changed and adapted based on specific implementation details . for example , the frequency range of the hopping pattern may be regulated by various government entities and the duration of each of the frequencies in the frequency hopping pattern may be determined based on wireless transmission conditions such as noise environment , congestion , etc . this invention provides a dynamic frequency hopping system 100 that selects a frequency hopping pattern which optimizes system performance . conventional frequency hopping patterns provides benefits of interference averaging achieved by channel coding over multiple hops . thus , if one or a few hops experience strong interference , the transmitted information can still be reliably recovered . therefore , interference averaging provides robustness to sudden change in one or more interferers as well as robustness to measurement and estimation errors and fading of the channel . this invention further extends the benefits of frequency hopping by ensuring that the frequency hops experience weaker interference by avoiding strong interferers . it is assumed that all the links 104 - 108 are synchronized ( i . e ., frequency and frame ) so that all the links 104 - 108 hop from one frequency to another frequency at substantially the same time . thus , interference among the links 104 - 108 may be determined without considerations of the percentage of time that interference may occur . additionally , it is assumed that interference between links occurs when the links 104 - 108 are communicating within a same frequency neighborhood ( i . e ., those frequencies whose cross frequency interference exceeds a threshold set as a system parameter ). for a frequency neighborhood of 1 , interference occurs when more than one link 104 - 108 communicate using the same frequency . however , adjacent frequencies may also interfere . thus , depending on specific circumstances , frequency neighborhoods of more than one may be considered . in the following discussion , frequency neighborhood of 1 is assumed . thus , different frequencies in a frequency hopping pattern are assumed not to interfere with each other . however , the following discussion may be extended to frequency neighborhoods of greater than 1 . as is discussed below , the signal - interference - plus - noise - ratio ( sinr ) of a link may be defined in terms of power and path gains of all currently active links for a frequency neighborhood . thus , to avoid any interference , all of the frequencies assigned to frequency hopping patterns for currently active links may not be assigned to another link for the same dwell period . however , if two links are separated in such a way that the path gains between a receiver of one link and a transmitter of another link is below a path gain threshold , then the two links may be considered non - interfering and frequencies of the same frequency neighborhood may be assigned to the two links for the same dwell period . based on the above , a link neighborhood may be associated with each link where a first link ( a transmitter of the link , for example ) may be included in a link neighborhood of a second link ( a receiver of the second link , for example ) if the path gain between the respective transmitter and receiver of the two links is less than a path gain threshold . based on the above , the link neighborhood 118 of fig1 includes the link 104 if the link 104 is a downlink from the base station 110 to the terminal 134 and the link neighborhood 116 includes the link 106 if the link 106 is uplink from the terminal 134 to the base station 112 . the size of the link neighborhoods 116 - 120 may be adjusted depending on a particular cost / performance levels desired . the link neighborhoods 116 - 120 may be selected based on a trade off between optimizing performance of the wireless communication system 100 and resources of the network 102 ( i . e ., costs ) that are required to support that performance . in the ideal case , the link neighborhoods 116 - 120 may be defined to include all links 104 - 108 of the wireless communication system 100 . if such a definition is assumed , then path gain and other information from all the base stations 110 - 114 of the dynamic frequency hopping system 100 must be included to determine whether to allocate resources such as to assign a frequency hopping pattern to a requested link . for this case , all the base stations 110 - 114 are required to constantly communicate with every other base station in the dynamic frequency hopping system 100 to achieve optimum system performance . the cost to support such a communication may be very high . the cost may be reduced while controlling the impact on system performance by limiting the size of the link neighborhoods 116 - 120 based on magnitudes of interference that are expected to be received , for example . the link neighborhood of link r may be defined as follows : 1 ) sort all links of a wireless communication system in a descending order based on a magnitude of interference that may be expected from a link q on link r ; then 2 ) select the first k r links q in the sorted order to be the link neighborhood for link r . in this way , the size of a link neighborhood k r may be balanced against an efficiency of the frequency assignments by accounting for interference that may be sustained by other links 104 - 108 within the link neighborhood of a limited size . thus , cost and performance are optimized by balancing the magnitude of k r against the cost required to provide inter - base station communications over the network 102 . fig3 shows a functional block diagram of the terminal 134 and the base station 112 as an example to discuss the dynamic frequency hopping pattern assignment process . the terminal 134 detects channel quality for all the base stations 110 - 114 from which the terminal 134 can receive control signals as shown in functional block 302 . the detected information is transmitted wirelessly to the base station 112 which is servicing the terminal 134 . the base station 112 collects the detected information from the terminal 134 and all other terminals that are serviced by the base station 112 as shown in functional block 306 . the detected information that is collected by the base station 112 is stored in a database 308 as well as transmitted to other base stations 110 , 114 via the network 102 . the database 308 also stores detected information received from other base stations 110 , 114 so that the database 308 has a “ local ” copy of all the detected information throughout the base station neighborhood . the base station neighborhood of a base station 110 - 114 may be defined in terms of link neighborhoods of links 104 - 106 supported by the base stations 110 - 114 . for example , a base station neighborhood of the base station 112 may include all those base stations 110 , 114 supporting links 104 - 108 that may receive interference from links 104 - 108 supported by the base station 112 . for example , fig1 shows that the link 106 is serviced by the base station 112 , and the link 104 is serviced by the base station 110 . the link 104 has a link neighborhood 116 that includes the link 106 . thus , the base station neighborhood of base station 112 includes the base station 110 . the base station 114 may also be included in the base station neighborhood of the base station 112 if there was another link that is serviced by the base station 112 and that is included in the link neighborhood 120 of the link 108 . thus , the base station neighborhood for a selected base station 110 - 114 includes all those base stations 110 - 114 that support links 104 - 108 having link neighborhoods that include a link serviced by the selected base station . the database 308 includes all the detected information that are collected by the base stations 110 - 114 that are within the base station neighborhood of the base station 112 . the base station 112 also includes a frequency hopping pattern database 312 . the database 312 receives frequency hopping patterns from all the base stations 110 - 114 within the base station neighborhood of the base station 112 as well as the frequency hopping patterns assigned by the base station 112 . thus , the database 312 includes the frequency hopping patterns of the links 104 , 108 serviced by all the base stations 110 , 114 within the base station neighborhood of the base station 112 . the base station 112 includes a dynamic frequency hopping management device 310 that processes the information of the system 100 stored in the database 308 and the frequency hopping patterns in the database 312 to generate new frequency hopping patterns for the links 106 supported by the base station 112 . the base station 112 wirelessly transmits new frequency hopping patterns to the terminal 134 . the terminal 134 receives the new frequency hopping pattern form the base station 112 as shown in block 304 and applies the new frequency hopping pattern for further communications . the frequency hopping pattern assignment process may be performed in three alternative ways as described below . each of the base stations 110 - 114 may independently assign frequency hopping patterns without any coordination among the base station 110 - 114 except for exchanging information such as detected information and frequency hopping pattern assignments , of all the base station 110 - 114 . the independent assignment process may be performed based on a performance criteria such as signal - interference - to - noise - ratio ( sinr ), optimum estimated performance or optimum estimated gain as described below . the sinr is used as a criterion for frequency hopping assignment decisions in the discussed below as an example . however , one or more other link quality parameters such as block error rate , frame error rate , bit error rate measure , etc . may also be used as criteria for the frequency hopping assignment decisions without departing from the spirit of the invention . the sinr of a link i for a particular frequency may be defined by equation ( 1 ) below : sinr i = p i  g ii ∑ j ≠ i  p j  g ji + n i ( 1 ) where p i is the power transmitted over the link i , g ii is a path gain over the link i for a receiver of the link i , p j is the power transmitted over one or more links j , g ji is the path gain from transmitters of the links j to the receiver of link i , and n i is the receiver noise of the receiver . thus , the numerator of equation ( 1 ) represents the power received by the receiver when receiving signals over the link i . the denominator represents the sum of all the interfering power received by the receiver of link i from all the transmitters of other links j transmitting in the particular frequency ( or frequency neighborhood ) for the link i plus the noise power at the receiver of link i . p i and g ii are available locally at a base station 110 - 1 14 that is servicing the link i and p j and g ji may be obtained ( via the network 102 ) from one or more base stations 110 , 114 servicing links j , if necessary . the dynamic frequency hopping management device 310 may first determine the sinr for each of the frequencies assigned to frequency hopping patterns of currently active links serviced by the base station 112 . then , the dynamic frequency hopping management device 310 compares each of the sinrs against a sinr threshold . a number of frequencies in a frequency hopping pattern that is less than the sinr threshold is determined . when this number falls below a marking threshold , then the dynamic frequency hopping management device 310 marks the corresponding link for assignment of a new frequency hopping pattern . for each of the marked links , the dynamic frequency hopping management device 310 generates available frequencies that may be assigned to the frequency hopping patterns of the marked links . as shown in fig4 the available frequencies 320 for a marked link includes a first block 322 of unassigned frequencies . a second block 324 of currently assigned frequencies whose sinr is below the sinr threshold is also included because the sinr for a frequency may change when assigned to a different link due to different geographical conditions , for example . thus , while the sinr of a frequency for one link may be below the sinr threshold , the sinr for another link may exceed the sinr threshold . a third block 326 of frequencies assigned to currently active links whose link neighborhood does not include the marked link may also be included . the third block 326 is generated for each of the marked links by verifying whether the marked link is within the link neighborhood of any currently active link . if the marked link is not in the link neighborhood of a currently active link , then all the frequencies in the frequency hopping pattern of the currently active link are included in the available frequency list for the marked link . this process is performed for all the currently active links to generate the third block 326 of available frequencies . the dynamic frequency hopping management device 310 may assign the frequencies to each of the marked links based on assignment rules such as : 1 ) randomly select frequencies that have associated sinrs that exceed an assignment threshold . assign the selected frequencies to replace those frequencies that have sinrs that is below the sinr threshold ; 2 ) select the frequencies that have the highest sinrs of the available frequency list and assign the selected frequencies as replacement frequencies . the dynamic frequency hopping management device 310 may rank all the frequencies in the available frequencies 320 based on communication qualities that may be obtained if each of the available frequencies is assigned to the marked link as part of a new frequency hopping pattern . then , the frequencies corresponding to the highest ranked sinrs are assigned as either new or replacement frequencies ; and 3 ) make tentative frequency assignments for all the marked links from respective lists of available frequencies . assign as replacement frequencies the tentative assignment for all the marked links that results in an optimum estimated performance for all the links serviced by the base station 110 - 114 . assignment guidelines 1 and 2 treat each link 106 separately from other links 106 . however , some of the frequencies of the available frequencies for each of the marked links may occur in the available frequency list of other marked links serviced by the same base station 112 ( e . g ., the unassigned frequencies of block 322 ). thus , the available frequencies may be generated when needed so that each of the available frequencies takes into consideration frequency assignments that have already been made . the assignment guideline 3 may consider all possible frequency assignments in terms of optimum estimated link performance for all the links serviced by the base station 112 independent of whether a link is marked . in actual implementation , links may be marked and only marked links may be considered to reduce base station processing loads . optimum estimated link performance may include frequency assignments that optimizes an estimated signal quality for a link 106 , maximize a number of terminals 134 - 136 that may be serviced by the base station 112 or other performance characteristics that may be desired . for example , the dynamic frequency hopping management device 310 may not necessarily assign frequencies having the highest estimated performance for a selected link because the same available frequency may have highest sinr in more than one of the links . thus , the dynamic frequency hopping management device 310 may consider spreading the highest sinr frequencies among all the links so that an overall optimum estimated performance for all of the active links may be obtained . optimum estimated performance corresponding to the available frequencies for each of the links may be based on any number of communication criteria . for example , if throughput is selected as a communication criterion , then the dynamic frequency hopping management device 310 generates an estimated throughput for each of the available frequencies for each of the links . estimated throughput t i s for link i at frequency s using mode m i may be defined by equation ( 2 ) below . t s i = r m i ( 1 − bler m i ( sinr i )) ( 2 ) where m i is a transmission mode for link i , r m i is a radio interface rate for link i transmitting using mode m i , bler m i is a block error rate for the mode m i , and sinr i is the sinr for a receiver of link i . while equation ( 2 ) defines the throughput as a function of the sinr , other link quality parameters may also be used to define the throughput such as frame error rate and bit error rate measure . the transmission mode m i is assigned to a link i for optimal transmission based on the transmission environment such as interference conditions . for example , different transmission modes such as qam ( quadrature amplitude modulation ), npsk ( n order phase shift keying ), different types of coding ( e . g ., half rate coding ), etc ., have different transmission performance advantages depending on the transmission environment . based on the throughput generated using equation 2 above , the dynamic frequency hopping management device 310 may assign frequencies to optimize a total base station throughput parameter for the base station 112 . the total estimated throughput for a frequency neighborhood q , t q , is a sum of the estimated throughputs of all links actively supporting communications using the frequency q and may be defined by equation ( 3 ) below . t q = ∑ i ∈ all   links  in   q  t i q ( 3 ) the dynamic frequency hopping management device 310 assigns frequencies to the links so that t q is maximized , for example . alternatively , the dynamic frequency hopping management device 310 may assign any frequency combination that results in t q exceeding a threshold . in this way , the dynamic frequency hopping management device 310 may avoid generating all possible t q s and may assign a first set of frequencies for which t q exceeds the threshold . the dynamic frequency hopping management device 310 may also make frequency assignments based on a link quality parameter improvement . for example , the dynamic frequency hopping management device 310 may make frequency hopping pattern assignments based on a difference between an original base station link estimated performance before the frequency hopping patterns are changed and a maximum new base station &# 39 ; s estimated link performance after the frequency hopping patterns are changed . the total estimated throughput for the marked links may be generated for the originally assigned frequencies and new estimated throughputs frequency hopping patterns may be generated for each new possible frequency assignment . if the largest new estimated throughput of all the possible frequency assignments does not exceed the original estimated throughput by a gain threshold , then the original frequencies may be retained or the link may be assigned a mode zero to temporarily stop transmission until a later time when better interference and / or noise conditions are encountered . if the threshold value is set to a positive value , then the above procedure may not change a frequency pattern unless a throughput improvement is obtained . token passing assignment accounts for possible adverse interaction of frequency hopping pattern assignments between multiple base stations 110 - 114 . this technique provides a token passing procedure where only the base station 110 - 114 that possesses a token , for example , may assign new frequency hopping patterns to terminals 134 - 136 serviced by the base station 110 - 114 . for example , the base station 110 - 114 may be configured in a ring order much like a token ring network . a token may be initiated at any one of the base stations 110 - 114 and the base station 110 - 114 that has the token may assign new frequency hopping patterns . when the base station 110 - 114 has completed the link frequency hopping pattern assignments or after a set period of time , the token may be passed on to a next base station 110 - 114 based on the ring order . in this way , at any one time , only one base station 110 - 114 is assigning new frequency hopping patterns to its terminals 134 , 136 . the token passing procedure may also be controlled by a centralized token unit ( not shown ) where , a token is passed to a base station 110 - 114 by the centralized token unit via the network 102 . when the frequency hopping pattern assignments are completed or after the set period of time , the token maybe sent to a next base station 110 - 114 . the centralized token unit may easily change the sequence of base station frequency hopping pattern updates based on system wide conditions . also , if necessary , selected base stations 110 - 114 may receive tokens more often than other base stations 110 - 114 . the dynamic frequency hopping management device 310 may make total estimated system performance optimizations under the token assignment alternative because all the other base stations that the frequency hopping pattern assignments remain static while the base station 110 - 114 that possesses the token is assigning its new frequency hopping patterns . for example , if estimated system throughput is used as a performance parameter that is optimized , the dynamic frequency hopping management device 310 may generate an estimated system throughput parameter using equation 3 with the exception that the summation is taken over all the links in the complete system instead of only the links for a particular base station 110 - 114 . the frequency hopping patterns assigned to all the actively communicating links for the base station 112 that correspond to an estimated system throughput that exceeds a system throughput threshold may be assigned to optimize the estimated system performance . alternatively , the dynamic frequency hopping management device 310 may assign a new frequency hopping pattern for all the links supported by the base station 112 that provide an estimated system throughput that exceeds a current estimated system throughput by a performance gain threshold . in the centralized assignment technique , the dynamic frequency hopping management device 310 may be a separate unit ( or a specifically assigned base station 110 - 114 , for example ) that interfaces with all the base stations 110 - 114 through the network 102 . as shown in fig5 a dynamic frequency hopping system 101 includes a dynamic frequency hopping management device 340 that is connected to the network 102 and a database 342 coupled to the dynamic frequency hopping management device 340 . the dynamic frequency hopping management device 340 receives information ( detected or generated ) as well as the frequency hopping patterns from all the base stations 110 - 114 . the dynamic frequency hopping management device 340 provides for optimum estimated system performance by reviewing each of the frequency hopping patterns to verify whether a different frequency hopping pattern may be assigned to improve system performance . for example , the dynamic frequency hopping management device 340 may generate estimated throughput for a current frequency hopping pattern assignment for all currently active links and also possible estimated throughputs for new potential frequency hopping patterns for the currently active links . the dynamic frequency hopping management device 340 may permute the frequency patterns through possible frequency patterns and select potential frequency patterns that provide an optimum possible estimated throughput . for example , if a possible estimated throughput exceeds the original estimated throughput by a threshold value , then the dynamic frequency hopping management device 340 may change the frequency pattern assignments to new frequency hopping patterns that corresponds to the optimum estimated throughput . in this way , the dynamic frequency hopping system 101 is constantly maintained at an optimum estimated system performance level . the dynamic frequency hopping management device 340 may also determine optimum estimated performance based on the estimated system performance damage concept disclosed in u . s . patent application ser . no . 09 / 453 , 566 entitled “ wireless network resource allocation ” filed on december 3 , which is herein incorporated by reference . a new frequency hopping pattern may be assigned for a particular link if the maximum estimated system gain that corresponds to a new frequency hopping pattern exceeds a gain threshold for the current frequency hopping pattern assignment . while the above discussion addresses changing a frequency hopping pattern of a currently active link , the dynamic frequency hopping management device 310 , 340 also assigns new frequency hopping patterns for a link request . the link request may be received from a terminal 134 - 136 when placing a call or initiating a data transfer , for example ; when a call is received for a terminal 134 - 136 ; or when a data packet is being forwarded en route to its destination . when a request is received for a new link , the dynamic frequency hopping management device 310 , 340 may identify a list of available frequencies corresponding to blocks 322 and 326 as shown in fig4 for example . block 324 is not applicable because a new link has not yet been assigned a frequency hopping pattern . the dynamic frequency hopping management device 310 , 340 may assign a new frequency hopping pattern using any of the techniques discussed above , i . e ., random assignment of frequencies whose sinr exceed the assignment threshold , assignment of frequencies having highest sinrs , or assigning frequencies that provides for optimum base station estimated performance or estimated system performance . example block diagram and processes of the dynamic frequency hopping management device fig6 shows an exemplary block diagram for the dynamic frequency hopping management device 310 , 340 . the dynamic frequency hopping management device 310 , 340 may include a controller 402 , a memory 404 , a wireless interface 406 , a network interface 408 and a database interface 410 . the above components are coupled together via signal bus 412 . while the exemplary block diagram shown in fig6 is illustrated in a bus architecture , any other types of architecture as dictated by implementation details may be used as is well known to one of ordinary skill in the art . the functions performed by the dynamic frequency hopping management device 310 , 340 may be performed by application specific integrated circuits ( asics ), pla , plds or a program executing in a general purpose or special purpose processor . the dynamic frequency hopping management device 310 , 340 receives detected information and other communication parameters such as frequency hopping pattern assignments , sinrs , etc . from the base stations 110 - 114 through the network interface 408 . the dynamic frequency hopping management device 310 , 340 may receive detected information from terminals 134 - 136 directly , if necessary , via the wireless interface 406 . the received information are stored in the database 342 via the database interface 410 . the controller 402 controls the dynamic frequency hopping management device processes by performing the required functions using the memory 404 and processing the data that are stored in the database 342 . new frequency patterns may be communicated to the terminals 134 - 136 by sending the new frequency patterns to the respective base stations 110 - 114 via the network interface 408 or directly to the terminals 134 - 136 via the wireless interface 406 . if the dynamic frequency hopping management device 310 , 340 is incorporated in the base stations 110 - 114 , the frequency hopping patterns are transmitted to the terminals 134 - 136 via the wireless interface 406 and communicated to all other base stations 110 - 114 via the network interface 408 . the functions performed by the dynamic frequency hopping management device 310 , 340 are described in conjunction with flowcharts shown in the following figures . fig7 shows a flowchart for an exemplary process of the dynamic frequency hopping management device 310 , 340 for frequency assignment rules 1 and 2 . in step 1000 , the controller 402 determines whether it is time to verify the frequency hopping pattern assignments . if it is time , the controller 402 goes to step 1002 ; otherwise , the controller 402 returns to step 1000 . in step 1002 , the controller 402 determines whether all the sinrs are available via either the database interface 410 or in the memory 404 . if available , the controller 402 goes to step 1006 ; otherwise , the controller 402 goes to step 1004 . in step 1004 , the controller 402 generates the sinrs that are needed and goes to step 1006 . in step 1006 , the controller 402 marks those links whose frequency hopping patterns include frequencies that have corresponding sinrs which are below the sinr threshold and goes to step 1008 . in step 1008 , the controller 402 generates lists of available channels for all the marked links and goes to step 1010 . in step 1010 , the controller 402 assigns new frequency hopping patterns to all the marked links and goes to step 1012 . in step 1012 , the controller 402 sends the new frequency assignments to the terminals 134 - 136 via the wireless interface 406 ( also via a base station 110 - 114 if the dynamic frequency hopping management device is the centralized unit ) and goes to step 1014 . in step 1014 , the controller 402 determines whether a system off condition has been received . if received , the controller 402 goes to step 1016 and ends the process ; otherwise , the controller 402 returns to step 1000 and continues the process . fig8 shows a flowchart of a subroutine that expands step 1008 of fig7 in greater detail . in step 2000 , the controller 402 selects a marked link and goes to step 2002 . in step 2002 , the controller 402 adds unassigned frequencies to a list of available frequencies and goes to step 2004 . the list of available frequencies may be stored in the memory 404 , for example . in step 2004 , the controller 402 adds all the frequencies that have sinrs which are below the sinr threshold to the list of available frequencies and goes to step 2006 . in step 2006 , the controller 402 selects a next remaining frequency . the remaining frequencies are those frequencies that are assigned to frequency hopping patterns of currently active links . then the controller 402 goes to step 2008 . in step 2008 , the controller 402 determines whether the selected marked link is in a link neighborhood of the link that is associated with the remaining frequency . if associated , the controller 402 goes to step 2012 ; otherwise , the controller 402 goes to step 2010 . in step 2012 , the controller 402 determines whether any frequencies still remain . if frequencies still remain , the controller 402 returns to step 2006 ; otherwise , the controller 402 goes to step 2014 . in step 2010 , the controller 402 adds the selected remaining frequency to the list of available frequencies and goes to step 2012 . in step 2014 , the controller 402 determines whether there are more marked links . if there are more marked links , the controller 402 returns to step 2000 ; otherwise , the controller 402 goes to step 2018 and ends the process . fig9 shows a flowchart of a subroutine that expands step 1010 of fig7 in greater detail for guideline 1 using an assignment threshold . in step 3000 , the controller 402 selects a marked link and goes to step 3002 . in step 3002 , the controller 402 selects a next frequency from the list of available frequencies corresponding to the selected marked link and goes to step 3004 . in step 3004 , the controller 402 determines whether the sinr corresponding to the selected frequency is greater than the assignment threshold . if greater , the controller 402 goes to step 3006 ; otherwise , the controller 402 returns to step 3002 and selects a next frequency . in step 3006 , the controller 402 assigns the selected frequency to the frequency hopping pattern of the marked link then goes to step 3008 . in step 3008 , the controller 402 determines whether more frequencies are to be assigned to the marked link . if more frequencies are to be assigned , the controller 402 returns to step 3002 ; otherwise , the controller 402 goes to step 3010 . in step 3010 , the controller 402 determines whether there are more marked links to assign frequencies . if there are more marked links , the controller 402 returns to step 3000 and selects another marked link ; otherwise , the controller 402 goes to step 3012 and ends the process . the process for guideline 2 is similar to the assignment process discussed above with fig9 . the difference is in step 3002 . instead of selecting a next frequency from the list of available frequencies , the controller 402 ranks all of the available frequencies based on the magnitude of the sinr associated with each of the frequencies . instead of step 3004 , the controller 402 selects a frequency corresponding to a next highest sinr . all subsequent steps 3006 - 3012 are identical to those shown in fig9 . fig1 shows an exemplary flowchart for a process of the dynamic frequency hopping management device 310 , 340 that assigns frequency hopping patterns to optimize an estimated system performance . in step 4000 , the controller 402 collects information from other base stations 110 , 114 and from links serviced by the base station 112 , for example , and goes to step 4002 . in step 4002 , the controller 402 selects a next link to verify estimated system performance in relation to the assigned frequency hopping pattern for the link and goes to step 4004 . in step 4004 , the controller 402 generates three estimated throughput values ( estimated throughput values being used as a measure of estimated system performance ) t org , t 0 and t new . t org is the estimated system throughput for the currently assigned frequency hopping pattern for the selected link . t 0 is the estimated system throughput if the currently selected link is not permitted to transmit data ( assign a transmission mode of 0 ); and t new is the maximum estimated system throughput for all possible frequency hopping patterns that may be assigned to the selected link . as discussed earlier , a list of available frequencies may be generated for the selected link where the list of available frequencies may include the unassigned frequencies corresponding to block 322 of fig4 and frequencies of currently assigned active links having link neighborhoods that do not include the selected link corresponding to block 326 of fig4 . the controller 402 tests every combination of the available frequencies to form possible frequency hopping patterns for the selected link and selects a possible frequency hopping pattern that corresponds to a maximum estimated system throughput t new . then the controller goes to step 4006 . in step 4006 , the controller 402 determines whether t 0 or t new exceeds t org by a gain threshold . if exceeded , the controller 402 goes to step 4008 ; otherwise , the controller 402 goes to step 4010 . in step 4008 , the controller 402 either assigns transmission mode 0 to the selected link or assigns the frequency hopping pattern corresponding to t new to the selected link and goes to step 4010 . in step 4010 , the controller 402 determines whether a system off condition is detected . if detected , the controller 402 goes to step 4014 and ends the process ; otherwise , the controller 402 returns to step 4002 and continues the verification process . fig1 shows a flowchart for a subroutine that expands step 4006 of fig1 for generating t new in greater detail . in step 5000 , the controller 402 sets the maximum estimated throughput t new to an initial value and goes to step 5002 . in step 5002 , the controller 402 selects a next possible frequency hopping pattern . the possible frequency hopping patterns are possible combinations of available frequencies that may be assigned to the selected link . then the controller 402 goes to step 5004 . in step 5004 , the controller 402 generates an estimated system throughput t . the estimated system throughput may be the sum of the estimated throughputs of each currently active link generated using equation 2 above where the estimated throughput for each of the frequencies for a frequency hopping pattern is summed together for a currently active link . then the controller 402 goes to step 5006 . in step 5006 , the controller 402 determines whether the estimated system throughput t is greater than the maximum estimated system throughput t new . if t is greater than t new , the controller 402 goes to step 5008 ; otherwise , the controller 402 goes to step 5010 . in step 5008 , the controller 402 sets t new to t and goes to step 5010 . in step 5010 , the controller 402 determines whether more frequency hopping patterns remain . if more possible frequency hopping patterns remain , the controller 402 returns to step 5002 ; otherwise , the controller 402 goes to step 5012 and returns to the next processing step of fig1 . the estimated system throughput t may also be generated by using the nominal throughput and throughput damage techniques described in the wireless network resource allocation application , ser . no . 09 / 453 , 566 mentioned above . also , other system parameters other than system throughput may be used as an optimizing parameter such as a maximum number of terminals to be served by the base station or maintaining specific qualities of service . the above - described processes in connection with fig1 and 11 may be applied to a single base station 110 - 114 to optimize total estimated performance of the links serviced by the base station 110 - 114 or on a system wide basis to optimize total estimated system performance . in addition , the processes described in fig7 - 11 may be applied to determine whether a request for a link should be allocated system resources and assign a frequency hopping pattern or the request denied because a desired system performance cannot be obtained . while this invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . for example , while the dynamic frequency hopping system 100 is discussed in terms of assigning frequencies to new frequency hopping patterns , the process is equally applicable to assigning different time division multiplexing ( tdm ) time slots or combinations of time slots and / or frequencies when the new frequency / slot hopping patterns are assigned . if tdm is used and the original frequency hopping pattern / slot assignment is : slot s o 1 - frequency f o 1 , slot s o 2 - frequency f o 2 , . . . , slot s o n - frequency f o n , then new frequency hopping pattern / slot assignment may be : slot s n 1 - frequency f n 1 , slot s n 2 - frequency f n 2 , . . . , slot s n n - frequency f n n . to obtain benefits of frequency diversity , f o 1 - f o n should be different frequencies and f n 1 - f n n should be different frequencies . the system performance may be generated for each available slot and the patterns of slot and frequency pairs that optimizes the system may be selected as the new patterns . accordingly , preferred embodiments of the invention as set forth herein are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention .	7
fig1 shows , schematically , a section along a compressor unit 1 according to the invention which has , as major components , a motor 2 and a compressor 3 in a gas - tight housing 4 . the housing 4 accommodates the motor 2 and the compressor 3 . the housing 4 is provided with an inlet 6 and an outlet 7 in the area of the junction between the motor 2 and the compressor 3 , with the fluid to be compressed being sucked in through the inlet 6 by means of a suction connecting stub 8 , and with the compressed fluid flowing out through the outlet 7 . the compressor unit 1 is arranged vertically during operation , with a motor rotor of the motor 2 above a compressor rotor 9 of the compressor 3 being combined to form a common shaft 19 which rotates about a common vertical rotation axis 60 . the motor rotor is borne in a first radial bearing 21 at the upper end of the motor rotor . the compressor rotor 9 is borne by means of a second radial bearing 22 in the lower position . an axial bearing 25 is provided at the upper end of the common shaft 19 , that is to say at the upper end of the motor rotor . the radial bearings and the axial bearing operate electromagnetically and are each encapsulated . in this case , the radial bearings extend around the respective bearing point of the shaft 19 in the circumferential direction and in this case are circumferential through 360 ° and are undivided . the compressor 3 is in the form of a centrifugal compressor and has three compressor stages 11 which are each connected by means of an overflow 33 . the pressure differences which result across the compressor stages 11 ensure that there is a thrust on the compressor rotor 9 which is transmitted on the motor rotor and is directed against the force of gravity from the entire resultant rotor comprising the compressor rotor 9 and the motor rotor , thus resulting in a very high degree of thrust matching during rated operation . this allows the axial bearing 25 to be designed to be comparatively smaller than if the rotation axis 60 were to be arranged horizontally . the electromagnetic bearings 21 , 22 , 25 are cooled to the operating temperature by means of a cooling system ( not illustrated in detail ), with the cooling system providing a tap in an overflow 33 of the compressor 3 . a portion of the pumping medium , which is preferably natural gas , is passed from the tap by means of pipelines through a filter , and is then passed through two separate pipelines to the respective outer bearing points ( first radial bearing 21 and second radial bearing 22 as well as the axial bearing 25 ). this cooling by means of the cold pumping medium 80 saves additional supply lines . the motor rotor is surrounded by a stator 16 which has encapsulation such that the aggressive pumping medium 80 does not damage the windings of the stator 16 . the encapsulation is in this case preferably designed such that it can contribute to the full operating pressure . this is also because a separate cooling arrangement is provided for the stator , in which cooling arrangement a dedicated cooling medium circulates . the compressor rotor 9 expediently has a compressor shaft 10 on which the individual compressor stages 11 are mounted . this can preferably be done by means of a thermal shrink fit . an interlock , for example by means of polygons , is likewise possible . another embodiment provides for different compressor stages 11 to be welded to one another , thus resulting in an integral compressor rotor 9 . the pumping medium 80 or natural gas ng is passed from the natural reservoir first of all into a condensate separator 81 , which separates condensates 82 , including water , from the gaseous phase . the condensates 82 are passed into a condensate line 84 , into which a downstream drain line 95 also opens , which introduces condensates that have been deposited in the compressor unit into the condensate line 84 . the condensates 84 are passed from a condensate pump 85 to a mixing unit 86 , in which they are mixed with the compressed natural gas ng or pumping medium 80 . the resultant mixture is pumped into a pipeline 87 in the direction of a base station 89 . the compressor unit 1 has a system for distribution of antifreeze 73 , comprising distribution lines 94 and injection modules 72 . the antifreeze 73 is pumped from a reservoir tank 92 by means of a metering pump 93 to the various injection modules 72 on the compressor unit 1 . the injection modules 72 locally apply antifreeze to the first radial bearing 21 , to the axial bearing 25 , to the second radial bearing 22 and to the overflows 33 . a further injection module 72 is located on the intake connecting stub 8 , by means of which module the antifreeze 73 is injected directly into the pumping medium 80 which is sucked in . part of the injected antifreeze 73 is deposited in the compressor unit 1 , to be precise such that it is emitted through a drain 96 ( at the “ single drain point ”) of the compressor unit 1 into the drain line 95 . the rest is pumped together with the compressed natural gas ng through the outlet 7 into the mixing unit 86 . the antifreeze 73 , the natural gas ng and the condensate 82 are pumped to the base station 89 at the earth &# 39 ; s surface through the pipeline 87 . hydrate formation in the pipeline 87 is precluded because of the antifreeze 73 being carried with it . before reaching the base station 89 , a further condensate separator 88 ensures that the natural gas ng is dry , with the condensate including the antifreeze 73 being passed to a conditioner 90 in which the antifreeze 73 is separated from the rest of the condensate 82 . the conditioned antifreeze 73 is passed back by means of a return line 91 along the pipeline 87 to the reservoir tank 92 . the closed circuit of the antifreeze 73 ensures protection against hydrate formation on the one hand , and on the other hand compliance with the relevant environmental	5
as required , detailed embodiments of the present invention are disclosed herein , however , it is to be understood that the disclosed embodiments are merely exemplary of the invention which may be embodied in various forms . therefore , specific functional and structural details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . referring to fig1 the protective device 10 of the instant invention comprises a sheet of flexible plastic , rubber , or coatable paper material depicted by numeral 12 . plastic can be transparent , translucent , or opaque . the sheet is substantially flat in its formation defined by first side surface 14 and second side surface 16 . an acute opening is placed in the sheet 12 outlined by first coupling edge 18 and second coupling edge 20 . a center opening 22 is disposed in the center of sheet 12 sized to allow insertion of a conventional flag pole therethrough as described in detail later in this specification . the perimeter edge 24 of the center opening 22 begins at the inner corner 23 of the first coupling edge 18 and ends at the inner corner edge 25 of the second coupling edge 20 . the outer periphery 26 of the sheet 12 is substantially circular beginning at the outer corner 27 of the first coupling edge 18 and ending at the outer corner 29 of the second coupling edge 20 . corner 29 is shown chamfered to eliminate a sharp point . means for locking first coupling edge 18 to second coupling edge 20 comprises tabs 28 and 30 extending obliquely from first coupling edge 18 engagable with and separated from second coupling edge 20 by the aforementioned acute opening . the second coupling edge 20 having corresponding slots 32 and 34 disposed therein for coupling thereto . to lock tab 28 into slot 32 , a triangular shaped notch 36 is placed in the tab 28 wherein one edge of the notch 28 is made parallel to or part of first coupling edge 18 . similarly , to lock tab 30 into slot 34 a triangular shaped notch 38 is placed in the tab 30 wherein one edge of the notch 38 is made parallel to or part of the first coupling edge 18 . it should be noted at this point that any means of coupling first coupling edge 18 to second coupling edge 20 is deemed within the scope of this invention . the locking means may comprise two way adhesive tape , loop and pile attachment , magnetic attraction , and so forth . the locking means does not seal the coupling edges together allowing sufficient drainage in most instances . in areas having excessively moist conditions , a plurality of drainage holes 40 can be placed in the device . in addition , an advertisement or message can be placed on either side surface of the sheet . if the sheet is made from transparent or translucent plastic , an advertisement placed against the bottom of the cup protects the advertisement from scratches . if an opaque plastic is utilized , a different advertisement can be placed on either side of the sheet allowing the sheet to be reversed to expose alternate advertisements . now referring to fig2 and 3 , the instant device is made operational by placing first coupling edge 18 and second coupling edge 20 juxtapose holding their position by said locking means . the locking means in this embodiment consists of insertable tabs 28 and 30 depicted inserted into slots 34 and 32 respectively . slidable movement of first coupling edge 18 outwardly toward edge 29 causes notch 36 and 38 to engage second surface 16 locking the first coupling edge 18 to the second coupling edge 20 . upon locking , the device forms a conical arrangement with surface 14 forming an inner surface and surface 16 forming an outer surface . the conical shape is easily insertable in one direction into a golf cup with the outer periphery 26 forming a continuous perimeter dimensioned to co - axially fit into a conventional golf cup . optionally , the outer periphery of the device includes a plurality of tabs , not shown , extending therefrom or a periphery conforming to the side wall of a conventional golf cup for friction fit by biasing the device against the inner surface of the golf cup . it should be noted that the device can be inverted causing outer surface 16 to become an inner surface . now referring to fig4 an alternative locking means is depicted wherein the protective device 10 is shown as a substantially flat piece of material defined by first side surface 14 and second side surface 16 . the sheet is available for display of an advertisement thereon . formation of the device requires an acute opening be placed in a section of sheet 12 depicted by first coupling edge 18 and second coupling edge 20 . center opening 22 is defined by inner perimeter edge 24 . the outer circumference of the sheet is substantially circular creating outer periphery 26 . means for locking first coupling edge 18 to second coupling edge 20 comprises tab 42 formed in the shape of a trihedral wedge having a top edge and a first edge 46 and second edge 48 extending obliquely from first coupling edge 18 engagable with and separated from second coupling edge 20 by the aforementioned acute opening . the second coupling edge 20 includes a corresponding notch 50 disposed therein for coupling thereto . the method of manufacture for the instant device is low cost and allows printing before or after manufacture , on either side of the device , while in a flatten state . further , the device can be stored , shipped , and taken to point of use in the flatten state . manufacture of the golf cup protective device comprising the steps of : ( a ) cutting a flexible sheet of material into a predetermined pattern having a substantially circular inner and outer circumference with an acute opening defined by two edges communicating the inner and outer circumference ; ( c ) optiionally punching a plurality of drain holes through said sheet of material ; ( d ) providing a means for locking the edges of the acute opening in a fixed position ; ( e ) forming said sheet into a conical shape and placing said two edges of the acute opening juxtapose ; ( f ) locking said edges together by said means for locking ; ( g ) inserting said conical shaped device into a conventional golf cup . fig5 and 6 illustrate the instant device 10 with its angular surface 14 formed in the same angular shape of the bottom surface 58 of a conventional golf cup 52 . in a alternative embodiment , the outer periphery 26 of the device 10 frictionally engages the inner surface 54 of the golf cup 52 causing the device to bias against the two surfaces 26 and 54 creating a slidable insertion in the direction of the arrow 56 . the device is slid into the golf cup until the bottom surface 16 of the device 10 contacts the upper surface 58 of the conventional cup . as previously mentioned , an alternative embodiment for maintaining the device in the bottom of a golf cup is by use of frictional engagement between surfaces 26 and 54 . alternatively , a means for maintaining the device at the bottom of the cup may comprise two way adhesive tape , loop and pile attachment , magnetic attraction , and so forth as depicted by components 60 and 62 . the opening 20 is dimensionally larger than a conventional golf flag pole , not shown , allowing the end of the pole to pass through the center 20 of the device 10 for seating into hole 64 provided for flag pole erection . drain holes 40 allow excess water to flow through the device 10 in the event the flag poles prevents normal draining . when the device is to be exchanged , it can be removed from the golf cup by overcoming the frictional engagement of edge 26 to wall 54 . movement of the tabs unlocks the device from its conical position and allows the device to be reformed into a reverse conical shape for inverted replacement into the golf cup hole . it is to be understood that while we have illustrated and described certain forms of my invention , it is not to be limited to the specific forms or arrangement of parts herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown in the drawings and described in the specification .	0
referring to fig1 and 3 , the automatic sound - emitted self - learning toy of the present invention comprises a dynamic mechanism unit box ( 1 ), a movable figure of an animal , robot or mankind ( 2 ), a battery box for batteries ( 3 ), a micro - motor ( 4 ), a speed change device ( 5 ), a sound - emitting ( tape ) turntable ( 6 ), an annular tape ( 7 ), two semi - circular cams ( 8 ) and ( 9 ), a 30 - tooth gear ( 10 ), a 60 tooth gear ( 11 ), a micro - switch ( 12 ), ( 13 ), a sound - emitting head ( 14 ), a speaker ( 15 ), a sound - emitting pad ( 16 ), a triangle flange ( 16a ), a question card ( 17 ), an answer card ( 18 ), several parallel horizontal beams ( 19 ), ( 20 ),( 21 ),( 22 ), cylinder magnets ( 23a ), ( 23b ), ( 23c ), ( 23d ), ( 24a ), ( 24b ), ( 24c ), ( 24d ), block magnets of question card ( 25a ), ( 25b ), ( 25c ), ( 25d ), block magnets of answer card ( 26a ), ( 26b ), ( 26c ), ( 26d ), a spring ( 27 ), movable arms ( 28 ), ( 29 ), ( 30 ), a groove ( 28a ), two microswitches ( 31 ), ( 32 ), two thrust elements ( 33 ), ( 34 ) and two transmission leaves ( x ),( y ). with reference to fig . ( 2 ) and fig . ( 3 ), the first prefered embodiment illustrates the dynamic mechanism unit of the present invention . a question card 17 is placed on the left side of the corresponding position of the toy and an answer card ( 18 ) on the right side . each card contains only one block magnet . the magnet fixed in the question card ( 17 ), for example , is ( 25a ), which attracts the corresponding cylinder magnet ( 23a ) within the horizontal beam ( 19 ). the magnet ( 23a ) then mounts upward and sticks between the arm ( 28 ) and the horizontal beam ( 19 ). the magnet fixed in the answer card ( 18 ), for example , is ( 26a ), which attracts the cylinder magnet ( 24a ) within the horizontal beam ( 19 ). the cylinder magnet ( 24a ) then mounts upward and sticks between the arm ( 29 ) and the said horizontal beam ( 19 ). by pressing the pad ( 16 ), the triangle flange ( 16a ) thereon is forced downward into the groove ( 28a ). this forces the arm ( 28 ) to move to the right - hand side , since the cylinder magnet ( 23a ) stick between the arm ( 28 ) and the beam ( 19 ). the moving arm ( 28 ) drives the beam ( 19 ) in the same direction , along with the arm ( 30 ). the transmission leaf ( x ) on the micro - switch ( 31 ) is thus contacted with the end of the arm ( 30 ). meanwhile , another transmission leaf ( y ) on the micro - switch ( 32 ) is also contacted with the end of the arm ( 29 ) by means of the right - hand moving beam ( 19 ) through the cylinder magnet ( 24a ) stuck therebetween . the work of the micro - switches ( 31 ) and ( 32 ) are known as the general dynamic mechanism . the micro - switches start the micro - motor ( 14 ) which is powered by battery ( 3 ). the motor rotates the tape ( 7 ) on the tape turntable ( 6 ) by means of the speed change device ( 5 ). since sound of &# 34 ; yes &# 34 ; or &# 34 ; no &# 34 ; are recorded on each semi - circle of the tape ( 7 ), the &# 34 ; yes &# 34 ; is voiced by pressing the pad ( 16 ) while the two micro - switch ( 31 ) and ( 32 ) are both in action . the semi - circle arms ( 8 ), ( 9 ) are connected to the tape ( 7 ) and are controlled by the microswitch ( 12 ),( 13 ) and the 60 tooth gear ( 11 ). the rotation of the speed - change device ( 5 ) is stopped automatically after one complete rotation of the tape turntable ( 6 ). the tape having the sound &# 34 ; yes &# 34 ; thereon is stopped by the cams ( 8 ), ( 9 ). while releasing the pad ( 16 ), the triangle flange ( 16 ) moves upward . the beam ( 19 ) is then set back to the original position by the spring ( 27 ) and the thrust elements ( 33 ),( 34 ). the arms ( 29 ),( 30 ) depart the transmission leaves of the microswitch and the motion cycle is completed . the second situation regarding the placement of the answer cards within the present invention is illustrated hereinafter . a question card ( 17 ) is placed on the left side of the corresponding position of the toy , and an answer card ( 18 ) on the right side . the magnet fixed in the question card ( 17 ), for example , is ( 25a ), it attracts the corresponding cylinder magnet ( 23a ) within the horizontal beam ( 19 ). the magnet ( 23a ) then mounts upward and sticks between the arm ( 28 ) and the horizontal beam ( 19 ). the magnet fixed in the answer card ( 18 ), for example , is ( 26b ), it attracts the cylinder magnet ( 24b ) within the beam ( 20 ). then ( 24b ) mounts up and sticks between the arm ( 29 ) and the beams ( 20 ). by pressing the pad ( 16 ), the triangle flange ( 16a ) is forced downward into the groove ( 28a ). this forces arm ( 28 ) to move to the righthand side , since the cylinder magnet ( 23a ) sticks between the arm ( 28 ) and the beam ( 19 ), the moving arm ( 28 ) simultaneously drives the beam ( 19 ) in the same direction . furthermore , the arm ( 30 ) is driven to the righthand side by the said horizontal beam ( 19 ), thus the transmission leaf ( x ) on the micro - switch ( 31 ) is brought into contact with the end of the arm 30 . meanwhile , the cylinder magnet ( 24b ) is attracted upward by the magnet ( 26b ) in the answer card . however , the horizontal beam ( 20 ) is not pushed by the arm ( 28 ) and is retained in the original position without movement . the arm ( 29 ) therefore remains motionless with no connection to the transmission leaf ( y ). the work of the micro - switch ( 31 ) is the same as the preceding dynamic mechanism illustrated in the first embodiment . since the microswitch ( 32 ) remains motionless the &# 34 ; no &# 34 ; sound recorded on the semi - circle tape ( 7 ) is voiced by pressing the pad ( 16 ). the movement mechanism operates in the same manner as previously described . the corresponding answer cards to the question cards have magnets which are previously arranged thereon in the right positions , such as ( 26a ) to ( 25a ), ( 26b ) to ( 25b ), ( 26c ) to ( 25c ), ( 26d ) to ( 25d ) . . . etc . the parallel horizontal beams ( 19 ), ( 20 ) . . . are also pre - located in the corresponding positions to the magnets . accordingly , the magnets are arranged such that when the right answer card is matched with the question card , the &# 34 ; yes &# 34 ; sound will be emitted by pressing the pad through the attractive magnets , and the movement mechanism . further , more corresponding question cards and answer cards can be designed , and new parallel horizontal beams can also be designed . in addition , the figure body of the toy according to the present invention may be designed with movable arms by supplying rotatable shafts connected with the gears ( 10 ), ( 11 ) which are in turn connected to a means for creating movement . the above embodiments are given only for illustration purpose and not by the way of limitation , modification will become evident to those skilled in the art which will fall within the scope of the attached claims .	0
fig1 shows a well shaft 10 which is arranged in a shaft which is located in a ground region 11 and has an upper permeable portion 10 . 1 and a lower permeable wall portion 10 . 2 spaced from the upper portion . a transverse wall 12 is sealingly inserted between both permeable wall portions 10 . 1 and 10 . 2 in the valve pipe . it has a throughgoing opening 4 for a tubular throughgoing passage 13 . in the throughgoing passage 13 a preferably electrically operated pump 14 is arranged . the throughgoing passage 13 has lateral outflow openings 13 . 1 at the height of the upper permeable wall portion 10 . 1 , and an inflow opening 13 . 2 provided at its lower end . the throughgoing passage 13 extends upwardly to a partial flow supply conduit 15 which leads outwardly to a not shown treatment device . in an immovable condition of the arrangement the ground water assumes a level 16 underneath a ground surface 17 . during the operation of the pump 14 the ground water located in the region 18 of the well shaft 10 is aspirated into the throughgoing passage 13 and supplied in its greater part through the outflow opening 13 . 1 into the upper region 19 of the well shaft . a smaller part of the supplied liquid can be withdrawn when needed through the partial stream supply conduit 15 . the upwardly transported liquid in the region 19 of the well shaft 10 flows through the permeable wall portion 10 . 1 outwardly into the ground . there it produces ground water flow between the upper and lower permeable wall portion 10 . 2 , its flow diagram is shown in fig1 with potential lines 20 . in contrast to a well shaft from which ground water is only aspirated , no undesirable ground water lowering occurs but instead a ground water raise . the water circulation through the ground region 11 from the upper permeable wall portion 10 . 1 to the lower permeable wall portion 20 . 1 of the well shaft 10 extends through an unexpectedly great peripheral region of the shaft . in the region of the lower permeable wall portion 10 . 2 a very active flow profile is obtained , and further ground water which until now has not been in circulation is pulled into this strong flow . the arrangements for influencing liquid located in the ground under the formation of a liquid circulation can be adjusted in different manner to the local conditions and special applications . fig2 shows an arrangement in which the well shaft 10 with its both permeable wall portions 10 . 1 and 10 . 2 is arranged in a shaft 21 with a substantially greater diameter . the intermediate space between the wall of the shaft 21 and the well pipe 10 is filled around the impermeable wall portion with a sealing mass 22 identified with an intersecting hatching , and is also filled around the permeable wall portions 10 . 1 and 10 . 2 with a permeable gravel filling 23 . since air and other free gas mixtures located in the ground make difficult the circulation produced by the pump 14 in the throughgoing passage 13 , a ventilation of the ground in the region of the gravel filling 23 is provided . for this purpose a ventilating pipe 24 is arranged at the right side of the valve shaft 10 . the ventilation pipe 24 extends parallel to the well shaft 10 through its whole length and has a sieve wall at the height of the gravel filling 23 . the ventilation can be performed forcedly , as shown at the left side of in fig2 . there ventilating pipe 25 extends to the upper gravel filling 23 before the wall portion 10 . 1 , in which a ventilator 26 produces a negative pressure and gases can be withdrawn outwardly through a valve member 27 of the aspiration pipe . a return conduit 28 is identified with a broken line and leads to the shaft region 19 . a gas circulation stream can be formed through the return conduit 28 by means of the ventilator 26 to flow through the region 19 of the well shaft 10 and the liquid free part of the permeable wall portion 10 . 1 . in this case the gas circulating stream serves not only for ground ventilation , but also for preventing a hardening of the liquid free parts of the liquid permeable wall portion 10 . 1 . nitrogen can be used here as gaseous medium . a great number of openings formed in the tubular throughgoing passage formed the outflow opening 13 . 1 in the throughflow passage 13 . the throughflow passage 13 is extended through a throttle point 29 to the partial flow supply conduit 15 . the arrangement in accordance with the embodiment of fig3 differs from the arrangement of fig2 by a second transverse wall 30 located in the interior of the well shaft 10 . also a sealing mass 22 in the central well pipe region is dispensed with for facilitating a filter gravel rinsing for cleaning purposes . the transverse wall 30 through which the tubular throughgoing passage 15 extends , closes the region 19 of the valve shaft 10 which is limited by the permeable upper wall portion 10 &# 39 ;, with respect to a fluid free upper pipe region 31 . a liquid tight horizontal wall 32 is arranged around the well shaft at the height of the normal ground water level 16 in the ground 11 . it prevents a raise of the fluid forced in the circulating movement , above the normal fluid level 16 . it also provides a horizontal outflow of the liquid along a greater region than the flow diagram shows in fig1 . in this embodiment of the arrangement a very strong pump 14 is utilized , which can form a very high liquid overpressure in the region 19 of the valve shaft 10 . the shown thick arrow indicates the rinsing water path in the filter gravel layer during high pressure cleaning process . the lower end of the valve pipe 10 is formed by a deposit bath 33 . fig4 shows an embodiment in which an arrangement for forming a fluid circulation in the ground region 11 for withdrawing a liquid partial flow is combined with an arrangement for a negative pressure evaporation of light soluble impurities from the ground water . moreover , this arrangement is suitable for use in areas with purged ground water or for operation with negative pressure differences between the well shaft and the ventilation region located outside the well pipe . a well shaft 40 located in the shaft 21 is provided under the normal available liquid level with an upper permeable wall region 40 . 1 and a lower permeable wall region 40 . 2 . a liquid circulation is produced by a pump 44 which is arranged in a throughgoing passage 43 extending through a transverse wall 42 . the throughgoing passage 43 with its lower inlet opening 43 . 2 ends with its upper outflow outlet opening 43 . 1 in the well pipe region 49 . a special partial flow supplying conduit 45 leads from the well pipe region 49 , and a feed pump 46 is arranged in it . a nozzle body 50 is located in the well pipe region 49 for performing a negative pressure evaporation process . it is located under the liquid level 47 formed in the shaft and operates in a known manner as disclosed for example in the german gebrauchsmuster 88 08 089 which describes its operation . a gas supply to the nozzle body 50 is performed from a connection 51 through a pressure receiving chamber 52 and through a gas conduit 53 . the gas withdrawal from the well shaft is performed through an aspiration passage 54 of a ventilator 55 and through a pressure limiting valve 56 . for providing a wider horizontal discharge of the liquid from the wall portion 40 . 1 of the well pipe 40 , a water impermeable wall 32 is located in the ground region 11 as shown in the arrangement of fig3 . the withdrawn partial liquid stream is supplied through the partial stream supplying conduit 45 to a treatment device 57 shown in a broken line and from there is supplied to a return conduit 59 which leads to a pump 59 . the pump supplies the partial flow liquid to a pressure probe 60 arranged in the ground region , or in other words is supplied back under pressure into the circulating region of the fluid in the ground region 11 . the return flow is performed substantially at the height of the lower permeable wall portion 40 . 2 of the well shaft , at which height in accordance with the flow diagram of fig1 an especially intensive horizontal return flow to the well pipe is available . a water impermeable ground region located under it is favorable for the orientation of the return flow stream . due to this intensive flow movement which is increased by a pressure lance 60 , even tough impurities such as , for example , impurities like crude oil can be whirled free in this ground region and discharged to the well shaft 40 , where they can be collected in a deposit cup 61 formed at the bottom of the well pipe 40 . from there they can be withdrawn through a discharge conduit 62 by a pump 63 . the flow profile of the produce liquid circulation can be influenced by a change of the inlet cross - section of the lower wall portion 40 . 2 , for example it can be compressed . for this purpose the transverse wall 42 can be vertically adjustable in a not shown manner and provided with a screening casing 64 . depending on the height of the transverse wall 42 the screening casing can cover a greater or smaller region of the permeable wall portion 40 . 2 . in the arrangement of fig4 traditional liquid can be supplied from a supply conduit 65 into the ground region in the circulation through a pressure probe 60 . a treatment liquid or a storage liquid can be used here depending on the purpose for which the arrangement is utilized for forming a liquid circulation and a partial stream withdrawal . fig5 shows a well pipe 10 with a water permeable wall subdivided into regions 18 and 19 similarly to fig1 - 4 . in contrast to the arrangement of fig1 - 4 , no transverse wall is provided for separation of the regions . instead a region 71 is a turbulent water flow 70 produced by a whirl flow compressor 72 , which is simultaneously responsible for supplying water from the lower shaft region 18 through the throughgoing passage 13 . instead of the whirl flow compressor 72 , also a simple transporting screw 72a can be used as shown in fig5 a , or air can be blown through a pipe into the region 71 for providing a water tight separation of both regions 18 and 19 . with a relatively large pump housing , an intensive reduction of the throughflow cross - section of the well shaft 10 can be obtained such that with a corresponding supplied quantity a water dam of the pump can be produced which acts as a separating wall . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of methods and constructions differing from the types described above . while the invention has been illustrated and described as embodied in an arrangement for and a method of influencing water in ground , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims .	4
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention , which may be embodied in other specific structure . while the best known embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . because studying the process invention first will aid one &# 39 ; s understanding of the mechanical features of the invention , reference is first made to fig1 showing the process flow . box 30 represents municipal waste input , which is first transferred , as by a screw conveyor , to a shredder 32 where the waste is comminuted to a uniform size for even burning and better processing . the shredded waste is then conveyed , again preferably by a screw conveyor , to a magnetic separator 34 which separates a stream of ferrous metal 36 for salvage by further , well known means denoted as 38 . the nonferrous stream from separator 34 is conveyed to a storage hopper 40 from which incinerator 42 is fed . damper air from source 44 , typically the atmosphere , passes into incinerator 42 to support combustion . a first output 46 from incinerator 42 is provided for a light fraction consisting essentially of ash , which can be distributed to farm fields or landfill sites denoted by box 48 . a second output stream from incinerator 42 is a heavy fraction consisting essentially of glass and nonferrous metals such as aluminum . this stream , represented by box 50 , is passed through a flotation separator 52 which divides the stream into a glass rich fraction 54 and an aluminum rich fraction 56 . these fractions are respectively salvaged from points 58 and 60 . the third output from incinerator 42 is for flue gases , denoted as 62 and consisting essentially of nitrogen , water vapor , carbon dioxide , other combustion products , and some particulate matter . the flue gases pass through heat exchanger 64 , then through a wet cyclone system 66 in which the flue gases are mixed with a water spray and then liquids and entrained solids are separated from gases . the cyclone treated flue gases are then conveyed through an electrostatic precipitator 68 , preferably a wet electrostatic precipitator for precipitating entrained fluid droplets as well as solid particles . the scrubbed gases are then conveyed by an induction blower 70 to a stack 72 from which the treated flue gases are vented to the atmosphere . the scrubber water from wet cyclone system 66 is also used in the operation of precipitator 68 , and then is conveyed via a pump and filter 74 back to wet cyclone system 66 , where it is again sprayed into the flue gases . the system shown in fig1 is adapted to extract heat from incinerator 42 for generation of electrical power . incinerator 42 contains at least a flue gas heat exchanger 64 , and preferably the incinerator walls also include heat exchange surfaces which are in circuit with the flue gas heat exchanger . the heat exchangers are part of a primary loop which also includes a boiler 75 and preheater 76 for transferring heat to a secondary loop and a pump 78 for circulating the heat transfer medium . in this embodiment the heat transfer medium in the primary loop is a eutectic mixture or alloy of sodium and potassium metals . the secondary loop circulates water through preheater 76 and boiler 75 in heat exchange relation to the primary loop , producing pressurized , heated water or steam . boiler 75 can feed any device which requires a feed of pressurized heated water or steam , such as steam turbine 80 , then the condensate is cooled in cooling tower 82 , recovered and replenished at a water treatment station 84 , and recycled by pump 86 to pre - heater 76 , thus completing the secondary loop . turbine 80 is here shown driving an electric power generator 88 , connected via the usual transformer 90 and meter 92 to the power grid 94 . electric power from generator 88 can also be used for operating equipment connected with the incinerator system . fig2 and 3 show the preferred incinerator means in more detail . incinerator 42 comprises front and rear walls 96 and 98 , side walls 100 and 102 , a top wall 104 , and a bottom wall 106 which together define a substantially closed flue chamber having a draft air inlet 108 , a waste inlet 110 leading out of storage hopper 40 , a flue gas outlet 112 , leading into heat exchanger 113 , and a combustion zone 114 between draft air inlet 108 and flue gas outlet 112 . support means 116 are provided for receiving and maintaining unburned waste in combustion zone 114 . support means 116 here comprises a rotating open - ended cage having a cylindrical , foraminated side wall 118 for supporting unburned waste , the foramina of which are small enough to retain the waste as delivered from hopper 40 but large enough to pass burned waste once it has been reduced in size or liquefied . side wall 118 is supported by a framework of axially disposed members such as 120 , 121 , 122 , 123 , 124 , 125 , 126 , and 127 , each joined at its respective ends to an inlet ring 130 rotatably supported by roller bearings 132 and end hub and outlet ring 134 . an open drop space 136 is framed by the axially disposed members and the space between the edge 137 of side wall 118 and end hub and outlet ring 134 . an axially disposed stem 138 is secured by welded insertion to end hub 134 and is received and supported in a bearing 140 . bearings 132 and 140 are located outside walls 96 and 98 to protect them from the high temperature of the operating incinerator . in this embodiment infeed vanes such as 142 and 144 disposed within inlet ring 130 attack the waste material within hopper 40 as cage 116 is rotated by a motor , schematically shown as 146 , which is disposed outside the confines of the flue chamber . the rate of rotation can be varied to account for differences in the composition of the waste , but for typical municipal trash should be about one revolution per minute . cage 116 can be inclined downwardly at an angle of about 5 degrees below horizontal if desired , both to assist feeding and to distribute burned and unburned material during combustion . as a result of combustion , all carbonaceous materials are consumed to form carbon dioxide , water , and ash , glass materials are fractured and to some extent melted to form slag , and aluminum materials tend also to form a heavy slag . any materials not able to escape through foraminated side wall 118 are advanced ( by the infeed of unburned material ) to drop space 136 and fall from the combustion zone . looking now at the manner in which draft air passes into and through the system , air drawn into incinerator 42 via draft air inlet 108 is regulated by a connected series of vanes 148 , flows inward and upward along the inclined portion of bottom wall 106 and past a side edge of ash baffle 154 via opening 151 , and enters combustion zone 114 . opening 151 directs the draft air directly at the burning waste , increasing turbulence in the combustion zone and the efficiency of combustion . support means 116 is arranged so essentially all draft air must pass through it . the flue gases formed in combustion zone 114 , as well as nitrogen and other nonparticipating constituents of the draft air , form flue gases which collect in headspace 152 before being vented through flue gas outlet 112 to a flue gas heat exchanger 113 shown in profile . returning now to the disposition of the solid products of combustion , the slag , ash , and other unburnable matter escaping through foraminated side wall 118 or drop space 136 drops to ash baffles 150 and 154 which act as burned waste conveying means . ash baffles 150 and 154 are disposed within incinerator 42 beneath support means 116 and are inclined inwardly and downwardly ( about 45 degrees below horizontal in this embodiment ) toward an ash screw 155 disposed in a trough 156 . the lower edge 157 of ash baffle 150 is spaced from ash baffle 154 to define an ash drop passage 158 for feeding burned waste from the lower edge of ash pan 150 . ash screw 155 fits closely within trough 156 to limit the counterflow of draft air . burned waste is fed along trough 156 and through slot 160 by rotation of screw 155 to intersect with the draft air drawn through opening 108 . slot 160 is tapered outward in the direction of feeding , so ash falls through first and larger particles and pieces are conveyed further to the right ( fig2 and 3 ) before passing through slot 160 . heavier material contacted by the draft air is affected only slightly , and drops substantially straight down into a trough 184 disposed at the foot of draft air inlet 108 . the material collected in trough 184 is a heavy fraction , rich in aluminum and glass . lighter materials are carried by the incoming draft air past trough 184 to trough 186 or beyond . a portion 187 of bottom wall 106 inclined at a substantial angle ( 35 degress below horizontal ) receives a portion of the light fraction carried by the incoming draft air and redirects it toward trough 186 . although some very finely divided material will remain in the flue gases , most of the light fraction -- primarily fly ash -- will gravitate toward trough 186 . a screw conveyor 188 conveys the heavier fraction out of the incinerator for further separation such as the flotation separation to be described , while ash disposed in trough 186 is conveyed away independently by screw conveyor 190 . thus , unlike in prior art devices , separation of ash from reclaimable components of the burned waste is achieved directly in the incinerator , employing the draft air drawn into the incinerator by induction as a separating medium . looking now at the materials used in incinerator 42 , the portions of the incinerator exposed to heat , particularly the foraminated side wall 118 , other portions of support means 116 , walls 96 through 106 , and baffles 150 and 154 are made of heat resistant metal . a preferred material , which is resistant both to hydrogen chloride corrosion and to heat , is an alloy consisting essentially of about 16 percent chromium , about 7 percent iron , and about 77 percent nickel . one such material is known commercially as inconel 600 . in the preferred embodiment of the invention , heat exchange means are provided for the stationary heated surfaces of the incinerator , such as ash baffles 150 and 154 and the incinerator walls , which are normally exposed to the radiant heat energy of combustion or in contact with flue gases , for extracting heat from the incinerator . for example , each wall to be provided with heat exchange means can be a double sheet joined together and hydrostatically expanded to define a labrynthine flow passage for conveying a heat transfer medium . the preferred heat transfer medium is a eutectic alloy of sodium and potassium comprising about 40 percent potassium and 60 percent sodium . this eutectic mixture or alloy has an operating temperature of roughly 1000 degrees fahrenheit , and is liquid under normal conditions between about 67 degrees fahrenheit and roughly 1500 degrees fahrenheit . although it has a lower heat capacity than water , this alloy has a higher heat capacity than most high boiling fluids and its wide range of operating temperatures allows it to carry a substantial heat load without increasing its vapor pressure to as much as atmospheric pressure . the walls of the incinerator heat exchanger surfaces can thus be quite thin , requiring less of the relatively expensive high temperature alloy from which they are fabricated . although magnetic separators 34 shown in fig1 are known to the art , a particularly preferred magnetic separator for use herein is shown in schematic form in fig5 and 6 . separator 34 has an inlet 192 fed from shredder 32 via a suitable conveyor . inlet 192 is reduced to form a restricted throat 194 bounded on one side by a fixed wall 196 and on the other side by an endless belt 198 carried by rollers 200 , 202 , 204 and disposed in sliding contact with a block 206 which is magnetized by an electromagnet 208 , thereby creating a substantial magnetic field directly adjacent to belt 198 . in this embodiment of the invention , the passage through throat 194 is arranged to be substantially vertical to define ( gravitational ) means for conveying a stream of waste along a path . belt 198 has a first run 210 disposed parallel to and moving at the same velocity as waste traveling through the device . ferrous materials are attracted by block 206 and held against first run 210 . a second run 212 of belt 198 diverges from the path through throat 194 , but at least a part of second run 212 is adjacent block 206 for transporting ferrous metal objects obliquely from the path through throat 194 . the leftward extremity 214 of block 206 is located over the lip of conduit 216 . ferrous material conveyed past leftward extremity 214 escapes the magnetic field and drops through conduit 216 to a hopper 218 for recycling . nonmagnetic material is not diverted by the magnetic means , and thus drops through an expansion zone 220 into storage hopper 40 as previously described . the travel of belt 198 is effected by drive roller 202 , which is driven by a motor 222 . the magnetic separator shown in fig4 and 5 works best if the material being treated is previously shredded , and a commercially available shredder which will comminute the material into 4 inch pieces is a model 42d shredder sold by the heil co ., 3000 west montana street , milwaukee , wis . turning now to the flue gas treatment means , fig7 , and 9 show the mechanical elements of wet cyclone system 66 . inlet 224 of cyclone system 66 forming a first part of the scrubber system receives effluent from flue gas outlet 112 or from a heat exchanger in circuit therewith . a ring shaped manifold 230 is supplied with a mildly alkaline water - based liquor by pump and filter 74 to feed spray heads such as 232 , 234 , and 236 , forming a substantially continuous fluid curtain through which the flue gases flow . for a system in which 16 , 000 pounds of flue gas per hour are scrubbed , the scrubber liquor can be introduced at the rate of about 24 gallons per minute . the liquor absorbs noxious gases such as hydrogen chloride , soaks the fly ash , and thus entrains or dissolves these components in liquid droplets . the sprayed flue gases then enter cyclone 237 . cyclone 237 has a helical top ring 238 defining a correspondingly shaped passed which receives the effluent , directing it along the conical inner wall 240 of the cyclone . wall 240 can be made of coated fiberglas or coated carbon steel . large particles and droplets ( having a diameter exceeding about 160 microns ) lose velocity , slide downward along wall 240 , and ultimately exit at the liquid outlet 242 of wall 240 , while effluent gases are able to leave the cyclone by rising through outlet conduit 244 . the effluent from liquid outlet 242 of cyclone 237 is treated , replenished as necessary with makeup water , filtered to remove particulate matter , and returned to manifold 230 to treat another portion of the effluent . the gaseous component leaving cyclone 237 is directed into a wet electrostatic precipitator 68 , which can be the basic model precipitator commercially available from fiber - dyne company , 8530 san fernando road , sun valley , calif . 91352 . fig1 and 11 show a flotation separator for separating the heavy fraction taken from trough 184 into a first fraction which consists essentially of glass and a second fraction which consists essentially of aluminum . the separation depends on the difference in specific gravity between aluminum slag and glass slag , the former being lighter than the latter . fig1 shows the downstream end of screw conveyor 188 conveying the heavy fraction from incinerator 42 to an inlet 248 in the side wall 250 of flotation separator 52 . inlet 248 is located roughly midway between the upper end 252 and lower end 254 of separator 52 . the charge of material in separator 52 is acted upon by a stream of fluidizing air supplied from an inlet conduit 256 at the rate of roughly 4000 cubic feet per minute for a flotation separator having a diameter of about 2 feet . air from inlet conduit 256 passes through a steel support screen 258 . due to the action of this fluidizing air , the material within wall 250 is fluidized and agitated , thereby allowing it to sort itself according to density , the lighter materials rich in aluminum tending to migrate to upper end 252 , and the heavier glass - rich fractions tending to gravitate downwardly toward lower end 254 . air passes upward through cylindrical wall 250 and out through the top 260 of the device . the aluminum rich fraction is drawn off by outlet conduit 262 which is equipped with a rotary air lock feeder 264 . a second outlet conduit 266 is provided for conducting away the glass heavy fraction , and also includes a rotary air lock feeder 268 as previously described for preventing fluidizing air from escaping via this route . to assist in removing the heavier fraction from the separator , a rotating sweeper blade 270 is provided to sweep screen 258 , thereby moving the heaviest particles toward outlet conduit 266 . sweeper 270 is powered by a motor and gear drive 272 . since the device shown in fig1 and 11 can be expected to occasionally entrap very small , heavy particles which can fall through screen 258 , a clean out door 274 is provided for permitting the convenient removal of such very dense materials when the device is not in operation . conduits 266 and 262 respectively feed salvage hoppers 60 and 58 shown in fig1 .	1
referring to the attached drawings , in fig2 there is shown a maximum mileage indicator comprises a casing 11 , a dial plate 13 mounted on the casing 11 , a transparent cover 12 placed over the dial plate 13 , and a bourdon gauge including a bourdon tube 115 fixed at one end to the side wall of the casing 11 and at the other end to a connecting rod 114 which is coupled at the other end to the lever portion of a segment gear 112 which engages with a gear 111 to which a pointer 19 is attached by a pin 110 . referring to fig3 the pin 110 extends upwards through the dial plate 13 to the pointer 19 and downwards to a bearing ( not shown ) fixed to the bottom of the casing 11 and is secured at its leg portion of the gear 111 . the gear 111 engages with the segment gear 112 which has the lever portion coupled to one end of connecting rod 114 . as described above , the other end of the connecting rod 114 is coupled to the tip of the bourdon tube 115 which is tightly sealed . the other end of bourdon tube 115 or inlet port is airtightly connected to an intake manifold of an engine ( not shown ). the dial plate 13 is formed with a slit window 18 the upper edge of which is graduated in pressure scale . under the dial plate 13 is disposed an indicator board 40 secured to the shaft of a speedometer including a hair spring 15 , a rotor 16 , a magnet 17 and a magnet driving shaft 116 to which the rotation of wheels of a vehicle is transmitted through a flexible wire which is well known in the art . the magnet driving shaft 116 is supported by a bearing 117 in such a manner as shown in fig3 . fig4 illustrates one example of the indicator board 40 on which the maximum mileage curves bv &# 39 ; s are drawn for various conditions . the speed scale of a vehicle is printed on the circumference of the indicator board 40 while the vacuum scale in the intake manifold is printed on concentric circles from the center to the circumference as shown in fig4 . a radial line representing vehicle speed is such a curve as to conform to the locus of the pointer 19 ( fig2 and 3 ). the curve bv1 is constructed by connecting the plots of vacuum for each vehicle speed in the similar way to the bv curve in fig1 . the width of the curve represents the amount of scatter in measurement due to variations in the vehicle weight or engine conditions . the shape of bv curve depends upon the vehicle weight and the state of road gradient and road surface . the bv curves from bv1 to bv5 are printed for different operating conditions from at a level road with a normal load to at a medium falling grade as illustrated in fig4 . in practice it is preferred that the bv curves from bv1 to bv5 are distinctly colored , for example , from green for the maximum mileage to red for the minimum mileage . the manner of operation of the indicator described in connection with fig2 and 3 will be explained particularly with reference to fig2 . in proportion to the vehicle speed , the indicator board 40 rotates clockwise or counter - clockwise so that a vehicle speed line observed through the slit window 18 will represent the vehicle speed while a portion p of the bv curve will indicate the ideal pressure ( 400 mmhg ) required for the maximum mileage at the vehicle speed . on the other hand , the pointer 19 indicates an actual pressure ( 320 mmhg ) so that it is required to operate a shift lever or accelerator pedal in such a manner that the pointer 19 overlaps the portion p of the bv curve in the slit window 18 . thus , the overlap of the pointer 19 on the portion p indicates that the vehicle is running under the maximum mileage driving condition . referring to fig5 and 6 there is shown another embodiment of the maximum mileage indicator according to the invention . it comprises a casing 11 provided with a dial plate 13 formed with slit windows 18 and 121 , a pointer 19 secured to a pin 110 and placed between the dial plate 13 and a transparent cover 112 mounted on the casing 11 , and a vacuum gauge including a bourdon tube 115 , a connecting rod 114 , a segment gear 112 , a windup spring 113 , a gear 111 and the pointer 19 . the outer end of the bourdon tube 115 is designed to couple with the intake manifold of an engine . as the vacuum inside the bourdon tube 115 increases , the free end of the tube 115 turns counter - clockwise , as shown in fig6 rotating the segment gear 112 against the windup spring 113 and the gear 111 clockwise , together with the pointer 19 . in this embodiment there is provided a cam board 41 which is secured to a shaft 125 fixed to the rotor 16 of a speedometer so that it turns around in proportion to the vehicle speed . the rotor 16 which is well known in the art is opposed at a distance to a magnet ( not shown ) to which the rotation of wheels of a vehicle is transmitted through a flexible wire . the cam 41 is formed in such a way that its shape conforms to the spiral line bv &# 39 ; s is constructed in the similar way to the bv curves on the indicator board 40 as shown in fig4 . the contour of the cam board 41 contacts with an indicator rod 120 which is slidably supported by a cylindrical guide member 123 fixed to the casing 11 and having a square hole 126 cut in line with the slit window 18 of the dial plate 13 . a coil spring 124 is provided within the guide member 123 to push the indicator rod 120 to the left as shown in fig6 . when the cam board 41 turns around corresponding to the vehicle speed , the indicator rod 120 in contact with the cam face travels to and fro in the lateral direction . the indicator rod 120 is provided with a mark 122 , whose position indicates the ideal vacuum required for the maximum mileage driving for a given vehicle speed . since the pointer 19 of the vacuum gauge indicates an actual vacuum in the intake manifold , control may be made in such a manner that the pointer 19 overlaps the mark 122 to thus provide the maximum mileage driving condition . in addition , when the cam board 41 is graduated in the speed scale , the vehicle speed can be read through the slit window 121 of the dial plate 13 . fig7 illustrates the essential parts of the modified embodiment as shown in fig5 and 6 . this embodiment is different from the one shown in fig5 and 6 only in the indicating mechanism of the vacuum gauge . a pulley 131 is supported by a shaft 134 provided at the center of the bourdon tube 115 and has a slit 132 cut in the radial direction . the bourdon tube 115 has at its free end a pin 133 which slidably engages with the slit 132 of the pulley 131 so that the pulley 131 rotates clockwise or counterclockwise as the bourdon tube 115 contracts or expands depending on the vacuum therein . a string , rope or belt 130 is held in strain over the pulley 131 and an idle roller 134 . the pointer 19 is fixed to the string 130 so that it travels transversely in accordance with the rotation of the pulley 131 . referring now to fig9 and 10 there is shown the modified preferred embodiment of maximum mileage indicator of the invention as shown in fig2 and 3 . on the indicator board 42 the speed scale is printed as well as the maximum mileage curve bv . correspondingly , the dial plate 13 is formed with a slit window 121 through which the vehicle speed can be read . the dial plate 13 of this embodiment further has window 50 and 51 for an odometer 53 and trip - type odometer 52 , respectively . these odometer 53 and trip - type odometer 52 are driven by a gear 160 fixed to a shaft 116 through a train of gear ( not shown ). the rest of the parts of this embodiment are identical with those as shown fig2 and 3 . it is noted however that the speedometer window 121 is disposed at a place making an angle 90 ° with the slit window 18 so that the speed scale should be printed on the indicator board 42 rotated counterclockwise by an angle 90 ° with the corresponding portion p of the bv curve observed in the slit window 18 . when the indicator board 42 is graduated in vehicle speed as shown in fig4 the speedometer window 121 should be placed on the extended line of the slit window 18 . with this arrangement , the maximum mileage indicator can be also used for a speedometer so that the space on the instrument panel and the manufacturing cost can be greatly reduced . moreover , it makes easier to read both the vehicle speed and maximum mileage scales at the same time . while the invention has been particularly illustrated and described with reference to the preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention .	6
the invention is based on achieving stable operation of refrigerating installations with small temperature differences of the media to be cooled , and consequently higher efficiencies . this results in highly efficient evaporation in refrigerating installations . the method of producing cold conditions is supplemented or modified to the novel extent that , in addition to the monitored suction and high pressures in refrigerating systems , the temperature of the liquid refrigerant upstream of the expansion valve ( a ) and the temperature of the suction vapor upstream of the compressor inlet ( b ) is monitored , controlled and kept constant . monitoring the refrigerant temperature upstream of the expansion valve ( a ) allows control of the saturation states in the refrigerant mixture ( liquid / vapor ). this control in the refrigerant leads to stable conditions in the refrigerating circuit . the same effect may be achieved by monitoring the temperature and keeping constant the suction vapor temperature at the compressor inlet ( b ). by stabilizing these two temperatures , which are the temperatures upstream of the expansion valve and the temperature at the inlet of the compressor , and the associated respective states of the respective refrigerant at these two points in the refrigerating circuit , we achieve stable conditions and prevent feedback effects in the control equipment and hunting of the system . as a result , there are fewer disturbances , which leads to a stable control loop and consequently to stable operation of the refrigerating installations and to highly efficient evaporation . such a stable operation has the effect of producing energy and cost savings and making it possible to operate processes with much smaller temperature differences of the media to be cooled in relation to the respective evaporation temperatures , especially in combination with the two - stage evaporation technique ( 1 + 2 ). as a result , processes can be operated in a simple and low - cost manner that is not possible at present in this way . the temperature a upstream of the expansion valve and the temperature b at the inlet of the compressor and the associated refrigerant states can be monitored and stabilized in many possible ways . the enumeration of possibilities is analogously restricted in this patent specification to just a few . the innovation is the monitoring of the two described refrigerant states ( a + b ). irrespective of the method by which this is achieved , only one or the other measure ( temperature a , temperature b , or pressure differential 7 ) must be taken , depending on the application . it is consequently possible to arrive at the desired result just by the monitoring of the temperature of the liquid refrigerant upstream of the expansion valve ( a ) or monitoring the temperature of the suction vapor upstream of the compressor ( b ) or by the monitoring of the liquid refrigerant pressure upstream of the expansion valve and the monitoring of the temperature of the suction vapor ( a + b ). suitable measures for monitoring the temperature of the refrigerant upstream of the expansion valve are : 1 . keeping the temperature of the refrigerant upstream of the expansion valve constant by using a secondary medium through a heat exchanger ( 4 ). 2 . keeping the temperature of the liquid refrigerant upstream of the expansion valve constant ( slow to react ) by using a mass ( 13 ) which may be liquid , solid , gaseous or mixed between these states of aggregation . 3 . keeping the temperature of the liquid refrigerant upstream of the expansion valve constant , especially when using an ihe or applying the two - stage evaporation process , through use of a control valve ( 9 ). this control passes only a specific mass flow through the ihe or the second stage of the two - stage evaporation and the remaining mass flow ( e ) passes directly or indirectly to the expansion valve . therefore , it is possible for the mass flow ( e ) to pass the ihe or the second stage of the two - stage evaporation to be cooled , heated or kept at the same temperature . suitable measures for monitoring the temperature of the refrigerant upstream of the compressor are : 4 . keeping the temperature of the suction vapor upstream of the compressor ( b ) constant by using a secondary medium by means of a heat exchanger . 5 . keeping the temperature of the suction vapor upstream of the compressor constant ( slow to react ) by using a mass ( liquid , solid , gaseous or mixed between these states of aggregation ). 6 . keeping the temperature of the suction vapor upstream of the compressor constant , especially when using an ihe or applying the two - stage evaporation process , by means of a control valve ( 8 ), ( 12 ) and / or ( 9 ). control valves 9 and 12 pass only a specific mass flow through the ihe ( 2 ) or the second stage of the two - stage evaporation and the remaining mass flow ( 9 ) travels directly or indirectly to the expansion valve ( 6 ) or compressor ( 5 ). 7 . by means of a monitored inlet temperature ( f ) of the liquid refrigerant into the ihe ( 2 ) or the second stage of the two - stage evaporator , for example using an external refrigerant liquid supercooler ( 3 ) or the like . 8 . by means of a monitored filling level of the refrigerant to be liquefied in the evaporator or in the ihe or in the second stage of the two - stage evaporator , for example by means of level control ( 7 ) or pressure difference measurement ( 7 ) or suction vapor temperature control ( t 23 ) upstream of the compressor . therefore , it is possible for the level control to occur by means of the evaporator , the ihe or the second stage of the two - stage evaporator individually and / or the evaporator alone or in combination with the ihe or by means of the second stage of the two - stage evaporator or a reference object , for example an accumulator . 9 . especially in the case of a refrigerating system with two - stage evaporation ( 1 + 2 ), the control can be performed as follows ( combinations and variants thereof are also possible ): expansion valve may be controlled bydetecting the temperature of the refrigerant 1 ) upstream of the expansion valve ( t 20 ), the pressure / temperature downstream of the expansion valve ( t 21 / p 7 ), 2 ) the pressure / temperature between the first and the second evaporator stages ( p 8 / t 22 ), or 3 ) the pressure / temperature downstream of the second evaporator stage ( p 9 / t 23 ) or combinations thereof . the temperature / pressure difference ( t 20 / p 7 , p 8 , p 9 ) serves as a controlled variable for the expansion valve ( 6 ). a suction vapor temperature detection ( t 23 ) upstream of the compressor ( 5 ) overrides the temperature difference / pressure control ( t 20 / p 7 , p 8 , p 9 ) as required . as an alternative to the temperature difference / pressure control , a level or pressure difference control ( 7 ) for the expansion valve ( 6 ) may be used . the temperature upstream of the expansion valve is kept constant by means of suitable measures as already described . keeping the temperature of the liquid refrigerant upstream of the expansion valve constant in this way may take place for example by using a heat exchanger ( 4 ) fitted between the liquid line and the medium flow . a partial mass flow or the entire mass flow of the cooled medium is conducted ( 10 / 11 ) through the heat exchanger ( 4 ) in co - flow , counter - flow or cross - flow , etc ., in relation to the refrigerant liquid . the medium may in this case be conducted through the exchanger with a controlled or uncontrolled temperature . the correct dimensioning of the heat exchanger ( 4 ) has the effect that the refrigerant liquid upstream of the expansion valve ( a ) is supercooled or kept constant at any desired temperature level , or if desired even at a very low temperature level , which means that the evaporator ( 1 ) is fed with liquid refrigerant or with only a small proportion of vapor refrigerant . the proportion of vapor refrigerant in the evaporator can be optimized and set to the evaporator type ( 1 ), and consequently will influence the efficiency for starting the evaporation process , with a corresponding temperature of the liquid refrigerant upstream of the expansion valve ( a ). as an alternative to overriding the expansion valve control , based upon the suction gas temperature , by flooding the second stage of the two - stage evaporator , in the case of excessive suction vapor temperatures upstream of the compressor ( t 23 ), the refrigerant liquid inlet temperature into the second evaporator stage ( ihe ) ( 2 ) ( f ) may be limited for example by means of an external supercooler ( 32 ). this may be applied in cases of high condensation temperatures . as an alternative or in combination with this limitation , part of the refrigerant liquid mass flow ( e ) may be conducted past the second compressor stage ( ihe ) ( 2 ), in dependence on the suction vapor temperature ( b ).	5
the present invention provides an improved process for the chemical reduction of imide esters , singly or mixtures thereof , of the general formula ## str1 ## wherein : ar represents an aryl or substituted aryl group ## str2 ## in which x can be hydrogen , c1 - c4 alkyl , c1 - c4 alkoxy , trifluoroalkyl , hydroxy , halogen , preferably fluorine , methylthio or arylalkyloxy ; to the corresponding amino alcohols , singly or mixtures thereof , of the general formula ## str3 ## in which r 1 and ar are the same as defined above . preferably , x is hydrogen or fluorine , r 1 is hydrogen or methyl , and r 2 is methyl or ethyl . for example , unexpectedly , it was discovered that the reduction of the imide ester (+/-) trans 3 - ethoxy or 3 - methoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) resulted in the production of the amino alcohol (+/-) trans - 4 -( 4 &# 39 ;- fluorophenyl )- 3 - hydroxymethyl - n - methylpiperidine ( ii ) with isolated yields greater than 76 %. the higher yields obtained by this process result in lower raw material costs and minimization of unwanted by - products . in addition , it was discovered that the reduction could be performed at higher concentrations than described in the prior art , with no deleterious effect on the yield or quality of product . higher throughput on an industrial scale and minimization of cycle time result from the use of higher concentrations . the yields were obtained under certain specific reaction conditions . the substrate ( i ) was reduced with a suitable reducing agent , such as but not limited to lithium aluminum hydride , the reducing agent mixture of sodium aluminum hydride and an additive , such as lithium chloride , and the like . the reaction concentration ranged from approximately 7 to 10 ml of solvent per gram of substrate . the proportion of ethereal to hydrocarbon solvent ranged from 40 % to 70 % ethereal solvent in hydrocarbon solvent by volume . the reduction can be performed from room temperature to solvent reflux temperatures . the amino alcohols can be obtained as a mixture of enantiomers . the compounds can be resolved into their enantiomeric forms by conventional methods , such as by use of an optically active acid , such as (+)- 2 &# 39 ;- nitrotartranilic acid , (-)- di - p - toluoyltartaric acid , and the like . alternatively , the optically active form of the compound can be produced without requiring subsequent resolution . these results for the reduction of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methylpiperidine - 2 , 6 - dione ( i ) are summarized in the table below : ______________________________________ % % % ethereal hydrocarbon yieldreference reducing agent solvent solvent of ii______________________________________4 , 902 , 801 lialh . sub . 4 100 0 65 ( example 5 ) 4 , 902 , 801 lialh . sub . 4 14 86 65 - 75 ( example 7 ) example 1 lialh . sub . 4 42 58 89 . 0 ( invention ) example 2 naalh . sub . 4 / licl 44 56 82 . 7 ( invention ) example 3 naalh . sub . 4 / licl 55 45 85 . 5 ( invention ) example 4 naalh . sub . 4 / licl 45 55 85 . 4 ( invention ) example 5 naalh . sub . 4 / licl 56 44 83 . 1 ( invention ) comparative naalh . sub . 4 / licl 38 62 72 . 0example______________________________________ examples of ethereal solvents include , but are not limited to , tetrahydrofuran , 2 - methyltetrahydrofuran , diethyl ether , dibutyl ether , methyl t - butyl ether , diethoxymethane , dimethoxyethane and other glyme solvents , and mixtures thereof . examples of hydrocarbon solvents include , but are not limited to , toluene , benzene , hexanes , heptane , xylene , ethyl benzene , and the like , and mixtures thereof . optionally , additives other than lithium chloride can be used , such as , but not limited to , libr , alcl 3 , hcl , ticl 4 , albr 3 , tibr 4 , lialh 4 , nabh 4 , alh 3 , thf - bh 3 , alcohols such as methanol , ethanol , isopropanol , t - butanol , ethereal alcohols and / or their corresponding metal alkoxides , and mixtures thereof . the additives can be employed in 0 . 01 equivalents up to and including 5 . 0 equivalents . a 500 ml , three - necked , jacketed flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . the flask was charged with tetrahydrofuran , 70 ml . this solution was stirred at 350 rpms and cooled to 0 ° c . with a circulating chiller . lithium aluminum hydride , 8 . 51 grams of 95 % assay ( 2 . 70 equivalents , 213 mmole ) was added to the reactor . an immediate exotherm of 45 ° c . was noted , which quickly subsided . toluene , 24 ml , was then added . this suspension was stirred at 0 ° c . for an additional 10 minutes . a dry , 250 ml , single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . this flask was purged with argon , then charged with 23 . 3 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 79 mmole ) and 65 ml of toluene . this suspension was stirred at room temperature . this solution was transferred to the addition funnel . the 250 ml flask was rinsed with additional toluene , 8 ml , and this was added to the additional funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . total imide - ester feed time was 54 minutes . after the end of the feed , the reaction mixture was heated to 65 ° c . for two hours , then recooled to 0 ° c . the speed of the agitator was increased to 500 rpms . additional toluene , 85 ml , was added . this was followed by slow addition of 9 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 9 ml , was then added dropwise . the solid started to break up at the end of this addition . water , 18 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 27 ° c ., and the stirrer was slowed to 350 rpms . the reaction mixture was stirred at 27 ° c . for one hour , then the byproduct solids were collected on a buchner funnel . the solids were reslurried with toluene ( 2 × 30 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . a 500 ml , four - necked , round bottom flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , a teflon ® stopper and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . lithium chloride , 10 . 00 grams ( 3 . 00 equivalents , 236 . 8 mmole ) was added . the flask was then charged with tetrahydrofuran , 70 ml . this solution was stirred at 350 rpms for thirty minutes . sodium aluminum hydride , 12 . 80 grams of 90 % assay ( 2 . 70 equivalents , 213 . 3 mmole ) slurried in toluene , 24 ml , was added , and this suspension was stirred at room temperature for one hour then cooled to 10 ° c . a dry , 250 ml , single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . this flask was purged with argon , then charged with 23 . 3 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 79 mmole ) and 65 ml of toluene . this suspension was stirred at room temperature . the solution was transferred to the addition funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . the reaction mixture was heated to 75 ° c . for two hours , then recooled to 10 ° c . additional toluene , 75 ml , was added . this was followed by slow addition of 9 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 9 ml , was then added dropwise . this solid started to break up at the end of this addition . water , 18 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 65 ° c . for thirty minutes and then the reaction mixture was then cooled to room temperature , then the byproduct solids were collected on a buchner funnel . the solids were reslurried with toluene ( 2 × 30 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . a 500 ml , four - necked , round bottom flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , a teflon ® stopper and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . lithium chloride , 9 . 83 grams ( 2 . 64 equivalents , 231 . 90 mmole ) was added . the flask was then charged with tetrahydrofuran , 67 ml . this solution was stirred at 350 rpms . sodium aluminum hydride , 11 . 98 grams of 95 % assay ( 2 . 40 equivalents , 210 . 82 mmole ) slurried in toluene , 21 ml , was added to the reactor . additional tetrahydrofuran , 61 ml , was added and this suspension was stirred at room temperature for ninety minutes . toluene , 6 ml , was then added . this suspension was cooled to 10 ° c . and stirred for an additional thirty minutes . a dry , 250 ml ., single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . the flask was purged with argon , then charged with 25 . 9 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 88 mmole ) and 69 ml of toluene . this suspension was stirred at room temperature . this solution was transferred to the addition funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . after the end of the feed , the 250 ml flask was rinsed with additional toluene , 7 ml , and this was added to the addition funnel . the reaction mixture was heated to 75 ° c . for three hours , then recooled to 10 ° c . additional toluene , 50 ml , was added . the speed of the agitator was increased to 500 rpms . this was followed by slow addition of 9 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 9 ml , was then added dropwise . the solid started to break up at the end of this addition . water , 18 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 60 ° c . for twenty minutes and the stirrer was slowed to 350 rpms . the reaction mixture was then cooled to 40 ° c ., then the byproduct solids were collected on a buchner funnel . the solids were reslurried with reslurried with toluene ( 2 × 31 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . a 500 ml , four - necked , round bottom flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , a teflon ® stopper and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . lithium chloride , 9 . 85 grams ( 2 . 64 equivalents , 232 . 36 mmole ) was added . the flask was then charged with tetrahydrofuran , 67 ml . this solution was stirred at 350 rpms . sodium aluminum hydride , 12 . 01 grams of 95 % assay ( 2 . 40 equivalents , 211 . 24 mmole ) slurried in toluene , 21 ml , was added to the reactor . additional tetrahydrofuran , 39 ml , was added and this suspension was stirred at room temperature for fifty minutes . toluene , 31 ml , was then added . this suspension was cooled to 10 ° c . and stirred for an additional five minutes . a dry , 250 ml ., single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . this flask was purged with argon , then charged with 25 . 9 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 88 mmole ) and 69 ml of toluene . this suspension was stirred at room temperature . this solution was transferred to the additional funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . after the end of the feed , the 250 ml flask was rinsed with additional toluene , 7 ml , and this was added to the addition funnel . the reaction mixture was heated to 75 ° c . for three hours , then recooled to 10 ° c . additional toluene , 50 ml , was added . the speed of the agitator was increased to 500 rpms . this was followed by slow addition of 9 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 9 ml , was then added dropwise . the solid started to break up at the end of this addition . water , 18 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 65 ° c . for twenty minutes and the stirrer was slowed to 350 rpms . the reaction mixture was then cooled to 40 ° c ., then the byproduct solids were collected on a buchner funnel . the solids were reslurried with toluene ( 2 × 31 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . a 500 ml , four - necked , round bottom flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , a teflon ® stopper and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . lithium chloride , 9 . 90 grams ( 3 . 24 equivalents , 233 . 86 mmole ) was added . the flask was then charged with tetrahydrofuran , 69 ml . this solution was stirred at 350 rpms . sodium aluminum hydride , 11 . 70 grams of 95 % assay ( 2 . 70 equivalents , 194 . 89 mmole ) slurried in toluene , 19 ml , was added to the reactor . additional tetrahydrofuran , 37 ml , was added and this suspension was stirred at room temperature for thirty minutes . this suspension was cooled to 5 ° c . and stirred for an additional five minutes . a dry , 250 ml , single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . this flask was purged with argon , then charged with 21 . 2 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 72 . 2 mmole ) and 59 ml of toluene . this suspension was stirred at room temperature . this solution was transferred to the addition funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . after the end of the feed , the 250 ml flask was rinsed with additional toluene , 6 ml , and this was added to the additional funnel . the reaction mixture was heated to 75 ° c . for three hours , then recooled to 10 ° c . additional toluene , 40 ml , was added . the speed of the agitator was increased to 500 rpms . this was followed by slow addition of 8 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 8 ml , was then added dropwise . the solid started to break up at the end of this addition . water , 16 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 65 ° c . for thirty minutes and the stirrer was slowed to 350 rpms . the reaction mixture was then cooled to 30 ° c ., then the byproduct solids were collected on a buchner funnel . the solids were reslurried with toluene ( 2 × 27 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . a 500 ml , four - necked , round bottom flask was equipped with a mechanical stirrer , a 125 ml pressure - equalizing addition funnel , a teflon ® stopper and a claisen adapter fitted with a teflon ® clad thermocouple , a dry ice condenser , and an argon inlet . this apparatus was dried in an oven overnight at 125 ° c ., assembled hot , and allowed to cool to room temperature in a stream of argon . lithium chloride , 10 . 55 grams ( 3 . 15 equivalents , 240 . 0 mmole ) was added . the flask was then charged with tetrahydrofuran , 60 ml . this solution was stirred at 350 rpms . sodium aluminum hydride , 13 . 53 grams of 90 % assay ( 2 . 86 equivalents , 226 . 0 mmole ) was added , and this suspension was stirred at room temperature for thirty minutes . toluene , 75 ml , was then added to the reactor . this suspension was cooled to 10 ° c . and stirred for an additional thirty minutes . a dry , 250 ml , single - necked flask was fitted with a large , egg - shaped magnetic stir bar , and an argon inlet . this flask was purged with argon , then charged with 23 . 3 grams of (+/-) trans 3 - ethoxy carbonyl - 4 -( 4 &# 39 ;- fluorophenyl )- n - methyl - piperidine - 2 , 6 - dione ( i ) ( 1 . 00 equivalent , 79 mmole ) and 50 ml of toluene and 15 ml tetrahydrofuran . this suspension was stirred at room temperature . this solution was transferred to the addition funnel . the imide - ester solution was added dropwise . this resulted in a very exothermic reaction . the feed rate was adjusted to maintain the reaction temperature at below 20 ° c . the reaction mixture was heated to 65 ° c . for three hours , then recooled to 10 ° c . additional toluene , 47 . 5 ml , was added . this was followed by slow addition of 9 ml of water . the reaction mixture got very thick at the end of this addition . aqueous sodium hydroxide , 15 %, 9 ml , was then added dropwise . the solid started to break up at the end of this addition . water , 18 . 1 ml , was then added dropwise . at the end of this feed , the reaction mixture was warmed to 50 ° c . for thirty minutes , the reaction mixture was cooled to room temperature , and then the byproduct solids were collected on a buchner funnel . the solids were reslurried with toluene ( 2 × 30 ml ). the desired product ( ii ) was isolated from the combined filtrates , washed , air dried , then dried in a vacuum desiccator overnight . the foregoing examples are illustrative of the present invention and are not to be construed as limiting thereof . the invention is defined by the following claims , with equivalents of the claims to be included therein .	2
a single panel or bay of an electronic apparatus , similar to that shown in u . s . pat . no . 3 , 711 , 814 , incorporating a high density of integrated circuit devices mounted on printed circuit boards or cards is shown in fig1 . the apparatus , which can be , for example , a portion of a computer , includes a pair of spaced parallel frame members 10 , 12 each provided with a plurality of parallel , spaced apart grooves 14 , 16 adapted to receive a plurality of circuit boards 18 in respective pairs of the grooves . a like plurality of printed circuit board edge connectors 20 are positioned on a base 22 extending between the side walls 10 , 12 . each circuit board 18 is provided at its upper end with a locking means 24 which lockingly secure the respective boards in position in the edge connectors 20 . the integrated circuits on the individual boards are arranged to be cooled by a closed fluid circulating cooling system . mounted on each board are a plurality of fluid cooled headers 26 , shown in greater detail in fig2 , 7 and 8 . each header 26 includes a base 28 having a central flow chamber 30 connected at opposite ends to inlet 32 and outlet 34 . the inlet and outlet are each provided with conventional means , such as the annular ridges shown , for making fixed connection to fluid carrying conduits 36 . an elongated groove 38 is formed in the base spaced from the edge of chamber 30 . a plurality of electrical contacts 40 are disposed along at least two opposite edges of the header . these contacts can be of the type described in u . s . pat . no . 3 , 753 , 211 for example . an annular gasket 42 of suitable resilient material is received in the groove 38 and makes sealing contact between the base and the substrate 44 . the substrate 44 includes a plurality of contact pads 46 along opposite side surfaces , each pad permanently connected to integrated circuit chip 48 and adapted to make contact with a respective electrical contact 40 . the header cover 50 has first and second parallel spaced flanges 52 , 54 , respectively , which are adapted to engage over oppositely directed shoulders 56 , 58 , respectively , on the header base 28 . the headers are fixed to the boards 18 by conventional means , not shown , and are interconnected by fluid conduits 36 and by fluid conduits 60 , 62 to the connector 64 on the edge of each board 18 . the edge connector 64 is adapted to make both electrical and fluid flow connection with the connector 20 . a fluid and electrical distribution cable 66 is shown connecting the individual connectors 20 to a unit or bay to a connector 68 mounted on a front panel 70 . a similar fluid and electrical distribution cable 72 connects the panel to the fluid distribution portion of a typical fluid cooling system as discussed above . at each of the interconnect positions in the closed fluid circuit of fig1 namely between the connectors 20 and 64 and in the mating halves of the connector 68 , each fluid line is provided with a fluid interconnect device 74 according to the present invention and shown in greater detail in fig4 to 6 . each device 74 comprises a fitting 76 one end of which engages , by conventional means ( not shown ), the appropriate associated conduit ( also not shown ). the other end of fitting 76 engages the body 78 of the device by means of a plurality of conventional annular ridges 80 . the body 78 of the device has a narrowed opening 82 at the opposite end from fitting 76 . a resilient seal member 84 is mounted in the narrow opening 82 with an annular flange 86 inside the body and an enlarged profiled head 88 outside the body holding the seal member in place against body 78 . the seal also has an axial bore 90 which is joined to a shallow conical entrance 92 . a valve member 94 is mounted in the body 78 with integral stem 96 passing through bore 90 . the head 98 of the valve member 94 is biased against the flange 86 of seal 84 by spring 100 . a stop 102 projects from the head 98 of valve member 94 in the opposite direction from the stem 96 . it should be noted that the mating halves of the interconnect device are identical . the device on the left of fig4 to 6 has been mounted as a plug member projecting from an associated housing , for example connector 64 , while the member on the right is recessed as a receptacle in an associated housing , for example connector 20 . the same conditions would apply for the mating halves of connector 68 . the steps of engaging the subject interconnect device are shown in fig4 to 6 . fig4 shows the separated or fully disconnected position of the device . in this position the heads 98 of both valve members 94 are biased against flanges 86 of seals 84 by springs 100 to prevent fluid flow through the device . when the devices are initially engaged , as shown in fig5 the free ends of the seals 84 engage and are compressed against each other to form a leak proof passageway through the aligned axial bores 90 . as the relative movement of the devices towards one another continues , the free ends of the valve stems 96 engage and begin to open the valves 94 against the biasing force of springs 100 to establish fluid flow therethrough . the stops 102 on the end of each valve 94 eliminates the possibility of only one valve opening while the other valve stays closed . if one valve sticks in the closed position the stop of the other valve will abut its related fitting 76 so that all force bringing the devices together will be applied against the stuck valve . full fluid communication between the mated devices is shown in fig6 . uncoupling of the devices produces a reverse action to that described above . as the valves 94 are closed by springs 100 the seals 84 expand to take up any excess fluid thereby preventing undue leakage of the fluid from the system . the alternate header , known as a cold plate header , is shown in fig7 and 8 . the cold plate header functions substantially the same as the header described above with reference to fig2 and 3 . there may , however , be times when it is desirable to have the fluid circulating system completely sealed so that individual integrated circuits 44 can be replaced without removing the associated board 18 from the frame . in such cases a cold plate header as shown in fig7 and 8 would be used . the header base 104 is similar to base 28 in that it has a central cavity 106 connected to inlet 108 and outlet 110 . however , instead of groove 38 surrounding the central , there is a step 112 extending around the upper edge of the cavity . a cold plate 114 is mounted with its peripheral edge sealed in the step 112 to provide a permanent closure of the central cavity . the cold plate 114 can be made of any fluid tight material , such as an elastomer , thin metal film or aluminum filled rubber , and sealed in the step by any known manner , such as by ultrasonic welding or by known adhesives . the cold plate header also includes contacts 116 fixed along opposite sides thereof and shoulders 116 , 118 adapted to receive flanges 122 , 124 of cover 126 . the coolant is pumped through the chamber of the cold plate header taking heat out of the integrated circuit mounted thereon . the substrate 44 lays against the cold plate 114 and heat is transferred from the substrate to the coolant via the cold plate . it is foreseen that the present invention may be subject to many changes and modifications without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative and not restrictive of the scope of the invention .	8
the components of solid catalysts according to the invention are obtained according to the following preparation process . 1st stage : chemical grafting of a ligand with a cyclopentadienyl structure to the solid support the support used for the preparation of the solid catalytic component according to the invention is finely divided and exhibits functional groups having a high reactivity with respect to the reactants employed . an inorganic support carrying hydroxyl functional groups is preferably chosen . mention may be made , among the latter , of inorganic oxides , such as alumina , silica or their mixtures . the support preferably comprises pores with a diameter ranging from 7 . 5 to 30 nm . its porosity is preferably from 1 to 4 cm 3 / g . the support advantageously exhibits a [ lacuna ] surface ranging from 100 to 600 m 2 / g . the support generally exhibits a mean particle size diameter ranging from 10 to 100 μm . the support preferably exhibits , at its surface , from 0 . 5 to 10 and more preferably 1 to 8 hydroxyl groups per nm 2 . this support can have various natures . depending on its nature , its state of hydration and its ability to retain water , there may be reason to subject it to dehydration treatments until the desired content of hydroxyl groups at the surface is obtained . for example , if the support is a silica , the silica can be heated at between 100 and 1000 ° c . and preferably between 140 and 800 ° c . while flushing with an inert gas , such as nitrogen or argon , at atmospheric pressure or preferably under vacuum , for example absolute pressure 1 × 10 − 2 mbar , for , for example , at least 60 minutes . for this heat treatment , the silica can be mixed , for example , with nh 4 cl so as to accelerate the dehydration . in addition , the support is preferably activated before it is used . in the case where it is a support comprising hydroxyl functional groups , the activation can be carried out , for example , by reaction with an alkyllithium compound rx where x = li + and r is an alkyl group . preferably , r is a c 2 to c 6 alkyl , even more preferred r is butyl . if appropriate after a preliminary activation treatment on the support , chemical grafting to the support is carried out by reaction of the reactive functional group with a substituted fulvene according to the formula ( 1 ), in which r1 to r6 can be a hydrogen atom or identical or different c 1 to c 16 alkyl , alkenyl , aryl , alkylaryl or arylalkyl radicals which can form one or more saturated or unsaturated rings . advantageously , r5 and r6 are methyl or phenyl . the activated support is preferably suspended in an inert solvent , such as chosen from aliphatic hydrocarbons , for example hexane or heptane , aromatic hydrocarbons , for example benzene , toluene , xylene , cumene or cymene , alicyclic hydrocarbons , for example cyclopentane , cyclooctane , methylcyclopentane or methylcyclohexane , or ethers , for example diethyl ether or tetrahydrofuran , under an atmosphere of inert gas , for example nitrogen or argon . the fulvene derivative ( 1 ) is added in an amount of between 0 . 01 and 100 and preferably ranges from 0 . 5 to 2 . the suspension obtained is then stirred at a temperature of between ambient temperature and the boiling point of the solvent used , preferably at a temperature of between 40 and 110 ° c . a cyclopentadienyl derivative grafted to the support via a —[ c ( r5 , r6 )]— bridge according to the formula ( 2 ): in which g is the reactive functional group of the support , preferably a deprotonated hydroxyl , x is an alkali metal , preferably lithium , and r1 to r6 have the same meaning as in the formula ( 1 ), is then obtained . 2nd stage : generation of the organometallic entity chemically bonded to the surface an unbridged compound ( 5 ) is obtained according to a route a , whereas the route b gives access to the bridged compound ( 5 ′). a transition metal derivative ml x reacts with the modified support ( 2 ). the product obtained has a structure according to the formula ( 3 ): in which m is a transition metal chosen from the elements from groups 3 , 4 , 5 , 6 , 7 , 8 , 9 and 10 and the lanthanides of the periodic table of the elements , preferably chosen from titanium , vanadium , hafnium , zirconium and chromium ; l is a halogen , a hydrogen , an alkyl , an aryl , an alkoxy or an amide ; x is an integer corresponding to the valency of the metal m ; and r1 to r6 have the same meaning as in the formula ( 1 ). mention may be made , as examples of transition metal derivatives , of ticl 4 , tibr 4 , tii 4 , zrcl 4 , zrbr 4 , zri 4 , hfcl 4 , hfbr 4 , hfi 4 , vcl 4 , nbcl 5 , tacl 5 , mocl 5 , wcl 5 or ndcl 3 . the transition metal derivative can also be a complex between one of the compounds described and an electron - donating compound , such as tetrahydrofuran . in carrying out the stage , use is preferably made of an inert solvent which can , for example , be chosen from aliphatic hydrocarbons , such as hexane or heptane , aromatic hydrocarbons , such as benzene , toluene , xylene , cumene or cymene , alicyclic hydrocarbons , such as cyclopentane , cyclooctane , methylcyclopentane or methylcyclohexane , or ethers , such as diethyl ether or tetrahydrofuran , under an atmosphere of an inert gas , such as nitrogen or argon . the molar ratio of the halogenated derivative to the surface hydroxyl groups of the support is generally between 0 . 5 and 30 and preferably ranges from 1 to 20 . use is preferably made of 5 to 100 ml and more preferably of 10 to 50 ml of inert solvent per gram of support . this contacting operation can be carried out between 80 and 150 ° c ., with stirring , if appropriate under pressure , if the nature of the solvent requires it . on conclusion of the reaction , it is advisable to wash the solid with an inert solvent of the type of those proposed for carrying out this stage . the solid can subsequently be recovered by siphoning or filtration . the compound ( 3 ) can subsequently be reacted with a compound according to the formula ( 4 ): in which r1 ′ to r5 ′ represent a hydrogen atom or identical or different c 1 to c 16 alkyl , alkenyl , aryl , alkylaryl or arylalkyl groups which can form one or more saturated or unsaturated rings and x is an alkali metal , preferably lithium . the derivative ( 4 ) is preferably a cyclopentadienyl , an indenyl or a fluorenyl which is or is not substituted and which is optionally hydrogenated , such as tetrahydroindenyl or octahydrofluorenyl . the precatalyst ( 5 ) obtained following the reaction of ( 3 ) and ( 4 ) has the following general formula : the compound ( 2 ) is reacted with a ligand carrying a bridging group a . the ligand can be a cyclopentadienyl group but also any other compound capable of acting as ligand , for example nr 2 , nhr or or , that is to say amide or alkoxide . preferably , the ligand is a compound according to the formula ( 6 ): in which a is a difunctional group , such as si ( ch 3 ) 2 , siph 2 or ch 2 ch 2 ; x is a halogen ; and r7 to r10 can be a hydrogen atom or identical or different c 1 to c 16 alkyl , alkenyl , aryl , alkylaryl or arylalkyl radicals which can form one or more saturated or unsaturated rings . according to a preferred embodiment of the invention , ( 6 ) is fluorenylsi ( ch 3 ) 2 cl . the reaction between the compound ( 2 ) and the ligand ( 6 ) results in the compound according to the formula ( 7 ): the compound ( 7 ) is converted to the precatalyst ( 5 ′), the carrier of a bridged ligand , by deprotonation of the ligands followed by metallation by ml x . the heterogeneous precatalysts ( 5 ) or ( 5 ′) are preferably activated by the usual cocatalysts for catalysts of monosite type ( in particular perfluorinated boranes of b ( c 6 f 5 ) 3 type and borates of [ x ][ b ( c 6 f 5 ) 4 ] type with preferably x = cph 3 or hnme 2 ph ) after alkylation of the derivative ( 5 ) or ( 5 ′) or mao ). the solid catalytic components according to the invention then constitute heterogeneous catalytic components compatible with heterogeneous - phase polymerization processes . the organometallic entities are chemically bonded thereto at the surface of a solid support , which makes it possible to avoid the phenomena of desorption of catalytic entities during the subsequent processing stages of the component : activation , polymerization . the component is heterogeneous and therefore compatible with heterogeneous polymerization processes ; in particular , the gas - phase process is very active in the polymerization of olefins . in comparison with the studies by soga et al . ( macromol . symp ., 1995 , 89 , 249 – 258 ), to give an example of unit construction , the grafting as described makes it possible to avoid the stage of deprotonation of the ligands of the cyclopentadienyl type chemically bonded to the surface . this stage may be incomplete and / or may give rise to secondary reactions , such as detachment of the grafted entities or opening of siloxane bridges on the support . furthermore , the method described exhibits , in comparison with the grafting of a presynthesized catalyst , the advantage of being easily generalized to a large number of structures . in addition , it does not require the problematic synthesis of molecular complexes . in other words , the ease and the reduced number of the synthetic stages may be emphasized . the syntheses disclosed in ep 0 821 009 , as in the article in macromolecules ( 2000 , 333 , 3194 ), do not make possible access to complexes having a single carbon between the support and the cyclopentadienyl ligand . the invention will be described in more detail by means of the following examples , which are given by way of illustration and without implied limitation . the handling operations are carried out under argon with conventional schlenk techniques . the heptane and the toluene used as solvents are dried over 3 å molecular sieve . the thf used as solvent and reactant is dried over sodium / benzophenone . whatever the type of silica used , 6 g of this support is subjected to a heat treatment under vacuum which successively comprises a rise in temperature from 20 ° c . to 100 ° c . over thirty minutes , from 100 ° c . to 130 ° c . over thirty minutes and from 130 ° c . to 550 ° c . over one hour thirty minutes , a stationary phase of 5 hours at 550 ° c . and a descent to ambient temperature . following this treatment , the levels of hydroxyl groups at the surface of the various silicas are as follows : 1 . 9 ml of a 0 . 9m solution of tributylaluminum in heptane ( 1 . 7 mmol ) are introduced , at ambient temperature , into a 150 ml schlenk flask comprising 0 . 333 g of said thermally treated silica a ( i . e . 0 . 36 mmol of hydroxyl groups ) in suspension in 50 ml of toluene . the suspension is stirred at ambient temperature for 4 hours . the support is washed with 3 times 40 ml of toluene and dried at ambient temperature under vacuum . 1 . 52 ml of a 1 . 6m solution of buli in heptane ( 2 . 4 mmol ) are introduced , at ambient temperature , into a 150 ml schlenk flask comprising 2 . 209 g of said thermally treated silica a ( 2 . 4 mmol of hydroxyl groups ) in suspension in 50 ml of toluene . the suspension is stirred at ambient temperature for 4 hours . the support is washed with 3 times 40 ml of toluene and dried at ambient temperature under vacuum . the solid recovered is suspended in 50 ml of freshly distilled thf . 0 . 29 ml of 6 , 6 - dimethylfulvene ( 2 . 4 mmol ) is subsequently introduced therein at ambient temperature and under an argon atmosphere . the suspension is stirred at 60 ° c . for 24 hours . during the reaction , the support assumes an orangey coloring . after returning to ambient temperature , the support is washed with three times 40 ml of freshly distilled thf and dried at ambient temperature under vacuum . an orangey solid is then recovered . 1 . 07 ml of freshly distilled thf ( 1 . 3 mmol ) are introduced , at ambient temperature , into a 100 ml schlenk flask comprising 1 . 546 g of zirconium tetrachloride ( 6 . 6 mmol ) in suspension in 50 ml of toluene . the solution comprising the zrcl 4 . 2thf complex is introduced at 100 ° c . into a 150 ml schlenk flask comprising 1 . 115 g of starting stock s ( 1 . 2 mmol of hydroxyl groups ) suspended in 20 ml of toluene at 100 ° c . the mixture obtained is brought to reflux for 24 hours . after returning to 100 ° c ., the support is washed with three times 40 ml of toluene . the support is brought back to ambient temperature before being dried under vacuum . the support , which then has a brown coloring , is suspended in 20 ml of toluene . a solution comprising 0 . 086 g of cyclopentadienyllithium ( 1 . 2 mmol ) suspended in 30 ml of toluene is subsequently introduced therein at ambient temperature . the mixture is brought to reflux after 24 hours . before being brought back to ambient temperature , the catalyst is washed with three times 40 ml of toluene at 100 ° c . the catalyst is subsequently dried under vacuum . elemental analysis of this catalyst gives us a level of zirconium equal to 7 . 4 % by weight ( 0 . 811 mmol / g ). catalyst b is prepared in the same way as catalyst a , except that , in this case , the silica used corresponds to said thermally treated silica b . the amounts introduced for the synthesis are as follows : 0 . 996 g of said silica b ( 1 . 1 mmol of hydroxyl groups ), 0 . 66 ml of the 1 . 6m solution of buli in heptane ( 1 . 1 mmol ), 0 . 13 ml of 6 , 6 - dimethylfulvene ( 1 . 1 mmol ), 1 . 190 g of zrcl 4 ( 5 . 1 mmol ), 0 . 83 ml of freshly distilled thf ( 10 . 2 mmol ) and 0 . 078 g of licp ( 1 . 1 mmol ). elemental analysis of this catalyst gives us a level of zirconium equal to 7 . 0 % by weight ( 0 . 767 mmol / g ). catalyst c is prepared in the same way as catalyst a except that , in this case , 0 . 777 g ( 0 . 85 mmol of hydroxyl groups ) of starting stock s is withdrawn . the amounts introduced for the synthesis are as follows : 1 . 353 g of zrcl 4 ( 5 . 8 mmol ), 0 . 94 ml of freshly distilled thf ( 11 . 6 mmol ) and 0 . 020 g of licp ( 0 . 3 mmol ). elemental analysis of this catalyst gives us a level of zirconium equal to 9 . 1 % by weight ( 1 . 003 mmol / g ). 0 . 56 ml of a 1 . 6m solution of buli in heptane ( 0 . 9 mmol ) is introduced , at ambient temperature , into a 150 ml schlenk flask comprising 1 . 287 g of said thermally treated silica c ( 0 . 9 mmol of hydroxyl groups ) in suspension in 50 ml of toluene . the suspension is stirred at ambient temperature for 4 hours . the support is washed with 3 times 40 ml of toluene and then the solvent is evaporated under a stream of argon . the solid recovered is suspended in 50 ml of toluene . 0 . 13 ml of 6 , 6 - dimethylfulvene ( 1 . 0 mmol ) is subsequently introduced therein at ambient temperature and under an argon atmosphere . the suspension is stirred at ambient temperature for 30 minutes and then at reflux for 2 hours . during the reaction , the support assumes an orangey coloration . after returning to ambient temperature , the support is washed with three times 40 ml of toluene and then washed with three times 40 ml of heptane . the solvent is subsequently evaporated by flushing with argon . an orangey solid is then recovered . this solid is suspended in 20 ml of toluene . 0 . 72 ml of freshly distilled thf ( i . e . 8 . 8 mmol ) is introduced , at ambient temperature , into a 100 ml schlenk flask comprising 1 . 040 g of zirconium tetrachloride ( 4 . 4 mmol ) in suspension in 50 ml of toluene . the solution comprising the zrcl 4 . 2thf complex is introduced at 100 ° c . into the schlenk flask comprising the support . the mixture obtained is brought to reflux for 24 hours . after returning to 100 ° c ., the support is washed with three times 40 ml of toluene . the support is brought back to ambient temperature and then the solvent is evaporated by flushing with argon . the support , which then has a brown coloration , is suspended in 20 ml of toluene . a solution comprising 0 . 061 g of cyclopentadienyllithium ( 0 . 8 mmol ) suspended in 30 ml of toluene is subsequently introduced therein at ambient temperature . the mixture is brought to reflux after 24 hours . before being brought back to ambient temperature , the catalyst is washed with three times 40 ml of toluene at 100 ° c . the solvent is subsequently evaporated by flushing with argon . elemental analysis of the catalyst obtained gives us a level of zirconium equal to 6 . 9 % by weight ( 0 . 757 mmol / g ). 0 . 3 ml of a 1 . 6m solution of buli in heptane ( 0 . 5 mmol ) is introduced , at ambient temperature , into a 150 ml schlenk flask comprising 0 . 680 g of said thermally treated silica c ( 0 . 5 mmol of hydroxyl groups ) in suspension in 50 ml of toluene . the suspension is stirred at ambient temperature for 4 hours . the support is washed with 3 times 40 ml of toluene and then the solvent is evaporated under a stream of argon . the solid recovered is suspended in 50 ml of toluene , to which 0 . 05 ml of chlorotrimethylsilane ( 0 . 4 mmol ) is added at ambient temperature and under an argon atmosphere . the mixture obtained is brought to reflux for 48 hours . after returning to 80 ° c ., the support is washed with three times 40 ml of toluene . the support is brought back to ambient temperature and then the solvent is evaporated under a stream of argon . the solid recovered is suspended in 50 ml of toluene . 0 . 05 ml of 6 , 6 - dimethylfulvene ( 0 . 5 mmol ) is subsequently introduced therein at ambient temperature and under an argon atmosphere . the suspension is stirred at ambient temperature for 30 minutes and then at reflux for 24 hours . during the reaction , the support assumes an orangey coloration . after returning to 100 ° c ., the support is washed with three times 40 ml of toluene . the solvent is subsequently evaporated by flushing with argon . an orangey solid is then recovered . this solid is suspended in 20 ml of toluene . 0 . 41 ml of freshly distilled thf ( 5 . 0 mmol ) is introduced , at ambient temperature , into a 100 ml schlenk flask comprising 0 . 594 g of zirconium tetrachloride ( 2 . 5 mmol ) in suspension in 50 ml of toluene . the solution comprising the zrcl 4 . 2thf complex is introduced at ambient temperature into the schlenk flask comprising the support . the mixture obtained is brought to reflux for 24 hours . after returning to 100 ° c ., the support is washed with three times 40 ml of toluene . the support is brought back to ambient temperature and then the solvent is evaporated under a stream of argon . the support , which then has a brown coloration , is suspended in 20 ml of toluene . a solution comprising 0 . 0160 g of cyclopentadienyllithium ( 0 . 2 mmol ) suspended in 30 ml of toluene is subsequently introduced therein at ambient temperature . the mixture is brought to reflux for 24 hours . before being brought back to ambient temperature , the catalyst is washed with three times 40 ml of toluene at 100 ° c . and then the solvent is evaporated under a stream of argon . elemental analysis of the catalyst obtained gives us a level of zirconium equal to 3 . 4 % by weight ( 0 . 373 mmol / g ). 0 . 191 g of silica d is introduced into a 50 ml schlenk flask comprising 0 . 046 g of catalyst a . a solid / solid dilution is thus obtained comprising 20 % of catalyst a in silica d . 0 . 095 g of silica d is introduced into a 50 ml schlenk flask comprising 0 . 027 g of catalyst d . a solid / solid dilution is thus obtained comprising 22 % of catalyst d in silica d . 1 . 96 ml of a 1 . 53m solution of methylaluminoxane in toluene ( 2 . 9 mmol ) and then 0 . 006 g of catalyst a ( 4 . 8 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 40 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 17 . 8 g of polyethylene are recovered , which corresponds to a productive output of 2 966 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 21 . 6 kg , is 6 . 2 g / 10 minutes . 2 . 5 ml of a 0 . 9m solution of tributylaluminum in heptane ( 2 . 2 mmol ) and then 0 . 028 g of catalyst a ( i . e . 22 . 7 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 7 . 9 ml of a 3 . 1 mm solution of tris ( pentafluorophenyl ) borane in petroleum ether ( 24 . 5 μmol ) are subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 4 hours , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 4 . 0 g of polyethylene are recovered , which corresponds to a productive output of 143 g pe / g catalyst . 0 . 45 ml of a 0 . 9m solution of tributylaluminum in heptane ( 0 . 4 mmol ) and then 0 . 005 g of catalyst a ( i . e . 4 . 1 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 005 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( i . e . 6 . 2 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 1 hour , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 17 . 9 g of polyethylene are recovered , which corresponds to a productive output of 3 580 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 21 . 6 kg , is 10 . 2 g / 10 minutes . 0 . 1 ml of a 0 . 9m solution of tributylaluminum in heptane ( 0 . 11 mmol ) and then 0 . 006 g of catalyst f ( i . e . 1 . 2 mg of catalyst a , i . e . 1 . 0 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 001 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( i . e . 1 . 2 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 12 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 4 . 4 g of polyethylene are recovered , which corresponds to a productive output of 3 384 g pe / g catalyst a . the melt flow index of the polymer , at 190 ° c . under 21 . 6 kg , is 0 . 8 g / 10 minutes . 1 . 96 ml of a 1 . 53m solution of methylaluminoxane in toluene ( 2 . 9 mmol ) and then 0 . 005 g of catalyst b ( 3 . 8 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 20 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 9 . 5 g of polyethylene are recovered , which corresponds to a productive output of 1 900 g pe / g catalyst . 1 . 96 ml of a 1 . 53m solution of methylaluminoxane in toluene ( 2 . 9 mmol ) and then 0 . 007 g of catalyst c ( 7 . 0 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 30 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 2 . 8 g of polyethylene are recovered , which corresponds to a productive output of 400 g pe / g catalyst . 0 . 3 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 4 mmol ) and then 0 . 005 g of catalyst d ( 3 . 8 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 006 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 7 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 5 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 5 . 5 g of polyethylene are recovered , which corresponds to a productive output of 1 100 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 0 . 1 g / 10 minutes . 0 . 42 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 5 mmol ) and then 0 . 007 g of catalyst d ( 5 . 3 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 006 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 7 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of an ethylene / hydrogen mixture ( c 2 / h 2 molar ratio = 1 / 10 000 ) and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 10 minutes , the [ lacuna ] is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 6 . 8 g of polyethylene are recovered , which corresponds to a productive output of 971 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 0 . 8 g / 10 minutes . 0 . 47 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 6 mmol ) and then 0 . 008 g of catalyst d ( 6 . 1 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 008 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 9 . 9 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of an ethylene / hydrogen mixture ( c 2 / h 2 molar ratio = 2 / 10 000 ) and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 7 minutes , the [ lacuna ] is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 6 . 5 g of polyethylene are recovered , which corresponds to a productive output of 812 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 1 . 5 g / 10 minutes . 0 . 47 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 6 mmol ) and then 0 . 008 g of catalyst d ( 6 . 1 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 005 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 6 . 2 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of an ethylene / hydrogen mixture ( c 2 / h 2 molar ratio = 3 / 10 000 ) and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 12 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 7 . 1 g of polyethylene are recovered , which corresponds to a productive output of 887 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 1 . 2 g / 10 minutes . 0 . 42 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 5 mmol ) and then 0 . 007 g of catalyst d ( 5 . 3 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 007 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 8 . 7 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of an ethylene / hydrogen mixture ( c 2 / h 2 molar ratio = 4 / 10 000 ) and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 15 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 6 . 9 g of polyethylene are recovered , which corresponds to a productive output of 985 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 1 . 5 g / 10 minutes . 0 . 42 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 5 mmol ) and then 0 . 007 g of catalyst d ( 5 . 3 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 005 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 6 . 2 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of an ethylene / hydrogen mixture ( c 2 / h 2 molar ratio = 5 / 10 000 ) and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 15 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 5 . 7 g of polyethylene are recovered , which corresponds to a productive output of 814 g pe / g catalyst . the melt flow index of the polymer , at 190 ° c . under 2 . 16 kg , is 2 . 0 g / 10 minutes . 0 . 3 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 4 mmol ) and then 0 . 009 g of catalyst g ( 2 . 0 mg of catalyst d , 1 . 5 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 002 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 2 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 10 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 5 . 3 g of polyethylene are recovered , which corresponds to a productive output of 2 944 g pe / g catalyst d . 0 . 2 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 3 mmol ) and then 0 . 006 g of catalyst g ( 1 . 3 mg of catalyst d , 1 . 0 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 004 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 4 . 9 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 20 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 5 . 7 g of polyethylene are recovered , which corresponds to a productive output of 4 750 g pe / g catalyst d . 0 . 1 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 2 mmol ) and then 0 . 004 g of catalyst g ( 0 . 9 mg of catalyst d , 0 . 7 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 006 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 7 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 25 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 8 . 4 g of polyethylene are recovered , which corresponds to a productive output of 10 500 g pe / g catalyst d . 0 . 2 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 3 mmol ) and then 0 . 006 g of catalyst g ( 1 . 3 mg of catalyst d , 1 . 0 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 014 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 17 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 10 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 8 . 7 g of polyethylene are recovered , which corresponds to a productive output of 7 250 g pe / g catalyst d . 0 . 011 g of catalyst d ( 7 . 2 μmol of zr ), 0 . 009 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 11 . 2 μmol ), 1 . 4 ml of a 1 . 3m solution of tributylaluminum in heptane ( 1 . 6 mmol ) and 20 ml of toluene are successively introduced , at [ lacuna ] temperature , into a 50 ml round - bottomed flask comprising 2 . 772 g of hdpe ( the hdpe was drawn under a dynamic vacuum at 200 ° c . for 2 hours before it is used ). after stirring for 15 minutes , the solvent is evaporated under dynamic vacuum . the solid obtained is introduced under a stream of argon into a gas - phase reactor comprising 20 g of hdpe charge ( the reactor and the charge were conditioned beforehand by a series of three times vacuum / argon at 80 ° c ., then 1 . 2 ml of a 1 . 3m solution of tributylaluminum in heptane ( 1 . 6 mmol ) were introduced before drawing the reactor under vacuum at 80 ° c .). 0 . 5 bar of butene is introduced before raising the pressure to 12 bar with ethylene and the temperature to 70 ° c . the total pressure of the reactor is held at 12 bar ( by addition of ethylene ) and the temperature at 70 ° c . during the polymerization . after polymerizing for 92 minutes , the reactor is degassed and 26 . 0 g of polyethylene ( plus the 20 g of charge ) are recovered , which corresponds to a productive output of 2 363 g pe / g catalyst d . the melt flow index of the polymer , at 190 ° c . under 21 . 6 kg , is 1 . 6 g / 10 minutes . 0 . 012 g of catalyst d ( 9 . 1 μmol of zr ), 0 . 030 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 37 . 4 μmol ), 1 . 5 ml of a 1 . 3m solution of tributylaluminum in heptane ( 2 . 0 mmol ) and 20 ml of toluene are successively introduced , at [ lacuna ] temperature , into a 50 ml round - bottomed flask comprising 0 . 828 g of hdpe ( the hdpe was drawn under a dynamic vacuum at 200 ° c . for 2 hours before it is used ). after stirring for 15 minutes , the solvent is evaporated under dynamic vacuum . the solid obtained is introduced under a stream of argon into a gas - phase reactor comprising 20 g of hdpe charge ( the reactor and the charge were conditioned beforehand by a series of three times vacuum / argon at 80 ° c ., then 1 . 5 ml of a 1 . 3m solution of tributylaluminum in heptane ( 2 . 0 mmol ) were introduced before drawing the reactor under vacuum at 80 ° c .). 0 . 5 bar of butene is introduced before raising the pressure to 12 bar with ethylene and the temperature to 70 ° c . the total pressure of the reactor is held at 12 bar ( by addition of ethylene ) and the temperature at 70 ° c . during the polymerization . after polymerizing for 56 minutes , the reactor is degassed and 43 g of polyethylene ( plus the 20 g of charge ) are recovered , which corresponds to a productive output of 3 583 g pe / g catalyst d . 1 ml of a 0 . 9m solution of tributylaluminum in heptane ( 0 . 9 mmol ) and then 0 . 014 g of catalyst e ( i . e . 5 . 2 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 300 ml of heptane . 0 . 012 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 14 . 9 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of ethylene and the temperature is raised to 80 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 95 minutes , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 7 . 2 g of polyethylene are recovered , which corresponds to a productive output of 514 g pe / g catalyst e . 0 . 6 ml of a 1 . 3m solution of tributylaluminum in heptane ( 0 . 8 mmol ) and then 0 . 010 g of catalyst d ( 7 . 6 μmol of zr ) are introduced into a 500 ml two - necked round - bottomed flask comprising 250 ml of toluene . 0 . 014 g of n , n - dimethylaluminum tetra ( pentafluorophenyl ) borate ( 17 . 5 μmol ) is subsequently introduced . the suspension thus obtained is introduced under a stream of argon into a 0 . 5 liter glass reactor . after having degassed the reactor , the pressure is raised to 4 bar absolute of propylene and the temperature is raised to 70 ° c . the pressure and the temperature are kept constant during the polymerization . after polymerizing for 15 hours , the reactor is degassed and the polymer is precipitated from a dilute solution of acidic methanol ( meoh / hcl ). after filtering , washing with methanol and drying , 15 g of polypropylene are recovered , which corresponds to a productive output of 1 500 g pp / g catalyst e . atactic polypropylene ; mn 3 820 g / mol ; mw 5 930 ( gpc in tetrahydrofuran at 45 ° c ., polystyrene standards ). although the invention has been described in conjunction with specific embodiments , it is evident that many alternatives and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , the invention is intended to embrace all of the alternatives and variations that fall within the spirit and scope of the appended claims . the foregoing references are hereby incorporated by reference .	8
in the description as follows , it is intended that a compatible cmos structure be employed to fabricate the various circuit elements . an epitaxial layer form of construction is preferred and pn junction isolation diffusion , employed in the well known manner , is used to provide isolated tubs of semiconductor material . active devices can then be fabricated into these tubs to form the circuit elements . with reference to fig3 a functional showing of the invention is disclosed in a combined schematic block diagram . only the top - side h - bridge drivers 44 and 45 are shown . these large area dmost devices are respectively controlled in the conventional manner at drive terminals 46 and 47 . while not shown , bottom - side drivers will be connected to output terminals 48 and 49 to complete the h - bridge return to ground . sense sources 50 and 51 are associated with the drivers , as well known in the art , to provide a current that is a known fraction of the currents flowing in the power sources of dmost &# 39 ; s 44 and 45 . the two sources in dmost 44 are connected to the input terminals of op - amp 52 which in turn drives the gate of p most 53 . note that sense source 50 is connected to the inverting input . since the source of pmost 53 is connected to the same input , it is clear that a 100 % negative feedback loop is present . op - amp 52 will operate to force the inverting input to the same potential as its noninverting input thus equalizing the dmost source potentials . it can also be seen that any current flowing in sense source 50 will also flow in pmost 53 . diode 54 will couple the current flowing in pmost 53 to output terminal 55 . a similar set of components connected to dmost 45 will pass any current flowing in sense source 51 to output terminal 55 . this , the current output is the sum of the currents flowing in sense sources 50 and 51 . note that at any instant of time either dmost 44 or 45 will be conducting current , thus the current out of pin 55 is the or function of transistor currents 44 and 45 because the two diodes connected to pin 55 perform the well known logic or function . fig4 shows an operational amplifier suitable for practicing the invention . where the parts function the same as those of fig3 the same designations are used . dmost 44 is one of the top - side drivers . the power source is returned to terminal 48 which couples to the remainder of the h - bridge circuit sense source 50 is coupled to the emitters of transistors 56 - 58 the power source is coupled to the emitter of transistor 59 . transistors 56 and 59 form a differential input stage with each one drawing i sense / 3 . transistor 61 couples the collector of transistor 56 back to node 60 and therefore provides 100 % negative feedback . thus , the op - amp will drive node 60 to that level where the conduction in transistor 59 equals that in transistor 56 . for this condition , the emitters of transistors 56 and 59 will be at the same potentials . capacitor 62 frequency compensates the op - amp in the conventional manner so that its gain falls with increasing frequency . p channel transistors 63 - 66 are cascode connected with transistors 56 - 59 and each one has its back gate connection returned to node 60 . transistors ( 61 , 63 - 66 ) are not ordinary p channel devices . they are of high - voltage construction as shown in fig5 . the typical pmos transistor has a drain breakdown voltage of about 35 volts . this low value is due to the fact that the gate slightly overlaps the drain and thus sets up an associated electric field that triggers a low breakdown . as shown in fig5 the p + drain is offset from the gate region and a lightly doped or p - region joins the drain to the gate region . fig5 is a cross - section showing of a silicon wafer fragment that contains a high voltage p channel transistor . the various device elements are shown , but the oxide , or passivation and metallization , have been removed for clarity . the various metal connections are shown in schematic form . a p type substrate wafer 70 has an epitaxial n type layer 71 grown thereon . the active device is located over an n + buried layer 72 . such buried layers are well - known in he ic art . the epitaxial layer is divided into tubs by means of p + isolation diffusion 73 which exists here as a ring that surrounds buried layer 72 . a p + source diffusion 76 extends into the epitaxial n type tub adjacent to a gate region defined by the gate 75 . an n + diffusion 77 extends into the epitaxial n type tub to form an ohmic contact therewith . this is the transistor back gate connection . the p + drain region 78 is offset from the gate and , as shown , a p - or lightly doped extension 79 , electrically joins the drain region 78 with the gate region . the device shown in fig5 has a typical drain breakdown of greater than 80 volts which is over twice that of a conventional p channel transistor . the use of high voltage p channel transistors in the circuit is important in extending the h - switch input or supply voltage range . the circuit shown in fig3 and 4 can operate in the range of 12 to 60 volts . transistor 44 is made large enough for the h - switch to pass a steady state current of 3 amperes . in the preferred embodiment the current sense source is 1 / 1500 of the area of the power source . thus , i sense has a maximum value o 1 . 33 milliamperes . npn transistors 80 and 81 form a current mirror load for the op - amp output . transistor 82 , which has its drain returned to a low voltage supply , v dd acts as a source follower . functionally it returns the collector of transistor 80 to its base thereby forcing it to operate as a current mirror input diode the current flowing in transistor 56 , and cascode transistor 64 , flows in this current mirror input . the reflected current will flow in transistor 81 , which will conduct the current flowing in transistor 59 and its cascode transistor 63 . dmost 90 is of standard construction and is coupled to pass the current flowing in transistor 81 . this device is necessary to support a high supply voltage because the gate of transistor 63 is connected to its drain . resistor 83 is present to return the source of n channel transistor 82 to ground while resistors 84 and 85 are low value isolation resistors in the bases respectively of transistors 80 and 81 . low value resistors 86 and 87 return the emitters of transistors 80 and 81 to ground respectively and complete the current mirror circuit . transistor 90 is present to limit the collector voltage on transistor 81 which has a typical collector breakdown on the order of 40 volts . the gate of transistor 90 is connected to zener diode 88 which operates at a level of about 10 volts . thus , the collector of transistor 81 is limited to the zener diode voltage less the threshold voltage of transistor 90 . transistor 89 , which is a high voltage p channel transistor of the construction of fig5 has its source returned to terminal 10 or + v s . its drain passes a small reverse current through zener diode 88 thereby biasing it into its zener breakdown . the gate of transistor 89 is returned to a bias voltage source operating at about one threshold below v s . it can be seen that the op - amp circuit , along with its current mirror load , will force sense source 50 to the potential of the power source of transistor 44 . under quiescent conditions i sense / 3 will flow in transistor 56 ( and transistor 59 ). a similar value will also flow in the emitters of transistors 57 and 58 . thus , a current of 2i sense / 3 will flow in combined transistors 57 and 58 along with their cascode connected transistors 65 and 66 . therefore , the current flowing in output terminal 55 will be directly related to the h - switch current flowing in transistor 44 . the invention has been described and a detailed preferred embodiment set forth . when a person skilled in the art reads the foregoing description , alternatives and equivalents , within the spirit and intent of the invention , will be apparent . accordingly , it is intended that the scope of the invention be limited only by the following claims .	7
a retractor apparatus of the present invention is generally indicated at 10 in fig1 . a locking mechanism of the present invention is generally indicated at 12 . the locking mechanism 12 is designed to automatically permit rotational movement of a retractor blade 50 in one direction only , from a first upright position 16 to a second downward position 18 ( shown in broken lines ), while the locking mechanism 12 is engaged . the locking mechanism 12 includes a cammed member 14 , a wedge member 20 , and a spring 22 , all enclosed within a housing 24 as illustrated in fig2 . the cammed member 14 includes a through - bore 26 , the through - bore 26 defining an axis of rotation 27 for the cammed member 14 . the housing 24 includes first and second mating apertures 28 , only one of which is illustrated . the mating apertures 28 are aligned with each other by being positioned on opposing wall sections . the cammed member 14 is positioned within the housing 24 such that the through - bore 26 aligns with each mating aperture 28 . a securing pin 30 is inserted through the mating apertures 28 and the through - bore 26 of the cammed member 14 , thereby rotatably securing the cammed member 14 to the housing 24 . once secured within the housing 24 , the cammed member 14 is freely rotatable between the first upright position 16 and the second downward position 18 . the first upright position 16 is defined by a first top side 32 of the cammed member 14 contacting the housing 24 , while the second downward position 18 is defined by a second bottom side 34 of the cammed member 14 contacting the housing 24 . it should be noted , however , that the terms ‘ top ’ and ‘ bottom ’ are arbitrary terms , and are used for illustrative purposes with reference to the figures . the cammed member 14 further includes a cammed surface 36 having a decreasing radius from point a to point b as defined from axis 27 . the cammed surface 36 may be the result of an eccentric construction ( wherein the axis of rotation is in an offset position ) or wherein the cam surface 36 is a lobe offset from the axis of rotation or other construction known in the art . point a is defined as a point on the cammed surface 36 where an inclined surface 40 of the wedge 20 contacts the cammed member 14 , corresponding to the cammed member 14 in the first upright position 16 . point b is defined as a point on the cammed surface 36 where the inclined surface 40 of the wedge 20 contacts the cammed member 14 , corresponding to the cammed member 14 being in the second downward position 18 . the wedge 20 is a movable member situated within the housing 24 such that the inclined surface 40 of the wedge 20 is capable of contacting the cammed surface 36 of the cammed member 14 . the wedge 20 is movable through an infinite number of positions while contacting the wedge 20 . a first initial engagement position 42 and a second extended position 44 in broken lines is illustrated in fig2 . the first initial engagement position 42 is defined as the position wherein the retractor blade 50 is at a first upright position and the wedge 20 contacts the cammed member 14 . the second extended position 44 is defined as the position wherein the retractor blade 50 is at the second downward position 18 and further forward movement of the wedge 20 is prohibited . the wedge is also movable away from the cammed member to a non - engaging position ( not shown ), wherein the wedge is disengaged from the cammed member 14 , and the retractor blade 50 is freely rotatable in either direction . a height of the inclined surface 40 of the wedge 20 is lowest at a first forward end 46 of the wedge 20 , and increases down the length of the wedge 20 . the compressible spring 22 urges the wedge 20 toward the second extended position 44 and against the cammed member 14 , thereby contacting the inclined surface 40 of the wedge 20 with the cammed surface 36 of the cammed member 14 . a finger tab 48 is attached to the wedge 20 . the finger tab 48 allows a user to withdraw the wedge 20 away from contacting the cammed member 14 and toward the first position 42 . in operation , a force is applied to the finger tab 48 which overcomes the force of the compressible spring 22 , thereby allowing the wedge 20 to withdraw away from the cammed member 14 toward and even beyond the first initial engaging position 42 . upon moving past the first non - engaging position , the cammed member 14 is freely rotatable in either direction . the retractor blade 50 , and thus the cammed member 14 is manually positionable in the first upright position 16 by engaging the finger tab 48 and urging the wedge 20 toward the first position 42 . upon removal of the force applied to the finger tab 48 , the compression spring 22 urges the wedge 20 into contact with the cammed member 14 . upon the wedge 20 engaging the cammed member 14 , the cammed member 14 is only rotatable from the first upright position 16 to the second downward position 18 , and not in reverse . as the cammed member 14 rotates from the first position 16 to the second position 18 , the decreasing radius from point a to point b of the cammed surface 36 allows the compression spring 22 to urge the wedge 20 toward the second extended position 44 , the wedge 20 in continuous contact with the cammed member 14 . reverse - rotation of the cammed member 14 in the direction from the second downward position 18 to the first upward position 16 is not possible because the cammed surface 36 of the cammed member 14 will be forced against the inclined surface 40 of the wedge 20 . the relative increase in length of the radius of the cammed member 14 , from point b to point a , which defines the cammed surface 36 , in conjunction with the increase in height of the wedge 20 , prohibits rotatable travel of the cammed member 14 in the reverse direction . to rotate the cammed member 14 toward the first upright position 16 , a force is applied to the finger tab 48 to overcome the force of the compression spring 22 allowing the wedge 20 to slide toward the first initial engaging position 42 . when the wedge 20 moves past the initial engaging position 42 , the wedge 20 disengages from the cammed member 14 , and the cammed member 14 is freely rotatable in either direction . the cammed member 14 can then be positioned in the first upright position 16 . in the preferred embodiment of the present invention , the retractor blade 50 is attached to the cammed member 14 . as illustrated in each figure , the retractor blade 50 has a general “ l ”- shaped configuration with a first leg 52 attached to the cammed member 14 . a second leg 54 of the retractor blade extends past the locking mechanism 12 , and is configured to retract flesh , such as skin and muscle tissue , in a selected position during a surgical operation . preferably , the retractor apparatus 10 includes an arm 56 having a proximate end 58 and a distal end 60 . the housing 24 of the retractor apparatus 10 is attached to the proximate end 58 of the arm 56 . in use , the retractor blade 50 , which is in the first upright position 16 , is positioned within the surgical incision , and the distal end 60 of the arm 56 is secured to the operating table ( not shown ). the surgeon is then able to further position the retractor blade 50 by rotating retractor blade 50 , and thus the cammed member 14 , toward the second downward position 18 . when a selected position of the retractor blade 50 is obtained , there being an infinite number of selectable positions between the first upright position 16 and the second downward position 18 , the retractor blade 50 is held at the selected position due to the automatic locking mechanism 12 . a load on the retractor blade 50 , which is provided by the retained flesh , tends to urge the retractor blade 50 in the reverse direction toward the first upright position 16 . however , when the wedge 20 engages the cammed member 14 , rotation in the reverse direction is not permitted , and the flesh is retained at the selected position . thus , the retractor blade 50 is automatically held at the selected position . the retractor blade 50 can be further positioned to increase access to the operable area if the surgeon desires by further rotating the retractor blade 50 , and thus the cammed member 14 . any amount of rotation of the cammed member 14 in the direction of the second downward position 18 will lock the cammed member 14 at that position . to reposition the retractor blade 50 toward the first upright position 16 , a force to overcome the compression spring 22 is applied to the finger tab 48 urging the wedge 20 towards the first initial engaging position 42 . as the wedge 20 travels towards the initial engaging position 42 , the relative height of the inclined surface 40 decreases allowing the cammed member 14 , which has a tendency to rotate toward the first upright position 16 due to the load bearing on the retractor blade 50 , to rotate in the reverse direction because of the relatively increasing radius of the cammed surface 36 contacting the relatively decreasing height of the inclined surface 40 of the wedge 20 . any movement of the wedge 20 toward the first non - engaging position will cause the cammed member 14 to reverse rotate and thus affecting the position of the retractor blade 50 towards the first upright position 16 . to remove the retractor apparatus 10 upon completion of the surgical procedure , the finger tab 48 is used to position the wedge 20 past the initial engaging position 42 , thus allowing the cammed member 14 to be freely rotatable . the retractor blade 50 is brought to the first upright position 16 , and the apparatus 10 is removed from the surgical site . an alternative embodiment of the present invention is generally indicated at 100 in fig3 through 5 . a releasing mechanism for use with the alternative embodiment 100 is generally indicated at 110 while a locking mechanism is generally indicated at 112 . the locking mechanism 112 is designed to automatically permit rotational movement of a retractor blade 114 in one direction only , from a first upright position 116 to a second downward position 118 ( shown in broken lines ), while the locking mechanism 112 is engaged . the releasing mechanism 110 provides a means to selectively position the retractor blade between the second downward position 118 to the first upright position 116 when a retraction force is exerted on the retractor blade 114 . the locking mechanism 112 includes a cammed member 120 , a wedge 122 , and a spring 124 , all enclosed within a housing 126 . the cammed member 120 includes a through - bore 128 an axis of rotation 130 for the cammed member 120 . the housing 126 includes first and second mating apertures 132 , only one of which is illustrated . the mating apertures 132 are aligned with each other by being positioned on opposing wall sections of the housing 126 . the cammed member 120 is positioned within the housing 126 such that the through - bore 128 aligns with each mating aperture 132 . a securing pin 134 inserts through the mating apertures 132 and the through - bore 128 of the cammed member 120 , thereby rotatably securing the cammed member 120 to the housing 126 . once secured within the housing 126 , the cammed member 120 is freely rotatable between the first upright position 116 and the second downward position 118 . the cammed member 120 further includes a cammed surface 136 having a decreasing radius from point d to point e as defined from axis 130 . the cammed surface 136 may be the result of an eccentric construction ( wherein the axis of rotation is in an offset position ) or wherein the cam surface 136 is a lobe offset from the axis of rotation or other construction known in the art . point d is defined as a point on the cammed surface 136 where an inclined surface 138 of the wedge 122 contacts the cammed member 120 , corresponding to the cammed member 120 in the first upright position 116 . point e is defined as a point on the cammed surface 136 where the inclined surface 138 of the wedge 122 contacts the cammed member 120 , corresponding to the cammed member 120 being in the second downward position 118 . the wedge 122 is a movable member situated within the housing 126 such that the inclined surface 138 of the wedge 122 is capable of contacting the cammed surface 136 of the cammed member 120 . the wedge 122 is movable through an infinite number of positions while contacting the cammed member 120 . the infinite number of positions is best explained by a first initial engagement position 140 and a second extended position 142 . as illustrated in fig4 the first initial engagement position 140 is defined as the position wherein the retractor blade 114 is at the first upright position 116 and the wedge 122 contacts the cammed member 120 . the second extended position 142 is defined as the position wherein the retractor blade 114 is at the second downward position 118 and further forward movement of the wedge 122 is prohibited . the wedge 122 is also movable away from the cammed member 120 to a non - engaging position ( not shown ), wherein the wedge 122 is disengaged from the cammed member 120 , and the retractor blade 114 is freely rotatable in either direction . a height of the inclined surface 138 of the wedge 122 is lowest at a first forward end 144 of the wedge 122 , and increases down the length of the wedge 122 . the compressible spring 124 urges the wedge 122 toward the second extended position 142 and against the cammed member 120 , thereby contacting the inclined surface 138 of the wedge 122 with the cammed surface 136 . the releasing mechanism 110 pivotally attaches to the wedge 122 . the releasing mechanism 110 allows a user to incrementally urge the wedge 122 toward the first position 140 , away from contacting the cammed member 120 , thus incrementally allowing the retractor blade 114 to travel from the second position 118 toward the first position 116 . the releasing mechanism 110 includes a lever 146 having an aperture 148 through which a pin 150 extends to pivotally secure the lever 146 to the wedge 122 . the pin 150 slidably disposes within a slotted aperture 152 positioned within the housing 126 . the slotted aperture 152 includes flattened surfaces 154 on either side upon which the lever 146 slidably engages . as illustrated in fig3 the lever 146 is pivotable between a non - engaging position ( dashed ) and an engaging position ( solid ). positioning the lever 146 from the non - engaging position toward the engaging position , the lever 146 engages an abutting surface 156 of the cammed member 120 . a torsional spring 150 is provided to retain the lever 146 in the non - engaging position during use to prevent the lever 146 from unwanted engagement with the abutting surface 156 . in operation , the releasing mechanism 110 disengages the wedge 122 from the cammed member 120 . the lever 146 is positioned to fully engage the abutting surface 156 , which overcomes the force of the compressible spring 124 , thereby allowing the wedge 122 to withdraw away from the cammed member 120 toward and even beyond the first initial engaging position 140 . upon moving past the first non - engaging position , the cammed member 120 is rotatable in either direction against the frictional force of the lever 146 engaging the abutting surface 156 . the retractor blade 114 , and thus the cammed member 120 , is manually positionable to the first upright position 116 . upon releasing the lever 146 , the torsional spring 158 urges the lever 146 into the non - engaging position , and the compression spring 124 urges the wedge 122 into contact with the cammed member 120 . upon the wedge 122 engaging the cammed member 120 , the cammed member 120 is only rotatable from the first upright position 116 to the second downward position 118 , and not in reverse . as the cammed member 120 rotates from the first position 116 to the second position 118 , the decreasing radius from point d to point e of the cammed surface 136 allows the compression spring 124 to urge the wedge 122 toward the second extended position 142 , the wedge 122 being in continuous contact with the cammed surface 136 . reverse - rotation of the cammed member 120 in the direction from the second downward position 118 to the first upward position 116 is not possible because the cammed surface 136 of the cammed member 120 will be forced against the inclined surface 138 of the wedge 122 . the relative increase in length of the radius of the cammed member 120 , from point e to point d , which defines the cammed surface 136 , in conjunction with the increase in height of the wedge 122 , prohibits rotatable travel of the cammed member 120 in the reverse direction . to position the retractor blade 114 toward the first upright position 116 , the releasing mechanism 110 is enacted to urge the wedge 122 to slide toward the first initial engaging position 140 . the lever 146 is positioned to engage the abutting surface 156 of the cammed member 120 . upon overcoming the force of the compression spring 124 , the wedge 122 will travel away from the cammed member 120 , allowing the cammed member 120 to slightly rotate and reposition the retractor blade 114 in an infinite number of positions . as the wedge 122 travels toward the initial engaging position 140 , the lever 146 slides upon the flattened surfaces 154 of the housing such that the contact with the lever 146 and the abutting surface 156 coincide with the contact of the traveling inclined surface 138 and cammed surface 136 . when the wedge 122 reaches the initial engaging position 140 , the lever 146 must manually disengage the wedge 122 from the cammed member 120 in order for the cammed member 120 to be rotatable in either direction to position the retractor blade 114 . the retractor blade 114 , and use of the retractor apparatus 100 in a surgical setting , is the same as described in relation to the embodiment of retractor apparatus 10 . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .	0
a solution for modulating / demodulating an ac power line with an overlaid communication signal using a low attenuation inductive coupling between the signal source and the ac line is described in the following detailed description . the difference between the present mentioned and above mentioned ep 1085673 is that the present invention operates on ac , high voltage signals and the windings are flowed by ac current . the core thus obtains the net flow and requires special dimension and material for obtaining linear magnetization . as may be seen in fig1 a and 1b , a pcb 101 , or a carrier structure of any type suitable for carrying electric components or conductors , comprises a primary winding 102 and a secondary winding 103 . the windings are built up by one or several conductive layers on the pcb . the primary winding 102 comprises first and second spaced apart parts 102 a and 102 b . the secondary winding 103 comprises first and second spaced apart parts 103 a and 103 b . the secondary winding 103 may be located inside the primary winding 103 on one or several planes of the pcb 101 using a multilayer pcb or a plurality of pcbs . the pcb further comprises one or several holes or apertures 105 at substantially the center of the two windings 102 and 103 . a ferrite ( or similar magnetic ) core 104 is mounted through the apertures and thus together with the windings providing a coupler / decoupler in order to improve the efficiency of the transformer coupling . this transformer is used to isolate communication signal generating equipment from an ac line and facilitate the overlay of a modulated communication signal on the ac line . the primary windings 102 are connected to an ac power line and the secondary windings 103 to a signal line . in the case of fig1 a and 1 b , a substantially circular magnetic core 104 is used in order to mount the magnetic core 104 , it is divided into two or more pieces and when mounted on the pcb , the pieces are attached together , e . g . by means of glue or other means . preferably , the attachment between the core pieces may be in the vicinity of the holes in the pcb for easy installation . the magnetic core 104 provides an efficient coupling between the two windings as in a normal transformer coupling and therefore the core 104 is preferably mounted on the pcb in such a way that the legs of the core 104 pass through the apertures . the primary 102 and secondary 103 windings preferably surround the core legs in order to provide an efficient inductive coupling . the core may be of ferrite type or any other suitable type as appreciated by the person skilled in the art . advantages using this design with an integrated ferrite or other magnetic core on the pcb , with primary and secondary windings are for instance easy and cost efficient production , easy installation , and the result is an efficient transformer coupling between the ac line and the high frequency modulated communication signal . the primary 102 and secondary 103 windings may be formed on different printed circuit boards and the pcb &# 39 ; s may be mounted together in such a way that the two windings are located in close vicinity of each other . the two pcb &# 39 ; s may be sandwiched together . the conductive layer on the pcb may be of any suitable kind but is preferably made of copper , aluminum or similar high electrically conductive material . fig2 a and 2b illustrate another embodiment of the invention . in which two substantially circular ferrites 204 a and 204 b are arranged on different sides of the pcb and attached together by means of attachment pieces 2041 a and 2041 b . the attachment pieces are made of same material as the core and together with the ferrite comprise the core . also , this embodiment comprises primary and secondary windings connected to the power line and signal line , respectively . in fig3 an example of an application of a preferred embodiment for a power line communication system is illustrated . a signal line 303 carrying data signals is connected to a secondary winding 303 around a primary winding 302 connected to the power line . the windings are formed on a printed circuit board from a conductive layer . the communication signal is overlaid on to the signal in the primary winding 302 , in this case an ac power line . the core 304 mounted on the pcb facilitates the coupling . an optional filter or emc / emi shield 307 may be connected to the primary circuit 302 and also an optional capacitor may be mounted between the two lines ( phase and neutral ) in the primary circuit 302 as illustrated in the schematic block diagram in fig3 . the combined ac power voltage and communication signal is then further coupled / decoupled onto / from the power line wiring system 308 . the circuit boards 101 , 201 may be used as part of a modem and mounted inside a casing or housing ( not shown ) for safety and esthetical reasons . this casing may also have a mains attachment , i . e . some connector connecting the device to the power line in a suitable manner , and a communication signal connector including , but not limited to , an ethernet connector ( rj45 or similar ) or usb connector ( universal serial bus ) for communicating with external equipment including , but not limited to , a personal computer or similar computational device . the above - described arrangement may also be used in applications where a plurality of sensors are connected to a power line and the sensor signals and measurements are transmitted on the power line to a central information - aggregating device . this may for instance be in an application for automatic remote measurement of power usage in homes or industrial facilities , facilitating the today often manual reading of power meters . the legislation in many countries also directs the attention to such solutions where automatic readings of power meters are of interest . the modulated communication signal may be generated with standard equipment and techniques as known for the person skilled in the art and not shown in this illustration or discussed in this document . also any type of frequency modulation scheme may be used . in a power line communication system the modulated communication signal may be provided by a communication modem and the coupling / decoupling arrangement may be incorporated into a communication modem or any other suitable communication device . in a complete communication system , the coupling / decoupling arrangement is connected to a communication modem , which in turn is connected to a computational device or any other signal generating / consuming device such as , but not limited to , a personal computer , power consumption measuring device , or a household appliance device . the coupling / decoupling arrangement is coupled to a power line through a power line connector conforming to local regulations . the communication signal may be encrypted and has no bearing on the present invention . it should be appreciated that the above mentioned embodiments are only for illustrative purposes and should not be limiting to the present invention , but it should be evident that other modifications and variations may be made without departing from the scope of the invention as laid out in the following claims .	7
in fig1 an impeller 2 with an outer radius r 2 is disposed inside a housing 1 . the blades 3 of this impeller are disposed between an impeller cover disk 4 on the pressure side and an impeller cover disk 5 on the suction side . stationary surfaces of the housing wall , namely , a housing wall surface 6 on the pressure side and a housing wall surface 7 on the suction side , are situated opposite these cover disks 4 , 5 , respectively . the impeller 2 is surrounded by a spiral space 8 , which is connected to a pressure joint 9 . due to the pressure drop inside the impeller side spaces , a portion of the medium situated inside the housing 1 flows to the diaphragm gland 10 in the region of the impeller entry and to the diaphragm gland 11 on the pressure side , in the region of a shaft seal . the impeller side friction at the impeller cover disks 4 , 5 in familiar fashion creates a flow in the impeller side space 12 on the pressure side and in the impeller side space 13 on the suction side . the flow condition in the various spaces , as explained in terms of the example of the impeller side spaces 12 , 13 must be considered in a differentiated fashion . in an impeller side space 13 on the suction side or a corresponding space , there exists a through - flow due to the existing pressure drop . the medium therefore flows from the region of higher pressure to a region of lower pressure , e . g . in the case of a pump from the impeller exit to the impeller entry . this flow is superposed by a flow which results from the impeller side friction between the rotating surface and the medium which wets it . the like applies to an impeller side space 12 on the pressure side or a corresponding space , if it is possible for the medium to flow through there . this could be an axial thrust - relief bore , or any other opening which makes through - flow possible . however , in the case that there is no through - flow in this space , the radially inward flow at a stationary wall will exist nevertheless . the cause of this then is the impeller side friction . because of this , a flow with a radially outward component exists at the rotating surface . this results in a backflow at the stationary wall surface , that is in a circulation . in all the cases of through - flow or circulation described above , the medium charged with the abrasive particles flows radially inward , following the stationary surfaces . the other embodiment of a multi - stage turbo - machine , shown in fig2 behaves in a corresponding manner . when it is operated as a pump , the medium that is charged with particles would flow through the suction connections 14 . 1 , 14 . 2 toward the impellers 2 . 1 , 2 . 2 . in contrast to the embodiment of fig1 the impellers 2 . 1 , 2 . 2 of the first stage have a diaphragm gland on the pressure side only in the region of the shaft penetration between the individual stages . after the medium leaves the first impellers , it flows through the guide devices 15 . 1 , 15 . 2 , and flows toward a double - flow impeller 16 of a second stage . from there it enters a spiral space 8 , from where it flows off through a pressure joint 9 . the environment of the impeller , which was described in more detail in connection with the example of fig1 also applies correspondingly to the embodiment of fig2 . with the exception of fig1 , 14 , 16 , 17 , 21 , 24 and 25 , the representations of fig3 to 23 are identical in their structure . these are exemplary designs , always between a left wall surface that is disposed stationary and a right wall surface that is disposed rotating . in accordance with fig1 these therefore would be designs which could be used in the region of an impeller side space 13 on the suction side . the rotation axis of the rotating part of the wall surface is always situated underneath the respective picture . of course , the pictures shown here would apply correspondingly also to the impeller side space 12 on the pressure side , but then the mirror images of these pictures would be seen . for the sake of simplicity , the description is limited to the specification mentioned above . fig3 to 8 show a protruding ring 17 affixed to the stationary housing wall 7 . opposite this , with a gap 18 , is situated the rotating impeller cover disk 5 . the flow with the abrasive particles migrates radially inward along the fixed housing wall 7 . the ring 17 that is used here deflects it in the direction toward the impeller and thus toward the rotating impeller cover disk 5 . from there , it is conducted off to the outside with the flow that is caused by the impeller side friction . the width t 1 of the ring 17 should be greater than half the width b of the impeller side space , that is t 1 / b ≧ 0 . 5 . in practical tests , it has proven especially beneficial to dispose the ring 17 on a relative radius r 1 , which , relative to the outer radius r 2 of the impeller or of the impeller cover disk 5 , has a ratio r 1 / r 2 of approximately 0 . 8 . it is demonstrably effective even for other radii r 1 . as regards the gap s , as a difference between the width b of the impeller side space minus the width t 1 of the ring 17 , what is required is that it may not be less than 2 mm . this gap in no way has the function of a diaphragm gland ; the latter would be destroyed by the through - flowing particles . because the minimum gap width is 2 mm or greater , increased wear is prevented from occurring inside the gap region . this applies correspondingly also to the representations in the other subsequent figures . in fig4 several blades 19 are affixed at the rotating impeller cover disk 5 , at the same level as the protruding ring 17 and likewise at a small distance thereto . the radial extent of these blades 19 is equal or unequal to the radial extent of the ring . according to fig5 the blades 19 are fastened adjoiningly on the rotating impeller cover disk 5 , at a greater diameter and with a greater radial extent . the lines shown by dots and dashes in fig3 to 5 , enclosing the rings 17 , symbolize regions in which the ring surfaces are at a different inclination . in fig6 a ring 20 is disposed at the rotating cover disk 5 . it is situated at a greater diameter than the stationary housing ring 17 . the underside of the rotating ring 20 , facing the fixed ring 17 , is equipped with blades 19 , which create a region of higher rotational motion , and consequently deflect the particle - loaded flow near the wall toward the outer diameter of the impeller . in place of the blades 19 , grooves which create a transport effect can also be disposed , for example by inserting them into the material of the impeller . when pairing the rings and the blades or the grooves , it is advantages for the gap between the two to be slanted , so as to force the particles to move radially outward . the blades or grooves can be disposed both in the axial direction and perpendicular to the direction of rotation as well as at a certain angle to the axial direction , as is shown in fig1 and 17 by way of example . according to fig7 the rotating ring 20 is disposed at a smaller diameter than the stationary ring 17 , and has grooves or blades 19 to create a greater rotational motion for the purpose of deflecting the particle - loaded flow near the wall . the grooves or blades 19 are scaled in their conveyance power so that their conveyance power influences the flow near the wall slightly . however , they are so small that they do not reinforce the circular flow within the impeller side space 13 , such as is increasingly the case with previously known outer auxiliary blades . according to fig8 short blades 19 . 1 , 19 . 2 are disposed at the rotating part 5 of the impeller , above and below the stationary and protruding rings 17 . the gaps 21 , 22 between the rings 17 and the blades run at a slant . the blades shown in fig5 to 8 as well as in the subsequent figures can also be covered wholly or partly by elements shaped like cover disks , in the manner of an enclosed impeller . in fig9 to 12 , the housing ring 17 has a disk 23 which points radially outward , and which reinforces the deflection of the particle - loaded flow near the wall . furthermore , the rotating impeller cover disks 5 here may or may not have short blades 19 . the disk 23 can be situated at the ring 17 either on its front side or in its middle region . the lines shown by dots and dashes in fig1 , which enclose the disk 23 here too symbolize regions where the disk surfaces have different inclinations . fig1 and 14 show a top view of the ring 17 , which is fixed on the housing . according to fig1 , this can be a closed ring , but according to fig1 it can also be a divided ring . the division here can be chosen in such a way that several ring segments 17 . 2 are arranged in a blade - like pattern relative to the housing wall 7 . the center point ( s ) of the ring segments 17 . 2 are situated outside the center point of the rotation axis , but displaced in the associated vertical and / or horizontal intersection plane . the individual ring segments here open outward in the sense of rotation of the impeller , which is not shown here . this can achieve a differentiated incidence and thus can affect on the flow . the arrow shows the direction of rotation of the impeller . fig1 shows an inventive design , using as an example a diaphragm gland 10 situated on the suction side . a rotating ring 20 has blades 19 on the side which faces the stationary ring 17 . grooves with a similar effect can also be used instead of blades . the rotating part of the diaphragm gland is here situated at a greater diameter than the stationary part , and with a narrow gap being situated in between . the blades 19 or the grooves can be disposed both in the axial direction and perpendicular to the direction of rotation , as well as at a certain angle to the axial direction . in fig1 , 17 , the section line a -- a of fig1 shows the developed views of the blades 19 or grooves in the circumferential direction of the impeller . the direction of rotation is here specified by the arrow . fig1 to 20 show designs of the wall surfaces , in which , in place of a protruding ring , the wall itself has a type of recess 25 , whose run - out , designed as a run - off edge 26 , points toward the opposite rotating cover disk 5 of the impeller . depending on the mode of consideration , this design of the wall surface can also be regarded as a design which constricts the side space 13 or 14 of the impeller . this is then followed by a recess 25 which deflects the particle - loaded flow near the wall . the particle - loaded flow near the wall is deflected along the stationary surface 7 of the housing wall , toward the side space 13 of the impeller , with the greater rotational motion prevailing therein . here , too , blades 19 with a small radial extent can be affixed to the rotating cover disks 5 of the impeller , so as to enhance the deflection of the particles into a region of higher rotational energy . the circumstances are specified in more detail in the example of fig1 . the angle α specified in fig1 should not exceed 30 deg ; the ratio of the length 1 to the depth t 2 of the recess 25 is subject to the condition that it should not be less than the value 1 / t 2 = 3 . the depth t 2 should be scaled so that it corresponds at least to 3 times the local thickness of the boundary layer . the thickness of the boundary layer is derived from customary calculations ( e . g . according to schlichting ; boundary layer theory , g . braun , karlsruhe 1982 ). the boundary layer thickness here depends largely on the medium , the rotational speed of the impeller , on the radius r 1 and r 1 &# 39 ; and on the width b of the side space 13 of the impeller . fig2 to 25 show another way of influencing the flow near the wall . on the one hand , this can be grooves 27 or protruding blades 28 incorporated into a stationary wall surface 7 . these grooves or blades progress radially outward in the direction of rotation of the impeller or of the opposite rotating disk surface . thus they conduct the particles brought in by the flow near the wall , along the radially outward directed contour of the grooves 27 or the blades 28 , to the outside . to transport the particle from the interior region of the side space of the impeller to the outside , several cycles inside the impeller side space are needed , until the particles can be discharged inside a spiral or a guide device . according to fig2 , the stationary surface 7 of the housing wall has been designed in saw - tooth shape , such that the flat rise 29 of the contour extends in the direction of rotation of the rotating wall surface 5 . by means of this measure , the particles again and again are repelled from the stationary wall , and move into regions where the medium has a higher local rotational speed . thus , after several cycles , they can again leave the side space 13 or 14 of the impeller . fig2 shows a top view of the wall surface 7 designed in this way . having described the presently preferred exemplary embodiments of a turbo - machine in accordance with the present invention , it is believed that other modifications , variations and changes will be suggested to those skilled in the art in view of the teachings set forth herein . it is , therefore , to be understood that all modifications , variations and changes are believed to fall within the scope of the present invention without departing from the spirit and scope of the invention as disclosed above .	5
in the following table 1 are shown results measured on the properties of high strength and high modulus pva fiber cord used in the invention together with those of the other conventional fiber cords for the belt reinforcing layer . table 1__________________________________________________________________________ high strength high strength and high modulus aramide rayon polyester and high modulus crosslinkedkind of cord fiber fiber fiber pva fiber pva fiber__________________________________________________________________________denier ( d ) 1500 / 2 1650 / 2 1500 / 2 1500 / 2 1500 / 2twisting number 32 × 32 29 × 29 30 × 30 31 × 31 31 × 31 ( turns / 10 cm ) cord strength ( g / d ). sup . 1 15 . 0 6 . 6 8 . 0 12 . 0 12 . 0cord dynamic modulus 2 . 5 × 10 . sup . 11 0 . 4 × 10 . sup . 11 0 . 5 × 10 . sup . 11 1 . 2 × 10 . sup . 11 1 . 2 × 10 . sup . 11 ( dyn / cm . sup . 2 ). sup . 1fatigue resistance 40 72 80 70 80 ( retention oftenacity ) (%) adhesion force at room 2 . 0 2 . 8 1 . 8 2 . 8 2 . 8temperature ( kg / cord ) adhesion force at high 0 . 4 2 . 0 0 . 4 1 . 8 1 . 8temperature of 100 ° c . ( kg / cord ) __________________________________________________________________________ . sup . 1 cord properties were measured after the cord was taken out from the reinforcing layer embedded in rubber . cord dynamic modulus e &# 39 ; was measured at 100 ° c . and 30 hz . the adhesive treatment of the cord in table 1 was carried out as follows . each of the rayon fiber and the high strength and high modulus pva fiber was immersed in a usual resorcin / formaldehyde / latex ( rf / l ) series adhesive , dried and subjected to a heat treatment . the polyester fiber was immersed in a mixed solution of sulfur - modified resorcin and rf / l , dried and subjected to the heat treatment . the aramid fiber was immersed in an aqueous epoxy solution before the application of rf / l series adhesive , which was dried and subjected to the heat treatment . the measurement of fatigue resistance in table 1 was made according to the following fatigue test . a sheet of unvulcanized rubber consisting essentially of natural rubber having a thickness of 1 mm was attached to each side of cords arranged at an end count of 24 cords / 2 . 54 cm ( 24 cords / inch ) to prepare a topping cord sheet of 5 cm width × 60 cm length . the topping cord sheet was attached to a steel cord sheet , and then the unvulcanized rubber was attached to upper and lower surfaces thereof so as to provide a total sample thickness of 15 mm . then , the sheet assembly was vulcanized under a pressure of 20 kg / cm 2 at 145 ° c . for 30 minutes to prepare a vulcanizate usable for the measurement of flexural fatigue resistance . next , the vulcanizate was attached to a pulley of 20 mm in diameter so as to face the sample cord sheet to the pulley side , and a load of 100 kg was applied to both ends thereof , which was subjected to flexural strain of 5000 times per hour at 100 ° c . for 4 hours . after the cord was taken out from the vulcanizate , the strength at break was measured , and a retention (%) to original strength at break calculated as a fatigue resistance of the cord . as shown in table 1 , the high strength and high modulus pva fiber is low in the cord tenacity and cord dynamic modulus as compared with the aramid fiber but high as compared with the rayon and polyester fibers , and considerably excellent in the fatigue resistance as compared with the aramid fiber and equal to the rayon and polyester fibers . furthermore , in case of the aramid fiber , the adhesion force at high temperature is low , and the separation failure is apt to be caused at the belt end under the running conditions of high speed , high load , low internal pressure and the like , while the high strength and high modulus pva fiber is good in the adhesion property to resorcin / formaldehyde / latex ( rf / l ) adhesive because of the presence of many oh groups bonded to the molecular chain , and also the adhesion property at high temperature is good . the invention includes crosslinked fibers obtained by reacting the high strength and high modulus pva fiber with a crosslinking agent as mentioned below , which has the same advantages as in the fiber not crosslinked and further improves the fatigue resistance . the high strength and high modulus pva fiber used in the invention is required to satisfy the relationship ( 1 ) as mentioned above . if this relationship is not satisfied , the breakage of the belt cord is apt to be caused through stones and protrusions on rough road during the running . furthermore , even when the relationship ( 1 ) is satisfied , if the relationship ( 2 ) is not satisfied , the separation failure at belt end is apt to be caused . moreover , if the relationship ( 3 ) is not satisfied , the steering stability is poor . on the contrary , the high strength and high modulus pva fiber satisfying all of the relationships ( 1 ), ( 2 ) and ( 3 ) has not the above problems and improves the comfortability and the durability . the high strength and high modulus pva fiber used in the invention is preferable to be subjected to a crosslinking treatment . as shown in table 1 , the strength retention is improved by the crosslinking treatment , which has a good tendency to improve the tire . the inventors have made various studies with respect to the cause that the strength of high strength and high modulus pva fiber cord not subjected to the crosslinking treatment is decreased after the actual running of the tire containing such cords , and obtained the following knowledge . that is , it has been confirmed that the cords taken out from the tire after the actual running were embedded in an epoxy resin and cut by means of a microform and then the transverse section of the cut cord was observed and as a result the filaments in the vicinity of intersection between cable twist bundles considerably deformed to aggregate 10 or more filaments and partly cause fibrillation . this phenomenon is not observed in the polyester and aramid fibers . according to the invention , in order to improve the fatigue properties and resistances to compression , distortion , high temperature and hot water in the filament and enhance the transverse bond in fiber molecular chain , the crosslinking reaction between oh groups of adjoining polyvinyl alcohol molecules could be produced to improve the fatigue properties . in this case , the crosslinking agent used naturally includes any substances causing the crosslinking reaction by reaction with the above oh group , but other crosslinking agents capable of producing the crosslinking between pva molecule chains may be used . as the crosslinking agent reacting with oh group , there are mentioned aldehydes , methylol compounds , epoxy compounds , isocyanate compounds , peroxides , compounds containing a metal ( al , ti , p , cr , cu or the like ), and inorganic acids causing dehydration reaction . the reaction between fiber yarn or fiber cord and crosslinking agent will be described as a method of reacting with such a crosslinking agent . in order to penetrate the crosslinking agent into the inside of the pva fiber yarn or filaments in the cord , such a fiber is treated with the solution of the crosslinking agent . in this case , it is preferable to use the same solvent as in the spinning . as the solvent , mention may be made of dimethylsulfoxide , glycerine , ethylene glycol , propylene glycol , triethylene glycol , dimethylformamide , methyl alcohol , ethyl alcohol , phenol , n - propyl alcohol , iso - propyl alcohol , water and a mixture thereof , among which the use of dimethylsulfoxide and water is favorable . for instance , when the temperature of a bath dissolving the crosslinking agent in dimethylsulfoxide or water is maintained within a range of about 50 °- 90 ° c ., the amorphous portion of the pva fiber swells to promote the penetration of the crosslinking agent into the inside of the filament . in this case , the immersing time is preferable to become longer , but is sufficient to be about 30 minutes . after the immersion , the extra crosslinking agent remaining between the cords or onto the surface of the filament is washed out with water , alcohol or the like and then the crosslinking reaction can be made by subjecting to drying and heat treatment . furthermore , the crosslinked pva fiber used in the invention may naturally be obtained by the crosslinking treatment other than the above . for example , the penetration of the crosslinking agent into the inside of the filament can be carried out at a spinning step or a solidification step after the spinning , which is more preferable in industry . when the crosslinking agent is added to the spinning solution , a spinning solution capable of dissolving 2 - 50 % by weight of pva is prepared , to which is discharged the crosslinking agent in an amount of not more than 1 part by weight per 100 parts by weight of pva . as the spinning method , use may be made of dry system , wet system and dry - wet system . in general , the yarn after the spinning is passed through a solidification bath of methanol or the like , drawn and further drawn under heat treatment to conduct the crosslinking reaction . moreover , the method of adding the crosslinking agent to the solidification bath to penetrate into the inside of the fiber can be taken instead of the addition to the spinning solution . the temperature required for the crosslinking reaction differs in accordance with the kind of the crosslinking agent used , but is usually not lower than 120 ° c . but preferably not higher than the melting point of the filament . furthermore , ultraviolet ray , far - infrared ray , microwave and the like may be used for the crosslinking reaction . when the crosslinked pva fiber is used in the invention , the content of insoluble matter when the cord is dissolved in dimethylsulfoxide ( dmso ) at 120 ° c . is not less than 5 % by weight , preferably not less than 10 % by weight , more particularly not less than 30 % by weight . this content of insoluble matter indicates the degree of crosslinking between molecules . when the content of insoluble matter is less than 5 % by weight , the improving effect of fatigue properties in not clear . the pva filaments after the formation of the crosslink bond are rendered into a green cord at a twisting step . thereafter , the green cord is subjected to a treatment with a usual rfl adhesive . as seen from table 1 , the fatigue resistance is considerably improved in the thus obtained crosslinked high strength and high modulus pva fiber as compared with the pva fiber not subjected to the crosslinking treatment . moreover , the cord tenacity s , tensile strength and cord elongation at break u according to the invention are measured at a span of 25 cm and a tensile speed of 30 cm / min according to a method of jis l - 1013 . the dynamic modulus ( e &# 39 ;) of the cord is measured by using a vibron type spectrometer at a cord sample length of 3 cm under conditions of 100 ° c ., 30 hz , initial tension of 0 . 1 g / d and dynamic tension of ± 0 . 033 g / d . the following examples are given in illustration of the invention and are not intended as limitations thereof . cords used in examples 1 and 2 and comparative examples 1 and 2 were those shown in table 1 , and cords used in comparative examples 3 - 6 were those prepared according to the method of example 1 and having properties shown in the following table 2 . each of these cords was used in a second belt reinforcing layer located at a tread side of a radial tire for passenger car having two belt reinforcing layers , while steel cords were used in the first belt reinforcing layer to prepare a test tire having a tire size of 185 / 70 r13 . further , polyester cords of 1500 d / 2 were used in a carcass ply of the tire . the structure of the tire was shown in fig1 in which the second belt reinforcing layer had a fold structure that each outermost end portion of the layer in transverse direction was folded inward . as to the tire test , the steering stability and the comfortability were evaluated by a feeling of a professional driver in the actual running test at a speed of 60 - 200 km / hr . the larger the value , the better the property . after the test tire was run on road consisting of 40 % rough road and 60 % good road under an internal pressure of 2 . 5 kg / cm 2 and a loading of 500 kg until the complete wearing of the tire , the second belt reinforcing layer portion was exposed and the number of broken cords per one tire was measured as a cord breaking property . as the durability test , the tire was run on a drum at a speed of 60 km / hr under an internal pressure of 3 . 0 kg / cm 2 and a loading of 900 kg . if troubles were not caused , the test was stopped at a running distance of 20 , 000 km . after the drum test , the second belt reinforcing layer was taken out to measure the presence or absence of separation at belt end . further , a percentage of retention of tenacity of the cord after the drum test to the original tenacity of the cord was evaluated as a measure of fatigue property . the measurement of insoluble matter in dimethylsulfoxide ( dmso ) at 120 ° c . was carried out as follows . the pva cords in the belt were taken out from the tire and then rubber adhered portion and rfl adhesive portion were carefully removed therefrom . then , the pva fibers in the cord were cut to a length of about 3 mm and about 0 . 05 g of the cut fibers was previously measured . next , these cut fibers were dissolved in 50 cc of dmso at 120 ° c . for 1 hour , which was filtered at hot state through a filter paper ( no . 5a ). the insoluble matter remaining on the filter paper was dried in air and hot dried throughly , and thereafter the weight of insoluble matter on the filter paper was measured . the ratio of the measured weight of the insoluble matter to the weight of the pva fiber was indicated as a percentage . table 2 ( a ) __________________________________________________________________________ compar - compar - compar - compar - compar - compar - ative ative ative ative ative ative example 1 example 2 example 3 example 1 example 4 example 5 example example__________________________________________________________________________ 2kind of cord in polyester aramide high high high high highsecond belt fiber fiber strength strength strength strength high strength andreinforcing and high and high and high and high strength high moduluslayer modulus modulus modulus modulus high modulus crosslinked pva fiber pva fiber pva fiber pva fiber pva fiber pva fibercord denier ( d ) 1500d / 2 1500d / 2 1500d / 2 1500d / 3 1500d / 2 1500d / 2 1500d / 3 1500d / 3twisting number 30 × 30 32 × 32 31 × 31 25 × 25 31 × 31 42 × 42 34 × 34 25 × 25 ( turns / 10 cm ) cord dynamic 0 . 5 × 10 . sup . 11 2 . 5 × 10 . sup . 11 1 . 2 × 10 . sup . 11 1 . 2 × 10 . sup . 11 1 . 2 × 10 . sup . 11 0 . 55 × 10 . sup . 11 0 . 55 × 10 . sup . 11 1 . 2 × 10 . sup . 11modulus e &# 39 ;( dyn / cm . sup . 2 ). sup . 1t : end count 45 45 45 40 57 45 45 40 ( cords / 5 cm ) s : cord tenacity 22 51 38 56 38 30 45 56 ( kg ). sup . 1u : elongation 10 . 2 5 . 0 6 . 3 6 . 3 6 . 5 9 . 0 9 . 0 6 . 5at break of cord (%). sup . 1cord occupying 57 57 64 70 81 67 82 70ratio : l × t / 50 × 100 (%) steering 4 7 7 7 7 5 5 7stabilitycomfortability 6 5 6 6 6 7 7 612 ( s × t ) + 1000 u -- 32540 26820 33180 32492 25200 33300 33380number of broken no 0 8 0 0 6 0 0cords after therunning on badroaddrum test no separation no trouble no trouble separation no trouble separation no trouble running failure at after after failure at after failure after belt end complete complete belt end complete belt end complete after the running of running of after the running of after the running of running 20 , 000 km 20 , 000 km running 20 , 000 km running 20 , 000 km over over 20 , 000 km 20 , 000 km 20 , 000 kmretention of no -- 70 71 -- 82 86 85cord tenacity runningafter therunning on druminsoluble matter -- -- 0 0 0 0 0 10in dmso at 120 ° c . (%) __________________________________________________________________________ *. sup . 1 cord properties were measured after the cord was taken out from the reinforcing layer embedded in rubber . cord dynamic modulus e &# 39 ; was measured at 100 ° c . and 30 hz . the dynamic modulus of polyester fiber in comparative example 1 is as low as 0 . 5 × 10 11 dyn / cm 2 , so that even when the cord having such a dynamic modulus is used as a belt material , the steering stability is poor and the sufficient hoop effect can not be expected . the dynamic modulus of the aramid fiber in comparative example 2 is as high as 2 . 5 × 10 11 dyn / cm 2 , so that the steering stability of the tire using this fiber as a belt material is good , but the comfortability is poorer as compared with the other organic fibers in table 2 . furthermore , the tire is completely run in the drum test , but the separation failure is caused at the belt end . moreover , the adhesion force , particularly adhesion force at high temperature is poor as shown in table 1 . a graph showing a non - breakage region of cord in the running on bad road is shown in fig2 based on the data of table 2 , in which an ordinate is an elongation at break and an abscissa is end count × cord tenacity . this shows that the breakage of cord in the belt layer is not caused in a region satisfying the relationship ( 1 ) of 12 ( s × t )+ 1000u & gt ; 28000 ( shadowed portion of fig2 ) but the cord breakage occurs in a region not satisfying the above relationship ( comparative examples 3 , 5 ). in example 1 , the cord is made thick under the same twisting number as compared with comparative example 3 and to largely increase the cord tenacity , whereby the resistance to cord breakage is enhanced . in comparative example 4 , the cord breakage is prevented by the increasing the twisting number , but the separation failure is caused at the belt end after the drum test because the cord occupying ratio is not less than 80 . in comparative example 5 , the twisting number is increased for raising the elongation at break , but the cord tenacity and cord modulus are lowered , which does not satisfy the relationship ( 1 ), so that the breakage of the belt cord is caused and the steering stability lowers . in comparative example 6 , the second belt cords having a thick size under the same twisting number as in comparative example 5 are used , so that the cord tenacity is increased to satisfy the relationship ( 1 ), and consequently the breakage of the belt cord is not caused even in the running on bad road . however , the dynamic modulus is lowered to 0 . 55 × 10 11 dyn / cm 2 likewise comparative example 5 , so that the steering stability is degraded . in example 2 , the high strength and high modulus pva fiber is subjected to a crosslinking treatment , so that the retention of tenacity of the belt cord after the drum test is considerably improved as compared with example 1 conducting no crosslinking treatment . from the above data , the inventors have established the relationship ( 1 ) ( shadowed region of fig2 ) as a condition causing no breakage of belt cord . the technique of the invention preventing the occurrence of cord breakage in the running on bad road is considered as follows . that is , when the tire rides on stones scattered on the road or protrusions on the road , the tire deforms so as to envelop the stone or the like . at this time , a large tension is locally applied to the cords , particularly cords in the second belt reinforcing layer , so that the breakage of belt cord is considered to be depended upon the presence or absence of tenacity ( that is , cord tenacity × end count ) enough to endure the above tension and the presence or absence of followability ( elongation at break ) to the deformation of the belt cord in the envelopment of the protrusion . the boundary condition causing such a breakage is a border line of the shadowed region in fig2 . therefore , it is considered that only the cords having cord tenacity × end count and elongation at break within the shadowed region can overcome the tension in the riding over the stone or the like . moreover , when the end count is too large , the rubber gauge between the cords becomes thinner , which causes a problem of separation failure at belt end . as seen from examples and comparative examples , the invention provides pneumatic radial tires having improved comfortability and durability by using the high strength and high modulus pva fiber as a cord of the belt reinforcing layer , particularly second belt reinforcing layer in the tire and specifying the properties and arrangement of this cord .	1
the figure schematically shows an embodiment of a vibration exciter 1 in a view from above in a section in a plane running substantially parallel to the surface of the ground to be processed . the vibration exciter 1 may be used in particular in a vibratory plate foreground compaction . the vibration exciter 1 has a first imbalance shaft 3 which is driven in rotation by a drive device 2 and which has imbalance masses 4 a and 4 b arranged or fastened thereon . by means of two gearwheels 5 and 6 , the rotational movement of the first imbalance shaft 3 is transmitted in positively locking fashion to a second imbalance shaft 7 such that the latter rotates in the opposite direction . the second imbalance shaft 7 has a first imbalance shaft half 8 a and a second imbalance shaft half 8 b which is arranged coaxially with respect to the first imbalance shaft half 8 a and which is rotatable relative to the first imbalance shaft half . the two imbalance shaft halves 8 a and 8 b are inserted into both sides of an adjustment sleeve 9 which belongs to a coupling device and which couples the two imbalance shaft halves 8 a and 8 b in positively locking fashion but such that they are rotatable relative to one another . the gearwheel 6 is arranged in encircling fashion on the adjustment sleeve 9 . the adjustment sleeve 9 consequently forms , with the gearwheel 6 , a coupling device for the positively locking coupling of the first imbalance shaft 3 to the second imbalance shaft 7 , which is composed of the two imbalance shaft halves 8 a , 8 b . adjustable imbalances 10 a and 10 b are arranged or fastened on the two imbalance shaft halves 8 a and 8 b . to realize an individual relative rotation of the adjustable imbalances 10 a , 10 b about the axis of rotation of the second imbalance shaft 7 , respective relative - rotation devices 11 a , 11 b are provided and are recessed into the imbalance shaft halves 8 a and 8 b , which are in the form of hollow shafts . by means of the relative - rotation devices 11 a , 11 b , the phase angle of the adjustable imbalances 10 a , 10 b relative to the imbalance masses 4 a , 4 b arranged on the first imbalance shaft 3 can be adjusted . by means of the centrifugal force vectors that act on the imbalance masses 4 a , 4 b , 10 a , 10 b during a rotation of the imbalance masses 4 a , 4 b and 10 a , 10 b in each case about the oppositely rotating imbalance shafts 3 , 7 , it is possible , with a shifted phase angle , to realize a forward or reverse movement of the ground compaction device that is operated by way of the vibration exciter 1 . by means of a relative rotation of the adjustable imbalances 10 a , 10 b with respect to one another , a yaw moment and thus a rotation of the ground compaction device is generated about a vertical axis of the vibration exciter 1 or of the ground compaction device , said vertical axis projecting vertically out of the plane of the drawing . below , only the relative - rotation device 11 a will be discussed . the relative - rotation device 11 b is of identical construction and , in the figure , is illustrated mirror - symmetrically with respect to the relative - rotation device 11 a . the relative - rotation device 11 a has , as actuation device , a piston 12 a arranged in a cover sleeve , the latter being arranged or fastened on a housing 19 of the vibration exciter 1 and engaging into the imbalance shaft half 8 a . part of the cover sleeve is formed by a cylinder 22 a in which the piston 12 a is mounted in axially movable fashion . the cover sleeve , the cylinder 22 a and the piston 12 a are rotationally decoupled from the imbalance shaft half 8 a by way of bearing 18 a and are fastened to the housing 19 of the vibration exciter 1 . the piston 12 a can axially displace a slide 13 a within the imbalance shaft half 8 a . the slide 13 a bears a transverse pin 14 a which extends through a helical groove 15 a provided in a wall of the first imbalance shaft half 8 a , which is in the form of a hollow shaft . at the same time , the transverse pin 14 a engages into a longitudinal groove 16 which is formed on the inner side of the adjustment sleeve 9 and which lies radially outside or above the helical groove 15 a . owing to the helical profile of the groove 15 a , the axial displacement of the slide 13 a with the transverse pin 14 a has the effect of forcibly imparting to the first imbalance shaft half 8 a a rotational movement relative to the adjustment sleeve 9 . in this way , the relative rotational position of the adjustable imbalance 10 a relative to the adjustment sleeve 9 , relative to the adjustable imbalance 10 b and relative to the first imbalance shaft 3 is varied . the helical groove 15 a forms a recess of the first imbalance shaft half 8 a and is preferably arranged in a region of the first imbalance shaft half 8 a which faces toward the central axis of symmetry of the housing 19 ( exciter housing ) and / or of the ground compaction device . the recess is preferably arranged in a half of the first imbalance shaft half 8 a , and / or the recess extends over at most a half of the length of the first imbalance shaft half 8 a , which half faces toward the central axis of symmetry . the recess is particularly preferably arranged in a third of the first imbalance shaft half 8 a , and / or the recess extends over at most a third of the length of the first imbalance shaft half 8 a , which third faces toward the central axis of symmetry . during working operation , the adjustable imbalances 10 a and 10 b seek , owing to their inertia , to change their respective phase angle in a retarding direction , and thus push the pistons 12 a and 12 b back into their initial positions . to further assist the return movement of the pistons 12 a , 12 b , spring devices may be provided , and arranged for example within the cylinders 22 a , 22 b . the spring devices can support the pistons 12 a , 12 b for example against a face side , facing toward the adjustment sleeve 9 , of the respective cylinder 22 a , 22 b . in this arrangement , the relative - rotation device 11 a is almost entirely recessed into a cavity of the first imbalance shaft half 8 a . only an inlet 17 a for hydraulic fluid for the movement or exertion of pressure on the piston 12 a projects out of the first imbalance shaft half 8 a . the piston 12 a , at least in a maximally retracted position , is entirely received in the second imbalance shaft 7 and / or recessed into the first imbalance shaft half 8 a . the piston 12 a , the cylinder 22 a and the inlet 17 a are in this case decoupled from a rotational movement of the first imbalance shaft half 8 a and of the slide 13 a by way of a bearing 18 a , which serves as a rotational decoupling means . furthermore , it may be the case that the end region of the piston 12 a , even in a maximally deployed position , that is to say remote from the central axis of symmetry of the housing 19 , is received entirely in the second imbalance shaft 7 and / or does not project out of the contour formed by the housing 19 ( exciter housing ). the exciter housing is to be understood to mean the housing 19 without further fixtures , which housing serves for receiving the shafts 3 , 7 and imbalance masses 4 a , 4 b , 10 a , 10 b . in this arrangement , an orbit of the adjustable imbalance 10 a about the first imbalance shaft half 8 a may at least partially or even entirely surround the cavity , the piston 12 a and / or the cylinder 22 a . this makes it possible for the adjustable imbalance 10 a to be arranged far to the outside on the first imbalance shaft half 8 a , that is to say with a large spacing to an axis of symmetry , running through the gearwheels 5 , 6 , of the vibration exciter 1 , and for example directly adjacent to a housing 19 of the vibration exciter 1 . consequently , during the rotation of the adjustable imbalance 10 a , a large lever arm acts , which can yield a high rate of rotation of the ground compaction device about the vertical axis . good controllability of the ground compaction device can be attained in particular if , as shown in the figure , the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ) are arranged far remote from the center of the exciter . in this way , it can be achieved that the imbalance masses 4 a , 4 b and the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ) are arranged axially offset with respect to one another such that there is only a small overlap , or no overlap , between the imbalance masses 4 a , 4 b , 10 a , 10 b . the overlap between an imbalance mass 4 a , 4 b of the first imbalance shaft 3 and an imbalance mass 10 a , 10 b ( adjustable imbalance 10 a , 10 b ) of the second imbalance shaft 7 is preferably at most 50 percent . to calculate this , the axial length of the overlap is set in a ratio with respect to the added - together total length of the two imbalance masses . the overlap is more preferably at most 25 percent . there is particularly preferably no overlap between the imbalance masses 4 a , 4 b , 10 a , 10 b . an inner bearing 20 a is arranged axially between the adjustable imbalance 10 a and the adjustment sleeve 9 , and a further inner bearing 20 b is arranged between the adjustable imbalance 10 b and the adjustment sleeve 9 . the adjustment sleeve 9 with the gearwheel 6 is thus mounted between the adjacently arranged inner bearings 20 a and 20 b . furthermore , the second imbalance shaft 7 is mounted on the housing 19 by way of outer bearings 21 a , 21 b . the outer bearings 21 a , 21 b may be arranged adjacent to or in the direct vicinity of the adjustable imbalances 10 a , 10 b . the adjustment sleeve 9 is positioned on , and supported by , the end regions of the first imbalance shaft half 8 a and of the second imbalance shaft half 8 b . thus , the first imbalance shaft half 8 a is mounted in the housing 19 by way of the bearings 20 a and 21 a , whereas the second imbalance shaft half 8 b is mounted in the housing 19 by way of the bearings 20 b and 21 b . elastic deformations of the second imbalance shaft 7 , which are imparted to the latter by the rotating adjustable imbalances 10 a and 10 b , are lessened by the bearings 20 a , 20 b and 21 a , 21 b . the adjustment sleeve 9 with the gearwheel 6 arranged thereon is thus subjected to elastic displacement only to a small extent . consequently , the gearwheel pairing 5 , 6 runs relatively quietly , and is subjected to significantly lower mechanical load . furthermore , the bearings 20 a , 20 b , 21 a , 21 b are arranged , with regard to the first and second imbalance shaft halves 8 a , 8 b , such that the loads imparted by the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ) are dissipated by the respectively adjacently arranged bearings , such that the region of the respective imbalance shaft half 8 a , 8 b in which the recess ( helical groove 15 a , 15 b ) is arranged is isolated from the load . owing to the splitting of the second imbalance shaft 7 into the two imbalance shaft halves 8 a and 8 b , it is possible in the embodiment shown in the figure for the adjustable imbalances 10 a and 10 b to be arranged directly on the imbalance shaft halves 8 a and 8 b . the adjustment sleeve 9 is thus not subjected to load by the imbalances , but is spatially separate from the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ). furthermore , in each case one bearing point is arranged between the adjustment sleeve 9 and the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ), such that the action of the imbalance masses ( adjustable imbalances 10 a , 10 b ) on the sleeve ( adjustment sleeve 9 ), and on the adjustment arrangement 9 , 13 a , 13 b , 14 a , 14 b , 15 a , 15 b as a whole , is minimized this increases the robustness of the vibration exciter 1 . in the exemplary embodiment shown , the torque flow runs from the drive device 2 via the first imbalance shaft 3 , the gearwheel pairing 5 , 6 , the adjustment sleeve 9 , the engagement elements ( transverse pins ) 14 a , 14 b , in each case to the first and second imbalance shaft halves 8 a , 8 b and in each case onward to the second and third imbalance masses 10 a , 10 b ( adjustable imbalances 10 a , 10 b ). the relative rotatability of the adjustable imbalances 10 a and 10 b is in this case ensured by way of the centrally arranged adjustment sleeve 9 . the adjustment sleeve 9 is in this case isolated from the weight of the adjustable imbalances 10 a and 10 b and is furthermore protected , by the inner bearings 20 a and 20 b , from the shaft bending caused by the rotating adjustable imbalances 10 a , 10 b . consequently , quieter operation and an increased service life of the vibration exciter 1 can be expected . owing to the arrangement of the relative - rotation devices 11 a , 11 b within the imbalance shaft halves 8 a , 8 b formed as hollow shafts , the adjustable imbalances 10 a and 10 b can be arranged far to the outside on the second imbalance shaft 7 and thus with a large lever arm with respect to the vertical axis of the ground compaction device . this permits a high level of rotational dynamics and improved traveling behavior of the ground compaction device or vibratory plate in accordance with an operator demand . traveling maneuvers can be realized more quickly , leading to greater productivity of the ground compaction device . this also applies in particular to remote - controlled vibratory plates of compact design .	4
as illustrated in fig1 the present invention is embodied in a solar heating system including a solar panel or collector 20 for heating a fluid , such as water , from radiant solar energy and a tank 22 for storing the heated fluid . the tank 22 can be , for example , connected in a conventional manner with a pressuized water supply to provide a hot water supply or can be connected to heat the interior of a building such as through radiators . a pipe 24 connects an outlet of the tank 22 to an inlet of the solar panel 20 while a pipe 26 connects an outlet of the solar panel 20 to an inlet of the tank 22 . a pump 28 is suitably provided , for example in the return pipe 26 , for circulating the fluid from the tank 22 through the solar panel 20 . connected to the pump 28 is an electric motor 30 which has power input leads connected to power output terminals 32 and 34 of controller circuit unit 36 energized by a suitable power source , such as a 120 volt 60 cycle ac source 38 , connected across a power input terminal 42 and the common power terminal 34 of the unit 36 . temperature sensors , such as negative temperature coefficient resistances or thermistors 44 and 46 , are suitably mounted for sensing a temperature of the fluid in the solar panel 20 and the tank 22 , respectively ; for example the temperature sensor 44 is illustrated as mounted in the solar panel 20 adjacent to the outlet thereof while the sensor 46 is mounted in the outlet of the tank 22 . the temperature sensor 44 is connected between a terminal 48 and a common terminal 50 of the unit 36 while the temperature sensor 46 is connected between a terminal 52 and the common terminal 50 of the unit 36 . the electrical circuitry within the unit 36 , as shown in fig2 includes a power control triac 54 connected between the terminals 32 and 42 . normally open contacts 56 of a relay , such as a reed relay which includes a winding 57 for closing the contacts when energized , are connected in series with a protective resistance 58 from the terminal 42 to a control electrode of the triac 54 . connected across the triac 54 is a series circuit of a resistance 60 and a capacitance 62 which have values selected to limit voltage rise time across the triac 54 to prevent false triggering from transients and the like . a voltage step down transformer 64 has a primary winding connected across the terminals 34 and 42 and has a secondary winding connected in series with a current limiting resistance 65 across the ac inputs of a full wave rectifier 66 which has its negative going dc output joined with the common terminal or node 50 and its positive going dc output connected to one side of a filter capacitance 68 . the other side of the capacitance 68 is connected to the terminal 50 . coupled across the capacitance 68 are inputs of a voltage regulator 70 which has on output thereof forming a regulated positive voltage node or junction 72 . the panel sensor 44 with the terminals 50 and 52 is connected in series with resistances 74 and 76 in a first circuit across the dc voltage nodes 50 and 72 while the tank sensor 46 with terminals 48 and 50 is connected in series with resistances 78 and 80 in a second series circuit across nodes 50 and 72 . a resistance 82 is connected in parallel with the tank sensor 46 . the first and second series circuits form a resistance bridge wherein the panel sensor resistance 44 is a first arm of the bridge , the resistances 74 and 76 form a second arm of the bridge , the resistance 80 forms a third arm of the bridge , and the tank sensor resistance 46 with series resistance 78 and parallel resistance 82 form the fourth arm of the bridge . an operational amplifier or comparator 84 has its non - inverting input connected by a resistance 86 to the sensing node or terminal 52 of the bridge between the panel sensor 44 and the resistance 74 , and has its inverting input connected by resistance 88 to the other sensing node 90 of the bridge at the junction between resistances 78 and 80 . the resistances 86 and 88 and a capacitance 92 connected between the inputs of the amplifier 84 have values selected to prevent operation of the amplifier 84 by spurious signals , induced electrical noise and the like . the relay winding 57 has one end connected to the voltage node 72 and its other end 93 connected to the anode of a diode 94 which has its cathode connected to the output of the amplifier 84 together with one end of a bias resistance 95 which has its other end joined to the common terminal 50 . a protective diode 96 is connected across the winding 57 . connected between the output of the amplifier 84 and the junction 97 between the resistances 74 and 76 is a series circuit of a resistance 98 and a diode 99 which has a polarity to conduct positive voltage from the output of the amplifier 84 to the junction 97 . the power inputs of the amplifier 84 are connected across the dc voltage nodes 50 and 72 . the panel sensor 44 and the tank sensor 46 preferrably have substantially the same temperature responsive characteristics . the values of the resistances 76 and 80 , taking into consideration the values of resistances 74 , 78 and 82 , are selected to produce a zero or negative voltage on the output of amplifier 84 when the temperatures sensed by the sensors 44 and 46 reach a predetermined differential ( the sensor 44 sensing a temperature which is the predetermined amount greater than the temperature sensed by the sensor 46 ) at an average normal tank temperature . the resistances 78 and 82 have values selected to linearize the differential response , i . e . to produce zero voltage across nodes 52 and 90 for substantially the same temperature differential , throughout a normal range of tank temperatures ; for the thermistors 44 and 46 , the resistance 78 is selected to linearize the differential at higher tank temperatures while the resistance 82 is selected to linearize the differential at lower tank temperatures . a hysteresis or difference between turn - off ( the output of amplifier 84 changing from negative to positive ) and turn - on ( the output of amplifier 84 changing from positive to negative ) is set by the value of the resistance 98 taking into consideration resistance 74 . the resistance 74 is inserted for use with a low limit temperature comparator in a modification shown in fig4 as will be explained hereafter , but is merely additive to the resistances 76 and 98 in the circuit of fig2 . in operation of the solar heating system of fig1 the sensing of a temperature in the solar panel 20 by the sensor 44 greater by more that the predetermined differential from the temperature of the tank 22 sensed by the temperature sensor 46 results in operation of the controller circuit unit 36 to energize the motor 30 and operate the pump 28 circulating fluid from the tank 22 through the solar panel 20 where the fluid is heated by solar energy impinging upon the panel 20 . when the temperature sensed by the sensor 44 is less than the predetermined differential above the temperature sensed by the sensor 46 , the motor 30 remains unenergized by the controller circuit unit 36 to prevent circulation of the fluid in the tank 22 through the solar panel 20 ; thus the heat of the fluid in the tank 22 is conserved and circulation is prevented where there is insufficient temperature differential between the solar panel 20 and the tank to provide significant heating of the water in the tank 22 . referring to fig2 the resistance of the panel thermistor sensor 44 becomes substantially less than the resistance of the tank thermistor sensor 46 when the temperature of the solar panel exceeds the temperature of the tank by more the predetermined differential so that the voltage at terminal 52 becomes negative relative to the voltage at terminal 90 rendering the output of the operational amplifier 84 negative . current from the voltage terminal 72 through the relay winding 57 and the output of the amplifier 84 then operates the reed relay to close contacts 56 and render the triac 54 conductive energizing the motor output terminal 42 . when the temperature of the solar panel is less than the predetermined differential greater than the temperature of the tank , the node 52 is positive relative to node 90 due to the resistance of sensor 44 not being sufficiently less than the resistance of sensor 46 ; thus the operational amplifier 84 has a high or positive output which blocks current passage through diode 94 and the relay winding 57 to allow the contacts 56 to open and maintain the triac 54 in a non - conductive state to deenergize the motor output 42 . the high output of the amplifier 84 renders the diode 99 conductive and current through the resistance 98 slightly raises the voltage at terminal 52 relative to the voltage of the terminal 90 to provide a hysteresis in the operation of the differential amplifier 84 and to prevent hunting or vacillation of the circuit unit between on and off conditions . in a specific example , the transformer 64 was a 120 volt to 24 volt stepdown transformer , the temperature sensing resistances 44 and 48 were fenwal thermistors no , uut43j1 , the voltage regulator 70 was type 78l18a , and the amplifier 84 was type 741 . the resistances and capacitances were selected to have the values as indicated in the following table : ______________________________________resistance 58 , 60 and 65 82 ohmscapacitance 62 0 . 1 mfd . capacitance 68 100 mfd . resistance 74 2000 ohmsresistance 78 150 ohmresistance 80 17 . 8k ohmresistance 82 680k ohmresistances 86 and 88 82k ohmcapacitance 92 0 . 047 mfd . resistance 95 27k ohm______________________________________ with the resistor 76 selected at about 14k ohms , the amplifier 84 turned off ( i . e . the output went from negative the positive ) when the temperature sensed by the sensor 44 dropped below about 2 . 8 ° c . greater than the temperature sensed by the sensor 46 as illustrated by the curve 102 in fig3 for varying temperatures sensor 44 . curves 104 , 106 and 108 illustrate the turn - on differential temperatures of the controller unit ( i . e . the output of amplifier 84 going from positive to negative ) when the resistance 98 is selected to be 88 . 7k ohms , 34 . 7k ohms and 22 . 1k ohms , respectively , for varying tank temperatures . smaller values may be selected for the resistance 76 to produce a greater differential temperature at turn - off ; such greater turn - off differential temperature correspondingly raising the turn - on differential temperatures represented by curves 104 , 106 and 108 since the difference between turn - on and turn - off remains generally constant for a selected value of resistance 98 . the circuitry enclosed within the long and short dashed line 110 of fig2 is modified by adding a low level comparator in the modification of fig4 . the additions include an operational amplifier 112 having its non - inverting input connected by a resistance 114 to the junction 97 between resistances 74 and 76 and having its inverting input connected by a resistance 116 to the junction 52 . conveniently the amplifiers 84 and 112 can be a dual amplifier integrated circuit such as type 1558 with common power terminals connected to the d . c . voltage terminals 72 and 50 . a capacitance 118 is coupled between the inputs of the amplifier 112 . the values of the resistances 114 and 116 and the capacitance 118 are selected to avoid erroneous operation of the amplifier 112 from spurious signals generated by electrical noise , etc . the output of the amplifier 112 is connected to the line 93 by a diode 120 and to one end of a bias resistance 112 which has its other end connected to the common junction 50 . the diode 120 has a polarity passing only positive current from line 93 . a series circuit of a resistance 124 and a diode 126 are connected between the output of the amplifier 112 and the non - inverting input ; the diode 126 having a polarity to pass positive current to the non - inverting input while the resistance 124 has a value selected to produce a predetermined difference between turn - on and turn - off conditions of the amplifier 112 . a resistance 119 has one end connected to the non - inverting input of the amplifier 112 and has its other end connected to the common terminal 50 . it is noted that a bridge circuit is formed by the temperature responsive resistance 44 and the resistances 74 , 114 and 119 when the diode 126 is non - conductive ; resistance 44 forming one arm of the bridge , the resistance 74 forming a second arm of the bridge , the resistance 114 forming a third arm to the bridge and the resistance 119 forming a fourth arm of the bridge . the resistance 119 has a value selected to turn - off the low level comparator circuit ( i . e . change the output of the amplifier 112 from negative to positive ) at a temperature sensed by the panel sensor 44 a comfortable margin above freezing temperature . the resistance 124 has a value selected to turn - on the low level comparator ( i . e . to render the output of the amplifier 112 negative ) when the temperature sensed by the panel sensor 44 is near freezing temperature such as one or two degrees above freezing temperature . in operation to the modified circuit in fig4 when the temperature sensed by the panel sensor 44 approaches freezing temperature , the resistance of the sensor 44 increases causing the voltage on terminal 52 to go positive relative to the voltage on the junction between resistance 119 and diode 126 ; thus the output of the operational amplifier 112 becomes negative completing a path from line 93 through diode 120 and the output of the amplifier 112 to the common terminal 50 to cause the relay winding 57 , fig1 to be energized to operate the pump and circulate water through the solar panel to prevent freezing of the water in the solar panel . also when the output of the amplifier 112 goes low , current through the resistance 124 and diode 126 is stoppd , thus rendering the voltage on the non - inverting input of the amplifier 112 even lower than the voltage on the inverting input to make it necessary for the temperature sensed by the sensor 44 to rise to a temperature substantially greater than the turn - on temperature before the pump will be turned - off . when the temperature sensed by the sensor 44 rises to this higher temperature , the output of the amplifier 112 is rendered positive terminating current flow through the diode 120 to thus deenergize the relay and the pump motor . current flow through the resistance 124 raises the voltage on the non - inverting input of amplifier 112 so that the panel temperature must drop to the lower temperature near freezing in order to turn - on the pump . in a specific example of the modification of fig4 the components identified by the same number have the same value as in the example for fig2 while the amplifiers 84 and 112 are respective amplifiers on a type 1558 integrated circuit . the capacitance 118 and resistances 114 , 116 and 122 have values equal to the capacitance 92 and resistances 86 , 88 and 95 , respectively . values of resistance 119 range from 3 . 3m to 3 . 9m ohm to produce turn - off panel temperatures from 5 ° c . to 2 . 8 ° c . values of resistance 124 from 1 . 8m to 3 . 0m ohm result in a turn - on temperature about 3 . 3 ° c . to 2 . 2 ° c . below turn - off . a high limit cut - off for preventing operation of the circulation pump when the water temperature in the tank becomes excessively high can be provided by additions to the circuitry within the dashed line 110 of fig2 as shown in the modification of fig5 . the additions include an operational amplifier or comparator 130 which has its inverting input connected to the junction 48 and its non - inverting input connected to a junction between resistances 132 and 134 , the resistance 132 being connected to the common terminal 50 while the resistance 134 is connected in series with a resistance 136 to the positive voltage terminal 72 . a resistance 138 has been inserted between the output of the amplifier 84 and the diode 94 with a bias resistance 139 connected between the anode of the diode 94 and the positive voltage node 72 . the output of the amplifier 130 is connected to the anode of a diode 140 which has its cathode connected to the junction 142 between the resistance 138 and the diode 94 to form a gate circuit . a bias resistance 144 is connected between the junction 50 and the output of the amplifier 140 . connected between the output of the amplifier 130 and the non - inverting input of the amplifier 130 is a resistance 146 which has a value selected to produce a desired difference between the turn - on and turn - off temperatures of the amplifier 130 . also the anode of the diode 94 is connected to the non - inverting input of an operational amplifier 148 which has its inverting input connected to the junction between resistances 134 and 136 and has its output connected to lead 93 . the relative values of the resistances 134 and 136 are selected to hold the inverting input of the amplifier 148 negative relative to the non - inverting input of amplifier 148 when either of the amplifiers 84 and 130 produce a positive output , and to allow the non - inverting input of amplifier 148 to become negative relative to the inverting input of amplifier 148 only when the outputs of both amplifiers are negative . in operation of the modification of fig5 when the temperature in the tank 22 , fig1 reaches a high limit , the resistance of the tank sensor 46 drops to a level which renders the terminal 48 negative relative to the junction between the resistances 132 and 134 . the output of the amplifier 130 is driven positive which drives junciton 142 positive through diode 140 . due to the resistance 138 the junction 142 is maintained positive by the positive current flow through diode 140 even if the output of the amplifier 84 becomes negative due to the solar panel reaching a temperature greater than the tank temperature by more than the predetermined differential . also when the output of the amplifier 130 goes positive , current through the resistance 146 drives the non - inverting input of the amplifier 130 still more positive relative to the inverting input thereof ; thus the temperature to which the tank must drop to render the output of amplifier 130 negative is substantially below the temperature which caused the amplifier to produce a positive output . after such a drop in temperature , the resistance of the sensor 46 increases sufficiently to raise the voltage on terminal 48 and to render the inverting input of the amplifier 130 positive with respect to the non - inverting input thereof causing the output of the amplifier 130 to go negative and render the diode 140 non - conductive ; thus the amplifier 84 is permitted to control the amplifier 148 in response to the temperature differential between the tank and panel . the amplifier 148 controls lead 93 , the relay and pump motor in the same manner as previously described in connection with the output of amplifier 84 in the circuit of fig2 . the use of the high limit comparator prevents the water in the tank from exceeding a set high limit . in a specific example of the circuit of fig5 values of components with the same number are the same as in the previous examples while amplifier 84 is a type # 741 integrated circuit and amplifiers 130 and 148 are formed by a type # 1558 integrated circuit . resistance 144 is the same value as resistance 95 . resistances 134 , 136 , 138 and 139 have the values 56 . 2k ohm , 10k ohm , 22k ohm and 4 . 7k ohm , respectively . values of resistance 132 between 7 . 6k and 16 . 9k result in a high limit turn - off in the range from 93 . 3 ° c . to 71 ° c . while values of resistance 146 between 1 . 5m ohm to 324k ohm produce turn - on temperatures from 1 . 1 ° c . to 5 . 6 ° c . below turn - off . the low limit turn - on circuitry of fig4 can be added to the modification of fig5 to produce a combined circuit as shown in fig6 having both a low limit turn - on and high limit turn - off of the water circulation pump . the anode of the diode 120 is connected between the junction of the resistance 139 and the diode 94 ; otherwise the low limit amplifier 112 and the associated resistances , capacitance and diode are connected in the circuit in the same manner as herein before described in connection with fig4 . turn - on , i . e . the output of amplifier 148 being rendered low , occurs when either of the outputs of the amplifiers 84 or 112 become low in response to a differential temperature between the solar panel and the tank exceeding the predetermined differential temperature or the panel temperature dropping near freezing temperature ; the high limit amplifier 130 goes high when the tank temperature reaches the high limit temperature to prevent turn - on of the circulation pump from the operation of the differential comparator 84 . in a further modification illustrated in fig7 the low limit circuitry is converted from a low limit turn - on to a low limit turn - off by reversing the inputs to the operational amplifier 112 and by reversing the polarity of the diode 120 . also the values of the resistances 119 and 124 are changed to raise the temperature at which the output of the operational amplifier 112 is operated to a temperature below which the temperature of the solar panel is inadequate to heat the water . when the temperature of the solar panel drops below this inadequate temperature the output of the operational amplifier 112 becomes positive applying current through diode 120 to maintain the noninverting input of the amplifier 148 positive preventing operation of the water circulation pump . this conserves energy by not operating the water circulation pump when the temperature of the solar panel is not adequate to heat the water . as an example of the changes , values of resistance 119 between 732k ohm and 1 . 18m ohm produce turn - off temperature responses from 37 . 8 ° c . to 26 . 7 ° c ., and values of resistance 124 from 7 . 87m ohm to 3 . 32m ohm result in turn - on between 1 . 7 ° c . and 4 . 4 ° c . below turn - off . the employment of the particular bridge circuit for sensing temperature differential , i . e . the panel sensor 44 and tank sensor 46 in respective bridge arms joined at one d . c . voltage node , permits a wide range of modifications with a minimum number of cirucit changes and additions . it is noted that the low level protection circuits of fig4 and 7 and the high level protection circuits of fig5 and 7 are added without the necessity of adding additional temperature sensors . the use of the two resistances 74 and 76 in one arm of a bridge used for differential sensing at relatively high levels allows the connection of one resistance 74 in a second bridge circuit for low level sensing ; thus the single panel sensor 44 can be used in two different ranges , namely the high temperature range sensed by the differential comparator 84 where the resistance of sensor 44 is relatively low and the low temperature range sensed by the low limit comparator 112 where the resistance of sensor 44 is relatively high . further this particular bridge cirucit permits the series circuit of the resistances 80 and 78 and tank sensor 46 with parallel resistance 82 to be used with the further voltage dividing circuit of resistances 132 , 134 and 136 to operate the high limit comparator 130 in still another range , the high temperature range of the tank sensor 46 . it is also noted that in the circuit the low limit comparator 112 is responsive only to the panel sensor 44 and the high limit comparator 130 is responsive only to the tank sensor 46 ; thus the low limit response is independent of tank sensor 46 and high limit response is independent of panel sensor 44 . the illustrated circuit further is such that it can be manufactured in its several modifications utilizing the same printed circuit board ; thus separate printed circuit boards do not have to be made or stocked for the different modifications . this is illustrated in fig8 and 9 which show the connection of an integrated circuit ic1 ( type # 741 ) in a circuit pattern in fig8 to form the amplifier 84 of fig2 and the connection of an integrated circuit ic1 ( type # 1558 ) to the same circuit pattern in fig9 to form the amplifiers 84 and 112 of fig4 . the circuit pattern has a circuit conductor 152 which branches into branches 153 and 154 used in the pattern shown in fig8 ; the branch 154 is cut at 155 from the circuit path 152 in the modification of fig9 . similarly a circuit conductor 157 has branches 158 and 159 ; the branch 158 severed by cut 160 from the conductor 157 in fig8 while the branch 159 is severed by a cut from the conductor 157 in fig9 . the employment of a conductor with several branches or interconnections one or more of which are selectively cut to from a desired modification substantially reduces the cost of making , handling and stocking printed circuit patterns for different modifications of the circuit . the use of the printed circuit pattern for both the low limit turn - on and the low limit turn - off conditions is illustrated in fig1 and 11 wherein the terminal or conductor 52 has alternate resistance lead receiving openings 164 and 166 , the terminal of conductor 97 has alternate resistive lead receiving openings 168 and 170 , the branch 159 has alternate resistance lead receiving openings 172 and 174 and alternate capacitance lead receiving openings 176 and 178 , and a conductor 180 has alternate lead receiving openings 182 and 184 . as shown in fig1 for the low limit turn - on , the openings 164 and 172 are aligned so that they receive the leads of the resistor 116 , the openings 168 and 184 are aligned so that they receive the leads of the resistor 114 , and the openings 176 and 182 are aligned so that they receive the leads of the capacitance 118 . as shown in fig1 for limit turn - off the openings 166 and 182 are aligned so that they receive the leads of the resistance 116 , the openings 170 and 174 are aligned so that they receive the leads of the resistance 114 , and the openings 178 and 184 are aligned so that they receive the leads of the capacitance 118 . it is noted that the opening 116 is aligned with the openings 176 and 182 on the same side of the opening 182 as opening 176 but spaced further from the opening 182 than the opening 176 and similarly the opening 168 is aligned with the opening 178 but spaced further apart from opening 184 . this use of the same printed circuit pattern for different circuits is made possible by the use of alternate lead receiving openings in a first conductor aligned with respective lead receiving openings in second and third conductors so that an element or elements can be alternately connected between the first conductor and the second and third conductors . further the use of the openings 166 and 168 spaced further from the respective openings 182 and 184 than the openings 176 and 178 allows the use of longer and shorter components to be inserted in the openings conserving space and making alternate use of the printed circuit pattern feasible . a controlled oscillator circuit shown in fig1 can be used to energize the triac 54 instead of the relay ( winding 57 and contacts 56 of fig2 ), such relay and the resistance 58 being eliminated in this alternative . the diodes 94 and 120 have their cathodes connected to the respective amplifiers 84 and 112 and their anodes connected to one end of a resistance 186 which has its other end connected to the inverting input of the operational amplifier 188 . the cathode of the diode 140 from the amplifier 130 is connected to the non - inverting input of the amplifier 188 . feedback resistors 190 and 192 are connected from the output of the amplifier 188 back to the inverting and non - inverting inputs thereof respectively , while a capacitance 94 is coupled from the non - inverting input of the amplifier 188 to the negative voltage terminal 50 . a resistance 196 is coupled between the inverting input of the amplifier 188 and the positive voltage terminal 72 . the output of the amplifier 188 is coupled to the base of a transistor amplifier 198 by a coupling capacitance 200 . a protective diode 202 is coupled across the base and emitter terminals of the transistor 198 and a protective resistance 204 is coupled in series with the collector terminal of the transistor 198 and the primary winding of a transformer 206 which has its secondary winding coupled at points 208 and 210 , fig2 across the control electrode and one output electrode of the triac 54 . the resistances 190 , 192 and 196 and the capacitance 194 are selected to produce an oscillation of the output of the amplifier 188 at a frequency which is sufficiently high to trigger the triac 54 at the beginning of each cycle of the a . c . power signal . in operation of the oscillator excitation circuit of fig1 , the oscillator 188 is allowed to freely oscillate whenever the outputs of either of the amplifiers 84 and 112 are low providing the output of the amplifier 130 is also low . a positive voltage on the output of the amplifier 130 indicating the tank temperature is at the high limit prevents oscillation of the amplifier 188 . in particular when the junction of the anodes of the diodes 94 and 120 is held negative by either one or both of the outputs of the amplifiers 84 and 112 being negative , the inverting input of the amplifier 188 is free to be changed by the feedback voltage through resistance 190 ; and when the output of the amplifier 130 is low the non - inverting input of the amplifier 188 is free to be changed by feedback through the resistance 192 . the output of the amplifier 188 drives the transistor 198 which in turn produces an alternating current through the primary of the transformer 206 energizing the secondary winding to render the triac 54 conductive . for an example of suitable circuit oscillator components , the amplifier 188 is a type # 741 , the resistors 186 , 190 , 192 and 196 have equal values of 10k ohm , the resistor 204 is a 120 ohm resistance , the transistor 198 is a type 2n3642 , the capacitors 194 and 200 have values of 0 . 047 mfd . and 0 . 001 mfd . respectively , and the transformer 206 is a bpmc 4259 - 0003 transformer . a variation of the solar heating system as illustrated in fig1 includes an overheat limit unit 222 which has four internal connections to junctions 72 , 50 , 48 and 42 of the controller circuit unit 36 . a terminal 224 of the unit 222 is connected to one side of the winding a solenoid valve 226 ; the other side of the solenoid winding is connected to terminal 34 of unit 36 . the solenoid valve is a normally closed valve connected in a discharge outlet 228 for the closed tank 22 which has an inlet connected to a pressurized water supply 230 . the circuitry in the unit 222 shown in fig1 includes resistances 234 and 236 connected in a voltage divider circuit across the d . c . voltage nodes 72 and 50 in parallel with the power inputs of an operational amplifier 238 . the amplifier 238 has its non - inverting input connected to the junction between resistances 234 and 236 and has its inverting input connected to junction 48 between the tank temperature sensor 44 and the resistance 74 . a positive feedback resistance 242 is connected between the output of the amplifier 238 and its input . connected between the output of the amplifier 238 and the negative voltage node 50 is a winding 244 of a reed relay with a protective diode 246 connected across the winding 244 . contacts 248 of the relay are connected in series with a resistance 250 between the junction 42 and the control electrode of a triac 252 which has its power electrodes connected between the terminals 42 and 224 . a false trigger preventing circuit including a series resistance 254 and capacitance 256 is connected across the triac 254 . in operation of the solar heating system with the overheat limit unit 222 of fig1 and 14 , an overheat limit temperature in the tank 22 causes the unit 222 to open valve 226 and discharge hot water from the tank 22 . cold water from the supply 230 is thus allowed to flow into the tank 22 cooling the tank water to a turn - off temperature which is a predetermined amount below the overheat temperature . more particularly , the increase in temperature to the overheat limit results in the resistance of the sensor 44 dropping to a value where the voltage on junction 48 goes negative relative to the voltage between resistances 234 and 236 . this drives the output of amplifier 238 high energizing winging 244 to close contacts 248 and excite triac 252 to complete a circuit with the a . c . source 38 and the winding of the solenoid valve 226 . positive feedback through resistance 242 causes the turn - on of the valve 226 at a higher tank temperature than the turn - off temperature when sufficient cold water has entered the tank . an example of components suitable for the variation of fig1 include a type # 741 integrated circuit for amplifier 238 , 17 . 8k ohm resistor for resistance 234 , a 2k ohm resistor for resistance 236 , a 150k ohm resistor for resistance 242 , 82 ohm resistors for resistances 250 and 254 , and a 0 . 1 mfd . capacitor for capacitance 256 . another variation , illustrated in fig1 , of the solar heating system has a sun switch 270 connected across terminals 48 and 50 in parallel with the panel temperature sensor 44 which is located in the outlet of the solar panel 20 rather than directly in the panel 20 . the sun switch 270 is illustrated as being mounted on the back of the solar panel so as not to be exposed to direct rays from the sun but rather to be exposed to indirect light . included in the switch 270 as shown in fig1 is a light sensing npn transistor 272 suitably exposed to ambient light and which is connected in series with a load resistance 274 between the terminal 50 and a junction 273 ; the emitter of the transistor 272 being connected to the junction with terminal 50 . a transient suppressing filter capacitance 276 is connected across the transistor 272 . both inputs of a nand gate 278 , i . e . a logic gate wherein the output is low or negative only when both inputs are high or positive , are connected to the collector of transistor 272 . a feedback bias junction between resistances 280 and 282 , which are serially connected between the output of gate 278 and junction 50 , is connected to the base of the transistor 272 . the output of the gate 278 is connected to one input of a nand gate 284 which has an output connected to both inputs of a nand gate 286 with one side of a capacitance 292 connected to the output of gate 286 and with resistances 288 and 290 connected from the other side of capacitance 292 to the output and other input , respectively , of the gate 284 ; the gate 284 and 286 together with the resistances 288 and 292 and the capacitance 292 form a square wave oscillator . the output of gate 284 is connected to the counting input of a counter , such as a multistage binary counter 294 , which has one output , such as a higher stage output , connected by a resistance 296 to the base input of darlington transistor 298 which is coupled in series with a resistance 300 to a junction between one end of a resistance 301 and the cathode of a diode 302 . the other end of the resistance 301 is connected to the junction 273 while the anode of the diode 302 is connected to the terminal 48 . the values of the resistance 301 and other components connected to junction 273 are selected to avoid significant loading between terminals 48 and 50 in the absence of conduction of transistor 298 . a zener diode 303 and parallel filter capacitance 305 are coupled across the junctions 273 and 50 to filter the voltage on terminal 273 and prevent any excess voltage . the resistance 300 has a value to decrease the resistance of parallel connected sensor 44 to a value indicating a substantially elevated temperature , but has a value less than that which would render the voltage on terminal 273 insufficient to operate the circuitry connected thereto . a filter circuit , including a capacitance 304 with one side connected to the output of gate 286 , a resistance 306 connected between the other side of capacitance 304 and the negative junction 50 , a diode 308 having its anode connected to the junction between capacitance 304 and resistance 306 , and a capacitance 310 coupled between the cathode of diode 312 and junction 50 , is coupled by a nand gate 312 to the reset input of the counter 294 . one input of gate 312 is connected to the cathode of diode 308 while the other input of gate 312 is connected to the positive junction 273 . conveniently the nand gates 278 , 284 , 286 and 312 are respective gates of a guad nand gate integrated circuit which has power inputs coupled across the junctions 50 and 273 . the power inputs to the counter 294 are similarly connected across the junctions 50 and 273 . in operation of the variation of fig1 when the light is sufficient to indicate substantially full sunlight conditions , the sun switch cycles on and off to alternately trigger the controller unit 36 to periodically operate the motor 30 and the pump 28 . this periodic operation of the controller unit 36 occurs when the temperature of the sensor 44 is below a cutoff temperature for the sun switch 270 but sufficiently near to the required temperature differential above tank temperature . during the periodic operation , fluid from the solar panel 20 flows over the sensor 44 ; thus the sensor 44 senses the true panel temperature instead of only the temperature in the outlet which can be much lower . referring to fig1 indirect sunlight on the transistor 272 renders the transistor 272 conductive which in turn lowers both inputs of gate 278 producing a high output which is fed back through resistance 280 to further increase the conductivity and provide a difference between the light intensity at which transistor 272 is rendered conductive and the light intensity at which the transistor 272 switches to the non - conductive state . the high output of gate 278 enables gate 284 initially producing a low output on gate 284 which in turn switches the output of gate 286 high . the charge on capacitance 292 momentarily holds the other input of gate 284 high until the charge is dissipated by current flow through resistance 288 to result in switching of the gates 284 and 286 into opposite states where they are again momentarily held by the charge on the capacitance 292 . thus the gates 284 and 286 oscillate and produce a square wave output which is filtered and detected by the capacitance 304 , resistance 306 , diode 308 and capacitance 310 to drive and hold the output of gate 312 and reset input of counter 294 low . with the reset input low , the counter 294 continuously counts the square wave pulses from gate 284 . when a count is reached at which the output stage connected to resistance 296 is rendered high , the darlington transistor 298 becomes conductive to connect the resistance 300 across terminals 48 and 50 ; thus the resistance sensed by the unit 36 between terminals 48 and 50 will correspond to a substantially higher temperature of the sensor 44 . if this increased apparent panel temperature is sufficiently high , it will turn the controller on to operate the motor 30 and pump 28 in the same manner as decribed hereinabove in connection to operation when the sensed panel temperature exceeds the tank temperture by a predetermined differential . thus where the temperature sensed by sensor 44 is a few degrees less than the true solar panel temperature which is at of near to being sufficient to turn the controller on , the flow of fluid from the panel 20 increases the temperature of the senser to the true panel temperature . after a period of time determined by the period of oscillation and the selected output stage of counter 294 , the transistor 298 is rendered non - conductive to remove the resistance 300 from the circuitry . periodic operation of the transistor 298 continues so long as the voltage on line 273 is maintained sufficient to operate the gates and counter 294 and there is sufficient sunlight . in the absence of sufficient sunlight , the input of gate 278 is high rendering gate 284 and the square wave oscillator inoperative . this produces a low on one input of gate 312 which applies a high to the reset input to counter 294 holding the counter 294 in its reset state with all outputs low . when the temperature sensed by the sensor 44 reaches a relatively high level , its resistance drops to lower the voltage across terminals 48 and 50 to a level insufficient to operate the sun switch 270 . thus where the temperature of the fluid in the solar panel is relatively high the sun switch 270 is effectively removed from the circuit and does not significantly effect the operation of the controller unit 36 . the diode 302 prevents damage in the event of a reversed connection of the sun switch 270 to the terminals 48 and 50 . in a specific example , the nand gates 278 , 284 , 286 and 312 are a type cd4011ae cmos quad nand integrated circuit , the counter 294 is a type # cd4020ae cmos 14 stage ripple counter , the transistor 272 is type # l14h2 , and the darlington transistor 298 is type # d16p1 . the resistances 274 , 280 , 282 , 288 , 290 , 306 , 296 , 300 and 301 are 10 m ohm , 10 m ohm , 680 k ohm , 12 m ohm , 22 m ohm , 1 m ohm , 4 . 7 m ohm , 12 k ohm and 1 m ohm resistors , respectively . the capacitances 276 , 292 , 304 , 305 and 310 are 0 . 01 mfd ., 0 . 01 mfd ., 0 . 047 mfd ., 100 mfd . and 0 . 001 mfd . capacitors , respectively . the resistance 296 is connected to stage 13 of the counter 294 . when operative the square wave oscillator has a period of about 150 milliseconds and the transistor 298 is periodically turned on for about 10 minutes and then off for about 10 minutes . the apparent increase in the temperature sensed by sensor 44 when the resistance 300 of the above example is connected there across by the conduction of transistor 298 is illustrated by the curve 320 in fig1 . above 71 ° c . ( 160 ° f .) the voltage on junction 273 is insufficient to operate the sun switch . the period of the square wave oscillator can be increased by increasing the value of capacitance 292 ; for example a capacitance 292 of 1 . 0 mfd . in the above example would increase the period to 1 . 5 seconds . thus a counter 294 with fewer stages could be used . since many modifications , variations and changes in detail may be made to the above described enbodiment , it is intended that all matter in the foregoing description and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense .	5
fig1 is a block diagram of an example microcontroller with a quadrature decoder ( qdec ) and a pulse width modulator ( pwm ) module connected as a peripheral of a microprocessor core located in the microcontroller . in this example configuration the qdec is included in a microcontroller . the qdec , however , can be used in any type of integrated circuit ( ic ) device . to control a motor ( e . g ., speed , position ), a control application generates signals to create the rotation of the motor and receives and processes signals generated by a rotary sensor module mounted on the shaft of the motor . this rotary sensor produces electrical signals that enable the motor control logic circuitry to be aware of the rotation , speed and direction of the motor . this feedback circuitry allows operation of the motor in a closed loop system for accurate speed and positioning of the motor . the feedback circuitry processing these signals is often a standard microcontroller . the microcontroller can include a peripheral module ( e . g ., a pwm module ) to generate the signals used to operate rotation of the motor . the signals from the microcontroller can be amplified ( e . g ., voltage , current ) by means of power transistors ( e . g ., mosfet power transistors ) or any other power transistors , prior to driving the coils of the motors . the signals generating the rotation are well known in the art and will not be discussed further in this document . the feedback signals from the rotary sensor are usually not directly processed by the microprocessor module of the microcontroller but rather are processed by a peripheral module ( e . g ., a qdec ), which performs filtering and analysis . this method is generally the only way to process these signals in a real time manner without requiring too much power ( e . g ., very high clock frequency ) for the microprocessor core . increasing power by adding additional circuitry would make the bill of materials of the control application too expensive for volume production . referring to fig1 , the microcontroller 100 comprises a microprocessor 101 capable of accessing peripheral circuitries like pwm module 105 and “ timer + qdec ” quadrature decoder 106 . data exchanges are performed by means of the system bus 120 , which comprises ( not shown ) a read data bus carrying data from peripherals to microprocessor 101 , a write data bus carrying data from microprocessor 101 to peripherals , an address bus and control signals to indicate transfer direction on system bus 120 . since the address bus of the system bus 120 is shared by all peripherals there is a need to decode the value carried on this bus to select one peripheral at a time . a circuitry 102 acts as an address decoder by receiving the address bus ( part of system bus 120 ) and provides select signals 121 , 122 , 123 , 124 . peripheral circuits 103 , 104 , 105 , 106 read these select signals to take into account values carried on system bus 120 . on - chip memories 103 store the application software to be processed by microprocessor 101 . the microcontroller 100 is powered by means of a different set of terminals 140 . terminals 140 comprise a series of physical access terminals ( pads ) to power the microcontroller 100 , some for providing vdd , some for providing gnd . a user application runs software , which may be loaded within on - chip memories 103 during the startup of the microcontroller ( boot section ). the software located within on - chip memory 103 is fetched by microprocessor 101 by means of system bus 120 . the on - chip memory 103 is selected ( e . g ., signal 123 is active ) as soon as the address value of the address bus matches the address range allocated for the on - chip memory . the address decoder 102 is designed accordingly , the address range being hard - wired in the address decoder . as a response , the memory provides the corresponding data onto system bus 120 which is read by microprocessor 101 and processed accordingly . the software may also be aware of the availability of a data through the interrupt signal 125 . when set , this signal triggers interrupt module 104 . then the interrupt controller 104 signals the event directly to a dedicated pin of the microprocessor 101 . a central interrupt module allows any number of interrupts to be handled by a single input pin on the microprocessor 101 . when the microprocessor 101 is triggered by the interrupt signal , its internal state machine interrupts the processing of the current task and performs a read access on the interrupt controller 104 by means of system bus 120 to get the source ( peripheral ) of interrupt . the microcontroller 100 supervises the control of an electrical motor 150 . to get feedback information , a rotary sensor 160 is mounted on shaft 161 . to create the rotation , the pwm module 105 generates a set of signals 132 . the rotation is detected by rotary sensor 160 , which creates electrical signals 133 and 134 according to the speed of the motor . the amplification of signals 132 in order to match the voltage requirements of the motor , and amplification of signals 133 , 134 to adapt the microcontroller 100 voltage levels and the power supply circuitries of rotary sensor are well known and therefore not described in this document . several types of rotary sensors exist but they basically provide the same type of electrical signals . if only one signal is provided there is no way to determine the rotation direction . some sensors provide two electrical signals aligned in quadrature . this quadrature alignment , after processing ( decoding ) provides the direction of rotation . fig2 and 3 illustrate output waveforms 200 , 201 of a rotary sensor aligned in quadrature . in this example , the output waveform 200 corresponds to the waveform of signal 133 of fig1 and the output waveform 201 corresponds to the waveform of signal 134 of fig1 . quadrature alignment allows easy detection of the direction of rotation using simple circuitry . depending on the value sampled by the rising edge of signal 133 ( waveform 200 ) on signal 134 ( waveform 201 ) the rotation is determined . the rising edge of waveform 200 may capture either a logical “ 0 ” or “ 1 ” on signal 201 . a direction change event can also be declared as soon as two consecutive edges on one of the quadrature signals occurs without any change on the other quadrature signal . the waveforms 200 , 201 shown in fig3 can be easily determined when one knows how the sensor generating the waveforms 200 , 201 is built . an optical disk is often mounted on the shaft of a motor . the optical disk contains a series of reflective bars . a light emitting diode ( led ) generates a light beam which bounces on the disk or not and is detected by a receiving diode circuitry ( e . g ., an amplifier , filter , level shifter ) to provide the waveform 200 . in a quadrature sensor interface , at least two series of reflective bars are printed in quadrature and two led emitters / receivers are mounted to provide the quadrature waveforms 200 , 201 . the same result can be obtained by a series of holes within the disk , so that the light source is transmitted to the receiver or not , thus creating the same waveforms 200 , 201 as reflective bars method . the more bars on a disk , the more accuracy the sensor provides for rotation at lower speed . the speed can be calculated by differentiating the accumulated number of received pulses . a time base is generated , providing sampling points . for each sampling point , the counter is first stored in a register and then cleared ; otherwise , the pulses are counted . the register contains an image of the speed of rotation . in practice , however , the optical disk may not be as clean . dust particles and scratches may be located on the disk . therefore , the output signal from the rotary sensor may be corrupted due to dust particles and scratches , which can cause spurious pulses in the signal generated by the rotary sensor . these spurious signals can be misread by downstream circuitry as , for example , a direction change in rotation of the motor shaft . fig4 illustrates spurious pulses in sensor output waveforms 200 , 201 due to light reflective and light absorbing dust . depending on the nature of the dust , the light can be absorbed or reflected , resulting in a glitch in the waveforms 200 , 201 that can be positive or negative . fig5 is a schematic diagram of a circuit that overcomes spurious pulses resulting from dust or scratches located on an optical disk . referring to the left - hand portion of the circuit , the pha input signal is generated by the rotary sensor and is first sampled on the system clock (“ clock ”) signal of filtering synchronous logic . because the pha signal is asynchronous , a proper synchronization circuit can be a dual stage flip - flop ( dff ). but for simplicity only one dff 500 is described in the circuitry shown . the signal 520 (“ pha ”) is therefore synchronous of “ clock .” dff 501 samples the signal 520 and both dff 500 and dff 501 outputs are compared by means of xnor gate 502 . the output 522 of xnor gate 502 is high ( logical “ 1 ”) when there is no difference between the outputs 520 and 521 . the output 522 drives a series of and gates 505 , where one input of each and gate of the series is connected to output 522 . as soon as output 522 is cleared , i . e ., there is an edge on input pha , the outputs of the series of and gates 505 are cleared . therefore , one “ clock ” cycle later , the signal 524 “ count ” has cleared its current value . when pha input is stable , two “ clock ” cycles after output 522 is high ( logical “ 0 ”), the series of and gates 505 acts as transparent cells because 1 and x results in x ( x representing logical 1 or 0 ). signal 524 feeds incrementor 503 , comparator 504 and a series of 2 to 1 multiplexers 507 . the incrementor 503 provides on its output the input value + 1 . the current value 524 is compared with a maximum value “ max ” which can be driven by a configuration register accessible from a software user interface . this value modifies the filtering feature of the circuitry . for simplicity , we will assume a constant value of 4 . just after being cleared , the value 524 is lower than 4 , as a consequence the signal 523 is cleared and multiplexers 507 copy , respectively , on their outputs , their inputs driven by the output of incrementor 503 , so 1 is loaded on outputs of “ count signal 524 . and so on up to 4 . when 524 reaches 4 , the output of the comparator 504 is set and multiplexers 507 copy , respectively , on their outputs , their inputs driven by signal 524 , the “ count ” value is held . the output of comparator 504 is also driving two - input and gate 509 . the second input is driven by output 522 . if the “ count ” value is 4 and “ pha ” input is stable , true when output 522 is set , the output of and gate 509 is high . when high , the 2 to 1 multiplexer 508 copies signal 521 on its output , therefore dff 510 loads an image of the input value “ pha ” on signal 525 ; otherwise , dff 510 and multiplexer 508 re - circulates the data 525 . both cells ( multiplexer 509 and dff 510 ) constitute a sample and hold function . as a consequence , if “ pha ” is not stable for more than 4 clock cycles , “ pha ” is not copied on output 525 . the filter circuitry described in fig5 delays the output by 4 clock cycles compared to the input pha . fig6 illustrates the waveforms of the circuitry of fig5 . the circuitry shown in fig5 can be found on many existing integrated circuits because it prevents false detection of direction changes in rotation . a spurious pulse locally looks like a direction change ( refer to fig4 ). if this circuitry is efficiently filtering spurious pulses introduced by dusts located on the disk , the circuitry cannot efficiently filter the noise introduced by large dust particles or scratches because a scratch may cover several reflective bars . if the filtering capability ( e . g ., the “ max ” value of the circuitry of fig5 ) is increased , then correct pulses from the reflective bars may be filtered , resulting in no rotation detection . so another technique and circuitry is needed for large dust particles and scratches . such circuitry can be located downstream compared to the previously described filtering circuitry shown in fig5 . fig7 shows a change in rotation followed by a quadrature signal error due to dust that masks a reflective bar . even if there is a condition of change at the time the quadrature error occurs ( e . g ., two edges of one signal while the other remains at the same logical value ), one can see that there is no change in the quadrature signals alignment just before and just after the dust masking ( e . g ., the rising edge of signal 200 samples a logical ‘ 1 ’ on 201 just before the dust masking but also just after ). thus declaring a rotation change when the quadrature error occurs may lead to unpredictable behavior of the logic downstream . of course this situation can be also found without any dust or scratch , if the motor is started in one direction then stopped , direction reverted for one reflective bar , then reverted again and so on . but it is unlikely to occur for a normal mode of operation , especially when the motor is powered in one direction for several rounds or several seconds ( e . g ., hundreds or thousands of rounds ). the method and circuitry described below in reference to fig8 and 9 detects errors in a quadrature signal , and corrects missing pulses in the quadrature signal . the method is based on consecutive edges counting on one quadrature signal while the other quadrature signal is constant . the determination of direction change or a missing pulse will depend on events of the constant signal and count value ( odd , even ). the correction of missing pulses will also depend on count value . to calculate speed and position , the edges of signals 200 and 201 are counted . fig8 is schematic diagram of example quadrature decoder filter circuitry for detecting errors in a quadrature signal , and for correcting missing pulses in the quadrature signal . the circuitry of fig8 can be connected downstream to the filtering circuitry described in fig5 or coupled directly to rotary sensor outputs . for simplicity , fig8 shows the circuitry coupled directly to rotary sensor outputs ( pha , phb ). fig8 describes circuitry to detect and correct a missing pulse on phb using an edge of pha . the same circuit can be used for detecting and correcting a missing pulse on pha using an edge of phb . part of the logic can be shared between these two circuitries . in practice the circuitry shown in fig8 can be duplicated to process the input signal pha in the same manner as input signal phb is processed , as described below . referring now to fig8 with reference to the waveforms of fig9 , because the signals pha and phb are asynchronous to the synchronous logic system clock (“ clock ”), the signals pha and phb are first sampled using , respectively , dff 600 and dff 606 . to detect the rising or falling edges in a synchronous way , the outputs of dff 600 and dff 606 are sampled again using respectively dff 601 and dff 607 . when the input pha switches from 0 to 1 or 1 to 0 , the output value of dff 600 differs from output value of dff 601 for one clock cycle . this difference is detected by means of xor gate 602 generating a logical “ 1 ” on signal 652 each time a difference occurs between dff 600 and dff 601 . the same structure is located on phb path , with xor gate 608 generating a logical “ 1 ” on signal 657 , so that a difference exists between the output of dff 606 and the output of dff 607 . a difference is detected as soon as a rising edge or a falling edge occurs on pha or phb . therefore , cells 601 and 602 act as an edge detector for input pha and cells 607 and 608 act as an edge detector for input phb . let &# 39 ; s now assume there is a direction change in rotation and two consecutive edges of pha occurs without any change on phb . the edge detection of pha , signal 652 , drives the select input of 2 to 1 multiplexer 603 so that when there is an edge detected on pha ( signal 652 is high ), the multiplexer 603 selects the input driven by signal 655 . signal 655 is an image of phb input . when there is no more edge on pha , two clock cycles later the signal 652 is cleared and multiplexor 603 selects the input driven by the output of dff 604 . therefore , dff 604 stores the value of phb when an edge occurs on pha . so for any pha edge , the value of phb during the previous pha edge is available by reading dff 604 output . a matching circuit , for example , xnor gate 605 receives output of dff 604 and signal 655 ( image of phb ) and drives a 1 on signal 653 when both inputs are equal . this is the case when two consecutive edges of pha samples the same value on phb , so when a possible direction change occurred . signal 653 also drives two - input and gate 618 . the other input is driven by signal 652 , which corresponds to the detection of any pha edge . the output of the and gate is set when there are two consecutive edges of pha sampling the same value on phb . this result drives a series of multiplexers 615 which select the output of incrementor 614 when output of and gate 618 is high . when the and gate 618 output is 0 , the set of multiplexers 615 copy the other input driven by the output of dff 617 , thus re - circulating the data ( hold function ), if the set of and gate 616 acts as transparent ( e . g ., the output of two - input nand gate 613 is high ). the incrementor 614 is driven by the output of the series of dff 617 . therefore if dff 617 is carrying 0 , incrementor output will be 1 , and this value will be loaded by dff 617 because nand gate 613 is driven by the output of bit wise or gate 612 . the bit wise or gate 612 receives all outputs of the set of dff 617 and makes an or between all these bits resulting in logical “ 1 ” on its output when signal 658 differs from 0 . when 0 , the nand gate 613 drives a 1 on its output . therefore , the set of and gate is transparent and signal 658 is incremented . so cells 614 to 617 form a counter that counts the number of times two consecutive edges on pha samples the same data on phb . the direction change detection logic ( not shown ) does not declare a change direction at this time ( when signal 658 changes from 0 to 1 ). when signal 658 is 1 , if an edge occurs on phb , the signal 657 is set and bitwise or gate 612 is 1 because signal 658 differs from 0 ( the lsb of signal 658 is set ); therefore nand gate 613 output is 0 . this value clears the outputs of and gates 616 , therefore clearing the dff 617 output and signal 658 . the direction change detection logic ( not shown ) can declare a direction change by using the output of nand 613 ( e . g ., signal 658 equals 1 and output of nand 613 is 1 ). let &# 39 ; s now assume , there is a scratch or big dust on phb reflective bars of the optical disk on signal 654 . there are missing pulses on signal 657 due to this noise . therefore , the counter made of cells 614 to 617 counts up to the next edge of phb as described in reference to the previous figures . when the counter increments from 1 to 2 ( refer to waveforms on fig9 ), there is an edge on pha but at this time the output of comparator 619 is 0 because signal 658 is still 1 ( just switching to 2 ). comparator 619 drives a 1 on its output when the value of signal 658 is strictly greater than 1 . when signal 658 is 2 and edge occurs again on pha , then there is a quadrature error and direction change is not the root cause ; therefore there is a missing pulse and no edge can be detected without correction . when signal 658 is 2 and an edge occurs on pha , signal 652 is set , therefore two - input and gate 620 drives a 1 on input of dff 621 and also two - input or gate 622 . the output of or gate 622 is high . therefore , a 1 is propagated to output 659 through two - input or gate 623 . if synchronous counter logic is placed downstream signal 659 , it will increment by one whereas phb input has no edge . correction is active but since a complete pulse was lost , 2 edges are missing . the edge on pha results on a 1 - clock cycle pulse on signal 652 . this is sampled by dff 621 and its output is high the next clock cycle and for 1 clock cycle . the dff 621 driving the output of or gate 622 , there is a 1 on this output for one more clock cycle , therefore propagating to output signal 659 . then for each missing pulse on phb , any pulse on pha creates a two - clock cycle pulse duration on signal 659 . therefore , if downstream logic is a synchronous counter it will increment by two , which corrects the missing edge of phb . depending on the counter value one can also determine if the direction change occurred at the time missing edges are detected . if the counter value 658 is odd and there is an edge detected on signal 654 ( e . g ., signal 657 equals 1 ) then we have also a direction change . if the counter value is even , then only missing edges are detected and also corrected . while this document contains many specific implementation details , these should not be construed as limitations on the scope what may be claimed , but rather as descriptions of features that may be specific to particular embodiments . certain features that are described in this specification in the context of separate embodiments can also be implemented in combination in a single embodiment . conversely , various features that are described in the context of a single embodiment can also be implemented in multiple embodiments separately or in any suitable subcombination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a subcombination or variation of a subcombination .	7
fig4 a ) shows a conventional photosensitive system including a gated photodiode 400 . the diode 400 is formed on a p + - type substrate 402 in which a p − type epitaxial layer 404 is formed , which embeds an n - well 408 including a highly doped n + region 406 acting as a cathode . the photodiode 400 comprises a field plate 410 that covers the perimeter of the photodiode 400 and that is separated from the impurity regions in the substrate including the p - n junction between the n - well 408 and the epitaxial layer 404 by a gate dielectric 412 , e . g . a suitable gate oxide . the field plate 410 is connected to a fixed potential source , i . e . ground in fig4 a . the highly doped n + cathode region 406 is conductively connected to a buffer 420 , which may be implemented in any suitable manner , e . g . as a differential amplifier having one of its inputs connected to the cathode of the photodiode 400 and the other of its inputs connected to its output , i . e . connected to a feedback loop . as indicated in fig4 a ), this arrangement has the consequence of the presence of several parasitic capacitances , such as the parasitic capacitance formed by the field plate 410 and the n - well 408 as the opposite plate separated from each other by the gate dielectric 412 , and the parasitic capacitance between the n - well 408 and the p - type epitaxial layer 404 . as previously explained , the overall parasitic capacitance , i . e . the sum of all individual capacitances , is dominated by the parasitic capacitance formed by the field plate 410 and the n - well 408 as the opposite plate separated from each other by the gate dielectric 412 . hence , the neutralization of this dominant parasitic capacitance would significantly improve the sensitivity of the photosensitive system shown in fig4 a . fig4 b ) shows an exemplary embodiment of a photosensitive system of the present invention . the system is essentially the same as the system shown in fig4 a ) apart from the fact that the field plate 410 is biased by a conductive connection 422 to the output of the buffer 420 . this conductive connection 422 effectively provides a loopback from the output of the buffer to its input via the field plate 410 , which has the effect that the bias difference between the cathode 406 and the gate of the photodiode 400 remains constant , such that the dominant contribution of the aforementioned dominant capacitance is effectively removed . more precisely , in such an arrangement , the field plate bias will follow the bias of the cathode 406 of the photodiode 400 . as is well known , the bias of the gate 408 should preferably be chosen such that the underlying silicon region having the lowest impurity concentration , e . g . the p − epitaxial region 404 , is in weak accumulation , such that the leakage current from the diode 400 is minimized . consequently , a photosensitive system , e . g . a pixel , can be achieved that has a large area yet has a low leakage current combined with a much improved sensitivity . it is important to realize that the photosensitive system shown in fig4 b ) can be realized using conventional processing technologies , in particular cmos technologies . this means that the photosensitive system can be realized in an affordable manner , whilst being able to compete in terms of sensitivity with the much more complex avalanche photodiode - based systems . it is furthermore pointed out that fig4 b ) shows a non - limiting example of such a system . many adaptations of the system will be apparent to the skilled person . for instance , although the buffer 420 is shown as a differential amplifier , it will be clear to the skilled person that other types of buffers are equally feasible , such as the combination of a reset transistor and a source following transistor as shown in fig1 a ). also , the skilled person will realize that the conductive connection 422 between the output of the buffer 420 and the field plate 410 may be a direct connection , or alternatively may contain additional circuit elements such as a further buffer 430 , which also may be any suitable type of buffer . the skilled person will furthermore realize that the photodiode 400 may be implemented in any suitable manner , and is not limited to the specific layout shown in this figure . also , the use of impurity types opposite to those shown in fig4 b is equally feasible . the photosensitive system shown in fig4 b ) or equivalents thereof may be advantageously integrated in any device that benefits from the improved sensitivity of the photosensitive system of the present invention . in particular , such benefits are expected to occur in devices in which the electromagnetic radiation levels are very low , e . g . a few photons only . although this may apply to a large number of application domains , one particular application domain that is targeted by the present invention is medical devices . there is for instance a large interest into disposable medical devices that can be used by the patient or medical staff for diagnostic purposes , in which e . g . an assay is provided that generates photonic emissions at levels correlated to a diagnostic parameter , such as blood clotting , i . e . hemostasis , parameters , by means of e . g . fluorescence or chemo - luminescence . the photosensitive system of the present invention is particularly suitable for integration into a small form - factor lab - on - a - card type device , such as a biochip for measuring hemostasis . it should be noted that the above - mentioned embodiments illustrate rather than limit the invention , and that those skilled in the art will be able to design many alternative embodiments without departing from the scope of the appended claims . in the claims , any reference signs placed between parentheses shall not be construed as limiting the claim . the word “ comprising ” does not exclude the presence of elements or steps other than those listed in a claim . the word “ a ” or “ an ” preceding an element does not exclude the presence of a plurality of such elements . the invention can be implemented by means of hardware comprising several distinct elements . in the device claim enumerating several means , several of these means can be embodied by one and the same item of hardware . the mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage .	7
fig1 is a cross - sectional representation of the rotor blade 10 having a deformable leading edge 20 . as shown in this figure , rotor blade 10 is additionally provided with a central supporting d - spar 12 and a trailing edge 14 . the deformable leading edge has an overlying compliant cover having an upper portion 22 , a lower portion 23 , the upper and lower portions being joined at a central forward portion 25 . fig2 is a cross - sectional representation of deformation arrangement 20 of rotor blade 10 , the deformation arrangement being enlarged to show structural details . the overlying deformable cover has been removed in this figure . as shown in fig2 , d - spar 12 has attached thereto a support 30 having a pivot 32 to which is attached a rotatory element 40 that it is rotatable about pivot 32 in the direction arrows 41 and 42 . rotatory element to 40 has integrally form therewith an arm portion 44 to which it is attached a coupler portion 45 . rotatory element 40 it is rotatable in response to the longitudinal motion of a cam bar 60 . the cam bar is supported by a cam system support 50 having a cam bar support portion 52 . in this figure , cam bar 60 is movable longitudinally in and out of the plane of the drawing . fig3 is an isometric representation of a portion of the deformation arrangement 20 of rotor blade 10 of fig1 . elements of structure that have previously been described are similarly designated . in this figure , the overlying deformable cover is not shown for sake of clarity . in addition , rotatable element 40 is not shown , but there are shown cams 47 a and 47 b that are attached to the rotatable element via needle bearings 48 a and 48 b that facilitate the rotation of the cams . cams 47 a and 47 b are shown to be engaged in a slot 62 of cam bar 60 . the cams , as will hereinafter be described , are fixed longitudinally in longitudinal relation to longitudinal axis 11 of rotor blade 10 , and therefore , as cam bar 60 is displaced in the direction of arrow 61 , the cams are displaced transversely in the direction of arrow 49 . fig4 is an isometric representation of a portion of the deformation arrangement of rotor blade 10 of fig1 with the overlying deformable cover having been removed . elements of structure that have previously been described are similarly designated . this figure shows that as cam bar 60 is urged in the direction of arrow 61 , rotatory element 40 is rotated about pivot 32 in the direction of arrow 42 . thus , arm portion 44 and coupler portion 45 are moved downward . conversely , when cam bar 60 is urged in a direction opposite to that indicated by arrow 61 , rotatory element 40 is rotated in a direction opposite to that indicated by arrow 42 , and coupler portion 45 is correspondingly urged upward . fig5 is a cross - sectional representation of the deformation arrangement of rotor blade 10 of fig1 . elements of structure that have previously been described are similarly designated . in this figure , the deformable cover is installed to form the leading edge of rotor blade 10 . the deformable cover consists of an upper portion 22 and a lower portion 23 that are joined together at a frontal portion 25 . upper portion 22 is a fixedly coupled to d - spar 12 at coupling juncture 77 . lower portion 23 , however , is slidably coupled to d - spar 12 at sliding juncture 78 . there are additionally shown in this figure web structures 71 and 72 ( shown in cross - section ) that are coupled at respective upper ends to upper portion 22 of the deformable cover , and at lower ends of thereof to lower portion 23 at a juncture 75 of a drive link 74 . drive link 74 is shown to be coupled to coupler portion 45 of rotatory element 40 . as cam bar 60 is urged a longitudinally along cam bar support portion 52 , rotatory element 40 it is rotated , as hereinabove described , whereupon coupler portion 45 of the rotatory element urges drive link 74 upward and downward . fig6 is a cross - sectional representation of the deformation arrangement of rotor blade 10 of fig1 showing the deformable portion of rotor blade 10 in a slightly upward orientation . in this representation , cam bar 60 has been urged into the plane of the figure ( i . e ., opposite to the direction indicated by arrow 61 of fig3 ) whereby arm portion 44 and coupler portion 45 are urged upward . this results in forward portion 25 of the overlying compliant cover to be raised in the direction of arrow 65 . fig7 is a cross - sectional representation of the deformation arrangement of rotor blade 10 of fig1 showing the deformable portion of rotor blade 10 in a slightly downward orientation . elements of structure that have previously been discussed are similarly designated . in the orientation of elements indicated by this figure , cam bar 60 has been urged out of the plane of the figure ( i . e ., in the direction indicated by arrow 61 of fig3 ) whereby arm portion 44 and coupler portion 45 are urged downward . this results in forward portion 25 of the overlying compliant cover to be lowered in the direction of arrow 66 . with reference to fig6 and 7 , it is seen that deformation arrangement 20 is deformable in relation to the motion of cam bar 60 to achieve a compliant structure leading edge for the rotor blade of a helicopter ( not shown ). more specifically , and as noted herein , deformation arrangement 20 modifies the baseline air foil aspects of high performance rotor blade 10 airfoil to provide 0 to 10 of flap motion for an 8 . 5 % chord flap . the flap can be actuated at rates exceeding 7 hz to provide flap positioning once during each revolution . at the 10 position , the shape of the flap allows the airfoil to generate additional lift at higher angles of attack compared to the baseline ( no flap ) airfoil . in the practice of the invention , the compliant leading edge flap provides up to a 35 % increase in retreating blade lift with no stall and no negative hysteresis in lift , pitching moment , and drag . this technology has the capability to increase the combination of top speed , maximum payload , and altitude capability of all rotorcraft . fig8 is a perspective representation of a model segment the deformation arrangement of rotor blade 10 of fig1 , in disassembled condition . elements of structure that have previously been discussed are similarly designated , and the overlying compliant cover is not shown in this figure . as can readily be seen in this figure , rotatory element 40 is , in this specific illustrative embodiment of the invention , longitudinally elongated and continuous . similarly , arm portion 44 and coupler portion 45 are coextensive therewith in this embodiment . also in this figure , cams 47 a and 47 b are shown to depend from the underside of rotatory element 40 and are coupled thereto via respectively associated ones of needle bearings 48 a and 48 b . the cams 47 a and 47 b are arranged to engage with slots 62 of cam bar 60 , which is disassembled from d - spar 12 in this figure so that the structure of cam bar 60 within cam bar support portion 52 of cam system support 50 can be illustrated . fig9 is a diagram that illustrates the three - dimensional , time - varying loading that is experienced by leading edge flap 70 . as shown in this figure , the leading edge flap system consists of a suitable actuation system ( not shown ), an optional actuator transmission ( not shown ) ( to convert push - pull motion appropriate for the flap mechanism ) via actuator push rod 72 , and a compliant structure flap 74 that must undergo the required shape change while resisting pressure loads and acceleration forces and accommodating flex in primary d - spar 76 . the flexure of d - spar 76 is represented in the drawing by outline 77 . this requirement to change shape occurs at moderate speed ( 7 hz ) and thus the loads and boundary conditions will change in at least this rate ( higher harmonics are possible ). note that mechanism dynamics will also need to be considered when actuation occurs at these speeds . centrifugal force in this specific illustrative embodiment of the invention , is directed as indicated by arrow 78 . high performance materials for compliant structures primarily include materials with a high modulus and high strain capacity that directly translates to materials with high strength limits , and particularly fatigue strength . high strength titanium alloys and carbon fiber reinforced polymers ( cfrp ) represent preferred high performance materials , especially in embodiments of the invention wherein weight is a factor . given the 4500 hour blade operating requirement of a commercial helicopter rotorcraft , if the flap runs continuously at 7 hz , the flap will be subjected to just over 110 million cycles over its lifetime . applying a fatigue safety factor of 2 would require the structure to survive roughly 220 million cycles . a readily available titanium alloy , ti - 6a1 - 4v , has a yield strength of 880 mpa and a 10 7 fatigue cycle strength of 510 mpa . additionally , other titanium alloys that might increase static and fatigue strength include a ti - i ov - 2fe - 3a1 that is possessed of superior static and fatigue strength . this alloy has a yield strength of 174 ksi ( 1200 mpa ) and a 145 ksi ( 1000 mpa ) 1e6 cycle fatigue strength that extrapolates to a 75 ksi ( 517 mpa ) fatigue strength at 220 million cycles . at a 7 hz sinusoidal operation , the lower translating joint topology optimized design requires a maximum of 0 . 127 hp / fl ( 310 watts / m ) peak power per unit length . if 6 . 7 ft ( 2 m ) of the rotor blade has an adaptive structure leading edge flap , the compliant leading edge requires 0 . 85 hp or 621 watts peak power to drive the entire flap ( the average cyclic power would be much lower ). this required peak power is only 5 % below the maximum rated power output capability of the aerotech blumuc - 79 linear electromagnetic motor , which achieves a maximum of 0 . 87 hp or 650 watts for a 6 . 22 in ( 158 mm ) long actuator . note that the power analysis is conservative ( no frictional forces ) such that the average total power is zero if one integrates over one complete cycle . frictional forces will cause power losses during operation of the flap , so a slightly larger ( longer , more powerful stator ) may be required to provide additional actuator power . the 1000 g loading was originally estimated from a 20 ft blade radius spinning at 7 hz rotation rate . in order to develop a more accurate acceleration value , the rotor diameter and tip speeds for a range of military helicopters are shown in table 1 , which illustrates three different helicopter models that encompass a range of lift and speed performance . based on the data for a range of high speed transport , fighter ( ground support ) and heavy lift helicopters , the inventors herein have determined that the maximum tip acceleration should be reduced slightly to 800gs to represent a more maneuverable , higher disk loading helicopter like the cobra . detailed ( continuum ) three - dimensional simulation of the leading edge structure was reexamined to assess the stresses / strains in an individual compliant rib due to pressure loading and centrifugal loading . an equivalent stress plot is shown in fig9 of the model in the 0 and 10 flap position , with maximum pressure load and 800 g lateral acceleration . one method of actuating the leading edge flap is to provide longitudinal motion along the rotor blade span using a push rod ( or a rod in constant tension ). this method allows an actuator to be located inboard away from high centrifugal force locations . while investigating various actuation strategies , the motion of the actuator ( linear , rotary , or other ) along with the system packaging must be considered in order to develop an appropriate method for coupling the motion of the actuator together with the compliant structure . ideally , the location of the actuator helps leverage ( or increase the stiffness of ) the leading edge system as much as possible . this may be required in order to maintain a high structural stiffness and integrity ( with respect to any undesirable aero - elastic phenomenon such as a critical divergence or shape change due to aerodynamic pressure loads ). the actuator characteristics can then be input into the compliant mechanism design algorithms to optimize the system performance . information and data of ( a ) rotary actuators , ( b ) linear actuators , ( c ) with or without a speed reduction transmission , ( d ) embedded actuation concept , and ( e ) alternative actuation schemes has been compiled . the ultimate actuator choice depends on many factors including : reliability / durability , force / displacement required to drive the compliant le , need for a transmission system , packaging , weight ( including drive electronics ) and power capability . different solutions may exist due to the specific consideration ( criterion ) and trade - offs . power density ( power per weight , power per volume , power per span ) is one important factor for selecting actuators . but other factors must be considered to determine whether an actuator is feasible for the application . all actuators studied are subjected to dimension restrictions necessitated by the small space available at the leading edge . according to the power density data , the ultrasonic rotary motor and linear inchworm actuator can be ruled out because with required size , they cannot generate enough power to actuate the leading edge system . moreover , the life of ultrasonic rotary motors is typically less than 2000 hours and is much too short for deformable rotor blade applications . also , the operating temperature of linear inchworm actuators is very limited ( due to thermal expansion and tolerancing issues ) and could not cover the possible temperature ranges of the helicopters . linear electromagnetic actuators , voice coil actuators and piezoelectric actuators all generate linear output motion ; however , output forces and output displacements of these actuators are dramatically different . piezoelectric actuators are compact and generate very large forces , but the output displacement is on the order of microns . efficient amplification mechanisms are needed to enlarge the output motion and trade force for displacement ( power losses will be created due to the amplification mechanism ). voice coil actuators can generate significantly larger displacement than piezoelectric actuators ; however , the output force is much smaller . linear electromagnetic actuators can generate moderate output forces and large output displacements . however , the size of the linear electromagnetic actuators may be prohibitive for use in the leading edge flap application ( slightly smaller motors may be fabricated ). rotary dc motors are compact and powerful enough to meet the application needs . small brushless dc motors and their accessories are commercially available , and proven to operate continuously for up to 20 , 000 hours . because of continuous rotational motion , they generate less vibration and are easy to control . the space available within the leading edge is extremely tight , such that careful system packaging and component selection will be necessary to develop a compact enough transmission that enables high power efficiency and capacity to handle the roughly 700 watts of power ( at 7 hz ). in addition , the shape change performed by the flap further reduces the available space for actuation components . fig1 is a representation of a cad model of leading edge flap and d - spar . the transmission system must transform the linear actuation motion to rotary motion to drive the flap position . the preferred method is to develop a cam and wedge system to perform the linear to rotational transformation . tight space constraints and high power requirements dictate careful selection of components to develop a durable system . bearings are selected to maintain compact and high load carrying capacity ( static and dynamic ). bending , shear , and contact stresses for the cam - roller system are estimated using strength of materials and hertzian stress calculation approaches . all highly loaded components are fabricated from precision - ground , hardened steel to meet static and cyclic strength requirements . the cam - wedge system is tailored to provide the correct mechanical advantage given the actuation system characteristics to optimize the force / velocity operating conditions of the linear actuation system . currently , the wedge system is designed with a 4 slope , which requires a 943 n ( 212 ib ) maximum force requirement from the actuation system for a 2 meter span flap ( static force calculation at 10 deflection and maximum pressure loading ). the linear actuation travel to move the flap 0 to 10 is 3 . 0 inches (± 1 . 5 inches ) requiring a maximum actuation velocity of 1 . 68 m / s ( 66 . 0 mis )— assuming a sinusoidal displacement profile . this peak velocity of 1 . 68 mis is well within the terminal velocity capability of the linear motor system , which is approximately 17 . 8 mis ( 700 mis ). fig1 is a simplified schematic representation of cam wedge system 80 that is designed so that only one of dual cam rollers 82 is loaded for a particular flap moment loading ( positive or negative ). the cam system is also designed to provide smooth , low friction motion of the tension rod ( linear actuation system ) and flap rotary motion by avoiding sliding surfaces and providing pure rolling motion , via linear slide bearings 84 for flap movement . as shown , rotary flap motion is , in this illustration , shown to be rotationally displaced by a wedge angle 86 having a value é . linear motion is , in this embodiment , directed as indicated by arrow 88 , and rotary flap motion is indicated by arrows 89 . currently the bearing - shaft system has been sized to handle the flap maximum moment loading of i6 in - lb per inch span of flap ( 1260 in - lb for a 79 inch flap span ) and the wedge system is designed to provide the total 0 . 38 radians of rotational motion ( 21 . 77 ) at the base of the arm ( not shown ) that drives the compliant structure . fig1 is a simplified schematic representation of a rotor blade 100 , that illustrates the layout of actuator 104 and representative length scale with respect to the rotor blade span . rotor blade 100 is shown in this figure to have actuator 104 coupled via a balancing spring 106 and a tension rod 108 to a cam system 110 that converts linear to rotary motion , which is applied to compliant flap 109 . the actuator is configured in this embodiment to produce motion in accordance with arrow 111 . centrifugal force is shown to be in the direction of arrow 112 , toward rotor blade tip 114 . the hub of the rotor blade is designated as 116 . given the cad and finite element models , one can extract the key mass and stiffness values for the flap system . the table below outlines key values for the features present in the flap model . fig1 is a simplified schematic representation of a modified flap - actuator 130 . elements of structure that have previously been discussed are similarly designated in this figure . actuator 104 is coupled via a tuning spring 132 to tension rod 133 . as compared to the embodiment of fig1 , the embodiment of fig1 has a redirection pulley 134 that is coupled to a second tension rod 136 . tension rod 136 has , in this embodiment , a balancing weight 138 affixed thereto distal from redirection pulley 134 . the modification represented in fig1 is generates a steady offset of the centrifugal force without requiring a heavy and stiff balancing spring . since the no - flap zone in the last 10 % of the rotor blade span and because of the high g loading here , a relatively small mass can be used to generate a balancing force to compensate for the centrifugal force , which is reversed in part by redirection pulley 134 , which in some embodiments is configured as a rack and pinion ( not shown ) or as a pulley system . the linear tuning spring of the present embodiment has much more freedom to be “ stiffness tuned ” to minimize the impedance of the system at the desired operational frequency . in this manner , actuator force amplitude is reduced . also , since the tuning linear spring is softer than a balancing spring , the actuator offset force can be significantly reduced . analysis of the packaging space within the leading edge reveals that there is room to place the second thin tension rod 136 , which may be configured in some embodiments to have ˜ ⅛ cross - sectional diameter , and yet will have adequate strength and stiffness to support the balancing mass 138 located at rotor tip 114 . of course , balancing mass 138 adds additional weight and complexity to the system , but this additional weight is likely to be significantly less than the added mass of some 12 heavy - duty helical tension balancing springs . as shown in fig1 , the linear actuator is located near hub 116 of the rotor blade , thereby isolating the actuator from high centrifugal loading . the linear actuator will transmit power to the leading edge flap using a tension rod where maximum stiffness of the transmission is obtained using a carbon fiber rod in tension / compression rather than torsion or bending ( higher structural efficiency ). a balancing spring will compensate for centrifugal loading acting on the tension rod . the linear actuator motion will be transferred to rotary motion to drive the main rotary link using a cam - type system designed to be very compact , lightweight and stiff in the rotary direction . along the flap span , there will be cam stations at intervals . spacing should be determined based on component space , the mechanical advantage of the cam system ( stroke of the tension rod versus rotation of the drive link ), and the stiffness and allowable drag ( damping ) of the cam system . it is an important aspect of the tension rod approach of the present invention that the actuation rod is always in tension . as such , therefore , the actuation force constitutes but a reduction in the tension in such an embodiment . this approach to the design of the system avoids buckling of the actuation rod , as would be the case with compression . for the modified flap system , the instantaneous peak actuator power is reduced to 885 watts compared to the previous design that had a peak actuator power of 2250 watts . it is to be noted that the actuator force offset is negative (− 120 . 25 lb ) illustrating the need to apply negative ( inward ) actuator force in order for the flap to sit at a + 5 offset ( neutral position ). because of the frictional characteristic of the bearings and due to the proximity of the forced frequency to the first natural frequency , the force tends to spike and shift between sinusoidal amplitudes . the linearized friction characteristic has the effect of slightly changing the natural frequency of the system as the velocity vector changes . given the actuator force and power requirements , a linear electromagnetic motor from anorad ( rockwell automation ) lc - 50 - 300 and aerotech lmx - 382 linear actuator will satisfy the force requirements . the lc - 50 - 300 motor has a theoretical peak power of 4420 watts and the lmx - 282 motor has a theoretical peak power of 2263 watts . these actuators are larger than the originally specified aerotech blmu - 79 that has a peak power output of 660 watts but its force limited for this application ( peak force is 29 . 2 lb ). in this particular case , the force requirement of 150 lb peak force dictates the actuator size . a much smaller actuator could be utilized if the safety feature — providing 0 flap position when the actuator is disabled — is not needed ( dictates the − 120 . 25 lb steady state force to pull the flap to the 5 position ). the anorad linear motor displays a more compact , lighter design that can satisfy the force requirements ( higher power density than a comparable aerotech actuator ). the dimensions and weight of this actuator are : 2 . 12 ″× 3 . 15 ″× 15 ″ and would weigh 15 . 5 lb ( 9 . 8 lbm is included in the dynamic analysis as the stator mass ). inboard mounting of the actuator would require a local bulge in the airfoil to accommodate the added volume forward of the d - spar . for further study , an electro - mechanical system analysis of the linear actuator could be used to detail the required operating voltages and currents . given the tight space constraints , high power requirements , and the limitations associated with selecting off - the - shelf bearings , shafting , etc . the leading edge spar was moved backward an additional 0 . 097 inches pushing the d - spar back to 9 . 0 %. bearings were selected to support the cam - wedge loads while operating ( rolling ) for the 220e6 cycles . bending , shear , and contact stresses for the cam - roller system are estimated using strength of materials and hertzian stress calculation approaches . currently , the maximum contact stress is 301 , 511 psi (˜ 2 gpa ) for the cams at the 10 flap position with maximum pressure loading . there are a few specialty carburized and hardened steels that can meet these very high contact stress values . fig1 is a cad model of an improved leading edge flap cam wedge system and d - spar . fig1 is a representation of a sample wire edm titanium rib 160 depicted in relation to a measuring ruler ( not specifically designated ). as shown , titanium rib 160 has a cross - sectional length of approximately 3 . fig1 ( a ) and 16 ( b ) show a prototype model 170 of the present invention in 0 and 10 positions , respectively . fig1 is a block diagram of the design optimization procedure of the present invention . as shown in this figure , the content of a function block 471 is used to commence the design process . this includes determination of the design specifications , which include determination of the : ( 6 ) lower and upper bounds on dimensions of beams ( depending on the choice of manufacturing method ); and at function block 473 , the following determinations are made : ( 1 ) create a network of beam elements to fit within the available space with certain nominal cross sectional dimensions ; ( 3 ) define boundary conditions — that is , identify nodes that should remain fixed to the ground , nodes where the actuator exerts input force and nodes on the boundary representing the outer surface of the shape to be morphed . the figure shows function blocks 471 and 473 to direct the process to function block 475 . at function block 475 , there is performed the optimization procedure objective function , specifically : ( 2 ) minimize the actuator force required to cause desired shape change against external resistive load ; and ( 3 ) minimize the overall weight of the system subject to various constraints such as maximum allowable stress , buckling load , fatigue stress , minimum and maximum dimensions of the beam elements , etc . the process of design optimization then flows from function block 475 to function block 477 , wherein , when the optimization process converges , cross - sections of certain beams approach zero leaving on a sub - set of beam elements necessary to meet the design specifications . this establishes the topology , size arid geometry of the compliant mechanism . fig1 ( a ), 18 ( b ), and 18 ( c ) are simplified schematic representations of a layered structure arrangement 200 that is provided with web - like structures 202 that are , in this specific illustrative embodiment of the invention , bonded to compliant skin 210 , which will be described in greater detail in connection with fig1 ( b ) and 18 ( c ) , below . referring to fig1 ( a ) , layered structure arrangement 200 is shown to be provided with a drive bar 204 that applies a linear force against rear wing spar 206 by operation of an actuator 208 . the motion of drive bar 204 is transmitted to a compliant skin 210 , the motion of the compliant skin being accommodated by a sliding joint 214 that in some embodiments of the invention may be configured as an elastomer panel ( not shown ). fig1 ( b ) is a representation of compliant skin 210 that is formed , in this specific illustrative embodiment of the invention , of a variable thickness core 210 ( a ). alternatively , fig1 ( c ) shows compliant skin 210 to be a multiple - ply composite laminate 210 ( b ) wherein the plies are staggered to facilitate control over thickness . as shown , the composite laminate plies are bonded to each other with a laminating adhesive 211 . the composite layers are configured from the standpoint of ply orientation , fiber weave , selection of adhesive , etc . the achieve a desired compliant structure stiffness and strength . fig1 is a simplified schematic representation of layered structure arrangement 230 , without the web - like structures described in fig1 ( a ) . elements of structure that have previously been discussed are similarly designated in this figure . fig2 is a simplified schematic representation of the layered structure arrangement 250 with a tailored ” core structure 252 , illustratively formed of a cellular material . core structure 252 is , in this specific illustrative embodiment of the invention , configured to have a high stiffness characteristic in the substantially vertical direction indicated by arrow 256 , and a low stiffness characteristic in the substantially horizontal direction indicated by arrows 258 . fig2 is a simplified schematic representation of a fixed - fixed arrangement 270 wherein inward motion of lower surface 272 effects a change in the shape of the flap . in this embodiment , two actuators 276 and 278 are coupled by respectively associated ones of antagonistic drive cables 277 and 279 , to respectively associated ones of trailing edge tip spars 281 and 282 . in some embodiments , drive cables 277 and 279 may be replaced with rods ( not shown ). tip spars 281 and 282 are configured to slip against each other at sliding joint 285 . fig2 is a simplified schematic representation of a standard airfoil 300 having a variable thickness surface perimeter 302 to permit “ tailoring ” of the perimeter stiffness to achieve a best match for a desired contour . when actuator 305 is operated toward inward motion as indicated by the direction of arrow 307 , the contour of variable thickness surface perimeter 302 is urged into the configuration represented in phantom and designated as 309 . in this embodiment , there is no sliding joint or elastomer surface on either the top or bottom surface , thus it is termed a “ fixed - fixed ” configuration . fig2 is a simplified schematic representation of a standard airfoil 320 having a variable thickness surface perimeter 322 that permits “ tailoring ” of the perimeter stiffness to achieve a best match for a desired contour . that is , the varying wing thickness allows the perimeter stiffness to be “ tailored ” to facilitate the design of an advantageous contour characteristic . thinning of the airfoil is effected by causing actuators 326 and 328 to pull inward in the direction of the arrows . fig2 is a simplified schematic representation of airfoil 320 that has been “ thinned ” by operation of the actuators , as discussed hereinabove in relation to fig2 . fig2 is a simplified schematic representation of a standard airfoil 320 wherein the actuators 326 and 328 urge a thickening of the airfoil , in the direction of the arrows . fig2 is a simplified schematic representation of the standard airfoil of fig2 , showing the airfoil in thickened condition . fig2 is a simplified schematic representation of a variable thickness airfoil 350 that is actuated , in this specific illustrative embodiment of the invention , by compliant mechanisms 352 and 354 . by operation of actuators 356 and 358 , the airfoil is either thickened , as represented by contour 360 , or thinned , as represented by contour 362 . although the invention has been described in terms of specific embodiments and applications , persons skilled in the art can , in light of this teaching , generate additional embodiments without exceeding the scope or departing from the spirit of the invention herein described and claimed . accordingly , it is to be understood that the drawing and description in this disclosure are proffered to facilitate comprehension of the invention , and should not be construed to limit the scope thereof .	8
referring now to the drawings , fig1 and 2 depict a chip 10 with pads 12 designed in accordance with known techniques . attached to each pad 12 is a wire bond 14 and wire 16 that electrically connects pad 12 to a lead frame or chip carrier ( not shown ). in the past , in order to probe pads 12 , the wire bond 14 and wire 16 were required to be removed with a polishing mechanism or other technique in order to provide enough surface area to allow a probe to contact pad 12 . as noted above , this requirement represents a limitation . in particular , by disconnecting wires 16 from pads 12 , the package is no longer in a usable state and package defects can no longer be isolated from ic defects . thus , under existing techniques , it was impossible to exercise the ic to full application specifications for diagnostics and fault localization . referring now to fig3 and 4 , a novel pad 24 is depicted that provides a pad extension 26 that allows the pad 24 to be probed without first removing the wire 22 and / or wire bond 20 . as can be seen in fig4 a probe tip 28 can be placed in contact with the pad extension 26 in order to effectuate a test without removing wire bond 20 or wire 22 . in this embodiment , the pad extensions 26 extend between the pads and are about ¼ the size of the pad 24 . typical pads are 100 mm by 100 mm and include a pitch of about 200 mm . therefore , the extensions are approximately 50 mm by 50 mm . it is conceivable that the pad extensions 26 could be 10 mm by 10 mm , or smaller , so long as the probe tips could be manufactured to contact the pad extensions . thus , the actual size of the pad and pad extensions will generally be dictated by the need to maneuver between the wires extending from the balls as shown in fig4 . referring now to fig5 and 6 , two alternate embodiments of the present invention are depicted on chip 30 and chip 34 , respectively . fig5 shows probe pads 32 arranged in a ring inside of the wire bond pads 37 and electrically connected by lands 33 . fig6 depicts probe pads 36 that are arranged in a ring outside of the wire bond pads 39 and connected by lands 35 . because the lands 33 and 35 need only be about 20 mm wide , these arrangements present no additional chip size requirement . the embodiments depicted in fig5 and 6 , which neatly organize the probe pads on the chip , are particularly suited for chips that require a large number of probes . fig7 - 11 depict additional embodiments of the present invention . for example , fig7 depicts a chip 41 that includes pad extensions 38 extending towards an interior portion of the chip and include corner pads 29 with pad extensions 40 that are also offset towards the center of the chip 41 . fig8 depicts a chip 42 with pad extensions 44 that extend towards an exterior portion of the chip 42 . fig9 depicts a chip 46 with pads that include two pad extensions 48 and 50 that extend both toward and away from the center of the chip 46 . fig1 depicts a chip 52 that includes pad extensions 54 that are bent to extend in two directions . fig1 depicts a chip 56 having pad extensions 58 that extend from a center portion of a pad 59 toward an exterior portion of the chip 56 . as is evident from these embodiments , any number of alternative designs are possible and are considered to be within the scope of this invention . the placement of the pad extensions may be in part influenced by the type of probing system used to perform failure analysis . for example , probing may be performed with a group of single probes on a probe station or with a probe ring on a tester , voltage contrast tool , or any other analytical equipment . certain configurations may be particularly suited for use with a probe ring , while others may be better suited for single probe usage . in the preferred embodiment of the present invention the entire wire bond pad is created within a single layer of the integrated circuit device during the fabrication process . in this manner , no additional cost or processes are added to the manufacturing of the chip in order to add this additional functionality . thus , the wire bond pad will be formed with a first area for receiving the wire bond , and a second area for receiving the probe , wherein the first and second area will be integrally formed substantially simultaneously during the fabrication process . the implementation of the pad extension is therefore accomplished during the same fabrication step as the pad itself . accordingly , the only alteration necessary during the fabrication process may be a modification to the mask used to define the pad configuration on the layer at which the pads reside . the remaining fabrication steps ( e . g ., applying photoresist , developing photoresist , and the etching process ) need not be altered . in addition , a novel method for performing failure analysis on the integrated circuit after packaging is completed and a fault is detected , is described . referring to fig1 , an integrated circuit device is depicted that includes a chip 61 and lead frame 63 . chip 61 includes pads 68 each having a wire bond 66 and wire 64 that electrically connects chip 61 to lead frame 63 . in accordance with this invention , pad extensions 69 are also included to facilitate in the testing process . during the packaging process , chip 61 and the associated electrical connections are encapsulated in a insulative material 60 and 62 that entirely surrounds the chip 58 . during the failure analysis procedure , a first portion 60 of the encapsulation material is removed . the removal of the encapsulation may be done with any known method , including the use of nitric acid . as can be seen , a second portion 62 of the encapsulation material is left intact . once the first portion 60 of the encapsulation material is removed , probing of the system , using probe extensions 69 can occur without removing wire bond 66 or wire 64 from the pad 68 . in addition to the example depicted in fig1 , it is understood that this technique could be used for the testing of any wire bonded system , including the case where a chip is wire bonded directly to a circuit board . in addition to the failure analysis application described herein , it is understood that the testing or probing procedures may be performed on the chip after the wire bond has been formed but prior to the encapsulation process . thus , the probe extensions could be used as a mechanism for testing the chip prior to final packaging . referring to fig1 and 14 , a probe ring 70 is depicted . the probe ring includes a plurality of probes 76 that contact pad extensions 74 on the chip 72 . in general , the probes are configured in a circular fashion around and above the chip 72 . generally , each pad on the chip 72 will have a probe in contact therewith for isolating faults . while the invention has been described in detail herein in accordance with certain preferred embodiments thereof , many modifications and changes therein may be affected by those skilled in the art . accordingly , it is intended by the appended claims to proper all such modifications and changes as fall within the true spirit and scope of the invention .	7
fig1 shows a section of a linear motor assembly 1 , which in the illustrated embodiment comprises several stator segments 10 , 20 lined up along a movement path 2 , at least one conveying means 3 movable along the movement path 2 relative to the stator segments 10 , 20 , as well as control units 4 , 5 assigned to the stator segments 10 , 20 for the provision of electric energy and a controlling device 6 for the provision of control signals to the control units 4 , 5 . each of the stator segments 10 , 20 comprises several solenoids not shown in the drawing , which are arranged side by side , in particular adjoining one another , along the movement path and which are electrically and mechanically accommodated in the respective stator segments 10 , 20 . the solenoids are , for example , designed such that turn planes of windings of the solenoids are oriented parallel to a section of the movement path 2 and at right angles to a representation plane of fig1 to 8 . the solenoids are further electrically connected to one another in such a way that all solenoids of a stator segment 10 , 20 can be simultaneously supplied with electric energy , in particular with a common electric voltage , and that adjacent solenoids emit mutually opposing magnetic fields . this can , for example , be achieved by opposite electric polarity of adjacent solenoids or by opposite winding of adjacent solenoids . by applying an alternating electric current to the solenoids of the respective stator segments 10 , 20 , a magnetic travelling field can be generated , which moves in the direction of the movement path 2 and results in the provision of a propulsive force acting on the conveying means 3 by interacting with a permanent magnet arrangement 8 on the conveying means 3 . the speed of movement of the conveying means 3 is determined by a frequency of the magnetic travelling field . in the illustrated embodiment , the permanent magnet arrangement 8 on the conveying means 3 comprises four rectangular bar magnets 9 , the largest dimension of which extends normal to the representation plane of fig1 to 8 and which are lined up along the movement path 2 . the bar magnets 9 are arranged such that adjacent bar magnets 9 have opposite polarities . as a result , mutually opposite magnetic field lines emerge from the end faces of the bar magnets 9 , which are visible in fig1 to 8 . in the illustrated embodiment , a magnetic action centre 11 is drawn in the geometrical centre of the permanent magnet arrangement 8 ; this symbolises the point where the magnetic field lines of the bar magnets 9 can be combined to form a model . this magnetic action centre 11 is in particular taken into account in the determination of the phase angle for applying an electric current to the stator segments 10 , 20 . the controlling device 6 is designed for providing electric energy to the first stator segment 10 under open - loop control . the first stator segment 10 is preferably supplied with an electric ac voltage , the frequency of which is presettable and can be adapted to different operating conditions of the first stator segment 10 . the amplitude of the electric ac voltage , which determines the flow of current through the solenoids of the first stator segment 10 , can also be adjusted using a presettable value . in the illustrated embodiment , however , a control of the amplitude of the electric ac voltage is in particular provided by monitoring the current flowing through the solenoids for the first stator segment 10 . the second stator segment 20 differs from the first stator segment 10 by a position sensing system 9 , which is electrically connected to the controlling device 6 and which generates a position signal as a function of the position of the conveying means 3 along the movement path 2 . in the illustrated embodiment , the position sensing system 9 is designed as a magnetostrictive position sensing system , which is designed for interacting with a permanent magnet mounted on the conveying means 3 but not shown in the drawing , and in which a signal propagation time through the position sensing system 9 is used as a measure for the position of the conveying means 3 . with the aid of the position sensing system 9 , the controlling device 6 can control the position of the conveying means 3 along the section of the movement path 2 which extends along the second stator segment 20 . in this closed - loop control , the controlling device 6 uses a difference between an actual position value , i . e . an actual position of the conveying means 3 along the movement path 2 , and a set position value , i . e . an expected position of the conveying means 3 at a preset point in time , as a control deviation to be minimised over one or more control cycles by means of the control algorithm running in the controlling device 6 . the control algorithm is preferably designed such that the position of the conveying means 3 , in particular the position of the magnetic action centre 11 of the conveying means 3 , relative to the magnetic travelling wave provided by the second stator segment is chosen such that a phase angle of 90 degrees is always maintained between the active electric current flowing through the solenoids and the magnetic action centre 11 of the conveying means 3 . in fig5 , which is explained in greater detail below , this is symbolised by providing that a distance between an apex of the electric current for the second stator segment 20 , which is represented by a sine wave in the illustrated embodiment , and the magnetic action centre 11 of the conveying means 3 corresponds to a quarter ( λ / 4 ) of the wave length ( λ ) of the magnetic travelling wave . the active current component not shown in the drawing is in phase with the voltage curve at the solenoids , and the idle current component , which is not shown in the drawing , has a phase angle of 90 degrees relative to the voltage and the active current component . at the transition of the conveying means 3 from the first stator segment 10 operated under open - loop control to the second stator segment 20 , which is basically operated under closed - loop control , as shown in fig1 to 4 , the following procedure can be provided . owing the magnetic travelling wave emitted by the first stator segment 10 as a result of the application of electric energy to the solenoids , the conveying means 3 moves along the movement path 2 . if we assume a dwindling resistance to the movement of the conveying means 3 , a phase angle between the electric voltage made available to the first stator segment by the control unit 4 , which is represented by a sine wave in the illustrated example , and the magnetic action centre 11 of the conveying means 3 amounts to only a few degrees or ideally to 0 percent of the wave length ( λ ) of the magnetic travelling wave , as shown in fig1 . fig1 further shows that the second stator segment 20 does not have to be supplied with an electric voltage if the conveying means 3 is sufficiently distant from a transition between the first and the second stator segment 10 , 20 . as the conveying means 3 approaches the transition between the first and the second stator segment 10 , 20 , the second stator segment 20 is initially activated by the controlling device 6 in an open - loop mode . in this , the controlling device 6 initially controls the second stator segment 20 with the aid of the control unit 5 with an electric voltage in such a way that an equal - frequency , in - phase and equal - amplitude current is obtained . this is to ensure that the magnetic travelling waves of the two stator segments 10 , 20 are congruent . as a result , the conveying means 3 can make a smooth transition between the first and the second stator segment 10 , 20 . however , as the second stator segment 20 is basically designed for closed - loop controlled operation and this mode is required for many movements , for example for approaching a defined position along the movement path 2 and / or for maintaining a presettable speed of movement , a switch - over of the second stator segment 20 from open - to closed - loop controlled operation is provided . for this purpose , the position sensing system 7 is activated by the controlling device 6 in a first step . by means of a position signal made available by the position sensing system 7 , the position of the conveying means 3 , in particular the position of the magnetic action centre 11 , along the second stator segment 20 can then be determined by means of an algorithm running in the controlling device 6 . next , a control algorithm running in the controlling device 6 is activated ; this determines a control deviation from the difference between the actual position value for the conveying means 3 and the set position value for the conveying means 3 . this control deviation is then minimised by the controlling device 6 by suitably influencing the frequency and amplitude of the electric ac current to be provided to the solenoids of the second stator segment 20 within a presettable period of time , for example within several control cycles . as a result of the minimisation of the control deviation , the state described above is targeted , in which a phase angle of 90 degrees is maintained between the active current component through the solenoids of the second stator segment 20 and the magnetic action centre 11 of the permanent magnet arrangement 8 . in order to avoid jerky movements of the conveying means 3 , it can be provided by way of example that an integral component in the control algorithm is set to a presettable value , in particular to zero , at the time of the switch - over between the open - and the closed - loop controlled operation of the second stator segment 20 . in this way , the control algorithm will require several control cycles for matching the actual position value to the set position value , so that a sudden change of the movement state of the conveying means 3 is avoided . in addition or as an alternative , it can be provided that the amplitude of the electric current provided to the solenoids of the second stator segment 20 is limited to a presettable first value at the switch - over from the open - to the closed - loop controlled operation of the second stator segment 20 and then increased to a second , higher , value within a presettable number of control cycles . in this way , the active current and thus a magnetic force acting on the conveying means 3 is limited . by this time - dependent increase of the current limit threshold for the solenoids , the magnetic force is increased over a presettable period of time , facilitating a smooth transition for the movement of the conveying means from the open - to the closed - loop controlled state . in addition or as an alternative , it can further be provided that the control algorithm calculates , at the time of the switch - over from the open - to the closed - loop controlled operation of the second stator segment 20 , the acceleration or deceleration required for reaching the targeted set position value and , using a presettable maximum acceleration for the conveying means 3 , sets the number of control cycles and / or the increase of the current limit threshold in such a way that the maximum acceleration is not exceeded . at the transition of the conveying means 3 from the second , closed - loop controlled stator segment 20 to the first , open - loop controlled stator segment 10 as shown in fig5 to 8 , the preset phase angle of 90 degrees between the active current component for the solenoids and the magnetic action centre 11 of the permanent magnet arrangement 8 is initially changed to a phase angle of 180 degrees or 0 degrees , as shown in fig6 . as a result , the conveying means 3 is moved at least substantially in phase with the idle current component of the solenoids of the second stator segment 20 . the controlling device 6 then begins the control of the first stator segment 10 . in this process , the frequency and / or the phase and / or the amplitude of the electric current applied to the first stator segment 10 is / are in particular chosen such that the two magnetic travelling waves of the adjoining stator segments 10 , 20 have equal frequencies and / or phases and / or amplitudes , therefore being congruent . in a subsequent step , the controlling device 6 deactivates the control algorithm and the algorithm for determining the position of the conveying means 3 by means of the position sensing system 9 , thereby concluding the switch - over from the closed - to the open - loop controlled operation of the second stator segment 20 . as it has been ensured that the travelling waves of the adjoining stator segments 10 , 20 are congruent , the conveying means 3 can now manage the transition between the second and first stator segments 20 , 10 and move along the stator segment 10 operated under open - loop control without any jerky accelerations .	7
the heat insulating device in accordance with the invention comprises an elastomer layer 2 whose purpose is to protect the metal tube 1 to be insulated from corrosion , a layer 3 made from a foam insulating material enclosing air and a second elastomer layer 4 which protects the insulating material layer 3 . preferably , the elastomer used for forming layers 2 and 4 is , for example , polychloroprene which , is applied in layers of five to seven millimeters and seven to ten millimeters in thickness , respectively , on the one hand on tube 1 and on the other on the insulating layer 3 . the insulating device designated generally by the reference 10 in fig1 may be formed in different ways : it may be formed by insulating material sectors 5 bonded together by rubber 6 ( see fig2 and 7 ), or by a laminate comprising sheets 7 of an insulating material bonded together by thin rubber sheets 8 ( see fig3 and 8 ). in particular , the insulating device is formed by winding insulating material sheets whose thickness is of the order of 5 to 8 mm , bonded together by rubber sheets from one to two millimeters in thickness . the heat insulating means are preferably formed by sectors 5 or sheets 7 of rigid polyvinyl chloride foam with closed cells or from syntactic material comprising polyvinyl chloride foam spheres encased in an epoxy resin based matrix or comprising glass microballs associated with plastic material balls embedded in the epoxy resin . the insulating material formed by sectors 5 or sheets 7 bonded together by rubber of a similar elastomer is cured , before positioning about tubes 1 , at a temperature less than or equal to 120 ° c ., preferably between 80 ° and 100 ° c ., which the insulating material withstands well ( and particularly &# 34 ; klegecell &# 34 ;), and provides a homogeneous cured product , withstanding high pressures , which does not peel and which has excellent heat insulating properties while withstanding well the hydrostatic pressures of the surrounding sea environment , which are themselves transmitted to the metal tube to be insulated . the elastomer for bonding together elements 5 or 7 which form the heat insulating means is preferably rubber of any composition , appropriate for the desired purpose . however , a bonding rubber may be used formed from a lightened rubber in which glass microballs are embedded in rubber . in the variant shown in fig5 a layer 9 of rubber lightened by glass microballs is inserted between the anti corrosion elastomer layer 2 and the insulating material layer 5 or 7 , the purpose of this layer 9 being to improve the resistance of the heat insulating means of the invention to temperatures greater than 80 ° c . of the fluids which flow in the ducts . as shown in fig1 the heat insulating device 10 is placed about a metal tube 1 to be insulated so that the anti corrosion elastomer layer 2 leaves the ends 11 of said tube 1 free over a length of about 30 cm ( with respect to a length , for example of 12 m for the tube ) so as to allow subsequent welding together of the metal tubes placed end to end . after end to end welding of two adjacent tubes 1 , the welding zone 12 without heat insulating device defines , with the corresponding ends 13 of the heat insulating means of the invention , an empty space 14 intended to receive a jointing means which comprises an elastomer ring 15 in which is included at least one strip 16 of the above mentioned insulating material such as &# 34 ; klegecell &# 34 ; more particularly , whose role is to limit the thermal flow . ring 15 is advantageously prefabricated and may be formed by molding or successively and alternatively winding insulating material 16 and rubber strips ( of fig8 ). ring 15 is advantageously split longitudinally . fixing thereof in space 14 is preferably achieved by using a layer 17 of butyl mastic or a similar self curing rubber , which provides adherence and sealing of ring 15 at the corresponding ends 13 of the adjacent heat insulating devices which define space 14 with the welding zone 12 . fixing of the internal face of ring 15 in the welding zone 12 and on the ends of the elastomer layer 2 is preferably achieved by means of a butyl mastic layer 18 having a retractable polyethylene sheath 19 which retracts under heating and creates compression forces which are exerted on the butyl mastic 18 for reinforcing its adherence and sealing properties . in addition , a sealing and protecting sheath 20 , preferably made from retractable polyethylene or from another material capable of exerting a compression effort in the jointing zones 21 - 22 , is applied to the zones 21 - 22 . in the embodiment shown in fig4 metal inserts 23 ensure hooping of ring 15 . in the embodiment shown in fig6 the metal inserts comprise a hook shaped part 24 which is integral with the anti corrosion elastomer layer 2 and a part 25 integral with ring 15 , parts 24 and 25 each comprising a groove which face each other , the two grooves where joined together forming the channel 26 which is filled with butyl mastic 27 so as to firmly secure together the metal insert parts 24 and 25 and to fix ring 15 in position in space 14 . the heat insulating device according to the present invention may be fitted , either in the factory or on the barge , onto the tubes to be insulated and the prefabricated jointing means may be mounted and fixed very rapidly , after end to end welding of adjacent tubes on the barge , for example within five to seven minutes , because of the design of these devices and means . the heat insulating device according to the present invention , besides withstanding high hydrostatic pressures , as was mentioned above , because of its outer elastomer sheath , provides perfect sealing with respect to sea water , excellent abrasion resistance , and a reliability such that its lifespan may be reckoned at 25 years on average . in addition , the heat insulating device of the present invention withstands the hydrostatic pressures which are exerted at undersea depths greater than 200m and reaching 400m and more ; it further provides perfect heat insulation of the fluid which flows in the ducts , since this fluid , whose input temperature may be of the order of 95 ° c ., arrives on the platform at a temperature substantially equal to the input temperature , since the maximum temperature drop observed does not exceed 5 ° c . thus , as is clear from the foregoing , the invention is in no wise limited to those of its modes of implementation , application and embodiments which have just been described more explicitly ; it embraces on the contrary all the variants thereof which may occur to a technician skilled in the matter , without departing from the scope or spirit of the present invention .	8
the present invention relates to breakaway devices for disconnecting the terminal end of a connectorized optical fiber from a pulling force . the breakaway device may be placed at different locations along the connection between the pulling force and the connector covering the optical fiber , depending upon the particular demands of the environment in which optical fibers are being routed or the characteristics of the optical fibers and connectors themselves . for situations in which it is preferable to disconnect the connector covering the optical fiber from the pulling force by breaking apart a portion of a clamshell cover , the first embodiment of the present invention is presented . another embodiment of the invention has a breakaway piece on a connector cover that breaks when excess tension is applied . another embodiment of the present invention utilizes a breakaway component in a device that is along the line connecting the front end of the connectorized optical fiber and the pulling force . referring to the first embodiment in fig1 a breakaway cap 10 is shown holding a connector 12 mounted on an end of an optical fiber 14 , employing standard mounting techniques , including strain relief using , for example , a crimp body and crimp ring to hold strength members ( e . g ., kevlar ® fibers ) associated with the optical fiber . the breakaway cap 10 is preferably of a elongated clamshell design , in which a first segment 18 and a second segment 20 are connected by a hinge element 28 , but any shape would be possible . the cap 10 is shown in fig1 and fig2 in an open configuration . an optical fiber 14 , which is shown as ribbon cable , but could be of any type or configuration , has a connector 12 mounted on a first end 16 of the optical fiber 14 and is held in recess 22 defined by the inner surface 24 of the breakaway cap 10 . the holding recess 22 preferably has a shape that closely corresponds to the connector 12 , and preferably engages the connector 12 at the second end 26 of the recess 22 where is it is narrower than at the first end 30 , preventing the connector from pulling out of the cap 10 . when the connector 12 mounted on the optical fiber 14 is placed into the holding recess 22 , the first and second segments 18 , 20 of the cap 10 cooperate to enclose the connector 12 . the connector 12 and the front end 16 of the optical fiber 14 are securely held by the closed breakaway cap 10 and resist dislocation toward the second end 26 of the cap 10 due to the narrowing of the holding recess 22 at the second end 26 and larger width of the connector 12 . while cap 10 does not have any elements to secure it in the closed position ( see fig3 ), cap 10 may have such securing elements if so desired . however , the shape of recess 22 closely corresponds to the connector 12 and connector 12 may aid in keeping the cap 10 closed during operation . additionally , as shown in fig3 the first and second segments 18 , 20 are held together by the pulling cord 38 , as described below . a breakaway pulling loop 34 forms an opening at the first end 30 of the breakaway cap 10 . a force - sensitive tongue 32 , contiguous with the material of the breakaway cap 10 , extends from its first end 30 to circumscribe the outermost perimeter of the pulling loop 34 . the material of the breakaway cap 10 and that of the force - sensitive tongue 32 of the pulling loop 34 are of a thickness and conformation that support up to a specified pulling force , so that the force - sensitive tongue 32 breaks apart releasing the pulling cord 38 when that force is exceeded . the force required to break through the tongue 32 depends on the specific connector and the strength members associated with the optical fiber . for larger connectors and larger numbers of optical fibers , the strength of the connection between the connector and the optical fibers / cable increases . therefore , the larger the connector / number of fibers , the larger the force the connectorized optical fiber can withstand and the thicker the tongue 32 could be . as best seen in fig2 and 3 , the force - sensitive tongue 32 may have a notch 37 or have some other geometric design to facilitate the breakaway at a predetermined force . the pulling loop 34 is preferably shaped to facilitate placement of the pulling cord in the opening 36 , so that the tension is applied at the tongue 32 to ensure proper operation . as illustrated in fig3 the pulling cord 38 may be passed through the pulling loop 34 of a closed breakaway cap 10 enclosing at least one connector 12 covering an optical fiber 14 and also be connected to a pulling device ( not shown ). the pulling cord 38 may be tied at the cap 10 to assist in keeping the cap 10 in a closed position during use . alternatively , the cord 38 could be secured anywhere between the cap 10 and the pulling device . the force applied by the pulling device and transferred to the pulling cord 38 would draw the breakaway cap 10 , the connector 12 , and optical fiber 14 along the pathway routed by the cord 38 . if force were applied in excess of that permitted by the configuration of the breakaway cap 10 , the force - sensitive tongue 32 would break apart , thereby releasing the pulling cord 38 that had been fastened to pull the optical fiber 14 . a connectorized optical fiber 14 housed within the breakaway cap 10 could then be drawn back to its original location , and another attempt ( using another cap 10 ) to position the optical fiber 14 could commence . advantages of the breakaway cap 10 include its protective capabilities in covering the front end of the optical fiber 14 and connector 12 , as well as its ease in replacement once the optical fiber has been drawn back to its starting position for re - routing . as the breakaway cap is a single element , no assembly of multiple parts is required . an alternative to connecting the pulling cord to a pulling loop on the breakaway cap would be to mount a breakaway knob on the outer surface of a breakaway cap . as shown in the embodiment in fig4 a closed breakaway cap 50 having a breakaway knob 52 on its front end 54 may be used to secure a pulling cord 58 to a connectorized optical fiber 56 . the knob 52 is connected to the cap 50 by a piece 53 , which may also have a notch as in the first embodiment , having a reduced diameter relative to the cap 10 . the reduced diameter piece 53 is designed to break at a predetermined force . as in the first embodiment , the breaking force is dependent on the connector and the strength members associated with the optical fiber . another embodiment of the present invention positions a breakaway element along the path of the pulling cord connecting a connectorized optical fiber and a pulling force . referring to fig5 a breakaway element 100 is shown that has a rounded body 102 , with a first pole 104 and second pole 106 . while a round body is shown , any shape or dimension is acceptable , although bodies that are smaller and with no sharp edges to catch are preferable . each pole ( 104 , 106 ) has a force - sensitive portion 108 defining a pulling opening 110 . pulling cords may be secured through each opening 110 at each pole ( 104 , 106 ), and one of the poles would then connect with a connectorized optical fiber and the other pole with a pulling force . as an alternative to a pulling opening 110 covered by a force - sensitive portion 108 that breaks upon reaching excessive pulling force , the element 100 may also comprise a body 102 that employ breakaway knobs , as shown above in fig4 or a combination of the openings 110 and the knobs . furthermore , only one pole of the element 100 may have a breakaway portion 108 while the other pole may firmly retain its pulling cord . another embodiment is shown in fig6 . in this embodiment , the breakaway mechanism is similar to that shown in fig5 but may also include of the body 122 of the element 100 , rather than the pulling openings 130 at the first pole 132 or second pole 134 . as shown in fig6 a divider groove 124 traverses the circumference of the body 122 , weakening the structure of the breakaway element 120 such that the element 120 breaks apart into a first segment 126 and a second segment 128 , or even multiple smaller segments , upon reaching an excessive pulling force . the breakaway cap ( fig1 - 4 ) or breakaway element ( fig5 and 6 ) could be fabricated from virtually any material ranging from metals to plastics , as long as the article breaking apart ( e . g ., the force - sensitive tongue , knob , or element ) were of a strength that would permit appropriate pulling of optical fibers , but would break apart upon reaching a force limitation . the first embodiment having a clamshell design could be preferably made from molded plastic , facilitating installation and allowing for disposability . although the present invention has been described with respect to certain preferred and alternative embodiments , it should be understood that various changes , substitutions and modifications may be suggested to one skilled in the art , and it is intended that the present invention encompass such changes , substitutions , and modifications as fall within the scope of the appended claims and their equivalents .	6
the present invention provides an improved synchronizer unit which includes a reverse brake arrangement for arresting rotation of a shaft when shifting a transmission to reverse from a forward gear . while shown in a synchronizing unit adapted to the input shaft of a manual transmission , those skilled in the art will appreciate that the invention is not so limited in scope and is readily adaptable for use with any mechanical device incorporating a shaft that needs to be rotational arrested . turning to the drawings , identical or equivalent elements have been denoted with like reference numerals . referring to fig1 a portion of a five - speed manual transmission is identified generally at 10 . transmission 10 is shown to include a housing 12 and an input shaft 14 rotationally mounted within housing 12 by bearings 16 . housing 12 includes a first housing member 18 and an end cover 20 secured to first housing member 18 by a plurality of threaded fasteners , one of which is shown at 22 . input shaft 14 is adapted to receive driving input torque from a suitable power source ( e . g ., an internal combustion engine ) in a well - known manner . a pair of snap rings 24 prevent axial displacement of bearing 16 in an aft direction ( i . e ., leftward as shown in fig1 ) during assembly of transmission housing 12 . after assembly of transmission housing 12 has been completed , cover 20 cooperates with snap rings 24 to prevent aftward axially displacement . shown in fig1 is a fifth speed gear ratio 28 . while not shown , the exemplary transmission 10 of fig1 will be understood to further include first , second , third , fourth and reverse speed gear ratios of conventional construction . however , differing gear arrangements and additional speed gear ratios are possible without varying the scope of the present invention . reference may be had to u . s . pat . no . 4 , 677 , 868 which discloses in more detail a suitable manual transmission for use with the present invention , the disclosure of which is expressly incorporated herein by reference . as can be seen in fig1 forward gear ratio 28 is rotatably supported on input shaft 14 by a needle roller bearing 30 . in addition , forward gear ratio 28 is formed to include gear teeth 29 and is adapted to meshingly engage a mating gear ( not shown ) splined to a transmission countershaft ( not shown ) for providing driving output . a synchronizer unit 32 is mounted on input shaft 14 . synchronizer unit 32 is actuated by means of a shift fork , partially indicated at 36 , which is supported on a gear box shift selector rail ( not shown ). as will be appreciated by those skilled in the art , shift fork 36 is longitudinally slidable with its selector rail and is connected by a yoke portion ( not shown ) to a shift sleeve 38 of synchronizer unit 32 by means of a circumferential external groove 39 . in the disclosed embodiment , synchronizer unit 32 is a &# 34 ; strut - type &# 34 ; synchronizer unit , a complete description of which may be had by referring to commonly assigned u . s . pat . no . 5 , 085 , 303 , the disclosure of which is hereby expressly incorporated by reference . as will become more apparent below , synchronizer unit 32 operatively provides a synchronizing action between shaft 14 and forward gear ratio 28 and incorporates a reverse brake arrangement for providing a braking action of shaft 14 . synchronizer unit 32 is depicted intermediate forward gear ratio 28 and an end portion 40 of first housing member 18 of transmission housing 12 . with continued reference to fig1 synchronizer unit 32 is shown to include a clutch hub 42 having an inner web portion 44 fixed to input shaft 14 through clutch hub internal splines 46 engaging input shaft external splines 48 . clutch hub 42 includes a longitudinally extending circumferential portion having an externally splined surface 52 formed thereon . shift sleeve 38 is mounted for rotation with clutch hub 42 on input shaft 14 by means of clutch hub externally splined surface 52 slidably engaging a sleeve internal splined surface 54 . thus , shift sleeve 38 is axially movable in a fore or aft direction relative to clutch hub 42 by means of shift fork 36 . synchronizer unit 32 further includes thrust means associated with shift sleeve 38 for energizing synchronizer unit 32 upon axial shifting of shift sleeve 32 in one of the fore and aft directions . in the exemplary embodiment of fig1 the thrust means is shown to include helical compression springs 56 . as is known in the art , helical compression springs 56 are compressed and inserted between a plurality of circumferentially spaced strut members 58 and clutch hub 42 . in the particular embodiments shown , three ( 3 ) strut members 58 are uniformly spaced on 120 ° centers . while not shown in detail , it will be appreciated by those skilled in the art that strut members 58 are adapted to be biased radially outward by springs 56 in their respective longitudinally extending guide slots ( not shown ). guide slots are formed in web portion 44 of clutch hub 42 and have longitudinally extending side walls configured to cooperate with facing edge surfaces of strut for retaining strut member 58 against dislodgement out of guide slots under all radially outward forces . compression springs 56 are sized to produce a predetermined compressive force for biasing strut members 58 in a radially outward direction within guide slots for permitting strut members 58 to move in an axial direction upon axial movement of shift sleeve 38 . springs 56 directly bias a stop ball 59 which in a neutral position of synchronizer unit 32 rides in an annular groove 60 formed in shift sleeve 38 . a drive member or synchronizer cone 64 is carried on an axially extending portion of forward gear ratio 28 . as shown in fig1 synchronizer cone 64 includes an annular rim projection 68 extending transversely from a disk portion 70 on which is formed an external frustoconical friction surface 72 . external clutch teeth 74 are formed along the outer periphery of the radially projecting disk portion 70 . it will be appreciated by those skilled in the art that alternatively synchronizer cone 64 can be formed to include internal splines ( not shown ) which meshingly engage external splines ( not shown ) of input shaft 14 , such that synchronizer cone 64 is directly driven by input shaft 14 . synchronizer unit 32 is shown to further include a reverse brake cone 76 specifically adapted to provide speed synchronization between shaft 14 and housing 12 . particularly , reverse brake cone 76 is adapted to arrest rotational movement of shaft 14 upon axially leftward shifting of shift sleeve 38 . reverse brake cone 76 is axially interdisposed between end wall portion 40 of first housing member 18 of housing 12 and clutch hub 42 . with particular reference to fig2 through 5 , additional features of reverse brake cone 76 and its cooperating relationship with housing 12 will be described . reverse brake cone 76 includes a transversely extending disk portion 78 on which is formed an external frustoconical friction surface 90 that converges toward the right hand end thereof . a plurality of tangs 92 project radially from the left end surface of an annular rim projection 94 of reverse brake cone 76 . each tang 92 includes a pair of side walls 96 and a circumferential wall portion 98 . as will become more apparent below , tangs 92 serve to limit rotation of reverse brake cone 76 with respect to transmission housing 12 . in the exemplary embodiment illustrated , reverse brake cone 76 is shown to include three radially projecting tangs 92 equally spaced circumferentially about reverse brake cone 76 . however , it will be appreciated by those skilled in the art , that reverse brake cone 76 can be readily modified to incorporate any number of radially projecting tangs 92 . synchronizer unit 32 further includes means for limiting rotation of reverse brake cone 76 and means for limiting radial translation of reverse brake cone 76 . in the preferred embodiment , the means for limiting rotation of reverse brake cone 76 and the means for limiting axial translation of reverse brake cone are a slot or slots 100 defined by end wall portion 40 of transmission housing 12 . as shown most clearly in fig1 and 2 , reverse brake cone 76 is positioned in slots 100 and is supported thereby . more specifically , end wall portion 40 of transmission housing 12 is formed to include a plurality of slots 100 corresponding in number to the number of tangs 92 of reverse brake cone 76 . in the exemplary embodiment , end wall portion 40 is formed to include three such slots 100 which are circumferentially arranged . slots 100 are defined by a plurality axially extending portions 102 of end wall 40 . each axially extending portion 102 of end wall 40 includes a flange portion 104 integrally formed therewith that extends in a radially inward direction toward shaft 14 . flange portions 104 , which are generally arcuate in shape , are circumferentially arranged and each include a pair of stop surfaces 106 and an arcuate inner surface 108 . arcuate inner surfaces 108 each lie on a common circle axially arranged with shaft 14 . adjacent stop surfaces 106 of adjacent flange portions 108 cooperate to limit rotation of reverse brake cone 76 . arcuate inner surfaces 108 cooperate to limit radial translation of reverse brake cone 76 , and thereby pilot reverse brake cone 76 . synchronizer unit 32 is shown to further includes a first blocker ring 120 and a second blocker ring 122 . first and second blocker rings 120 , 122 are disposed fore and aft , respectively , of clutch hub 42 . first and second blocker rings 120 , 122 are substantially mirror images of one another and are each formed to include external clutch teeth 124 , 126 , respectively , and an internal frustoconical friction surface 128 , 130 , respectively . internal frustoconical friction surfaces 128 , 130 of first and second blocker rings 120 , 122 , respectively are arranged to generally surround external frustoconical friction surfaces 72 , 90 on synchronizer cone 64 and reverse brake cone 76 , respectively . it will be noted that in the disclosed embodiments external frustoconical friction surfaces 72 , 90 and external frustoconical friction surfaces 128 , 130 are in the form of a friction pad or lining bonded or cemented to its associated conical surface for providing effective frictional engagement . an example of one type of suitable friction lining that may be used with the present invention is disclosed in u . s . pat . no . 4 , 267 , 912 issued may 29 , 1981 to bauer , et al . the disclosure of which is expressly incorporated by reference herein . clutch teeth 124 of first blocker ring 120 are coaxial and alignable with external clutch teeth 74 formed on the outer circumferential portion of forward gear ratio 28 . clutch teeth 124 and clutch teeth 74 are engageable with shift sleeve internal splined surface 54 , the splines of which are in continual meshed engagement with clutch hub externally splined surface 52 , upon shift sleeve 38 being shifted rightwardly toward forward gear ratio 28 and into a first operating position or forward gear mode . clutch teeth 126 of second blocker ring 122 are similarly engageable with shift sleeve internal splined surface 54 upon axial movement of shift sleeve 38 to a second operating position . with particular reference to fig1 the operation of the present invention heretofore detailed will now be described . initial rightward axial movement of shift sleeve 38 toward forward gear ratio 28 causes ball 59 to be displaced from groove 60 , thereby biasing strut members 58 to correspondingly move axially in the same direction until strut members 58 engage blocker ring 120 . next , a detent load builds up as blocker ring 120 is axially pressed by internal splined surface shift sleeve 38 . this contact force against external clutch teeth 124 of blocker ring 120 generates initial &# 34 ; cone &# 34 ; torque between blocker ring 120 internal frustoconical friction surface 130 and external frustoconical friction surface 72 of synchronizer cone 64 . this initial &# 34 ; cone &# 34 ; torque causes blocker ring 120 to be rotated or &# 34 ; clocked &# 34 ; to an indexed position wherein external clutch teeth 124 of blocker ring 120 allow shift sleeve 38 to axially move to a chamfer - to - chamfer loading position between the opposed faces of externally toothed surface 124 on blocker ring 120 and internal splined surface 54 of shift sleeve 38 . when the speed of forward speed ratio 28 relative to blocker ring 120 approaches &# 34 ; zero &# 34 ;, the cone torque falls to zero . synchronization is now complete and blocker ring 120 is no longer energized . since the index torque resulting from the chamfer - to - chamfer loading between shift sleeve internal splined surface 54 and blocker ring teeth 124 exceeds the cone torque , blocker ring 120 rotates in an opposite direction and out of its &# 34 ; clocked &# 34 ; position . thereafter , speed gear ratio 28 rotates aside to pass sleeve internal splined surface 54 beyond blocker ring teeth 124 until there is locked contact between sleeve splined surface 54 and its associated gear teeth splines 74 . synchronizer unit 32 incorporates unique structure so as to provide synchronization of input shaft 14 with transmission housing 12 in substantially the same manner as the aforementioned synchronizer action between input shaft 14 and forward gear ratio 28 . in other words , when shift sleeve 38 is shifted in an aft direction synchronizer unit 32 serves to arrest rotation of input shaft 14 relative to transmission housing 12 . in operation , upon gear shift sleeve 38 being axially shifted from its neutral position leftward , sleeve 42 contact external clutch teeth 126 of blocker ring 122 . next , a detent load builds up as blocker ring 122 is pressed by internal splines 54 of gear shift sleeve 38 generating initial &# 34 ; cone &# 34 ; torque between blocker ring 122 , internal frustoconical friction surface 130 and external frustoconical friction surface 90 of reverse brake cone 76 . this initial &# 34 ; cone &# 34 ; torque causes blocker ring 122 to be rotated or &# 34 ; clocked &# 34 ; to an indexed position wherein external clutch teeth 126 of blocker ring 122 allow shift sleeve 38 to move to a chamfer - to - chamfer loading position between the opposed faces of externally toothed surface 126 on blocker ring 122 and internally splined surface 54 of gear shift sleeve 38 . at this point , reverse brake cone 76 , piloting on transmission housing 12 clocks until radially projecting tangs 92 are rotationally stopped by transmission housing 12 , thereby creating a braking effect on blocker ring 122 , gear shift sleeve 38 , and ultimately input shaft 14 . when the speed of rotation of blocker ring 122 and gear shift sleeve 38 approaches zero , the cone torque correspondingly falls to substantially zero . rotation of input shaft 14 is arrested and the braking function is now complete . at this point , the reverse idler ( not shown ) can be engaged for a reverse gear ratio ( not shown ) to be utilized . upon the reverse rotation of input shaft 14 , the reverse torque created by the rotation biases gear shift sleeve 38 rightwardly towards the neutral position and is locked into position as annular groove 60 is engaged by stop ball 59 . turning to fig6 through 8 , a second preferred embodiment of the present invention will be described . fig6 illustrates a portion of a manual transmission 210 incorporating synchronizer unit 232 including a reverse brake mechanism constructed in accordance with the second preferred embodiment of the present invention . fig7 and 8 further detail the construction of reverse brake cone 276 . in general , synchronizer unit 232 is substantially identical in function and form to synchronizer unit 32 of the first preferred embodiment , with the exception of the configuration of reverse cone brake 276 and the manner reverse cone brake 276 is supported for rotation . as such , like reference numerals are used to identify components that are substantially identical to those previously described . reference numerals for modified elements have been increased by a factor of 200 . in general , reverse brake cone 76 has been modified to cooperate with a needle bearing 120 for rotationally supporting reverse brake cone 276 on shaft 14 . similar to reverse brake cone 76 of the first preferred embodiment , reverse brake cone 276 is formed to include a plurality of tangs 292 . in the second preferred embodiment , however , tangs 292 are formed to project axially from the left end surface of reverse brake cone 276 . tangs 292 function to limit rotation of reverse brake cone 276 with respect to transmission housing 12 . in the exemplary embodiment illustrated , reverse brake cone 276 is shown to include three axially projecting tangs 292 equally spaced circumferentially from the left end of reverse brake cone 276 . however , it will be appreciated by those skilled in the art , that reverse brake cone 276 can be readily modified to incorporate any number of axially projecting tangs 292 . reverse brake cone 276 is positioned in a slot or slots 100 ( not clearly shown in fig6 but substantially identical to slots 100 shown in fig2 ). slots 100 are formed in end wall portion 240 of transmission housing 12 . more specifically , end wall portion 240 of transmission housing 12 is formed to define a plurality of slots 94 corresponding in number to the number of tangs 292 of reverse brake cone 276 . in the exemplary embodiment , end wall portion 40 is formed to include three such slots 100 which are radially arranged . it will be appreciated by those skilled in the art that the operation of five speed transmission 210 incorporating synchronizer unit 232 of the second preferred embodiment is substantially identical to the operation of the first preferred embodiment and need not be described . while the specific embodiments of the invention have been shown and described in detail to illustrate the principles of the present invention , it will be understood that the invention may be embodied otherwise without departing from such principles . for example , one skilled in the art will readily recognize from such discussion and from the accompanying drawings and claims that various changes , modifications and variations can be made therein without departing from the spirit and scope of the invention as defined in the following claims .	5
according to the invention the above - mentioned object is solved by the features of the independent claim . further embodiments will become clear from the features of the dependent claims . the implementation of the method according to the invention for the specific detection of microorganisms in a sample comprises the following steps : b ) incubating the fixed microorganisms with nucleic acid probe molecules contained in a hybridization solution in order to achieve hybridization (= hybridization step ), c ) adding a washing solution to the fixed microorganisms incubated with the nucleic acid probe molecules (= washing step ), d ) detecting the microorganisms with hybridized nucleic acid probe molecules by flow cytometry , wherein the hybridization solution is not removed between the hybridization step b ) and the washing step c ). in a preferred embodiment the method further comprises between the fixing step a ) and the hybridization step b ) the step i ) drying the sample and removing the fixing agent . in a further preferred embodiment the method according to the invention further comprises between the fixing step a ) and the hybridization step b ), or between the drying step i ) and the hybridization step b ) the step ii ) lysing the fixed microorganisms . a particularly preferred embodiment of the method for the specific detection of microorganisms in a sample therefore provides the following steps : i ) drying the sample and removing the fixing agent , ii ) complete lysis of the cells contained in the sample , b ) incubating the fixed and lysed cells with nucleic acid probe molecules in order to achieve hybridization , d ) detecting the cells with hybridized nucleic acid probe molecules in the flow cytometer , wherein between step b ) and step c ) the hybridization solution containing the nucleic acid probe molecules is not removed . optionally , the first step is preceded by a short cultivation for the enrichment of the cells contained in the sample to be tested . in a further embodiment the method can be performed without centrifugation after the washing step . by dispensing completely with centrifugation the method according to the invention can be performed even faster and more simply . within the scope of the present invention “ fixing ” of the microorganisms is understood to mean a treatment with which the bacterial envelope is made permeable for nucleic acid probes . for fixation , usually ethanol is used . if the cell wall cannot be penetrated by the nucleic acid probes using these techniques , the expert will know a sufficient number of other techniques which lead to the same result . these include , for example , methanol , mixtures of alcohols , a low percentage paraformaldehyde solution or a diluted formaldehyde solution or the like . within the scope of the present invention “ drying ” is understood to mean an evaporation of the sample at elevated temperature , until the fixation solution is completely evaporated . within the scope of the present invention , “ complete lysis of the cells ” is understood to mean an enzymatic treatment of the cells . by this treatment the cell wall of gram - positive bacteria is made permeable for nucleic acid probe molecules . for this purpose , for example lysozyme in a concentration of 0 . 1 - 10 mg / ml h 2 o is suitable . also , other enzymes , such as for instance mutanolysine or proteinase k can be used alone or in combination . suitable concentrations and solvents are well known to the expert . it goes without saying that the method according to the invention is also suitable for the analysis of gram - negative bacteria ; the enzymatic treatment for complete cell lysis is then adapted accordingly , it can then also be completely dispensed with . within the scope of the present invention the fixed bacteria are incubated with fluorescence labeled nucleic acid probe molecules for the “ hybridization .” these nucleic acid probe molecules , which consist of an oligonucleotide and a marker linked thereto can then penetrate the cell wall and bind to the target sequence corresponding to the nucleic acid probe molecule within the cell . binding is to be understood as formation of hydrogen bonds between complementary nucleic acid pieces . the nucleic acid probe molecule here can be complementary to a chromosomal or episomal dna , but also to an mrna or rrna of the microorganism to be detected . it is advantageous to select a nucleic acid probe molecule which is complementary to a region present in copies of more than 1 in the microorganism to be detected . the sequence to be detected is preferably present in 500 - 100 , 000 copies per cell , especially preferred 1 , 000 - 50 , 000 copies . for this reason the rrna is preferably used as target site , since the ribosomes as sites of protein biosynthesis are present many thousand - fold in each active cell . the nucleic acid probe molecule within the meaning of the invention may be a dna or rna probe usually comprising between 12 and 1 , 000 nucleotides , preferably between 12 and 500 , more preferably between 12 and 200 and between 12 and 100 , especially preferably between 12 and 50 and between 14 and 40 and between 15 and 30 , and most preferably between 16 and 25 nucleotides . the selection of the nucleic acid probe molecules is done according to criteria of whether a suitable complementary sequence is present in the microorganism to be detected . by selecting a defined sequence , a bacterial species , a bacterial genus or an entire bacterial group may be detected . in a probe consisting of 15 nucleotides , the sequences should be 100 % complementary . in oligonucleotides of more than 15 nucleotides , one or more mismatches are allowed . a sequence is suitable if it is on the one hand specific for the microorganism to be detected and on the other hand accessible for the entering nucleic acid probe molecule , i . e ., not masked by ribosomal proteins or the secondary structure of the rrna . within the scope of the present invention the nucleic acid probe molecules are used with suitable hybridization solutions . suitable compositions of this solution are well known to the expert . such a hybridization solution contains organic solvents , in particular formamide , in a concentration of between 0 % and 80 % and has a salt concentration ( preferably nacl ) between 0 . 1 mol / l and 1 . 5 mol / l . also contained is a detergent ( usually sds ) in a concentration of between 0 % and 0 . 2 % as well as a buffer substance suitable for the buffering of the solution ( e . g ., tris - hcl , na - citrate , hepes , pipes or similar ), usually in a concentration of between 0 . 01 mol / l and 0 . 1 mol / l . usually , the hybridization solution has a ph of between 6 . 0 and 9 . 0 . the concentration of the nucleic acid probe in the hybridization solution depends on the kind of its label and on the number of target structures . in order to allow rapid and efficient hybridization , the number of nucleic acid probe molecules should exceed the number of target structures by several orders of magnitude . however , it has to be noted that too high levels of fluorescence labeled nucleic acid probe molecules result in increased background fluorescence . the concentration of the nucleic acid probe molecules should therefore be in the range between 0 . 5 and 500 ng / μl . within the scope of the method of the present invention the preferred concentration is 1 - 10 ng for each nucleic acid probe molecule used per μl hybridization solution . the volume of the hybridization solution used should be between 8 μl and 100 ml , in a preferred embodiment of the method of the present invention it is between 10 μl and 1000 ml , especially preferred it is between 20 μl and 200 μl . it is characteristic for the method according to the invention that the concentration and the volume of the hybridization solution used are adjusted to the volume of the enzyme solution used in the preceding step , if enzymatic lysis takes place . immediately after mixing the enzyme and the hybridization solution , the chemicals contained in the hybridization solution are present in the concentration required for the specificity of the detection reaction . at the same time , the hybridization solution is composed in such a way that the enzyme reaction for the cell lysis is stopped by the addition of the hybridization solution . in this way the duration of the enzymatic treatment of the tested probe can be controlled very precisely , without a separate working step for removing the enzyme solution being necessary . the hybridization usually lasts between 10 minutes and 12 hours , preferably the hybridization lasts for about 1 . 5 hours . the hybridization temperature is preferably between 44 ° c . and 48 ° c ., especially preferred 46 ° c ., wherein the parameter of the hybridization temperature as well as the concentration of salts and detergents in the hybridization solution may be optimized depending on the nucleic acid probes , especially their lengths and the degree to which they are complementary to the target sequence in the cell to be detected . the expert is familiar with the appropriate calculations . according to the invention it is further preferred that the nucleic acid probe molecule is covalently linked with a detectable marker . this detectable marker is preferably selected from the group of the following markers : fluorescence marker , chemoluminescence marker , radioactive marker , enzymatically active group , haptene , nucleic acid detectable by hybridization . within the scope of the present invention “ removing ” or “ displacing ” of the non - bound nucleic acid probe molecules is achieved by the addition of a washing solution . that means , in contrast to the prior art , the hybridization solution is not removed prior to the washing step , e . g ., by a centrifugation step . suitable compositions of this solution are well known to the expert . if desired , this washing solution can contain 0 . 001 - 0 . 1 % of a detergent such as sds , as well as tris - hcl in a concentration of 0 . 001 - 0 . 1 mol / l , wherein the ph of tris - hcl is in the range of 6 . 0 to 9 . 0 . the detergent can be included , but is not absolutely necessary . furthermore , the washing solution usually contains nacl , the concentration being from 0 . 003 mol / l to 0 . 9 mol / l , preferably from 0 . 01 mol / l to 0 . 9 mol / l , depending on the required stringency . also , the washing solution can contain edta , wherein the concentration is preferably 0 . 005 mol / l . further , the washing solution can also contain preservatives in suitable amounts which are known to the expert . it is characteristic for the method according to the invention that the concentration and the volume of the washing solution used are adjusted to the volume of the hybridization solution used in the preceding step . immediately after mixing the hybridization solution and the washing solution , the chemicals contained in the washing solution are present in the concentration required for the specificity of the detection reaction . in contrast to the method according to the invention , in the prior art the hybridization solution is first removed ( e . g ., by a centrifugation step ) and then the washing solution is added . in this process the temperature of the reaction mixture drops to room temperature , resulting in unspecific false positive results of the detection reaction . in contrast , using the method according to the invention ensures that the temperature can be kept constant during the entire hybridization and washing procedure , thus for the first time guaranteeing the specificity of the detection methods . the superior specificity of the method according to the invention compared to the prior art could be proven by using different probe molecules and different samples , i . e . different microorganisms . the improved specificity is mainly due to the fact that the hybridization solution is not removed between the hybridization step and the washing step , but that the washing solution is added to the cells to be detected and the hybridization solution . very good results were achieved when the volume of the hybridization solution was 50 - 150 μl , especially preferred 80 - 120 μl , and when the solution was concentrated 1 to 3 - fold , especially preferred 1 to 1 . 5 - fold and when the volume of the washing solution was 20 - 50 μl , especially preferred 30 - 40 μl and when the washing solution was concentrated 3 to 6 - fold , especially preferred 4 to 5 - fold . the non - bound nucleic acid probe molecules are usually “ washed off ” at a temperature in the range of 44 ° c . to 52 ° c ., preferably of 44 ° c . to 50 ° c . and especially preferred at 46 ° c . for 10 - 40 minutes , preferably for 15 minutes . the specifically hybridized nucleic acid probe molecules are then detected in the respective cells , provided that the nucleic acid probe molecule is detectable , e . g ., by linking the nucleic acid probe molecule to a marker by covalent binding . as detectable markers , for example , fluorescent groups , such as for example cy2 ( available from amersham life sciences , inc ., arlington heights , usa ), cy3 ( also available from amersham life sciences ), cy5 ( also obtainable from amersham life sciences ), fitc ( molecular probes inc ., eugene , usa ), fluos ( available from roche diagnostics gmbh , mannheim , germany ), tritc ( available from molecular probes inc ., eugene , usa ), 6 - fam or fluos - prime are used , which are well known to the person skilled in the art . also chemical markers , radioactive markers or enzymatic markers , such as horseradish peroxidase , acid phosphatase , alkaline phosphatase , and peroxidase may be used . for each of these enzymes a number of chromogens are known which may be converted instead of the natural substrate and may be transformed to either coloured or fluorescent products . examples of such chromogens are listed in the following table : finally , it is possible to generate the nucleic acid probe molecules in such a way that another nucleic acid sequence suitable for hybridization is present at their 5 ′ or 3 ′ ends . this nucleic acid sequence in turn comprises about 15 to 1 , 000 , preferably 15 - 50 nucleotides . this second nucleic acid region may in turn be detected by a nucleic acid probe molecule , which is detectable by one of the above - mentioned agents . another possibility is the coupling of the detectable nucleic acid probe molecules to a haptene which may subsequently be brought into contact with a haptene - recognising antibody . digoxigenin may be mentioned as an example of such a haptene . other examples in addition to those mentioned are well known to the expert . the final detection of the cells labeled as described above takes place in a flow cytometer . the values obtained from this measurement are visualized in the form of histograms or dot plots on the computer and permit reliable statements about the kind and amount of the bacteria contained . furthermore , a kit for carrying out the method according to the invention is provided which contains at least one nucleic acid probe molecule for the specific detection of a microorganism , preferably already in the suitable hybridization solution . preferably , also the suitable washing solution , the fixation solution as well as the solution for the cell lysis and optionally reaction vessels are included . important advantages of the method according to the invention are thus the very easy handling as well as speed , reproducibility , reliability and objectivity with which the specific detection of microorganisms in a sample is possible . a further advantage is that the advantageous method of in - situ hybridization in solution can now for the first time also be performed for gram - positive organisms . thus , the combined advantages of the fish and the flow cytometry can for the first time be used for the analysis of gram - positive organisms . a further advantage is the hybridization time , which , compared to the prior art , is reduced from 3 hours to preferably 1 . 5 hours . a further advantage is the specificity of the method . here it is crucial that the concentration and the volume of the washing solution used is adjusted to the volume of the hybridization solution used in the preceding step . immediately after mixing the hybridization solution and the washing solution the chemicals contained in the washing solution are present in the concentration required for the specificity of the detection reaction . according to the techniques of prior art , the hybridization solution has first to be removed ( e . g ., through a centrifugation step ) before the washing solution can be added . in this process the temperature of the reaction mixture drops down to room temperature . at this low temperature the nucleic acid probe molecules used in the hybridization reaction bind non - specifically also in those cells which do not contain the exact target sites for the nucleic acid probe molecules but only similar sequences . in the final detection step also these non - target cells , which are labeled due to the unspecific binding of the nucleic acid probe molecules , are detected . a false positive result is the consequence . in contrast , using the method according to the invention ensures that the temperature remains constant during the whole hybridization and washing procedure , as a result of which the specificity of the detection method is for the first time guaranteed . a further advantage is the washing time , which is reduced compared to the prior art from 30 minutes to preferably 15 minutes . the microorganism to be detected by the method according to the invention can be a prokaryotic or a eukaryotic microorganism . in most cases it will be desired to detect unicellular microorganisms . these unicellular microorganisms can also be present in larger aggregates , so - called filaments . relevant microorganisms are especially yeast , algae , bacteria or fungi . the method according to the invention may be used in various ways . for example , environmental samples may be tested for the presence of microorganisms . these samples may be collected from air , water or may be taken from the soil . another field of application of the method according to the invention is the control of foodstuffs . in preferred embodiments the food samples are obtained from milk or milk products ( yogurt , cheese , sweet cheese , butter , and buttermilk ), drinking water , beverages ( lemonades , beer , and juices ), bakery products or meat products . the method according to the invention may further be used for testing medicinal samples . it is suitable for the analysis of tissue samples , e . g ., biopsy material from the lung , tumor tissue or inflamed tissue , from secretions such as sweat , saliva , semen and discharges from the nose , urethra or vagina as well as for urine and stool samples . a further field of application for the present method is the testing of sewage , e . g ., activated sludge , sludge or anaerobic sludge . apart from this , it is also suitable for the analysis of biofilms in industrial plants , as well as for testing of naturally forming biofilms or biofilms forming in the purification of sewage . also the testing of pharmaceutical and cosmetic products , e . g ., ointments , creams , tinctures , juices , etc . is possible with the method according to the invention . the following examples are intended to illustrate the invention without limiting it . combined method for the specific detection of microorganisms taking as an example the detection of lactobacilli harmful to beer the sample to be tested is cultivated for 24 - 48 hours in a suitable manner . various suitable methods and cultivation media are well known to the expert . an aliquot of the culture ( e . g ., 2 ml ) is transferred into a suitable reaction vessel and the cells contained are pelleted by centrifugation ( 4000 × g , 5 min , room temperature ). then a suitable volume ( preferably 20 μl ) of the fixation solution is added and the open reaction vessel is incubated at ≧ 37 ° c . until the fixation solution is completely evaporated . then a suitable volume of the enzyme solution ( preferably 30 - 40 μl lysozyme [ 1 mg / ml h 2 o ]) is added and the sample is incubated for 7 minutes at room temperature . then a suitable volume ( preferably 90 - 120 μl ) of 1 . 33 - fold concentrated hybridization solution containing the labeled nucleic acid probe molecules for the specific detection of lactobacilli harmful to beer is added and the sample is incubated ( 46 ° c ., 1 . 5 hours ). then a suitable volume of 5 - fold concentrated washing solution ( preferably 30 - 40 μl ) is added and the sample is incubated for another 15 minutes at 46 ° c . then the sample is centrifuged ( 4000 × g , 5 min , room temperature ). the supernatant is discarded and the pellet is dissolved in a suitable volume of buffered phosphate solution ( preferably 100 - 200 μl ). the sample thus prepared is now analysed on a flow cytometer ( e . g ., microcyte , optoflow , norway ). combined method for the specific detection of microorganisms taking as example the detection of lactobacilli the bacteria strains designated dsm are available from the dsmz ( german collection of microorganisms and cell cultures gmbh , braunschweig , germany ). the strains wsb l32 and tum 618 are strains from the laboratory collection of the wsb ( faculty of technology of brewery i , freising - weihenstephan , germany ) and of the technical university munich tum ( faculty of microbiology , freising - weihenstephan , germany ). all aforementioned media used for the cultivation of bacteria are commercially available from the dsmz ( german collection of microorganisms and cell cultures gmbh , braunschweig , germany ). the enrichment of the bacterial cultures to be tested was carried out as described under item “ 1 . 1 microorganisms used ”. then an aliquot of the culture ( 1 - 2 ml ) was transferred to a reaction vessel and the cells contained were pelleted by centrifugation ( 4000 × g , 5 min , room temperature ). the supernatant was discarded and 15 μl of the fixation solution ( 99 . 8 % etoh ) were added to the cell pellet and the open reaction vessel was incubated at 46 ° c . until the fixation solution was completely evaporated . then 40 μl of the enzyme solution ( lysozyme [ 1 mg / ml h 2 o ]) were added and the sample was incubated for 7 minutes at room temperature . then 80 μl 1 . 5 - fold concentrated hybridization solution containing a cy5 - labeled nucleic acid probe molecule ( lgc - 354a 5 ′- tggaagattccctactgc - 3 ′; seq id no : 1 ) was added and the sample was incubated ( 46 ° c ., 1 . 5 hours ). then 40 μl 4 - fold concentrated washing solution was added and the sample was incubated for a further 15 minutes at 46 ° c . then the sample was centrifuged ( 4000 × g , 5 min , room temperature ). the supernatant was discarded and the pellet was dissolved in a suitable volume of buffered phosphate solution ( preferably 100 - 200 μl ). this last centrifugation step is optional ; alternatively , the sample can also be measured without any centrifugation step directly after the washing step . the sample prepared in this way was analyzed on a flow cytometer ( microcyte , optoflow , norway ) using the mc2200 software ( optoflow , norway ). further , the software winmdi 2 . 8 ( windows multiple document interface for flow cytometry ), a program freely available under http :// facs . scripps . edu / software . html , was used for the graphic post - editing of the readings . alternatively , the supernatant was discarded after centrifuging the sample aliquot and 5 μl of the enzyme solution ( lysozyme [ 1 mg / ml h 2 o ]) was added to the cell pellet and the sample was incubated for 7 minutes at room temperature . then 10 μl of the fixation solution ( 99 . 8 % etoh ) was added and the open reaction vessel was incubated at 46 ° c . until the fixation solution was completely evaporated . in this case , the subsequent hybridization step was performed by adding 120 μl 1 - fold concentrated hybridization solution ( instead of 80 μl 1 . 5 - fold concentrated solution ). all other steps remained unchanged . in contrast to the visual inspection on a microscope , the possibility of distinguishing between unspecific binding or artefacts and a specific signal is very limited on the flow cytometer , if these events occur in a similar size range . it is therefore essential to set a threshold or a detection limit . readings below this limit are interpreted as background ; readings above this limit are evaluated as a positive result . this detection limit was determined by measuring pure water , 1 × pbs , cells hybridized without probe and cells hybridized with a non - binding oligonucleotide probe and was at 9 × 10 3 counts / ml . fig1 shows the results obtained with non - target organisms of the probe used . the values obtained were between 1 . 0 × 10 3 and 3 . 1 × 10 3 counts / ml ( with a centrifugation step after washing , fig1 a to c ) or between 4 . 5 × 10 3 and 6 . 7 × 10 3 counts / ml ( without a centrifugation step after washing , fig1 d to f ), respectively , and were thus clearly below the detection limit . the values were lower with the final centrifugation step than without this step , but also without the final centrifugation step the analysis could be successfully performed . 3 . 2 positive findings fig2 shows the results obtained with target organisms of the probe used . the values obtained were all clearly above the detection limit . the readings obtained with the analysis of pure and mixed cultures ( fig2 g - l ) were stable and comparable with each other . also the readings for different amounts of cells ( processing of 1 ml or 2 ml of a culture , respectively ) showed a good correlation both for lactobacillus brevis as well as for pediococcus damnosus . the measurement of lactobacillus brevis ( see fig2 i , j and l ) and pediococcus damnosus ( see fig2 g and h ) cells produced not only reproducible readings , but also different distributions of the single events depending on the morphology of the cells . the different shape of the plots obtained can primarily be explained by the different morphology ( p . damnosus = cocci and l . brevis = rods ). additionally , the homogeneity or the heterogeneity of a culture , respectively , is made clear in the different way of presentation . in this way the culture of p . damnosus consisting of cells of essentially the same size and the same shape is presented conically ( see fig2 g and h ). the distribution of the single readings of the very heterogeneous culture of l . brevis consisting of cells with very different morphology and size ( short , long , rods with partially filamentous structures ) is presented in the shape similar to a triangle ( see fig2 i , j and l ). the distribution of the single measuring events of a mixed culture of l . brevis and p . damnosus shown in fig . k shows both different distribution forms in one reading .	2
the preferred embodiments will be described with reference to the drawing figures where like numerals represent like elements throughout . [ 0031 ] fig5 and 6 depict transmitter systems of the invention . a group of data signals 28 1 , 28 2 . . . 28 n that include traffic , pilot and maintenance signals are mixed with different chip code sequences 32 1 , 32 2 . . . 32 n and are summed together in a combiner 34 as a combined signal 44 . the combiner 34 is coupled to an adjustable signal limiter 50 ( clipper ) where signal power levels are hard limited to + β and − β db . power levels in between + β and − β are not affected . the limited signal 45 is modulated up to rf by a mixer 36 . the modulated signal is amplified by an amplifier 38 to a predetermined power level and radiated by antenna 40 . [ 0032 ] fig7 illustrates a typical probability distribution function of the combined signal power level . combined chip sequences 46 , 47 , 48 as shown in fig4 d will have an associated power level . the probability of given combined chip sequences having a particular power level is shown in fig7 . the two extreme power levels are + k and − k . as shown in fig7 the probability of a given combined sequences chip having a power level of + k or − k is extremely low . whereas , the probability of combined chip sequences having a power level in the middle of the two extremes is high . since a spread spectrum signal is spread across a wide communication bandwidth and there is a low probability that combined chip sequences will have a power level at the ends of the distribution , the combined signal 44 can be clipped below these extremes with insignificant loss . the transmitter system adjusts the clipping levels , β , to eliminate the signal transients with only a small decrease in the transmittal signal - to - noise ratio ( snr ). fig8 is a graph illustrating the relationship between snr and clipping levels for a system not using adaptive power control . the solid line , dashed line and dotted line , respectively , depict communication channels with different operating snrs . as shown in fig8 for a β set at a clipping level of two standard deviations the loss in snr is negligible and at a clipping level of one standard deviation the loss is only approximately 0 . 2 db . for a system using adaptive power control , fig9 is a graph of snr versus the clipping level . the results are similar to those obtained in a system not using adaptive power control . as shown in fig9 with a clipping level of two standard deviations , the loss in snr is again negligible . accordingly , the clipping circuitry is applicable to systems utilizing adaptive power control and systems not using adaptive power control . referring back to fig5 to determine β , the invention uses a power measurement device 52 and a processor 54 . the power measurement device 52 is coupled to either the output of the rf amplifier 38 as shown in fig5 or the mixer 36 as shown in fig6 . preferably , the power measurement device 52 determines the average of the square of the magnitude of the transmitted signal over a predetermined time period . the output of the preferred power measurement device 52 approximates the variance of the mixed signal 49 or the signal 51 being transmitted . alternatively , the power measurement device 52 determines an approximation of the standard deviation by taking the average of the absolute value of the signal 49 , 51 or the power measurement device 52 measures the magnitude of the signal 49 , 51 with the processor determining either the variance or standard deviation . the output of the power measurement device 52 is coupled to a processor 54 . if the power measurement device 52 is coupled to the output of the amplifier 38 , the processor 54 scales down the output of the power measurement device 52 by the gain of the amplifier 38 . the processor 54 determines the proper clipping level for β . depending on the desired snr and bandwidth , the value for β will be a multiple of the standard deviation . if the power measurement device 52 approximates the variance , the processor 54 will take the square root of the device &# 39 ; s output as the standard deviation . in the preferred embodiment , β will be two times the standard deviation . in certain situations , the processor 54 overrides the determined value of β . for instance , if the transmitter 25 was used in a base station 20 1 , 20 2 . . . 20 n , a large increase in the number of users may result in β being temporarily set too low . this will result in an undesirable received snr . as supplied to the processor 54 through the line 60 , the number of users currently in communication with the base station 20 1 , 20 2 . . . 20 n , is used to either change β or temporarily disable the clipper 50 to allow all signals to pass unaltered when appropriate . additionally , since the probability distribution function assumes a large sample size , a small number of users may result in an undesired received snr . accordingly , if only a few users were in communication with the base station 20 1 , 20 2 . . . 20 n , the clipper 50 may be disabled . in addition , when there are only a small number of users active , the amplifier &# 39 ; s dynamic range is not reached . accordingly , there is no need to clip the combined signal . under other situations , it may be necessary to override the clipper 50 . for instance , in some cdma systems short codes are used during initial power ramp up . since these codes are not long enough to approximate a random signal , by chance one code may result in a large number of high transient peaks within the signal . clipping these transmissions may dramatically decrease the received snr and unnecessarily delay the initial power ramp up procedure . in these situations , a signal will be sent to the processor 54 through the line 62 to override the clipper 50 . in an alternate embodiment shown in fig1 , the processor 54 is also used to control the gain of the amplifier 38 through the line 58 . stored in the processor is the amplifier gain characteristic . the amplifier gain is adjusted to keep the amplifier from going into the nonlinear operating region . accordingly , out - of - band emissions and interference to services in adjoining frequency bands is reduced . although the invention has been described in part by making detailed reference to certain specific embodiments , such detail is intended to be instructive rather that restrictive . it will be appreciated by those skilled in the art that many variations may be made in the structure and mode of operation without departing from the scope of the invention as disclosed in the teachings herein .	7
sti cmp processing without the reverse pattern and etch processes requires a high polish removal selectivity for optimal sti structures to be fabricated on the semiconductor surface . as used herein , the phrase &# 34 ; polish removal selectivity &# 34 ; refers to the ratio of removal of silicon dioxide ( sio 2 ) to silicon nitride ( si 3 n 4 ) as measured on sheet film wafers . in prior art techniques , the polish removal selectivity is most commonly 4 : 1 . by using the techniques described herein , enhanced polish removal selectivity ratios of greater than 10 : 1 are achieved . as used herein , the phrase &# 34 ; enhanced polish removal selectivity &# 34 ; refers to a polish selectivity of 10 : 1 or greater . the technique involves modification of basic slurry compositions to achieve the enhanced polish removal selectivity . in a preferred embodiment of the present invention , tetramethyl ammonium hydroxide ( tmah ) and hydrogen peroxide are added to a slurry to improve the polish removal selectivity . namely a slurry with an enhanced polish removal selectivity of 30 : 1 has been achieved . in an alternative embodiment , different salts of tetramethyl ammonium ( tma ) and a highly basic solution are added to the slurry to enhance polish removal selectivity . a slurry using this method has shown an enhanced polish removal selectivity of greater than 10 : 1 . a suitable slurry is a colloidal silica formulation having an initial ph of around 10 . 5 . suitable slurries include , but are not limited to , cabot ( el dorado hills , calif ., usa ) sc112 or rodel ( newark , del .) ild1300 . these slurries represent the mainstream slurries used in oxide polish operations by most major us semiconductor manufacturers . in the preferred embodiment of the present invention , the slurry is sc112 from cabot . when the correct amount of tetramethyl ammonium hydroxide ( tmah ) alone is used ( without h 2 o 2 ), the ph may become greater than 13 , causing the silica or other suspended particles to become non - colloidal ( charge loss ) and to fall out of suspension . thus , the colloidal nature of the slurry is lost and slurry performance is adversely affected . the hydrogen peroxide is introduced to lower the ph to less than 13 , thereby preventing silica dilution from the slurry . it is preferrable that the final ph of the slurry ( after addition of the tmah and h 2 o 2 ) be in the range of 11 . 0 to 13 , and most preferably in the range of 11 . 5 to 12 . 0 . it is also preferable that the slurry to tmah ratio ( volume : volume ) is between 50 : 1 to 55 : 1 , or between 50 and 55 parts slurry to 1 part tmah . the ratio of slurry to h 2 o 2 is preferably between 300 : 1 to 500 : 1 ( volume : volume ). for all mixtures described herein , the tmah has a 25 % concentration ( 2 . 7 moles / l ) and the hydrogen peroxide used has a 30 % concentration ( 9 . 8 moles / l ). with this modified slurry formulation , an enhanced polish removal selectivity of greater than 15 : 1 oxide to nitride is achieved . in fact , enhanced polish removal selectivity ratios of 30 : 1 may be obtained . tmah is known to have stability problems because of its degradation into trimethyl amines . this breakdown causes the performance of the slurry to degrade over time . hence , it is preferable that the modified slurry be used soon after it is prepared . the modified slurry should be used within two hours after preparation , as the polish removal selectivity of the modified slurry diminishes to below 5 : 1 after about 3 hours . useful salts of tma include , but are not limited to chloride , bromide , iodide , sulfide , or fluoride salts . most preferably , the tma salt is tetramethylammonium fluoride added to increase the ph to 11 to 13 , and most preferably to 11 . 6 to 11 . 9 . the correct ph is maintained by a basic solution such as , but not limited to potassium hydroxide . this modified slurry provides a selectivity of 10 : 1 or greater . interestingly , salts of tetraethyl ammonium hydroxide and of tetrabutyl ammonium hydroxide are not effective in enhancing polish removal selectivity . the following examples are offered to illustrate embodiments of the invention and should not be viewed as limiting the scope of the invention . this example describes the polish removal selectivity of tmah used in conjunction with hydrogen peroxide . pilot wafers ( non - patterned ) were ran on both plasma enhanced tetra ethyl ortho silicate ( peteos ) and low pressure , chemical vapor deposited silicon nitride ( lpcvd nitride ). the slurry was mixed using the above formulations and the wafers polished on a westech 472 polishing machine . each pilot wafer was polished for 2 minutes using a slurry flow of 150 milliliters per minute . pre - and post - measurements of the wafer thicknesses were made using a calibrated tencor ft750 . two examples of the westech tool parameters for the polish process are shown below : ______________________________________table speed : 60 rpm 85 rpmcarrier speed : 40 rpm 40 rpmdown force : 7 psi 7 psibackpressure : 1 . 5 psi 4 . 5 psi______________________________________ the polish rates of the peteos and lpcvd nitride were measured . the following formula was used to calculate selectivity : this is expressed as xx : 1 oxide to nitride selectivity , where &# 34 ; xx &# 34 ; is calculated as above . these terms can be found in other semiconductor literature and are common definitions in the semiconductor field . below is the data reflecting the various ratios of tmah and h 2 o 2 added to sc112 to achieve different desired selectivities . the numbers in the table are expressed as ratios of volume of 25 % tmah ( 2 . 7 moles / l ) and 30 % h 2 o 2 ( 9 . 8 moles / l ) added to 3000 ml of sc112 slurry . table 1______________________________________oxide and nitride removal rates ( rr ) ratios of tmah and h . sub . 2 o . sub . 2 are in volume : volumetmah h . sub . 2 o . sub . 2 oxide ( rr ) nitride ( rr ) selectivity______________________________________ 30 : 1 150 : 1 100 7 . 5 13 : 1100 : 1 150 : 1 2500 700 4 : 1 52 : 1 300 : 1 530 17 . 6 30 : 1125 : 1 300 : 1 2600 700 4 : 1______________________________________ the ratio of slurry to tmah ( volume : volume ) was varied from 30 : 1 up to 125 : 1 . hydrogen peroxide was used to adjust the ph to values of 11 . 3 and 12 . 3 . at a ratio of 52 : 1 of slurry to tmah , the etch selectivity was 30 : 1 . table 2 shows that an optimal ph of about 11 . 7 is preferable . table 2______________________________________oxide and nitride removal rates ( rr ) tmah h . sub . 2 o . sub . 2 oxide ( rr ) nitride ( rr ) selectivity ph______________________________________53 : 1 300 : 1 450 17 . 7 25 . 3 : 1 11 . 754 . 1 400 : 1 950 50 19 : 1 11 . 5111 : 1 500 : 1 2400 600 4 : 1 11 . 169 : 1 500 : 1 2400 400 6 : 1 11 . 354 : 1 500 : 1 460 20 23 : 1 11 . 7______________________________________ this investigation was conducted to explore the contribution of a salt of tma to the slurry . the example was conducted as described above in example 1 , except tetramethyl ammonium fluoride salt was added to the slurry at the ratios given . the mixture included adding 40 % tma ( f ) h 2 o 2 and 8 molar potassium hydroxide ( koh ) to 2000 ml of sc112 . the koh and the h2o2 were used to maintain a basic ph in the range described herein . table 3______________________________________selectivity with fluoride salttma ( f ) h . sub . 2 o . sub . 2 koh selectivity______________________________________10 : 1 500 : 1 200 : 1 6 : 115 : 1 500 : 1 200 : 1 8 : 117 . 5 : 1 500 : 1 200 : 1 15 : 120 : 1 500 : 1 200 : 1 13 : 1______________________________________ these data show that fluoride salts of tetramethyl ammonium can be used to decrease the nitride removal rate , therefore increasing the oxide to nitride selectivity . although the present invention has been described in detail , it should be understood that various changes , alterations and substitutions may be made to the teachings herein without departing from the spirit and scope of the present invention , which is defined solely by the appended claims .	2
one preferred embodiment of a lamp unit mounting structure of the present invention will now be described in detail with reference to the accompanying drawings . fig1 is an exploded , perspective view of a room lamp to which one preferred embodiment of the lamp unit mounting structure of the invention is applied , fig2 a is an enlarged perspective view of an important portion of a fixing member shown in fig1 fig2 b is a cross - sectional view thereof , fig3 is a front - elevational view as seen from a direction iii of fig2 a , fig4 a is an enlarged perspective view of an important portion of a modified example of the fixing member shown in fig2 a , fig4 b is a cross - sectional view thereof , and fig5 to 7 are cross - sectional views explanatory of a process of mounting the lamp unit of fig1 on a car body panel . the room lamp 20 according to the embodiment , shown in fig1 is a lamp unit which is adapted to be mounted at a lamp - mounting window 31 formed on a roof trim 30 ( serving as an interior wall member ) covering a body roof ( car body panel ). the room lamp 20 includes a lamp function portion a for mounting on that side ( upper side in the drawings ) of the roof trim 30 facing the body roof , and a design portion b for mounting on that side ( lower side in the drawings ) of the roof trim 30 facing the room , the lamp function portion a including a bulb 24 mounted in a housing 21 , a switch portion ( not shown ) and so on , while the design portion b includes a cover lens 51 , and a holder 41 . an ffc 22 ( which is a cable forming a roof harness ) is connected via the switch portion ( not shown ) to the bulb 24 mounted in the housing 21 of the lamp function portion a . namely , a connection portion of the ffc 22 ( which is the roof harness beforehand installed on the roof trim 30 ) is electrically connected to a wire connection portion of the lamp function portion a , and at this time the operator can effect this connecting operation with his face directed downward while confirming this connected condition with the eyes . the cover lens 51 of the design portion b is integrally attached to the holder 41 by engaging retaining projections 51 a respectively with engagement portions ( not shown ) of the holder 41 . the holder 41 includes engagement claws 42 for engagement respectively in engagement holes 32 ( formed through the roof trim 30 ) to fix the holder 41 and the roof trim 30 to each other , a housing fitting hole 46 for fittingly receiving the housing 21 , a fixing member 43 for fixing the room lamp 20 and a reinforcing member 60 of the body roof to each other , and shake - prevention piece portions 48 for being brought into resilient abutting engagement with the reinforcing member 60 after the mounting of the room lamp on the car body so as to prevent the shaking of the room lamp . the pair of engagement claws 42 are provided on a diagonal line of the holder 41 having a generally rectangular shape when viewed from the top , and also the pair of fixing member 43 are provided on another diagonal line of the holder 41 . two pairs of shake - prevention piece portions 48 are formed integrally on the holder 41 , and each pair of shake - prevention piece portions 48 are provided along a corresponding short side of the holder 41 , and extend obliquely upwardly . as shown in fig2 a , each fixing member 43 is formed on and projects perpendicularly from that side ( upper side in the drawings ) of the holder 41 ( of the room lamp 20 ) facing the reinforcing member 60 . this fixing member 43 includes an elastic arm 44 for retaining engagement at its distal end portion 44 c with a mounting portion 61 of the reinforcing member 60 , and a pair of elastic arm restriction portions 47 provided respectively on opposite ( right and left ) sides of the elastic arm 44 . the mounting portion 61 is formed by an edge portion of a notch 62 formed in the reinforcing member 60 . the elastic arm 44 includes a vertical portion 44 a formed integrally at its proximal end with the holder 41 , an elastic portion 44 b which extends from the vertical portion 44 a , and is bent into a generally inverted u - shape to extend obliquely downwardly , and a support piece portion 45 extending vertically downwardly from a lower surface of the elastic portion 44 b . the distal end portion 44 c of the elastic portion 44 b is adapted to be retainingly engaged with the mounting portion 61 of the reinforcing member 60 . a distal end portion ( lower end portion ) of the support piece portion 45 extends through a notch portion 41 a formed on the holder 41 , and is not fixed , and therefore is in a free condition . a pair of upper and lower engagement projections 45 a and 45 b are formed on and project outwardly from each of opposite side edges of the support piece portion 45 , these upper and lower engagement projections serving as the engagement portions of the elastic arm 44 . as shown in fig3 the amount la of projecting of each upper engagement projection 45 a is smaller than the amount lb of projecting of each lower engagement projection 45 b . each elastic arm restriction portion 47 , formed ( molded ) integrally on the holder 41 , includes a retaining wall 47 a , and a slanting portion 47 b . as shown in fig2 a and 2b , a notch 47 c ( serving as an escape portion ) is formed in the retaining wall 47 a , and each lower engagement projection 45 b extends laterally beyond the notch 47 c to a position beneath the corresponding retaining wall 47 a since the amount lb of projecting of the lower engagement projection . 45 b is large . the amount la of projecting of each upper engagement projection 45 a is small , and therefore the upper engagement projection 45 a is within the range of the notch 47 c . therefore , in a non - deformed condition of the elastic arm 44 , that is , before the room lamp 20 is mounted or after the room lamp is properly mounted , the lower engagement projections 45 b of the elastic arm 44 abut respectively against the lower surfaces of the retaining walls 47 a , and therefore the elastic arm 44 is prevented from being deformed upwardly : on the other hand , each upper engagement projection 45 a is within the range of the corresponding notch 47 c , and therefore the upper engagement projection 45 a will not interfere with the retaining wall 47 c upon downward deformation of the elastic arm , thereby allowing the downward deformation of the elastic arm . further , each pair of upper and lower engagement projections 45 a and 45 b are disposed respectively at upper and lower sides of the corresponding slanting portion 47 b , and therefore can slide along the slanting portion 47 b , but are prevented from movement in a direction perpendicular to the slanting portion 47 b . therefore , during the mounting of the room lamp on the car body , the distal end portion 44 c is prevented from being displaced in a direction ( upward - downward direction in the drawings ) of mounting and dismounting of the room lamp 20 relative to the car body , but can slide along the slanting portions 47 b . therefore , the elastic arm 44 can be deformed along the slanting portions 47 b , and therefore the room lamp 20 can be mounted on and removed from the car body . although a starting end of each slanting portion 47 b is cut vertically as shown in fig2 a and 2b , a tapering portion 47 d may be formed at this portion as shown in fig4 a and 4b . in this case , the engagement projections 45 a and 45 b , disposed in registry with the notch 47 c , can smoothly move to the slating portion 47 b . and besides , even if the support piece portion 45 is slightly engaged with the slanting portion 47 b of each elastic arm restriction portion 47 after the mounting operation is completed , each engagement projection 45 a slides over the tapering portion 47 d to move to the notch 47 c when an apex portion 44 d of the elastic arm 44 abuts against the body roof upon application of an upward force to the room lamp 20 . thus , the engagement projection 45 a is disengaged from the slanting portion 47 b , and therefore the upward force is prevented from acting on the body roof . in fig4 a and 4b , the same portions as described above are designated by identical reference numerals , respectively , and repeated description will be omitted . when the room lamp 20 of this embodiment is to be mounted on the roof trim 30 , first , the holder 41 is attached to the roof trim 30 to cover the lamp - mounting window 31 in the roof trim 30 , and the engagement claws 42 on the holder 41 are engaged respectively in the engagement holes 32 in the roof trim 30 , thereby fixing the holder 41 and the roof trim 30 to each other . at this time , the fixing member 43 and the shake - prevention piece portions 48 will not interfere with the roof trim 30 thanks to the provision of openings 33 in the roof trim 30 ( see fig5 ). the cover lens 51 is attached to the holder 41 from the inside of the car room ( that is , from the lower side in fig1 ), so that the design portion b is beforehand attached to the roof trim 30 . then , the housing 21 , forming the lamp function portion a of the room lamp 20 connected to the connection portion of the ffc 22 , is fitted into the housing fitting hole 46 in the holder 41 from that side ( upper side in the drawings ) of the roof trim 30 facing the reinforcing member 60 , and trim mounting portions 23 are retainingly engaged with a peripheral edge portion of the lamp - mounting window 31 , so that the lamp function portion a is directly mounted on the roof trim 30 as shown in fig5 . the cover lens 51 may be attached to the holder 41 after the housing 21 is fitted into the housing fitting hole 46 in the holder 41 . then , the ffc 22 is installed on that side of the roof trim 30 facing the reinforcing member 60 , and roof accessories ( not shown ) such as a back mirror and a sun visor are beforehand attached to the roof trim 30 , thereby forming a roof module in which the room lamp 20 and the roof trim 30 with the roof accessories are integrally combined together as shown in fig5 . then , the roof module , having the room lamp 20 and the roof trim 30 integrally combined together , is mounted on the body roof as shown in fig6 and 7 . at this time , the distal end portions 44 c of the elastic arms 44 , disposed at that side where the room lamp 20 is provided , are retainingly engaged respectively with the mounting portions 61 of the reinforcing member 60 , and by doing so , the room lamp 20 and the roof trim 30 are fixed to the reinforcing member 60 by the fixing member 43 . in the lamp unit mounting structure of this embodiment , the mounting operation is thus completed merely by mounting the roof module ( having the room lamp 20 and the roof trim 30 integrally combined together ) on the reinforcing member 60 of the body roof , and the operation for mounting the roof accessories can be omitted when mounting the roof trim , and therefore the mounting operation is easy . particularly , the fixing member 43 enable the room lamp 20 and the roof trim 30 to be easily and positively mounted simultaneously on the reinforcing member 60 of the body roof by their elastic arms 44 and elastic arm restriction portions 47 . namely , in the fixing member 43 of this embodiment , the pair of engagement projections 45 a and 45 b , formed at each of the opposite side edges of the support piece portion 45 of the elastic arm 44 , are disposed in registry with the notch 47 c ( formed in the retaining wall 47 a of the elastic arm restriction portion 47 formed integrally with the holder 41 ) as shown in fig2 b before the room lamp is mounted . when the elastic portion 44 b of the elastic arm 44 abuts against an edge 61 a of the mounting portion 61 as shown in fig8 a during the mounting of the roof module on the reinforcing member 60 , the elastic portion 44 b is pressed downward , so that the support piece portion 45 is pressed down rearwardly ( in a right - hand direction in fig8 a ). as a result , the slanting portion 47 b of each elastic arm restriction portion 47 is fitted between the corresponding pair of upper and lower engagement projections 45 a and 45 b formed on the support piece portion 45 . therefore , the elastic arm 44 is prevented from being deformed downwardly , and moves rearward . when the roof module is further pushed up , the support piece portion 45 moves rearward , and the distal end of the elastic arm 44 also moves rearward , and therefore the distal end portion 44 c of the elastic arm 44 slides past the edge 61 a , and is retainingly engaged with the mounting portion 61 , so that the roof module is mounted on the reinforcing member 60 . therefore , when mounting the room lamp 20 and the roof trim 30 ( combined together to form the module ) simultaneously on the reinforcing member 60 , the distal end portion 44 c of the elastic arm 44 will not escape toward the car room ( that is , downward ) in the direction of mounting and dismounting of the room lamp 20 relative to the car body before this distal end portion 44 c is retainingly engaged with the mounting portion 61 of the reinforcing member 60 . therefore , in the fixing member 43 , the distal end portion 44 c of the elastic arm 44 will not fail to be retainingly engaged with the mounting portion 61 of the reinforcing member , and hence is prevented from being held in a half fixed condition , so that the module can be positively mounted on the reinforcing member 60 . and besides , when mounting the module on the car body , the distal end portion 44 c of the elastic arm 44 will not escape toward the car room in the direction of mounting and dismounting of the room lamp 20 relative to the car body as described above , and therefore an excessive clearance for allowing for this escape does not need to be formed between the distal end portion 44 c and the mounting portion 61 of the reinforcing member 60 . furthermore , at the time of mounting the module on the reinforcing member 60 of the body roof , the elastic portion 44 b is elastically deformed such that its distal end portion 44 c is moved toward the vertical portion 44 a , and hence is displaced so as to be releasably engaged with the mounting portion 61 , and at the same time this distal end portion 44 c is also displaced toward the reinforcing member 60 ( that is , upward ). therefore , the distal end portion 44 c can be displaced upwardly beyond its normal position , and therefore can positively slide past the edge 61 a of the mounting portion 61 . therefore , the distal end portion 44 c can be positively engaged with the mounting portion 61 without the need for providing a clearance ( as described above for the related room lamp - fixing structure of fig1 b in which the clearance t is needed ) between this distal end portion 44 c and the mounting portion 61 after the module is completely mounted on the car body . when the distal end portion 44 c slides past the edge 61 a as shown in fig6 the slanting portions 47 b cease to urge the elastic portion 44 b upward , so that the distal end portion 44 c tends to be restored into its normal condition . therefore , a resilient force is produced in the elastic portion 44 b when the module is completely mounted on the car body , and the elastic portion 44 b resiliently abuts against the mounting portion 61 , so that the module is prevented from shaking relative to the reinforcing member 60 . in this embodiment , the shake - prevention piece portions 48 are provided at the holder 41 of the room lamp 20 , and are resiliently abut against the reinforcing member 60 after the module is mounted on the car body as shown in fig5 and 6 . therefore , for example , even when a clearance due to a molding error of the elastic arm 44 and an assembling tolerance is formed between the distal end portion 44 c and the mounting portion 61 , the shake - prevention piece portions 48 positively prevent the shaking of the module relative to the reinforcing member 60 . therefore , the module will not be shaken by vibrations or others during the travel of the car , and therefore will not produce abnormal sounds . when an excessive upward force acts on the room lamp 20 after the mounting operation is completed , there is a fear that the apex portion 44 d of each elastic arm 44 strikes against the body roof . however , the support piece portion 45 is located in the notches 47 c formed respectively in the elastic arm restriction portions 47 , and each engagement projection 45 a will not interfere with the retaining wall 47 a , so that the elastic arm 44 is allowed to be deformed downward as shown in fig8 b . therefore , the upward force is absorbed , thereby avoiding a situation in which the body roof is recessed . in the case where the tapering portion 47 d is formed at that end portion of the retaining wall 47 a disposed adjacent to the notch 47 c as shown in fig4 a and 4b , the engagement projections 45 a and 45 b , disposed in registry with the notch 47 c , can smoothly move to the slanting portion 47 b as shown in fig9 a . and besides , even if the support piece portion 45 is slightly engaged with the slanting portion 47 b of each elastic arm restriction portion 47 after the mounting operation is completed , each engagement projection 45 a slides over the tapering portion 47 d to move to the notch 47 c when the apex portion 44 d of the elastic arm 44 abuts against the body roof upon application of an upward force to the room lamp 20 , as shown in fig9 b . even when there is applied a large external force tending to displace the module ( fixed to the reinforcing member 60 of the body roof as shown in fig5 and 6 ) toward the room ( downward in the drawings ) relative to the roof reinforcing member 60 , the lower wide engagement projections 45 b ( formed on and projecting from the support piece portion 45 of the elastic arm 44 ), each laterally extending beyond the corresponding notch 47 c , abut respectively against the lower surfaces of the retaining walls 47 a of the elastic arm restriction portions 47 , and therefore the distal end portion 44 c can hardly be displaced upward in the direction ( upward - downward direction in the drawings ) of mounting and dismounting of the room lamp 20 relative to the car body . therefore , the distal end portion 44 c of the elastic arm 44 is prevented from being turned up , and the retaining force is enhanced , so that the fixed condition will not be canceled . the car body panel , interior wall member , lamp unit , wire connection portion , wires , etc ., of the lamp unit mounting structure of the invention are not limited to their respective constructions shown in the above embodiment , and each of these can take any other suitable form on the basis of the subject matter of the invention . for example , in the above embodiment , although the room lamp , serving as the lamp unit , is attached to the roof trim serving as the interior wall member , the invention can be applied also to the cases where a map lamp is attached to a roof trim and where a lamp unit such as a courtesy lamp is attached to a door trim serving as an interior wall member covering a car body panel such as a door panel . the cable ( wires ) to be installed on the interior wall member is not limited to the ffc described in the above embodiment , and a flat circuit member , such as an fpc ( flexible printed circuit board ) and a ribbon cable , and a wire harness can be used . although the present invention has been shown and described with reference to specific preferred embodiments , various changes and modifications will be apparent to those skilled in the art from the teachings herein . such changes and modifications as are obvious are deemed to come within the spirit , scope and contemplation of the invention as defined in the appended claims .	1
susceptor in which the displacement gas is supplied via an opening in the center is shown in fig1 . the wafer 1 rests on a susceptor 2 . to load the wafer 1 into and out of the reactor , it can be lifted off the susceptor as a result of the wafer lift 5 being raised , with the result that the lift pins 3 ( of which only one is shown ) and therefore the wafer 1 are lifted . the susceptor is held by a susceptor support 4 , which can generally be rotated . in this case , the support 4 is designed in such a way that it is in contact with the susceptor 2 at least in the center . it is now possible to supply a displacement gas 6 through a bore 10 along the central axis 9 . the “ device for mechanically manipulating the substrate ” is in the case the central axis 3 for rotating the susceptor 2 and the substrate . susceptor in which the displacement gas is supplied via bores 11 in the lift pins as shown in fig2 . as in fig1 except that in this case the “ device for mechanically manipulating the substrate ” used for supplying gas is a lift mechanism for raising the substrate 1 off the susceptor 2 . the displacement gas 6 is supplied via the wafer lift 5 and the bore 11 in the lift pins 3 ( of which only one is shown , by way of example ). for illustration purposes , the bore 10 disclosed in fig1 in the center of the susceptor is closed . however , it is also conceivable for the displacement gas to be supplied both via the lift pins 3 and via the susceptor support 4 . preferred embodiment of the edge region of the susceptor as shown in fig3 . according to a preferred embodiment of the invention , the displacement gas , on account of a slight excess pressure , flows around the wafer edge 1 a . on the front surface , the small quantity of displacement gas flowing is mixed and diluted with the carrier gas . a possible further reduction of displacement gas in the region of the front surface after it has flowed around the edge 1 a of the wafer 1 can be achieved by passages 7 being arranged in the outer periphery of the susceptor 2 , allowing at least a partial flow of the displacement gas into the rear region of the wafer . these passages can be used in combination with each of the preferred embodiments of the susceptor . after the wafer 1 has been placed onto the susceptor 2 , a cavity 8 is formed , this cavity being closed apart from possible passages for a lift mechanism , for example lift pins 3 . the images shown are oriented , by way of example , to the design of the lift mechanism and susceptor holder produced by applied materials . possible realizations of susceptors as shown in fig1 to 4 can , however , also be adapted to systems produced by other manufacturers by means of suitable modifications . if the process according to the invention , for example on account of the gas flows or the nature of the susceptor used , leads to locally varying deposition rates during the epitaxy process , undesirable effects of this type are preferably compensated for by controlled optimization of the power of the heating sources on the front and back surfaces of the wafer . in the case of a particularly short process duration , i . e . for example in the case of thin epitaxial layers , a further embodiment of the invention can be used : a “ dish - like ” susceptor ( fig4 ) with lift mechanism but without bores , apart from those which may be required for producing the lift mechanism , is used , the semiconductor wafer resting on this dish - like susceptor only at the edge . therefore , there is a closed cavity which is separated from the remainder of the volume of the reactor chamber between the semiconductor wafer and the susceptor . at any desired point prior to the beginning of the deposition of the epitaxial layer , at least that part of the reactor chamber which is connected to the wafer back surface is purged with the displacement gas , with the semiconductor wafer raised , i . e . resting on the lift mechanism . during the purging or thereafter , the lift mechanism is lowered , the semiconductor wafer is placed onto the edge of the susceptor and as a result some of the displacement gas is enclosed in the cavity between the dish - like susceptor and the semiconductor wafer . the purging step may take place as early as before or during any pretreatment of the semiconductor wafer , for example a thermal pretreatment and / or a vapor - phase etch or also between any pretreatment and the actual deposition . the purging step may affect either the entire reactor chamber or only a part , for example separated off by chamber dividers , of the reactor chamber , although this part must include the gas space on the back surface of the semiconductor wafer . it is only important for the semiconductor wafer already to be resting on the edge of the susceptor when the deposition of the epitaxial layer commences , so that there can substantially no longer be any gas exchange between the enclosed cavity and the remainder of the reactor chamber . then , process gas is introduced into the reactor chamber and the epitaxial coating of the wafer front surface is carried out . furthermore , the back surface of the semiconductor wafer comes into contact only with the enclosed displacement gas . in this embodiment , it is sufficient for only the losses of displacement gas which are caused by points in the cavity which are not sealed , for example the bores for the lift pins , to be compensated for . these losses are compensated for by a controlled supply of displacement gas into the cavity . however , it is particularly preferable for the cavity between wafer back surface and dish - like susceptor to be made substantially sealed , so that it is possible to dispense with a supply of displacement gas into the cavity during the epitaxy process . then , only process gas is supplied during the epitaxy process . however , the entire process may at most lead to an enrichment of 5 % by volume of hydrogen in the cavity between the wafer back surface and the susceptor , and consequently this embodiment can be employed advantageously in particular for very short epitaxy processes . the process for producing an epitaxial layer on a semiconductor substrate may , in addition to the actual deposition , comprise further steps for pretreatment and aftertreatment ( e . g . bake , vapor - phase etch ) and any desired purging steps . in the treatments and the purging steps it is possible for either the entire volume of the reactor chamber or only certain parts , which are separated from the remainder of the volume of the reactor chamber by chamber dividers , to be exposed to the displacement gas . the extent to which the front surface can be exposed to the displacement gas is dependent in particular on the treatment step . however , it is also preferable for the wafer back surface to be acted on by the displacement gas during the pretreatment and aftertreatment . as a result , by way of example , contact of the wafer back surface with hydrogen during the bake or with etching gas during the vapor phase etch is substantially avoided . this has a number of advantages : firstly , even during the pretreatment increased outdiffusion of dopants on the wafer back surface and in the region of the wafer edge through contact with hydrogen is prevented . secondly , contact of the wafer back surface and the wafer edge with etching gas during the vapor phase etch is avoided , which contact would lead to inhomogenous removal of semiconductor material and would therefore contribute to the formation of the back - surface halo . moreover , the susceptor is prevented from being chemically attacked by the etching gas , which would require the susceptor to be reworked or exchanged from time to time . the preferred embodiment of the invention described therefore leads to an increase in the service life of the susceptor . a silicon wafer with a diameter of 300 mm and a resistivity of 10 mωcm was homoepitaxially coated in an epitaxy reactor at 1100 ° c . during the coating , the silicon wafer was rotated about its center axis at 32 revolutions per minute . the flow of hydrogen was 50 slm ( standard liters per minute ), the flow of trichlorosilane was 17 slm and the flow of diborane was 150 sccm ( standard cubic centimeters per minute ). under these conditions , a 3 μm thick , boron - doped silicon layer with a resistivity of 5 ωcm was deposited . according to the invention , argon was supplied during the epitaxial coating below the center of the silicon wafer , as shown in fig1 . the radius of , the feed was 1 cm . the recess in the susceptor ( pocket ) was designed in such a way that the distance between wafer back surface and the lowest point of the susceptor was 0 . 5 mm . the argon flowed in below the silicon wafer at a volumetric flow rate of 180 sccm . under these conditions , a radial resistance variation on the front surface of the epitaxially coated silicon wafer of & lt ; 5 % was achieved . the invention can be used in the context of the epitaxial coating of semiconductor wafers , preferably of silicon wafers with a diameter of ≦ 100 mm . the epitaxial coating may take place at atmospheric pressure or reduced pressure . however , it is also possible to apply the principle as part of other single - wafer processes which deposit or remove , i . e . etch , material on one side and in which a carrier gas is required by the deposition or etching chemistry . accordingly , while a few embodiments of the present invention have been shown and described , it is to be understood that many changes and modifications may be made thereunto without departing from the spirit and scope of the invention as defined in the appended claims .	8
referring more specifically to the drawings , for illustrative purposes the present invention is embodied in the apparatus generally shown in fig1 through fig1 . it will be appreciated that the apparatus may vary as to configuration and as to details of the parts , and that the method may vary as to the specific steps and sequence , without departing from the basic concepts as disclosed herein . the present invention generally involves a method in which the image of a light point is represented by a circle by using the properties of propagation of light in biaxial crystals close to the optical axis . theoretically , optical propagation in biaxial crystals is specific due to the existence of a conical singularity ( internal conical refraction ) and a toroidal ring ( external conical refraction ) of the dispersion surface , as described in berry , m . v ., previously incorporated by reference . this specificity creates a behavior of the light propagation different from those obtained in any other media ; this behavior cannot be fully accounted on by using geometrical optics formalism . in more practical terms , the light propagates in ways different from the normal behavior in other media , opening the way to new effects , methods and devices . fig1 illustrates a schematic view of a basic setup of the system 10 of the present invention . an emitting point 12 is positioned at the entrance or input face 14 of biaxial crystal 16 . a cone of light 18 emerges from the light point 12 , with the light propagating along the optical axis , or optical path z , of the biaxial crystal 16 . the light emerges at the exit face 20 of crystal 16 , and is observed at a plane 22 down the optical path via an instrument such as a detector , microscope objective , or the like . as shown in fig2 , the light emerges at the exit face 20 as two concentric bright thin rings or circles , e . g . outer circle 30 and inner circle 32 , with a dark circle 34 between them , also known as poggendorff rings . thus , a single point is transformed in a thin ring structure . the ring structure shown in fig2 has peculiar properties due to the singular behavior of the light inside the crystal 16 . the dark circle 34 is caused by an inherent sign - change in the amplitude as in a phase mask . this transformation is done with a minimal loss of energy . the relative intensity and shape of the pattern depends on the emission light angular light distribution and on the position of the observation plane 22 . different light shaping strategies may be used in order to create circles with predetermined light distribution at the observation plane 22 . fig3 and 4 illustrate the simulated behavior of poggendorff rings amplitude and intensity distribution , with parameters r o = 1 mm , w = 50 μm , and z = 0 the simplest case is a focused pinhole imaged through a microscope objective . at the poggendorff dark ring 34 , ( point b ) the amplitude reverses its sign and at the corresponding point in fig4 the intensity is a zero crossing . the position of the dark ring zero is a stable topological feature and is present in all poggendorff rings . the amplitude distribution of the rings will differ from the image intensity in any regular linear optical device . measurement of the center of a ring removes a major source of error in the measurement of the position of a point ; i . e ., pixel quantization error . this error occurs in the common case that the point size is comparable to the pixel size . in a spot measurement , the photons will fall on a single pixel or a small number of pixels . the subpixel information is washed out and can be only partially recovered in special cases , necessitating a huge oversampling of the image . even if such a solution is acceptable in large astronomical systems — as gaia — it may be impracticable for industrial systems . in measuring the center of a ring , a dithering effect exists , and the discretization error is averaged out along the circumference of the ring . in one embodiment of the invention , using coherent light , the following two mathematical actions are performed simultaneously on the light distribution : 1 . two - dimensional image information is high - pass filtered , removing the background and low frequency components ; and 2 . the light point ( e . g . point 12 in fig1 ) is transformed into a thin circle . both of these two steps are performed optically . for an ensemble of light points or small features , the first step will remove the fixed and slowly varying background , while the second step transforms the light input into a pattern well fitted for accurate position measurement . the method allows for the lateral positioning of the points to be accurately recovered , because the center of a circle can be retrieved more accurately then the position of a point . the pattern is quite stable within a large defocusing range . fig5 illustrates a concentric circles test pattern . a small circle , e . g . 50 or 52 , also creates also an image pattern of poggendorff rings . the rings , for a circle , are separated by a value close to the circle radius . fig6 illustrates an “ arrow and target ” test pattern characterized by a point 56 and circle 58 . p and q denote center points of the circles ( or point 56 for “ arrow and target ” test pattern ). the case of two concentric rings , or a point and a circle , is of significant practical interest , e . g . for overlay pattern in semiconductor applications or other applications . the image for a point and a circle is represented in fig7 , which illustrates the superposition of poggendorff rings of a point ( the innermost ring 60 ) and a small circle ( the outermost ring 62 ). this pattern provides a very sensitive measurement of the misfit between the two layers , and the geometry is well adapted to retrieve even small departures from concentricity . for a small target , a circularly polarized incoming light in a biaxial crystal creates two separate waves , with inverse handiness . these waves are ( 1 ) a fundamental wave and ( 2 ) a vortex wave . the fundamental wave has the same handiness as the incoming polarization , while the vortex wave has a circular polarization with the opposite handiness to the incoming polarization . the vortex wave carries information on a spatially filtered version of the input . the resulting light distribution is a convolution of a filtered version of the image with poggendorff ring distribution ; i . e ., every point is converted to a finite - width ring as illustrated in fig2 . by removing the fundamental wave with an adequate circular polarizer , it is possible to remove the background from the image and to keep a coded version of the incoming filtered image . in this coded image , each point is transformed to a large circle . for imaging microscopy , a numerical deconvolution is needed to retrieve the original image . the resulting image may indeed contain more details than in standard microscopy . for automated microscopy , when the object is a cloud of points , the image can be processed directly without needing full deconvolution . note also that the rings became thicker as a function of longitudinal position but keep the basic symmetry . by a proper choice of the optical parameters , the useable depth of field may be larger then in an imaging configuration . with regard to implementation of the invention , several industrial and natural biaxial crystals are available . the developments in the field of non - linear , optical parametric oscillators , frequency doubling and molecular optics have yielded a large number of new industrial biaxial crystals . these crystals are available in large sizes in different transmission ranges , suitable for the proposed applications . exemplary crystals include , ktp , pom , bibo , lap , lbo , knbo 3 , dast , mbanp , aanp , ycob and mdt . table 1 summarizes the properties of some of the organic and inorganic biaxial crystals . a more detailed description of these crystals and their properties may be found in hansson , g ., et al ., transmission measurements in ktp and isomorphic compounds . applied optics , 2000 . 39 ( 27 ): p . 5058 - 5069 , zhang , w . q ., femtosecond second and third harmonic light generation in biaxial crystal ktp . optik , 1997 . 104 ( 3 ): p . 87 - 91 , hellstrom , j ., et al ., optical parametric amplification in periodically poled ktiopo 4 seeded by an er - yb : glass microchip laser . optics letters , 2001 . 26 ( 6 ): p . 352 - 354 , hierle , r ., j . badan , and j . zyss , growth and characterization of a new material for nonlinear optics — methyl - 3 - nitro - 4 - pyridine - 1 - oxide ( pom ). journal of crystal growth , 1984 . 69 ( 2 - 3 ): p . 545 - 554 , eimerl , d ., et al ., deuterated l - arginine phosphate — a new efficient nonlinear crystal . ieee journal of quantum electronics , 1989 . 25 ( 2 ): p . 179 - 193 , meier , u ., et al ., dast a high optical nonlinearity organic crystal synthetic metals , 2000 . 109 ( 1 - 3 ): p . 19 - 22 , rai , r . n ., et al ., crystal morphology , solubility , optical and nonlinear optical studies of dast crystals grown from different solvents . journal of the chinese institute of chemical engineers , 2002 . 33 ( 5 ): p . 461 - 468 , kaminskii , a . a ., et al ., monocrystalline 2 - adamantylamino - 5 - nitropyridine ( aanp )— a novel organic material for laser raman converters in the visible and near - ir . japanese journal of applied physics part 2 - letters , 2002 . 41 ( 6a ): p . l603 - l605 , taima , t ., k . komatsu , and t . kaino , novel crystallization method : ring - heater heated pedestal growth method for nonlinear optical organic material . journal of nonlinear optical physics & amp ; materials , 2002 . 11 ( 1 ): p . 49 - 55 , tomaru , s ., et al ., nonlinear optical - properties of 2 - adamantylamino - 5 - nitropyridine crystals . applied physics letters , 1991 . 58 ( 23 ): p . 2583 - 2585 , li , l . x ., et al ., growth and spectra of ycob and nd : ycob crystals . crystal research and technology , 2000 . 35 ( 11 - 12 ): p . 1361 - 1371 , and vivien , d ., et al ., crystal growth and optical properties of rare earth calcium oxoborates . journal of crystal growth , 2002 . 237 : p . 621 - 628 , each of which is incorporated herein by reference in its entirety . several crystals have absorption range in the uv going down to 220 - 250 nm . lbo is the only crystal with transmission at 193 nm ; lbo transmission threshold is 155 nm and so , lbo crystals may be used even at 157 nm . the dast crystal is the most potent biaxial crystal , is currently the only biaxial crystal reaching an angle of more than 8 . 5 degrees , and is currently produced industrially in small sizes . pom , knbo 3 mdt crystals are also produced industrially , and can reach a size of 5 mm × 5 mm × 20 mm thus making them suitable for microscopy applications . fig8 schematically illustrates light propagation theory in biaxial crystals . for a circularly polarized incoming light , for a centrosymmetric object , an incoming light distribution is defined , d 0 ( r , 0 ), at the plane z = 0 ( i . e . input face 14 ), in terms of a displacement electrical vector d . the coordinates used are transverse cone - centered coordinates { x , y , z }={ r , z }. d ( r , z )= b 0 ( r , r 0 , z ) d r − i exp ( iθ p ) b 1 ( r , r 0 , z ) d l , ( 1 ) where b 0 ( r , r 0 , z ) and b 1 ( r , r 0 , z ) are the fundamental and vortex waves , and : 1 . the circular right and left polarization eigenmodes are denoted by d r and d l . 2 . z is an equivalent optical path , corrected by the index of refraction . 4 . r 0 is the radius of the cylinder of refraction 24 beyond the crystal 5 . θ r is an azimuthal angle of the r vector in the transverse cone - centered coordinates ( fig5 ). note that the two waves b 0 ( r , r 0 , z ) and b 1 ( r , r 0 , z ), have different properties . the fundamental wave , b 0 ( r , r 0 , z ), has the same polarization as the incoming light distribution ; its transfer function at p = 0 , for a constant light distribution and for low frequency components ( p & lt ;& lt ; 1 / r 0 ) is unity . on the other hand , the vortex wave , b 1 ( r , r 0 , z ), has a polarization orthogonal to the incoming light distribution . its transfer function at p = 0 is zero . an additional azimuthally dependent phase shift is superposed on the vortex wave . the vortex wave creates a high pass filtered version of the input light distribution , with a limiting spatial frequency equal to 1 / r 0 . using a suitable circular polarizer it is possible to choose either the fundamental or the vortex wave accordingly . consider an incoming field distribution composed of background and signal terms : d 0 ( r , 0 )= c d c ( r , 0 )+ q d 0 ( r , 0 ), ( 2 ) where d c ( r , 0 ) represents a constant background , either in the form of a step function or an apodized function , and where d 0 ( r , 0 ) represents a small optical feature modelized either as a fermi - dirac or gaussian spot . the parameter q characterizes the signal to background ratio . for a faint amplitude object q is small , real and positive , for a faint absorption object q is negative and for a faint phase object q is small and imaginary . we simulated numerically the background and signal terms separately for the fundamental and vortex waves using the equations described by berry [ 1 ]. because the spatial background frequency is below 1 / r 0 , the energy of the background is concentrated in the fundamental wave , with some energy present in the vortex wave at the edges of the background in the region between ( w − r 0 ) and ( w + r 0 ). fig9 illustrates the fundamental wave for a step function background of extent w , represented by an arrow , without apodization ( i . e . a lens treatment configured to cut down diffraction fringes that appear around bright points of light ). fig1 shows the vortex wave for a step function background of extent w , represented by an arrow . the vortex wave is noticeable only at the edge of the background , in a region between w − r0 and w + r0 . the energy leaking to the vortex wave may be reduced and smoothed by apodization ( as shown in fig1 and 12 ) or can be removed by an appropriate mask , of size below w − r 0 , in the image plane . fig1 shows a fundamental wave for an apodized background of extent w , and fig1 illustrates the vortex wave for an apodized background of extent w . the vortex wave is smaller but extends more than in the non - apodized case . as illustrated in fig1 , the signal frequency is much larger than 1 / r 0 and is split evenly between the fundamental and vortex waves . this figure presents the fundamental and vortex waves intensity , as a function of r , for a small coherently illuminated spot . the two waves are almost identical . note that the waves are hollow cylinders with radius r 0 around the spot position . fig1 is a simulated image of the intensity distribution at the output plane of the vortex wave for an object consisting of six randomly positioned spots having random intensities . note that the spots create hollow rings 70 centered at the spot &# 39 ; s projected lateral position , with the radius of the dark ring close to r 0 . the light is right circularly polarized . by adding a left - handed circular polarizer , the system efficiently removes the background and filter all spatial frequency terms smaller then 1 / r 0 . specifically , the fundamental wave is removed , the background c is subtracted and only the vortex wave , b 1 ( r , r 0 , z ), will pass through . from the foregoing discussion it can be seen that the invention has several advantages relative to the previous methods . these advantages include : 1 . background suppression : in coherent light , only a few of the existing methods provide optical background suppression . however , these methods are more cumbersome and the set - up is more complex and less robust than with the present invention . it should be noted that the background suppression will happen only for coherent and partially coherent light unlike the other features of this invention which apply also to incoherent light . 2 . geometrical pattern : the transformation of a point to a thin circle permits a precise measurement of the point &# 39 ; s position . 3 . field depth : the field depth of the measurement is larger than the lens field depth . 4 . discretization noise : the circle pattern removes a major source of noise , due to ccd discretization . 5 . diffraction limit : the pattern created is thinner then the diffraction limit in linear regular optical systems . 6 . relative positioning of two features : the method opens new possibilities to compare accurately two features such as a point and a circle or two concentric circles . it is contemplated that the present invention can be applied for single molecule detection and positioning , and / or for nanobiotechnology . for example , imaging and position sensing is a major building block required in most nanobiotechnology applications . the parameters to be measured are the presence of the molecule and its position as function of time . from these values it is possible to retrieve the dynamics of a chemical or biological process , in order to characterize and control it interactively . the present method may permit an increase in the precision of the measurement of spatial parameters . this increase can be translated , in diagnostic applications , to an improvement of the diagnostic effectiveness and reliability . in control applications the performance improvement may yield a better control of the process . another example is use of the invention with automated microscopy systems that are primarily used in pharmaceutics , medical diagnostics , and automated packaging of chips and semiconductor wafers . an increase of spatial measurement precision will be translated to an additional reliability of the process results . furthermore , many quantitative applications in microscopy can be reduced to the identification , count , position and velocity of single light points . the range of applications that can be addressed by the present invention includes fluorescent markers , particles and powders . another type of application where the present invention can be implemented includes recognition , identification , and positioning of small specific features . the ability to filter optically the background and to create a high pass filter to emphasize small features permits a better recognition and may improve the performance of these applications . still another application for the present invention is wafer alignment and for semiconductor pattern overlay . wafer positioning is the ability to measure the position of a fiducial mark on the wafer , either dynamically to control the wafer movement or statically to assert the wafer position . the advance of lithography towards nanoscales creates a challenge to alignment of wafers in real - time with adequate accuracy . semiconductor processing equipment is very expensive . the prerequisite is to be able to process as many wafers as possible in a short time . a meaningful part of the processing time is related to the loading and unloading of wafers . the positioning of a new unprocessed wafer at the right position has clear implications for the overall yield of the full system . a dynamic measurement of the wafer position for determining whether the wafer is close to the final position may permit an optimization of the final approach of the wafer . the assessment of the final position of the wafer relative to the system and the mask is also important in optimizing the process . semiconductor pattern overlay is a still further application for the invention . semiconductor pattern overlay is the measurement of vector displacement from one process level ( substrate ) to another level ( resist ), usually separated by an intermediate ( thin - film ) layer . the standard silicon wafer technology process is : 3 . etching or doping the silicon through the photopolymer pattern in order to transfer a negative replica of the pattern in the silicon . a major performance index is the ability to accurately position the photopolymer pattern relative to previous patterns already etched or doped in the silicon . this parameter is known as overlay requirement . overlay measurement involves the determination of the centerline of each structure along both the x and y axes . centerline determination uses the symmetry around the structure &# 39 ; s center such that the error associated with edge determination will tend to cancel from each side of the structure . overlay error , i . e ., the planar distance from the center of the substrate target to the center of the resist - defined target , is commonly measured using a variant of the box - in - box test structure . for the method of the present invention , either the two concentric circles ( fig5 ) or an “ arrow and target ” test structure ( fig6 ) may be used as the basic overlay pattern . for two concentric circles , a first circle 50 is positioned on the wafer and a second circle 52 is positioned on the resist . for the arrow and target , a spot 56 is positioned on the wafer and a circle 58 on the resist . the overlay error is the distance between p and q , which are the centers of the two circles or the spot and circle centers . fig1 a - c illustrate the image corresponding to an “ arrow in a target ”, i . e . a point at the center of a small circle is represented , where the point pattern is represented by the inner ring 60 and the circle pattern is represented by the outer ring 62 . superposition of poggendorff rings reveals that the two features are concentric in fig1 a , have an x - axis misfit in fig1 b and y - axis misfit in fig1 c . the poggendorff metrology method of the present invention uses the measure of the dark poggendorff ring position for metrology . by recording the position of the black poggendorff ring , the position of a point or an optical feature may be retrieved with high accuracy . the position accuracy of the dark ring is not limited by diffraction but only by photon statistics . in the present method , fiducial marks created on the wafer comprise of points or small circles with different diameters on each one of the layers . the marks are then observed through a high magnification microscope and the resulting image is passed through the crystal set - up . the resulting pattern , for each circle , is made of two concentric poggendorff rings pattern with different diameters . the poggendorff rings will create , when accurately aligned , a bull &# 39 ; s eye target ( as shown in fig5 and 6 ). such a target is very sensitive to overlay misalignment and can provide very high accuracy positioning . all overlay solutions are based today on relatively complex targets . indeed , a complex and rich motif is necessary to reach the required precision . in the method of the present invention , the target collapses to a single point or to a small circle . the complex motif necessary for the positioning accuracy is created afterwards by the conical diffraction . because the target surface on the wafer is quite small , a sizeable error source , the tool induced error is reduced . the poggendorff rings , as phase masks , are relatively insensitive to focus , removing a major uncertainty parameter in the overlay metrology system . additionally , since the pattern is created by the biaxial crystal and not as a physical pattern etched on the wafer , there will be a marked reduction in one of the major error source , the ofs — overlay mark fidelity . moreover , more targets can be added , in any unused surface on the mask , even in the active part of the chip , with minimal penalty . adding more targets reduces the unmodeled residuals error , the main error in overlay metrology . note that emerging technologies such as nano - imprints are even more dependent on the accuracy of the relative positioning of the wafer and mask . the error of positioning is today a major limit for the applications of this technology . the simplest and most commonly applied solution is to measure the position of several fiducial marks positioned at strategic points on the wafer or mask , using imaging techniques . this imaging approach is limited in precision due to diffraction and creates strong constraints on the system design due to its limited field depth . the poggendorff ring pattern can be used as the basis of a lithographic technique , e . g . poggendorff lithography , either by direct projection or through additional projection optics . if the poggendorff rings pattern is directly projected or reimaged with appropriate reduction on a negative photoresist , a ring can be created by standard lithographic techniques . the thickness will be limited only by process threshold value and not by diffraction effects . like phase mask lithography ( see levenson , m . d ., et al ., the phase - shifting mask . 2 . imaging simulations and submicrometer resist exposures . ieee transactions on electron devices , 1984 . 31 ( 6 ): p . 753 - 763 , levenson , m . d ., n . s . viswanathan , and r . a . simpson , improving resolution in photolithography with a phase - shifting mask . ieee transactions on electron devices , 1982 . 29 ( 12 ): p . 1828 - 1836 . ], incorporated herein by reference in their entirety ), an amplitude zero crossing is created artificially by the juxtaposition of two regions of opposite phases on the mask . very thin features ( as thin as 9 nm ), much below the diffraction limit , have been obtained using phase marks . however , a major difference between the present invention and other existing lithographic technologies is related to the fact that the circle is not — or not only — at the emitting point position . several points , on the same mask , may be illuminated ; a more complex pattern corresponding to coherent or incoherent superposition of these patterns can be realized in a single exposure . the method of the present invention has various additional features uncommon in lithographic techniques . as stated , the method of the method of the present invention may be configured to create a superposition of several circles using a single exposure . an array of contact holes , with potential dimensions in the low tens of nm , may be realized as the intersection of two rings for each hole , within a single exposure . in addition , the dark ring position may be more independent of focusing then existing technologies , yielding a large process window . unlike phase masks , the ring is a topological sound closed structure and does not create phase conflicts . furthermore , the circles created by the method of the present invention are geometrically perfect , depending only on the polarization quality which can be accurately controlled and limited only by the photoresist quality . the method can theoretically be performed even with low na optics . although the present description is primarily directed to the behavior of the light coming from a single point , it is appreciated that his behavior can be generalized to multipoint features . it is also important to stress that the point light distribution maybe a pinhole or a gaussian beam , as described in berry , m . v ., conical diffraction asymptotics : fine structure of poggendorff rings and axial spike . journal of optics a - pure and applied optics , 2004 . 6 ( 4 ): p . 289 - 300 , previously incorporated by reference , but many additional points may be used , including but not limited to , annular , both opaque and phase , apodized holes or any adequate circular light distribution . it should be noted that the system has to adjust to the small angle limitation of biaxial crystals . the conical diffraction occurs only for light with an angular spread of the order of the half - angle of the diffraction cone . this may necessitate in some set - ups the use of an intermediate optical system which will reduce the light pattern created by the conical diffraction system and adapt it to the dimensions of the lithographic pattern ring structures have been proposed as building blocks of nanophotonics . sub - 100 nm , circle and ring structures are also ideal for realizing zone plates for x - ray imaging and lithography . finally , sub wavelength structures are beginning to find applications as polarizer , retarder and moth eye ( antireflective ) coatings . contact holes are one of the top challenges currently found in lithography . using a ring or circle pattern , contact holes can be made by the intersection of two , or more , circles . phase shift lithography solutions need multiple exposures for realizing contact holes . indeed , phase mask lithography is based on a “ point to point ” structure , and when two features have to be superimposed , two exposures are needed . in one embodiment of the present invention , contact holes are realized using two illuminating points , at 90 degrees one from the other , using 4 points on a cross pattern or any adequate geometrical points pattern . in yet another embodiment , illustrated as system 100 in fig1 , a first biaxial crystal 102 creates a ring 106 , using conical refraction 104 through the first crystal . a mask 108 is applied , along the dark ring ( e . g . ring 34 in fig2 ), removing the external poggendorff ring ( e . g . ring 30 in fig2 ). this is due to the fact that the two rings have inverse amplitude and that the inner ring is thinner . the inner ring is then directed to the input face 110 of a second biaxial crystal 112 . it has to be reminded that a biaxial crystal has two axes , positioned symmetrically relative to the z optical axis , second biaxial crystal 112 may have its optical axis being the opposite axis of the one of the first crystal 102 . the reason for the inversion is due to the fact that the poggendorff circles are positioned with the original point being at the apex of the circle . reversing the axis permits to compensate to this feature and to superpose the dark rings of all points at the initial location of the point . the resulting light distribution is vortex - like , with a very small dark point at the center of a light distribution . the application of this set - up may also be used in maskless lithography , where the system creates a lithographic pattern point by point . this technique is developed in order to fulfill manufacturing needs of chips with smaller production quantities — as asic for example . a schematic diagram of the poggendorff lithography system 130 is shown in fig1 . a laser 132 ( e . g . an arf or krf laser emitting a beam 193 nm in the uv ), is focused on a point 136 with use of lens 134 , or similar optics available in the art . the point 136 is at the input plane 140 of a biaxial crystal 142 , ( which may comprise , for example of , lbo ). an additional imaging lens 144 is used to reimage the exit pattern in the kohler plane 146 of a lithographic system . focusing mechanism 144 is provided in order to control the size and shape of the pattern . additional optical elements , such as imaging and holographic optical elements ( hoe ) or components 148 , may be necessary to adjust the parameters of the output light distribution after the crystal 142 to the optical parameters necessitated by lithographic systems . the light distribution in the kohler plane 146 will have the structure of the above described poggendorff rings . an additional stop ( such as mask 108 in fig1 ) may be used to remove the outer ring ( or the inner ring ) to keep only a single ring as the illumination pattern . the above described system has the following distinctions advantages over existing oai techniques : coherence state : the light is fully coherent around the circle even for incoherent or partially coherent light input . this peculiar situation is due to the degeneracy of the optical properties around the conical ring . the points around the ring are indistinguishable for their optical properties one from the other — except for their polarization state . several systems which cannot be implemented using linear optics can be implemented using optical propagation in biaxial crystals due to the singular behavior of the light propagation . a striking characteristic is the degeneracy of optical properties along the ring , in the sense that the points are derived coherently from the same initial point . because of this , each point on the ring , and each angle ( αx , αy ) will have a conjugate point (− αx , − αy ) with a phase difference of either 0 ° for the fundamental wave and 180 ° for the vortex wave fully coherent with it . the illumination may still be partially coherent , but with coherence circles located around the rings . the poggendorff illumination of the present invention provides a symmetric coherent point for each off - axis illumination point . the system creates two orders — positive and negative — which interfere at the image plane . the positive order is the projection of the negative order created by the mask by the positive off - axis angle . the negative order is the projection of the positive order created by the mask by the negative off - axis angle . polarization : the polarization of the light in the present invention is rotating azimuthally . in an annular aperture the polarization of the light is fixed in a single direction . the system provides an output with an azimuthally varying polarization . the polarization is rotating in a way that two opposite points will have orthogonal polarizations . due to the requirements of lithographic illumination , an additional optical element , able to adjust the polarization to any predetermined polarization pattern will be necessary . such devices have been described previously in the literature in the visible range and can be adapted to the uv . energy : all the energy is transferred from the point to the two rings . although one of the rings is removed , most of the initial energy is recovered . the poggendorff rings are an efficient way to transfer energy from a point to a ring without much energy loss . homogeneity : the poggendorff rings of the present invention are homogeneous due to the filtering properties of biaxial crystals . indeed , the light is spread homogeneously , around the circle , by the basic effect of conical diffraction , removing fully in this direction any local variation . although the description above contains many details , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . therefore , it will be appreciated that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more .” all structural , chemical , and functional equivalents to the elements of the above - described preferred embodiment that are known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for .”	6
fig1 is a block diagram representation of one embodiment of a computer system 100 utilizing the error correction code of the present invention . in the embodiment shown , computer system 100 includes a memory 110 connected to a main storage controller ( msc ) 120 via a data bus 115 , a cache 130 connected to msc 120 via an msc - cache interface 116 , and a plurality of central processing units ( cpus ) 140 connected to cache 130 via data buses 117 . msc - cache interface 116 and data buses 117 are used to transfer data between msc 120 and cache 130 and between cache 130 and cpus 140 , respectively . transfer of data between memory 110 and msc 120 , on the other hand , occurs via data bus 115 . thus , data bus 115 facilitates the reading of data from memory 110 as well as the writing of data to memory 110 by msc 120 . a subset of the data area in cache 130 is a storage protection key area ( sp key ) 118 , which contains storage protection keys generated to assure data integrity in the cache . in accordance with the present invention , storage protection keys from key area 118 are constantly updated and stored in memory 110 , as is all data from the cache 130 . however , because storage protection keys are considered critical data that require a higher level of reliability , a more potent ecc is selected for error protection of these keys . in particular , a dec - ted code is used to correct all single or double errors , detect all triple errors and also detect a plurality of multiple errors in an encoded ecc word , as described further below . in the embodiment shown , a storage protection key consists of 7 bits . in addition , one data bit is used for encoding of the memory address parity , while another data bit is used for encoding of two special uncorrectable errors ( ues ). thus , a total of 9 data bits are required for the ecc . this leads to an ( 18 , 9 ) dec - ted code that consists of 18 bits in a code word with 9 data bits and 9 check bits . note that a special ue ( spue ) is a data validity indicator generated when the data sent out of a particular computer component to the memory is known to be bad . as the special ues come from different computer components , it is desirable to be able to identify the source that generates a particular special ue when the data associated with the special ue is fetched from the memory . fig2 shows the ecc word structure according to one embodiment of the invention . the first 7 bits ( bits 0 - 6 ) contain the original storage protection key data . the next 9 bits ( bits 7 - 15 ) are check bits generated from bits 0 - 6 and bits 16 - 17 according to the ecc equations to be described shortly . bit 16 ( spue ) is assigned for special ues . finally , an address parity bit ap ( bit 17 ) is assigned for the parity of the memory address . only the first 16 bits ( bits 0 - 15 ) are stored in memory 110 ( fig1 ). though bits 16 and 17 are used in the generation of check bits , they are not stored in memory 110 . in reading data from memory 110 , the address parity bit ap is made available to the ecc decoder , while the value of the spue bit is assumed to be zero . if , however , the syndrome decoder to be described detects an error at bit location 16 ( assuming a bit value of zero at that location ), then it determines that the spue bit is one and that bits 0 - 6 encode a spue . thus , even though the spue bit is not stored as such , it is effectively encoded in the 16 bits of the code word that are stored in memory 110 through its use in generating the check bits 7 - 15 . the value of the spue bit is 0 for a valid storage protection key . a key is marked invalid when the data received from other components of the computer system is known to be bad . in such case , the value of spue is set to 1 . conventionally , plural data bits are used in order to differentiate the sources of the bad data . in the present invention , by contrast , only one data bit ( bit 16 ) is used . to identify the source of the bad data , the associated key data bits ( bits 0 - 6 ) are modified so that different sources of bad data are represented by different pattern of bits 0 - 6 . for example , to differentiate bad data from cache 130 from bad data from msc 120 ( fig1 ), two 7 - bit patterns ( 0000000 ) and ( 1111111 ) can be assigned to bits 0 - 6 ( fig2 ). as an illustration , ( 0000000 ) may be assigned to be the pattern of bits 0 - 6 and spue bit 16 set to 1 if the bad data originated from cache 130 , while ( 1111111 ) may be assigned to be the pattern of bits 0 - 6 and spue bit 16 set to 1 if the bad data originated from msc 120 . other possible pattern pairs are ( 1010101 , 0101010 ) and ( 0001111 , 1110000 ). now suppose that one of the spue patterns is stored in memory 110 and then retrieved . in accordance with the ecc decoding method to be described , if there is no error in the memory , a unique error syndrome 010001111 is generated and the ecc decoding flags bit 16 to be in error . this indicates that the data received is associated with a spue . the pattern in bits 0 - 6 is then used to identify the original source of bad data . if there is an error in the memory in which the spue data resided , the ecc decoding would detect the presence of two errors , one of which is a memory error and the other of which is bit 16 . the error syndrome depends on the location of the memory error . in any case , the syndrome is a double error syndrome and will be decoded as such because the code is capable of correcting double errors . again , upon the error detection of bit 16 the source of the bad data can be isolated . an ecc can be specified by a set of equations that all encoded ecc words have to satisfy . let c =( c 0 , c 1 , c 2 , . . . , c 17 ) be a 1 × 18 row vector defining a code word . the ( 17 , 8 ) dec - ted code described in u . s . pat . no . 4 , 117 , 458 is a non - primitive bch code that can be lengthened by one bit to yield a ( 18 , 9 ) dec - ted code . including the all - one 18 - bit vector in the code space does this . the ( 18 , 9 ) dec - ted code of the present invention is defined by the following two equations : c 0 β 3 + c 1 β 6 + c 2 β 12 + c 3 β 7 + c 4 β 14 + c 5 β 11 + c 6 β 5 + c 7 β + c 8 β 2 ° c 9 β 4 + c 10 β 8 + c 11 β 16 + c 12 β 15 + c 13 β — + c 14 β 9 + c 15 0 + c 16 β 10 + c 17 β 0 = 0 c 0 + c 1 + c 2 + c 3 + c 4 + c 5 + c 6 + c 7 + c 8 + c 9 + c 10 + c 11 + c 12 + c 13 + c 14 + c 15 + c 16 + c 17 = 0 the additions in the above equations are performed according to the rules of the finite field of 256 elements . the first equation specifies the ( 17 , 9 ) code listed on page 494 of the above - identified work of peterson et al . and guarantees that the number of nonzero terms is at least 5 for a nonzero code word . the second equation says that the number of nonzero terms in a code word is even , since each c i is binary . as explained on page 119 of the same work , combining both equations means that the number of nonzero terms of a nonzero code word is at least 6 , i . e ., the hamming distance of the code is 6 . note that the first equation involves all 17 unique powers of β . in this first equation , the terms of the powers of β are not arranged in a sequential order . however , the ordering is not critical ; any ordering works . the symbol β in the above equations is a primitive root of x 17 − 1 in the finite field of 256 elements . specifically , β = α 15 , where α is a root of the binary primitive polynomial x 8 + x 7 + x 6 + x + 1 . the same code space can be defined using an irreducible polynomial . however , in practical application , the particular choice presented here has been empirically shown to lead to a simpler implementation . notice that α is primitive element of the finite field of 256 elements , and β is also an element of the same finite field . the above equations that define the ecc can be expressed in matrix form as ch t = 0 , where h t denotes the transpose of the matrix h : β 3 β 6 β 12 β 7 β 14 β 11 β 5 β 1 b 2 β 4 β 8 β 16 β 15 β 13 β 9 0 β 10 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 . it can be shown that the code defined by matrix h is a dec - ted code . in addition , the columns of the matrix can be permuted in any order without reducing the capability of error correction and error detection . the finite field elements in matrix h can be expressed in binary vectors to facilitate implementation using digital circuitry . specifically , matrix h can be transformed into a 9 × 18 binary matrix h 1 : the derivation of h 1 from h maybe briefly explained . assume , as before , that α is a root of x 8 + x 7 + x 6 + x + 1 and β = α 15 . then a power of β can be expressed as a polynomial in terms of the powers of α . the coefficients of the polynomial are a binary 8 - bit vector listed in the first 8 bits of a column vector in the h 1 matrix above . now , the field element 1 corresponds to the 8 - bit vector 10000000 . the second row of the h matrix above is an all ones vector . it is translated into a 8 - row binary matrix with the first row being all ones and the rest of the rows being all zeros , which can be discarded . this explains how the original matrix is translated into a 9 - row binary matrix . however , the last row of the h 1 matrix above is not all ones . the all ones row vector has been replaced by the sum ( exclusive or ) of all 9 row vectors so that each column contains an odd number of ones . if you add all 9 row vectors together , you obtain an all ones vector . there is no difference in the spaces defined by h and h 1 . in reading data from the memory , matrix h 1 is used to check if an 18 - bit received vector r is a legitimate code word by calculating the syndrome s by the formula s = rh 1 t , where h 1 t is the transpose of the vector h 1 . vector r is assumed to be a code word if the syndrome s is an all zeros vector . if s is not an all zeros vector , the ecc decoder to be described is used to determine if r contains one or two errors and also to determine the associated error positions . the decoder is also used to determine if r contains detectable uncorrectable errors ( ues ), which include the set of all triple errors and some higher - order errors that are also detectable , though not correctible . let s =( s 0 , s 1 , s 2 , . . . , s 8 ). the received bits marked with the ones in row i of matrix h 1 are summed together using exclusive or ( xor ) operations to obtain the value of s i . specifically , the syndrome bits are obtained by the following formulas . s 0 = xor of input bits 2 , 3 , 4 , 6 , 11 , 12 , 13 , 17 s 1 = xor of bits 4 , 5 , 6 , 7 , 9 , 16 s 2 = xor of bits 0 , 1 , 2 , 5 , 7 , 8 , 10 , 11 , 12 , 13 s 3 = xor of bits 2 , 4 , 7 , 9 , 11 , 14 s 4 = xor of bits 0 , 4 , 11 , 12 , 13 , 14 s 5 = xor of bits 1 , 2 , 6 , 7 , 11 , 12 , 13 , 16 s 6 = xor of bits 2 , 3 , 6 , 7 , 8 , 10 , 11 , 12 , 14 , 16 s 7 = xor of bits 0 , 1 , 2 , 3 , 5 , 7 , 8 , 16 s 8 = xor of bits 2 , 4 , 6 , 7 , 9 , 10 , 11 , 13 , 15 , 16 . ( 2 ) let us label the columns of matrix h 1 as columns 0 , 1 , . . . , 17 . for the generation of check bits , h 1 is multiplied by the inverse of the matrix formed by its columns 7 - 15 to obtain the matrix h 2 . notice that columns 7 - 15 of h 2 form a 9 × 9 identity matrix . the value of each check bit is calculated from a row vector of h 2 . let c =( c 0 , c 1 , c 2 , . . . , c 17 ) be a code word . since for a properly formed code word c , ch 2 t = 0 , each row of h 2 is in effect a statement that the xor sum of a given check bit and the data bits indicated by the ones in the row is zero or , equivalently , that the check bit is the xor sum of those data bits . given the values of bits 0 - 6 and bits 16 - 17 in the code word , the values of bits 7 - 15 are calculated from the following responding to the rows of h 2 ) in terms of exclusive or operations : c 7 = xor of bits 1 , 3 , 4 , 16 , 17 c 8 = xor of bits 0 , 2 , 4 , 5 , 17 c 9 = xor of bits 1 , 3 , 5 , 6 , 17 c 10 = xor of bits 2 , 4 , 6 , 16 , 17 c 11 = xor of bits 0 , 3 , 5 , 16 , 17 c 12 = xor of bits 0 , 1 , 4 , 6 , 17 c 13 = xor of bits 1 , 2 , 5 , 16 , 17 c 14 = xor of bits 0 , 2 , 3 , 6 , 17 c 15 = xor of bits 0 , 1 , 2 , 3 , 4 , 5 , 6 , 16 , 17 . ( 4 ) to calculate the check bits above , it is not necessary to obtain an explicit value for a generator matrix g . however , it can readily be shown ( see , e . g ., chapter 3 of the peterson et al . reference identified above ) that matrix h 2 is a parity check matrix for a code having the following a generator matrix g : columns 0 - 6 and 16 - 17 of g form an identity matrix , while columns 7 - 15 form the transpose of the matrix formed by columns 0 - 6 and 7 - 15 of h 2 . since columns 0 - 6 and 16 - 17 of g form an identity matrix , bits 0 - 6 and 16 - 17 of a code word c are simply the corresponding bits of the original data word ( hence their label as information bits ). check bits 7 - 15 may alternatively be calculated using columns 7 - 15 of generator matrix g ( with the bits spue and ap being regarded as bits 7 and 8 of the original data word ). since columns 7 - 15 of g are simply the transpose of the matrix formed by columns 0 - 6 and 7 - 15 of h 2 , the resulting xor operations are identical to the operations ( 4 ) set forth above . as described earlier , the syndrome s of a received vector r is used in the decoding to determine the nature of the errors if s is not zero . let sp be the parity of the syndrome bits . that is , sp is the xor of all 9 syndrome bits . since each column of the parity check matrix h 1 contains an odd number of ones , an error in any one bit of the received vector r will invert ( i . e ., flip ) an odd number of syndrome bits , thereby inverting their xor sum sp . accordingly , sp = 0 if there is an even number of errors in r , and sp = 1 if there is an odd number of errors in r . thus , the decoder can easily determine whether the number of errors is even or odd . if the number of errors is odd , the decoder assumes that there is one error and it goes on to determine the single error position . on other hand , if the number of errors is even , the decoder assumes that there are two errors and it goes on to determine the locations of two errors . single error position is relatively easy to determine . if the first 8 bits of column i of h 1 are identical to the first 8 syndrome bits , then bit i is identified as the single error location . double error positions are not trivial to identify . an equation with the error locations as unknown variables has to be derived and solved . let x 1 and x 2 be two unknown variables representing the error locations in terms of the finite field of 256 elements . each variable is either a power of β or 0 . let s 1 be the first 8 bits of the syndrome and consider s 1 as an element of the finite field . from the first row of matrix h and the equation hc t = 0 , the syndrome is related to the error locations x 1 and x 2 by the equation s 1 = x 1 + x 2 . in addition , it can be shown that error locations x 1 and x 2 are roots of x 18 − x . that is , x 1 18 − x 1 = 0 and x 2 18 − x 2 = 0 . combining all these relations , it can be shown that x 1 and x 2 are solutions to the following equation with x as the unknown variable . the values of x 1 and x 2 are obtained by solving equation ( 5 ) for x . special attention is required in the case that one of the two errors is located at bit 15 , which has a 0 as the field element in matrix h . in this case , equation ( 5 ) is not used . instead , s 1 is treated as a single error syndrome , and the second error location is identified by matching s 1 with the column vectors of the first 8 rows of h 1 . let e i be the error indicator for bit i with the property that e i = 0 if bit i is not in error and e i = 1 if bit i is in error . the decoder is used to generate the values of e i for all bit positions . one decoding algorithm ( algorithm a ) is described below : 1 . if all 9 - syndrome bits are zero , there is no error and the received data is not altered . exit the algorithm . 2 . set e 15 = 1 if ( a ) s 1 = 0 and sp = 1 ; or ( b ) s 1 17 = 1 and sp = 0 , where s 1 is the first 8 bits of the syndrome s and is considered a field element , and sp is the exclusive or sum of all syndrome bits . 3 . for 0 ≦ i ≦ 17 and i ≠ 15 : set e i = 1 if ( a ) s 1 = column i of the first 8 rows of h 1 and s 1 17 = 1 ; or ( b ) the field element x i of column i of the first 8 rows of h 1 satisfies x i 16 s + x i s 1 16 = s 1 17 , s 1 17 ≠ 1 , s 1 ≠ 0 , and sp = 0 . 4 . set ue = 1 if ( a ) s 1 17 ≠ 1 , s 1 ≠ 0 and sp = 1 ; or ( b ) s 1 17 ≠ 1 , sp = 0 and there is no solution to x i 16 s 1 16 = s 1 17 . if the value of e 16 obtained from algorithm a is 1 , the received data r is a spue . in this case , the data bits in bits 0 - 6 after error correction are used to determine the nature of the spue , which results in failure isolation . the components of the 8 - bit vector s 1 17 are not independent . it can be shown that bits 0 , 1 , 2 , and 4 are linearly independent and that the remaining 4 bits can be derived from these independent bits . ( more generally , the exact positions of the independent bits depend on the polynomial defining the field , but the number of independent bits is always 4 .) thus , s 1 17 can be replaced by s 1 17 ( 0 , 2 , 4 ), which represents bits 0 , 1 , 2 , 4 of s 1 17 in algorithm a . these 4 bits can be obtained from the following formulas : s 1 17 ( 0 )= xor of s ( 0 ), s ( 2 ), s ( 3 ), s ( 6 ), s ( 0 ) s ( 1 ), s ( 0 ) s ( 5 ). s ( 0 ) s ( 7 ), s ( 1 ) s ( 2 ), s ( 1 ) s ( 6 ), s ( 1 ) s ( 7 ), s ( 2 ) s ( 4 ), s ( 2 ) s ( 6 ), s ( 3 ) s ( 6 ), s ( 3 ) s ( 7 ), s ( 4 ) s ( 5 ), s ( 4 ) s ( 7 ) s 1 17 ( 1 )= xor of s ( 1 ), s ( 3 ), s ( 4 ), s ( 7 ), s ( 0 ) s ( 2 ), s ( 0 ) s ( 3 ), s ( 0 ) s ( 6 ). s ( 1 ) s ( 2 ), s ( 1 ) s ( 6 ), s ( 2 ) s ( 3 ), s ( 2 ) s ( 7 ), s ( 3 ) s ( 5 ), s ( 3 ) s ( 7 ), s ( 4 ) s ( 7 ), s ( 5 ) s ( 6 ) s 1 17 ( 2 )= xor of s ( 1 ), s ( 2 ), s ( 5 ), s ( 0 ) s ( 1 ), s ( 0 ) s ( 5 ), s ( 0 ) s ( 6 ), s ( 0 ) s ( 7 ), s ( 1 ) s ( 3 ), s ( 1 ) s ( 5 ), s ( 2 ) s ( 5 ), s ( 2 ) s ( 6 ), s ( 3 ) s ( 4 ), s ( 3 ) s ( 6 ), s ( 3 ) s ( 7 ), s ( 4 ) s ( 7 ), s ( 5 ) s ( 7 ) s 1 17 ( 4 )= xor of s ( 1 ), s ( 2 ), s ( 3 ), s ( 4 ), s ( 6 ), s ( 0 ) s ( 1 ), s ( 0 ) s ( 2 ), s ( 0 ) s ( 4 ), s ( 0 ) s ( 5 ), s ( 1 ) s ( 2 ), s ( 1 ) s ( 4 ), s ( 1 ) s ( 5 ), s ( 1 ) s ( 6 ), s ( 2 ) s ( 3 ), s ( 2 ) s ( 4 ), s ( 2 ) s ( 5 ), s ( 2 ), s ( 4 ) s ( 5 ), s ( 4 ) s ( 6 ), s ( 5 ) s ( 7 ), s ( 6 ) s ( 7 ) ( 6 ) in equation ( 6 ), s ( i ) denotes bit i of the syndrome s and s ( i ) s ( j ) is the product of s ( i ) and s ( j ). one embodiment of the hardware implementation of the ecc encoding and decoding is described next . fig3 a shows an encoder 200 for ecc encoding . input data ( data in ) 210 consists of the 7 - bit storage protection key data to be encoded . two other inputs to the encoder 200 are the special uncorrectable error bit spue and the memory address parity bit ap shown in fig2 . the key data 210 is sent to a modification circuit ( data modified ) 240 that has spue as the other input . if spue is 0 , the key data 210 is not modified . on the other hand , if spue is 1 , circuit 240 modifies the key data 210 according to the pre - defined spue data patterns as described above . the output of circuit 240 appears as output data ( data out ) 220 . it is also sent to an check symbol generator 250 comprising an xor gate array containing xor circuits 260 - 268 ( xor 0 - xor 8 ). xor circuits 260 - 268 generate check bits according to equation ( 4 ). thus , fig3 b illustrates the generation of check bit 0 ( bit 7 of the encoded word ) using xor circuit 260 according to equation ( 4 ). the output of the xor gate array 250 appears as check bits 230 . bits 0 - 15 of the encoded ecc word ( bits 0 - 17 ) consist of the output data 220 ( bits 0 - 6 ) and check bits 230 ( bits 7 - 15 ). as noted above , bits 0 - 15 of the code word are stored in memory 110 , while bit 16 ( spue ) is assumed to be zero and bit 17 ( ap ) of the code word is independently regenerated when bits 0 - 15 of the code word are later read out of the memory 110 . fig4 is a block diagram of a decoder 300 for data read from memory 110 . the received 16 - bit word is stored in an input register ( data in ) 400 , of which the first 7 bits represent the data bits and the last 9 bits represent the check bits . the entire 16 - bit word in input register 400 is sent to a syndrome generator ( syndrome gen ) 500 that has the address parity bit ap as another input . ( since spue information is not available , it is assumed to be zero .) syndrome generator 500 generates as an output all 9 syndrome bits , which are sent to a syndrome decoder ( syndrome decode ) 600 for the generation of error location indicators e i and a one - bit uncorrectable error indicator ue . the error indicators e i for 0 ≦ i ≦ 6 from syndrome decoder 600 and the 7 data bits from input register 400 are xored bitwise by a data correction circuit 700 to produce corrected output data . fig5 a shows the syndrome generator 500 . the inputs are the 16 received bits — 7 data bits ( 0 - 6 ) and 9 check bits ( 7 - 15 )— stored in input register 400 and the ap bit ( 17 ). the 9 - bit output is stored in a syndrome register ( syndrome reg ) 520 . the 9 syndrome bits are generated by xor blocks 530 - 538 , each of which contains logic for performing an xor operation specified in equation ( 2 ). fig5 b shows , by way of illustration , the input bits ( 2 - 4 , 6 , 11 - 13 , ap = 17 ) for xor block 530 , which generates syndrome bit 0 . notice that bit 17 appears only once in equation ( 2 ); only xor block 530 takes ap as an input . fig6 shows the syndrome decoder 600 , which generates the error indicator e 15 as well as error indicators e i for i ≠ 15 in accordance with steps 2 and 3 , respectively , of algorithm a . although not shown in fig6 , syndrome decoder 600 also contains uncorrectable error ( ue ) detection logic 660 ( fig8 ) for generating an uncorrectable error ( ue ) signal indicating the presence of an uncorrectable error . in this figure , for i ≠ 15 , e 1 , i = 1 indicates that s 1 = column i of the first 8 rows of h 1 , while e 2 , i = 1 indicates that the field element x i of column i of the first 8 rows of h 1 satisfies the equation x i 16 s + x i s 1 16 = s 1 17 . each and block 632 - 636 logical and of its inputs , while each or block 641 - 643 outputs the logical or of its inputs and each inverter block 651 - 653 ( denoted by a triangle ) outputs the logical inverse of its input . a syndrome parity bit sp is generated by an xor circuit 602 that outputs the exclusive or of all 9 syndrome bits , stored in a syndrome register ( syndrome s ) 601 . also , a vector s 1 ( 603 ) is extracted as the first 8 bits of the syndrome vector s . single error location logic 610 performs the function of matching input s 1 ( 603 ) with the column vectors of the first 8 rows of h 1 of equation ( 1 ). the output bits are single error indicators e 1 , i . fig7 illustrates by way of example the circuit for generating the single error indicator e 1 , 0 . ( the triangles in the figure denote logical inverters .) the circuit matches an 8 - bit input ( 0 - 7 ) with column 0 of the first 8 rows of h 1 to produce an output e 1 , 0 of 1 if and only if each input bit matches the corresponding bit of that column of h 1 . logic 630 in fig6 generates as the output s 1 17 ( 0 , 1 , 2 , 4 ) for bits 0 , 1 , 2 , and 4 of s 1 17 according to equation ( 6 ). this generated output is used to represent s 1 17 . double error location logic 620 generates the double error indicators e 2 , i . the inputs to logic 620 include s 1 17 ( 0 , 1 , 2 , 4 ) from logic 630 and s 1 ( 603 ). the outputs e 2 , i of logic 620 are generated as follows . logic 620 first generates a set of comparison bits fi from syndrome bits 0 - 7 according to the following formulas : f 14 = xor of syndrome bits 4 , 5 , 6 , f 21 = xor of syndrome bits 3 , 5 , 7 , f 23 = xor of syndrome bits 3 , 5 , 6 , 7 , f 26 = xor of syndrome bits 3 , 4 , 6 , f 29 = xor of syndrome bits 3 , 4 , 5 , 7 , f 30 = xor of syndrome bits 3 , 4 , 5 , 6 , f 42 = xor of syndrome bits 2 , 4 , 6 , f 44 = xor of syndrome bits 2 , 4 , 5 , f 45 = xor of syndrome bits 2 , 4 , 5 , 7 , f 49 = xor of syndrome bits 2 , 3 , 7 , f 50 = xor of syndrome bits 2 , 3 , 6 , f 52 = xor of syndrome bits 2 , 3 , 5 , f 58 = xor of syndrome bits 2 , 3 , 4 , 6 , f 69 = xor of syndrome bits 1 , 5 , 7 , f 71 = xor of syndrome bits 1 , 5 , 6 , 7 , f 74 = xor of syndrome bits 1 , 4 , 6 , f 85 = xor of syndrome bits 1 , 3 , 5 , 7 , f 86 = xor of syndrome bits 1 , 3 , 5 , 6 , f 89 = xor of syndrome bits 1 , 3 , 4 , 7 , f 98 = xor of syndrome bits 1 , 2 , 6 , f 107 = xor of syndrome bits 1 , 2 , 4 , 6 , 7 , f 108 = xor of syndrome bits 1 , 2 , 4 , 5 , f 123 = xor of syndrome bits 1 , 2 , 3 , 4 , 6 , 7 , f 131 = xor of syndrome bits 0 , 6 , 7 , f 135 = xor of syndrome bits 0 , 5 , 6 , 7 , f 137 = xor of syndrome bits 0 , 4 , 7 , f 139 = xor of syndrome bits 0 , 4 , 6 , 7 , f 142 = xor of syndrome bits 0 , 4 , 5 , 6 , f 143 = xor of syndrome bits 0 , 4 , 5 , 6 , 7 , f 145 = xor of syndrome bits 0 , 3 , 7 , f 148 = xor of syndrome bits 0 , 3 , 5 , f 162 = xor of syndrome bits 0 , 2 , 6 , f 168 = xor of syndrome bits 0 , 2 , 4 , f 177 = xor of syndrome bits 0 , 2 , 3 , 7 , f 178 = xor of syndrome bits 0 , 2 , 3 , 6 , f 180 = xor of syndrome bits 0 , 2 , 3 , 5 , f 182 = xor of syndrome bits 0 , 2 , 3 , 5 , 6 , f 183 = xor of syndrome bits 0 , 2 , 3 , 5 , 6 , 7 , f 184 = xor of syndrome bits 0 , 2 , 3 , 4 , f 190 = xor of syndrome bits 0 , 2 , 3 , 4 , 5 , 6 , f 198 = xor of syndrome bits 0 , 1 , 5 , 6 , f 199 = xor of syndrome bits 0 , 1 , 5 , 6 , 7 , f 202 = xor of syndrome bits 0 , 1 , 4 , 6 , f 203 = xor of syndrome bits 0 , 1 , 4 , 6 , 7 , f 204 = xor of syndrome bits 0 , 1 , 4 , 5 , f 206 = xor of syndrome bits 0 , 1 , 4 , 5 , 6 , f 209 = xor of syndrome bits 0 , 1 , 3 , 7 , f 210 = xor of syndrome bits 0 , 1 , 3 , 6 , f 213 = xor of syndrome bits 0 , 1 , 3 , 5 , 7 , f 215 = xor of syndrome bits 0 , 1 , 3 , 5 , 6 , 7 , f 223 = xor of syndrome bits 0 , 1 , 3 , 4 , 5 , 6 , 7 , f 226 = xor of syndrome bits 0 , 1 , 2 , 6 , f 232 = xor of syndrome bits 0 , 1 , 2 , 4 , f 234 = xor of syndrome bits 0 , 1 , 2 , 4 , 6 , f 237 = xor of syndrome bits 0 , 1 , 2 , 4 , 5 , 7 , f 240 = xor of syndrome bits 0 , 1 , 2 , 3 , f 247 = xor of syndrome bits 0 , 1 , 2 , 3 , 5 , 6 , 7 , f 251 = xor of syndrome bits 0 , 1 , 2 , 3 , 4 , 6 , 7 , note that the syndrome bits participating in the xor operations for f i correspond to the binary representation of the integer i . for example , the binary representation of 226 is 11100010 , and f 226 is the xor of syndrome bits 0 , 1 , 2 , 6 . logic 620 then generates a set of error values e 2 , j for 0 ≦ j ≦ 17 and j ≠ 15 by comparing the bits of s 1 17 ( 0 , 1 , 2 , 4 ) with selected bits fi , as indicated below . each generated error value e 2 , j is one if the bits all match and is otherwise zero . more particularly : e 2 , 0 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 183 , f 232 , f 139 , f 29 ) e 2 , 1 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 26 , f 251 , f 123 , f 18 ) e 2 , 2 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 44 , f 168 , f 199 , f 23 ) e 2 , 3 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 237 , f 206 , f 107 , f 3 ) e 2 , 4 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 192 , f 180 , f 137 , f 4 ) e 2 , 5 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 49 , f 203 , f 14 , f 85 ) e 2 , 6 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 30 , f 198 , f 30 , f 98 ) e 2 , 7 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 202 , f 184 , f 20 , f 213 ) e 2 , 8 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 226 , f 45 , f 42 , f 178 ) e 2 , 9 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 160 , f 135 , f 223 , f 142 ) e 2 , 10 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 58 , f 21 , f 182 , f 148 ) e 2 , 11 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 209 , f 145 , f 74 , f 215 ) e 2 , 12 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 210 , f 52 , f 1 , f 247 ) e 2 , 13 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 162 , f 240 , f 177 , f 190 ) e 2 , 14 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 86 , f 96 , f 234 , f 143 ) e 2 , 16 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 131 , f 204 , f 89 , f 40 ) e 2 , 17 = 1 if s 1 17 ( 0 , 1 , 2 , 4 )=( f 69 , f 50 , f 71 , f 108 ). syndrome decoder 600 combines the outputs of single error location logic 610 and double error location logic 620 to generate an error locator bit e for each bit i , where 0 ≦ i ≦ 17 , in accordance with steps 2 and 3 of algorithm a . to accomplish this , a gate array 631 responsive to logic 630 produces a output of one whenever s 1 17 = 1 , that is , if s 1 17 ( 0 , 1 , 2 , 4 )=( 1 , 0 , 0 , 0 ). also , an or gate 641 produces a zero whenever s 1 = 0 , that is , whenever the first eight bits of the syndrome vector s are all zero . for i = 15 , in step 2 of the algorithm , if s 1 = 0 and sp = 1 , then both inputs to and gate 633 are one , causing or gate 642 to output a one to generate an e 15 locator bit . similarly , if s 1 17 = 1 sp = 0 , then both inputs to and gate 635 are one , against causing or gate 642 to output a one to generate an e 15 locator bit . in the first instance , the e 15 locator bit indicates a single error at bit location 15 , while in the second , the e 15 locator bit indicates a double error involving bit 15 and one other bit location ( as indicated by another e i ). for 0 ≦ i ≦ 17 and i ≠ 15 , in step 3 of the algorithm , if s 1 = column i of the first 8 rows of h 1 and s 1 17 = 1 , then logic 610 ( e 1 , i ) and logic 631 input ones to the and gate 632 for the particular i , causing the or gate 643 for the particular i to generate an e i locator bit , this time for a single error at bit location i . similarly , if the field element x i of column i of the first 8 rows of h 1 satisfies the equation x i 16 s + x i s 1 16 = s 1 17 , then logic 620 ( e 2 , i ) and and gate 634 input ones to the and gate 636 for the particular i , again causing the or gate 643 for the particular i to generate an e i locator bit , this time for a double error at bit location i and one other location ( as indicated by another e i ). fig8 shows uncorrectable error ( ue ) detection logic 660 for generating the uncorrectable error ( ue ) signal ( fig4 ). ue detection logic 660 is a part of syndrome decoder 600 . each of the and blocks 661 , 662 , and 663 outputs the logical and of its inputs and each of the or blocks 664 outputs the logical or of its inputs . nor 665 outputs the inverse of the logical or of the inputs e 2 , i from the output of logic 620 . ue detection logic 660 implements in hardware step 4 of algorithm a . thus , if ( 1 ) s 1 17 ≠ 1 , ( 2 ) s 1 ≠ 0 and ( 3 ) sp = 1 , then ( 1 ) circuit 631 outputs a zero to inverter 651 , inverter to supply a first one to and gate 661 , ( 2 ) or gate 641 supplies a second one to and gate 661 , causing that gate to supply a first one to and gate 662 , and ( 3 ) the sp line supplies a second one to and gate 662 ; all of this causes and gate 662 to input a one to or gate 664 , resulting in a one on the ue line . alternatively , if ( 1 ) s 1 17 ≠ 1 , ( 2 ) sp = 0 and ( 3 ) there is no solution to the equation x i 16 s 1 + x i s 1 16 = s 1 17 , then ( 1 ) circuit 631 outputs a zero to inverter 651 causing that inverter to supply a first one to and gate 663 , ( 2 ) the sp line supplies a zero to inverter 652 , causing that inverter to supply a second one to and gate 663 , and ( 3 ) logic 620 supplies all zeros to nor gate 665 , causing that gate to output a third one to and gate 663 ; all of this causes and gate 663 to input a one to or gate 664 , likewise resulting in a one on the ue line . if ( as shown in fig4 ) errors in the check bits ( 7 - 15 ) are not corrected , the associated error locators need not be generated for this purpose . in such case , the circuits in single error location logic 610 for generating e 1 , i for 7 ≦ i ≦ 14 , as well as the circuits for generating e 15 , may be omitted . on the other hand , since step 4 of algorithm a involves all 17 e 2 , i values ( 0 ≦ i ≦ 17 , i ≠ 15 ), it is still necessary for double error location logic 620 to generate all of these e 2 , i values for ue detection logic 660 to fully implement this step of the algorithm . if the e 2 , i values for 7 ≦ i ≦ 14 are not generated in logic 620 , then the ue detection is reduced to determining whether s 17 ≠ 1 , s ≠ 0 and sp = 1 . the decoder 300 still provides double error correcting and triple error detecting ability . however , it does not detect as many errors beyond triple errors as the full decoder . note also that if logic 620 does generate e 2 , i values for 7 ≦ i ≦ 14 , the number of fi xor functions is reduced from 68 to 36 . thus , the overall syndrome decoding circuitry would be reduced nearly by half , but at the expense of reducing the probability of detecting four or more errors . the capabilities of the present invention can be implemented in software , firmware , hardware or some combination thereof . as one example , one or more aspects of the present invention can be included in an article of manufacture ( e . g ., one or more computer program products ) having , for instance , computer usable media . the media has embodied therein , for instance , computer readable program code means for providing and facilitating the capabilities of the present invention . the article of manufacture can be included as a part of a computer system or sold separately . additionally , at least one program storage device readable by a machine , tangibly embodying at least one program of instructions executable by the machine to perform the capabilities of the present invention can be provided . the flow diagrams depicted herein are just examples . there may be many variations to these diagrams or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . while the preferred embodiment to the invention has been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described .	6
fig1 a and fig1 b have been described with respect to the related art . referring to fig2 a , the propagate bit and generate bit cell 20 , according to the present invention , is shown . in addition to receiving four propagate bit control signals , four generate bit control signals , the a n , a n &# 39 ;, b n and b n &# 39 ; signals , the propagate bit and generate bit cell 20 receives a control signal designated abs ( a - b ). the propagate bit and generate bit cell 20 , in addition to providing the g ( generate ) bit and the p ( propagate ) bit , also provides an auxiliary g n (&# 34 ; g n &# 34 ;) bit in response to the abs ( a - b ) control signal . referring to fig2 b , the block diagram of the arithmetic logic unit according to the present invention is illustrated . for each resister a and b position , a corresponding propagate bit and generate bit cell 201 through 203 is available to receive the logic signals ( and complementary logic signals ) from associated register positions . the output signals of the propagate bit and generate bit cells 201 through 203 . p 0 through p n and g 0 through g n , are applied to carry - chain cells 204 through 206 respectively . the carry - chain cells associated with bit positions 0 through n - 1 apply carry - out signals , c 0 through c n - 1 to an input terminal of the exclusive nor logic rate associated with the next successive ( i . e ., next more significant ) bit position respectively , the carry - out signal c n - 1 being applied to an input terminal of exclusive nor logic gate 109 . the associated p n signal is also applied to an input terminal of the exclusive nor logic gates 207 - 209 of the associated bit position . the &# 34 ; g n &# 34 ; bit signal is applied along with the associated p n bit signal to an associated carry - chain cell 225 through 227 . each carry - chain cell 225 through 227 provides an associated auxiliary carry signal &# 34 ; c n &# 34 ; that is applied to an input terminal of the exclusive nor gate associated with the auxiliary carry - chain of the next successive ( i . e ., more significant ) bit position . the exclusive nor logic gates 218 through 220 , associated with each bit position , have the p n signal associated with the bit position applied to a second input terminal of the exclusive nor gate associated with each bit position . a multiplexer unit 215 through 217 selects output signals from exclusive nor logic gate pairs 218 and 207 through 220 and 209 , respectively , and applies the selected signal to an associated output register cell 210 through 212 . the carry - out signal , c n - 1 , from the most significant position - 1 carry - chain cell and the carry - chain signal , &# 34 ; c n - 1 &# 34 ;, from the most significant bit position - 1 auxiliary carry - chain cell are applied to selection circuit 230 , selection circuit 230 controlling the selection of the multiplexer units 215 through 217 . the selection circuit 230 is activated by the abs ( a - b ) signal . in the absence of the abs ( a - b ) signal , the output signals from exclusive nor logic gates 207 through 209 are applied to the result registers 210 through 212 . referring to fig3 a and fig3 b , the operation of the arithmetic logic unit of the prior art is compared with the operation of the arithmetic unit of the present invention . referring to fig3 a , the quantities to be combined by a logical operation are entered in the a register 301 and in the b register 302 . these quantities are applied to the propagate bit and generate bit cell array 303 . the output signals from the propagate bit and generate bit cell array 303 are applied to the normal group carry - chain 304 . this apparatus ( not described herein ) provides a look - ahead function for the carry function in which the carry operation is determined for groups of signals . this apparatus is designed to eliminate the length of time for a ripple carry signal to be transmitted through the carry - chain . the normal local carry - chain 305 completes the operation begun by the normal group carry - chain 304 and selected signals are applied to the logic xnor gate array 306 . the output signals from the logic xnor gate array 306 are entered in the a result register 307 . referring next to fig3 b , the functional block diagram of the present invention is illustrated . the signals in a register 351 and in b register 352 , to be combined in a predetermined logical operation , are applied to the propagate bit and generate bit cell array 353 . the output signals from the propagate bit and generate bit cell array are applied to the normal group carry - chain 354 ( performing the look - ahead ) function for the carry operation . similarly , the auxiliary group carry - chain 355 receives signals from the propagate bit and generate bit cell array and performs the similar look - ahead function for the carry - chain implemented specifically to accommodate the new ( auxiliary ) signal created by the propagate bit and generate bit cell array of the present invention . the normal local carry operation is completed using normal local carry - chain 356 and the auxiliary signal carry - chain operation is completed by auxiliary local carry - chain 357 . the propagate signal and the auxiliary generate signal are applied to auxiliary logic xnor gate array 359 , while the propagate bit and the ( normal ) generate bit are applied to the normal xnor gate array 306 . the select xnor gate and a result register determine which of the two sets of signals is selected for storage . referring next to fig4 the additional functional apparatus required to be added to the propagate bit and generate bit cells 201 through 203 to implement the present invention is shown . the additional apparatus , designated auxiliary &# 34 ; g n &# 34 ; apparatus can have available the same input signals a n , a n &# 39 ;, b n and b n &# 39 ;. additionally , one control signal the abs ( a - b ) control signal is applied to the auxiliary &# 34 ; g n &# 34 ; apparatus 41 and an additional output signal &# 34 ; g n &# 34 ; is available . as will be clear from the output signal of auxiliary &# 34 ; g n &# 34 ; apparatus 41 , because &# 34 ; g n &# 34 ;= 1 only when a n and b n &# 39 ; are present , a n &# 39 ; and b n are redundant . the implementation can be provided by a transistor network of the type illustrated by fig5 . 5 , page 152 , of mead et al . cited previously . the arithmetic logic unit ( alu ) in a data processing system , and particularly in a microprocessor component of a data processing system , is used to process two data groups in response to control signals , typically generated by instructions , to obtain a result data group . the set of functions which the alu is capable of executing includes addition , subtractions , negation and inversion . the alu operates on the full width of an input operand and must provide apparatus , referred to as a carry - chain , to accommodate the effect of the operation on the most significant bit through the least significant bit . the number of data positions that the apparatus can accommodate in the carry chain determines the performance of the arithmetic logic unit . in the very large scale integration ( vlsi ) techniques , the selection of the function to be performed can be programmed , for example , by combining 2 sets of 4 control lines and two input data groups to produce a 2 bit function code , one propagate bit and one generate bit . this function code controls the operation of the carry - chain apparatus and controls the carry look - ahead circuitry ( not shown ). one bit of the function code , the propagate bit , and the result signal of the carry - chain cell associated with the next lessor significant bit position have the exclusive - nor ( xnor ) logic function performed thereon to produce a result signal for the associated bit position . in order to evaluate the [ a - b ] and [ b - a ] simultaneously , several economies in implementation can be used . for example , the propagate bit for [ a - b ] and [ b - a ] has the same control signals ( cf . table 5 . 2 , page 174 , mead et al ., cited previously ) and therefore provides the same propagate bit result signal . therefore , additional apparatus must be added only to provide the auxiliary generate bit , &# 34 ; g n &# 34 ;. however , this auxiliary &# 34 ; g n &# 34 ; apparatus 41 is used only when the abs ( a - b ) control signal is active . in this circumstance , the &# 34 ; g n &# 34 ; bit will take the value of a logic &# 34 ; 1 &# 34 ; signal when b n = 0 and a n = 1 and will take the value of a logic 0 signal for all other input signal combinations . in the preferred embodiment , the auxiliary &# 34 ; g n &# 34 ; apparatus is implemented by five transistors . however , with respect to the carry - chain cell array , the &# 34 ; g n &# 34 ; bits must utilize a duplicated carry - chain cell array . similarly , the xnor logic gate array must be duplicated and the one of the output signals from the two xnor logic gates associated with each bit position must be selected . the decision between the result signal bits associated with the [ a - b ] or the [ b - a ] operation is determined by testing the most significant bit position - 1 carry - out signals . because subtraction of a larger quantity from a smaller quantity results in a negative number , the negative number can be identified by testing this position . the foregoing description is included to illustrate the operation of the preferred embodiment and is not meant to limit the scope of the invention . the scope of the invention is to be limited only by the following claims . from the foregoing description , many variations will be apparent to those skilled in the art that would yet be encompassed by the spirit and scope of the invention .	6
the present invention is best understood by first starting with a description of the environment in which the invention operates . as shown in fig1 and 2 , to place the coronary sinus introducer 20 of the present invention in the body , it is first required that a guide wire 12 be inserted into the jugular vein 14 to travel along the jugular vein to the superior vena cava 15 of the heart and into the right atrium 16 and into the vicinity of the coronary sinus 17 at the coronary sinus opening 17a within the right atrium . the guide wire 12 is placed in the jugular vein 14 through the use of the seldinger technique . this technique may be used for gaining arterial or venous access . it involves locating the vessel by palpation and entering it with a locator needle through the skin ( percutaneous insertion ). once the vessel is entered , the guide wire 12 is inserted through the needle ( not shown ) and the needle is removed . this procedure can be done quickly , does not require surgical incision and preserves the site of insertion for future procedures . the superior vena cava returns blood from the upper half of the body , and opens into the upper and posterior part of the atrium . its orifice is directed downward and forward and has no valve . the coronary sinus 17 returns the greater part of the blood from the substance of the heart . its opening 17a is placed between the orifice of the inferior vena cava and the atrioventricular opening , and is protected by a thin , semi - circular valve , termed the valve of the coronary sinus , which covers the lower part of the orifice . it prevents the regurgitation of blood into the sinus during the contraction of the atrium . this valve may be double or it may be cribriform . placement of the coronary sinus introducer 20 of the present invention is best seen through the series of fig3 through 7 . as shown in fig3 the guide wire 12 is first introduced into the cardiovascular system through the jugular vein 14 and then through the superior vena cava 15 to place its distal end in the vicinity of the coronary sinus opening 17a . then the dilator 18 receives the coronary introducer 20 in a manner to be described in more detail below , then the dilator and introducer combination descend along the guide wire 12 through the jugular vein 14 , through the superior vena cava 15 and into the right atrium 16 to the position shown in fig3 in which the guide wire 12 with its distal end 12a , the dilator 18 with its tip or distal end 18a and the introducer 20 with its tip or distal end 20a are all in the right atrium in the vicinity of the coronary sinus opening 17a . in fig4 guidewire 12 has been removed from the combination of dilator 18 and introducer 20 to leave dilator tip end 18a and introducer end 20a in the vicinity of the coronary sinus opening 17a within the right atrium 16 . in fig5 coronary sinus introducer 20 with its tip end 20a is shown in the right atrium . introducer 20 is bent at bend or bent section 22 to place tip end 20a of the introducer in the vicinity of the coronary sinus opening 17a . in fig5 the dilator 18 , which is a relatively stiff straight member , has been removed from the coronary sinus introducer 20 and the bent section 22 has been restored to the coronary sinus introducer to tilt it toward the opening 17a of the coronary sinus 17 and to enable the introducer tip end 20a to be placed within the coronary sinus 17 as shown in fig6 . in fig7 a coronary sinus catheter 40 has been delivered into the coronary sinus of the patient . the structure of the coronary sinus catheter introducer system of the present invention is best understood by references to fig8 - 11 . at the top of fig8 is shown the guide wire 12 which is essentially a long metallic coiled wire preferably made of a metal which will not interact with body fluids , such as stainless steel . as shown in fig8 and 9 , dilator 18 is a relatively stiff member having a luer fitting 23 at one end with a longitudinal rod 24 extending from the luer fitting 22 . the longitudinal rod 24 is approximately 30 - 40 centimeters inches in length and is preferably made of a material which will not interact with body fluids such as a relatively stiff polyurethane material . the rod 24 includes a central longitudinal bore 24a . the rod 24 receives a coating 24b , also preferably made of a material non - reactive with body fluids , such as polyurethane . the dilator 18 is relatively inflexible , and is expected to follow a path from the jugular vein 14 , into the superior vena cava 15 and thereafter into the right atrium 16 of the heart . the luer fitting 23 receives an end cap ( not shown ) during installation of the dilator - introducer combination in the right atrium to minimize blood loss therethrough . the introducer 20 comprises a longitudinal tubular main body portion 26 having a luer fitting 28 at a proximal end thereof . similarly , the luer fitting 28 receives an end cap ( not shown ) which may be received following removal of the guide wire and dilator and prior to catheter installation to minimize blood loss through the tube 26 . luer fitting 28 also includes an eyelet 28a for a purpose to be described later . the main body portion 26 is a relatively inflexible longitudinal plastic tube having a pleated section 26a at its proximal end to give some flexibility to the introducer 20 at the junction at the tube 26 and the luer fitting 28 . also a soft plastic bumper 26b is provided at the distal end of the plastic tube 26 to prevent abrasive contact between the coronary sinus 17 and the coronary sinus opening 17a and the introducer 20 when the distal end 20a of the introducer 20 is placed within the coronary sinus 17 . the bend 22 at the distal end 20a of the coronary sinus introducer 20 is shown in more detail in fig1 . the distal end 20a of the introducer 20 includes the bumper 26b and extends about 2 - 4 centimeters beyond the bent section 22 at an angle between 30 °- 45 ° from the longitudinal axis of the tube 26 . it is the purpose of the dilator 18 to take the bend 22 out of the introducer 20 during the placement of the coronary sinus introducer within the body of the patient as shown in fig3 - 7 . therefore , as shown in fig1 , when the dilator 18 is fully extended to place its tip end 18a beyond the bumper 26b at the distal end of the tube 26 , the tube 26 is fully aligned along its longitudinal axis to remove the bend 22 from the introducer 20 . moreover there is a tight tolerance between the pliable bumper 26b of the introducer 20 and the dilator 18 to minimize blood loss to the patient through the interface between the dilator outer face and the inner face of the introducer body . when the dilator 18 is removed from the coronary sinus introducer 20 , the bend 22 returns to the coronary sinus introducer to enable placement of its end 20a in the coronary sinus opening 17a . although the invention has been described with reference to the preferred embodiment , other embodiments can achieve the same results . variations and modifications of the present invention will be obvious to those skilled in the art and it is intended to cover in the apended claims all such modifications and equivalents . the entire disclosures of all applications , patents , and publications cited above , and of the corresponding application are hereby incorporated by reference .	0
while this invention is susceptible of embodiment in many different forms , there is shown in the drawings and will herein be described in detail one or more specific embodiments , with the understanding that the present disclosure is to be considered as exemplary of the principles of the invention and not intended to limit the invention to the specific embodiments shown and described . in the description below , like reference numerals are used to describe the same , similar or corresponding parts in the several views of the drawings . fig6 is an electrical diagram of an improved bonding pad arrangement 600 providing multiple input esd circuits in accordance with the present invention . the bonding pad arrangement 600 includes a bonding pad 602 defining a bonding area that is used to connect the battery output to the power supply voltage detection circuit and to supply power for other circuits located on the integrated circuit . a second bonding pad 634 is shown in fig6 that is used to connect the battery output to the battery switching circuit that has also been fabricated on the integrated circuit . bonding pad 634 is electrically connected to bonding pad 602 and provides the battery output to the battery switching circuit . alternatively , bonding pad 634 can be eliminated in accordance with the present invention , and the substrate diode 624 , the n - channel diode - connected mos transistor 626 , an esd resistor 628 included within the improved bonding pad arrangement 600 as will be described below . the connection between the bonding pad 602 and the substrate or circuit board is through a wire bond 636 using aluminum wire bonding or gold ball bonding techniques in a manner well known to one of ordinary skill in the art and provides the battery input to the integrated circuit . in addition to wire bonding , solder bumps may be used to obtain bonding . included within the layout of the bonding pad 602 in accordance with the present invention are portions of multiple input esd circuits , including but not limited to a substrate diode 604 an n - channel diode - connected mos transistor 606 , an esd resistor 608 , a substrate diode 614 an n - channel diode - connected mos transistor 616 , and an esd resistor 618 , as will be described further below in fig7 the bonding pad 602 is connected to the cathode terminal of the substrate diode 604 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 606 , and to one terminal of the esd resistor 608 . the anode terminal of substrate diode 604 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 606 are connected to vss ( ground ). the second terminal of the esd resistor 608 is connected to the cathode terminal of a substrate diode 610 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 612 , and to the input of a comparator , such as the prior art comparator 100 . the anode terminal of substrate diode 610 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 612 are connected to vss ( ground ). the esd resistor 608 has a typical resistance of from 100 to 300 ω ( ohms ). the bonding pad 602 is also connected to the cathode terminal of the substrate diode 614 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 616 , and to one terminal of the esd resistor 618 . the anode terminal of substrate diode 614 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 616 are connected to vss ( ground ). the second terminal of the esd resistor 618 is connected to the cathode terminal of a substrate diode 620 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 622 , and to an input providing internal power to the integrated circuit . the anode terminal of substrate diode 620 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 622 are connected to vss ( ground ). the esd resistor 618 has a typical resistance of from 100 to 300 ω ( ohms ). bonding pad 634 is connected to the cathode terminal of the substrate diode 624 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 626 , and to one terminal of the esd resistor 628 . the anode terminal of substrate diode 624 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 626 are connected to vss ( ground ). the second terminal of the esd resistor 628 is connected to the cathode terminal of a substrate diode 630 , to the anode terminal ( drain terminal ) of an n - channel diode - connected mos transistor 632 , and to an input providing power to a battery switching circuit , such as battery switching circuit 200 . the anode terminal of substrate diode 630 and the cathode terminal ( gate and source terminals ) of n - channel diode - connected mos transistor 632 are connected to vss ( ground ). the esd resistor 628 has a typical resistance of from 100 to 300 ω ( ohms ). the layout of the bonding pad arrangement 600 is shown in fig7 . the structures of fig7 represent the active layers of the integrated circuit forming the bonding pad arrangement 600 in accordance with the present invention . the bonding pad arrangement 600 includes a wire bonding area 702 within which the wire bond 636 is attached to the bonding pad metallization 712 . surrounding the wire bonding area 702 is a polysilicon resistor 704 corresponding to esd resistor 608 and a polysilicon resistor 706 corresponding to esd resistor 618 ; please note that in addition to the esd resistor surrounding the bonding area , it could be fabricated adjacent to it . the n - channel diode - connected mos transistor 606 is represented by structure 708 , while the n - channel diode - connected mos transistor 616 is represented by structure 708 . the bonding pad metallization 602 directly connects to the esd resistor 608 supplying current to the comparator 100 and the esd resistor 618 supplying power to the internal curcuits as shown in fig5 so the voltage drop induced by the current in one esd resistor does not influence the voltage drop induced by a second current in a second esd resistor . it will be appreciated by one of ordinary skill in the art , that additional esd resistors can be fabricated in a manner described above , whereby addition polysilicon resistors are formed around the polysilicon resistor 704 and polysilicon resistor 706 , thereby providing power to additional circuits from a single bonding pad . fig8 is a graph 800 depicting the operation of a comparator 100 and battery switching circuit 200 connected to the bonding pad arrangement 600 providing multiple input esd circuits in accordance with the present invention . the vertical axis represents voltage and the horizontal axis represents time . waveform 502 depicts the power supply voltage vcc decaying because of a power supply failure and approaching the battery voltage vbat . waveform 804 depicts the resultant voltage drop at the output of the input esd circuit of the bonding pad arrangement 600 , corresponding to the input to comparator 100 , when vbat = vcc and the comparator triggers the battery switching circuit 200 . it will be noted the interaction between the comparator 100 and battery switching circuit 200 has been eliminated . waveform 806 depicts the output of the switching circuit vout . as shown the battery switching circuit 200 cleanly switches when vbat & gt ; vcc . while the invention has been described in conjunction with specific embodiments , it is evident that many alternatives , modifications , permutations and variations will become apparent to those of ordinary skill in the art in light of the foregoing description . accordingly , it is intended that the present invention embrace all such alternatives , modifications and variations as fall within the scope of the appended claims .	7
fig1 shows a pump system comprising a supply pipe 2 and a discharge pipe 3 . the pump system furthermore comprises a displacement pump 4 ( partially shown ) for drawing in a medium 5 , for example a slurry , from supply pipe 2 , via a first one - way valve 6 , into a generally horizontally disposed bidirectional flow pipe 7 . the drawing in of medium 5 takes place in a suction phase , which is followed by a delivery phase , in which the medium 5 , which has collected in bidirectional flow pipe 7 , is forced into a discharge pipe 3 connected thereto via a second one - way valve 8 . the two one - way valves 6 and 8 used in the illustrated embodiment are ball valves and are positioned in valve casing 24 . it is also possible , however , to use other types of one - way valves , such as conical valves , ring valves or flat valves . valve 6 is open and valve 8 is closed during the suction phase , whilst valve 6 is closed and valve 8 is open during the delivery phase . letter a indicates the point of reversal or the boundary layer in bidirectional flow pipe 7 that indicates the point to which the sucked - in medium 5 enters bidirectional flow pipe 7 before being removed therefrom again . on its side remote from the valves bidirectional flow pipe 7 is connected to a horizontally extending pipe 10 , which is surrounded by a heat exchanger 11 , through which a cooling medium is passed from inlet 12 to outlet 12 ′. as shown in fig1 the first 6 and second 8 one - way valves are attached to the bidirectional flow pipe 5 at a first end 30 of the pipe 5 . on the other end of pipe 5 , at second end of 32 , second pipe 10 is connected , via a bent pipe 13 , to the pump chamber 14 of a membrane pump 4 . membrane pump 4 possesses a membrane 15 disposed in a pump casing 16 to which pipe 13 is connected . the membrane pump is provided with a piston rod 18 , which is reciprocated by driving means ( not shown ). attached to piston rod 17 is a displacement member 18 , which is capable of movement within a cylinder 19 . piston rod 17 may reciprocate membrane 15 directly , if desired , but the reciprocation may also be effected via an intermediate medium shown in the figure , which is reciprocated by displacement member 18 and which transmits said reciprocating movement to membrane 15 . the reciprocating movement of membrane 15 results in the suction phase and the delivery phase , as a result of which medium 5 is transported from supply pipe 2 to discharge pipe 3 . the hot medium 5 reciprocating through bidirectional flow pipe 7 is thereby separated from membrane by the column of medium present in second pipe 10 . as a result of the horizontal arrangement of both bidirectional flow pipe 7 and second pipe 10 , transport of heat from medium in the direction of membrane 15 is only possible to a very limited extent , namely via conduction and a small amount of admixing caused by turbulence . the small amount of heat is thereby removed from pipe 10 by cooling via heat exchange means 11 , so that membrane 15 will not be exposed to high temperatures . due to the horizontal arrangement of the two pipes there will be hardly any heat transport , if at all , from the hot medium 5 present in bidirectional flow pipe 7 via convection current . in this manner a pump system has been obtained which is also capable of pumping media having very high temperatures , without exposing membrane 15 to excessively high temperatures thereby . since the temperature of the two pipes 7 and 10 during assembly will be much lower than the temperatures that occur during operation of the pump system , the two pipes will exhibit expansion . since it is generally desirable , for practical reasons , for the valve casing 24 comprising valves 6 and 8 to be fixedly disposed , because valve casing 24 is connected to supply and discharge pipes 2 and 3 , which form part of a larger , fixedly disposed installation , it will be necessary to accommodate the expansion of pipes 7 and 10 on the other side . in order to accommodate the expansions , displacement pump block 20 of the pump system according to the invention is disposed on foundation 21 with the interposition of a guide 22 , over which displacement pump block 20 can move . the guide may also be a friction guide , but it is also possible to place block 20 on a roller guide 22 , over which a slight movement of the block is possible in case of expansion of pipes 7 and 10 . the forces required for moving block 20 are thereby transmitted to the pump block by pipes 7 and 10 themselves . as will be explained hereafter , it is also possible to design the system of pipes 7 and 10 to have a certain flexibility . in the embodiment shown in fig1 the displacement pump is a membrane pump , which may either be a single - acting pump or a double - acting pump . in the case where the pump is a double - acting pump , an intermediate medium will be present to the right of displacement member 18 , which intermediate medium is capable of moving a membrane ( not shown ) and operating another pump system . instead of using a membrane pump it is also possible to use ordinary displacement pumps , and the pump system may comprise several such displacement pumps . generally , the displacement volume of the displacement pump will be smaller than the interior volume of bidirectional flow pipe 7 , so that the boundary layer a will remain within bidirectional flow pipe 7 . the extent to which the displacement volume will be smaller thereby depends on a factor which is determined empirically and , given the temperature of the slurry , on the basis of the reynolds number . generally , the factor will range between 1 . 05 and 5 , in practice . as is shown in fig1 the displacement pump is disposed in the illustrated pump system in such a manner that the central axes of the rods extend parallel to second pipe 10 . this has resulted in a highly compact construction of the pump system . the figures to be discussed hereafter show a number of possible arrangements of pump systems according to the invention . all these arrangements comprise as common elements , which are consequently indicated by the same numerals in the various figures , a pump unit 20 , which in this embodiment comprises four displacement pumps , which are each provided with a pump chamber 14 . the pump unit is thereby disposed on a foundation 21 . furthermore each of these embodiments comprises four valve casings 24 housing valves 6 and 8 , which are connected to a supply pipe 2 and a discharge pipe 3 , respectively . in the embodiment shown in fig2 a and 2 b , bidirectional flow pipe 7 and second pipe 10 are disposed in coaxially aligned relationship between valve casings 24 on the one hand and pump unit 20 on the other hand . valve housings 24 are fixedly disposed thereby , and pump unit 20 is disposed on foundation 21 via roller guides 23 so as to accommodate expansion differences between pipes 7 and 10 caused by temperature differences . if expansion differences occur in pipes 7 and 10 , the pipes will move the pump unit a small distance , thus accommodating the expansion differences . fig3 a and 3 b show another possible embodiment , which in principle corresponds with the embodiment which is diagrammatically shown in fig1 . in fig3 a and 3 b , pipes 7 and 10 extend between valve casings 24 and pump chambers 14 in such a manner that pipe 10 extends parallel to pump unit 20 . this leads to a compact construction of the pump system . pipe is connected to pump chamber 14 via a pipe 25 , which extends at an angle to pipe 10 . this arrangement has resulted in a certain amount of flexibility in the pipe system , as a result of which expansion differences occurring in pipes 7 and 10 can at least partially be compensated . although pipe 25 is a straight pipe in this embodiment , it may also be configured as a large bend connected to pump chamber 14 on one side and to pipe 10 on the other side , whilst still retaining its advantages . another possibility of accommodating expansion differences in pipes 7 and 10 is shown in fig4 a and 4 b , wherein pipes 7 and 10 connect to one another in coaxially aligned relationship , but wherein said pipes are substantially arcuate or bent between valve casings 24 and pump chambers 14 . as a result of this bent configuration , expansion differences in pipes 7 and 10 will cause the bend or curve in the pipes to become sharper or wider , thus accommodating expansion differences in the pipes . the possibilities of accommodating expansion differences in the system of pipes are by no means limited to the possibilities that have been discussed above , of course , with several other configurations being possible . thus it is , for example , possible to have pipes 7 and 10 extend at an angle to each other in the horizontal plane as well . in the above , a possibility of slidably mounting pump block 20 on its foundation in order to accommodate expansions in pipes 7 and 10 has been discussed , whereby pipes 7 and 10 transmit the expansion forces to pump block 20 themselves , as a result of which the block is slightly moved . on the other hand , it is also possible to activate driving means by means of a temperature signal or an expansion signal . the driving means will move pump block 20 over a certain distance , which is determined on the basis of the signal being delivered . fig5 shows another embodiment of a pump system according to the invention . the parts shown in this figure are numbered the same as in fig1 . bidirectional flow pipe 7 of this pump system is provided with an intermediate pipe 50 , which is connected to pipe 10 by means of a flange 51 b , and which is connected to supply and discharge pipes 2 and 3 by means of a flange 51 a . analogously to what is shown in fig1 intermediate pipe 50 normally forms part of bidirectional flow pipe 7 , in which medium 5 collects . the embodiment of the pump system as shown includes a partition element 52 in the intermediate pipe 50 ( also called bidirectional flow pipe 1 ). the partition element 52 can freely reciprocate in the direction of the axis of intermediate pipe 50 . to this end , partition element 52 is provided with guides 54 , and it is slidably mounted on a guide bar 53 extending along the central axis of intermediate pipe 50 . the guide bar 53 is connected to intermediate pipe 50 near flanges 51 a and 51 b , in a manner which is known , but which is not shown . the freely movable partition element 52 forms a more or less physical partition in bidirectional flow pipe 7 , and impedes to a considerable extent transport of the hot and frequently corrosive medium 5 in the direction of pump casing 16 . it has become apparent that the hot medium 5 moves slowly in the direction of pump casing 15 as a result of the periodic suction and delivery phases of membrane 15 . thus , the placing of partition element 52 provides additional protection of the pump casing and membrane 15 , whilst it furthermore prevents unnecessary loading of heat exchanger 11 . this arrangement makes it possible to lower the requirements that are made of heat exchanger 11 , thus enabling a simpler and cheaper construction thereof . furthermore , pump casing 16 and in particular membrane will be loaded to a much smaller extent by the hot medium 5 , as a result of which the life of these components is considerably prolonged . consequently , the requirements made of the construction may be lowered as well , which enables a cheaper overall installation . another aspect of the invention is indicated at 55 . numeral 55 indicates mixing means , which are placed in pipe at the location of heat exchanger 11 . in this embodiment the mixing means 55 consist of a large number of blades 56 , which are mounted on a shaft 57 extending along the central axis of pipe 10 . alternatively , the blades 56 may be mounted on the inner wall of pipe 10 . the mixing means have a mixing effect on medium 5 , such that medium 5 is placed into proper heat - exchanging contact with the wall of pipe 10 of heat exchanger 11 . the mixing action of the mixing means consists primarily of increasing the flow turbulence of medium 5 in pipe 10 , which functions to increase the contact between heat exchanger 11 and the hot medium and thus obtain a greater cooling effect on hot medium 5 . in particular , if medium 5 exhibits a flow behavior with predominantly low flow velocities , the static mixing means 55 will increase the turbulence of the hot medium considerably , thus increasing the cooling effect which heat exchanger 11 has on the medium . fig6 a and 6 b show two embodiments of the partition element according to the invention . the two figures show intermediate pipe 50 , which can be fitted into bidirectional flow pipe 7 of fig5 by means of flanges 51 a and 51 b . analogously to fig5 fig6 a shows a guide bar 53 , which is disposed along the central axis of intermediate pipe 50 , and which is fixedly connected at its ends 60 a and 60 b to flanges 51 a and 51 b respectively in a manner which is known per se . a partition element 52 provided with suitable guide means bar 54 is mounted over the guide bar 53 in a manner which allows free reciprocating movement . partition element 52 at least partially shuts off the passage through intermediate pipe 50 . in the embodiment shown in fig6 a , partition element 52 is configured as a disc - shaped element having a diameter which is smaller than the diameter of pipe 50 . the disc - shaped element is preferably made of a flexible , heat and corrosion resistant rubber material , so as not to affect the pumping action of the membrane pump , in particular when the pump system is being started . fig6 b shows another embodiment of the partition element according to the invention . analogously to fig6 a , a guide bar 53 is mounted along the central axis of intermediate pipe 50 , which guide bar is fixedly connected at its ends 60 a and 60 b to flanges 51 a and 51 b respectively in a manner which is known per se . partition element 61 of this embodiment is elongated , however , and is built up of a number of through channels 62 , which are arranged in a row around guide bar 53 . this is shown in section a — a of fig6 b . unlike the embodiment shown in fig6 a , the partition element 61 of this embodiment is not capable of free reciprocating movement , but it is fixedly mounted on guide bar 53 . the presence of channels 62 allows hot medium to pass in the direction of heat exchanger 11 and pump casing 16 . during the suction phase of the membrane pump , the medium flowing in will exhibit a turbulent flow behavior , which turbulence is converted into a laminar flow by channels 62 . as a result of this , the convection of heat in the direction of heat exchanger 11 and pump casing 16 ( and membrane 15 ) will decrease considerably , and the constructional demands to be made of heat exchanger 11 and pump casing 16 may be lowered . this makes it possible to achieve a simpler and cheaper construction . it will be apparent that also the disc - shaped element 52 shown in fig6 a may be provided with a number of through channels . the partition element may be configured in the form of a sphere , which is provided in pipe 50 in a manner which allows free reciprocating movement . also a brush - shaped element provided with a large number of protrusions will be satisfactory .	5
the present invention provides a method called 2 - step , solid source ( 2sss ) processing , as shown in fig1 , to overcome the limitations of the prior art . the invention is a novel method for the deposition of the absorber layer which can be cigs or any suitable alloy of the i - iii - vi 2 family of compounds including compounds such as cuznsnse 2 which use more earth abundant elements in place of in and or ga . the platform can be either of the substrate or superstrate variety of any material including glass , stainless steel and other metal foils or polyimide or any other flexible material capable of supporting the film . in the most common substrate configuration a metal contact such as mo is first deposited on the substrate . the absorber layer is then deposited on the mo / substrate as it passes through the deposition chamber as illustrated in fig1 . one specific embodiment for the invented method in a 2 - step process would be as follows : 1 . preheat the substrate to a temperature of about 300 ° c . in an alternative embodiment , the substrate is preheated to a temperature of about 275 ° c . 2 . deposit a thin layer of cu and ga in the first deposition zone of the deposition system . this can be done by sputtering from a single target of cu and ga or using two targets containing cu and ga in desired proportions . 3 . while maintaining the temperature at about 300 ° c . ( or 275 ° c . ), move the substrate into the second zone in the deposition system and expose the metal layer to se flux at such a rate to selenize the layer . 4 . move the substrate to the next deposition zone and repeat steps 2 and 3 . this process is repeated until the cugase layer reaches the desired thickness . in a preferred embodiment this film will be cu - rich . 5 . once the cugase layer is completed , heat the substrate to about 550 ° c . while moving it to the next deposition zone . in an alternative embodiment , the substrate is heated to a temperature of about 530 ° c . 6 . in this zone deposit a thin layer of cu in and ga in suitable proportions to achieve the desired stoichiometry in the completed absorber layer . electronic quality films typically have 0 . 8 ≦ cu / group iii ≦ 1 . 0 . as in step 2 the metals can be deposited from single or multiple targets containing cu , in and ga . 7 . while maintaining the temperature at about 550 ° c . ( or 530 ° c . ), move the substrate into the next zone in the deposition system and expose the growing film to se flux at such a rate to selenize the unreacted metals in the layer . 8 . move the substrate to the next zone and repeat steps 6 and 7 and continue to repeat this process until the necessary number of layers is deposited to attain the desired thickness and stoichiometry of the absorber layer . 9 . following the deposition steps the film is then subjected to a suitable temperature profile including cool down to optimize its properties . during this period the film may be exposed to additional se flux at suitable levels to preserve its integrity . 10 . device completion layers are then deposited on the absorber layer to result in the formation of a junction and electrode for extracting power . commonly used materials for this purpose are cds and zno . in the steps described above , group ii , iii and iv , elements such as zn and sn can be substituted for or used in addition to in and ga . other group vi elements , such as s , can be substituted for or used in addition to se . the above steps refer to the formation of the absorber layer which is the subject of the invention . there are many possible configurations for the finished solar cells and modules in the preparation of the substrate or superstrate , the manner of formation of the junction forming materials , the transparent contact layers and current collection constructs . for example , in the case of processing a monolithically integrated module there would be patterning steps inserted at appropriate points in the film deposition sequence . the deposition of the absorber layer using the method of the invention can be utilized in any of these approaches . the viability of the 2sss processes hinges on two key issues : 1 . demonstrating that films and devices of comparable quality and performance to those produced by current processing can be realized , and 2 . demonstrating that the 2sss process is cost - effective . to address issue 1 , devices have been produced using laboratory scale deposition systems . in this case deposition of the metals as well as the se flux is done by evaporation using effusion cells . while sputtering is the preferred method for deposition of the metals in a manufacturing environment because of the established capabilities of large area sputtering , for laboratory scale demonstration of device performance in small areas this capability is not required . to simulate the 2 - step sequential deposition process described above shutters are used to alternate exposure of the substrate to metal fluxes and se fluxes . this enables the layer by layer buildup of the absorber film . as discussed in further detail below , for a 2 - step process we have established that films with the same properties of composition and structure to co - deposited films can be made with the 2sss process . to further our demonstration of the quality of these films , devices have also been made and evaluated . as a comparison we made devices in the following manner . in the first step , the cu - rich cugase layer was made by depositing multiple thin layers by 2sss . in the second step , the cugain layer was deposited by co - deposition . as a baseline another device was made by the same 2 - step process but both steps were done by conventional co - deposition . total film thickness in each case was about 2 microns . both films were finished into devices using chemical bath deposition of cds followed by sputter deposition of a zno buffer layer followed by a zno : al transparent conducting layer . measurement of iv curves of several devices of each in a solar simulator indicated comparable performance of voc &# 39 ; s of about 530 mv and jsc &# 39 ; s of about 31 ma / cm 2 . since the devices were just made for comparison purposes , no attempt was made to optimize the device formation steps . we have found measurements of jsc and voc to suffice as indicators of performance . no grids were deposited and consequently the fill factor is not accurate . under similar processing with other devices we observe fill factors in the 0 . 70 - 0 . 75 range . as such these devices would have efficiency of order 12 %. since the entire film growth is different under 2sss processing performance parameters such as jsc that are dependent upon bulk properties are good indicators of changes in electronic properties . a more sensitive probe of these properties is the eqe , external quantum efficiency . eqe spectra were taken for both types of devices and compared by plotting the ratios . fig5 shows the co - deposition device is more efficient in the mid spectral range , while the 2sss device is more efficient in the blue and red regions . these differences have their origins in the underlying operation of the devices , but it can be seen that the overall performance of the 2sss device is comparable to the standard co - deposition device . furthermore , the small differences can be improved by further tuning of the 2sss process together with the device formation steps . while sputtering is the preferred method of deposition for the metals , the 2sss process can be applied with other deposition technologies as well . an example is deposition of the metals by evaporation as was done in these laboratory experiments . this reduces the difficulty of the co - deposition process which is based upon simultaneous fluxes of metals and se reaching the substrate . while this is not a difficulty in a laboratory - scale deposition system , it is at the manufacturing level in which this needs to be accomplished over large areas . with all evaporation based 2sss processing the sequential process of metal layer deposition followed by selenization uncouples the sources allowing for more facile placement to accomplish large area uniformity . another variation of this process would include selenization in a close space sublimation mode . vapor transport is another deposition technology with commercial potential . it could be utilized to deposit the metals . again suitable confinement of the processing fluxes would be utilized to prevent cross contamination with the selenization chamber . selenization of the metal layers is provided in subsequent locations by large area sources that are separated from the metal sources using constructs that prevent cross contamination of the sources and different processing conditions in the metal and selenization chambers ; this enables the metals to be deposited under different pressure than that in the selenization chamber . the process consists of several sequential steps of metal deposition followed by selenization . the number of steps is determined by the targeted total thickness and the most effective thickness of each metal / selenization sequence that optimizes throughput and performance . the thickness of each metal layer is determined by the speed of movement of the substrate and the deposition rate ; the process , as illustrated in fig1 , shows a configuration for a 2 - step process . the cu - rich cugase first step is accomplished in the upper chambers , and the cigs second step is accomplished in the lower chambers . as illustrated the metal / selenization steps are repeated for each step until the desired thickness is reached . in an actual system the chambers would all be connected in series , typically in a line . in this approach the substrate moves continuously through the system with each area going through a given metal / selenization zone only once . in a variation of this process the substrate could be moved back and forth between metal / selenization zones until the desired thickness is reached . there are three key factors that will determine the commercial success of this approach : since metals can be sputtered at high rates , factor 1 will be determined by the selenization rate . it is expected that this will be determined by thermodynamics since evaporation sources provide an abundance of se . factors 1 and 2 are not independent of each other . the thicker the layer that can be successfully selenized , the fewer the passes that are required . while this will determine the overall system size and configuration , the rate of selenization is still the key variable in determining throughput . a simple model was devised to approximate the cost of capital for the absorber deposition with results shown in fig2 . key parameters are the deposition rate , the total metal layer thickness and the cost of a metal / selenization deposition zone . results are plotted for metal layer thicknesses of 3000 å , 4000 å and 5000 å . the cost of a deposition zone is assumed to be $ 250k . for a deposition thickness of 4000 å a second curve is shown for the case of having two sets of deposition sources in each deposition zone . as can be seen , the capital cost can be $ 0 . 10 / w or less which is in the acceptable range for an overall module cost of $ 0 . 50 / w . thickness of the individual layers also becomes a driver of the system configuration . as this thickness is lowered , more deposition zones are needed . however , adding deposition zones also increases throughput as the substrate is moved faster , so on balance the capital cost is not a function of the total number of zones . the present invention allows extensive profiling of the constituents . the 3 - step co - deposition process which has produced world record efficiencies can easily be reproduced using this approach . in fig3 compositional data is provided for the cgs layer in a 2 - step process . the data was attained by depositing the same total metal thickness in steps of 6 , 12 , 25 and 50 cycles of the metal layer deposition / selenization sequence , which results in corresponding individual metal layer thicknesses of 59 . 2 , 29 . 6 , 14 . 8 and 7 . 4 nm respectively . the atomic composition as well as the cu / ga ( x10 ) ratio is plotted at each thickness . the deposition rates and conditions were identical for these runs with the exception of the open symbols . composition was measured by energy dispersive spectroscopy ( eds ). the data points on the y axis are for a co - deposited film which would have a metal layer thickness of zero for comparison with the 2sss films . a value of 0 . 1 was chosen to allow plotting the data on a log scale . the data points at metal layer thickness of 355 nm represent the other endpoint in which the entire metal layer thickness is deposited as one layer and then selenized . thus the two endpoints represent the known and practiced deposition technologies , while the center points are the 2sss process . since cu compounds are not known to be volatile , the cu content is readily controlled by maintaining the deposition rate . the cu level is nearly independent of the metal layer thickness , as shown in fig3 . in co - deposition the elemental species all arrive on the growth surface together and have nearly uninhibited access to each other . growth is then expected to be driven primarily by thermodynamics , although some component of surface migration could be operative . in the case of the layered films , compound formation is primarily on the surface . in such a case bulk kinetics or diffusion also plays a role . therefore , as the metal layers are made thinner , the diffusion contribution is decreasing . thus as the thickness of the metal layers is reduced , film formation should approach that of co - deposition , as shown in fig3 . the trend lines shown for ga and se asymptote toward the data for co - deposition . at the 355 nm thick endpoint , all of the metal is deposited in a single layer , and the layer needs to be selenized with the same total se flux as that used for the co - deposited films . the selenization level is below 30 % indicating poor compound formation . the ga level on the other hand is high because a lot of the ga has not diffused to the growth surface and been selenized to form the desired ga 2 se 3 binary . at the same time , this also reduced formation of ga 2 se which would have removed ga . therefore , under the deposition conditions used the ga level before any loss might be expected to be about 35 %. as the metal layers become thinner , the ga level diminishes and the se level increases , indicating greater reactivity and formation of both ga 2 se 3 and ga 2 se . the trend lines indicate the expected continuation of this process . however , at the metal layer thickness of 29 . 2 nm the ga composition starts to rise again , and the se starts to drop . this means that diffusion is no longer dominant , but rather compound formation is limited by se availability . the total se flux has not changed , but the exposure time of each metal layer to this flux is reduced . thus in this region both diffusion and thermodynamics are operative . to counter this in another experiment se flux was increased by about 30 % for the metal layer thickness of 7 . 4 nm . the results are shown as open symbols . it can be seen that ga content drops and the se content increases indicating a much higher level of selenization . the ga — se interaction was further tested in another series of samples . the samples were made at a metal layer thickness of 7 . 4 nm under similar conditions to those in fig3 . in this case the parameter that was varied was the deposition rate of ga by varying the ga source temperature . the starting point was a source temperature of 1010 ° c . which is the same as that used for the data of fig3 . the temperature was then lowered to observe the effect of decreased ga flux . the results are shown in fig4 . as the ga flux dropped there was a corresponding drop in incorporated ga , and a concomitant increase in se incorporation . this implies that some ga at the 1010 ° c . flux level is unselenized , but the se flux is sufficient to selenize a lesser amount of ga produced by lowering the ga source temperature . for the data point at 980 ° c . the se flux level was lowered by 25 %. this resulted in somewhat higher ga incorporation even though the ga flux was lowered . this indicates that ga composition can be managed by judicious selection of the selenization time and flux . in summary , the data indicates that films with good stoichiometry can be produced by the 2sss method . while films with lower and higher metal layer thicknesses could require more se than co - deposited films , films with metal layer thickness in the vicinity of 30 nm can be effectively selenized with the same total amount of se flux as co - deposited films . practice of this invention would focus on this region for this layer . as seen in fig3 , the cu / ga level for the film at metal thickness of 29 . 2 nm is about 2 . for other desired values of this ratio the cu flux can be changed . the two overriding aspects of film structure are formation of the proper compounds and the grain size . the predominant xrd peaks for films co - deposited at 300 ° c . are 2θ = 37 °− 38 °, 27 °− 28 ° and 44 °− 45 °. the best fit to these are the binaries γ - ga 2 se 3 , cu 3 se 2 , and cu 3 se 2 respectively . grain sizes are of order 0 . 5 μm . this structure is generally seen in the 2sss films . having established that both composition and structure is comparable in the cgs layer , we then extended our investigation of these properties in the completed film . this involved deposition of a second layer containing in on top of the first layer using the same 2sss processing steps as the cgs layer . the two layer stack is then heated to above 500 ° c . to form the final film . eds data and xrd data again indicated that composition and structure comparable to co - deposition films was being attained in the completed 2sss absorber layers . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .	8
the invention is described below in the context of a server and a client , although the invention is not limited to this context , but applies generally to two machines . in the description that follows , the client may be a user &# 39 ; s machine , and the server may be a service provider &# 39 ; s machine . a secret password , which may be distributed over a secure channel , is assumed to be known by both the client and the server . the password is assumed to be sufficiently long so that a random guess by either an unauthorized user or a rogue service provider is highly unlikely to be correct . such assumptions are made today with great evident success in the context of banking . for example , a banking user may receive his or her atm - card and its associated password separately through the mail ; the password is required to have at least a specified minimum number of characters . perhaps more apropos to the present invention , however , banks , brokers , and others rely on these same general principles to provide secure transmission of identifiers and passwords to clients using secure socket layer ( ssl ) applications . pw — secret one - time - use password that is known by both the client and the server ; ea ( b )— data b encrypted with a symmetric key a using an agreed - upon symmetric encryption algorithm ; epk ( b )— data b encrypted with an asymmetric public key pk , using an agreed - upon asymmetric encryption algorithm ; esk ( b )— data b encrypted with an asymmetric private key sk , using an agreed - upon asymmetric encryption algorithm ; rc — a secret random number generated by the client or on behalf of the client ; rs — a secret random number generated by the server or on behalf of the server ; and fig1 shows steps of the method according to the present invention for a server to distribute a public cryptographic key to a client . as shown in fig1 , a password pw , which may be random , is generated using current practices ( step 100 ), and distributed securely to the client and to the server ( step 105 ). for example , the server may generate and send the pair ( id , pw ) to the client using conventional mail , email , or telephone . although the term password is used here , a pass phrase may be used instead , the difference between the two being only a matter of semantics regarding the number of characters involved . the client generates a random number rc ( step 110 ), or reads such a random number generated on its behalf , and selects or reads a prime number ( step 115 ) for use as the prime modulus p of subsequent computations based on the diffie - hellman algorithm , as explained below . the diffie - hellman algorithm is described in schneier ( op cit ). the client then raises the password pw to the power rc , and reduces the result modulo p , to provide a diffie - hellman public key dc of the client ( step 120 ). this is denoted here as dc = pw rc mod p . the client then forms a concatenation of the client &# 39 ; s id , the diffie - hellman public key of the client dc , and the prime modulus p , thereby giving id , dc , p , and sends the concatenation to the server ( step 125 ). the server receives the concatenation id , dc , p from the client ( step 130 ), and generates a random number rs ( step 135 ), or reads such a random number generated on its behalf . the server then raises the password pw to the power rs , and reduces the result modulo p , to provide a diffie - hellman public key ds of the server ( step 140 ). this is denoted here as ds = pw rs mod p . the server , which has received dc from the client , computes s = dc rs mod p ( step 145 ), to provides a diffie - hellman symmetric secret key . the server then concatenates the client id , the diffie - hellman public key of the client dc , the prime modulus p , the public cryptographic key of the server pks , the diffie - hellman public key of the server ds , and the diffie - hellman symmetric secret key s , to provide an argument args , where args = id , dc , p , pks , ds , s ( step 150 ). the server hashes the argument args to provide a hashed value hash ( args ) ( step 155 ). the hash function may be any collision - resistant hash function drawn from the art of cryptography . a preferred embodiment of the invention uses the secure hash algorithm sha - 1 , which is described by schneier ( op cit ). although the order of the concatenation that provides the argument args is shown here for descriptive convenience as id , dc , p , pks , ds , s , any other permutations of the constituents of the argument args may also be used . the server then forms an extended concatenation exts = id , pks , ds , hash ( args ) ( step 160 ), and sends the extended concatenation exts to the client ( step 165 ). again , the order of the constituents of the extended concatenation is not important . the server has now distributed its public key cryptographic pks to the client , along with information the client may use as described below to authenticate the server . fig2 shows steps of the method according to the present invention for the client to authenticate the server &# 39 ; s public cryptographic key pks . as shown in fig2 , the client receives the extended concatenation exts from the server ( step 200 ), and now has tentative knowledge of the server &# 39 ; s public cryptographic key pks , of the server &# 39 ; s diffie - hellman public key ds , and of the hashed value hash ( args ). using this knowledge , the client computes its own version of the diffie - hellman symmetric secret key , which is denoted here as s ′, where s ′= ds rc mod p ( step 205 ). the client then forms a concatenation args ′= id , dc , p , pks , ds , s ′ ( step 210 ), and hashes the concatenation to provide a hashed value hash ( args ′) ( step 215 ). the client compares the received hashed value hash ( args ) with the computed hashed value hash ( args ′) ( step 220 ). if the two are the same , the client accepts the server &# 39 ; s public cryptographic key pks as authentic ( step 225 ). otherwise , i . e ., the two versions of the hashed value are not the same , the client rejects the server &# 39 ; s public cryptographic key pks ( step 230 ). it is instructive to note that s ′= s if the arguments of the computations are authentic . in essence , the server computes s = dc rs , where dc = pw rc , hence s = pw *( rc rs ), where * denotes multiplication . the client computes s ′= ds rc , where ds = pw rs , hence s ′= pw *( rs rc ). by commutativity , s ′= s . the foregoing argument can be shown to be true specifically when applied to modulo - p computations such as those of the invention . optionally , related processes may be employed by the client to distribute the client &# 39 ; s public cryptographic key pkc to the server , and by the server to authenticate the client &# 39 ; s public cryptographic key pkc . fig3 shows suitable steps according to the present invention . as shown in fig3 , the client forms the concatenation argc = id , pks , ds , pkc , s ′ ( step 300 ), and hashes argc to provide a hashed value hash ( argc ) ( step 305 ). the client forms an extended concatenation extc = id , pkc , hash ( argc ) ( step 310 ), and sends the extended concatenation extc to the server ( step 315 ). the server receives the extended concatenation extc ( step 320 ). the client has thus distributed its public cryptographic key pkc to the server as part of extc . to authenticate the client , the server forms the concatenation argc ′= id , pks , ds , pkc , s ( step 325 ), hashes the concatenation argc ′ to provide a computed hashed value hash ( argc ′) ( step 330 ), and compares the received hashed value hash ( argc ) with the computed hashed value hash ( argc ′) ( step 335 ). if the two are the same , the server accepts the client &# 39 ; s public cryptographic key pkc as authentic ( step 340 ). otherwise , i . e ., the two versions of the hashed value are not the same , the server rejects the client &# 39 ; s public cryptographic key pkc ( step 345 ). thus the server has authenticated the client , the client has authenticated the server , and the public cryptographic keys pks and pkc have been exchanged . now the client and the server can use public key cryptography further , with confidence that the public keys are authentic . the client and the server may discard the password pw , as it is not used again . neither the client nor the server accept any further messages supposedly protected according to pw . moreover , at this point there is no longer any need to keep pw secret , as pw has been used only for authentication rather than for encryption of sensitive data . the invention may be used for authenticating public encryption keys that are already known or that are distributed using some other technique . in such situations , there is no need to include pks in args ( fig1 , step 150 ), in exts ( fig1 , step 160 ), or in args ′ ( fig2 , step 210 ). likewise , there is no need to include pkc in argc ( fig3 , step 300 ), in extc ( fig3 , step 310 ), or in argc ′ ( fig3 , step 325 ). the method described above may be used to recover when either the client or the server has knowledge that its private key skc or sks , respectively , is compromised . if the client &# 39 ; s private key skc is compromised , the client sends an “ skc compromised ” message to the server in the concatenation id , “ skc compromised ”, eskc ( hash ( id , “ skc compromised ”)), where eskc ( x ) denotes encryption of x using the private key skc . if the server has the client &# 39 ; s public key , the server verifies the signature . if the signature is valid , the client and server suspend the exchange of data while the client determines a new public key and private key . the client then sends its new public key to the server as described above . if the server does not have the client &# 39 ; s public key , or if the signature is invalid , the server ignores the message . if the server &# 39 ; s private key sks is compromised , the server sends an “ sks compromised ” message to the client in the concatenation id , “ sks compromised ”, esks ( hash ( id , “ sks compromised ”)), where esks ( x ) denotes encryption of x using the private key sks . if the client has the server &# 39 ; s public key , the client verifies the signature . if the signature is valid , the client and server suspend the exchange of data while the server determines a new public key and private key . the server then sends its new public key to the client as described above . if the client does not have the server &# 39 ; s public key , or if the signature is invalid , the client ignores the message . in accordance with the present invention , a machine denoting the server or client is configured to read a program storage device that tangibly embodies ( i . e ., stores in a storage medium of the program storage device ) a program of instructions configured to be read and executed by the machine ( i . e ., read and executed by a processor of the machine ) to perform the methods whose steps are depicted in fig1 - 3 and the described herein . a system of the present invention comprises the machine and the program storage device . another name for the program storage device is a computer program product . from the foregoing description , those skilled in the art will now appreciate that the present invention provides an economical alternative to an x . 509 pki for distributing and authenticating public cryptographic keys . the foregoing description is illustrative rather than limiting , however , and the invention is limited only by the claims that follow .	7
according to fig1 , a wheel 1 of a vehicle ( not shown ) is connected to an electric drive 2 by means of a mechanical connection 3 . the vehicle can be , for example , a passenger car , a truck or a motor cycle . the electric drive 2 comprises an electric motor ( not shown ). in another exemplary embodiment of the invention which is not shown , the electric drive 2 can also comprise a plurality of electric motors , with the result that each wheel of the vehicle can be driven or braked individually by means of an electric drive . in a further embodiment of the invention which is not shown , the electric motor 2 drives an axle of the vehicle via a differential gear mechanism . in particular , the axle can comprise double wheels . the electric drive 2 can either drive the wheel 1 or , if the electric motor is operated as a generator , can generate a generator - type braking torque , with the result that the wheel is braked . the electric drive 2 also comprises an electric motor angle ( or angular speed ) sensor 4 which generates an electric motor drive signal 5 , wherein the electric motor drive signal 5 corresponds to an electric motor position signal or an electric motor speed signal . the electric motor drive signal 5 or the electric motor position signal is transmitted to an electric drive control device 6 . an evaluation device 7 , which measures and evaluates the electric motor drive signal 5 , is integrated into the electric drive control device 6 . the evaluated electric motor drive signal 5 corresponds to an electric motor speed signal 8 which is transmitted to a slip control device 9 . an electric motor speed can therefore be measured . in addition , the wheel 1 can be braked by means of a friction brake 10 which comprises a friction brake actuator 11 . the friction brake 10 is subjected to closed - loop or open - loop control by means of a friction brake control device 12 . the friction brake control device 12 is also designed to transmit friction brake state signals 13 to the slip control device 9 . for example , friction brake state signals 13 can correspond to a brake pressure , a brake application force , braking torque or a brake temperature . in the embodiment shown in fig1 , the friction brake 10 is embodied as a hydraulic friction brake . in an embodiment of the invention which is not shown , the friction brake 10 can be embodied , in particular , as an electromechanical friction brake . exemplary embodiments of the method according to the invention for performing closed - loop control of a wheel brake slip will be described in more detail below . the slip control device 9 detects a brake signal 14 . the brake signal 14 can be calculated , in particular , from signals in accordance with an activation process of the brake pedal , a vehicle speed , a steering angle , a yaw rate and / or a lateral acceleration . the slip control device 9 generates an electric drive signal 15 and a friction brake signal 16 as a function of the detected brake signal 14 . the electric drive signal 15 is transmitted to the electric drive control device 6 . the friction brake signal 16 is transmitted to the friction brake control device 12 . the friction brake control device 12 will generate a friction brake actuator signal 17 as a function of the friction brake signal 16 and will transmit the friction brake actuator signal 17 to the friction brake 10 . the friction brake 10 will activate the friction brake actuator 11 as a function of the friction brake actuator signal 17 . the friction brake actuator 11 generates a friction brake torque which brakes the wheel 1 . furthermore , the electric drive control device 6 will generate an electric drive control signal 18 as a function of the transmitted electric drive signal 15 and will transmit the electric drive control signal 18 to the electric drive 2 in order to perform closed - loop control of the electric drive 2 . the electric drive 2 will generate an electric drive torque in accordance with the electric drive control signal 18 . the wheel is driven or braked as a function of whether the electric drive torque has a positive or negative sign . if the wheel is braked , the generated electric drive torque is also referred to as a generator - type braking torque . the slip control device 9 generates the electric drive signal 15 and the friction brake signal 16 in such a way that a predetermined slip value of the wheel 1 can be set . this is to say that the resulting total braking torque composed of the proportion of the friction braking torque which is generated by the friction brake 10 and that of the electric drive torque which is generated by the electric drive 2 does not cause the wheel 1 to rotate more slowly than as a result of a predetermined slip value which is known to the slip control device 9 , wherein this slip value is , in particular , selected in such a way that a vehicle stability and a braking effect are optimal . in particular , the slip control device 9 evaluates , for the purpose of slip control , the electric motor speed signal 8 which is transmitted by the evaluation device 7 . furthermore , the electric drive control device 6 is connected to an electric resistor 19 which is connected to a storage device 20 for storing thermal energy . the electric resistor 19 can be , for example , a braking resistor , in particular a controlled braking resistor . in an exemplary embodiment ( not shown ) it is possible to provide that the electric resistor 19 and / or the storage device 20 are / is integrated into the electric drive control device 6 . in a further preferred embodiment ( not shown ) it is possible to provide that the electric drive 2 comprises the electric resistor 19 . this makes it advantageously possible that electrical energy which is generated by means of the electric drive 2 can be converted into thermal energy . the storage device 20 makes it possible for the thermal energy which is converted by means of the electric resistor 19 to be stored in order to then make said thermal energy available , for example , for heating a passenger cell at a later time . resistor 19 and storage device 20 could also be embodied in the form of an electrical storage device such as a battery . fig2 shows two graphs which explain in more detail the behavior of an exemplary embodiment of the wheel brake slip control system according to the invention or the method according to the invention in a driving situation with a varying coefficient of friction of the roadway . in the upper graph , the velocity is plotted against the time , with random units being selected for the axes here . the vehicle velocity v v , a wheel target speed v t and a wheel speed v w are plotted here . in the lower graph in fig2 , the individual torques t are plotted against the time t , with random units being also selected here . a driver braking request torque t d is plotted . this torque t d is the overall braking torque which is predefined by the driver on the basis of his activation of the brake pedal but which cannot be transmitted completely to the road as a braking effect in this way under certain circumstances , in particular if the roadway is wet or icy , or due to stability control constraints . however , this driver &# 39 ; s braking request torque t d is also included in the calculation of the brake signal 14 . furthermore , an electric drive torque t g , a friction braking torque t f and the overall braking torque t t which results from the electric drive torque t g and the friction braking torque t f are shown . at the time t 1 , the driver activates the brake pedal . as is apparent from the lower graph , the signal t d rises quickly to a value which cannot be completely transmitted to the road as a braking effect . the slip control device 9 will therefore generate an electric drive signal 15 in such a way that the electric drive control device 6 performs closed - loop control of the electric drive by means of a corresponding electric drive control signal 18 in such a way that the electric motor of the electric drive 2 operates as a generator , with the result that a generator - type braking torque t g is generated . the electric drive signal 15 corresponds here to a setpoint value . the control of the electric drive 2 itself is carried out by means of the electric drive control device 6 . this has , in particular , the advantage that as a result highly dynamic control of the electric drive 2 possible since the communication connection , in particular a bus connection , between the electric drive control device 6 and the electric drive 2 is much faster than a communication connection between the slip control device 9 and the electric drive control device 6 , which is usually in the range of greater than 10 ms . as is apparent from the lower graph , this generator - type braking torque t g rises very quickly to its maximum value in order to generate a braking effect as quickly as possible . in addition , the slip control device 9 will generate a friction brake signal 16 , with the result that the friction brake control device 12 generates a corresponding friction brake actuator signal 17 and transmits the latter to the friction brake 10 in order to activate the friction brake actuator 11 . the friction brake torque t f rises more slowly than the generator - type braking torque t g , but then takes over the greater part of the overall braking torque t t . in an analogous fashion , the friction brake signal 16 corresponds to a setpoint value . the actual control of the friction brake 10 is carried out by means of the friction brake control device 12 . up to the time t 2 , a coefficient of friction of the road is present which permits the transmission of braking forces which are relatively high but which do not completely meet the driver &# 39 ; s specification . this means that the wheel runs in the slip - controlled mode , for example of an abs controller . in order to transmit the braking force which is the maximum possible one for the respective coefficient of friction of the road , a characteristic difference must be present between the vehicle velocity v v and the wheel speed v w , i . e . the wheel must be adjusted to the predefined wheel target speed v t . at the time t 2 , the coefficient of friction of the road decreases suddenly to a value which permits only the transmission of braking forces which are significantly lower than the driver &# 39 ; s braking request torque t d . the electric drive torque t d of the electric drive 2 is then reduced very quickly and the electric motor 2 acts even as a drive in order to counteract the slowly reducing friction braking torque t f which is too large for this coefficient of friction of the road , and therefore to reduce a tendency of the wheel 1 to lock and / or to accelerate the wheel in order to rapidly reach the wheel target speed v t which is necessary for the optimum overall braking torque t t and for the vehicle stability . starting from the time t 3 , the friction braking torque t f is still somewhat further reduced to a value which in all cases precludes locking of the wheel 1 owing to the currently acting coefficient of friction of the road . in order to maintain the maximum transmissible braking torque , the electric drive torque t g of the electric motor is then increased again in opposition to the decreasing of the friction braking torque t f . the friction braking torque t f therefore constitutes a basic braking torque onto which the electric drive torque t g is modulated , which friction braking torque t f can then be very quickly adapted to the slip behavior of the wheel 1 and advantageously permits highly dynamic fine correction of the overall braking torque t t . the wheel with the slip value which is the optimum one for the stability of the vehicle and that for the length of the braking distance therefore runs by means of the braking method according to the invention . as a function of the coefficient of friction of the road , in particular in the case of a low coefficient of friction , the optimum brake slip requires only a very limited overall braking torque t t , which can even be generated almost exclusively by means of the electric drive torque t g , with the result that a negligible friction braking torque t f can be generated . a situation starting from the time t 3 is therefore illustrated in the graphs in fig2 . in a particularly advantageous embodiment of the invention which is not shown here , the electric motor drive control device 6 carries out an integrated electric motor speed control process in a power inverter ( not shown ), which electric motor speed control process has its target speed prescribed to it by the brake controller / vehicle movement dynamics controller and carries out the highly dynamic torque control itself when there is a requirement for slip control . the fact that the electric drive 2 can very quickly change the drive - type or generator - type braking torque generated by it — and can therefore even act in a driving fashion on the braked wheel insofar as it is advantageous for the setting of the wheel slip — and this torque which can be adjusted very quickly but is limited in magnitude is modulated onto the braking torque of the friction brake which can be controlled more slowly but is greater in terms of absolute value , provides , in particular , the following advantages , in particular if the electric drive 2 has at least one motor position sensor for controlling an internal magnetic field , since as a result a motor speed and therefore the wheel speed can be measured more quickly and more precisely than in conventional slip control systems : the vehicle movement dynamics control functions ( abs , esc , tcs ) can implement much more precise slip control , as a result of which both the utilization of the coefficient of friction and therefore the braking distance and also the driving comfort and the dynamic loading of the chassis are improved . the friction brake can be configured for a relatively low dynamic requirement and can therefore be manufactured more cost - effectively . if the friction brake is embodied as a hydraulic friction brake , the modulation frequency thereof can be reduced for the brake pressure control , which has an advantageous effect on the pedal reaction and the generation of noise . if the friction brake is embodied as an electromechanical brake , the configuration thereof can be concentrated more on reducing the manufacturing costs and optimizing the power loss and less on the otherwise critical dynamic requirements . it is therefore possible to embody the electromechanical brake also as an electromechanical wheel brake , in particular a front wheel brake , with a 12v operating voltage . improved driving dynamic functionality such as , for example , shortened braking distance , reduced pedal vibration and relatively low generation of noise during the slip control processes . improvement of comfort by reduced pedal vibration during an abs braking process , in particular in the case of a hydraulic friction brake . reduced dynamic loading of the chassis during abs and esc control processes . more cost - effective embodiment of brake actuators , in particular in an electromechanical friction brake . according to the invention , the computer program can be stored and executed , in particular , in a vehicle movement dynamics control device , in particular in an abs / vsc (“ vehicle stability control ”) control device . in summary , the invention provides a wheel brake slip control system and a method for controlling a wheel brake slip which combine the respective advantages of a friction brake and of an electric drive with one another , with the result that respective possible disadvantages can be compensated and / or overcome in a synergetic fashion . while the above description constitutes the preferred embodiment of the present invention , it will be appreciated that the invention is susceptible to modification , variation , and change without departing from the proper scope and fair meaning of the accompanying claims .	1
before the present methods and compositions are described , it is to be understood that this invention is not limited to particular methods , compositions , and experimental conditions described , as such methods and compounds may vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to be limiting , since the scope of the present invention will be limited only the appended claims . as used in this specification and the appended claims , the singular forms “ a ”, “ an ”, and “ the ” include plural references unless the context clearly dictates otherwise . thus for example , references to “ the method ” includes one or more methods , and / or steps of the type described herein and / or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are now described . all publications mentioned herein are incorporated herein by reference to disclose and described the methods and / or materials in connection with which the publications are cited . the method described herein is a rapid and accurate screening test for gbs that can be performed at the time of delivery and which obviates the need for prenatal screening and reduce the use of antibiotic prophylaxis in women who are not colonized . recently , bergeron et al . ( 2000 ) n . engl . j . med . 343 , 175 - 179 , described a rapid pcr technique capable of correctly identifying more than 90 % women colonized with gbs . both the sensitivity and specificity of this technique appeared to be in the range that would be acceptable for clinical use . the method described in the instant specification uses a standard pcr machine further , the probes and primers of the instant invention provide a very high and specific sensitivity for rapid detection of gbs . accordingly , the present invention resides in part in a process for amplifying two specific nucleic acid sequences present in a nucleic acid or mixture thereof , using two pairs of specific primers for polymerization , and two specific probes for detecting the amplified sequences . further , the present invention provides an important advantage in allowing quick detection of the presence of the gbs pathogen so that appropriate medical intervention is available to the infection patient ( s ) more quickly . the following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the methods and compositions of the invention , and are not intended to limit the scope of what the inventors regard as their invention . efforts have been made to ensure accuracy with respect to numbers used ( e . g ., amounts , temperature , etc .) but some experimental errors and deviations should be accounted for . unless indicated otherwise , parts are parts by weight , molecular weight is average molecular weight , temperature is in degrees centigrade , and pressure is at or near atmospheric . the sequences of cfb and sip genes are obtained from genbank . the primers and probes were designed with the aid of primer express 1 . 0 ( pe applied biosystem ). the possible homologies of the primers and probes with other none gbs genes were checked using ncbi blast program and megaline ( dna star lasergene ). forward primer : 5 ′ gatgtatctatctggaactctagtg 3 ′; ( seq id no : 1 ) reverse primer : 5 ′ ggcttgattattactatttacatgatttacca 3 ′; ( seq id no : 2 ) probe : 5 ′ f - agaagtacatgctgatcaagtgacaactccaca - q 3 ′. ( seq id no : 5 ) forward primer : ( seq id no : 6 ) 5 ′ gtgcatcaccagagcatgtat 3 ′; reverse primer ″ ( seq id no : 7 ) 5 ′ cgcttgtaacttactgtctgtagctg 3 ′; probe : ( seq id no : 10 ) 5 ′ f - agctccagcagttcctgtgactacgactt 3 ′. the specificity of the primers and probes was tested with real - time pcr ( taqman assay ) using genomic dnas isolated from the following organisms ( listed in table 1 ): nine gbs serotypes ( serotype ia , ib , ic , ii , iii , iv , v , vi and vii ; american type culture collection and national center for streptococcus , canada ); 10 clinical gbs isolates ; 60 clinical samples ; a wide variety of gram - positive and gram - negative bacterial strains as well as two yeast strains and hsv type 1 and 2 . total volume is 15 μl and the reaction is carried out in a lightcycler with : 25 sec denaturing at 94 ° c . ; followed by 50 cycles of 94 ° c . for 3 sec ., and 60 ° c . for 20 sec . results . both sets of primers and probes recognized all the nine gbs serotypes , the 10 clinical isolates , and the clinical samples , which are gbs positive by culturing method . there are no cross reactivities with any of the other pathogens .	2
if the processor enters a reduced power mode that entails turning a power domain ( vcc ) off ( e . g ., deep power down , c6 ), the power states ( may simply be referred to as the states ) of the logic powered down will be lost . the logic that is powered down and does not retain its state may be referred to as lost logic . certain logic in the processor ( e . g ., logic controlling clocking and power states ) may be powered by a separate power domain that remains on , such as vccp that is used to power the communications with the outside world ( e . g ., bumps , pads , pins ). the logic being powered by vccp may be referred to as retention logic . the state of the retention logic is accordingly retained during a c6 mode ( retained state ). when the processor exits the c6 mode and returns to powered operation , the processor needs to return to operation including returning the lost logic or at least a portion of the lost logic ( e . g ., important functions ) to its pre c6 mode state . in order to return the processor to its pre c6 mode state , the processor may copy the state of the lost logic ( or at least a portion thereof ) to a memory means ( e . g ., random access memory ( ram ), registers ) that remains powered ( e . g ., by vccp ) during the c6 mode prior to the processor entering the c6 mode ( pre c6 mode state ). upon returning to a powered mode ( e . g ., exiting the c6 mode ), the lost logic may be powered up and the initial states of the lost logic may vary . after the lost logic has been powered up , the initial state may be replaced with the recorded pre c6 mode state in the memory means . a signal ( e . g ., reset ) may be activated to clear the initial state and copy the pre c6 mode state from the memory means to the lost logic . regardless of the initial state of the lost logic , the lost logic needs to be capable of receiving the pre c6 mode state from the memory means and replacing the initial state with the recorded pre c6 mode state ( recovering the pre c6 mode state ). in order to ensure the states of the lost logic were accurately recovered ( and proper operation of the processor ) after returning to a powered mode , the processor may compare the pre c6 mode states in the memory means to the post c6 mode states recovered in the lost logic . simulations are utilized to test the operation of processors based on various operational parameters . the simulation may utilize register transfer levels ( rtls ) to define the possible states of logic ( state nodes ) within the processor during specific actions of the processor . in order to simulate the exiting of the processor from the c6 mode , random values may need to be injected into the rtl state nodes in the middle of the simulation . random initialization ( rinit ) may randomize all of the rtl state nodes within the processor . rinit may be utilized during a power - up simulation sequence to enable simulation of the processor being powered up under any circumstances . however , rinit cannot be utilized to simulate the processor exiting a c6 mode because not all the state nodes can be randomized . the state nodes associated with the logic that remains powered on ( e . g ., by vccp ) may not be randomized as their state will be the current state maintained therein . accordingly , running rinit to simulate a c6 mode exit may cause the simulation to crash if the state node of logic receiving vccp was randomized to an unexpected value . in order to simulate the exiting of the processor from a c6 mode , the simulation needs to be able to randomize just the logic powered by vcc that lost its state during the processor c6 mode . in order to limit the randomization , a c6 rinit may be defined that identifies just the logic that lost its state ( powered by vcc ) and thus can be a random value when exiting the c6 mode ( randomized signals ). the c6 rinit may be created by identifying the logic that can be randomized ( e . g ., powered by vcc and lost state during c6 ). alternatively , the c6 rinit may be created by identifying the logic that cannot be randomized ( e . g ., powered by vccp and maintaining state during c6 ) and excluding these signals from the overall rinit ( randomization of all signals ). the signals that may not be randomized and / or the signals that can be randomized may be manually identified . for example , the list of signals that may be randomized and / or those that may not be randomized may be generated from the processor model and schematic netlist . as the number of signals excluded from randomization is likely smaller than the number to be randomized , it may be easier to identify and exclude those signals . for example , the logic receiving vccp during the c6 mode could be identified and excluded from the rinit when the rinit is used in a simulation to simulate the exiting of the processor from a c6 mode . if the processor supports power - aware attributes and enables the identification and selection of logic connected to a certain voltage rail ( e . g ., vcc , vccp ) the processor could create a rinit for a specific voltage rail ( e . g ., vcc ) or exclude a specific voltage rail ( e . g ., vccp ) from the overall rinit . fig1 illustrates an example flow chart for generating a c6 mode randomization list for use in simulating an exit from a c6 mode . initially , the logic states are defined for the processor 100 . the logic states for the processor may be defined in the rtl and the simulator may select logic from the rtl and apply different states to different logic to simulate different activities of the processor . the c6 logic states are then defined as a subset of the processor logic states 110 . the c6 logic states may be those states that receive power ( e . g ., vccp ) during a c6 mode , and accordingly retain their state and are not be eligible for randomization . alternatively , the c6 logic states may be those states that are not retained during a c6 mode , and thus can be randomized . a c6 randomization list is created based on the c6 logic states 120 . if the c6 logic states are the states that cannot be randomized , the c6 randomization list is created by excluding those states from the processor logic states . alternatively , if the c6 logic states are the states that can be randomized , the c6 randomization list is created to include the c6 logic states . fig2 illustrates an example flow chart for utilizing the c6 randomization list to simulate a processor c6 mode . initially , the simulation is being run 200 . a determination may be made as to whether the processor has entered a c6 mode 210 . if the processor has not entered a c6 mode 210 no , the simulation continues 200 . if the processor has entered a c6 mode 210 yes , the states of the logic ( or a portion of the logic ) about to be lost during the c6 mode ( pre c6 mode states ) are copied to a memory means 215 . a c6 randomization may be initialized to randomize the states included in the c6 randomization list 220 . the c6 randomization may provide random logic states to the logic that has been powered down in the c6 mode . the random logic states may be randomly selected by the simulation . alternatively the logic states may be randomly selected by a user of the simulation . the user may select to inject all 1s or all 0s or a repeating pattern rather that randomly selecting each state . after the c6 randomization , the simulation continues 230 . a determination may be made as to whether the processor has exited the c6 mode ( e . g ., returned to a powered state ) 240 . if the processor is not exiting the c6 mode 240 no , the simulation continues 230 . according to one embodiment , if the processor is not exiting the c6 mode 240 no , the c6 randomization may be processed again 220 . this enables the c6 logic states to be randomized multiple times during the c6 mode . the c6 randomization 230 may be repeated while the processor remains in the c6 mode 240 no based on various parameters or conditions . if the processor has exited the c6 mode 240 yes , the simulator may retrieve the pre c6 mode states from the memory means and copy those states to the logic ( or portion thereof ). in order to ensure that the pre c6 mode states were accurately recovered ( and to ensure proper operation of the processor ), the simulation may compare the pre c6 mode states from the memory means to the post c6 mode states that were recovered for the lost logic 250 . if the states are the same , the processor is assumed to be working correctly . if the values are different , the discrepancy is flagged . fig3 illustrates an example timing diagram defining the period within which the c6 randomization may be performed . during powered operations vcc is on . upon initiation of the c6 mode , the vcc is ramped down and after the vcc dips below a retention value the states of the logic receiving vcc is lost . accordingly , the states of the logic that need to be preserved from vcc need to be transferred to the memory means ( vccp domain ) prior to this point . the bottom line illustrates states being stored in the vccp domain . while not illustrated for ease of convenience , the initiation of the c6 mode may be based on the setting of a signal or sequence of signals . when the processor determines that there is activity and it should return to the powered on state the vcc begins to ramp up . once the vcc ramps past the retention value the processor exits the c6 mode and again enters the powered state . the c6 randomization can be implemented during the c6 mode . the c6 randomization may be implemented multiple times during this period . according to one embodiment , the c6 randomization may be implemented during the vcc ramp up , as long as vcc is still below the retention threshold value . the states may remain stored in the vccp domain for some time after the exit of the c6 state in order to enable the processor to restore the states so that the restored states can be compared to the recorded states . fig4 illustrates an example flow chart for running a c6 randomization during a vcc ramp . the simulation is running during the c6 mode 400 . a determination is made as to whether the vcc is ramping up 410 . if the determination is that there is no vcc ramp 410 no , the simulation continues . if the determination is that the vcc ramp has started 410 yes , the c6 randomization is performed 420 . while not illustrated , once the processor exits the c6 mode the registers are checked . according to one embodiment , the c6 randomization values that are utilized in the simulation may be recorded so that errors detected in the simulation can be recreated . according to one embodiment , the simulation may be modified to focus on certain functional units or to exclude certain functional units during the simulation of the exit of the c6 mode . according to one embodiment , a user may exclude signals from the c6 randomization for any number of reasons . the signals may be excluded by updating the c6 randomization list to remove the logic . while the disclosure focused on simulating a c6 mode of a processor and identifying the logic states that can be randomized ( the logic that lost their power state ) during the c6 mode , it is in no way intended to be limited thereto . rather , the simulation may be performed for any event ( e . g ., power state of the processor , other state of the processor ) where a subset of the logic loses its logic state during operation and the logic level selection or exclusion can be identified for the event so that an appropriate logic level randomization list is created for the occurrence . while the disclosure focused on simulations for processors it is in no way intended to be limited thereby . rather the simulation and the select signal level randomization utilized in the simulation can be used for any type of integrated circuit without departing from the current scope . although the disclosure has been illustrated by reference to specific embodiments , it will be apparent that the disclosure is not limited thereto as various changes and modifications may be made thereto without departing from the scope . reference to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure or characteristic described therein is included in at least one embodiment . thus , the appearances of the phrase “ in one embodiment ” or “ in an embodiment ” appearing in various places throughout the specification are not necessarily all referring to the same embodiment . the various embodiments are intended to be protected broadly within the spirit and scope of the appended claims .	6
fig1 shows an example of a light exposure apparatus according to the present invention as applied to the manufacture of color picture tubes . although not illustrated , the invention may also be applied to light exposure apparatus used for pattern formation of semiconductor integrated circuits . in fig1 a mercury - vapor lamp 1 serves as a light source , 2 a power source for supplying electric power to the mercury - vapor lamp , 3 a spectral filter possessing a hill - shaped transmittivity characteristic in a range of wavelength of from 300 to 400 nm , 4 a grading filter of 1 . 3 mm thick soda - lime glass serving as a first lens , 5 a second lens of plain plate glass bk - 7 , 6 a correction filter serving as a third lens , 7 a correction lens serving as a fourth lens , 8 a temperature sensor of zener diode attached , as separated by a distance of about 10 mm from the optical axis , to a glass substrate 9 mounted on the grading filter 4 , 10 a blower serving to blow off high - pressure air , 11 a hose for directing the high - pressure air onto the glass substrate 9 , 12 a face panel of a color picture tube , 13 a shadow mask , 14a an incident light sensor disposed at the center of the face panel 12 and serving to measure the intensity of light , and 14b an incident light sensor disposed at a peripheral position of the face panel 12 . during the measurement of the intensity of light , the incident light sensors 14a , 14b are set in position on the inner surface of the face panel 12 . prior to the actual light exposure , the sensors 14a and 14b are removed and a photosensitive film is formed on the inner surface of the face panel 12 . fig2 shows a circuit for temperature measurement . in the figure , 15 denotes a temperature sensor amplifier , 17 an indicator , r f a feedback resistor , r 1 through r 4 each an input resistor , and vr a variable resistor . let i s stand for the magnitude of electric current flowing to the temperature sensor 8 , t 1 and t 2 respectively for the temperatures detected by the temperature sensors 8 , 15 , and k for a constant and assume r 1 = r 3 = 4 . 3 k then r 2 = r 4 , and the output voltage of the operational amplifier 16 will be expressed by the following formula : ## equ1 ## thus , the temperature of the glass substrate or the grading filter 4 can be read out of the indicator . in this arrangement , after the mercury - vapor lamp 1 is turned on , the temperature of the grading filter 4 rises and the light transmittivity proportionally decreases with the elapse of time . when the hose 11 blows off the high - pressure air onto the glass substrate 9 , the rise of the temperature is repressed to keep the light transmittivity at a constant level . consequently , the intensity of light on the inner surface of the face panel 12 is kept constant . now , the results of various measurements made with the present embodiment of the light exposure apparatus will be described with reference to graphs . fig3 shows temperature elevation properties of various lenses in the optical system . during the measurements , the room temperature was fixed at 25 ° c . and the power of the mercury - vapor lamp at 1 kw . the distances from the light source were 57 . 6 mm to the glass substrate 9 , 59 . 0 mm to the first lens , and 79 . 6 mm to the correction filter 6 , respectively . the correction filter 6 was also made of soda - lime glass . in the figure , solid curves represent the properties exhibited normally without forced cooling and the dotted - line curves represent the properties exhibited when the blower 10 was operated to feed the high - pressure air supplied under a pressure of 0 . 5 kg / cm 2 to the glass substrate 9 . curve ( a ) represents the property obtained of the grading filter 4 through the detection by temperature sensor 8 , curve ( b ) that obtained of the first lens 5 , and curve ( c ) that of the correction filter 6 , respectively . temperatures of first lens 5 and correction filter 6 were detected by suitable sensors not shown . the cooling of the grading filter 4 to a temperature which is above dew point has an effect of preventing the other lenses from gaining in temperature , although this effect dwindles with the increasing distance . it is noted from the figure that repression of temperature rise in the various lenses started two to three minutes after the lamp had been turned on . fig4 shows the temperature elevation properties exhibited by the grading filter 4 when the cooling conditions were changed by varying pressure of the high - pressure air . curve ( a ) represents the property exhibited in the absence of cooling , and curves ( b ), ( c ), ( d ), and ( e ) represent the properties exhibited under the pressures of 0 . 2 kg / cm 2 , 0 . 5 kg / cm 2 , 1 . 0 kg / cm 2 , and 2 . 0 kg / cm 2 respectively . compared with the property of ( a ) involving no cooling , the properties of ( b ) and ( c ) involving relatively small extents of cooling reflect the effect of cooling to fair extents . fig5 shows the relative light intensity properties exhibited at the central position of the inner surface of the face panel when the cooling conditions were changed by varying the pressure of the high - pressure air . the change is expressed by the ratio of the intensity of light detected by the incident light sensor 14a at the central position to the initial intensity of light taken as 100 . curve ( a ) represents the property exhibited in the absence of cooling and curves ( b ), ( c ), and ( d ) represent the properties exhibited under the pressures of 0 . 2 kg / cm 2 , 1 . 0 kg / cm 2 , and 2 . 0 kg / cm 2 respectively . on elapse of more than 10 minutes after the lamp had been turned on , the curve ( a ) showed a fall of 9 percent and the curves ( b ), ( c ), and ( d ) showed small falls of 3 percents , 1 percent , and 0 . 8 percents respectively . fig6 shows the change in the ratio of the intensity of light detected at the central position to the intensity of light detected at the peripheral position by the incident light sensor 14b . curve ( a ) represents the property exhibited in the absence of cooling and curve ( b ) the property exhibited when the pressure was 1 . 0 kg / cm 2 . it is noted from the figure that , on elapse of 6 minutes after the lamp had been turned on , the ratio increased by 5 percent in ( a ) and by only 1 percent in ( b ). in the embodiment so far described , the grading filter 4 was made of a soda - lime glass of 1 . 3 mm in thickness . it can be made of any of various other materials . now , the dependency on temperature of the change of the relative transmittivity of various glass materials will be described . fig7 shows relative transmittivity properties indicating the change of transmittivity of various glass materials due to the change of temperature , with abscissa representing temperature of glass materials and ordinate representing relative transmittivity under the room temperature ( 25 ° c .) condition taken as 100 . each of the glasses involved was used in the form of a grading filter 4 and cooled with the high - pressure air of 1 . 0 kg / cm 2 . curve ( a ) represents the property of a bk - 7 glass of 2 . 5 mm in thickness , the curve ( b ) that of a filter formed by vapor depositing 35 percent ni on a 2 . 5 mm thick bk - 7 glass , curve ( c ) that of the same soda - lime glass of 1 . 3 mm thickness as used in the embodiment described above , curve ( d ) that of a lens glass , curve ( e ) that of a soda - lime glass of 3 . 0 mm thickness , and curve ( f ) that of a filter formed by vapor depositing 35 percent ni on a 1 . 3 mm thick soda - lime glass . it is noted from the figure that the relative transmittivity is variable with the material and thickness of glass and with the presence or absence of vapor - deposited coating . it is seen particularly that the bk - 7 glass showed less change of spectral transmittivity due to the change of temperature , indicating that the spectral filter using this glass offers stabler light intensity than that using soda - lime glass . fig8 compares soda - lime glass and bk - 7 glass in terms of temperature rise . the test conditions involved in this case were the same as those of fig7 . curve ( a ) represents the property exhibited by a filter formed by vapor depositing 35 percent ni on a soda - lime glass , curve ( b ) the property exhibited by a bs - 7 glass sheet of 2 . 5 mm thickness , and curve ( c ) the property exhibited by a filter formed by vapor depositing 35 percent ni on a bk - 7 glass . fig9 shows a similar comparison in terms of relative light intensity at the central position . it is noted that on elapse of 6 minutes , the relative light intensity fell by 3 percents in the case of soda - lime glass of ( a ), whereas it fell by only 1 percent in the case of bk - 7 glass of ( b ). curve ( c ) corresponds to the property exhibited by a bk - 7 glass with a 35 % ni vapor deposited coating . fig1 shows the rise of temperature of a grading filter 4 ( soda - lime glass ) observed when the electric power of the mercury - vapor lamp was varied and fig1 shows the change of light intensity ( value of illumination ) at the central position of the inner surface of the face panel observed when the electric power of the mercury - vapor lamp was similarly varied . the cooling was effected with the pressure of air fixed at 0 . 5 kg / cm 2 . in each of the two diagrams , curve ( a ) represents the property exhibited when the electric power of the mercury vapor lamp was 500 w and curves ( b ), ( c ), and ( d ) represent the properties exhibited when electric power was abruptly raised from 500 w to 700 w , from 500 w to 900 w , and from 500 w to 1100 w respectively . it is noted that at all the levels of electric power involved , the light intensity in terms of illumination at the central position was kept substantially at a fixed value despite the sharp rise in electric power . fig1 shows wavelength characteristics in accordance with types of glass materials used for lenses and filters in the optical system of the light exposure apparatus . when using a spectral filter 3 of a uv - dic filter manufactured by toshiba , a wavelength range of from 300 to 400 nm covering spectral sensitivity of photoresist for black matrix type color picture tubes can be obtained . however , the soda - line glass and bk - 7 glass have within the above wavelength range temperature characteristics as shown in fig1 wherein wavelength curves shift toward longer wavelengths as the temperature increases and toward shorter wavelengths as the temperature decreases . such a shifting of the wavelength curves is found reversible . on the other hand , quartz glass has no temperature dependency within a wavelength range of from 250 to 400 nm and is stable . but difficulties are encountered in making a quartz glass correction lens of complicated curved surfaces and a quartz glass optical lens . in addition , quartz glass is expensive even in the form of a flat plate . accordingly , it is desirable to use soda - line glass and bk - 7 glass . in employment of the soda - line and bk - 7 glass materials in the optical system , the temperature needs to be always kept constant in order to obtain the constant transmittivity and especially , kept at lower values for the sake of obtaining higher transmittivities . a blower 10 as exemplified in fig1 has an outlet port member 130 mounted to one end of the hose 11 . the outlet port member is disposed near the glass substrate 9 and has an elongated opening suitable for blow - off onto one surface of the glass substrate 9 . connected to the other end of the hose is a regulator valve 131 through which air from a constant pressure air source 132 is fed to the outlet port member . the valve ( 3 ) is provided with a pressure adjusting lever 133 . accordingly , by manipulating the lever 133 , the blow - off pressure can be adjusted . denoted by 134 is a cock for opening and closing the valve 131 . the blower 10 has dimensions as indicated in fig1 . although in experiments , there was observed no correction between the temperature detected and the pressure of the cooling air , it is possible to control the pressure of the cooling air so as to maintain the temperature at a fixed level by feeding the temperature signal of the grading filter back to the air blower . by this feedback arrangement , it becomes possible to regulate the light intensity on the surface exposed to light constantly at the prescribed value . fig1 shows an example of such a closed loop controlling wherein a control unit 141 is interposed between the output of a temperature measurement circuit 140 as shown in fig2 and the blower 10 . the control unit 141 is actuated in response to output signals of the circuit 140 and the adjusting lever 133 of the blower is adjusted in accordance with the actuation of the control unit . according to the light exposure apparatus contemplated by this invention , since the spectral transmittivity of the glass such as of the grading filter can be regulated to a constant value by controlling the temperature of the glass as described above , this invention brings about an effect of stabilizing the light intensity on the surface exposed to light a very short time after the light source has been turned on .	7
[ 0033 ] fig1 schematically illustrates a part of constitution of a rlg working system for carrying out a mr height working process and a taper working process according to a preferred embodiment of the present invention , and fig2 illustrates electrical constitution of the embodiment in fig1 . in fig1 and 2 , reference numeral 10 denotes a bar in which a plurality of thin - film magnetic head sliders formed by cutting a wafer ( not shown ) are aligned , 11 denotes a jig or a transfer tool for the rlg working to which the bar 10 is attached , 12 denotes a bar code reader for reading a bar code 13 provided on the jig 11 , 14 denotes a rlg working machine for carrying out the mr height working process and taper working process , 15 denotes a personal computer electrically connected to this rlg working machine 14 and the bar code reader 12 , 16 denotes a plurality of rlg sensors ( lapping control sensors ) provided on the bar 10 and connected to the computer 15 , 17 denotes a rlg database having a jig number database ( jignodb ) table 18 and a wafer database ( waferdb ) table 19 , 20 denotes an optical measuring device of rlg sensor height , and 21 denotes a chamfer length measuring device . the computer 15 , the rlg database 17 , the sensor height optical measuring device 20 and the chamfer length measuring device 21 can transmit and receive data through a network such as lan 22 . although not shown in fig2 a plurality or sets each composed of the computer 15 and the rlg working machine 14 can be connected to the lan 22 . in this embodiment , the jig 11 is formed by a white ceramic material , and a black colored bar code which represents a jig number for identifying this jig itself ( identification sign ) is formed on a side surface of the jig 11 by laser processing . the rlg working machine 14 conducts control of stopping position for mr height ( or throat height ) working of bar 10 , correction of bending of a bar , and working of a slider taper portion in control of the computer 15 . the structure of this type of working machine is well known from , for example , u . s . pat . no . 5 , 620 , 356 . the rlg sensors 16 are simultaneously formed together with mr head elements in the wafer processing stage . the planar structure of one of the rlg sensors is shown in fig3 which illustrates a plan view of mr head element portions and a rlg sensor portion of the bar 10 . in this figure , although all the mr head element portions and the rlg sensor portion cannot be seen from outside due to an inductive head element multi - layered on this structure , a part of these layers on the bar 10 is transparently viewed . in fig3 reference numeral 10 denotes the bar , 10 a denotes an abs of the bar 10 , which is to be lapped , 30 and 31 denote two of a plurality of mr head elements formed in one row along this bar 10 , 32 denotes one of the rlg sensors formed in a space area between the mr head elements 30 and 31 in parallel with these mr head elements , 30 a and 31 a denote mr layers of the respective mr head elements 30 and 31 , 30 b and 31 b , and 30 c and 31 c denote lead conductors connected to both ends of the mr layers 30 a and 31 a , 32 a denotes a resistor layer of the rlg sensor 32 , and 32 b and 32 c denote lead conductors connected to both ends of the resistor layer 32 a . the mr layers 30 a and 31 a and the resistor layer 32 a run in parallel with the abs 10 a . the jignodb table 18 is a reference table in which relationships of a wafer number for identifying the wafer , a bar number for identifying the bar 10 and a jig number of the jig 11 to which the bar 11 is attached are stored . the waferdb table 19 is a database in which a wafer number is used as a first retrieval key and a bar number is used as a second retrieval key . in the table 19 , various working data inherent to each bar are stored so that the data can be taken out in a unit of bar . the rlg sensor height optical measuring device 20 optically measures non - lapped rlg sensor height in the wafer processing stage . the optically measured data with respect to rlg sensor height hereinafter referred to as msi data is transferred to the waferdb table 19 through the lan 22 during the wafer processing stage . the chamfer length measuring device 21 measures a chamfer length , namely length of the taper portion of bar 10 . the measured data of the chamfer length is transferred to the computer 15 through the lan 22 . [ 0041 ] fig4 schematically illustrates a flow of the rlg working process in this embodiment . before starting the rlg working process , data are prepared in the rlg database 17 ( step s 0 ). that is , during the wafer processing stage , parameters inherent to each bar , which are necessary for calculation of mr height and calculated from measured resistance data from the rlg sensor 16 and msi data from the optical measuring device 20 , working target values of the mr height and working standards ( errors ) are stored in the waferdb table 19 for each bar in a unit of wafer . furthermore , each bar 10 separated from the wafer by cutting is adhered to the working jig 11 , and relationships of the wafer number for identifying the wafer , the bar number for identifying the bar 10 and the jig number of the jig 11 to which the bar 10 is adhered are stored in the jignodb table 18 . the parameters inherent to each bar which are necessary for calculation of the mr height and stored in the waferdb table 19 are calculated as follows . as shown in fig5 a marker 50 , a plurality of mr head elements 51 , 52 , 53 , . . . , and rlg sensors 54 , 55 , 56 , . . . are formed on the single bar 10 in rows . the mr head elements 51 , 52 and 53 and the first , second and third rlg sensors 54 , 55 and 56 are alternately aligned . these rlg sensors 54 , 55 and 56 have patterns different from each other . a plurality of sets , for example , 12 sets of the first , second and third rlg sensors 54 , 55 and 56 are formed on the single bar 10 . this 12 sets case corresponds to a case of 30 % shrink magnetic head . edges 57 opposite to the abss 10 a of the mr head elements and the rlg sensors are aligned on the same line which is parallel to the abs 10 a . although omitted in fig5 to these mr head elements and rlg sensors are connected lead conductors as shown in fig3 . width and height of the first rlg sensor 54 are defined as w 1 and h 1 ( μm ), width and height of the second rlg sensor 55 are defined as w 1 and h 1 − 10 , width and height of the third rlg sensor 56 are defined as w 1 + 10 and h 1 − 10 . in order to correct a difference between a designed pattern size on a mask used for making these pattern and an actual pattern size of the bar , distance ( msi ) between the edge 58 positioned on the abs side of the marker 50 and the edges 57 opposite to the abs side of the mr head elements and rlg sensors is measured by the optical measuring device 20 . then , the difference between the measured msi data and the designed value of 13 μm for example is added to or subtracted from h 1 . the designed value of h 1 is 20 μm , and the designed value of w 1 is also 20 μm . a resistance value r 1 of the first rlg sensor 54 , a resistance value r 2 of the second rlg sensor 55 , and a resistance value r 3 of the third rlg sensor 56 are given by the following expressions ; r 2 = r l +( c + s × w 1 )/( h 1 − 10 ) r 3 = r l +{ c + s × ( w 1 + 10 )}/( h 1 − 10 ) where r l represents a resistance value of lead conductors , s represents a sheet resistance value defined by the material and thickness of a resistor layer , and c represents other resistance ( resistance value per a unit of height ) such as crowding resistance . ( c + s × w 1 ) and r l can be calculated using r 1 and r 2 in these expressions as follows . c + s × w 1 =− h 1 ×( h 1 − 10 )×( r 1 − r 2 )/ 10 r l = r 1 +( h 1 − 10 )×( r 1 − r 2 )/ 10 thus , ( c + s × w 1 ) and r l are calculated with h 1 corrected by msi data and resistance data r 1 and r 2 actually measured by the first and second rlg sensors 54 and 55 , using the above - described expressions . then , the obtained values are stored in waferdb table 19 . rlg working process is actually started from step s 1 in fig4 . first , the jig 11 to which the bar 10 to be lapped is adhered is placed on the rlg working machine 14 ( step s 1 ). after the placement , the bar code 13 described on the jig 11 is read out by the bar code reader 12 ( step s 2 ). thus , the computer 15 obtains a jig number from input bar code data , and retrieves the jignodb table 18 of the rlg database 17 by referring to the obtained jig number , and extracts a wafer number and a bar number ( step s 3 ). then , the waferdb table 19 of the rlg database 17 is retrieved by referring to these wafer number and bar number , and parameters inherent to the bar , a target value of mr height working , and working standards ( errors ) thereof are extracted from the table 19 ( step s 4 ). then , the rlg working process for lapping the abs is started on the basis of the extracted data ( step s 5 ). this rlg working process is carried out as follows . during lapping , resistance values of the rlg sensors are repeatedly ( at a predetermined interval , for example , 10 seconds ) detected and mr heights h m r at that time are calculated ( step s 6 ). then , bending of the bar is corrected to uniform mr heights in the respective portions of the bar , in response to the calculated values ( step s 7 ). if the calculated mr heights h mr have reached to the target value , the lapping is stopped ( step s 8 and s 9 ). after the rlg working process is completed , finally measured resistance data r 1 and r 2 are stored in the waferdb table 19 ( step s 10 ). in this embodiment , the resistance values r 1 and r 2 of the first and second rlg sensors 54 and 55 are detected and mr heights are calculated from the detected resistance values . the mr height h mr is calculated by parameters r l and ( c + s × w 1 ) inherent to the bar and by detected resistance data r 1 and r 2 , using the following expression ; h mr =( c + s × w 1 )/( r 1 − r l ) h mr =( c + s × w 1 )/( r 2 − r l ). [ 0057 ] fig6 schematically illustrates a flow of a taper working process in this embodiment which is carried out sequentially to the rlg working process shown in fig4 . after the rlg working process has been completed , a primary taper working ( rough working ) of the bar is carried out for a required time with the jig 11 attached to the rlg working machine 14 ( step s 11 ). then , the jig 11 is detached from the rlg working machine 14 , and is placed on the chamfer length measuring device 21 to measure its chamfer length after the primary taper working ( step s 12 ). then , the bar code 13 of the jig 11 is read out by the bar code reader 12 ( step s 13 ). thus , the computer 15 obtains a jig number from input bar code data , retrieves jignodb table 18 for the rlg database 17 by referring to the obtained jig number , and extracts a wafer number and a bar number ( step s 14 ). then , the waferdb table 19 of the rlg database 17 is retrieved by referring to these wafer number and bar number , and working standard values of this bar are extracted from the table 19 ( step s 15 ). then , the chamfer length is measured by the chamfer length measuring device 21 , and the measured data is stored in the waferdb table 19 ( step s 16 ). the jig 11 is then detached from the chamfer length measuring device 21 , and is placed on the rlg working machine 14 ( step s 17 ). thereafter , the bar code 13 of the jig 11 is read out again by the bar code reader 12 ( step s 18 ). thus , the computer 15 obtains the jig number from input bar code data , retrieves jignodb table 18 for the rlg database 17 by referring the obtained jig number , and extracts the wafer number and bar number ( step s 19 ). then , the waferdb table 19 for the rlg database 17 is retrieved by referring the wafer number and the bar number , and the measured data of the chamfer length of the bar and the standard values of the bar are extracted from the table 19 ( step s 20 ). from thus obtained measured data of the chamfer length , the standard values and the time period of the primary taper working ( rough working ), a required time period for a secondary taper working ( accurate working ) by which the chamfer length becomes a target value is calculated ( step s 21 ). the secondary working is then carried out on the basis of this calculated time period ( step s 22 ). after the completion of the secondary working , the jig 11 is detached from the rlg working machine 14 ( step s 23 ). as explained above , since waferdb table 19 stores retrievable data in a unit of bar , the workpieces in one process can be moved to next process by the unit of bar . as a result , each process can be smoothly carried out causing dwell time between the processes to reduce . furthermore , since identification of the bar 10 to be worked is carried out by identifying the jig 11 to which the bar 10 is attached , the identification of the bar 10 to be worked is certain and easy , whereby the problem according to the conventional art that incorrect bar working processes are executed due to using of another bar data can be solved . in addition , since the identification of the bar 10 is carried out by using jignodb table 18 in which relationships of the wafer number , the bar number and the jig number are stored , the bar identification in each working process can be certainly and rapidly carried out . therefore , working man - hour for retrieval or else is greatly decreased . furthermore , since the jig is identified by using a bar code , reading can be certainly carried out than in a case where other identification signs are used . alternatively , if a plurality of sets of a computer and a rlg working machine are in parallel connected to the rlg database through a network of such as lan , a working process such as a rlg working can be simultaneously carried out with respect to bars of one wafer . although in the above - mentioned embodiment , data is used in a unit of bar in the rlg working process and the taper working process , it is apparent that the same advantages will be obtained in other working processes and other processes other than the working processes such as a visual test process for a slider . many widely different embodiments of the present invention may be constructed without departing from the spirit and scope of the present invention . it should be understood that the present invention is not limited to the specific embodiments described in the specification , except as defined in the appended claims .	8
fig1 shows that tracking filter 100 relies on inductor and capacitor ( lc ) filtering using fixed inductors and variable capacitors . as shown , in one possible implementation , the variable capacitors are implemented as arrays of capacitors 101 with switches 102 . the switches can easily be implemented using metal - oxide - semiconductor ( mos ) transistors but other methods are possible too such as diode switches . the switches connect the capacitors to a common signal point , for example ac ground . the switches are shown on the ac ground side of the capacitors but could also be on the signal side of the capacitors . additionally , fig1 shows how low noise amplifier ( lna ) 104 can be split up into several banks using different values of inductors to limit the required range of each capacitor bank . the variable capacitors can be implemented in other well - known ways such as with varactors or a combination of varactors with switched capacitors . one implementation of the lna is to use active gain elements . another implementation of fig1 can use unity gain or low gain buffers , for example , emitter followers , and gain is provided by the tracking filter . the tracking filter gain is the passive voltage multiplication provided by the q of the lc tanks ; therefore , the voltage gain would be equal to q , the circuit &# 39 ; s quality factor . a circuit &# 39 ; s q is defined as two times the product of pi and the ratio of the maximum energy stored to the energy dissipated per cycle . in addition to the gain from the q , the lna / tracking filter can also provide voltage gain at its input due to intentionally mismatching , for example , the input impedance is set higher than the signal source impedance , which causes less voltage division from the source than if the input impedance had been power - matched . this effect is maximized if high input impedance buffers are used ; however , if there is a restriction on allowable s 11 ( input reflection coefficient ) then it may be necessary to set the input impedance to a lower value . this can be done by either using amplifier or buffer 103 with a suitable input impedance or by using resistor 105 as shown in fig1 . alternatively , an impedance matching technique can be used that is described in co - pending and commonly assigned u . s . patent application filed dec . 9 , 2005 , serial number tbd , entitled “ tuner design and system for lossless interconnect of multiple tuner ” by peter shah , which claims priority from u . s . provisional application no . 60 / 636 , 305 filed dec . 15 , 2004 entitled “ tuner design and system for lossless interconnect of multiple tuners ” incorporated herein by reference . in this technique , a switchable matching impedance can be integrated into the tuner or can be located outside the tuner . using emitter followers in the lna as opposed to active gain blocks enables very high linearity and high input impedance . it is especially an advantage that the load impedance for the emitter followers increases significantly for frequencies away from the resonance frequency of the lc circuit . this greatly improves linearity for jammers at larger frequency offsets from the desired channel without sacrificing noise figure for the desired signal . fig1 shows the lna consisting of pre - buffer or amplifier 103 driving three buffers or amplifiers , of which only one is active at a time , depending on which band is selected . the number of bands could be any number from 1 upwards . in addition , the pre - buffer can be omitted - its main benefit is to reduce parasitic loading of the rf input from the disabled tracking filter buffers . similarly the switches ( s 1 , s 2 , s 3 ) can be omitted if the test signal buffer is designed so that it has relatively high output impedance when off . the same argument applies to switch s 4 in stage 106 of fig1 . the mentioned buffers do not have to be emitter - followers ; they could be implemented as source followers or as any other known buffer technique . in one embodiment , variable automatic gain control ( agc ) gain can be obtained by using variable parallel resistors across the tank circuits , which can de - q the filter and thereby lower the gain . in one implementation , the variability can be achieved by a resistor network 110 with switches 111 connecting the resistors to ground . this should be construed as ac ground , for example a suitable reference voltage or a capacitor connected to the circuit ground or any other technique for providing an ac signal ground . alternatively , the switches could be placed between the resistors and the signal node . variability of the resistors can be achieved in other well know ways , including using mos transistors . the lna optionally incorporates calibration signal input 107 . this can be used for auto - calibration of the center frequency that , for example , would determine the correct capacitor switch settings . the test signal can either be passed through the lna or it can be routed directly to the output . the latter feature also enables gain calibration if desired . fig2 shows lna calibration circuitry comprising calibration block 200 and calibration clock generator circuit 202 . the purpose of the calibration circuit is twofold : to tune the filter to the desired channel by adjustment of the capacitor arrays , and to optionally adjust the gain . the gain can be adjusted at several locations , for example , in the lna , before the lna or , by adjusting the tank circuit q and therefore the filter gain to a nominal value . calibration clock generator circuit 202 produces calibration test tone 201 and clock signals for the sample / hold and state machine circuits . the filter calibration is done by injection of test tone 201 in the signal path and by adjustment of the capacitor array while detecting the level of the test tone after it has passed through the receiver and dedicated detection circuitry 210 . the filter is centered by detecting the point at which , as the capacitor array is adjusted , the receive path gain is maximized . one way of achieving this is to monotonically adjust the capacitor array until the gain stops increasing and starts to decrease . hence , the circuit yields the peak receive path gain that is also for this filter topology the center frequency of the filter . this method requires some storage mechanism in order to determine change in gain from one step to the next . this can be achieved in several well - known ways , including sample - hold circuits 220 for analog implementations or registers in digital implementations . the gain calibration is done by injection of test tone 201 in the signal path , and establishing a reference receive path gain “ a ” with the lna bypassed . the lna is then switched in using the calibration through path and a new receive gain path gain “ b ” is established . the difference between “ a ” and “ b ” is the gain of the lna and tracking filter . the filter gain is then optimized by adjustment of a resistor array . in one implementation , an attenuator loss of predetermined value is switched in into the calibration block during the “ b ” phase only . the filter gain is optimized by adjustment of a resistor array while detecting the level of the test tone , after passing through the receiver and dedicated detection circuitry . path gain “ b ” is compared with the previously established reference receive path gain “ a ”. the filter gain is optimized and equal to the predetermined attenuator loss when gains “ a ” and “ b ” are equal , since the lna gain exactly offsets the attenuator loss . hence , the lna gain can be precisely set and in addition , if several attenuator values are available then several lna gain settings can be achieved . similar to the filter calibration , a storage function is needed . for the gain calibration , the signals representing gain “ b ” and the previously determined gain “ a ” need to be stored and compared . the lna calibration of determining center frequency and gain can be implemented in several ways , spanning from complete analog to complete digital or software implementation . fig2 shows a mainly analog implementation in which the aforementioned storage function is implemented with sample - hold circuits . alternatively , in a digital implementation one could use registers to store previously digitized signal samples . in digital receivers , such digitization of signal samples is already present and can be taken advantage of for this calibration as well . this invention also addresses some potential issues with the calibration method . situations to consider include leakage of the test tone out the rf pins could violate emissions specifications , noise and strong co - channel interference at the input can corrupt the calibration , thus making reliable signal level measurements difficult , and off - channel jammers can corrupt calibration by overwhelming the test tone signal and thereby causing the calibration machine to center on the jammer instead of the test tone . to overcome these issues , a test tone level control circuit can optionally be implemented which minimizes the level of the test tone while ensuring that noise or interference does not corrupt the measurement . for this the test tone level is set to a minimal value and gradually increased until a minimum required ratio of calibration test tone to noise and interference is achieved . this also ensures that emission of test tone power is minimized during the calibration period . fig3 shows details of an example of the described calibration procedure . the calibration procedure can be implemented in various other ways . fig2 shows an example implementation of an agc loop around the lna / tracking filter . this can take any number of inputs from any locations in the signal path . in the example shown , two sense points are used , input 203 of the mixer and input 204 of the main part of the channel filter . using this method , the front - end gain is determined by avoidance of overloading the channel filter as well as avoidance of overloading the mixer input . it is advantageous to use a sense point after the tracking filter but before the mixer . this enables the agc to react to off - channel jammers . the jammer level at which the agc starts reducing the gain then depends on the frequency offset from the desired channel ; the further the frequency offset is , the higher the tolerable jammer level before the onset of gain reduction . this is desirable because the distortion properties improve with further offset as well , thus allowing higher jammer levels for increasing frequency offset without contaminating the desired channel unacceptably . this allows the receiver to operate at higher gain for the desired channel compared to if the sense point had been before the tracking filter . the higher gain , in turn , means lower noise figure in the presence of jammers and therefore better reception quality . in the implementation shown in fig2 , the agc loop can advantageously be implemented in digital form , for example as an up / down counter whose output word controls the resistor array . the counter would be clocked with a reference frequency and the up / down control would be determined by the outputs of the power or peak detection circuits . in a simple form the analog outputs can be compared to reference , called “ set point ” values by using comparators and the digital outputs of these comparators can then be logically or &# 39 ; ed together to form the up / down control signal for the counter . in situations where the jammers are analog video signals asymmetric agc attack and decay times can be used , one implementation would be to sample a number of consecutive samples of the error signal to detect a ramp up / down and use this to slow down the counter clock using a divider . it may be desirable to limit the maximum q of the filter to prevent excessive gain variation in the passband , for example , lower frequencies will yield a narrower passband than at higher frequencies for the same q value . a maximum filter q can be set by limiting the maximum value of the variable resistors . one way to implement a resistance limit with switched resistors is to have a separate control register to store the limit value ; the value may be different based on frequency . the resistor control word is then prevented from setting the resistance beyond the limit value .	7
fig1 is a diagram useful for explaining the principles of the present invention . specifically , fig1 shows a two - dimensional image plane obtained from a signal corresponding to one field ( frame ) of a video formation signal to be recorded . in fig1 vertical and horizontal edge portions correspond to vertical and horizontal blanking portions , respectively , and a rectangular portion surrounded by a chain line corresponds to an image actually displayed on a monitor tv set . an upper hatched portion of an area surrounded by the vertical and horizontal blanking portions , which corresponds to several horizontal scanning periods ( h ), is assigned as a control signal insertion block . the remaining portion of the area is divided into m × n blocks as shown . control signals assign blocks into which time - compressed audio information is inserted so that locations in the image plane into which audio information is inserted are determined . it is of course possible , alternatively , to assign the locations into which video information is inserted and the size thereof to thereby determine blocks into which audio information is to be inserted . fig2 illustrates an example of insertion of audio information . in fig2 the audio information is inserted into an oppositely hatched block having the form of a rectangular ring , while the video information is inserted into a block surrounded by the rectangular ring . thus , a portion of the rectangular ring block into which the audio information is inserted appears in the monitor image plane surrounded by the chain line . that portion may be clamped at a constant level or replaced by other external video information in the reproduction apparatus . fig3 a and 3b show a video format signal waveform for recording using the ntsc system . it should be noted that other systems such as pal may be used . fig3 a shows the waveform prior to insertion of audio information , and fig3 b shows the same after insertion . in fig3 a and 3b , letters a and b depict test signals , such as color bars or the like , c indicates control information , and d the audio information . although , in fig3 b , there is no information inserted into vertical blanking ( v - blk ) intervals , the control information and the audio information may be inserted thereinto , alternatively to fig3 b . at least portions of the control information which relate to the location into which the audio information is inserted and to the image processing method should be inserted into a predetermined portion of a location preceding a corresponding image . in a case where the audio information is recorded through several frames , the control information is preferably inserted into a predetermined portion of a first frame , although it may be inserted into any frame other than the first frame . fig4 is a block diagram of an encoder used for providing the video format signal according to the present recording system . an analog audio signal is digitized with a nonlinear analog - to - digital ( a / d ) converter 1 operating according to a modulation system such as adaptive delta modulation ( adm ) or adaptive differential pulse code modulation ( adpcm ) which provides a high compression effect . the resulting digital signal is supplied to an error correction coding circuit 2 in which it is interleaved to distribute any digital signal error which may be caused by signal dropout due to defects or dust on the recording disc . a redundancy bit , used as an error correction code , is added to each block . the signal thus processed is written in a time - axis compression memory 3 with a sampling frequency f 1 . by reading out the signal from the memory 3 with a frequency f 2 higher than f 1 , the signal is time compressed . the control signals bearing the control information may be classified into one which is used to detect errors and corrects it on the reproduction side and one which does not detect and correct errors . the former control signal includes information concerning the block number corresponding to a block into which the audio information is inserted , the sampling frequency , channel number ( monaural or stereo etc .) of the audio information , a reproducing operation of the video disc player including an address number for search , reproduction of the audio information ( continous or non - continuous ), and a group number of grouped blocks into which the audio information is inserted . this control signal is supplied to an error correction coding circuit 4 . the control signal should be recorded using an error correcting code . the error corecting code used for the control signal should be more powerful than that used for the audio information because the control information is of course more critical for accurate system operation . further , signals such as flags indicating the existence or absence of audio information in the individual fields ( frame ) or philips codes ( which are stop codes ) by which reproduction is automatically switched to still mode reproduction , are supplied directly to a switching circuit 5 . output signals of the time compression memory 3 and the error correction coding circuit 4 and an image signal including synchronizing signals are also supplied to the switching circuit 5 . the latter circuit selects one of these signals under the control of a timing signal generator 6 which also controls the read in and read out of the memory 3 . an internal oscillator of the timing signal generator 6 is made synchrous with the synchronizing signal of the image signal supplied directly thereto for generating various timing signals in response to an external control signal , thereby to obtain a video format signal having desired blocks into which the time - compressed audio information is inserted and remaining blocks into which the video information is inserted ( at the output of the switch circuit 5 ). fig5 shows a block diagram of a decoder used for reproducing the video format signal thus obtained and recorded on a video disc . in fig5 the reproduced video signal , including the synchronizing signal , is supplied to a signal separator 7 and to a video synthesizing masking circuit 15 . in the signal separator 7 , the audio information and the control information are separated from the reproduced signal and supplied to error correction circuits 8 and 9 , so that errors included in these signals can be corrected thereby . thereafter , the audio information , that is , the still picture with sound ( sws ) data , is written into a time - expansion memory 10 at a high frequency f 2 . reading out thereof is performed with a clock of sampling frequency f 1 to provide a real - time audio data . then it is demodulated by a digital - to analog ( d / a ) converter 11 . in this case , the error correction may be performed at the same time as the time expansion during the reading out thereof from the memory 10 . control signals in which errors have been corrected and control signals in which errors have not been corrected are inputted to a system control circuit 12 . the circuit 12 controls the entire decoder system in response to the control signal separated from the reproduced signal and the external control signal , and also controls the video disc player . since the read out of the audio information from the memory 10 is not always performed immediately after the writing in thereof , it is necessary to store the control signal is used for read - out operation . a control signal memory 13 performs this function . a timing signal generator 14 , including an internal oscillator operable in synchronism with the synchronizing signal separated from the reproduced signal in the signal separation circuit 7 , functions to generate various timing signals according to control signals from the system controller 12 . these timing signals are supplied to respective blocks of the decoder . the blocks of the video format signal into which the audio information is inserted may be filled with other video signals obtained from a computer etc . or clamped at a constant level such as pedestal level ( or apl ) in a video synthesizing ( or masking ) circuit 15 . an external audio signal such as an fm two - channel audio signal obtained from the video disc player may be selectable as an audio signal output when there is no audio information or when a switch 16 is suitably set . the system control circuit 12 provides a control signal for controlling the reproduction operations of the video disc player , which control signal is included in the reproduced control signal and which is supplied through a player controller 17 to the video disc player . an a / d converter 18 and associated circuit ( shown by dotted lines ) may be necessary if the decoder has the so - called il ( language laboratory ) function . in such a case , a voice input of a student is supplied through a microphone to the a / d converter 18 in which it is digitized , and then the digital information is written in the time expansion memory 10 . that is , the memory 10 functions as a tape recorder . the memory 10 is read out at the frequency f 1 for use in writing into the memory 3 and reading out from the memory 10 in fig4 and 5 , respectively , according to the content of the audio information . according to the sampling theory , the sampling frequency required is at least twice as high as the information content of the signal to be recorded . thus if the audio information contains music , a high sampling frequency is required since such sound has a wide frequency range . on the other hand , for the human voice , the sampling frequency may be much lower . therefore , it is advisable to add sampling frequency selection information to the control information to thereby effect switching of the sampling frequency between different values according to the type of audio information . it is further advisable to add channel number selection information to the control information so that it is possible to select between a monaural ( single channel ) mode for human voice or a stereo ( two channels ) mode for music . fig6 a - 6c illustrate the processing of the reproduced image , in which fig6 a depicts in the reproduced image a hatched portion in which the audio information is inserted . the reproduced image of fig6 a is processed by the video synthesizing ( or masking ) circuit 15 of the decoder of fig5 to form an image as shown in fig6 b or 6c . the image of fig6 b has the audio information containing blocks replaced by an externally supplied image and the image of fig6 c has the blocks replaced by a constant level , such as the pedestal level . the image format of fig6 b is useful when the system is used for educational purpose since with such an image , communication between the user and a computer becomes possible . for example , with such an image format , it is possible to provide some inquiry as an image together with audio information and to provide in the hatched area in answer to the inquiry from the computer in the form of character or image while the inquiry is displayed as it is . further , it is possible to display in that area an instruction for a subsequent operation . it also becomes possible to process images easily and reliably by inserting a control signal ( or flag ) representative of the insertion of audio information into every frame ( or field ) in which the audio information is inserted and by employing the appropriate control signal . that is , by detecting the control signal , it is possible to externally insert images into the blocks into which the audio information is inserted , independently of video signal conditions and / or system operation . fig7 a and 7b illustrate relations between the inserted audio information and the reproduced image , respectively . in the case of fig7 a , which corresponds to a case where the audio information in respective frames ( or fields ) is continuously reproduced while the reproduced images are being fed , the audio information ( sws data ) is inserted into the upper and lower edge blocks of the respective frames ( or fields ) and recorded thereon . in reproducing such signals , the sws data in a first frame is written in a first zone of the time expansion memory 10 ( fig5 ), and it is read out ( time expanded ) upon commencement of reproduction of a second frame . at this time , sws data in the second frame is written in a second zone of the memory 10 . it is read out ( time expanded ) subsequent to completion of the readout of the sws data in the first frame , after which reproduction of a third frame is commenced . these operations are repeated successively so that the audio information is continuously outputted on a real - time basis while a corresponding image is being reproduced . since , in this case , the first frame of the reproduced image is animation and the image is sent for a time period equal to lengths of individual sws data for the respective second and subsequent frames , the usual reproduction ( animation ), slow reproduction and step reproduction ( so - called frame feeding ), etc . of the image become possible . in this example , since alternative writing in and reading out for two areas of the time stretching memory 10 are performed , and because it may be possible to slightly overlap these two areas , the capacity of the memory 10 may be limited to two frames of the sws data or less . fig7 b shows another example of a signal in which sws data is inserted into all blocks of a preceding six frames ( or fields ), and only video information is inserted into all of the remaining frames . for reproduction of this signal , while the video disc player is set in the reproduction mode , the sws data in the preceding six frames is written sequentially in the time expansion memory and the audio information is read out on a real time basis from the memory from the time at which reproduction of the image in the seventh frame is commenced . in this case , animation , slow , step and still reproduction of the image are possible . in this example , since it is necessary to store all of the sws data in six frames , the memory 10 should have a capacity larger than that of the memory used for the signal in fig7 a . in a case where still reproduction is required for the signal in fig7 a , it is necessary to feed a plurality of identical images in step since the time of audio for each frame is short . therefore , the number of stationary images to be recorded may be small . however , in the example of fig7 b , the number of stationary images to be recorded may be increased , although a larger memory is required . it should be noted that , when all of the sws data is stored in the memory it may be possible to insert the data into only the upper and lower edge portions of the image , as in the case of fig7 a . thus , various operations of the video disc player become possible depending upon the relations between the images and the method of insertion of the sws data . in the operations shown in fig7 a and 7b , control operations for the writing and reading for the memory are different , and thus it is necessary to instruct switching from one control method to the other according to the control information . further , for a video disc player , a different operation mode such as slow , step or still mode may be required according to the content of image . therefore , a switching instruction between these different operation modes as well as the switching between the controls should be also included in the control information . fig8 shows the relation between the reproduced video signal and the inserted audio information , corresponding to the system shown in fig7 a . in fig8 a first frame ( field ) is fed in the usual reproduction mode , and , for subsequent frames , the vdp is controlled such that frame feeding is performed every frame , the number of which corresponds to the sws data for one frame . firstly , a sws data point a is written into the memory . reading out of the data point a with time expanded , is started upon commencement of a subsequent reproduction of frame , that is , while a sws data point b is being written into the memory . upon a completion of the readout of the data point a , the data point b is read out , with time expanded , in the similar way , while a next data c is written in the portion of the memory in which the data a was stored . thus , the data point a , b , c , d . . . are written into the memory only once . since each of the data points corresponds to a length of an integer number of frames , the reading out of the data can be continuous if the capacity of the time stretching memory 10 is made equal to two frames of data , and thus continuous sound reproduction becomes possible . in fig8 the positions of the frames into which the data points a through b are inserted are arbitrary , and it is possible to provide continuous sound by setting the positions at which the readout of the respective data points a through d commence and the positions at which the readouts terminate as to be constant regardless of the positions of the data insertions . during this operation , an image is reproduced in the still mode for every four frames , as a result of which a frame - by - frame reproduced image is obtained . in this case , it is impossible to discriminate between the usual reproduction and frame - by - frame reproduction with the use of only the reproduced signal . therefore , when the decoder determines that the usual reproduction has been continued , the content of a sws data point b , c or d may be rewritten into the memory . in order to prevent such operations from occuring , it is necessary to determine whether or not the content of the sws data is the same as that of the preceding and subsequent frames . the control information is also used to perform this discrimination . in the case of multiple audio channels , they are multiplied in one block and the number of sws data points in the respective channels is made to correspond to an integer number of frames ( fields ). this can be expressed by : where n d is the number of sws sampling data points in one block , n c is the number of audio channels , n f is the number of frames corresponding to the sws data points in one block , f is a sampling frequency , and f f is a frame ( field ) frequency . fig9 shows another relation between the reproduced image and the insertion of the audio information . in this case , a block into which the audio information is inserted is further grouped and groups thus formed are assigned respective group numbers , so that a series of meaningful audio information is provided for each group . for example , a group of sws data inserted into all of the blocks of the first and second frames ( fields ) is numbered as # 0 , into which japanese speech is inserted . in a similar manner , a group of sws data inserted into all of the blocks of the third and fourth frames and a group of sws data inserted into all of blocks of the fifth and sixth frames are numbered as # 1 and # 2 , respectively , into which english and french speech is inserted . into subsequent frames , only video information is inserted . these group numbers are contained in one of the control information sequences to allow selective readout of the data in the respective groups by selecting a desired group number according to an instruction signal from a suitable input device as an external switch or a computer . for example , fig9 shows a case when the french speech in group # 3 is selected and read out . that is , the first to sixth frames are fed for the usual reproduction , and when the data in group # 3 arrives , it is written into the memory , for time expansion . the readout starts at the seventh frame . if the memory capacity is sufficient to store the data of all of the groups , it is possible to write all of the group data and to selectively read them out . other than the selection of language , this embodiment can be applied to a case where the video disc player provides an inquiry to a user and selectively provides comments to the user according to his answer to the inquiry . that is , this embodiment is suitable for use in educational equipment . particularly , when this sws system is incorporated into a bidirectional video system combined with a computer , it is very effective for educational applications . fig1 a and 10b show the relation between inserted audio and control information and a reproduced audio output , which is the case where the group number of the sws data in fig9 is included in the control information . in fig1 a and 10b , s 0 - s 2 indicate the sws data group numbers , c 1 a control signal indicative that a selected write in the memory is possible , c 2 s a control signal for performing an operation by which a continuous audio output is possible , c 3 a control signal for commencing readout from the memory . in fig1 a , the audio information of a group number s 1 is selectively written into the memory and a continuous audio output is provided as in the case in fig7 a . that is , the disc player is operated in the usual reproduction mode and switched temporarily to the still mode for each occurence of a group si except the first occurence , so that a continuous audio output is provided while images are displayed successively . if one readout time corresponds to the length of the frame ( i + 1 ), continuous sound may be provided for animation by feeding an image at the group si instead of the still reproduction thereat . in fig1 b , the audio information of the group si is selectively written into the memory , and upon a completion of the writing operation , readout thereof is commenced . after the readout is completed , data of a next group s 1 is written into the memory . this operation is the same as shown in fig9 . in fig1 b , a symbol () indicates that there is no need for player control when an audio output is provided for animation . it should be noted , with regard to fig1 a and 10b , that although the readout is commenced at the end of the group si , regardless of any selection of s o - s i , it may be commenced immediately after the completion of the write - in operation . in the latter case , the control signal c 3 is unnecessary . the block position of the video format signal into which the sws data is inserted may be any assigned by the control signal . although the selection of write in or readout of the sws data is possible using the control information as mentioned , it may be controlled externally . that is , it is possible to employ computer control . for example , if the region of the time expansion memory into which the sws data is written is distinguished according to group members , it is possible to change the group members of the input sws suitably to clearly write in another region without erasing previous sws data . thus , by using the control signal as described , various desirable functions can be realized . the above - described system is a universal type and requires a relatively sophisticated and expensive construction . in implementing this system , there may be a case where the construction should be simplified to reduce the cost , even if the function thereof may be restricted . for example , if the member of audio channels and the sampling frequency are fixed , there may be no need of using a control signal for controlling these parameters , or if the timing of readout of the sws data from the time expansion memory is fixed at a time immediately after the write - in , there may be no need of a control signal for the commencement of the readout . further , the construction may be further simplified by restricting the operation of the player . for example , for an optical - type video disc player , by making the system such that the player operates usually in the still reproduction mode with the philips code and transfers to the ordinary reproduction mode upon completion of the readout of the sws data from the memory , there may be no need of providing control signals for these operations . as an example , it is assumed that human voice is used as the audio information and it is encoded with an adpcm d gital signal and that the video signal is processed at 40 k bits / second , that is , displayed as animation . in such a case , the transmission rate of the video signal may be 666 bits / field . this may be recorded in a vertical area in two horizontal scanning lines which are close to at area and not displayed on a monitor television screen . that is , as shown in fig1 , a data overlap of 333 bits is present in a horizontal scanning line . in fig1 a , a depicts a test signal and b an audio information . fig1 b shows these on an enlarged scale . in the case of a two - channel audio syste , the signal may be recorded in four horizontal scanning lines . in the case of musical information , the transmission rate should be less than that for human voice and thus the number of horizontal scanning lines in which the data is overlapped should be increased . in a case where a redundancy bit 1s to be added as an error correction code , the number of bits in one horizontal scanning line , or the number of horizontal scanning lines , may be increased . by so doing , it is possible to add audio information to animation without reducing the image area substantially . an example where , for a continuous audio output , the capacity of the time expansion memory can be substantially reduced will be explained with reference to fig1 . it is assumed that the amount of audio information to be inserted into one frame ( field ) is made constant and corresponds to video information in a plurality of frames ( fields ) and that the location in the frame into which the audio information is inserted is fixed . since the writing rate into the memory is smaller than the reading rate , information which is written into the memory will be read out if the readout is started immediately after the write - in operation as shown . since audio information a , b , c , d . . . corresponds to three frames , the time at which the readout of each of these informations is started is always constant in every frame . therefore , by setting an end time of readout of the information immediately before write in of the last data of the subsequent audio information and performing the reading - out operation even at a switching point to the audio information with same timing , the memory capacity is reduced to that corresponding to one of a , b , c , d . . . reduced by an information amount which is readout until the completion of the write - in of the respective audio informations . practically , however , in order to accomodate jitter etc . of the reproduced signal and facilitate control , the memory should have a capacity corresponding the amount of audio information in one frame . the number of frames corresponding to eacn audio information data segment may be an arbitrary integer and , for one frame , corresponds to animation . error correction of the control information will now be described . the control information is divided , as a digital data , into a block a constant length , and a redundancy bit in bch code is added to each block so that error bits can be corrected block by block . the digital data in each block to which the redundancy bit is added is frequency or phase modulated . fig1 a shows a case where the data is phase - modulated , and in which the digital data rises at a center of a bit cell when it is &# 34 ; 1 &# 34 ; state and falls when it is &# 34 ; 0 &# 34 ; state . for a case of burst error as shown in fig1 b , which is a continuous error caused by signal dropout etc . and which cannot be corrected with only a redundancy bit in bch code , a breakage or the regular reverse of states is detected as an error pointer of that block , including the burst error . on the other hand , a parity bit c , obtained from two successive ( a and b , fig1 ) of the blocks to each of which the redundancy bit is added , is added as a redundancy bit . the parity bit c can be represented as c i = a i + b i , where i is a positive integer including 0 and + represents modulo two addition . thus , the burst error is corrected by using the parity bit c and the error pointer . the error pointer may be produced when the number of the bit cells in one block where there is no rising - up or going - down reverse at the centers thereof becomes larger than the number of bits which can be connected by the bch code . fig1 shows in block diagram form a system for performing phase modulation and error correction coding as indicated in fig1 and 14 . in fig1 , the input data a and b is fed to a selector 20 , and also a parity bit . the selector 20 outputs first the input data a and b and then the parity bit c . the output of the selecter 20 is supplied to a selecter 22 and a bch code redundancy bit forming circuit 23 in which redundancy bits are formed for a , b and c , respectively . the selecter 22 provides the data a , the redundancy bit for the data a , the data b , the redundancy bit for the data b , the parity bit c and the redundancy bit for the parity bit c , in the specified order . the output from the selecter 22 ( fig1 ) is phase modulated by a pm modulator 24 . it should be noted that instead of a parity code for burst error correction , it may be possible to use b adjacent codes . fig1 shows , in block diagram form , a system for demodulating the error - correction coded and pm modulated data and correcting errors therein . the data supplied is demodulated by a pm demodulator 25 , and at the same time , the respective blocks a , b and c are checked for burst error by a burst error detector 26 . the demodulated data in each of the blocks a , b and c is corrected for bit error by a corrector 27 using bhc code . the data thus corrected is fed to a delay circuit 28 and a data group forming circuit 29 in which a group s = a + b + c is formed . the delay circuit 28 delays the data so that first data a is inputted to a selector 30 at the time when the formation of the group s is complete . an adder circuit 31 performs modulo - two addition of the group s and the respective data . if the block b contains a burst error , represented by b &# 39 ;= b + e , the modulo - two addition performed by the adder 31 becomes : ## equ1 ## and thus the output of the adder 31 contains burst - error corrected data . if either of the data a or b includes a burst error and the parity bit c is plus (&# 34 ; 1 &# 34 ;), the selector 30 selects the output of the adder 31 so that it always provides correct data at its output . the selector 30 is controlled by an output of the burst error detector 26 . since error correction is impossible when at least two of the blocks a , b and c include burst errors , the detector 26 provides a flag showing non - correctability . since the parity bit c is used only for correction , and therefore there is no need of outputting it , error correction for the parity bit c itself is not performed . the burst error detector 26 is composed of a gate , a counter and latches , etc ., and the bhc corrector 27 and the data group forming circuit may be composed of gates , shift registers , exclusive - or gates , roms , etc ., and the delay circuit may be composed of shift register and latches , etc . the error correction system for audio information will be described with reference to an example when m and n in fig1 are 1 and 14 , respectively . it is assumed that the audio information in each block includes 1050 sampling data points , each represented by w i ( i = 0 to 1049 ), and that each of the samples w i is compped of four bits . it is further assumed that the suffix i indicates the order of the samples which conceptually are arranged in the three - dimensional form shown in fig1 . in fig1 , the numbers beside solid arrows show the sampling order and the numbers beside dashed arrows show the insertion order in the video format signal . more specifically , after 15 samples ( from wo at an upper left corner of the three - dimensional array to w 14 ) have been received in order , the redundant parity bits p 0 , 0 and q 0 , 0 for b adjacent code values are added thereto for error correction . then , after 15 samples w 15 to w 29 , p 0 , 15 and q 0 , 15 are added . in a similar manner , p 0 , 90 and q 0 , 90 are added after 15 samples ( w 90 to w 104 ). then , after 15 samples ( w 105 to w 119 ), p 0 , 105 and q 0 , 105 are added . this is repeated until p 0 , 1035 and q 0 , 1035 are added after samples w 1035 to w 1049 . p o , j and q o , j ( j = 0 , 15 , 30 , 45 , . . . , 1035 ) thus added are used as parity bits in the vertical direction ( along the solid arrow 1 ) of the three - dimensional arrangement . then , for parity bits in the lateral direction ( along the solid arrow 3 ), p 1 , 1s and q 1 , k are formed . for example , p 1 , 0 and q 1 , 0 are parity bits for 10 samples w 0 , w 105 , w 210 , . . . w 945 . in a similar manner , p 1 , 90 and q 1 , 90 are added after 10 samples ( w 90 to w 1035 ). the audio information in one block , which includes the error correction code thus obtained , is interleaved and rearranged , and it is inserted into a region corresponding to 17 horizontal scanning lines in one field of the video format signal . fig1 shows a sample arrangement in the first horizontal scanning line into which interleaved data is inserted . in fig1 , on the top portion subsequent to a color burst signal a data synchronizing signal is overlapped , and immediately thereafter , 12 sets , each including seven samples , are arranged in order . the arrangement ( interleaved ) in this case follows the dotted arrows in fig1 . with this arrangement , the parity bits p 1 , 0 and q 1 , 0 become error correcting codes for respective samples w 0 , w 105 , w 210 . . . w 945 on the same horizontal scanning line . generally , the parity bits p 1 , k and q 1 , k ( k = 0 , 1 , . . . 14 ; p 0 , 0 , 15 , . . . , 29 , p 0 , 15 , q 0 , 15 , 30 , . . . , 104 , p 0 , 90 , q 0 , 90 ) become error correcting codes for ten samples arrangeded randomly in one horizontal scanning line . during reproduction , error correction of the ten samples randomly arranged on one horizontal scanning line is performed by using p 1 , i and q 1 , i thus obtained , and in addition thereto , error correction for 15 samples such as w 0 to w 14 arranged randomly on different horizontal scanning lines is performed using p 0 , 0 and q 0 , 0 . the error correction code , made up of b adjacent code values , is used to correct adjacent error of b = 4 bits . that is , it can be used to correct up to four erroneous bits in one sample . parity bits p 0 , j and q 0 , j ( j = 0 , 15 , . . . 111 1035 ) are formed as follows : ## equ2 ## where each of p , q and w is a line vector of 4 bits , + indicates modulo two addition , and t is as follow : ## equ3 ## assuming that an error is included in w 0 - w 14 , it is corrected by p 0 , 0 and q 0 , 0 . for example , when w e includes an error e and is expressed by w &# 39 ;= w + e , where e is an error pattern , s 0 , p and s 0 , q are : s . sub . 0 , q ≡ q . sub . 0 , 0 + t . sup . 14 · w . sub . 0 + t . sup . 13 · w . sub . 1 + . . . + t . sup . 14 - l · w &# 39 ;. sub . l + . . . + w . sub . 14 = t . sup . 14 - l · e . sub . l that is , s 0 , q is multiplied with t (+ 1 ) times so that s 0 , q = s 0 , p is established and a sample position is derived from (+ 1 ). w &# 39 ; is corrected by thus obtained . the data group s o , p and s 0 , q can be expressed by using the parity check matrix h as follow : ## equ4 ## where is unit matrix of 4 × 4 . in the similar manner , parity bits p 1 , k and q 1 , k are obtained as follows : ## equ5 ## the data group is expressed by the parity check matrix as follows : ## equ6 ## when w m includes an error and becomes w &# 39 ; m = w m + e m , by obtaining m from the above , the correction is made along w &# 39 ; m + s 1 , p = w m + e m + e m = w m . that is , w i , p 0 , j and q 0 , j are corrected using p 0 , j and o 0 , j . alternately , it is possible to obtain error correction by detecting the error using p 1 , k and q 1 , k and to correct errors of two samples using p 0 , j and q o , j . fig1 is a block diagram of a circuit for interleaving and error correction coding of a sampling data shown in fig1 . when data is supplied , the redundancy parity bits p 0 , j and q o , j for performing error correction between different horizontal scanning lines and the redundancy parity bits p 1 , k and q 1 , k for performing correction in one h are found in forming circuits 40 to 43 , respectively . p 0 , j and q o , j are formed every 15 samples of the data and p 1 , k and q 1 , k are formed for data in the horizontal scanning line after the interleaved data . therefore , it is necessary to provide memories 44 and 45 to temporarily store intermediate values of p 1 , k and q 1 , k . that is , p 1 , 0 and q 1 , 0 are formed for w 0 , w 105 , . . . , w 945 . since similar operations for , for example , samples w 1 , w 106 . . . , which are supplied during the formation of p 1 , 0 and q 1 , 0 for w 0 , w 105 . . . etc ., must be performed , intermediate calculated values of p 1 , k and q 1 , k , corresponding to the input data , are temporarily stored in the memories 44 and 45 . the memories are then read out to start the calculation again , results of which are again written in these memories . this operation is repeated until p 1 , k and q 1 , k are produced . the input data and the redundant parity bits p 1 , j , q 1 , j , p 1 , k and q 1 , k are supplied to a selection circuit 46 and then to an interleave memory 47 . the interleaving operation is performed in the memory 47 by exchanging the order of sample write in and read out . when time - axis compression is necessary , this same memory can also be used for that purpose . a memory control circuit 48 functions to generate various timing signals necessary for the memory by using the control signal for read / write operation and a timing clock signal . the circuits 40 and 43 may be composed of shift registers and exclusive - or gates , and the memory may be composed of registers and rams . fig2 is a block circuit diagram of a circuit used for interleaving and error correcting data produced by the circuit of fig1 . reproduced input data is supplied to a delay circuit 49 , data group forming circuits 50 and 51 for s 1 , p and s 1 , q0 . s 1 , p and s 1 , q are syndromes for error correction in one h and formed on the basis of the formular described previously . since the data in the one h is interleaved , intermediate calculation values must be temporarily stored in memories 52 and 53 , as in the case of the formation of p 1 , k and q 1 , k in fig1 . with the groups s 1 , p and s 1 , q , sample positions at which there is an error are obtained by an error position detector 54 . since the group s 1 , p is a parity error , correction of the error sample can be performed by a modulo two addition of it to the error sample in an adder circuit 55 . a timing clock signal synchronizes the data sample , and pulses of the clock signal counted by the error position detecting circuit 54 to generate an addition instruction which is applied to the adder 55 at the time the error sample is supplied to the adder . the delay circuit 49 functions to delay the data such that the data group is formed prior to the supply of the data to the adder circuit 55 . the data which is error corrected in one horizontal scanning line is fed to a de - interleave memory 56 in which the write / read order is changed to de - interleave the data . it is also possible to perform time - axis expansion in this memory . the operation of the memory 56 is controlled by a memory control circuit 57 . the de - interleave memory 56 performs a readout operation for formation of the groups s 0 , p and s 0 , q , firstly , and then a readout operation for correction of respective samples and formation of an output . for example , when the samples w 0 , w 1 , . . . w 14 are to read out , w 0 , w 1 , . . . w 14 , p 0 , 0 and q 0 , 0 are read out first to form the groups s 0 , p and s 0 , q by group forming circuits 58 and 59 . then , w 0 , w 1 , . . . w 14 are read out again . at this time , the adder circuit 55 has no input . if , in this case , any of w 0 , w 1 , . . . w 14 is erroneous , an addition instruction is supplied by an error position detecting circuit 60 on the basis of the groups s 0 , p and s 0 , 0 and a timing clock 3 . in an adder circuit 61 , group s 0 , p and the error sample are added ( module two ) to correct the latter sample . with these circuits 58 - 61 , the error correction is thus performed between different horizontal scanning line . since the error correction circuits associated with the de - interleave memory 56 , i . e ., the error correction circuits for one horizontal scanning line , operates fundamentally in the same manner as that for different scanning lines , the correction circuit may be used commonly for both purposes on time - sharing basis , if operational timings permit . fig2 shows an example of such circuit . of course , other circuit constructions may be used as well . for example , it is possible to connect the error correction circuit for one horizontal scanning line to the output of the de - interleave memory 56 in parallel with the other correction circuits . in such a case , the formation of the groups s 1 , p and s 1 , q and the addition operation are performed upon the readout of the de - interleave memory , and therefore there may be no need of providing the memories 52 and 53 and the delay circuit 49 . fig2 illustrates a search mode operation of the video disc player for the reproduction of the sws data shown , for example , in fig7 b . when the reproduction system is set to the search mode , the pick - up of the player is controlled to perform rapid movement to a desired address number . ( since the verification operation for the address number during the search is well known , a detailed explanation is omitted .) during the search operation , there is no video signal output . when an address number preceding the desired address number is searched , rapid movement of the pick - up is stopped and the system is switched to the stationary image reproduction mode . if the decoder is synchronized with the video format signal causing the write - in of the audio information , the pick - up is switched to the normal reproduction mode , and , when it reaches a frame corresponding to the desired address number portion , the audio information is written into the memory in six frames . it may be possible , however , to employ selective write - in of the audio information as shown in fig9 . since the decoder is masked until it reaches the ninth frame in which audio information exists , even if the search operation is completed , the audio information , for example , may be masked too . thus , the masking is continued to clamp at the black level . the masking of the image is removed at a time when the reproduction of six frames has been completed and a desired image displayed on the monitor tv screen . at the same time , the audio information written in the memory is outputted with time - axis expension . therefore , the desired image is displayed on the monitor screen after the search in the same manner as for usual stationary reproduction , and the audio information corresponding thereto is outputted . a similar search is also possible for the continuous sound reproduction as shown in fig7 a , or the audio information ( fig7 b ) can be inserted into the block portion of the frame as shown in fig7 a . the masking of the frame or the replacement of the image may be performed only for the blocks having the audio information . fig2 is a block diagram of a control circuit for performing the search operation shown in fig2 . in fig2 , a reproduction signal from the vdp is supplied to a signal separation circuit 70 to separate the synchronizing signal therefrom , and the synchronizing signal is fed to a timing signal generator 71 . an oscillator and a counter in the generator 71 operate in synchronization with the synchronizing signal to generate various timing signals after the search is completed and the video signal is supplied . an output of the timing signal generator 71 takes the state &# 34 ; 1 &# 34 ; when the oscillator and the counter therein are synchronized with the synchronizing signal , and &# 34 ; 0 &# 34 ; when these are not in synchronization . the output of the generator 71 and the output delayed by a delay circuit 72 are supplied to a three - input or gate 73 , whose output is supplied to a video replacement or masking circuit 76 for replacement or masking of the video signal during the search and immediately after the search . since it is necessary to replace or mask the portion of the signal into which the audio information is inserted during the synchronization operation , a signal representative of a presence of audio information is supplied to one of the three - input or gate . the output of the timing signal generator 71 is also supplied to a monostable multivibrator 74 so that the latter is triggered when the state of the output of the multivibrator 74 changes from &# 34 ; 1 &# 34 ; to &# 34 ; 0 &# 34 ;, i . e ., when synchronization is established , to actuate a player controller 75 to generate a signal by which the vdp is controlled to set it to the &# 34 ; play &# 34 ; state . the delay circuit 72 provides a time delay equal to the time from the generation of the vdp control signal to establishment of reliable operation . when the vdp starts reproduction of a desired frame upon the &# 34 ; play &# 34 ; operation of the vdp , the replacement or masking of the video signal is terminated . since there are audio information blocks , included in that frame , the replacement or masking for these blocks is continued . as mentioned hereinbefore , according to the present invention , the audio information in blocks , together with control information , is inserted into arbitary locations in an image to be processed according to a video format signal . therefore , it is possible to record , on the same recording medium , the reproducing steps , i . e ., the software , which is read out by the decoder ( fig5 ) to control the vdp . thus , it is possible to realize various reproduction control without providing any special circuitry on the side of the vdp . further , since error correction is possible within the inserted audio and control information blocks , the reliability of the information when reproduced becomes very high . further , since it is possible to perform searches of the video format signal in the same manner as for a normal stationary image , there is no added distortion in the audio and video signals .	7
the present invention provides a process for the conversion of lutein or its esters occurring in nature into zeaxanthin by base - catalyzed isomerization , which process comprises heating a lutein - containing material , which may be an optionally pre - treated natural lutein - containing product or pure lutein , in a mixture of an aqueous solution of an alkali hydroxide and either dimethyl sulphoxide (&# 34 ; dmso &# 34 ;) or an organic solvent based on saturated aliphatic and / or aromatic hydrocarbons at temperatures in a range from about 50 ° c . to about 120 ° c ., with the process being carried out in the presence of a phase transfer catalyst when an organic solvent based on hydrocarbons is used . as used herein , the lutein - containing material may be pure lutein , or any material containing lutein or esters thereof . especially preferred lutein - containing materials are natural materials which contain lutein or esters thereof and other xanthophylls such as zeaxanthin . as the natural lutein - containing material there is preferably used a lutein - containing raw material of plant origin , which optionally has been pre - treated chemically , e . g ., by saponification , to produce free lutein from the esters thereof . such a raw material can be a concentrate or extract which is present in the form of a milled powder or a liquid or resinous material (&# 34 ; oleoresin &# 34 ;). powders or extracts of the yellow or orange blossoms of marigolds ( e . g ., tagetes erecta , etc . ), which contain not only lutein but also zeaxanthin , are the especially preferred lutein - containing materials . according to quackenbush et al . j . aoac , 55 ( 3 ), 617 - 621 ( 1972 )! the lutein : zeaxanthin ratio in these raw materials is about 72 - 88 : 16 - 4 . the xanthophylls present are mainly esters of palmitic , myristic and stearic acid w . gau et al ., j . chromatography 262 , 277 - 284 ( 1983 )!. since it is preferred to convert the lutein to the free form prior to carrying out the process of the invention , such esters are preferably previously saponified to the free lutein before the lutein - containing material is used in the process in accordance with the invention . such saponifications , as well as enzymatic hydrolyses carried out for the same purpose , may be carried out by any conventional means and are known in the art ( see , for example , u . s . pat . nos . 3 , 535 , 138 and 3 , 783 , 099 ). powder ( flour ) and saponified and non - saponified extracts of tagetes have been available commercially for a long time , and can be used as starting materials for the process in accordance with the invention . examples of these raw materials are saponified tagetes extracts from the mexican firms alcosa and iosa . the alcosa product &# 34 ; pasta saponificada amarillo &# 34 ; is a brownish paste having a total xanthophyll content of , for example , about 2 . 7 %, consisting of about 92 . 5 % lutein and about 6 . 6 % zeaxanthin , while the iosa product &# 34 ; hi - gold 20 &# 34 ; is a greenish - yellow powder , which contains , for example , about 0 . 96 % total xanthophylls ( about 65 . 5 % lutein and about 27 . 2 % zeaxanthin ) ( the percentages are area percentages ). these details have been established following the analysis of certain production batches and can vary from batch to batch , which also applies to the analytical results given hereinafter . other raw materials are &# 34 ; flora glo &# 34 ; kemin ind ., iowa , u . s . a . ; about 739 g / kg total xanthophylls , of which about 681 g / kg consists of ( all - e )- lutein and about 58 g / kg consists of ( all e )- zeaxanthin !, &# 34 ; oro glo layer dry &# 34 ;( esterified , i . e ., non - saponified ; likewise kemin ind . ; about 19 . 4 g / kg total xanthophylls : about 17 . 6 g / kg lutein and about 1 . 8 g / kg zeaxanthin ), &# 34 ; hi - gold 20 lutexan &# 34 ; ( iosa ; about 16 . 3 g / kg total xanthophylls : about 11 . 0 g / kg lutein and about 5 . 3 g / kg zeaxanthin ) as well as &# 34 ; xantopina plus &# 34 ; ( esterified ; bioquimex s . a ., mexico ; about 351 g / kg total xanthophylls : about 330 g / kg lutein and about 21 g / kg zeaxanthin ). the lutein - containing material can be processed before use by any conventional means , if desired , in order to concentrate the xanthophylls , for example by extraction , followed by chromatography and optionally also subsequent crystallization . a typical concentration method comprises extracting the raw material with acetone , subjecting the extract to flash chromatography on silica gel using a hexane / ethyl acetate mixture and then pure ethyl acetate as the eluting agent , concentrating the fractions obtained and crystallizing the solid resulting therefrom , e . g ., from a mixture of methylene chloride and methanol . by using this method it has been possible to obtain , for example , from 100 g of &# 34 ; pasta saponificada amarillo &# 34 ;( alcosa ; containing about 2 . 7 % total xanthophylls ) about 2 . 4 g of crystalline material consisting of about 93 % ( all - e )-( 3r , 3 &# 39 ; r , 6 &# 39 ; r )- lutein and about 7 % ( all - e )-( 3r , 3 &# 39 ; r )- zeaxanthin . this product is an example of a pre - treated natural lutein - containing material . an organic solvent based on saturated aliphatic and / or aromatic hydrocarbons is used as the solvent in the process in accordance with the invention as an alternative to dimethyl sulphoxide . this is especially a liquid alkane or an aromatic hydrocarbon , including a mixture of two or more of these hydrocarbons , e . g ., a mixture of several liquid alkanes , of several aromatic hydrocarbons or of one or more of such alkanes with one or more aromatic hydrocarbons . the liquid alkane is preferably a straight - chain or branched alkane with at least 5 carbon atoms , more preferably with 5 - 10 carbon atoms , such as , for example , pentane , hexane or heptane . petroleum ether , preferably high - boiling petroleum ether , is an especially suitable alkane mixture and benzene and toluene are especially suitable aromatic hydrocarbons . the most preferred hydrocarbons are hexane , heptane and high boiling petroleum ether . as is known , dimethyl sulphoxide is soluble in water , and thus an aqueous - organic solution readily forms with the aqueous alkali hydroxide solution which is also used . in contrast thereto , the alkanes and aromatic hydrocarbons are sparingly soluble in water , and thus when they are used a phase transfer catalyst must be employed . the alkali hydroxide is preferably sodium hydroxide or potassium hydroxide , most preferably the latter . the concentration of the alkali hydroxide in the aqueous solution is at least 3 molar ( m ). even aqueous solutions having concentrations up to saturation can be used . the concentration of the aqueous alkali hydroxide solution preferably lies in the range of about 7m to about 14m . when a phase transfer catalyst is required in accordance with the process of the invention , any conventional phase transfer catalyst may be used . tricaprylmethylammonium chloride ( aliquat ® 336 ), tetra ( n - butyl ) ammonium hydrogen sulphate , various alkylbenzyldimethyl ammonium chlorides ( benzalkonium chloride ), benzyltri ( n - butyl ) ammonium bromide and tri ( n - butyl ) methylammonium iodide are examples of phase transfer catalysts used in accordance with the invention . tricaprylmethylammonium chloride is preferably used as the phase transfer catalyst . with respect to ratios , there are conveniently used per mol of ( calculated ) xanthophyll ( s ) in the lutein - containing material about 10 to about 450 mol of alkali hydroxide and where required about 0 . 5 to about 5 mol of phase transfer catalyst , preferably about 200 to about 250 mol of alkali hydroxide and , respectively , about 0 . 5 to about 1 . 5 mol of phase transfer catalyst . the dimethyl sulphoxide : aqueous alkali hydroxide solution volume ratio is generally about 4 : 1 to about 1 : 2 , preferably about 2 . 5 : 1 to about 1 : 1 . when an organic solvent based on saturated aliphatic and / or aromatic hydrocarbons is used , the respective organic solvent : aqueous alkali hydroxide solution volume ratio is generally about 8 : 1 to about 1 : 2 , preferably about 4 : 1 to about 1 : 1 . it follows that , having regard to these convenient ratios as well as other factors , especially the amount and composition of xanthophylls in the lutein - containing material , there are generally used about 50 to 300 ml of solvent - alkali hydroxide solution mixture per 10 g of lutein - containing starting material , preferably about 60 to 80 ml per 10 g . having regard to the fact that the formation of undesired byproducts and the decomposition of the desired zeaxanthin are promoted at too high temperatures and / or too long a reaction period , the conversion in accordance with the invention is carried out at temperatures which as far as possible do not exceed 120 ° c ., i . e ., the conversion is conveniently carried out at temperatures in the range of about 50 ° c . to about 120 ° c . preferably , the conversion is carried out at temperatures in the range of about 80 ° c . to about 100 ° c . the reaction period depends , inter alia , on the reaction temperature , the amount and concentration of aqueous alkali hydroxide solution and the amount and nature of the organic solvent used . in general , this period is about 5 to about 65 hours . however , the conversion preferably does not take longer than about 24 hours . under the above basic reaction conditions not only the lutein present in the lutein - containing material is converted into the desired zeaxanthin in good yield , but also the esters of lutein and / or zeaxanthin which may be present , e . g ., the aforementioned palmitic , myristic and stearic esters , are for the most part converted into free zeaxanthin . the working up of the mixture after completion of the conversion may be carried out by any conventional means . for example , the working up may be effected in a simple manner , conveniently by cooling the mixture to room temperature or about 0 ° c ., optionally adding an alcohol , preferably methanol or ethanol , and filtering off the solid , which mainly consists of enriched zeaxanthin . moreover , conventional purification techniques , such as , for example , extraction , column chromatography and recrystallization , can be used . the last three treatments are required especially when a phase transfer catalyst is used . a recrystallization which may be carried out is effected especially well using a mixture of methylene chloride and methanol . 300 g of &# 34 ; pasta saponificada amarillo &# 34 ; industrias alcosa s . a . de c . v . ; 23 . 9 g / kg ( all - e )- lutein and 3 . 1 g / kg ( all - e )- zeaxanthin ! are suspended in 1 . 5 l of acetone and the suspension is stirred at room temperature for 30 minutes . then , 200 g of dicalite ® ( filter aid ; dicalite europe nord s . a .) are added thereto and the mixture is stirred for a further 5 minutes . the resulting suspension is then filtered through a layer of dicalite ®, the dicalite ® layer is suspended in 780 ml of acetone and the new suspension is stirred at room temperature for 30 minutes . after filtration of the suspension through a dicalite ® layer this is washed six times with 50 ml of acetone each time . the combined filtrates are concentrated under reduced pressure at 35 ° c ., and in this manner there are obtained 143 g of a dark , red paste . the paste is then subjected to a flash chromatography on 1 kg of silica ( mesh 70 - 230 ) using 4 l of hexane / ethyl acetate ( 2 : 1 ), followed by 1 . 3 l of ethyl acetate . the ethyl acetate fraction is concentrated under reduced pressure at 35 ° c ., which gives 20 . 6 g of a red , semi - crystalline oil . this oil is then crystallized from a methylene chloride / methanol mixture and the crystallizate is dried for 6 hours under a high vacuum at 37 ° c . in this manner there are obtained 6 . 36 g of a mixture of ( all - e )- lutein and ( all - e )- zeaxanthin ( 93 : 6 area percent ) as dark red crystals . the solvent dimethyl sulphoxide or liquid alkane or alkane mixture is added to a lutein - containing material for example , a mixture of lutein and zeaxanthin obtained according to example 1 , a commercially obtainable saponified , zeaxanthin - enriched tagetes extract &# 34 ; oleoresina amarillo saponificada &# 34 ; ( alcosa ) or &# 34 ; hi gold 20 &# 34 ; ( iosa ), or a likewise commercially obtainable non - saponified tagetes extract from the u . s . company kemin industries , iowa ! in a round flask equipped with a reflux condenser , stirrer and thermometer . when the liquid alkane or alkane mixture is used , the phase transfer catalyst is then added . subsequently , the aqueous solution of the alkali hydroxide is added thereto and the reaction mixture is heated . in order to follow the course of the reaction , a sample of the reaction mixture ( solution or suspension ) can be removed periodically , diluted with methylene chloride , the methylene chloride solution washed to neutrality with saturated aqueous ammonium chloride solution and then with water , subsequently dried over anhydrous sodium sulphate and finally the solution subjected to a hplc analysis . after completion of the reaction has been established ( no further conversion lutein → zeaxanthin ) the homogeneous or heterogeneous solution is cooled to room temperature or 0 ° c . while stirring , with an alcohol , e . g ., methanol or n - propanol , optionally being added during the stirring and cooling . the resulting suspension is filtered through a paper or glass fibre filter , the solid is washed several times with the chosen alcohol , is dried under a high vacuum at about 37 ° c . for at least one hour and , if desired , recrystallized from methylene chloride / methanol or methylene chloride / hexane . the starting material contains 23 . 9 g / kg lutein and 3 . 1 g / kg zeaxanthin . after extraction , chromatography and crystallization there is obtained a mixture which consists of 93 . 1 % lutein , 6 . 6 % zeaxanthin and 0 . 5 % additional material . the results of the conversion carried out according to the above procedure are compiled in table 1 hereinafter : table 1__________________________________________________________________________experi - ment base , reaction relative product compositiondesig - lutein , solvent , conc ., tempe - period di -( z )- ( all - e )- ( all - e )- ( z ) ( z )- zea - nation amount amount amount rature ( hours ) lutein lutein zeaxanthin lutein xanthin remarks__________________________________________________________________________ ( a ) 10 mg hexane , naoh , 17m , 85 ° c . 2 5 . 1 5 . 8 25 . 1 5 . 7 25 . 9 20 ml 5 ml ( b ) 100 mg hexane , koh , 7m , 64 ° c . 15 -- 18 . 0 79 . 6 0 . 2 0 . 9 20 ml 5 ml ( b &# 39 ;) -- 15 . 8 83 . 1 -- -- after crystal lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh ( c ) 100 mg hexane , koh , 7m , 64 ° c . 64 -- 24 . 8 71 . 9 -- -- 20 ml 5 ml ( c &# 39 ;) -- 22 . 3 77 . 7 -- -- after crystal - lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh ( d ) 100 mg hexane , koh , 10m , 64 ° c . 15 -- 19 . 3 75 . 7 -- -- 20 ml 5 ml ( d &# 39 ;) -- 12 . 3 87 . 7 -- -- after crystal lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh ( e ) 100 mg heptane , koh , 7m , 94 ° c . 1 . 5 3 . 5 19 . 1 52 . 0 -- 11 . 4 20 ml 5 ml ( e &# 39 ;) -- 18 . 1 80 . 0 -- -- after crystal - lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh ( f ) 100 mg petroleum koh , 7m , 84 ° c . 1 . 5 -- 21 . 5 66 . 2 -- 4 . 2 ether ( high 5 ml boiling ), 15 ml ( f &# 39 ;) -- 16 . 0 84 . 0 -- -- after crystal - lization from ch . sub . 2 c . sub . 12 / hexane ( g ) 100 mg hexane , koh , 64 ° c . 4 . 5 -- 11 . 3 72 . 5 -- 3 . 4 10 ml 11 . 5m , 5 ml ( g &# 39 ;) -- 6 . 6 93 . 4 -- -- after crystal - lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh ( g &# 34 ;) -- 4 . 5 95 . 5 -- -- after further crystallization from ch . sub . 2 cl . sub . 2 / hexane ( h ) 420 mg hexane , koh , 66 ° c . 4 . 5 -- 22 . 3 73 . 4 0 . 3 1 . 9 42 ml 11 . 5m , 21 ml ( h &# 39 ;) -- 21 . 4 77 . 1 -- -- after crystal - lization from ch . sub . 2 cl . sub . 2 / ch . sub . 3 oh__________________________________________________________________________ in all cases with the exception of experiments ( h ) and ( h &# 39 ;) 100 mg of aliquat ® 336 ( fluka chemi ag , buchs , switzerland ) are added to the reaction mixture as the phase transfer catalyst , since hexane , heptane or petroleum ether is used as the organic solvent ; in experiments ( h ) and ( h &# 39 ;) 300 mg of aliquat ® 336 are added . in the case of experiment ( a ) the temperature is that of the heating bath ; in all other cases the actual temperature of the reaction mixture is given . procedure and results with the starting material &# 34 ; oleoresina amarillo saponificada &# 34 ; ( direct use ) the starting material has the above composition and is not extracted , chromatographed and crystallized , but used immediately . the results of the conversion ( without phase transfer catalyst ) carried out according to the above procedure are compiled in table 2 hereinafter : table 2__________________________________________________________________________ tempe - experi - amount raturement of starting base of the reaction relative product compositiondesig - material solvent , concn ., reaction period di -( z )- ( all - e )- ( all - e )- ( z )- ( z )- zea - nation used amount amount mixture ( hours ) lutein lutein zeaxanthin lutein xanthin remarks__________________________________________________________________________ ( i ) 10 g dimethyl potassium 95 ° c . 2 . 5 -- 6 . 2 29 . 0 16 . 6 24 . 6 sulph - hydroxide , oxide , 14 . 3m , 40 ml 20 ml ( i &# 39 ;) -- 4 . 5 31 . 8 20 . 8 27 . 5 after crystalli - zation from ch . sub . 2 cl . sub . 2 / hexane__________________________________________________________________________ the starting material has a relative ( percentage ) composition of 91 . 3 % ( all - e )- lutein and 6 . 6 % ( all - e )- zeaxanthin and a total xanthophyll content of 73 . 9 % ( 739 g / kg crude material ). this material is already saponified , so that the probability of side - reactions is low . according to the above procedure ( without phase transfer catalyst ) the crude material is stirred in a mixture of dimethyl sulphoxide ( dmso ) and concentrated aqueous potassium hydroxide solution ( koh ) at about 80 ° c . or above this temperature . it is noticeable that the reaction takes place very cleanly , i . e . practically from educt to product . also , the working up of the reaction solution is simple : the lutein - zeaxanthin mixture crystallizes from the solution ( cooled to 0 ° c .) and is easily filtered off and rinsed with water in order to remove for the most part traces of excess base . the results of the conversion carried out in this manner are compiled in table 3 hereinafter : table 3__________________________________________________________________________ tempe - experi - amount of raturement starting base , of the reaction relative (%) product compositiondesign - material solvent , conc ., reaction period ( all - e )- ( all - e )- anhydro - ( all - e )- ( all - e )- productation used amount amount mixture ( hours ) lutein . sup . 1 zeaxanthin . sup . 1 lutein . sup . 2 lutein . sup . 3 zeaxanthin . sup . 3 amount__________________________________________________________________________ ( j ) 10 . 0 g dmso , koh , 9 . 5m , 65 ° c . 17 63 . 8 33 . 9 7 . 185 g 40 ml 19 ml ( k ) 10 . 0 g dmso , koh , 10 . 7m , 77 - 78 ° c . 0 . 5 91 . 3 6 . 8 40 ml 20 ml 1 89 . 4 7 . 9 2 87 . 1 10 . 7 4 . 3 82 . 9 14 . 6 7 74 . 9 22 . 0 23 34 . 2 59 . 4 4 . 2 28 . 5 33 . 9 61 . 7 3 . 9 21 . 0 42 . 1 7 . 67 g ( l ) 10 . 0 g dmso , koh , 15m , 20 63 - 64 ° c . 0 . 5 90 . 9 6 . 6 40 ml ml 1 88 . 0 6 . 4 2 85 . 2 8 . 5 4 . 3 82 . 5 15 . 1 7 75 . 2 21 . 1 22 . 5 50 . 3 46 . 4 1 . 7 28 . 5 50 . 4 47 . 4 1 . 7 42 . 1 36 . 7 8 . 16 g ( m ) 10 . 0 g dmso , koh , 15m , 20 75 - 76 °° c . 0 . 5 80 . 5 15 . 1 40 ml ml 1 58 . 3 35 . 1 1 . 8 3 . 2 47 . 9 44 . 6 2 . 3 5 47 . 4 48 . 6 2 . 7 23 42 . 6 52 . 1 3 . 8 24 41 . 1 53 . 3 3 . 4 31 . 6 38 . 0 6 . 014 g ( n ) 10 . 0 g dmso , koh , 10 . 7m , 80 - 82 ° c . 18 24 . 0 68 . 4 5 . 1 80 ml 40 ml 23 24 . 9 68 . 2 5 . 3 7 . 045 g ( n &# 39 ;) 7 . 045 g recrystal - residue 3 . 9 72 1 . 694 g lization mother from liquor 18 . 3 51 . 1 4 . 86 g ch . sub . 2 cl . sub . 2 / meoh ( o ) 10 . 0 g dmso , koh , 10 . 7m , 82 - 85 ° c . 16 29 . 2 56 . 1 8 . 0 80 ml 20 ml 23 27 . 8 60 . 1 9 . 1 14 . 1 30 . 8 5 . 6 g ( p ) 10 . 0 g dmso , koh , 10 . 7m , 80 - 82 ° c . 16 45 . 9 50 . 3 3 . 0 7 . 63 g 40 ml 20 ml 21 . 5 45 . 1 50 . 7 3 . 1 ( q ) 5 . 0 g dmso , koh , 10 . 7m , 80 - 83 ° c . 6 29 . 6 68 . 0 2 . 4 20 ml 10 ml 22 28 . 8 68 . 2 2 . 4 16 . 5 44 . 2 4 . 86 g ( r ) 10 . 0 g dmso , koh , 10 . 7m , 80 - 82 ° c . 21 92 . 1 7 . 2 20 ml + 40 ml 50 ml 42 74 . 4 22 . 2 ( s ) 10 . 0 g dmso , koh , 10 . 7m , 93 - 95 ° c . 23 24 . 9 71 . 3 3 . 9 19 . 5 55 . 1 7 . 223 g 40 ml 20 ml ( t ) 5 . 0 g dmso , koh , 10 . 7m , 80 - 85 ° c . 19 31 . 0 66 . 3 3 . 5 22 . 5 49 . 5 3 . 517 g 80 ml 40 ml ( u ) 10 . 0 g dmso , koh , 10 . 4m , 80 - 82 ° c . 5 45 . 1 50 . 5 2 . 9 40 ml 20 ml + 10 ml 23 43 . 0 53 . 7 2 . 5 11 . 3 g ( v ) 10 . 0 g dmso , koh , 10 . 4m , 82 - 84 ° c . 3 31 . 4 63 . 7 4 . 9 40 ml 20 ml . sup . 4 21 26 . 7 67 . 4 5 . 9 16 . 2 15 . 5 3 . 61 g ( w ) 10 . 0 g dmso , koh , 14 . 2m , 107 ° c . 0 . 5 14 . 1 . sup . 6 79 . 4 . sup . 6 6 . 6 . sup . 6 8 . 8 . sup . 6 35 . 2 . sup . 6 40 ml 20 ml . sup . 5 11 . 9 44 . 5 19 . 3 1 2 . 9 27 . 2 67 . 0 0 . 3 4 . 2 28 . 7 50 . 0 ( x ) 5 . 5 g dmso , koh , 14 . 3m , 98 - 99 ° c . 0 . 5 27 . 8 70 . 3 1 . 9 22 ml 11 ml 1 24 . 3 74 . 1 1 . 6 26 . 3 50 . 9 3 . 176__________________________________________________________________________ g . sup . 1 hplc area percent at 450 nm . sup . 2 it was not determined which anhydroluteins and other carotenoids made up this fraction . sup . 3 results of quantitative hplc analysis . sup . 4 addition of the base only after the dmsoflora glo suspension had reached 80 ° c . . sup . 5 addition of the base only after the dmsoflora glo suspension had reached 90 ° c . . sup . 6 the higher value was obtained in each case after 0 . 5 and 1 hour by the addition of an aliquot of the reaction solution to methanol , subsequent stirring of the suspension , filtration and hplc analysis . determination of the lower value as already described . the starting material has a composition of 90 . 9 % lutein and 5 . 3 % zeaxanthin in esterified form ; the remainder consists of ( z )- isomers of lutein esters and a small amount of anhydrolutein esters . the xanthophyll content of xantopina plus is 35 . 1 %. the results of the conversion ( without phase transfer catalyst ) carried out according to above procedure are compiled in table 4 hereinafter : table 4__________________________________________________________________________ tempe - experi - amount of raturement starting base , of the reaction relative (%) product compositiondesign - material solvent , conc ., reaction period ( all - e )- ( all - e )- anhydro - ( all - e )- ( all - e )- productation used amount amount mixture ( hours ) lutein . sup . 1 zeaxanthin . sup . 1 lutein . sup . 2 lutein . sup . 3 zeaxanthin . sup . 3 amount__________________________________________________________________________ ( y ) 10 . 0 g dmso , koh , 10 . 7m , 80 ° c . 18 41 . 0 53 . 3 3 . 7 20 . 8 27 . 5 4 . 488 g 40 ml 20 ml 21 40 . 2 54 . 5 3 . 5__________________________________________________________________________ 1 , 2 , 3 : see above ( end of table 3 )	2
fig1 shows a detail from a pointer instrument having a dial face 1 , which is penetrated by a connecting sleeve 3 that is plugged onto a pointer shaft 2 . fastened to the connecting sleeve 3 is a pointer 4 . in the region of the connecting sleeve 3 , the pointer 9 has a cap 5 made of an opaque material . arranged underneath the dial face 1 is a circuit board 6 having contacts 7 , 8 for a power supply . located on the upper side of the connecting sleeve 3 is an upright reflector 9 having an illuminating means 10 , these projecting into a recess 11 in the pointer 4 . the reflector 9 and the illuminating means 10 are aligned such that light radiated by them is radiated directly into a flag 12 of the pointer 4 . the connecting sleeve 3 forms a carrier 3 a at an end of the sleeve 3 facing the pointer 4 . the connecting sleeve 3 is produced from nonconductive plastic and has conductors 17 , 18 of conductive plastic which run continuously from connecting contacts 13 , 14 on its underside to contact surfaces 15 , 16 on its upper side . in order to supply the illuminating means with electrical power , sinuous wires 19 , 20 of conductive plastic are injection molded onto the connecting contacts 13 , 14 of the connecting sleeve 3 . while the wires 19 , 20 are portrayed as hanging loose in fig1 it is to be understood that , by way of alternative embodiment , they may be configured in helical form , as will be described for the conductor tracks 28 , 29 in fig3 in which case the wires 19 , 20 serve as a bifilar helical spring with a low spring force wherein the wires 19 , 20 would be soldered onto the connecting contacts 13 , 14 of the connecting sleeve 3 as shown in fig1 . fig2 shows the connecting sleeve 3 of fig1 from above . it can be clearly seen here that two reflectors 9 a , 9 b are arranged on the connecting sleeve 3 and at the same time constitute contact surfaces 15 , 16 for the illuminating means 10 . in this case , the illuminating means 10 is an led chip bonded onto the reflectors 9 a , 9 b . fig3 shows a plurality of balancing resistors 21 - 23 which are applied to the upper side of the connecting sleeve 3 and are each connected to an illuminating means 24 - 26 . the balancing resistors 21 - 23 can be changed by material removal by means of a laser beam , so that in this way uniform brightness of the illuminating means 24 - 26 may be set . the connecting contacts 13 , 14 of the connecting sleeve 3 are soldered to conductor tracks 28 , 29 printed onto a flexible , spiral sheet 27 . the other end of the sheet 27 is connected to the circuit board 6 to provide a power supply . in fig4 the connecting sleeve 3 has , at its end facing the pointer illustrated in fig1 a mount 30 which is upright , of c - shaped cross section and has contact surfaces 31 , 32 machined into it . this mount 30 is designed to accommodate an illuminating means 34 arranged on a circuit board 33 . the circuit board 33 is pushed into the mount 30 and , at the same time , contact is made with the contact surfaces 31 , 32 in the connecting sleeve 3 . the electrical connection between the connecting sleeve 3 and the power supply is carried out via slip rings 35 , 36 that run around the connecting sleeve 3 and against which contact springs 37 , 38 fastened to the circuit board 6 rest . fig5 shows a bent - over connecting sleeve 39 , which at its end facing the pointer 4 is configured as described in fig1 . as a result of using the bent - over connecting sleeve 39 , it is possible for an lcd screen 40 to be arranged in a radially inner region of the pointer instrument , while the dial face 1 is located in a radially outer region . electric power to the illuminating means 10 illustrated in fig1 is supplied via a first coil 41 , arranged in the connecting sleeve 39 , and a second coil 42 , arranged on the circuit board 6 . these coils 41 , 42 are arranged opposite each other , so that the electric power is transmitted by induction from the second coil 42 to the first coil 41 .	8
embodiments of this invention will now be described with reference to the attached drawings . in fig1 a thin film depositing apparatus comprises a heating chamber 1 for heating substrates 8 , a p - type layer deposition chamber 2 for depositing a p - type semiconductor thin film ( p - type layer ) on each substrate 8 , an i - type layer deposition chamber 3 for depositing an intrinsic semiconductor thin film ( i - type layer ) on the substrates 8 , an n - type layer deposition chamber 4 for depositing n - type semiconductor thin film ( n - type layer ) on the substrates 8 , and an unload lock chamber 5 for taking out the substrates 8 , which are articulated by gate valves 6 b - 6 e , respectively . each chamber 1 - 5 is adapted to be placed in an open state to an external space and in a hermetic state by opening and closing the related gate valves 6 a - 6 f provided at opposite ends of the chamber . the gate valve 6 a opens and closes between the atmosphere and the heating chamber 1 , the gate valve 6 b between the heating chamber 1 and the p - type layer deposition chamber 2 , the gate valve 6 c between the p - type layer deposition chamber 2 and the i - type layer deposition chamber 3 , the gate valve 6 d between the i - type layer deposition chamber 3 and the n - type layer deposition chamber 4 , the gate valve 6 e between the n - type layer deposition chamber 4 and the unload lock chamber 5 , and the gate valve 6 f between the unload lock chamber 5 and the atmosphere , respectively . each chamber 1 - 5 is internally adapted to receive the substrates 8 , which are movable between each chamber 1 - 5 through opening and closing each gate valve 6 b - 6 e . each substrate 8 , as shown in fig2 is fixed vertically to a substrate holder 7 , and each chamber 1 - 5 is internally provided with a not - shown conveying mechanism for moving the substrate holder 7 between each chamber 1 - 5 . the heating chamber 1 , as shown in fig3 a , is shaped like a box and surrounded by a plate - like bottom wall 1 a , top wall 1 b , and side walls 1 c and 1 d , and has the gate valves 6 a and 6 b extending in directions parallel to the surface of the fig3 a drawing . the heating chamber 1 heats the internally - disposed substrates 8 through heat exchange with a gas 11 ( first gas such as , for example , nitrogen gas or inert gas ) flowing inside the heating chamber 1 , from which impurities such as moisture , organic substances and the like have been removed . the removal of the impurities such as moisture and organic substances may be performed , for example , by passing the gas through a compression cooler apparatus or filter apparatus . more specifically , a compression cooler apparatus 30 , as shown in fig3 b , may be constructed , for example , by a compressor 32 , tank 34 , condenser 36 , receiver 38 , selector valve 40 , precooler 42 , blower 44 and dehumidifier rotor 46 , and the gas 11 free of impurities such as moisture and organic substances may be obtained by passing , for example , outside air through the above elements in the order mentioned . the gas 11 is thereafter supplied into the heating chamber 1 via a gas supply valve 12 . alternatively , a filter apparatus 50 , as shown in fig3 c , may be constructed , for example , by two parallel - connected sets of selector valves 52 , moisture / organic substance adsorber filters 54 and selector valves 52 , and a downstream - located particle remover filter 56 , and the gas 11 free of impurities such as moisture and organic substances may be obtained by passing , for example , compressed air through the filter apparatus 50 . the gas 11 is thereafter supplied into the heating chamber 1 via the gas supply valve 12 . the bottom wall 1 a is provided with a gas supply source including the gas supply valve 12 for supplying the gas 11 into the heating chamber 1 , and the top wall 1 b is provided with a gas exhaust opening 13 through which the gas inside the heating chamber 1 is evacuated to the outside . the side wall 1 c is provided with a blower 15 for causing the gas 11 , which has been heated at heat sources 14 , to flow along an airway inside the heating chamber 1 and with a guide plate 16 a located below the blower 15 for guiding the moving direction of the gas 11 which is blown by the blower 15 . the space inside the heating chamber 1 is composed of a space section 17 where the substrate holder 7 with substrates 8 fixed thereto is disposed and a space section 18 where the gas 11 is heated and blown , the space sections 17 and 18 being partitioned with a partition plate 19 and guide plate 20 . the partition plate 19 has a rectangular shape and is fixed vertically on the bottom wall 1 a such that its surface lies parallel to the side wall 1 c . the partition plate 19 is formed at a lower portion thereof with ventilating holes 19 a for passage therethrough of the gas 11 and at an upper portion , above the blower 15 , with a guide plate 16 b which projects on the side of the space section 18 to guide the moving direction of the gas 11 . a gap is formed between the upper end of the partition plate 19 and the top wall 1 b so as to allow passage therethrough of the gas 11 . the heat sources 14 are provided between the ventilating holes 19 a and the blower 15 and heat the gas 11 inside the heating chamber 1 to approximately 250 ° c . the guide plate 20 is disposed between the side face of the side wall 1 d and the upper end of the partition plate 19 such that it guides the gas 11 from the space section 18 to the space section 17 . the p - type layer deposition chamber 2 , as shown in fig4 is shaped box - like in the same way as the heating chamber 1 and surrounded by a plate - like bottom wall 2 a , top wall 2 b , and side walls 2 c , and has gate valves 6 b and 6 c extending in directions parallel to the surface of the fig4 drawing . the p - type layer deposition chamber 2 deposits a p - type semiconductor thin film on surfaces of the substrates 8 disposed therein . the side wall 2 c is provided with a gas introduction apparatus 100 made up of a gas introduction valve 101 and a gas introduction source 102 for introducing a p - type layer depositing gas ( second gas ) into the p - type layer deposition chamber 2 , and the side wall 2 d is provided with a pumping system 200 made up of a pump valve 201 and a pump 202 for evacuating the gas from inside the p - type layer deposition chamber 2 . furthermore , each of the side walls 2 c and 2 d is provided with a heater 27 for heating and maintaining the heat of the substrates 8 with radiant heat . the top wall 2 b is mounted with high - frequency electrodes 24 for causing an electrical discharge of the gas supplied into the p - type layer deposition chamber 2 , the high - frequency electrodes 24 connecting to respective high - frequency power sources 25 . each high - frequency electrode 24 is , for example , an inductively coupled type electrode made of a u - shaped rod - like metallic member and is disposed between substrates 8 and 8 . the high frequency electrode 24 is insulated from the top wall 2 b by means of an insulating block 26 . the gas which is introduced into the p - type layer deposition chamber 2 may , for example , be a mixture gas of b 2 h 6 , sih 4 and h 2 , and the pressure inside the p - type layer deposition chamber 2 may be maintained , for example , at approximately 10 - 100 pa . the i - type layer deposition chamber 3 deposits an intrinsic semiconductor thin film on surfaces of the substrates 8 disposed therein and has the same construction as that of the p - type layer deposition chamber 2 except that the gas which is introduced into the i - type layer deposition chamber 3 is different . the gas which is introduced into the i - type layer deposition chamber 3 may , for example , be a mixture gas of sih 4 and h 2 , and the pressure inside the i - type layer deposition chamber 3 may be maintained , for example , at approximately 10 - 100 pa as inside the p - type layer deposition chamber 2 . the n - type layer deposition chamber 4 deposits an n - type semiconductor thin film on surfaces of the substrates 8 disposed therein and has the same construction as that of the p - type layer deposition chamber 2 except for the gas to be introduced . the gas which is introduced into the n - type layer deposition chamber 4 may , for example , be a mixture gas of ph 3 , sih 4 and h 2 , and the pressure inside the n - type layer deposition chamber 4 may likewise be maintained , for example , at approximately 10 - 100 pa . the unload lock chamber 5 is for taking out the substrates 8 under atmospheric pressure . a thin film depositing method which uses the thin film depositing apparatus of the above construction will now be described . first , the substrate holder 7 with substrates 8 fixed thereto is disposed inside the heating chamber 1 through the gate valve 6 a , which is maintained at a pressure slightly higher than the atmospheric pressure and filled with the gas 11 , followed by closing the gate valve 6 a . in this state , all the gate valves 6 a - 6 e are closed , and the p - type layer deposition chamber 2 , the i - type layer deposition chamber 3 and the n - type layer deposition chamber 4 are maintained in a predetermined vacuum state , for example , at approximately 1 pa or less , preferably at less than 0 . 1 pa . then , the gas 11 with impurities such as moisture and organic substances removed therefrom ( for example , a nitrogen gas consisting almost only of nitrogen ) is supplied into the heating chamber 1 through the gas supply valve 12 . the pressure inside the heating chamber 1 is adjusted as required through the exhaust opening 13 , while spreading the gas 11 all over the interior of the heating chamber 1 . in this instance , heat is generated at the heat sources 14 to heat the gas 11 which is then passed in the direction of arrows in fig3 a and circulated inside the heating chamber 1 with the blower 15 . the gas 11 , which has been heated at the heat sources 14 and blown with the blower 15 so as to reach the guide plate 20 , is sent into the space section 17 where the substrates 8 are located . in the space section 17 , the gas 11 contacts the substrates 8 to perform heat exchange therewith and heats the substrates 8 . the time required for the heating is , for example , approximately 30 min . the gas 11 used to heat the substrates 8 and lowered in temperature , moves from the space section 17 again into the space section 18 through the ventilating holes 1 9 a and is reheated there by the heat sources 14 to a predetermined temperature . in this manner , the gas 11 is heated with the heat sources 14 and is blown by the blower 15 to move and circulate from the space section 18 to the space section 17 , and from the space section 17 to the space section 18 inside the heating chamber 1 , so as to heat the substrates 8 . in this instance , because the gas 11 contains almost no impurities such as moisture and organic substances , almost no impurities are adsorbed on the surfaces of the substrates 8 which would impair properties of the thin films deposited thereon . after heating substrates 8 to a predetermined temperature , the gate valve 6 b is opened , and the substrate holder 7 and thus the substrates 8 are moved to the p - type layer deposition chamber 2 with a not - shown conveying means , followed by closing the gate valve 6 b . in this state , the interior of the p - type layer deposition chamber 2 is evacuated to a pressure of , for example , 1 pa or less , preferably of less than 0 . 1 pa by means of a pumping system 200 , while disposing , as required , a second substrate holder 7 with second substrates 8 fixed thereto inside the heating chamber 1 through the gate valve 6 a , closing the gate valve 6 a , and heating the second substrates 8 . the time required for evacuating the p - type layer deposition chamber 2 to a predetermined pressure is , for example , approximately 3 - 5 min . after evacuating the interior of the p - type layer deposition chamber 2 to a predetermined pressure , a mixture gas consisting , for example , of b 2 h 6 , sih 4 and h 2 is introduced into the p - type layer deposition chamber 2 with the gas introduction apparatus 100 , and the gas flow rate and pumping speed , the latter pumping being effected with the pumping system 200 , are adjusted such that the interior pressure of the p - type layer deposition chamber 2 will be approximately 10 - 100 pa . after completion of realizing the predetermined state , a high - frequency electric power is supplied from each high - frequency power source 25 to the relevant high - frequency electrode 24 to cause an electrical discharge and decomposition of the mixture gas . the components of the gas decomposed adhere to surfaces of the substrate 8 to deposit a p - type semiconductor thin film ( p - type layer ) thereon . the time required for depositing the p - type layer is approximately 2 min . after depositing p - type layers on the surfaces of the substrates 8 in the p - type layer deposition chamber 2 , the introduction of the gas is stopped , the interior of the p - type layer deposition chamber 2 is evacuated to a pressure of , for example , 1 pa or less , preferably of less than 0 . 1 pa , the substrate holder 7 and thus the substrates 8 are moved through the gate valve 6 c into the i - type layer deposition chamber 3 with the not - shown conveying means , and the intrinsic semiconductor thin film ( i - type layer ) is deposited . the time required for depositing the i - type layer is approximately 20 min . in the meantime , if the second substrates 8 have been heated to a predetermined temperature , taking account of the time required for depositing the i - type layer on the substrates 8 and the time required for depositing the p - type layer on the second substrates 8 , the second substrates 8 are moved as required into the p - type layer deposition chamber 2 , and third substrates 8 are disposed as required in the heating chamber 1 to be heated . thus , it may be arranged that on completion of processing precedent substrates 8 in each chamber 1 - 5 , the next substrates 8 are sent as required in sequence into each chamber 1 - 5 so as to successively deposit thin layers on the substrates 8 . with the construction as mentioned above , because the gas 11 from which impurities such as moisture and organic substances have been removed is used as the gas which heats the substrates 8 through heat exchange , almost no impurities such as moisture and organic substances which would impair properties of the thin films deposited thereon are adsorbed on surfaces of the substrates 8 during heating of the substrates 8 , and because the substrates 8 , after being heated , are exposed to an atmosphere only of a gas which is the raw material of the films , it takes little time to evacuate the surroundings of the substrates 8 to remove the adsorbates adhering to the surfaces of the substrates 8 . thus , the time required for the evacuation prior to the film deposition can be shortened , with the result that the time required for depositing thin films can be shortened . because it takes little time to remove adsorbates , it is not necessary to provide the load lock chamber with a radiation heating lamp for maintaining the heat of the substrates 8 during the evacuation of space around the substrates 8 , thereby dispensing with the cost therefor . furthermore , because almost no impurities such as moisture and organic substances which would degrade the properties of the thin films are adsorbed on the substrates 8 , the properties of the thin films deposited on the substrates 8 will not be degraded . note that , although as the gas 11 from which impurities such as moisture and organic substances have been removed , a nitrogen gas from which impurities such as moisture and organic substances have been removed may be used , the gas 11 free of impurities such as moisture and organic substances is not limited to the nitrogen gas , and any inactive gas which will not give rise to adsorption on the substrates 8 and not effect the properties of the films during film deposition is usable . note that , although in the above embodiment the heating chamber 1 has not been configured to have its interior gas evacuated , the heating chamber 1 may be provided with a pumping system for evacuating the interior gas . in that case , after heating the substrates 8 in the heating chamber 1 , the space around the substrates in the heating chamber 1 may be evacuated , and then the substrates 8 may be moved to the p - type layer deposition chamber 2 to have the p - type thin film deposited thereon . note that in the above embodiment , the p - type layer deposition chamber 2 , the i - type layer deposition chamber 3 , and the n - type layer deposition chamber 4 are provided downstream of the heating chamber 1 . however , it is also possible to provide , instead of these three chambers , a single deposition chamber downstream of the heating chamber 1 which is capable of depositing the three layers of the p - type , i - type and n - type layers . furthermore , the heating chamber 1 and the p - type layer deposition chamber 2 , or the heating chamber 1 and a single layer deposition chamber capable of depositing all the three layers may be combined into a single chamber . in addition , the unload lock chamber 5 and the n - type layer deposition chamber 4 may be made the same . in this instance , the gate valve 6 e may be provided at the atmosphere side with a nitrogen - purged atmospheric pressure space so as to prevent impurities from entering the n - type layer deposition chamber 4 . alternatively , an air curtain of nitrogen may be provided on the atmosphere side of the gate valve 6 e . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit and scope of the invention as set forth in the appended claims .	2
a reactor vessel body 2 and a reactor vessel head 4 are joined by bolted connection at flange 6 . the reactor vessel body has an inlet opening 8 and an outlet opening 10 for flow of coolant water therethrough . a core 12 is comprised of a plurality of fuel assemblies 14 , each of which is comprised of a plurality of elongated fuel rods . the core is supported on the core support assembly 16 which is in turn supported by the core support barrel 18 . this core support barrel is supported by flange 20 from the reactor vessel body 2 at a location adjacent the flange 6 . immediately above the core 12 is a fuel assembly alignment and seal plate 22 which serves to engage the upper ends of the fuel assemblies and to maintain alignment thereof . a boundary plate structure 24 is located above the alignment plate , thereby defining the outlet plenum 26 . after the coolant enters through inlet opening 8 the flow passes downwardly through the annular space 28 between the reactor vessel and the core support barrel . this flow passes downwardly through the flow skirt 30 into an inlet plenum 32 located below the core 12 . the flow passes upwardly through the core and through openings 52 in the alignment plate 22 into the outlet plenum 26 . from here the flow passes out through outlet opening 10 to a steam generator ( not shown ). each of the fuel assemblies 14 contain within their structure four control rod guide tubes 40 which pass through the entire length of the fuel assembly . finger shaped control rods 48 are vertically movable within the guide tubes 40 of the fuel assemblies . each of these rods individually extends to an elevation above the foundary plate 24 at which location they may be joined in subgroupings to the control rod extension 50 . in addition to the flow holes 52 , the alignment and seal plate 22 also has openings 54 through which the control rods pass . control rod shroud tubes 56 pass through the outlet plenum 26 and may be welded to the alignment and seal plate 22 and the boundary plate structure 24 . these shroud tubes surround and protect the control rods from the effects of cross flow through the plenum 26 , and also are open to a chamber 72 above the boundary plate 24 . the boundary plate 24 is supported from barrel 60 which is supported by flanges 62 resting on flanges 20 of the core support barrel . the upper guide structure support plate 64 is open to permit flow therethrough . the upper end of the control rod shroud tube 56 is open to the chamber 72 from which water passes by plate structure 24 to the outlet 10 . guide tubes 40 in the fuel assemblies are open at their upper end and therefore exposed to a low pressure existing near outlet 10 . referring to fig2 the pressure at the top chamber of guide tubes 40 approximates the outlet pressure from the reactor . the control rod guide tubes 40 may be terminated just below the alignment and seal plate 22 as illustrated , or they may be continued upwardly into the top chamber 72 . in either case , the tubes are open to a fluid pressure which approximate the outlet pressure from the reactor . the lower end of the guide tubes 40 extend through the seal plate 90 and are exposed to the pressurizable chamber 91 . slots 92 are provided in the core support structure 93 and the pressure plate 90 has downwardly extending lips 94 extending into slots in sealing relationship . since the main flow of coolant is upwardly across the fuel assemblies 14 , the pressure at the lower end of the fuel assemblies is higher than the pressure at the upper end . this high inlet pressure operates on the upper surface of the pressure plate 90 . depending on the amount of flow past the seal , openings 95 may be provided through the seal plate structure , to permit additional flow to pass into chamber 91 and up through control rod guide tubes 40 in a total amount sufficient to cool the control rod fingers . a substantial amount of the flow restriction is provided in these openigns 95 so that the pressure in the pressurizable plenum 91 approximates that at the outlet of the control rod guide tubes . it follows that a low pressure exists below the seal plate 90 and a relatively high pressure exists above the seal plate . this pressure differential operates to hold - down the fuel assembly 14 . supplementary springs 96 may be provided between the upper portion of the fuel assembly and the alignment and seal plate 22 . a flow opening 99 may be provided as a flow path for the main coolant flow to the core . the low pressure chamber 91 is sealed around the periphery of the opening by downwardly extending lips 97 which engage the edges of slot 98 in the support and seal plate 93 . the uplift forces on the fuel assemblies are a function of the flow through the core . in this invention the hold - down force is also a function of the flow through the core , and therefore , the forces are self - compensating . this provides more tolerance in the event that flow or pressure drop varies form that predicted .	8
fig1 illustrates an embodiment of a system 10 for enhancing a useful life of a transportation surface s , such as pavement , a runway , a bridge , a parking structure , or the like . the system 10 includes a physical alteration component 20 , a protective compound 30 and , optionally , an applicator 40 for introducing the protective compound 30 onto the transportation surface s . the physical alteration component 20 may comprise any apparatus that will alter the texture of a transportation surface s . in some embodiments , the physical alteration component 20 may be configured to increase or at least partially restore microtexturing of the transportation surface s . a physical alteration component 20 may increase microtexturing by generating a physical impact against the transportation surface s . non - limiting examples of such a physical alteration component 20 include shot blasting equipment ( e . g ., that available from blastrac , n . a . of oklahoma city , okla ., etc .) and diamond grinding equipment ( e . g ., that available from diamond surface , inc ., of rogers , minn ., etc .). as another option , a physical alteration component 20 may chemically increase microtexturing ( e . g ., by etching the transportation surface s , etc .). microtexturing may be restored by a physical alteration component that forces contaminants ( e . g ., particles of rubber , dirt , oil , etc .) from microtexturing that may already be present in the transportation surface s . a couple of examples of such a physical alteration component 20 include , but are not limited to , sand blasting equipment and pressure washing equipment . in some embodiments , the physical alteration component 20 ( e . g ., a diamond grinder and / or groover , etc .) may also increase macrotexturing of the transportation surface s or impart the transportation surface with macrotexturing . once a transportation surface has been physically altered , it may be cleaned ( e . g ., by pressure spray , etc .). cleaning may remove bitumen residues or buildup on the aggregate , thereby exposing microtexture and , thus , enhancing the performance of the physical alteration process . the applicator 40 of a system 10 for enhancing a useful life of a transportation surface s may be configured to apply a protective compound 30 in the form of a liquid or a slurry . in some embodiments , the applicator 40 may be configured to spray the protective compound 30 onto a transportation surface s . such an applicator 40 may be configured to spray the protective compound 30 under sufficient pressure ( e . g ., 750 psi to 30 , 000 psi , or 5 mpa to 200 mpa , or more , etc .) to expose microtexturing in the transportation surface s . alternatively , the applicator 40 may be configured to generate a relatively low pressure spray of protective compound 30 . in other embodiments , the application 40 may be configured to drop a stream of protective compound 30 onto a transportation surface s , to roll protective compound 30 onto a transportation surface s , or to apply the protective compound 30 to a transportation surface s in any other acceptable manner . the protective compound 30 may comprise any type of compound that will protect the transportation surface s and prevent wearing of or damage to the same . in a specific embodiment , the protective compound 30 may comprise a hardener and / or densifier . as other options , a protective component 30 may prevent scaling of the transportation surface s , protect the transportation surface s from corrosive agents , seal the transportation surface s , or otherwise extend the useful life of the transportation surface s . in some embodiment , the protective compound 30 may be configured to perform a combination of these functions . in embodiments where the protective compound 30 hardens and / or densifies the transportation surface s , it may include a lithium - based hardener . examples of lithium - based hardeners include lithium polysilicates and colloidal silicas . when applied to a concrete surface , lithium - based hardeners penetrate pores and microcracks in the surface . the lithium of lithium - based hardeners stabilizes the silicate , enabling it to remain in solution for a sufficient time ( i . e ., longer than sodium silicates since lithium ions are larger than sodium ions and can stabilize more silica in the colloidal state than sodium ions ) to penetrate the pores and / or microcracks in the concrete and to react with calcium hydroxide . in some embodiments , other types of hardeners may be used as the protective compound 30 , including , without limitation , sodium silicates or potassium silicates . as the silicate reacts with calcium hydroxide , calcium silicate hydrate ( the same product produced when water is added to portland cement ) is formed . as a comparison of fig2 a ( untreated concrete surface ) to fig2 b ( hardened concrete surface ) demonstrates , calcium silicate hydrate chemically hardens , reduces the porosity of , and densifies the surface of the concrete , which increases the surface strength of the concrete , as well as the ability of the concrete to resist wear from abrasion . the greater the porosity at the surface , the further the lithium - based hardener and / or densifier will penetrate into the concrete . moreover , hardeners , including , without limitation , lithium - based hardeners , may react with the mineral make up of various aggregates ( e . g ., aggregates used in cementitious materials , such as concrete ; aggregates used in asphalts ( particularly lime - based aggregates ); etc .) while enhancing the hardness of the aggregates . the residue from lithium - based hardeners is a dust , which is more easily removed from a treated surface than the residues of other alkali metal silicates , which form crusts on concrete surfaces . a protective compound 30 that has been formulated to prevent scaling may be configured to render the transportation surface more water - resistant , or to facilitate drying of the transportation surface . an anti - scaling protective compound 30 may include a component that reacts with a material of the transportation surface to strengthen the same . by way of non - limiting example , a protective compound 30 may include a metal siliconate ( e . g ., a transition metal siliconate , a post - transition metal siliconate , an alkali metal alkyl siliconate , etc .). anti - corrosive agents that may be useful as at least part of a protective compound 30 include , without limitation , nitrates or nitrites . in a specific embodiment , a protective compound 30 may include lithium nitrate , which may prevent or counteract the effects of alkali silica reactivity ( asr ). a sealer ( i . e ., an agent that prevents migration of moisture into a transportation surface ) may be designed to penetrate and absorb into the pores and microfissures of the minerals from which aggregates ( e . g ., of cementitious materials , such as concrete ; of asphalt ; etc .) are formed , which may react in a manner that provides an insoluble structure that fortifies and strengthens the aggregate . silane is an example of a sealer that may be included in a protective compound 30 . protective compounds 30 , such as hardeners and / or sealers , that chemically and / or structurally reinforce the aggregate of a transportation surface may increase the durability and safety of the transportation surface . the following examples provide formulations for various embodiments of protective compound 30 : various studies have been performed to determine the effectiveness of the disclosed techniques in enhancing or extending the useful lives of transportation surfaces . the examples that follow provide further insight in various embodiments and aspects of the disclosed subject matter . the california department of transportation ( caltrans ) sponsored experimental research in which concrete pavement wear on a test section of u . s . interstate highway 80 (“ i - 80 ”) over donner pass was evaluated over a twelve ( 12 ) month period of time . it is well known that the donner pass section of i - 80 experiences some of the harshest conditions in the united states in terms of snow - removal , tire chains and tire studs , and deicing salts . as expected , during the test and observation period , the test section was subjected to frequent snow plowing , traffic with snow chains and traffic with studded tires . the test section included a three lane wide , one mile long section of i - 80 at donner pass . it was divided into three subsections . prior to treatment and testing , rut depths were measured at locations in each of the three subsections . a first of the three subsections served as a control ; it was not subjected to physical alteration or chemically protected . a second of the three subsections was not physically altered , but was treated with a lithium polysilicate densifier . the third subsection was shot blasted , then treated with the lithium polysilicate densifier . twelve ( 12 ) months after treatment , rut depths were again obtained from different locations across the three subsections . the results are set forth in the following table : as table 1 illustrates , the physically altered and chemically protected subsection exhibited only about one third the wear of the untreated control subsection . these results indicate that the lithium polysilicate densifier has delayed loss of and damage to the material of the transportation surface , suggesting that the polysilicate densifier has reduced the porosity of the transportation surface and improved its hardness . further , because the rate of wear has been significantly reduced by the lithium polysilicate densifier , these results suggest that physical alteration of the transportation surface has improved pavement friction and aggregate skid resistance . in other experimentation , a thirty - three ( 33 ) month field test sponsored by the oklahoma department of transportation was conducted along a section of u . s . highway 77 (“ us - 77 ”) near oklahoma city , okla . to confirm that a protective compound , a lithium - based densifier , does not present a safety threat when applied to transportation surfaces . the section of us - 77 that was tested included concrete pavement , and was divided into two subsections : a first of which had been subjected only to shot blasting and a second of which had been subjected to shot blasting and chemical protection with a lithium - based densifier . during the course of the study , skid numbers were obtained from each subsection on a monthly basis ( thirty - three ( 33 ) months for the shot blast - only treated surface ; twenty - six ( 26 ) months for the shot blast and a lithium - based densifier - treated surface ). the results , which are depicted by fig3 , demonstrate that the application of a lithium - based densifier to a physically altered transportation surface only marginally decreases the skid number of the transportation surface . nonetheless , the skid number ( approximately 44 ) of that subsection remained well above safe limits and , thus , the lithium - based densifier did not compromise the safety of the transportation surface . these results indicate that the application of a protective compound to a physically altered transportation surface will not substantially diminish the skid number , or frictional characteristics , of the transportation surface . in another study , the abilities of embodiments of the materials set forth in examples 1 and 2 to prevent scaling of concrete surfaces were evaluated . in that study , forty - eight ( 48 ) plastic tubs , each having an inside dimension of 7 . 5 inches by 12 . 5 inches , were filled with a concrete mixture ( at a w / cm ratio of 0 . 45 and including 564 . 00 lb / yd 3 cement type i / ii , 1207 . 00 lb / yd 3 sand , 1807 . 00 lb / yd 3 aggregate # 1 , 254 . 00 lb / yd 3 water and a design air content of 6 . 5 %) to a depth of 3 inches . the concrete within each tub was then finished with a broom . the concrete within each tub was flooded with water , then the tub and the concrete therein were covered and stored at room temperature ( 23 ° c .± 2 ° c .) for fourteen ( 14 ) days , during which the concrete moist - cured . after the fourteen ( 14 ) day moist cure , the concrete samples were removed from their tubs and air dried at room temperature ( 23 ° c .± 2 ° c .) and fifty percent ( 50 %) relative humidity for seven ( 7 ) days ( i . e ., until the samples were twenty - one ( 21 ) days old . the inside surfaces of the plastic tubs were abraded . at the end of that seven ( 7 ) day period , each concrete samples was secured within a plastic tub with novalink concrete caulk , which was applied around the top side and edge of each concrete sample . the caulk was permitted to cure for three ( 3 ) days . at this point , the concrete samples were twenty - four ( 24 ) days old . at that point in time , a protective compound according to example 1 was applied to top surfaces of a first test group of sixteen ( 16 ) of the concrete samples , while a protective compound according to example 2 was applied to the top surfaces of a second test group of sixteen ( 16 ) of the concrete samples . the protective compound of examples 1 and 2 were applied at a volume equivalent to one gallon / 150 ft 3 of concrete . the concrete samples were then allowed to sit for four ( 4 ) days . an equivalent amount of water was applied to the remaining sixteen ( 16 ) concrete samples , which served as a control group . two of the concrete samples of each group were reserved as controls , to which 400 ml of water were applied . volumes of 400 ml of seven ( 7 ) different deicing chemicals were applied to two more concrete samples from each group . the deicing chemicals that were used included : ( 1 ) the calcium chloride deicer available as dowflake from dow chemical company ; ( 2 ) the magnesium chloride hexahydrate deicer available as dustgard from north american salt company ; ( 3 ) the potassium acetate deicer available as e - 36 from cyrotech ; ( 4 ) the lithium potassium acetate deicer available as lithmelt ® from the lithium division of fmc ; ( 5 ) the beet juice extract deicer available as gen - 3 - 64 / di - h2o ( d3 ) from basic solutions ; ( 6 ) kosher salt ( nacl ) available from diamond crystal salt ; and ( 7 ) the calcium magnesium acetate deicer available as cma deicer from cryotech . with the water and deicers on the concrete samples , they cycled between a temperature of − 18 ° c . for about sixteen ( 16 ) hours and a temperature of 23 ° c .± 8 ° c . for eight hours . after the completion of five of these freeze / thaw cycles , the concrete samples were flushed with tap water , and the eroded aggregate and paste were collected in funnels ; one funnel corresponding to each concrete sample . each time aggregate and paste were collected , they were dried overnight at a temperature of about 38 ° c . and their weight was determined and recorded . this process was completed five ( 5 ) times for each concrete sample , subjecting each concrete sample to a total of twenty - five ( 25 ) freeze / thaw cycles and five ( 5 ) measurements . the collective amounts of paste and aggregate from each sample were weighed to provide an indication of the effectiveness of the protective compounds of example 1 and example 2 against no chemical protection and against one another when exposed to various deicers . fig4 illustrates the cumulative weight loss from the various concrete samples , and demonstrates that the compounds of example 1 and example 2 actually prevented erosion of the concrete samples , with the composition of example 1 performing slightly better than the composition of example 2 . in the past , it has taken about seven ( 7 ) years for new pavement along the donner pass section of i - 80 to fail ( i . e ., to develop ruts having a depth of 10 millimeters ). when failure occurs , the uppermost surface of the pavement is typically removed and the pavement is white - topped with a thin ( e . g ., four inch thick , etc .) layer of concrete . however , the predicted service life for a thin layer of white - topped concrete is 6 . 3 years to 7 . 1 years . in comparison , as demonstrated by the data provided in example 3 , physically altering the same pavement ( with shot blasting ) and chemically protecting it ( with a lithium - based hardener ) doubles or even triples the life of the pavement . for new pavement , this means a prolonged life of about 14 years up to about 21 years . alternatively , treatment of whitetop in accordance with teachings of this disclosure would also add a significant amount of time to the useful life of the whitetop . in any event , teachings of this disclosure reduce long - term costs associated with the repair and / or replacement of transportation surfaces , as well as costs associated with disruptions in the flow of traffic . although the foregoing description contains many specifics , these should not be construed as limiting the scopes of the inventions recited by any of the appended claims , but merely as providing information pertinent to some specific embodiments that may fall within the scopes of the appended claims . features from different embodiments may be employed in combination . in addition , other embodiments may also lie within the scopes of the appended claims . all additions to , deletions from and modifications of the disclosed subject matter that fall within the scopes of the claims are to be embraced by the claims .	4
referring now to the drawings , fig1 illustrates a door frame 10 for a self - bailing door assembly to be located on the side of a power generation container , such as a semi - tractor trailer . self bailing refers to the ability to directly receive or accumulate rain water without it entering the power generation container . the self - bailing achieved by specific gravity , all components fit from under another component with the bottom being sealed and self - draining the exterior . the frame 10 includes an outer rim or outer panel 12 that preferably are weld together at the corners 13 to form a rectangular configuration . the frame 10 houses and mounts the dual door assembler 14 shown in fig2 . a removable center post 16 shown in fig1 c is secured within the frame 10 by fitting one end of the post 16 within a slot 18 in the top of the frame 10 , and the other end of the post 16 in a notch 20 in the base or bottom of the frame 10 . the frame 10 preferably is constructed of a metal , such as steel . fig1 a illustrates an estop receptacle 22 mounted to the outer rim 12 of the frame 10 . the estop receptacle 22 houses components for an emergency stop button for a power generation system to be contained within the power generation container . fig1 b illustrates a flat blank plate 24 for covering an unused port or aperture for mounting an estop receptacle 22 . the blank plate 24 preferably is constructed of metal and can be easily removed or replaced for adding or removing an estop receptacle 22 . in accordance with the present invention , the estop receptacle 22 can be easily added or removed from estop ports or apertures 37 . moreover , the estop receptacle 22 can be pre - wired and installed on any outer surface of a container by simply making an aperture in the container for the wiring to pass through , and the bolting or welding the estop receptacle to the outer surface of the container . this feature of the present invention enables estop receptacles to be easily added to desired upper locations when a container is on the ground , or located in a lower location when a container is located at a higher location , such as when on a semi - trailer , or at multiple estops at multiple locations . a blank plate 24 can easily cover an unused estop port 21 . by enabling estop receptacles 22 to be easily removed and repositioned to a preferred located , this reduces the cost of having to provide multiple estop receptacles 22 for various potential locations . additionally , enabling the estop receptacle to be added or removed allows the estop receptacle to be easily painted and cleaned , thus preventing rust and dirt built up . the numeral intricate structures and fixtures located within the estop receptacle make it very difficult to paint and clean when mounted , this leading to rust and corrosion . by enabling the estop receptacle 22 to be painted completely before being mounted by submerging in it in paint , enables the estop receptacle to be completely covered by paint and thoroughly protected from rust and corrosion . moreover , the estop receptacle 22 can be removed for easy cleaning or repainted if needed . it the estop receptacle was welded to the container wall , as is conventionally , done such thorough cleaning or painting would not be possible . fig2 illustrates a dual door assembly 14 configured in accordance with the present invention for mounting within a door opening of a power generation container . fig2 a is an enlarged view of the door latch configured in accordance with the invention shown in fig2 . fig1 d is an enlarged view of the frame 10 shown in fig1 . in addition to the rim or outer frame 12 , illustrated are the upper slot 18 , preferably formed by a curved u - bar mounted to any inner frame or rim 27 , and the notice 20 formed between two bars or rods 17 . screw holes 23 are located within the end of the bars 17 for securing the bottom end 19 of the removable post 16 within the notch 20 . a spacer wall 11 is located between and perpendicular to the inner rim 27 and the outer rim 12 . mounting holes 25 are located within the outer rim 12 for securing the frame 10 within an opening in the side of a power generation container . fig1 e provides another perspective view of the frame 10 . fig2 b illustrates the dual door assembly 14 , and fig1 f illustrates the removable center post 16 which is located between the doors 31 and 33 . the dual door assembly 14 including the removable post 16 are to be located within an opening in the side of a power generation container in order provide easy access to the power generation machinery contained inside . the doors 31 , 33 each include a door latch 30 and mounting hinges 32 , on the opening side of the door are included door latches 34 . fig1 g illustrates an enlarged view of the estop receptacle 22 bolted to the rim 12 of the frame 10 shown in fig1 . fig1 h is a detailed view of the estop receptacle 22 including a cover plate 36 bolted to the rim 12 of the frame 10 shown in fig1 . the 152 e - stop outside body ( top ) receives 154 e - stop mounting plate and 155 front cover mounting plate and are aligned by means of slot and tang construction with 152 e - stop outside body ( bottom ) clamping them by means of 158 e - stop mounting bolts , 160 e - stop mounting washers and 162 e - stop mounting nuts . 152 e - stop outside body is connected to 150 mounting frame stud and 160 e - stop mounting washers and 162 e - stop mounting nuts . 156 front cover is mounted to 155 by means of 157 front cover mounting bolts . the pre wired e - stop switch is mounted to 154 e - stop mounting plate by means of 157 front cover bolts in 172 riv - nuts . 164 rear electrical cover with be mounted to 152 by means of 166 rear electrical cover bolts and 168 rear electrical cover washers through 170 rear electrical cover mounting holes into 152 e - stop outside body by means of 172 riv - nuts . fig1 i is an exploded view of the estop receptacle 22 and cover plate 36 mounted to the rim 12 of the frame 10 . an aperture 37 in the rim 12 of the frame 10 is shown for receiving wiring from electrical components to be mounted within the estop receptacle 22 . the estop receptacle is modularly constructed of symmetrical parts , so that they can easily be replaced and minimize cost by using minimal similar parts . fig1 j is an enlarge view of the blank plate 24 covering an unused estop mounting aperture 37 on the outer rim 12 of the frame 10 . bolts 21 mount blank plate 24 to the outing rim 12 of the frame 10 . fig1 k is an enlarged view of the black plate 24 shown in fig1 b and 1 j . bolts 21 , nuts 37 , and washers 39 are shown securing the blank plate 24 to the outer rim 12 . fig1 l is an enlarged view of the removable center post 16 shown in fig1 c . edges 40 are formed in the front 41 of removable center post 16 for receiving the corner edges of the doors 31 , 33 when is the closed position . apertures 42 are located in the sides of both the top end 44 and the bottom end 19 of the post 16 for securing the post 16 into a secured position within the frame 10 . fig1 m is an enlarged view of the rear 45 and bottom end 19 of the removable center post 16 . the top end 44 and the bottom end 19 of the post are identical , so it does not matter which end is first inserted into the slot 18 of the frame 10 when securing the post 16 in place . also illustrated are the other side of the edges 40 . nuts or bolts 43 are shown for securing the bottom end 19 of the post 16 within the notch 20 of the frame 10 when mounting the post 16 in place . fig2 c is an enlarged view of door 33 shown in fig2 b . illustrated are the hinges 32 , door latch handle 30 , and release latches 34 . fig2 d is an enlarged view of the door latch 30 shown in fig2 c . fig2 e is an exploded rear view of the door latch 30 shown in fig2 d . the outside handle 101 is mounted to the lockable outside handle base 102 and to the door 33 by mounting bolts 36 and outside mounting nuts 37 . the symmetrical door rod assembly 103 is mounted to the door 33 by the symmetrical control with safety escape handle mounting screws 39 . the handle 101 rotates the square shaft 35 through the lockable outside handle base 102 , the boomerang clocking mechanism 38 , the symmetrical door rod control with safety escape handle 104 , the safety handle 105 , the normal control rod actuator 108 , while rotating the inside door handle 107 . the rotation of said square shaft is clocked by boomerang clocking mechanism 38 about the single mounting bolt 36 , and this clocking can be reversed by flipping the boomerang clocking mechanism 38 because it has reversed geometry . the square shaft 35 rotates the normal door rod control 108 to engage perpendicular actuator pins 110 that move the door rod actuators 106 to unlatch the door release latches 34 . the safety escape handle 105 can rotate independently of said square shaft 35 to engage perpendicular actuator pins 110 in the symmetrical door rod control with safety escape handle 104 that moves the door rod actuators 106 to unlatch the door latches 34 in the event that the door 33 becomes locked from the outside . the safety escape handle 105 can still open the door 33 from the inside . additionally , the reverse geometry design of the components shown in fig2 e of the latch 30 enable this design to work on either a left or right opening door , simply by reversing the components of the latch 30 fig3 is a perspective view of an exhaust adapter assembly 50 configured in accordance with the present invention . the exhaust adapter assembly 50 is designed to be located on the roof or top of a power generation container housing power generation machinery . illustrated is a metal pan 52 including an integral drain 54 . the sides 53 of the pan 52 prevent water on the roof of the power generation container from flowing into the base area 54 of the exhaust adapter assembly 50 . the drain 55 enables rain water failing into the base area 54 to flow off the base area 54 . thus , this design prevents rain water surrounding the exhaust from flowing into the exhaust 51 . fig3 a is an exploded view of the exhaust adapter assembly 50 illustrated in fig3 . illustrated are fastening bolts 57 , rotatable split flange clamp 58 , exhaust adapter assembly 56 , heat seat member 59 , mounting member 61 , and mounting bolts 62 . in accordance with the present invention , the exhaust adapter assembly 56 mounts to the heat sink member 59 , which is then mounted to the mounting member 61 . the rotatable split flange clamp 58 mounts to exhaust bellows 120 ( fig3 f ), and the rim 60 of the exhaust adapter assembly 56 fits inside the inner rim and ledge 65 of the rotatable split flange clamp 58 , thus enabling the exhaust bellows 120 to rotate freely and adjust by rotating the rotatable split flange clamp 58 relative to the exhaust adapter assembly 56 and its upper rim 60 . fig3 b illustrates the exhaust adapter assembly of fig3 with only the pan 52 and mounting member 61 illustrated . fig3 c is an enlarged view of the heat sink member 61 . the heat sink member 61 preferably is a glass fiber gasket made by good quality high temperature resistant and high strength glass fiber cloth , coating with nonmetal rubber or fluorine . through a special process pressing and cutting , the heat sink member is high temperature resistant , thermal insulated , fireproofed , corrosion resistance , ageing resistance , and has a high strength and smooth appearance . fig3 d is an enlarged view of the exhaust adapter assembly 56 . included in the exhaust adapter assembly are mounting holes 121 and an upper rim 60 configured to rotate freely inside the rotatable split flange clamp 58 mounted to the exhaust bellows 120 . the lower rim 122 is bolted to the heat sink member 61 and then the mounting member 61 . the mounting member 61 is a metal gasket welded to the base 54 of the pan 52 of the exhaust adapter assembly 50 . fig3 e is an enlarged bottom view of the rotatable flange clamp 58 shown in fig3 . also shown are mounting holes 123 for bolting the rotatable flange to the exhaust bellows 120 . fig4 illustrates a storable foldable ladder assembly 70 configured in accordance with the present invention . illustrated are the straight ladder 72 located within a receptacle 74 . the receptacle 74 is to be mounted to the outer side of a power generation container . the ladder 72 is mounted to the receptacle 74 by rotatable bars 75 that each are pivotally mounted to the ladder 72 and the receptacle 74 . the ladder 72 is rigid and includes rungs 71 between the sides 73 of the ladder 72 . clasps 76 hold the ladder 72 in place within the receptacle 74 is the closed position . fig4 a illustrates the ladder 72 . apertures 77 located near the top and bottom on the sides 73 of the ladder 72 are used for bolts 78 to pivotally mount the ladder 72 via the bars 75 to the receptacle 74 . fig4 b illustrates the receptacle 74 containing pivotally mounting bracket 80 having apertures 81 for pivotally mounting the bars 75 using bolts 78 . fig4 c illustrates the pivoting bar 75 shown in fig4 for rotatably mounting the ladder 72 . the bar 75 includes pivotally mounting holes 82 , 83 for pivotally mounting the ladder 72 to the receptacle 74 using bolts 78 . in accordance with the present invention , the ladder 72 is contained within the receptacle 74 is the closed and used position . when a person wants to access the roof of a power generation container including the ladder assembly 70 , the person simply releases the ladder 72 for the clasps 76 and rotates the ladder down and outward from the receptacle 74 . the lock bar 84 of the bar 75 prevents the bar 75 from rotating past a 90 degree angle from the side of a container , thus keeping the ladder away from the receptacle 74 in the open position . when the user is down with the ladder 72 , the user simply pushes the ladder back up and inside the receptacle 74 and locks the ladder 72 within the receptacle 74 using the clasp 76 . fig5 illustrates a power generation container 90 configured in accordance with the present invention . in accordance with the present invention , the front end 91 of the container 90 is removable to provide greater and easier access to the contents therein , such as the fuel tank 92 and gen set . the front end 91 of the container 90 includes a gooseneck end frame 95 , a removable air intake louver 93 , and a front wall 94 . fig5 a illustrates the gooseneck end frame assembly 95 . fig5 b illustrates an enlarged view of the front louver 93 . fig5 c illustrates an enlarged view of the removable front wall 94 which preferably is bolted to the gooseneck end frame 95 for easy removal and attachment . fig5 d is a perspective view of the rear end of the container 90 shown in fig5 , wherein the radiators for the power generation machinery are typically located . illustrated are the adjustable exhaust assembly 50 and the foldable ladder assembly 70 . also illustrated are the dual doors 31 and 33 . in accordance with the present invention , louvers ( not shown ) on the sides 96 of the container 90 are removable to provide greater and easier access to the radiator section and machinery contained therein , such as the radiator machinery . in accordance with a further aspect of the present invention , the roof on the rear end 97 of the container 90 can be removed to allow the radiator machinery , or other machinery , to be lowered or raised via the opening 98 in the roof of the container 90 by removing modular components , such as the anti racking frame 99 and the air discharge screens 100 . the screen 100 is secured and removed from the frame 99 by using mounting hardware , such as bolts , and the frame 99 is similarly attached and removed from the top of the container 90 . fig5 e is an enlarged view of the rear 15 of the container 90 showing the modular components of the frame 99 and the screen 100 removed from the roof of the container 10 to provide greater access to the machinery inside , and raise or lower machinery via the roof of the container 90 . rear doors 102 also provide access to the machinery within the rear 15 of the container 10 . fig5 f is an enlarged view of the anti - racking frame 99 , and fig5 g is an enlarged view of the screen 100 . while specific embodiments have been shown and described to point out fundamental and novel features of the invention as applied to the preferred embodiments , it will be understood that various omissions and substitutions and changes of the form and details of the invention illustrated and in the operation may be done by those skilled in the art , without departing from the spirit of the invention .	8
the present invention generally comprises a linear actuator that employs at least one shape memory alloy component as the driving element . the invention provides relatively long stroke displacement with high force , and delivers reiterative operation over a large number of cycles . with regard to fig1 one significant aspect of the invention is the provision of a plurality of stages or sub - modules 31 a - 31 d that form the linear actuator motor 30 . each sub - module 31 includes a longitudinally extending rod 32 , and end brackets 33 and 34 secured to the lower end and upper end of the rod 32 , respectively . the sub - modules 31 are arranged to translate reciprocally in the longitudinal direction . note that the brackets 33 and 34 are generally parallel and extend in opposed lateral directions . a sma wire 36 a extends from the lower bracket 33 a to an anchor point 37 , sma wires 36 b extends from the lower bracket 33 b of sub - module 31 b to the upper bracket 34 a of sub - module 31 a , and sma wires 36 c and 36 d join sub - modules b to c , and c to d , to complete a serial chain connection . the sma wires 36 a - 36 d are fabricated to undergo a phase transition upon heating to a predetermined temperature to contract approximately 4 %- 8 %. the contractile force and excursion of each sma wire , represented by arrows a - d , is applied between the sub - modules 31 a - 31 d , each pulling on the next adjacent one , whereby the contractile excursion of each sma wire 36 a - 36 d is combined additively . thus the sub - module 31 d undergoes the greatest translation when all sma wires contract , as labeled in fig1 as total displacement ( stroke ). indeed , the effective length of sma wire in the mechanism is substantially equal to the sum of the lengths of all the sma wires 36 a - 36 d . this effective length is achieved in a compact mechanism , without resort to pulleys or other bending of the sma wires . the longitudinal rod 32 d may be provided with an extended distal end 38 to facilitate delivering the output of the actuator 30 to operate a mechanism or perform other useful work . the sma wires may be heated by connecting them in an electrical circuit that directs a current through all the sma wires for ohmic heating . the circuit may extend from a negative terminal to bracket 33 d , and thence through sma wire 36 d to the adjacent sub - module 31 c , and so on to a positive connection at anchor point 37 . in this series connection all wires 36 are heated at the same time and , due to the same current passing through all wires 36 , to the same extent . the linear actuator described thus far with respect to fig1 will exhibit a limited useful life ( one or a few cycles of contraction and extension ), due to the fact that sma wire will not relax fully when cooled below the phase transition temperature , unless a restoring force is applied in the extension direction . to provide a restoring force , a spring 39 is connected at one end to the bracket 34 d of sub - module 31 d , and the other end is secured to a fixed structural point . the spring 39 is arranged to be extended by outward movement of the bracket 34 d , thus undergoing extension that increases as the wires 36 contract . when the wires are cooled and contract , the spring restoring force applied to the bracket 34 d is applied equally through the linked sub - modules 31 to all the sma wires 36 . this restoring force aids the sma wires in returning substantially fully to their original length , thus greatly lengthening the useful life of the mechanism 30 . preferred embodiments of the spring 39 are described in the following specification , although standard forms of coil , leaf , or elastomer springs will suffice for a limited useful life of the mechanism 30 . with regard to fig2 the invention may provide a block - like housing 41 for securing the sub - modules 31 in a compact assembly . the housing includes a plurality of passages 42 extending therethrough in generally parallel arrangement to permit the longitudinal rods 32 a - 32 d to extend therethrough . likewise , a plurality of passages 43 extend parallel and interspersed with the passages 42 , to receive the sma wires 36 a - 36 d therethrough . the passages 42 are dimensioned to permit freely translating motion without any significant lateral movement , and the passages 43 are dimensioned to receive the sma wires with clearance to eliminate contact . the array of passages 42 and 43 is laid out to accept the sub - modules 31 a - 31 d in serial linked fashion , as described above , and this layout may be in a linear arrangement or in a curved plane that contains all the axes of the passages 42 , further foreshortening the outer dimensions of the housing 41 . with regard to fig5 a further embodiment of the invention comprises a linear actuator 51 having an outer shell - like housing 52 defined by front , rear , top , and bottom walls 53 - 56 , respectively , in a trapezoidal configuration , and side walls 57 ( only one shown in the cutaway view ) extending therebetween to form a closed interior space . a plurality of track elements 58 are supported on both side walls 57 in parallel arrays that define slots extending longitudinally in a parallel , vertically spaced arrangement . a plurality of drive bars 59 are provided , each supported in one of the slots defined by the track elements 58 and received therein in freely translating fashion in their longitudinal direction . the drive bars 59 are disposed in a vertically stacked array , and may extend distally or retract proximally along the slots in which they are supported . a plurality of sma wires 61 is provided , each extending between and connected to the proximal end of one drive bar 59 and the distal end of the vertically superjacent drive bar . at the top of the vertically stacked array of drive bars , the sma wire 61 is connected at its distal end to an anchor point 62 . at the bottom of the vertically stacked array the drive bar 59 ′ is provided with an elongated distal end that is aligned with a window 63 in end wall 53 , through which it may extend . the sma wires 61 may be heated to a temperature above the phase transition temperature to contract the wires 61 . ( electrical wire connections are not shown for simplification of the drawing .) each drive bar 59 is advanced incrementally , as shown by the arrow at the distal end of each bar 59 , and , since each wire 61 is anchored in the superjacent moving bar , the incremental translation of each bar is applied to the subjacent bar . consequently , the lowermost bar 59 ′ undergoes the greatest longitudinal translation , extending through the opening 63 to perform useful work . the sma wires undergo a contraction of approximately 4 %- 8 %. in the embodiment of fig5 the configuration of the sma wires determines that the contractile force is exerted substantially along the longitudinal directions of the drive bars 59 , and that the angle of the force vector does not change appreciably between the contracted and extended states of the wires 61 . a spring assembly 64 is disposed below the lowermost drive bar 59 ′, and is attached thereto to apply a restoring force to bar 59 ′ and thus to all the sma wires 61 . the spring assembly 64 comprises a rolamite spring , known in the prior art and described fully in sandia laboratory report no . sc - rr - 67 - 656 , and available from the clearinghouse for federal scientific and technical information of the national bureau of standards . briefly , the spring consists of a pair of rollers 65 retained within chamber 66 , and a band spring 67 that is passed about both of the rollers 65 in an s configuration . the band spring 67 includes a tongue 68 extending therefrom through opening 69 and secured to the drive bar 59 ′. the rolamite spring tongue exerts a specified , engineered restoring force on the bar 59 ′ to assure that all the sma wires 61 return to their fully extended disposition when the wires 61 are cooled below their shape memory transition temperature . as shown in greater detail in fig3 and 4 , the band spring 67 preferably is provided with an internal cutout 71 in an extended u configuration to define the longitudinally extending tongue 68 . the chamber 66 is defined by upper and lower walls 72 and 73 , respectively , to constrain vertical movement of the rollers . side walls 74 ( only one shown ) join the upper and lower walls , and constrain lateral movement of the rollers 65 , so that the rollers 65 may move only longitudinally in the chamber 66 . the band spring 67 is secured at a proximal end to the inner surface of the lower wall 72 , and is passed about the two rollers 65 in an s configuration , as evident in fig3 . the distal end of the band spring 67 is secured to the inner surface of the upper wall 73 , and the tongue 68 diverges from the s configuration to extend through the window 69 to join the drive bar 59 ′. as the tongue 68 extends from the opening 69 it pulls the band spring 67 distally , causing the rollers to roll on their respective portions of the band spring as they translate distally . the spring return force exerted on the tongue 68 is directly related to the difference between the energy liberated as portions of the band unbend versus the energy required to bend other portions of the band when the two rollers translate longitudinally . by selectively varying the width of the band spring 67 , or selectively varying the width of the cutout 71 , it is readily possible to generate a spring return force that follows a predictable mathematical function . as depicted graphically in fig7 a typical prior art helical spring or leaf spring develops a restoring force f that varies generally linearly with displacement x , or , f =− kx . for a rolamite spring , the function that relates spring return force with displacement may differ significantly from a typical coil spring or leaf spring . in particular , for restoring the sma linear actuator mechanisms described herein , it has been found that the optimal force for restoring the sma wires to full extension is one having a negative force constant ; i . e ., the restoring force decreases as extension of the spring increases . this force characteristic preserves the shape memory effect to the maximum extent , and results in a useful working life ( in terms of total number of cycles of operation ) in the same range as typical prior art linear actuators . in other words , the slope of the graph representing the spring function exhibits a negative slope in at least a portion of the spring excursion . if the negative slope is constant , the graph will be linear and parallel to line a of fig7 . the negative slope may change at different spring sections , producing a graph b comprised of several contiguous linear segments . or the negative slope may vary continuously , producing a smoothly curved graph of the spring function , as represented by graphs c and d . ( the band spring may also be fashioned to define positive slope areas , discontinuous spring functions , detent and dwell portions , neutral spring force , and the like , as required to provide these desired mechanical functions .) it should be noted that the contractile force of the sma wire phase transition is substantially constant as contraction takes place . as a result , the force delivered by the linear actuators described herein is substantially constant throughout the outward excursion of the actuator . this desirable characteristic is in marked contrast to typical solenoid actuators , which produce maximum force at initial actuation and taper off significantly as translation progresses . with regard to fig6 a further embodiment of a return spring having a having a negative force constant ; i . e ., the restoring force decreases as extension of the spring increases . a bar or similar moving element 76 is disposed in a channel 77 and is constrained to translate longitudinally therein , as shown by arrow l . the element 76 includes a side surface 78 defined by contiguous surface portions 78 a - 78 c that comprise a camming surface . a cam follower 79 is comprised of a telescoping mounting for a roller and a spring for urging the roller to engage the camming surfaces 78 a - 78 c . the roller is mounted to roll along the camming surfaces as they translate along the channel in the longitudinal direction . on an opposed side of the element 76 , a rectangular cutout portion 81 defines a linear , longitudinal surface 82 engaged by a cam follower 79 ′. the cam follower 79 ′ is provided to apply a lateral force to the element 76 to counterbalance the lateral force imparted by cam follower 79 , so that the element 76 will avoid becoming jammed in the channel 77 . it may be appreciated that the resilient force impinging cam follower 79 into camming surfaces 78 is resolved by classical mechanics techniques into vector forces exerted longitudinally and laterally on the element 76 . the lateral forces are offset by the follower 79 ′ and the channel constraints , so that the longitudinal force component urges the element 76 to translate longitudinally , thereby constituting a restoring force . for example , as the element 76 translates distally ( to the right in fig6 ), the cam follower 79 encounters the steeply angled cam surface portion 78 b , and exerts a strong , substantially constant longitudinal restoring force . when the cam follower 79 progresses and impinges on the camming surface portion 78 a , the restoring force is decreased to a lower constant due to the shallower slope . ( the surface 78 may comprise any number of segments , curves , or other features .) as the element translates proximally under the urging of the cam follower 79 , the portion 78 c acts as a stop to prevent further proximal translation . the spring assembly is capable of generating any desired restoring force function . with regard to fig8 - 13 , a further embodiment of the linear actuator of the present invention includes a housing 91 having a generally rectangular exterior and defining a rectangular interior space 94 extending longitudinally therein . a bottom plate 93 and a top plate 92 close the opposed ends of the space 94 , and the output plunger 95 of the actuator extends longitudinally through the central hole 97 of the top plate . within the space 94 a matrix of drive rods 96 is disposed in closely packed array , the dimensions of the space 94 and the close spacing of the rods 96 constraining the rods 96 to be translatable only in the longitudinal direction . the rods 96 are formed as rectangular parallelepipeds , with each longitudinally extending rectangular surface of each rod being adapted to receive and secure one sma wire , as detailed below . this construction enables any two rods 96 in the matrix to be connected together , end to opposite end , whether they are laterally or vertically adjacent ( as viewed in fig1 . the matrix also includes a spring housing 98 occupying the space of one drive rod 96 , as shown in fig1 and 12 , and enclosing any form of return spring described herein . the drive rod 96 g at the center of the matrix supports the output plunger 95 , and is connected to the spring within the housing 98 , so that the spring applies a restoring force to all the sma wires sufficient to restore the wires to their original length when cooled . drive rod 96 a may be connected at its lower end to an sma wire that is connected at its upper end to the housing 91 . the upper end of rod 96 a is connected to an sma wire that extends to the lower end of rod 96 b . likewise , rod 96 b is connected to rod 96 c , and so forth to rods 96 d - 96 g , which supports the output plunger 95 . when all the sma wires are actuated , the drive bars 96 a - 96 g extend in additive fashion , as shown in fig1 , to push the plunger 95 longitudinally with a strong , constant force . although the array of drive bars 96 is depicted as a [ 3 × 3 ] matrix , the arrangement may take the general form of any [ m × n ] array . with regard to fig1 , the drive bars 96 include at least one of the longitudinally extending channels 101 - 104 , each disposed in one of the four longitudinally extending rectangular faces of the parallelepiped configuration . each channel 101 - 104 is dimensioned to receive and secure one sma wire 106 . the wire 106 is provided with a mounting die 107 crimped to each end thereof , and a retaining pin 108 extends across the end of the channel to pinch the die 107 between the pin 108 and the sloped bottom surface at the end of each channel . the opposed ends of each pin 108 are secured in a passageway 109 extending from opposed sides of the bar 96 and intersecting the channel 101 . the provision of the channels 101 - 104 on each face of the bar 96 enables the connection of any bar 96 to any adjacent bar 96 , whether vertically stacked or laterally adjacent . each channel 101 - 104 may be prepared as described with reference to channel 101 to effect interconnection of the adjacent bars 96 . the channels 101 - 104 enable the wires 106 to extend between the opposite ends of adjacent impinging bars 96 without any contact or mechanical interference imparted to the wires by the bars . the crimped die 107 is formed of a conductive metal , and the engagement of the pin 109 enables electrical connection to the wires 106 by the simple expedient of securing the connecting wires to the outer ends of the pins 109 . with regard to fig1 , a further embodiment of the linear actuator of the invention makes use of a drive bar 96 as shown and described with reference to fig1 . in this embodiment the bars 96 are provided with top and bottom channels 102 and 103 , and are vertically stacked to be linked in serial , additive fashion as described previously . the vertical stacks ( two shown , but any number is possible ) are supported by side panels 111 and 112 , the side panels supporting at least one circuit board 113 that controls the application of current to the sma wires of the vertical arrays . conductors 114 extend from each circuit board to the mounting pins 108 of the adjacent drive bar vertical stack to complete circuits through the sma wires . alternatively , the circuit board may provide brush contacts that engage sliding contact pads placed on the drive bars 96 . in this embodiment the topmost drive bar undergoes the additive translation of all the subjacent bars , as described previously . a further embodiment of the return spring 39 is shown in fig2 with reference to the embodiment depicted in fig1 . however , this spring construction may be employed with any of the linear actuator embodiments described herein . drive bar 96 ′ at the upper end of the vertically stacked array of drive bars 96 undergoes the maximum longitudinal displacement , and operates the output plunger ( not shown ) of the array . a base plate 121 joins the side panels 111 and 112 below the array of drive bars . a deflection pin 122 extends laterally outwardly from drive bar 96 ′, and an elastically deformable beam 123 extends upwardly from the base plate 121 adjacent to the vertically stacked array , with the upper end of the beam disposed to impinge on the deflection pin 122 when the actuator is retracted . when the sma wires are heated and contract , the longitudinal translation of bar 96 ′ drives the deflection pin 122 to bend the beam 123 elastically , thereby exerting a restoring force on the bar 96 ′ and on the array of drive bars connected thereto . the beam 123 may be shaped with a non - uniform cross - section , or provided with other aspects that provide a return force function that approximates the spring functions a - d of fig7 sufficiently closely to provide full return of the sma wires to their elongated state , and also a high number of repetition cycles . with reference to fig1 and 17 , a further embodiment of the linear actuator of the invention includes a plurality of drive module 126 , each comprising a tubular member of rectangular cross - section , although circular and polygonal cross - sections are equally usable . the drive modules 126 are dimensioned to be disposed in concentric , nested fashion with sufficient clearance for telescoping translation therebetween . each drive module 126 includes a plurality of longitudinally extending projections 127 , each projection 127 extending from a medial end portion of one side of the respective drive module 126 , as shown in fig1 . ( for a cylindrical tubular array , the projections are spaced at equal angles about the periphery of the end of each drive module .) each side of each drive module 126 is provided with longitudinally extending channels 101 and 103 on the outer and inner surfaces , respectively , the channels being constructed as described with reference to fig1 . each projection 127 supports a mounting pin 108 received in aligned holes 109 to retain the crimped die 107 of an sma wire 106 , as described previously . the inner channel 103 provides clearance for the sma wire of the nested drive module disposed concentrically within . the number of sma wires used may vary ; in the embodiment shown in fig1 , at least two sma wires 106 are used at radially opposed sides of the nested modules to provide balanced contractile forces that resist binding of the telescoping elements . four sma wires per module may be used , one secured to each projection 127 , to provide maximum contractile force and maximum force to the actuating plunger . a return spring assembly , of any construction discussed herein , may be placed within the inner cavity of the innermost concentric element 126 and connected between the innermost and outermost elements 126 . the sma wires 106 of any contractile array described herein may be connected for ohmic heating by any of the circuit arrangements depicted in fig1 - 21 . in these figures , each drive element 140 may represent any of the drive bars or drive modules 32 , 59 , 96 , or 126 described previously . single sma wires 141 are connected at like ends of the elements 140 by extendable wires ( or sliding brush contacts ) 146 to form a continuous series circuit that includes all of the sma wires 141 . the moving end of the series circuit is connected to lead wire 143 and the other end , which is fixed in anchor point 142 , is connected to lead 144 of the current source that actuates the array . this circuit arrangement assures that all wires carry the same current . with regard to fig1 , a pair of sma wires 141 are extended between each pair of drive elements 140 , thereby multiplying the force output . this arrangement is depicted in the embodiments of fig1 - 17 and 22 , although all embodiments may support multi - wire arrangements . the paired sma wires are electrically isolated each from the other , and extendable wires 147 ( or sliding brush contacts ) are secured to the like ends of the paired sma wires , so that each pair of sma wires is connected in series . the series pairs are likewise connected in a series electrical circuit by extendable wires 148 , with lead wires 143 and 144 extending from the same end of the array . ( it may be appreciated that the number of wires extending between adjacent drive stages may be any integer number other than two .) this arrangement provides multiplied force output using a series circuit to actuate the wires . with regard to fig2 , a further embodiment of the electrical actuating circuit of the invention includes paired sma wires 141 extending between adjacent drive elements 140 , the paired wires being electrically isolated each from the other . extendable wires 151 interconnect the sma wires so that each sma wire of each pair is connected in series with one of the sma wires of the adjacent drive element . thus the circuit is comprised of two series branches that extend from the anchor point 142 to the proximal end of the output drive element 140 , where they are bridged by connection 152 . this connection arrangement provides multiplied output force and , most notably , both leads 143 and 144 from the power circuit are connected at the fixed anchor point 142 , so that the leads are not connected to a moving object . another embodiment of the actuating circuit , depicted in fig2 , also makes use of paired sma wires 141 extending between adjacent drive elements 140 . in this arrangement each pair of sma wires is connected in parallel , and the paralleled wires are connected by extendable wires 154 in a series circuit . lead 144 connects to the anchor point of the array , and lead 143 is connected at the proximal end of the output drive element 140 . this circuit arrangement provides the multiplied force output from a current draw that is double that of the previous embodiments . previous embodiments , such as those shown in fig1 and 22 , depict electrical power connections from the circuit board to each drive bar assembly . this feature permits any of the connection schemes described above , and also permits direct connection to each sma wire for individual actuation thereof . thus actuation of the sma wires may be carried out simultaneously , or staged sequentially in individual or grouped actuations . it is noted that there is a direct correlation between the diameter of the sma wires and the recovery ( relaxation ) time of the mechanisms described herein . that is , finer wire yields shorter recovery times . multiple fine wires between adjacent drive elements may be more advantageous ( in terms of actuation and recovery times ) than a single , heavier gauge sma wire , while producing approximately the same thrust . all embodiments of the invention have the explicit or implicit capability to use multiple sma wires between adjacent stages of the mechanism . in the embodiments of the linear actuator described herein in which the drive elements are enclosed in a housing , the housing may be filled with a liquid such as oil , ethylene glycol anti - freeze , or similar liquid that is lubricious and heat conducting . such fluid enhances the speed of cooling of the sma wires by a factor of one or two orders of magnitude , thereby increasing the rate of contraction of the sma wires and enabling a far faster actuation and cycle rate for the assemblies . the extension and retraction of the drive elements aids in circulating the fluid for cooling purposes . the fluid may be pumped through the housing for maximum cooling effect in high duty cycle situations . although the invention is described with reference to the shape memory component comprising a wire formed of nitinol , it is intended to encompass any shape memory material in any form that is consonant with the structural and functional concepts of the invention . the foregoing description of the preferred embodiments of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed , and many modifications and variations are possible in light of the above teaching without deviating from the spirit and the scope of the invention . the embodiments described are selected to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as suited to the particular purpose contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .	5
fig1 is a diagram showing a configuration example of an lsi including a clock supply circuit according to an embodiment of the present invention , and fig2 is a timing chart showing an operation example thereof . when a quartz oscillator 101 is connected to an oscillation cell ( oscillation circuit ) 102 inside an lsi 100 , an oscillation signal x oscillates . the oscillation cell 102 has a transistor , and inputs the oscillation signal x and outputs a clock signal ckin . the clock signal ckin is a binary signal representing the oscillation signal x by a high level or a low level depending on a threshold voltage of the transistor . the two - divider 103 is constituted of a d - type flip - flop , and divides the clock signal ckin in two to output a clock signal div 2 . the frequency of the clock signal div 2 is ½ of the frequency of the clock signal ckin . the two - divider 103 is provided for making a duty ratio for the clock signal div 2 to be 50 %. the two - divider 103 may be omitted . in such cases , the clock signal div 2 is the same as the clock signal ckin . also , the two - divider 103 may input a clock signal ckinf instead of the clock signal ckin . the output of the oscillation cell 102 is connected to an analog filter 111 . the analog filter 111 removes from the clock signal ckin pulses having a shorter pulse width than a threshold value and passes pulses having a longer pulse width than the threshold value to thereby output the clock signal ckinf . specifically , the analog filter 111 removes pulses having a short pulse width which cannot enable a divider 112 and a flip - flop constituting an oscillation stabilization waiting counter 106 in the subsequent stage to operate . here , for example , if the shortest pulse width which enables the flip - flop to operate is 1 nanosecond , the analog filter 111 only removes pulses having a pulse width shorter than 1 nanosecond . the divider 112 divides the clock signal ckinf to generate a divided clock signal ck 2 . the dividing ratio of the divider 112 is obtained from ( the highest operating frequency of the lsi 100 )/( the highest frequency of the clock signal ckinf ). the divider 112 performs dividing by a necessary dividing ratio thereof . for example , it is assumed that the highest operating frequency of the lsi 100 ( for example a first internal circuit 114 and a second internal circuit 115 ) is 100 mhz . from the clock signal ckinf , pulses having a shorter pulse width than 1 nanosecond are removed by the analog filter 111 . therefore , the shortest cycle of the clock signal ckinf is 1 nanosecond × 2 = 2 nanoseconds , so that the highest frequency of the clock signal ckinf is 500 mhz . thus , the dividing ratio of the divider 112 is 100 mhz / 500 mhz = ⅕ , which means that the divider 112 should divide at least by 5 . in this case , the divided clock signal ck 2 is 100 mhz . in the case of ripple carry type divider , which is one of preferable examples , divisions by 2 n can be obtained , so that dividing by 8 is the optimum dividing ratio . note that during an initial stage of oscillation , the clock signal ckinf has an unstable cycle and has a high frequency . for example , the clock signal ckinf has a highest frequency of approximately 500 mhz at the initial stage of oscillation - and then becomes stable with a frequency of 200 mhz at a stable stage of oscillation thereafter . the oscillation stabilization waiting counter 106 is constituted of a plurality of d - type flip - flops , which counts the number of pulses of the clock signal ckinf and turns a first count completion signal prdy to a high level and outputs it when the number of pulses exceeds a first predetermined value ( 2 4 = 16 for example ) and turns a second count completion signal crdy to a high level and outputs it when the number of pulses exceeds a second predetermined value ( 2 17 = 131072 for example ). a power supply voltage monitoring circuit 105 monitors stability of a power supply voltage after a start - up by turning on of power , and turns a reset signal prst to a low level and outputs it when the power supply voltage becomes stable . a reset signal erst is an external reset signal that is supplied externally . a reset generating circuit 107 inputs the reset signals prst , erst and the count completion signals prdy , crdy , and outputs a system reset signal rst 1 , an early reset signal rst 2 , a clock enable signal clken and a clock select signal clksl . the early reset signal rst 2 turns from a high level to a low level after the reset signals prst and erst turn to a low level and the first count completion signal prdy turns to a high level . the clock enable signal clken and the clock select signal clksl turn from a low level to a high level after the reset signals prst and erst turn to a low level and the second count completion signal crdy turns to a high level . a and ( logical product ) circuit 104 outputs a logical product signal of the clock signal div 2 and the clock enable signal clken as a system clock signal ck 1 . specifically , when the clock enable signal clken is at a low level , the system clock signal ck 1 becomes a low level . when the clock enable signal clken is at a high level , the system clock signal ck 1 becomes the same as the clock signal div 2 . after the clock enable signal clken turns to a high level and supply of the system clock signal ck 1 is started , the system reset signal rst 1 turns from a high level to a low level . the first internal circuit 114 inputs the system clock signal ck 1 and the system reset signal rst 1 and operates . the low level of the system reset signal ( enable signal ) rst 1 indicates that the system clock signal ck 1 is usable . a selector 113 selects the system clock signal ck 1 or the divided clock signal ck 2 depending on the clock select signal clksl and outputs it as a clock signal ck 3 . when the clock select signal clksl is at a low level , the divided clock signal ck 2 is outputted as the clock signal ck 3 . when the clock select signal clksl is at a high level , the system clock signal ck 1 is outputted as the clock signal ck 3 . in other words , the selector 113 selects the divided clock signal ck 2 until the oscillation becomes stable , and selects the system clock signal ck 1 after the oscillation became stable . the selector 113 selects and outputs the divided clock signal ck 2 until the count value of a counter reaches a first count value , and selects and outputs the system clock signal ck 1 after the first count value is reached . the second internal circuit 115 inputs the clock signal ck 3 and the early reset signal rst 2 and operates . the low level of the early reset signal ( enable signal ) rst 2 indicates that the clock signal ck 3 ( divided clock signal ck 2 ) is usable . responding to turning on of the power , the quartz oscillator 101 starts oscillating . at this time , the oscillation signal x starts oscillating with a small amplitude at first , which gradually becomes a large stable amplitude . a waveform of the oscillation signal x with a large amplitude becomes the clock signal ckin having a normal pulse width , but a waveform of the oscillation signal x with a small amplitude may become the clock signal ckin having a short pulse width . the analog filter 111 removes this pulse having a short pulse width to thereby generate the clock signal ckinf . the divider 112 divides the clock signal ckinf by 8 for example to generate the divided clock signal ck 2 . thus , the divided clock signal ck 2 becomes a pulse having a sufficiently long cycle for the lsi 100 to operate though this cycle is not constant . prior to the operation of the system of the lsi 100 , necessary initialization operations and the like operate with this divided clock signal ck 2 . at the time when the power is turned on , the power supply voltage monitoring circuit 105 asserts ( turns to a high level ) the reset signal prst . thus , the reset generating circuit 107 asserts ( turns to a high level ) the system reset signal rst 1 and the early reset signal rst 2 . when the reset signal prst is negated . ( turned to a low level ), the early reset signal rst 2 is also negated ( turned to a low level ). the oscillation stabilization waiting counter 106 counts the number of pulses of the clock signal ckinf , and outputs the first count completion signal prdy when the number of pulses reaches the first predetermined value and outputs the second count completion signal crdy when the number of pulses reaches the second predetermined value . due to generation of the first count completion signal prdy , the reset generating circuit 107 negates ( turns to a low level ) the early reset signal rst 2 . also , due to generation of the second count completion signal crdy , the reset generating circuit 107 asserts ( turns to a high level ) the clock enable signal clken , and starts supplying the system clock signal ck 1 . also , when the clock select signal clksl turns to a high level , the selector 113 selects the system clock signal ck 1 and outputs it . thereafter , the reset generating circuit 107 negates ( turns to a low level ) the system reset signal rst 1 . as described above , at the initial stage of oscillation , the pulse width of the clock signal ckin may become short . in this embodiment , since pulses having a short pulse width are removed by the analog filter 111 , the clock signal ckinf has a pulse having a sufficiently long pulse width . accordingly , operation failure of the divider 112 and the oscillation stabilization waiting counter 106 is prevented , and thus the stable divided clock signal ck 2 and count completion signals prdy , crdy can be generated . since the stable clock signal div 2 can be generated and also the count completion signals prdy , crdy become accurate , the first and second predetermined values to be counted by the counter 106 are not needed to be longer than necessary . accordingly , the reset signals rst 1 and rst 2 can be negated ( turned to a low level ) early , and the clock signals ck 1 and ck 2 can be made usable early . a period in which the early reset signal rst 2 is at a low level and the system reset signal rst 1 is at a high level is an initial period of oscillation , and during this period , the second internal circuit 115 uses the divided clock signal ck 2 as the clock signal ck 3 . at this moment , the clock signal ckinf has a high frequency ( 500 mhz for example ). when the dividing ratio of the divider 112 is ⅕ , the clock signals ck 2 and ck 3 become 100 mhz . the second internal circuit 115 can use the clock signal ck 3 of 100 mhz . when the lsi 100 is a microcontroller or the like , a program mounted on the lsi 100 performs initialization of a ram , development of a program from a low speed rom to a high speed ram , and the like immediately after a start - up thereof . the second internal circuit 115 can perform these initialization operations during the above - described initial period of oscillation and allows a main program to operate thereafter . accordingly , the second internal circuit 115 can start the initialization operations early and finish them early . a period in which the system reset signal rst 1 is at a low level after the initial period of oscillation is a stable period of oscillation , in which the second internal circuit 115 uses the system clock signal ck 1 as the clock signal ck 3 . at this time , the clock signal ckinf has a low frequency ( 200 mhz for example ). since the dividing ratio of the two - divider 103 is ½ , the clock signals ck 1 and ck 3 become 100 mhz . the second internal circuit 115 uses the clock signal ck 3 of 100 mhz and is able to perform processing of a main program for example . in the case of fig4 , an oscillation stabilization waiting time 401 from turning on of the power until the system reset signal rst 1 becomes a low level needs to be a long time ( a few milliseconds to a few tens of milliseconds ). in this embodiment , the first internal circuit 114 that is not required to perform early processing uses the system clock signal ck 1 and the system reset signal rst 1 , and the second internal circuit 115 that is required to perform early processing can use the clock signal ck 3 and the early reset signal rst 2 . the first internal circuit 114 can use the system clock signal ck 1 after a period 201 is passed , which is from turning on of the power until the system reset signal rst 1 turns to a low level . the second internal circuit 115 can use the clock signal ck 3 after a short period 202 is passed , which is from turning on of the power until the early reset signal rst 2 turns to a low level . according to this embodiment , the clock signal ck 3 ( ck 2 ) with the short oscillation stabilization waiting time 202 can be supplied . the clock signal ck 3 ( ck 2 ) can become usable earlier than the clock signal ck 1 . the clock signal ck 3 uses the divided clock signal ck 2 in the initial period of oscillation and uses the system clock signal ck 1 in the stable period of oscillation . the dividing ratio of the divider 103 is ½ , and the dividing ratio of the divider 113 is ⅕ or ⅛ . since the dividing ratio of the divider 112 is smaller than the dividing ratio of the divider 103 , the system clock signal ck 1 has a higher frequency than that of the divided clock signal ck 2 . as above , according to this embodiment , the analog filter 111 is inserted , the formed clock signal ckinf from which pulses having a short width are removed is generated , and a divider 112 constituted of one or more flip - flops is provided for dividing this formed clock signal ckinf . the clock signal ck 2 outputted by the divider 112 is supplied to the second internal circuit 115 , thereby enabling it to operate . the analog filter 111 only passes pulses having a width equal to or wider than a pulse that enables the flip - flop constituting the divider 112 to operate . thus , the flip - flop of the divider 112 operates properly . the divider 112 divides the formed clock signal ckinf so that it becomes a frequency equal to or lower than the highest frequency to enable the second internal circuit 115 to operate . the dividing ratio required for the divider 112 is ( the highest frequency to enable the second internal circuit 115 to operate )/( the highest frequency of the formed clock signal ckinf ). here , the shortest cycle of the formed clock signal ckinf becomes two times the pulse width that can pass through the analog filter 111 , so that the highest frequency of the formed clock signal ckinf is 1 /( the shortest pulse width that can pass through the analog filter 111 × 2 ). when the shortest pulse that can pass through the analog filter 111 is 1 nanosecond , the highest frequency of the clock signal ckinf is 500 mhz . in this embodiment , for predicting stabilization of clock oscillation , the counter 106 is provided . when the counter 106 reaches a certain value , it is assumed that the clock oscillation became stable . while the oscillation is not stable , the clock signal ck 2 outputted by the divider 112 is supplied to the second internal circuit 115 , and after the oscillation became stable , the clock signal ck 1 that does not pass through the divider 112 is supplied to the second internal circuit 115 . while the oscillation is not stable , not necessarily all the functions in the lsi 100 should operate , where only the second internal circuit 115 needs to operate , which performs transferring from a low speed memory to a high speed memory , initializing memories and the like for example . accordingly , only to the second internal circuit 115 needed for these operations , the clock signal ck 2 outputted by the divider 112 is allowed to be supplied . also , at the same time , the second internal circuit 115 to which the clock signal ck 2 outputted by the divider 112 is supplied and a circuit other than the second internal circuit 115 , namely the first internal circuit 114 , use the different reset signals ( initialization signals ) rst 2 and rst 1 , respectively . for the first internal circuit 114 , the reset signal rst 1 is negated ( turned to a low level ) after the oscillation became stable . as above , according to this embodiment , it is possible to generate the clock signal ck 2 capable of operating safely even before the oscillation of a clock becomes stable , and the start - up time of a system can be largely reduced by performing operations not depending on the cycle of a clock in advance . also , it is possible to effectively utilize the oscillation stabilization waiting time of a clock signal that is supplied externally or internally . a clock signal with a short oscillation stabilization waiting time can be supplied . accordingly , an lsi or the like which operates based on a clock signal can start initialization operations early and finish them early . the present embodiments are to be considered in all respects as illustrative and no restrictive , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof .	6
referring now to fig1 - 5 of the drawings , a portable base frame is shown as indicated generally by reference character 10 underneath a worker &# 39 ; s support frame , indicated generally by reference character 40 . base frame 10 is comprised of a u shaped bottom portion 11 having vertically upright members 12 and 13 fastened , as by welding , on the top side of the open ends and retained in such vertical position by suitable brace members 15 and 16 respectively . the forward side portions include suitable locking pin receiving holes ( indicated on fig2 by reference character 19 ). a step - cover plate is disposed on the top of the closed end of u shaped bottom member 11 and includes a further u shaped upwardly extending step member to enable the user to climb into position for servicing a vehicle . a plurality of rotatable casters 14 are disposed underneath each corner of bottom frame 11 to assist in the portability of my work dolly . upright members 12 and 13 are provided with a plurality of vertically spaced holes 17 and 18 for purposes to be described below . a pair of stabilizing support legs 20 and 25 are shown rotatably disposed on each side of u shaped bottom portion 11 of portable base frame 10 . leg 20 is rotatably disposed near the side rear of u shaped bottom portion 11 on base frame 10 through suitable bolt means 22 and is provided with a caster , 14 , at its forward end . similarly , leg 25 is rotatably disposed on a bolt , 27 , extending into the other rear side portion of u shaped frame 11 and includes a caster , 14 , at its forward end . a pair of locking pins shown in the form of eye pins 24 and 29 are shown disposed and extending through the sides of legs 20 and 25 respectively for lockable engagement with holes 19 in the front sides of u shaped frame 11 . worker support 40 is shown disposed on a sliding frame , indicated generally by reference character 32 , that includes right and left side members 34 and 37 adopted to be slideably received on upright legs 12 and 13 on base frame 10 . right and left side portions 34 and 37 are interconnected and held spaced apart by a center member 33 . right side portion 34 includes a bracket 35 having an aperture 36 and left side 37 includes a bracket 38 having an aperture 39 . a user &# 39 ; s step is shown in the form of the downwardly depending u shaped member attached to the underside of center portion 33 on sliding frame 32 and , as may be seen , is spaced and dimensioned so as to permit non - interferring slideable disposition of sliding frame 32 with the upwardly extending step portion on base frame 10 . worker &# 39 ; s support 40 is shown comprised of a pair of parallel support rails 42 and 43 that are connected by suitable means at the forward end and are connected to a swing frame 44 at the rear end . suitable padding material for the body , or the like , of a user is indicated by reference character 41 and for the head , as indicated by reference character 61 . swing frame 44 includes a horizontally disposed cross - member 45 and an extension member 46 , 51 on each end that is substantially perpendicular to the longitudinal axis of support rails 42 and 43 . the right side extension member , 46 , is provided with a locking pin aperture 47 and is rotatably disposed on extension 35 on sliding frame 32 through a suitable bolt , 49 . left side extension member 51 similarly includes an aperture 52 for receiving a locking pin and is rotatably disposed on extension 38 on the left side 37 of sliding frame 32 through a suitable bolt 54 . a pair of locking pins 50 and 55 are shown disposed adjacent the ends of cross member 45 to extend therefrom into complementary disposed apertures 18 and 17 in upright portions 12 and 13 on base frame 10 respectively . fig6 illustrates a safety lock for maintaining worker support 40 in the horizontal working position and includes a bracket 70 attached , as by welding , to the right and left sides 34 and 37 of sliding frame 32 and includes an aperture 71 disposed to overlie apertures 47 and 52 in swing frame 44 to receive a suitable locking pin , 72 . fig7 illustrates another embodiment of a locking pin that may be utilized in connection with legs 20 and 25 . the locking pin is indicated by reference character 24a and is adapted to be slideably inserted into aperture 19 in the front sides of u shaped frame 11 . locking pin 24a extends through a plate 63 that is suitably disposed over an aperture 62 in the outside of legs 20 and 25 . a sleeve 66 is shown extending inwardly from plate 63 through aperture 62 and includes a slot for slideably receiving a cross pin 69 extending through locking pin 24a into proximity with the topside of washer 68 that is disposed on top of a coil spring 67 . an operating lever 64 is shown rotatably disposed on bolt 65 at one end . the outer end of locking pin 24a , having washer 73 , welded in place , extends through lever 64 adjacent bolt 65 . referring to fig2 wherein my invention is shown in the folded storage disposition , it may be noted that the folded mode of operation presents a balanced , compact , portable apparatus wherein the weight of the upwardly extending , compact assembly is distributed evenly over base 10 , and the assembly is locked in the storage mode with locking pin 24 extending through leg 20 , into aperture 47 in the side of swing frame 44 . when it is desired to service a vehicle , the assembly just described is transported , as by rolling , to the location of the vehicle and locking pins 24 and 29 in legs 20 and 25 are withdrawn to allow movement of legs 20 and 25 from the vertical storage position to the horizontal working support position and eye pins 24 and 29 are inserted into apertures 19 in the front side portions of u shaped frame 11 to lock the legs into position . at this point , the entire apparatus is fully portable and the casters , 14 , on the forward ends of legs 20 and 25 are in operative engagement with the work surface adjacent the vehicle to be serviced to provide a stable portable base . sliding frame 32 is raised vertically on legs 12 and 13 to a horizontal position that is above the portion of the vehicle to be serviced . worker support frame 40 is rotated from its vertical position to a horizontal position whereat locking pins 50 and 55 are inserted into complementary disposed apertures 17 and 18 in upright members 13 and 12 to lock sliding frame 32 in the desired position as worker support 40 is rotated into a horizontal worker supporting position . the entire apparatus is then transported into a suitable position with respect to the vehicle to be serviced . the mechanic may climb upon the horizontal surface of worker support 40 and work in a sitting or prone position in which the body will be supported by the padding assembly 41 and the head may be supported by padding assembly 61 at the front end of worker support 40 . in an embodiment utilizing the features illustrated in fig6 whenever the worker support portion 40 is in a horizontal position , locking pin 72 may be inserted through aperture 71 into aperture 47 in the side 46 of swing frame 44 . the embodiment of fig7 is believed self - explanatory and provides a locking pin assembly that is easily and positively operable while remaining as an integral portion of the overall structure assembly .	1
in one aspect , an object of the technology disclosed in embodiments is to identify an account that performs a remote operation based on a credential issued by a credential issuing device . fig1 illustrates an example of an information processing system . computers 101 are connected via a network ( for example , a local area network ( lan )). the network is connected to the internet via a firewall 105 . it is assumed that the information processing system is based on , for example , an intranet . each of the computers 101 is , for example , a server computer or a client computer . functions of the server computer are arbitrary . the server computer may be , for example , a domain management server , a web server , a file server , a windows ( registered trademark ) server , a samba server , or the like . each of the client computers uses services based on the individual server computers , in some cases . each of the client computers uses dada held by each of the server computers , in some cases . in addition , some of the server computers collaborate with one another in some cases . the client computers share data in some cases . one of the client computers uses a service based on another one of the client computers in some cases . in other words , it is assumed that , under a predetermined condition , the computers 101 arbitrarily perform remote operations on one another in some cases . therefore , control based on a server message block ( smb ) is performed between the computers 101 . the smb is an example of a protocol of an application layer , which provides functions of a remote operation . as the protocol of an application layer , which provides functions of a remote operation , control based on a distributed computing environment / remote procedure calls ( dce / rpc ) may be further performed . in the present embodiment , a user is authenticated by using a kerberos authentication method . kerberos authentication is a network authentication method utilizing a common key encryption method . the kerberos authentication provides a mechanism of single sign - on , in which one - time acquisition of user authentication makes services available . in a sequence illustrated below , a client computer and a server computer each decrypt a ticket by using one &# 39 ; s own common key and each acquire a session key , thereby performing mutual authentication . in addition , in the kerberos authentication , time synchronization processing for avoiding spoofing and encryption processing for concealing data are performed , too . in accordance with the kerberos authentication method , the ticket issuing system 107 manages accounts and access rights of respective users in an integrated fashion . in addition , the ticket issuing system 107 holds common keys of the respective client computers and common keys of the respective server computers . by using these common keys , the ticket issuing system 107 confirms the identity of each of the client computers and the server computers . the ticket issuing system 107 is called a key distribution center ( kdc ) or a domain controller , in some cases . the ticket issuing system 107 includes an authentication server 109 and a ticket issuing server 111 . the authentication server 109 and the ticket issuing server 111 may be provided in an integrated device . the authentication server 109 performs user authentication in the kerberos authentication method . the authentication server 109 is called an authentication server ( as ) in some cases . the ticket issuing server 111 issues a service ticket used by one of the client computers to use one of the server computers . the service ticket includes an id of the corresponding one of the client computers , a time stamp , and a term of validity . the ticket issuing server 111 is called a ticket granting server ( tgs ) in some cases . the service ticket in the present embodiment is an example of a credential . likewise , the ticket issuing server 111 is an example of the credential issuing device . in addition , likewise , the ticket issuing system 107 is an example of a credential issuing system . note that each of the client computers and the server computers is called a principal in some cases . in addition , a group of client computers and server computers , to which the same authentication policy is applied , is called a realm in some cases . in this example , it is assumed that the realm is identical to a domain . a monitoring device 103 is connected to a network via , for example , a switch or network tap compatible with port mirroring . the monitoring device 103 captures packets flowing through the network and analyzes the packets , thereby generating a log of a remote operation with which an account name is associated . fig2 illustrates an example of a sequence . in this example , it is assumed that a client computer 201 accesses a server computer 203 and uses a service of the server computer 203 . the client computer 201 sends , to the authentication server 109 , a request message of user authentication ( hereinafter , called initial authentication ) in the kerberos authentication method ( s 211 ). the relevant request message includes an account name and a password , assigned to a user of the client computer 201 . based on the account name and the password included in the relevant request message , the authentication server 109 performs the initial authentication . if the initial authentication succeeds , the authentication server 109 generates a ticket - granting ticket ( tgt ) and sends , to the client computer 201 , a response message of a success , which includes the tgt ( s 213 ). the tgt is a ticket for permitting a service ticket to be issued . the client computer 201 stores the tgt included in the response message of a success . the client computer 201 sends , to the ticket issuing server 111 , a request message of issuance of the service ticket for using the server computer 203 ( s 215 ). the relevant request message includes the tgt and a service name of the server computer 203 . the ticket issuing server 111 verifies the tgt included in the request message of issuance of the service ticket . specifically , the ticket issuing server 111 confirms the time stamp and the term of validity of the tgt and further confirms that it is a user who has an access right for the server computer 203 . if the verification succeeds , the service ticket used by the user authenticated in s 211 to utilize the server computer 203 is generated . in addition , the ticket issuing server 111 sends , to the client computer 201 , a response message including the service ticket ( s 217 ). the relevant response message includes the account name used for the initial authentication . upon receiving the relevant response message , the client computer 201 sends , to the server computer 203 , a request message of smb authentication ( s 219 ). the relevant request message includes the service ticket . based on the service ticket , the server computer 203 performs user authentication ( hereinafter , called smb authentication ) in the smb . in a case where the service ticket is valid , the smb authentication succeeds . if the smb authentication succeeds , the server computer 203 sends a response message of a success to the client computer 201 ( s 221 ). if the response message of a success is sent , a preparation for a remote operation to be performed by the client computer 201 is completed . in this example , the client computer 201 sends , to the server computer 203 , a request message of file read ( s 223 ). in accordance with the relevant request message , the server computer 203 sends , to the client computer 201 , a response message including a file ( s 225 ). the file read illustrated in fig2 is an example of a remote operation , and another remote operation is performed in some cases . on the premise of such a sequence , the monitoring device 103 analyzes a packet corresponding to the above - mentioned message . next , an operation of the monitoring device 103 will be described . fig3 illustrates an example of a module configuration of the monitoring device 103 . the monitoring device 103 includes a capture unit 301 , a judgment unit 303 , a first identification unit 305 , a first recording processing unit 307 , a second recording processing unit 309 , a third recording processing unit 311 , a fourth recording processing unit 313 , a deletion unit 315 , a clock unit 317 , an issuance log memory unit 321 , a connection memory unit 323 , an authentication log memory unit 325 , an operation log memory unit 327 , and a packet storage unit 329 . the capture unit 301 captures packets flowing through the network . the judgment unit 303 judges the type of a packet . the first identification unit 305 performs connection identification processing . the first recording processing unit 307 performs first recording processing . in the first recording processing , data related to credential issuance is recorded in an issuance log . the second recording processing unit 309 performs second recording processing . in the second recording processing , data related to the smb authentication is recorded in an authentication log . in the present embodiment , second recording processing ( a ) is performed . in an embodiment to be described later , second recording processing ( b ) is performed . the third recording processing unit 311 performs third recording processing . in the third recording processing , data related to a remote file access is recorded in an operation log . the fourth recording processing unit 313 performs fourth recording processing . in the fourth recording processing , data related to remote operations other than the remote file access are recorded in the operation log . the deletion unit 315 deletes data of the issuance log . the clock unit 317 measures a date and time . the issuance log memory unit 321 memorizes the issuance log . the connection memory unit 323 memorizes a connection table . the authentication log memory unit 325 memorizes the authentication log . the operation log memory unit 327 memorizes the operation log . the packet storage unit 329 stores therein the captured packets . the individual logs and the table will be described later . the capture unit 301 , the judgment unit 303 , the first identification unit 305 , the first recording processing unit 307 , the second recording processing unit 309 , the third recording processing unit 311 , the fourth recording processing unit 313 , the deletion unit 315 , and the clock unit 317 , described above , are realized by using hardware resources ( in , for example , fig2 ) and a program to cause a processor to perform processing described later . the issuance log memory unit 321 , the connection memory unit 323 , the authentication log memory unit 325 , the operation log memory unit 327 , and the packet storage unit 329 , described above , are realized by using hardware resources ( in , for example , fig2 ). next , processing in the monitoring device 103 will be described . fig4 illustrates a main processing flow . the capture unit 301 starts capture processing ( s 401 ). in the capture processing , the capture unit 301 captures packets flowing through the network , via a switch or network tap , which is compatible with port mirroring and which is provided between the monitoring device 103 and the network . the captured packets are stored in the packet storage unit 329 . the capture unit 301 assigns , to the stored packets , a date and time of capturing . the date and time is obtained from the clock unit 317 . the judgment unit 303 identifies 1 unprocessed packet out of the captured packets ( s 403 ). the judgment unit 303 identifies packets in order of , for example , capturing . the judgment unit 303 may discard already processed packets . in a case where there is no unprocessed packet , the judgment unit 303 waits until a subsequent packet is captured . the judgment unit 303 determines whether or not an identified packet is a packet of a kerberos authentication protocol ( s 405 ). specifically , in a case where a transmission source port number set in the relevant packet is a number “ 88 ” assigned to the kerberos authentication , the judgment unit 303 determines that the relevant packet is a packet of the kerberos authentication protocol . in a case where the relevant packet is determined as a packet of the kerberos authentication protocol , the first recording processing unit 307 performs the first recording processing ( s 407 ). before describing the first recording processing , an example of a module configuration of the first recording processing unit 307 will be described . fig5 illustrates an example of a module configuration of the first recording processing unit 307 . the first recording processing unit 307 includes a first setting unit 501 and a first extraction unit 503 . the first setting unit 501 sets various types of data in a new record of the issuance log . the first extraction unit 503 extracts various types of data from a packet of the kerberos authentication protocol . the first setting unit 501 and the first extraction unit 503 , described above , are realized by using hardware resources ( in , for example , fig2 ) and a program to cause a processor to perform processing described later . fig6 illustrates a first recording processing flow . the first recording processing unit 307 provides a new record in the issuance log ( s 601 ). fig7 illustrates an example of a configuration of an issuance log . the issuance log in this example has a table form . in this regard , however , the issuance log may have a form other than the table form . the issuance log in this example includes a record corresponding to a response message of issuance of a service ticket . the relevant record includes a field for setting a date and time , a field for setting a transmission source ip address , a field for setting a transmission source port number , a field for setting a destination ip address , a field for setting a destination port number , a field for setting a client realm name and an account name , a field for setting a server realm name and a server name , and a field for setting a service ticket . the date and time is a date and time of capturing a packet of the relevant response message . the transmission source ip address and the destination ip address are extracted from the ip header of the relevant response message . the transmission source port number and the destination port number are extracted from the transmission control protocol ( tcp ) header or the user datagram protocol ( udp ) header ( hereinafter , called a udp / tcp header ) of the relevant response message . the account name identifies an account that requests the service ticket . the client realm name identifies a realm to which the client computer 201 belongs . the server name identifies the server computer 203 . the server realm name identifies a realm to which the server computer 203 belongs . while , in this example , the client realm name and the account name are recorded in a unified manner , the client realm name and the account name may be separately recorded . while , likewise , the server realm name and the server name are recorded in a unified manner , the server realm name and the server name may be separately recorded . the description returns to fig6 . the first setting unit 501 sets , in the new record , a date and time when the packet identified in s 403 is captured ( s 603 ). the first extraction unit 503 extracts , from the ip header of the relevant packet , the transmission source ip address and the destination ip address , and the first setting unit 501 sets , in the new record , the extracted transmission source ip address and destination ip address ( s 605 ). the first extraction unit 503 extracts , from the udp / tcp header of the relevant packet , the transmission source port number and the destination port number , and the first setting unit 501 sets , in the new record , the extracted transmission source port number and destination port number ( s 607 ). the first extraction unit 503 extracts , from the relevant packet , the account name , the client realm name , the server name , and the server realm name , and the first setting unit 501 sets , in the new record , the extracted account name , client realm name , server name , and server realm name ( s 609 ). the first extraction unit 503 extracts the service ticket from the relevant packet , and the first setting unit 501 sets the extracted service ticket in the new record ( s 611 ). after the first recording processing finishes , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . the description returns to fig4 . in a case of determining , in s 405 , that the packet identified in s 403 is not a packet of the kerberos authentication protocol , the judgment unit 303 determines whether or not the relevant packet is a packet of an smb protocol ( s 409 ). specifically , in a case where data indicating that a protocol is the smb is set in the relevant packet , the judgment unit 303 determines that the relevant packet is an smb packet . in a case where it is determined that the relevant packet is not an smb packet , the processing returns to the processing operation illustrated in s 403 , and the above - mentioned processing operations are repeated . the term “ smb packet ” means a packet used for control based on the smb protocol . fig8 illustrates a configuration of an smb packet . as illustrated in fig8 , a media access control ( mac ) header includes a field in which a destination mac address is set and a field in which a transmission source mac address is set . the transmission source mac address is a mac address of the corresponding computer 101 that sends the relevant packet . the destination mac address is a mac address of the corresponding computer 101 that receives the relevant packet . in addition , an ip header includes a field in which a transmission source ip address is set and a field in which a destination ip address is set . the transmission source ip address is the ip address of the corresponding computer 101 that sends the relevant packet . the destination ip address is the ip address of the corresponding computer 101 that receives the relevant packet . in a case where the smb packet is sent in accordance with the tcp , the relevant packet includes a tcp header . in a case where the smb packet is sent in accordance with the udp , the relevant packet includes a udp header . in a case of each of the tcp header and the udp header , the relevant header includes a field in which a transmission source port number is set and a field in which a destination port number is set . the transmission source port number is the number of a port from which the relevant packet is sent . the destination port number is the number of a port from which the relevant packet is received . note that , in this example , a header related to netbios is omitted . the smb packet includes an smb header and an smb body . the smb header includes a field in which a protocol is set , a field in which an operation code is set , and a field in which a pipe name is set . the identifier of the smb is set in the protocol . note that the identifier of the smb includes a version of the smb . the operation code is the identifier of a command ( corresponding to a remote operation ) in the smb . the pipe name is the name of a pipe serving as one of data transmission modes . the pipe name is uniquely defined for a service . accordingly , a service to be used is identified by the pipe name thereof . the smb header includes various types of attribute data . in this regard , however , attribute items and storage positions vary depending on the type of the smb packet in some cases . the type of the smb packet is judged based on both or one of the operation code and the pipe name . examples of the attribute data will be described later . the description returns to fig4 . in a case of determining , in s 409 , that the packet identified in s 403 is an smb packet , the judgment unit 303 further determines whether or not the packet identified in s 403 corresponds to a request message of the smb authentication ( s 411 ). specifically , in a case where an operation code ( sessionsetup ) of the smb authentication is set in the smb header , the judgment unit 303 determines that the relevant packet corresponds to a request message of the smb authentication . in a case where it is determined that the relevant packet corresponds to a request message of the smb authentication , the second recording processing unit 309 performs the second recording processing ( s 413 ). before describing the second recording processing , an example of a configuration of a request message of the smb authentication and an example of a module configuration of the second recording processing unit 309 will be described . fig9 illustrates an example of a request message of the smb authentication . in this example , the computers 101 are judged based on ip addresses . therefore , no mac address will be mentioned . in this regard , however , the computers 101 may be judged based on mac addresses . it is assumed that a request message of the smb authentication , illustrated in fig9 , is sent to the computer 101 having an ip address “ x . x . x . 30 ” by the computer 101 having an ip address “ x . x . x . 10 ”. accordingly , “ x . x . x . 10 ” is set in the field of the transmission source ip address , and “ x . x . x . 30 ” is set in the field of the destination ip address . it is assumed that the relevant request message is sent from a port having a port number “ p 1 ” in the computer 101 serving as a transmission source to a port having a port number “ p 2 ” in the computer 101 serving as a destination . accordingly , “ p 1 ” is set in in the field of the transmission source port number , and “ p 2 ” is set in in the field of the destination port number . it is assumed that a procedure of the smb authentication in this example is compliant with the version 2of the smb . accordingly , “ smb2 ” is set in the field of the protocol . “ 0x01 ” of the operation code corresponds to a request for authentication . a provider identifies an authentication method . the provider is called a security blob in some cases . in this example , the “ kerberos authentication method ” is set . note that while “ nt lan manager ( ntlm )” is set in the provider in some cases , it is not defined as a target of logging , in the present embodiment , in a case of authentication based on the ntlm . in a case of matching a condition that a protocol set in a captured packet is “ smb2 ” and an operation code set therein is “ 0x01 ”, it is determined that the relevant packet corresponds to a request message of the smb authentication . fig1 illustrates an example of a module configuration of the second recording processing unit 309 . the second recording processing unit 309 includes a second setting unit 1001 , a second extraction unit 1003 , a first determination unit 1005 , and a first search unit 1007 . the second setting unit 1001 sets various types of data in a new record of the authentication log . the second extraction unit 1003 extracts various types of data from a packet corresponding to a request message of the smb authentication . the first determination unit 1005 determines whether or not the “ kerberos authentication method ” is set in the field of the provider in a request message of the smb authentication . the first search unit 1007 searches , within the issuance log , for a record including a specific service ticket . the second setting unit 1001 , the second extraction unit 1003 , the first determination unit 1005 , and the first search unit 1007 , described above , are realized by using hardware resources ( in , for example , fig2 ) and a program to cause a processor to perform processing described later . next , the second recording processing ( a ) will be described . fig1 illustrates a second recording processing ( a ) flow . the first determination unit 1005 determines whether or not the “ kerberos authentication method ” is set in the field of the provider ( s 1101 ). in a case where it is determined that the “ kerberos authentication method ” is not set in the field of the provider , the second recording processing ( a ) is terminated , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . on the other hand , in a case where it is determined that the “ kerberos authentication method ” is set in the field of the provider , the second extraction unit 1003 extracts a service ticket from the packet identified in s 403 ( s 1103 ). the first search unit 1007 searches , within the issuance log , for a record including the same service ticket as the extracted service ticket ( s 1105 ). the first determination unit 1005 determines whether or not there is a record including the above - mentioned service ticket ( s 1107 ). in a case where it is determined that there is no record including the above - mentioned service ticket , the second recording processing ( a ) is terminated , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . on the other hand , in a case where it is determined that there is a record including the above - mentioned service ticket , the second recording processing unit 309 provides a new record in the authentication log ( s 1109 ). fig1 illustrates an example of a configuration of an authentication log . the authentication log in this example has a table form . in this regard , however , the authentication log may have a form other than the table form . the authentication log in this example includes a record corresponding to a request message of the smb authentication based on the kerberos authentication method . the relevant record includes a field for setting a date and time , a field for setting a transmission source ip address , a field for setting a transmission source port number , a field for setting a destination ip address , a field for setting a destination port number , a field for setting a connection id , a field for setting a client realm name and an account name , and a field for setting a server realm name and a server name . the date and time is a date and time of capturing a packet of the relevant request message . the transmission source ip address and the destination ip address are extracted from the ip header of the relevant request message . the transmission source port number and the destination port number are extracted from the tcp / udp header of the relevant request message . the account name identifies an account that requests issuance of the service ticket . the client realm name identifies a realm to which the client computer 201 belongs . the server name identifies the server computer 203 . the server realm name identifies a realm to which the server computer 203 belongs . while , in this example , the client realm name and the account name are recorded in a unified manner , the client realm name and the account name may be separately recorded . while , likewise , the server realm name and the server name are recorded in a unified manner , the server realm name and the server name may be separately recorded . the description returns to fig1 . the second setting unit 1001 sets , in the new record , a date and time when the packet identified in s 403 is captured ( s 1111 ). the second extraction unit 1003 extracts , from the ip header of the relevant packet , the transmission source ip address and the destination ip address , and the second setting unit 1001 sets , in the new record , the extracted transmission source ip address and destination ip address ( s 1113 ). the second extraction unit 1003 extracts , from the udp / tcp header of the relevant packet , the transmission source port number and the destination port number , and the second setting unit 1001 sets , in the new record , the extracted transmission source port number and destination port number ( s 1115 ). the first identification unit 305 performs the connection identification processing ( s 1117 ). in the connection identification processing , the first identification unit 305 identifies a connection through which the packet identified in s 403 is transmitted . fig1 illustrates a connection identification processing flow . the first identification unit 305 determines whether or not the same combination as a combination of the transmission source ip address extracted in s 1113 , the transmission source port number extracted in 51115 , the destination ip address extracted in s 1113 , and the destination port number extracted in 51115 is already registered in the connection table ( s 1301 ). fig1 illustrates an example of a configuration of a connection table . the connection table in this example includes a record corresponding to a connection . the relevant record includes a field for setting a connection id , a field for setting a transmission source ip address , a field for setting a transmission source port number , a field for setting a destination ip address , and a field for setting a destination port number . the connection id identifies a connection . the connection is identified by a combination of the transmission source ip address , the transmission source port number , the destination ip address , and the destination port number . the description returns to fig1 . in a case of determining , in s 1301 , that the above - mentioned combination is not registered in the connection table , the first identification unit 305 provides a new record in the connection table ( s 1303 ). the first identification unit 305 assigns a new connection id to the new record ( s 1305 ). the first identification unit 305 sets , in the new record , the transmission source ip address extracted in s 1113 , the transmission source port number extracted in s 1115 , the destination ip address extracted in s 1113 , and the destination port number extracted in s 1115 ( s 1307 ). then , the processing returns to the second recording processing ( a ) illustrated in fig1 . in this case , in the second recording processing ( a ), a connection is identified based on the connection id assigned in s 1305 . on the other hand , in a case of determining , in s 1301 , that the above - mentioned combination is registered in the connection table , the first identification unit 305 identifies a connection id corresponding to the above - mentioned combination ( s 1309 ). then , the processing returns to the second recording processing ( a ) illustrated in fig1 . the description returns to fig1 . the second setting unit 1001 sets the connection id identified in the processing operation in s 1117 , in the new record provided in s 1109 ( s 1119 ). the second extraction unit 1003 extracts the account name , the client realm name , the server name , and the server realm name , set in the record searched for in s 1105 , and the second setting unit 1001 sets , in the new record , the extracted account name , client realm name , server name , and server realm name ( s 1121 ). if the second recording processing ( a ) finishes , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . the description returns to fig4 . in a case of determining , in s 411 , that the packet identified in s 403 does not correspond to a request message of the smb authentication , the judgment unit 303 determines whether or not the relevant packet corresponds to a request message of the remote file access ( s 415 ). specifically , in a case where an operation code ( ntcreate ) of the remote file access is set in the smb header , the judgment unit 303 determines that the relevant packet corresponds to a request message of the remote file access . note that the remote file access is established by request messages . therefore , in accordance with a predetermined sequence of the remote file access , it is determined that a packet ( hereinafter , called a second request message ) following the packet ( hereinafter , called a first request message ) in which “ ntcreate ” is set also corresponds to a request message of the remote file access . fig1 illustrates an example of a request message of file read . depending on the type of the remote operation , there are a case where the request message is sent only once , thereby completing sending thereof , and a case where the request messages is sent more than once until the processing of the remote operation is completed . examples illustrated in fig1 and fig2 to be described later each correspond to a case where the request message is sent more than once . it is assumed that the first request message in the file read , illustrated in an upper stage , is sent to the computer 101 having the ip address “ x . x . x . 30 ” by the computer 101 having the ip address “ x . x . x . 10 ”. accordingly , “ x . x . x . 10 ” is set in the field of the transmission source ip address , and “ x . x . x . 30 ” is set in the field of the destination ip address . note that the same applies to the second request message in the file read , illustrated in a lower stage . it is assumed that the first request message in the file read , illustrated in the upper stage , is sent from a port in the computer 101 serving as a transmission source , which has the port number “ p 1 ”, to a port in the computer 101 serving as a destination , which has the port number “ p 2 ”. accordingly , “ p 1 ” is set in the field of the transmission source port number , and “ p 2 ” is set in the field of the destination port number . note that the same applies to the second request message in the file read , illustrated in the lower stage . it is assumed that a procedure of the file read in this example is compliant with the version 1 of the smb . accordingly , “ smb ” is set in the field of the protocol . “ 0xa2 ” of the operation code of the first request message indicates “ ntcreate ”. the operation code in a case of the smb of the version 1 is 1 byte . a case of the operation code “ 0x01 ” in the first request message indicates a request for a file access . “ 0x2e ” of the operation code in the second request message indicates that the type of the file access is file read . in a case where the operation code set in the first request message is “ 0xa2 ” and the operation code set in the second request message ( having the protocol , the transmission source ip address , the transmission source port number , the destination ip address , and the destination port number in common with the first request message ) is “ 0x2e ”, it is determined that these request messages request the file read . note that a file path is set in the first request message . the description returns to fig4 . in a case where it is determined that the relevant packet corresponds to a request message of the remote file access , the third recording processing unit 311 performs the third recording processing ( s 417 ). before describing the third recording processing , a module configuration of the third recording processing unit 311 will be described . fig1 illustrates an example of a module configuration of the third recording processing unit 311 . the third recording processing unit 311 includes a third setting unit 1601 , a third extraction unit 1603 , a second determination unit 1605 , a second identification unit 1607 , and a second search unit 1609 . the third setting unit 1601 sets various types of data in a new record of the operation log . the third extraction unit 1603 extracts various types of data from a packet corresponding to the request message of the remote file access . the second determination unit 1605 determines whether or not the packet serving as a processing target is the first request message . the second identification unit 1607 identifies a command name . the second search unit 1609 searches , within the authentication log , a record including a specific connection id . the third setting unit 1601 , the third extraction unit 1603 , the second determination unit 1605 , the second identification unit 1607 , and the second search unit 1609 , described above , are realized by using hardware resources ( in , for example , fig2 ) and a program to cause a processor to perform processing described later . fig1 illustrates a third recording processing flow . in the third recording processing , data based on the first request message and the second request message related to the remote file access is set in the operation log . the second determination unit 1605 determines whether or not the packet identified in s 403 is a packet in which “ ntcreate ” is set in the operation code , in other words , the first request message ( s 1701 ). in a case where it is determined that the relevant packet is the first request message , the third recording processing unit 311 provides a new record in the operation log ( s 1703 ). fig1 illustrates an example of a configuration of an operation log . the operation log in this example has a table form . in this regard , however , the operation log may have a form other than the table form . the operation log in this example includes a record corresponding to a request message of the remote operation . the relevant record includes a field for setting a date and time , a field for setting a transmission source ip address , a field for setting a transmission source port number , a field for setting a destination ip address , a field for setting a destination port number , a field for setting a connection id , a field for setting a command name and an option , and a field for setting attribute data . in this example , the field for setting the attribute data is divided into a field for setting a client realm name and an account name , a field for setting a server realm name and a server name , and a field for setting a path or an account name . in this regard , however , a field for setting another attribute item may be included . in addition , the fields for setting the attribute data may be unified , and arbitrary attributes may be set therein . the date and time is a date and time of capturing a packet of the relevant request message . regarding the transmission source ip address , the transmission source ip address and the destination ip address are extracted from the ip header of the relevant request message . the transmission source port number and the destination port number are extracted from the tcp / udp header of the relevant request message . the connection id identifies a connection through which the relevant request message is transmitted . the command name and the option indicates a content of the remote operation . the option is not set , in some cases . the client realm name identifies a realm to which the client computer 201 belongs . the server name identifies the server computer 203 . the server realm name identifies a realm to which the server computer 203 belongs . while , in this example , the client realm name and the account name are recorded in a unified manner , the client realm name and the account name may be separately recorded . while , likewise , the server realm name and the server name are recorded in a unified manner , the server realm name and the server name may be separately recorded . in this example , in a case where the command name is “ file read ”, a file path is set in the field of the path or the account name . likewise , in a case where the command name is “ user registration ”, an account name is set in the field of the path or the account name . the description returns to fig1 . the third setting unit 1601 sets , in the new record , a date and time when the relevant packet is captured ( s 1705 ). the third extraction unit 1603 extracts , from the ip header of the relevant packet , the transmission source ip address and the destination ip address , and the third setting unit 1601 sets , in the new record , the extracted transmission source ip address and destination ip address ( s 1707 ). furthermore , the third extraction unit 1603 extracts , from the tcp header or udp header of the relevant packet , the transmission source port number and the destination port number , and the third setting unit 1601 sets , in the new record , the extracted transmission source port number and destination port number ( s 1709 ). the first identification unit 305 references the connection table , thereby identifying a connection id corresponding to a combination of the transmission source ip address , the transmission source port number , the destination ip address , and the destination port number ( s 1711 ). the third setting unit 1601 sets the connection id in the new record ( s 1713 ). the third extraction unit 1603 extracts a file path from the smb header of the relevant packet , and the third setting unit 1601 sets the extracted file path in the field of the path or the account name in the new record ( s 1715 ). with that , setting of data based on the first request message finishes . in addition , the processing returns once to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . on the other hand , in a case where it is determined , in s 1701 , that the relevant packet is not the first request message , in other words , in a case where the relevant packet is the second request message , the processing shifts , via a terminal a , to a processing operation illustrated in s 1801 in fig1 . the second identification unit 1607 identifies a command name , based on the operation code ( s 1801 ). if the operation code is , for example , “ 0x2e ”, the command of the file read is identified . the third setting unit 1601 sets the identified command name , in a record in which data is set based on the first request message ( s 1803 ). within the authentication log , the second search unit 1609 searches for a record including the same connection id as the connection id identified in the processing operation in s 1711 , performed on the first request message ( s 1805 ). the third extraction unit 1603 extracts an account name , a client realm name , a server name , and a server realm name , set in the searched record , and the third setting unit 1601 sets , in the new record of the operation log , the extracted account name , client realm name , server name , and server realm name ( s 1807 ). the processing returns , via a terminal b , to the processing illustrated in fig1 . if the third recording processing finishes , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . the description returns to fig4 . in a case of determining , in s 415 , that the packet identified in s 403 does not correspond to a request message of the remote file access , the judgment unit 303 determines whether or not it corresponds to a request message of another remote operation , in other words , a remote operation ( called one of other remote operations in the following description of fig4 ) other than the remote file access ( s 419 ). specifically , in a case where a combination of the operation code and the pipe name set in the smb header ( alternatively , one of the operation code and the pipe name ) is matched with one of patterns assumed as the other remote operations , the judgment unit 303 determines that the relevant packet corresponds to a request message of one of the other remote operations . in a case where it is determined that the relevant packet corresponds to a request message of one of the other remote operations , the fourth recording processing unit 313 performs the fourth recording processing ( s 421 ). in this example of processing , it is assumed that one of the other remote operations is established by 1 request message . in this regard , however , among the other remote operations , there is a remote operation established by request messages in the same way as in a case of the remote file access . in that case , in the same way as in a case of the remote file access , processing is divided into 2 or more . in other words , it is assumed that the first request message and the second request message ( a third and subsequent request messages are included in some cases ) each correspond to a request message of the relevant other remote operation . hereinafter , an example of user registration will be described . before describing the fourth recording processing , a request message of the user registration and a module configuration of the fourth recording processing unit 313 will be described . fig2 illustrates an example of a request message of user registration . it is assumed that a first request message in the user registration , illustrated in an upper stage , is sent to the computer 101 having the ip address “ x . x . x . 25 ” by the computer 101 having the ip address “ x . x . x . 13 ”. accordingly , “ x . x . x . 13 ” is set in the field of the transmission source ip address , and “ x . x . x . 25 ” is set in the field of the destination ip address . note that the same applies to the second request message in the user registration , illustrated in a lower stage . it is assumed that a procedure of the user registration in this example is compliant with the version 2 of the smb . accordingly , “ smb2 ” is set in the field of the protocol . in a case where the operation code set in the first request message is “ 0x0005 ”, the pipe name set in the same packet is “ samr ”, and the operation code set in the second request message ( having the protocol , the transmission source ip address , the transmission source port number , the destination ip address , and the destination port number in common with the first request message ) is “ 0x0032 ”, it is determined that these request messages request the user registration . note that the operation code in a case of the smb of the version 2 is 2 bytes . the account name is set in the second request message . fig2 illustrates an example of a module configuration of the fourth recording processing unit 313 . the fourth recording processing unit 313 includes a fourth setting unit 2101 , a fourth extraction unit 2103 , a third identification unit 2105 , and a third search unit 2107 . the fourth setting unit 2101 sets various types of data in the new record of the operation log . the fourth extraction unit 2103 extracts various types of data from a packet corresponding to a request message of one of the remote operations other than the remote file access . the third identification unit 2105 identifies a command name . the third search unit 2107 searches , within the authentication log , a record including a specific connection id . the fourth setting unit 2101 , the fourth extraction unit 2103 , the third identification unit 2105 , and the third search unit 2107 , described above , are realized by using hardware resources ( in , for example , fig2 ) and a program to cause a processor to perform processing described later . next , the fourth recording processing will be described . fig2 illustrates a fourth recording processing flow . the fourth recording processing unit 313 provides a new record in the operation log ( s 2201 ). the fourth setting unit 2101 sets , in the new record , a date and time when a packet corresponding to a request message of one of the other remote operations other than the remote file access is captured ( s 2203 ). the fourth extraction unit 2103 extracts , from the ip header of the relevant packet , the transmission source ip address and the destination ip address , and the fourth setting unit 2101 sets , in the new record , the extracted transmission source ip address and destination ip address ( s 2205 ). furthermore , the fourth extraction unit 2103 extracts , from the udp / tcp header of the relevant packet , the transmission source port number and the destination port number , and the fourth setting unit 2101 sets , in the new record , the extracted transmission source port number and destination port number ( s 2207 ). the third identification unit 2105 references the connection table , thereby identifying a connection id corresponding to a combination of the transmission source ip address , the transmission source port number , the destination ip address , and the destination port number ( s 2209 ). the fourth setting unit 2101 sets the connection id in the new record ( s 2211 ). the third identification unit 2105 identifies a command name , based on the operation code and / or a service identifier ( s 2213 ). specifically , in accordance with a predetermined rule , the third identification unit 2105 identifies the command name of a remote operation ( alternatively , a combination of the command name and an option ) corresponding to a combination of the operation code and the pipe name ( alternatively , one of the operation code and the pipe name ). the fourth setting unit 2101 sets , in the new record , the identified command name ( alternatively , a combination of the command name and an option ) ( s 2215 ). note that in a case where the command name ( alternatively , a combination of the command name and an option ) is identified based on the first request message and the second request message ( the third and subsequent request messages are included in some cases ), the command name ( alternatively , a combination of the command name and an option ) is identified in a stage of performing processing on a subsequent request message , in the same way as in a case of the third recording processing . within the authentication log , the third search unit 2107 searches for a record including the same connection id as the connection id identified in the processing operation in s 2209 ( s 2217 ). the fourth extraction unit 2103 extracts an account name , a client realm name , a server name , and a server realm name , set in the searched record , and the fourth setting unit 2101 sets , in the new record of the operation log , the extracted account name , client realm name , server name , and server realm name ( s 2219 ). in accordance with a predetermined rule corresponding to the command name ( alternatively , a combination of the command name and an option ) identified in s 2213 , the fourth extraction unit 2103 extracts attribute data other than the account name . in addition , the fourth setting unit 2101 sets the extracted attribute data , in the field of the attribute data in the new record ( s 2221 ). the fourth extraction unit 2103 may acquire the attribute data from the smb body . in addition , in a case where there is no attribute data to be extracted , the processing operation in s 2221 may be omitted . in a case where attribute data to be extracted is included in the second request message ( the third and subsequent request messages are included in some cases ), the processing operation in s 2221 may be performed in a stage of performing processing on a subsequent request message . note that in a case of analyzing the subsequent request message , the rank orders of the request messages may be judged , and processing corresponding the rank order of each of the request messages may be performed . after the fourth recording processing finishes , the processing returns to the processing operation in s 403 illustrated in fig4 , and the above - mentioned processing operations are repeated . the description returns to fig4 . in a case where it is determined , in s 419 , that the packet identified in s 403 does not correspond to a request message of one of the other remote operations , the relevant packet is regarded as not corresponding to a log target . accordingly , the processing returns , without change , to the processing operation illustrated in s 403 , and the above - mentioned processing operations are repeated . according to the present embodiment , it is possible to identify an account that performs a remote operation based on a service ticket issued by the ticket issuing server 111 . in addition , there is an aspect that associating an account , authenticated by the authentication server 109 , with recording of a remote operation is helpful in identifying an illegal remote operation . in the present embodiment , an example of deleting an already processed service ticket will be described . in s 413 in fig4 , the second recording processing ( b ) is performed in place of the second recording processing ( a ) illustrated in fig1 . fig2 illustrates a second recording processing ( b ) flow . processing operations in s 1101 to s 1121 are the same as in a case of the second recording processing ( a ). subsequent to the processing operation in s 1121 , the deletion unit 315 deletes the record of the issuance log , searched for in s 1105 ( s 2301 ). according to the present embodiment , it is possible to suppress a data amount to be recorded . while embodiments of the present technology are described above , the present technology is not limited thereto . there is , for example , a case where the above - mentioned functional block configuration does not coincide with a program module configuration in some cases . in addition , the configuration of each of the memory areas described above is just an example and does not have to have such a configuration as described above . furthermore , in each of the processing flows , the order of processing operations may be changed or processing operations may be performed in parallel as long as no processing result changes . note that the above - mentioned monitoring device 103 is a computer device , in which a memory 2501 , a central processing unit ( cpu ) 2503 , a hard disk drive ( hdd ) 2505 , a display control unit 2507 connected to a display device 2509 , a drive device 2513 for a removable disk 2511 , an input device 2515 , and a communication control unit 2517 for connecting to a network are connected to one another via a bus 2519 , as illustrated in fig2 . an operating system ( os ) and an application program to perform processing in the present embodiments are stored in the hdd 2505 and are read from the hdd 2505 to the memory 2501 at a time of being executed by the cpu 2503 . in accordance with a content of processing of the application program , the cpu 2503 controls the display control unit 2507 , the communication control unit 2517 , and the drive device 2513 , thereby causing predetermined operations to be performed . in addition , while currently processed data is mainly stored in the memory 2501 , the currently processed data may be stored in the hdd 2505 . in each of embodiments of the present technology , the application program for implementing the above - mentioned processing is distributed while being stored in a computer - readable removable disk 2511 and is installed from the drive device 2513 to the hdd 2505 . the application program is installed to the hdd 2505 via a network such as the internet and the communication control unit 2517 in some cases . in such a computer , hardware such as the above - mentioned cpu 2503 and memory 2501 and programs such as the os and the application program organically collaborate with one another , thereby realizing such various types of functions as described above . a network monitoring method according to the present embodiment includes a process including ( a ) extracting , from communication data of a credential issuing device , an issued credential and identification data of an account that requests the relevant credential , ( b ) identifying a connection through which an authentication request of a remote operation protocol , which includes the credential , is transmitted , and ( c ) associating the identification data with recording of a remote operation in the connection . by doing this , it is possible to identify an account that performs a remote operation based on a credential issued by a credential issuing device . furthermore , the extracted credential and the extracted identification data may be recorded while being associated with each other , and in a case where the connection is identified , the connection and the identification data may be recorded while being associated with each other , and the credential may be deleted . by doing this , it is possible to suppress a data amount to be recorded . note that it is possible to create a program to cause a computer to perform processing based on the above - mentioned method , and the relevant program may be stored in a computer - readable memory medium or a memory device , such as , for example , a flexible disk , a cd - rom , a magneto - optical disk , a semiconductor memory , or a hard disk . note that in general , an intermediate processing result is temporarily stored in a memory device such as a main memory . all examples and conditional language recited herein are intended for pedagogical purposes to aid the reader in understanding the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions , nor does the organization of such examples in the specification relate to a showing of the superiority and inferiority of the invention . although the embodiments of the present invention have been described in detail , it should be understood that the various changes , substitutions , and alterations could be made hereto without departing from the spirit and scope of the invention .	7
the present inventors have found that there is a phenomenon that an irradiated portion of a surface of specific glass is swollen spherically when the surface of specific glass is irradiated with a laser beam having a wavelength exhibiting a high absorption factor . the inventors have made various experiments to use this phenomenon for forming a microlens . as a result , the invention is accomplished . a method for producing a lens will be described below in connection with specific embodiments . as shown in fig1 a , an yag laser beam 30 ( wavelength : 1 . 06 μm ) is converged by a lens 40 having a numerical aperture ( na ) of 0 . 3 so that a surface of a glass substrate 10 composed of components shown in table 1 is irradiated with the converged laser beam at an irradiation output of 3 . 2 w for 3 seconds . as a result , the glass surface can be locally swollen to form a microlens shape 20 with a lens diameter of about 90 μm , a focal length of about 60 μm and a wave front aberration rms value of about 0 . 10λ ( in which a is the wavelength used ). when the laser output is selected to be in a range of from 1 . 8 w to 5 . 6 w and the laser beam irradiation time is selected to be in a range of from 0 . 1 sec . to 240 sec . in this case , a microlens having a lens diameter of from 10 μm to 500 μm and a lens height up to 70 μm can be produced . further , when irradiation is made by a plurality of times while the position irradiated with the laser beam 30 is moved , the formation of such a microlens can be repeated on one substrate . in this manner , a microlens array 24 can be produced in a short time . the movement of the irradiated position is preferably performed in such a manner that the glass substrate 10 is moved to predetermined positions successively by use of an x - y drive stage 50 or the like . a method in which the position irradiated with the laser beam is scanned by an optical unit while the glass substrate is fixed may be also used . glass used in this embodiment and composed of components shown in table 1 has such property that the linear expansion coefficient of the glass at a higher temperature than the glass transition temperature is 1 . 48 times as large as the linear expansion coefficient of the glass at a lower temperature than the glass transition temperature . the temperature of a portion of the glass irradiated with the laser beam is raised by local heating due to the laser beam so as to be higher than the glass transition temperature whereas the temperature of the periphery of the portion is kept not higher than the glass transition temperature . in this case , as represented by the ratio , the linear expansion coefficient becomes large at a higher temperature than the glass transition temperature but the linear expansion efficient of the periphery still takes a value at a temperature not higher than the glass transition temperature . as result , the heated portion is swollen outward from the glass surface , so that a convex portion is formed on the surface of the glass substrate . because glass is an isotropic material , a swelling is generated isotropically . thus , a nearly spherical swelling is obtained . because the convex portion is formed by the mechanism , the glass surface of another glass than the glass used in this embodiment can be also locally swollen by laser beam irradiation if the linear expansion coefficient of the glass at a higher temperature than the glass transition temperature is not smaller than 1 . 1 times , preferably not smaller than 1 . 35 times , most preferably not smaller than 1 . 47 times as large as the linear expansion coefficient of the glass at a lower temperature than the glass transition temperature . when a general material is used , the ratio is about 2 at maximum . although this embodiment has shown the case where the glass substrate at ordinary temperature is irradiated with the laser beam , glass may be preheated in a range of temperature not higher than the glass transition temperature . although this embodiment has shown the case where an yag laser beam ( wavelength : 1 . 06 μm ) is used as the laser beam , a laser beam may be used so that the upper and lower limits of the allowable range of the absorption factor of the used glass substrate with respect to the wavelength of the laser beam are 95 % and 30 % respectively , preferably 90 % and 35 % respectively , most preferably 77 % and 40 % respectively . an array molding tool 60 made of quartz glass and having spherical concave portions 64 each having a diameter of 250 μm and a depth of about 20 μm as shown in fig2 a is stuck to a surface of a glass substrate 10 composed of components shown in table 1 ( fig2 b ). as shown in fig1 b , an yag laser beam 30 is converged in the same manner as in embodiment 1 so that a portion of the surface of the glass substrate 10 just under one of the concave portions 64 of the molding tool 60 is irradiated with the converged laser beam 30 through the molding tool 60 . the irradiation output and the irradiation time are selected to be 3 . 7 w and 120 seconds respectively . as a result , the portion of the surface of the glass substrate 10 corresponding to the concave portion 64 of the molding tool 60 is locally swollen , so that the swollen portion is molded into a microlens shape 22 in accordance with the shape of the concave portion of the molding tool 60 . in this manner , a microlens having a focal length of 880 μm and a wave front aberration rms value of 0 . 08λ can be molded on the glass substrate . when a plurality of concave portions 64 are formed in the molding tool 60 in advance and positions corresponding to the concave portions are irradiated with the laser beam successively by a plurality of times in the same condition as described above , a microlens array 26 of only glass can be formed ( fig2 c ). when the change of the surface of the glass substrate in the irradiated position is observed just after the laser beam irradiation , a state of the change as shown in fig3 a or 3 b can be observed . in each of the cases shown in fig3 a and 3b , a small convex portion ( swelling ) 11 or 12 is generated in the position irradiated with the laser beam , in the early stage of laser beam irradiation . with the lapse of time , the swelling may advance fast in a direction perpendicular to the substrate surface as shown in fig3 a or may advance fast in a direction of the substrate surface as shown in fig3 b . in the case shown in fig3 a , the height of a convex portion 13 is limited by the molding tool . in the case shown in fig3 b , the width of a portion in which a convex portion 14 will be generated is limited by the molding tool . in each case , the swelling advances with the lapse of the irradiation time until the shape of a convex portion 15 or 16 is entirely limited by the shape of the convex portion 64 of the molding tool 60 . if the concave portion 64 is sealed hermetically in this case because the glass substrate 10 is stuck to the molding tool 60 , there is fear that atmospheric pressure in the inside of the concave portion 64 may increase to prevent molding when a swelling is generated on the surface of the glass substrate 10 . therefore , in order to form a shape along the concave portion 64 of the molding tool 60 , it is preferable that laser beam irradiation is performed after the molding tool 60 and the glass substrate 10 are stuck to each other under reduced pressure . like the above description , another laser than the yag laser may be used for irradiating a laser beam . a laser such as a co 2 laser having a wavelength band absorbed to quartz glass is however unsuitable for the case where a microlens molding tool made of quartz glass is used . the wavelength of the laser beam which can be used is selected so that transmittance of the material forming the molding tool is not lower than 70 %, preferably not lower than 85 %, most preferably not lower than 90 %. even when a general material is used , there is some case where transmittance of nearly 100 % may be obtained . when a plurality of convex portions are formed on a glass substrate to produce a lens array , sizes of the convex portions can be changed individually and variously if the irradiation time of the laser beam is changed individually in accordance with the irradiated positions or if the concave portions of the molding tool are shaped individually . accordingly , lens elements different in characteristic can be integrated and formed on a substrate . a microlens made of only glass can be produced in a short time by locally heating a glass substrate by use of a laser beam . furthermore , when a molding tool is used in combination with this method , a better lens shape can be obtained . in addition , when the laser beam irradiation is repeated by a plurality of times , a microlens array can be formed .	2
in the illustrated preferred embodiment , the obstetrics bed of the invention , shown generally at 10 , comprises a base 11 made up of a head section 12 and a foot section 13 . a first mattress section 14 fits on the head section 12 to provide support for the upper body portion of a person reclining on the assembled bed 10 . a second mattress section 15 abuts the mattress section 14 , and rests on the foot section 13 and a portion of the head section 12 , to provide support for the lower body of a person reclining on the assembled bed 10 . a headboard 16 may be attached to the head section 12 . as shown , the headboard 16 has legs 17 that are inserted into tubular receptors 18 on the head section . it will be apparent , however , that the headboard can be bolted , welded or otherwise affixed to the head section 12 by other conventional means . the head section 12 has a bottom border frame 19 made up of interconnected channel members 20 . a pair of posts 21 and 22 extend upwardly from channel members 20 at opposite sides of the bed and are interconnected at their upper ends by an angle iron brace 23 . hinges 24 on the brace 23 are fixed to the brace 23 and to a backrest shown generally at 25 . the backrest includes a box frame made up of interconnected channel members 26 and a top cover plate 27 . an angle member 28 has one leg 28a centrally fixed to channel members 26 at opposite ends of the backrest and the other leg 28b has a guide slot 29 extending essentially the full length of the leg and short spaced apart , angled slots 30 extending from the slot 29 . a generally u - shaped backrest support member 31 has a web 31a that extends through the slot 29 or a slot 30 and has ends 31b and 31c respectively journaled in sleeves 32 and 33 that are fixed to a cross brace 34 that extends between spaced apart channel members 20 . a spring 35 is connected at 36 to the backrest support member and at 36 &# 39 ; to angle member 28 . thus , it will be apparent that raising of the backrest will move the web 31a out of a slot 30 and into slot 29 . an arm 37 projects from the backrest support member 31 to the side of the bed and provides a means by which an operator can hold the web 31a out of the slots 30 and in the slot 29 as the backrest is raised and lowered . as best seen in fig7 when the backrest 25 is fully lowered to a level bed position , a channel member 26 rests on posts 38 that are fixed to and extend upwardly from a channel member 20 making up frame 19 . the head section 12 , further includes a pelvic support plate 40 attached to the brace 23 by hinges 41 . the pelvic support plate extends from brace 23 in a direction opposite to backrest 25 and has an upturned lip 42 at the edge remote from the hinges 41 . as will be further explained , the lip 42 will keep the mattress section 14 from slipping off the head section during use of the bed 10 for delivery purposes . a scissors lift 43 is mounted beneath the pelvic support plate 40 on a plate 44 mounted on posts 45 and 46 that project upwardly from a channel member 20 . an extension rod 47 has one end 48 attached to the drive shaft 49 of the scissors lift and a socket 50 at the other end journaled in a housing 51 . housing 51 is fixed to a side plate 52 that has a hole 53 therethrough opening into the housing 51 , such that one end of a crank 54 ( fig5 and 6 ) may be inserted thereinto to turn the rod 47 and the attached drive shaft 49 . rotation of the drive shaft , in conventional fashion , operates the scissors lift to raise and lower the pelvic support plate about its hinge connections . the crank 54 may be withdrawn from hole 53 and may be stored by inserting one end thereof in a hole 55 in a channel member 20 as best seen in fig1 and 4 , located beneath the backrest 25 . head section 12 includes a long cabinet extension 56 projecting from top cover plate 27 at one side of the pelvic support plate 40 and a short cabinet extension 57 projecting from the plate 27 at the other side of the pelvic support plate . both cabinet extensions are carried by the bottom border frame 19 . the side plate 52 forms an outer wall for the short cabinet extension and a side plate 58 forms an outer wall for the long cabinet extension . each cabinet extension is formed with an upwardly opening cabinet space in which items that may be used during a birth are to be stored . top plates 59 and 60 of the long cabinet extension 56 and the short cabinet extension 57 , respectively , lie in the plane of the top cover plate 27 , when the backrest 25 is in its fully lowered position . holes 61 and 62 are provided through the top plates 59 and 60 , respectively , and a socket 63 is mounted beneath each of the holes to receive a support leg 64 of a stirrup 65 , as will be further explained . caster wheels 66 are preferably provided beneath the border frame 19 at the corners thereof to facilitate movement of the head section 12 . at least some of the wheels 66 are also desirably of a locking type so that they can be fixed to immobilize the head section 12 . a partition 67 extends between the long and short cabinet extensions 56 and 57 , beneath the lip 42 of the pelvic support plate 40 . spaced apart angle members 68 and 69 are fixed to channel members 20 and provide supports and guides for a drip pan 70 . the drip pan is shallow and may be pushed fully beneath the head section 12 or may be pulled out from beneath partition 67 to collect any liquids or other materials that may drop during a birth . foot section 13 is of generally l - shape configuration . one leg of the foot section is formed as a box 72 , the top surface 73 of which is arranged to form a continuation of the top plates 59 and 60 when the foot section 13 and head section 13 are nested together , as will be further explained . the other leg of the foot section is formed from a lower fixed box section 74 and a pivotable upper box section 75 . the lower box section is fixed to and extends from a face of box 72 , at one side thereof , and the upper box section 75 is attached to box 72 by a hinge 76 such that section 75 will swing into a position overlying the section 74 , or a position extending towards the side of box 72 at which section 74 extends . the top surface 73 is preferably hinged at 77 to a wall of the box 72 so that it can be raised to permit storage of blankets 78 ( fig7 ) or other items in the box . a lip 79 extends upwardly from the free end of top surface 73 to hold the mattress section 15 in place , as will be further explained . caster wheels 80 are mounted beneath corners of the box 72 and the box section 74 so that the foot section 13 may be moved with respect to the head section 12 . the caster wheels 80 , like the caster wheels 66 of the head section are preferably of a locking type so that the foot section can be immobilized , if desired . the obstetrics bed of the invention is used either with the head and foot sections in an assembled or nested arrangement ( fig4 ) or with the foot section separated from the head section ( fig5 ). when the head and foot sections are assembled the upper box section 74 is pivoted into position overlying the bottom box section 74 and the foot section is moved to position the box sections 74 and 75 snugly between the long cabinet extension 56 and the short cabinet extension 57 , with the upper surface of box section 75 and the top surface 73 forming continuations of the top plates 59 and 60 and top cover plate 27 . the mattress sections 14 and 15 are placed in position and a full sized bed of normal bed height is provided . the bed is particularly useful in labor rooms of hospitals and the like since it provides a comfortable , easily used bed on which a woman preparing to give birth may rest . when it comes time to deliver the baby the mattress section 15 is removed and latches 81 and 82 , which lock the head and foot sections together are released . the foot section is rolled to the position shown in fig5 and the box section 75 is pivoted from over the box section 74 . the backrest 25 is raised and crank 54 is operated to pivot the pelvic support plate 40 upwardly , and to thereby raise the reinforced more heavily padded central portion 83 of the mattress section 15 that extends over the pelvic support plate . as shown best in fig3 the central portion 83 of mattress section 15 includes an extra firm foam rubber pad 84 beneath the top cover of the mattress . this insures a comfortable seat for the woman user even when the pelvic support plate is raised . the stirrups 65 , which may be stored in one of the cabinet extensions 56 and 57 , when not in use , are positioned by inserting their support legs 64 in sockets 63 , such that the woman sitting on the central portion 83 and with her back resting on the raised backrest 25 can drape her legs over the stirrups . it has been found and is well recognized that this position is highly advantageous for most deliveries . the sim &# 39 ; s delivery position can also be readily accommodated . in this position , the mother reclines on her side and in some instances it may be desirable that her top leg be raised and supported . with the backrest 26 lowered the patient can be positioned on her side , with her lower torso resting on top plate 59 . pillows , blankets or other padding can be provided on the top plate 59 as cushioning for the patient , if desired . the patient &# 39 ; s upper leg can then be raised and positioned on stirrup 65 , if necessary , during the delivery . the lower box section 74 , when positioned as shown in fig5 serves as a seat for the doctor or other person attending the delivery . it will be apparent that the means for raising and lowering of the backrest could be easily mechanized and that different kinds of lifts could be used to replace the scissors lift shown at 43 . although a preferred form of my invention has been herein disclosed , it is to be understood that the present disclosure is made by way of example , and that variations are possible without departing from the subject matter coming within the scope of the following claims , which subject matter i regard as my invention .	0
referring to fig1 , an exemplary layout 10 is shown for a residential application including a driveway 11 , a sidewalk 12 , steps 13 and a patio 14 made from different types of cast paver blocks . the illustrated layout 10 is formed from four different shaped blocks , consisting of rectangular paver blocks 15 , corner paver blocks 16 , square paver blocks 17 and triangular paver blocks 18 . although the four illustrated block shapes will work for most applications , it will be appreciated that other block shapes also may be made to meet specific application requirements . the blocks 15 - 18 are cast from concrete and , preferably , are reinforced with steel mesh or with rebar rods to provide the strength required for the application . for example , greater reinforcement will be needed for paver blocks used in a driveway 11 which must support the weight of heavy vehicles , than for paver blocks used in a patio portions of a sidewalk 12 which do not cross a driveway . the blocks 15 - 18 are cast to a desired thickness , such as 4 inches ( 10 . 2 cm ). in order to provide a pleasing appearance , the exposed top surfaces and any exposed edges of the blocks 15 - 18 may be textured , for example , to simulate natural stone . the block surfaces also may be stained or otherwise colored to more closely simulate stone using techniques which are well known in the art or to provide a desired appearance . according to the invention , the sides of the blocks which abut the sides of other blocks are provided with one or more joints 19 which engage complimentary joints on the other blocks . the joints 19 are spaced on each block side for engaging the complimentary joint 19 on an abutting block side . fig2 shows the rectangular block 15 as having two short sides 20 and 21 , each having two joints 19 , and as having two long sides 22 and 23 , each having three joints 19 . the rectangular block 15 may have , for example , a width of 4 feet ( 122 cm ) and a length of 6 feet ( 183 cm ). fig3 shows details of the corner block 16 . the block 16 is substantially trapezoidal in shape having a side 24 which is either 4 feet ( 122 cm ) or 6 feet ( 183 cm ) long , two angled sides 25 and 26 which are 4 feet ( 122 cm ) long and , for example , form an angle of 30 ° to each other , and a side 27 which is shorter than the side 24 . in order to keep the width of the block at 4 feet or the width of the rectangular blocks 15 , ends 28 of the side 24 are slightly angled . by arranging the sides 25 and 26 at an angle of 30 °, three corner blocks 16 can be used to form a 90 ° bend . if the sides 25 and 26 were angled at 45 °, two blocks 16 would be used to form a 90 ° bend . the block 16 is intended to have the sides 25 and 26 abut sides of other blocks 15 - 18 . thus , the sides 25 and 26 are each provided with two joints 19 . the center portion of the side 24 ( without the ends 28 ) may be of the same length as the side 27 , for example , either 4 feet ( 122 cm ) or 6 feet ( 183 cm ). this will allow abutting a block to the center portion of the side 24 . fig4 shows the square block 17 , which has - four sides 29 - 32 , each of which is 4 feet ( 122 cm ) long . each side 29 - 32 has two joints 19 . fig5 shows the triangular block 18 , which has two adjacent 4 feet ( 122 cm ) long sides 33 and 34 which form a 90 ° angle and a long side 35 . each of the sides 33 and 34 has two joints 19 for engaging joints on the other blocks . fig6 - 8 show details of a construction for the joints 19 . each joint 19 extends along an edge 38 of the block parallel to a top surface 39 of the block . each joint 19 consists of a projecting rib 40 and of a groove 41 sized and shaped to receive a projecting rib 40 from a joint 19 on an abutting block . preferably , the rib 40 is triangular or wedge shaped in cross section with sides 42 and ends 43 which taper to an apex 44 . thus , the sides 42 are trapezoidal shaped and the ends 43 are triangular shaped . the groove 41 has complementary tapered sides and ends which are sized to receive the rib 40 . consequently , when two joints 19 are moved into position where the adjacent sides 38 abut , as shown in fig6 , the top surfaces 39 of the adjacent blocks are moved into alignment when the rib 40 is moved into the groove 41 . tapering the ribs 40 in two directions facilitates alignment of the blocks when they are positioned to form a desired layout . in the drawings , the rib 40 and the groove 41 for each joint 19 are shown as being aligned and adjacent each other . it will be appreciated that the rig 40 and the groove 41 may be spaced from each other , so long as they have the same spacing from the top surface 39 . a lower portion 45 of the edge 38 on each block may be angled slightly inwardly from the joint 19 to a bottom 46 of the block to form an angle between the lower portion 45 and the bottom 46 greater than 90 °. optionally , a chamfer may be provided between the lower portion 45 and the bottom 46 to eliminate sharp edges which may be subject to impact damage when installing the paver block . the angled lower portion 45 serves two functions . first , it allows a relief area for any dirt or other foundation material which may be trapped between the abutting edges . second , it allows two adjacent blocks to be slightly angled relative to each other when the ground on which the blocks are placed is not level , while maintaining a tighter fit at the top of the paver block . the joints 19 are formed to have the same configuration on each side of the block which will abut a side of another block . thus , when looking at an elevational view of any block side having a joint 19 , the rib 40 will be on the left side of the joint 19 and the recess 41 will be to the right of the rib 40 . as a consequence , when any two sides are moved into an abutting arrangement , the two joints are complementary and each rib 40 will align with a recess 41 . alternately , all of the joints 19 can be made with the ribs 40 on the right and the recesses 41 on the left . the joints 19 may be omitted from edges of the cast paver blocks which will not abut an adjacent paver block , especially any of these sides which may be visible after the blocks are installed . these edges may be textured with a pattern and colored similar to the exposed top surface of the block . it will be appreciated that various modifications and changes may be made to the above described preferred embodiment of a cast concrete paver block without departing from the scope of the following claims . although a preferred construction for the joints 19 has been described , it will be appreciated that other configurations also may be used to achieve the same results . for example , the ribs 40 can be replaced with round or oval knobs and the recesses 41 can be configured to receive the knobs . also , the number of joints 19 on each side of the paver blocks may be changed to meet the needs for any particular application . the block dimensions provided herein are intended to be exemplary . it will be appreciated that the block dimensions can be modified to meet local building codes and conventional sized in the community in which the blocks are used . however , the invention is particularly useful for paver blocks having a minimum dimension of at least 3 feet ( 91 cm ) for providing larger hard surfaces .	4
fig1 depicts a lithographic system 10 in accordance with one embodiment of the present invention that includes a pair of spaced - apart bridge supports 12 having a bridge 14 and a stage support 16 extending therebetween . bridge 14 and stage support 16 are spaced - apart . coupled to bridge 14 is an imprint head 18 , which extends from bridge 14 toward stage support 16 . disposed upon stage support 16 to face imprint head 18 is a motion stage 20 . motion stage 20 is configured to move with respect to stage support 16 along x and y axes . a radiation source 22 is coupled to system 10 to impinge actinic radiation upon motion stage 20 . as shown , radiation source 22 is coupled to bridge 14 and includes a power generator 23 connected to radiation source 22 . referring to both fig1 and 2 , connected to imprint head 18 is a substrate 26 having a patterned mold 28 thereon . patterned mold 28 includes a plurality of features defined by a plurality of spaced - apart recesses 28 a and projections 28 b . projections 28 b have a width w 1 , and recesses 28 a have a width w 2 , both of which are measured in a direction that extends transversely to z axis . the plurality of features defines an original pattern that is to be transferred into a wafer 31 positioned on motion stage 20 . to that end , imprint head 18 is adapted to move along the z axis and vary a distance “ d ” between patterned mold 28 and wafer 31 . alternatively , or in conjunction with imprint head 18 , motion stage 20 may move substrate 26 along the z - axis . in this manner , the features on patterned mold 28 may be imprinted into a flowable region of wafer 31 , discussed more fully below . radiation source 22 is located so that patterned mold 28 is positioned between radiation source 22 and wafer 31 . as a result , patterned mold 28 is fabricated from material that allows it to be substantially transparent to the radiation produced by radiation source 22 . referring to both fig2 and 3 , a flowable region , such as a patterned imprinting layer 34 , is disposed on a portion of surface 32 that presents a substantially planar profile . flowable region may be formed using any known technique such as a hot embossing process disclosed in u . s . pat . no . 5 , 772 , 905 , which is incorporated by reference in its entirety herein , or a laser assisted direct imprinting ( ladi ) process of the type described by chou et al . in ultrafast and direct imprint of nanostructures in silicon , nature , col . 417 , pp . 835 - 837 , june 2002 . in the present embodiment , however , flowable region consists of patterned imprinting layer 34 being deposited as a plurality of spaced - apart discrete beads 36 of material 36 a on wafer 31 , discussed more fully below . patterned imprinting layer 34 is formed from a substantially silicon - free material 36 a that may be selectively polymerized and cross - linked to record the original pattern therein , defining a recorded pattern . material 36 a is shown in fig4 as being cross - linked at points 36 b , forming cross - linked polymer material 36 c . referring to fig2 , 3 and 5 , the pattern recorded in patterned imprinting layer 34 is produced , in part , by mechanical contact with patterned mold 28 . to that end , imprint head 18 reduces the distance “ d ” to allow patterned imprinting layer 34 to come into mechanical contact with patterned mold 28 , spreading beads 36 so as to form patterned imprinting layer 34 with a contiguous formation of material 36 a over surface 32 . in one embodiment , distance “ d ” is reduced to allow sub - portions 34 a of patterned imprinting layer 34 to ingress into and fill recesses 28 a . to facilitate filling of recesses 28 a , material 36 a is provided with the requisite properties to completely fill recesses 28 a while covering surface 32 with a contiguous formation of material 36 a . in the present embodiment , sub - portions 34 b of patterned imprinting layer 34 in superimposition with projections 28 b remain after the desired , usually minimum distance “ d ”, has been reached , leaving sub - portions 34 a with a thickness , t 1 and sub - portions 34 b with a thickness , t 2 . thickness t 2 is referred to as a residual thickness . thicknesses “ t 1 ” and “ t 2 ” may be any thickness desired , dependent upon the application . referring to fig2 , 3 and 4 , after a desired distance “ d ” has been reached , radiation source 22 produces actinic radiation that polymerizes and cross - links material 36 a , forming cross - linked polymer material 36 c . as a result , the composition of patterned imprinting layer 34 transforms from material 36 a to material 36 c , which is a solid . specifically , material 36 c is solidified to provide side 34 c of patterned imprinting layer 34 with a shape conforming to a shape of a surface 28 c of patterned mold 28 , shown more clearly in fig5 , with patterned imprinting layer 34 having recessions 30 a and protrusions 30 b . after patterned imprinting layer 34 is transformed to consist of material 36 c , shown in fig4 , imprint head 18 , shown in fig2 , is moved to increase distance “ d ” so that patterned mold 28 and patterned imprinting layer 34 are spaced - apart . in a further embodiment , recessions 30 a and protrusions 30 b of imprinting layer 34 may be formed by such techniques including , but not limited to , photolithography ( various wavelengths including g line , i line , 248 nm , 193 nm , 157 nm , and 13 . 2 - 13 . 4 nm ), e - beam lithography , x - ray lithography , ion - beam lithography , and atomic beam lithography . referring to fig6 , additional processing is employed to form a multi - layered structure 38 by forming a conformal layer 40 adjacent to patterned imprinting layer 34 . one manner in which to form conformal layer 40 is to employ imprint lithography processes , such as those discussed above with respect to depositing patterned imprinting layer 34 . to that end , conformal layer 40 may be formed from a polymerizable material similar to that described above with respect to fig3 and 4 , excepting that the material from which conformal layer 40 is formed includes silicon , i . e ., is a silicon - containing polymerizable material . conformal layer 40 includes first and second opposed sides . first side 40 b faces patterned imprinting layer 34 and has a profile complementary to the profile of the patterned imprinting layer 34 . the second side faces away from patterned imprinting layer 34 forming normalization surface 40 a . normalization surface 40 a is provided with a substantially normalized profile , by ensuring that the distances , k 2 , k 4 , k 6 , k 8 and k 10 , between the apex 30 c , shown in fig5 , of each of the protrusions 30 b and normalization surface 40 a are substantially the same and that the distance , k 1 , k 3 , k 5 , k 7 , k 9 and k 11 between a nadir surface 30 d of each of the recessions 30 a and normalization surface 40 a are substantially the same . one manner in which to provide normalization surface 40 a with a normalized profile , a planarizing mold 128 having a planar surface 128 a is employed to come into contact with conformal layer 40 . as mentioned above , this may be accomplished by moving imprint head 18 , shown in fig2 , along the z - axis , moving motion stage 20 along the z - axis , or both . thereafter , mold 128 is separated from conformal layer 40 and actinic radiation impinges upon conformal layer 40 to polymerize and , therefore , solidify the same . alternatively , conformal layer 40 may be applied employing spin - on techniques . spin - on deposition of conformal layer 40 may be beneficial when recording patterns having numerous features per unit area , i . e ., a dense featured pattern . referring to fig6 and 7 , a blanket etch is employed to remove portions of conformal layer 40 to provide multi - layered structure 38 with a crown surface 38 a . crown surface 38 a is defined by an exposed surface 30 e of each of protrusions 30 b and upper surfaces of portions 40 c that remain on conformal layer 40 after the blanket etch . referring to fig7 and 8 , crown surface 38 a is subjected to an anisotropic etch . the etch chemistry of the anisotropic etch is selected to maximize etching of protrusions 30 b and the segments of patterned imprinting layer 34 , shown in fig6 , in superimposition therewith , while minimizing etching of the portions 40 c in superimposition with recessions 30 a . in the present example , advantage was taken of the distinction of the silicon content between the patterned imprinting layer 34 and the conformal layer 40 . specifically , employing a plasma etch with an oxygen - based chemistry , it was determined that an in - situ hardened mask 42 would be created in the regions of portions 40 c proximate to surface 38 a . this results from the interaction of the silicon - containing polymerizable material with the oxygen plasma . as a result of the hardened mask 42 and the anisotropicity of the etch process , regions 44 of wafer 31 in superimposition with protrusions 30 b are exposed . the width u ′ of regions 44 is optimally equal to width w 2 , shown in fig2 . referring to fig2 , 7 and 8 , the advantages of this process are manifold . for example , the relative etch rate between portions 40 c and exposed surfaces 30 e may be in a range of about 1 . 5 : 1 to about 100 : 1 due to the presence of the hardened mask 42 . as a result , the dimensional width u ′ of regions 44 may be precisely controlled , thereby reducing transfer distortions of the pattern into wafer 31 . referring to fig1 , 5 and 11 additionally , the control of dimensional width u ′ becomes relatively independent of residual thickness t 2 . the rate at which the polymerizable fluid fills the pattern on mold 28 is inversely proportional to the cube of residual thickness t 2 . as a result , residual thickness t 2 may be selected to maximize throughput without substantially increasing transfer distortions . decoupling of the transfer distortions from residual thickness t 2 facilitates patterning non - planar surfaces without exacerbating transfer distortions . this is particularly useful when mold 28 is deformed due to external forces , such as typically occurs when varying the dimensions of mold 28 when effectuating magnification correction . as a result , deformation in mold patterned imprinting layer 34 may have a profile in which apex 130 c of protrusions 130 b are not coplanar and / or nadir surface 130 d of recessions 130 a are not coplanar . to attenuate the transfer distortions that may result from this profile , conformal layer 140 is deposited so that distances , k i , between the apex 130 c of each of the protrusions 130 b and normalization surface 140 a satisfies the following parameter : where k i min is smallest value for k i and k i max is the greatest value for k i and t 3 is the height of protrusion 130 b measured between apex 130 c and nadir surface 130 d . thus , the constraint on the normalization provided by normalization surface 140 a may be relaxed so as not to require each value of k i to be substantially identical . to that end , conformal layer 140 may be applied by either spin - coating techniques or imprint lithography techniques . thereafter , stage 20 is employed to move substrate 131 along the z - axis to compress conformal layer 140 against a planar surface , such as mold 28 . alternatively , mold 28 may be moved against normalization surface 140 a or both . finally , forming patterned imprinting layer 34 from a substantially silicon - free polymerizable fluid eases the cleaning process of mold 28 , especially considering that mold 28 is often formed from fused silica . referring to both fig1 and 2 , an exemplary radiation source 22 may produce ultraviolet radiation . other radiation sources may be employed , such as thermal , electromagnetic and the like . the selection of radiation employed to initiate the polymerization of the material in patterned imprinting layer 34 is known to one skilled in the art and typically depends on the specific application which is desired . furthermore , the plurality of features on patterned mold 28 are shown as recesses 28 a extending along a direction parallel to projections 28 b that provide a cross - section of patterned mold 28 with a shape of a battlement . however , recesses 28 a and projections 28 b may correspond to virtually any feature required to create an integrated circuit and may be as small as a few tenths of nanometers . it may be desired to manufacture components of system 10 from materials that are thermally stable , e . g ., have a thermal expansion coefficient of less than about 10 ppm / degree centigrade at about room temperature ( e . g . 25 degrees centigrade ). in some embodiments , the material of construction may have a thermal expansion coefficient of less than about 10 ppm / degree centigrade , or less than 1 ppm / degree centigrade . to that end , bridge supports 12 , bridge 14 , and / or stage support 16 may be fabricated from one or more of the following materials : silicon carbide , iron alloys available under the trade - name invar ®, or trade - name super invar ™, ceramics , including but not limited to zerodur ® ceramic . additionally , table 24 may be constructed to isolate the remaining components of system 10 from vibrations in the surrounding environment . an exemplary table 24 is available from newport corporation of irvine , calif . referring to fig1 , 2 and 5 , the pattern produced by the present patterning technique may be transferred into wafer 31 provided features have aspect ratios as great as 30 : 1 . to that end , one embodiment of patterned mold 28 has recesses 28 a defining an aspect ratio in a range of 1 : 1 to 10 : 1 . specifically , projections 28 b have a width w 1 in a range of about 10 nm to about 5000 μm , and recesses 28 a have a width w 2 in a range of 10 nm to about 5000 μm . as a result , patterned mold 28 and / or substrate 26 , may be formed from various conventional materials , such as , but not limited to , fused - silica , quartz , silicon , organic polymers , siloxane polymers , borosilicate glass , fluorocarbon polymers , metal , and combinations of the above . referring to fig1 , 2 and 3 , the characteristics of material 36 a are important to efficiently pattern wafer 31 in light of the unique deposition process employed . as mentioned above , material 36 a is deposited on wafer 31 as a plurality of discrete and spaced - apart beads 36 . the combined volume of beads 36 is such that the material 36 a is distributed appropriately over area of surface 32 where patterned imprinting layer 34 is to be formed . as a result , patterned imprinting layer 34 is spread and patterned concurrently , with the pattern being subsequently set by exposure to radiation , such as ultraviolet radiation . as a result of the deposition process it is desired that material 36 a have certain characteristics to facilitate rapid and even spreading of material 36 a in beads 36 over surface 32 so that all thicknesses t 1 are substantially uniform and all residual thicknesses t 2 are substantially uniform . referring to fig2 and 9 , employing the compositions described above in material 36 a , shown in fig3 , to facilitate imprint lithography is achieved by including , on substrate 131 , a primer layer 46 . primer layer 46 functions , inter alia , to provide a standard interface with patterned imprinting layer 34 , thereby reducing the need to customize each process to the material from which substrate 131 is formed . in addition , primer layer 46 may be formed from an organic material with the same etch characteristics as patterned imprinting layer 34 . primer layer 46 is fabricated in such a manner so as to possess a continuous , smooth , relatively defect - free surface that may exhibit excellent adhesion to patterned imprinting layer 34 . additionally , to ensure that patterned imprinting layer 34 does not adhere to patterned mold 28 , surface 28 c , shown in fig5 , may be treated with a low surface energy coating 48 . as a result , patterned imprinting layer 34 is located between primer layer 46 and coating 48 upon contact of mold 28 with substrate 131 . coating 48 may be applied using any known process . for example , processing techniques may include chemical vapor deposition method , physical vapor deposition , atomic layer deposition or various other techniques , brazing and the like . in a similar fashion a low surface energy coating 148 may be applied to planarizing mold 128 , shown in fig1 . alternatively , release properties of either patterned imprinting layer 34 or conformal layer 140 , shown in fig1 , may be improved by including , in the material from which the same is fabricated , a compound having low surface energy , referred to as a surfactant . the compound is caused to migrate to a surface of the layer formed therewith to interface with mold 28 using known techniques . typically , the surfactant has a surface energy associated therewith that is lower than a surface energy of the polymerizable material in the layer . an exemplary material and process by which to form the aforementioned surfactant is discussed by bender et al . in multiple imprinting in uv - based nanoimprint lithography : related material issues , microelectronic engineering pp . 61 - 62 ( 2002 ). the low surface energy of the surfactant provides the desired release properties to reduce adherence of either imprinting layer 34 or conformal layer 40 to mold 28 . it should be understood that the surfactant may be used in conjunction with , or in lieu of , low surface energy coatings 48 and 148 . the embodiments of the present invention described above are exemplary . many changes and modifications may be made to the disclosure recited above , while remaining within the scope of the invention . the scope of the invention should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the appended claims along with their full scope of equivalents .	7
robust , large volume plasma discharges are needed for fast start - up of low current , low power plasmatron fuel converters (“ plasmatrons ”) and for efficient operation after start - up . rapid establishment , extinction and reestablishment of the plasma discharges , combined with initiation of persistent chemical reactions by the flux of active species generated by the discharge , result in a quasi - continuous plasma discharge . the quasi - continuous plasma discharge effectively fills the discharge region and initiates chemical reactions throughout that volume . the use of electrical energy by the plasmatron to promote hydrogen producing reactions is determined , in part , by the ratio of the period of operation in the non - arcing discharge regime to the total period of plasma discharge during an average cycle of operation . thus , the plasmatron of this invention can operate in a substantially continuous manner in the non - arc discharge regime . efficient plasmatron operation is enabled by the efficient use of the electrical energy to promote chemical reactions in a given discharge region and volumetric efficiency in the percentage of chemical conversion achieved in the volume of bulk reactant fluid . efficiency is further enhanced by reducing degradation of the plasmatron , such as that caused by soot formation and electrode surface wear . efficient operation and plasmatron protection have been achieved by the present invention through the use of multiple decoupled gas flow apertures providing gas flows to perform multiple functions in the vicinity of a plasma discharge region . one application of plasmatrons involves partial oxidation of hydrocarbon fuels to produce hydrogen - rich fuels for use in internal combustion systems such as gasoline or diesel engines and their associated exhaust systems . such plasmatrons may be selected for operation between stoichiometric partial oxidation and full combustion depending on conditions and applications . during full combustion , the output of the plasmatron is a hot gas that is no longer hydrogen - rich . power for operation of the plasmatron will preferably be provided by components of the internal combustion system . referring now to the figures of the drawing , the figures constitute a part of this specification and illustrate exemplary embodiments of the invention . it is to be understood that in some instances various aspects of the invention may be shown exaggerated or enlarged to facilitate an understanding of the invention . [ 0019 ] fig1 is a cross - sectional view of a plasmatron fuel converter 10 having multiple decoupled gas apertures according to one embodiment of the invention . the term “ decoupled ” refers to the independently controlled intake and flow operations of gas flowing through multiple apertures of the plasmatron 10 . the plasmatron 10 is comprised of a structure housing a top cylindrical electrode 20 and a bottom cylindrical electrode 24 separated by an electrical insulator 22 . in a preferred embodiment , fuel 12 is atomized and introduced as a reactive mixture 16 from a nozzle 14 at the center of the top electrode 20 . fuel atomization can be achieved by appropriate nozzle 14 design with or without air assist . fuel 12 may comprise liquid fuel , gaseous fuel , or vaporized fuel . when operating with liquid hydrocarbons , fuel deposition and condensation on the inner surfaces of electrodes 20 , 24 may be reduced by employing the nozzle 14 to produce a narrow jet of fuel droplets . spray angles between 15 and 30 degrees have been shown to be sufficient . the electrodes 20 , 24 are axially aligned with the longitudinal axis of the plasmatron 10 allowing for a gap in between them to form a plasma discharge region 26 . in one embodiment the diameter of the plasma discharge region 26 is approximately 0 . 85 inches and the length is approximately 1 . 25 inches . the plasma discharge is established by supplying , via a power supply 18 , high voltage ( 300 v to 60 kv ; and resulting current in the range of approximately 10 milliamperes to 2 amperes ) in the discharge region 26 between electrodes 20 , 24 . whether in thermodynamic equilibrium or non - equilibrium , the low current non - arcing discharge is eventually elongated to the point of extinction due to current limitation , voltage limitation or geometric plasma instability . generally , the plasmatron will provide average power to the plasma in range of between 10 and 1000 watts . the electrical power consumption is generally between 0 . 3 % to 10 % of the thermal power content of hydrogen - rich gas 82 produced by the plasmatron . the cycle frequency necessary to provide a quasi - uniform plasma discharge can be provided by the selection of various electrical and fluid dynamic characteristics of the plasmatron . the power supply frequency is adjusted in the range of 100 hz to 2 mhz . by controlling the electrical and thermodynamic parameters of the plasma , the operation of this plasmatron fuel converter can be selected for high energy conversion efficiency and for selectivity in the chemical processes initiated by the volumetric ignition . in a preferred embodiment of the invention , such selectivity is for the production of hydrogen - rich gas from hydrocarbon fuel . after extinction , the plasma discharge is reestablished almost instantaneously along a different pathway between two random points on the electrodes 20 , 24 . the plasma discharge is generally reestablished in a time of less than 100 nanoseconds . depending on the selections of various operational parameters of the plasmatron , this process occurs naturally at a high frequency of plasma discharge initiation and extinction and provides quasi - uniform plasma discharge throughout the entire volume of the discharge region . the frequency of plasma discharge initiation and extinction is here termed ‘ cycle frequency ’. natural cycle frequency for a plasmatron fuel converter of the illustrated preferred embodiment will typically be on the order of several khz ( 1 - 10 khz ). the plasmatron 10 has multiple separate gas intake apertures . hereinafter , the term “ air ” will be used to refer to any gas suitable for use with a plasmatron according to the present invention . it should be noted that in other embodiments , it is also contemplated that fuel and fuel / air mixtures can be injected via the multiple decoupled apertures . in the embodiment shown , one aperture 30 is for atomization air 32 that serves to provide the air assist for the atomization process of the fuel 12 to produce the injected reactive mixture 16 . a second aperture 40 provides wall protection air 42 that allows an air stream to flow down the sides of the plasma discharge region . a third aperture 50 provides the plasma shaping air 52 that is used to stretch and move the discharge in the plasma discharge region 26 . a fourth aperture 60 provides air 62 injected downstream from the plasma discharge region that mixes the ignited fuel / air mixture . the result of the operation of the present invention is the efficient production of a hydrogen - rich gas 82 . the functions of the apertures and decoupled air flows will now be further described . the fuel atomization air flow 32 provides air assist to the nozzle 14 so as to atomize the injected fuel 12 . fuel atomization provides for uniform mixing of the fuel within the injected air / fuel mixture 16 . the wall protection air flow 42 provides a gas blanket protecting the surface of the electrodes from operational wear and reducing deposition of fuel on the electrodes . amelioration of the problems of electrode surface wear and fuel deposition improves the efficiency of the operation of the plasmatron . the plasma shaping air flow 52 provides air that shapes and moves the plasma discharge within the plasma discharge region 26 . decoupling of the air flow rate of the plasma shaping air flow 52 from the overall air flow rate allows the plasma shaping air flow to be used additionally to create turbulent air flows within the plasma discharge region 26 . the downstream mixing air flow 62 provides downstream air injected into the ignited fuel / air mixture . this additional air can correct the required oxygen / carbon ( o / c ) of the ignited fuel mixture ( for example , close to stoichiometric partial oxidation , o / c ˜ 1 ). additionally , the downstream air creates turbulence in the ignited fuel / air mixture ( either axial , radial , tangential , or any combination thereof ) that creates a uniform mixture and speeds the chemical reaction kinetics . the one or more downstream mixing channels 60 can be oriented in at any angle of declination to perform the desired mixing function . in one embodiment , the downstream mixing apertures have a diameter of 0 . 1 inches at the site of injection into the vicinity of the plasma discharge region 26 . in another embodiment , the downstream mixing fluid flow may include air flows , fuel flows and fuel / air mixture flows . the multiple decoupled gas apertures and corresponding air flows are used to perform a number of functions for improving efficiency and protecting the plasmatron . fig1 illustrates one embodiment of aperture positioning ; however , other embodiments will be known to those of ordinary skill in the art . for example , for each function performed , multiple apertures can be utilized . in the cylindrical configuration of the plasma discharge region shown , multiple apertures can be radially aligned around the axis of the cylinder . additionally , multiple downstream mixing flow apertures may be utilized to provide multiple downstream fluid flows that include air , fuel , and fuel / air mixtures . in a preferred embodiment , the flow rates of the fuel atomization air 32 , wall protection air 42 , plasma shaping air 52 , and downstream air 62 are decoupled from the overall air flow rate of the plasmatron system and may be each controlled independently . the air flow rates are preferably set to provide improved conditions for discharge and protection of the plasmatron . such conditions include filling up the volume in the plasmatron to provide improved ignition by providing intimate contact between the microdischarges and the fuel / air mixture . at lower flow rates of the plasma shaping air , the discharge is moving slowly and not filling the volume . at flow rates higher than optimal , the discharge tends to stay close to the wall leaving a dark space in the center . other conditions to enhance operation include reducing fuel deposition on electrodes , reducing electrode surface wear , and increased turbulence in the injected fuel / air reactive mixture , the plasma discharge , and the ignited fuel / air mixture , which can be affected by corresponding adjustment of decoupled air flow rates . preferred flow rates of the air flows depend in part on the electrode geometry , axial flow rate , and power supply parameters . for an electrode gap of 2 mm , and an inner diameter of the electrodes of 12 - 25 mm , a preferred flow rate of the plasma shaping gas is 2 g / s ( 100 slpm ). under these conditions , it is possible to obtain good reforming at an o / c ratio of 1 . 06 , with a power consumption of 500 w , a fuel power conversion efficiency ( heating value of reformate over heating value of fuel ) of 82 - 85 %, a hydrogen yield of 80 %, and at a fuel flow rate of 0 . 5 - 1 . 0 g / s without soot production . the electrical power level in the plasmatron discharge is 100 w - 600 w . a typical distance between nozzle and gap is 12 - 30 mm . for best performance , the fuel injection nozzle should be electrically neutral , to minimize the possibility of arcing to the nozzle . air flow rates for the other apertures may be set to match the rate of air flow for the plasma shaping air or can be independently controlled depending on desired conditions . for example , the downstream air flow rate can be adjusted to alter the downstream turbulence as desired , and / or the wall protection air flow rate can be modified depending on observed degradation of the electrode surfaces . it is also possible to optimize the geometry of the fuel injection for maximum interaction ( contact ) with the plasma discharge . if the distance between the fuel injection and the plasma discharge is too long , the fuel may strike the walls of the electrode prior to ignition . if the distance is too short , the residence time of the fuel in the discharge region is too small , or the fuel is concentrated near the axis of the device , resulting in poor ignition . in another embodiment , as shown in fig2 the mixing and atomizing of the fuel can be improved through the use of a diaphragm 70 positioned downstream from but close to the nozzle 14 . the purpose of this diaphragm 70 is to redirect the wall protection air 42 from mainly axial flow to radially inward flow , towards the fuel / air mixture stream 16 . the turbulence thus produced achieves excellent mixing of the fuel / air mixture . this prepared mixture is better suited for ignition by the downstream discharge in the plasma discharge region 26 . an advantage of this embodiment is that it allows for a substantial increase in the overall flow rate , thus allowing the plasmatron to generate increased amounts of hydrogen rich gas 82 . by careful selection of the operating parameters of the air flows 32 , 42 , 52 , 62 and the fuel 12 , the conditions for enhanced and even optimal fuel reforming chemical reactions are achieved . the air - fuel ratio , and thus the o / c ratio , can be varied from as low as an o / c ratio = 1 to as high as an o / c ratio = 2 for liquid hydrocarbon fuels with a composition of ( ch 2 ) n , and preferably the o / c ratio will be in the range of 1 . 0 to 1 . 2 . the volumetric ignition feature of the present application is very useful in achieving high volumetric efficiencies and high electrical efficiencies under conditions of reduced chemical reaction persistence and / or propagation . such conditions occur in very fuel rich environments characteristic of partial oxidation reformation of hydrocarbon fuel , where chemical initiation at any individual site in the discharge region is difficult to initiate and maintain because of very slow ‘ flame ’ propagation speed . in another embodiment , the fuel atomization aperture 30 and wall protection air aperture 40 may be combined to provide for one flow that serves to control the spray angle of the nozzle and provides wall protection functions . fig3 is a cross - sectional view of a plasmatron wherein a portion of the wall protection air 42 is diverted to aid in preparing the fuel / air mixture 16 . the atomization air aperture is eliminated , its function being replaced by redirected wall protection air 42 flowing through aperture 40 . channels 80 for redirecting the wall protection air 42 allow some of the flowing air to flow down the sides of the plasma discharge region 26 while some of the flowing air is used as air assist for fuel atomization . to produce fine atomization of liquid fuels , and good uniform mixing , it is advantageous to use low pressure air assist with a pneumatic nozzle . the low pressure air cools down the nozzle and decreases the spray angle . in order to achieve fuel flow rate control , it is beneficial to use pulsed control ( fuel flow control by adjusting valve open duty cycle ). this allows fuel control while maintaining constant fuel pressure , as is the case in vehicles today . if a pulsed injector is used to introduce fuel directly into the plasmatron discharge region , the fuel / air composition is far from homogeneous , and soot formation occurs . improved atomization can be achieved by using pneumatic nozzles ; however , pneumatic nozzles have the disadvantage that they operate properly at very limited flow rate ranges . [ 0036 ] fig4 is a schematic view showing the combination of a pneumatic nozzle 90 utilizing atomization air 32 intake with a pulse solenoidal valve 92 for control of the fuel 12 intake . the pneumatic nozzle 90 produces a constant fuel / air mixture 16 flow despite the pulsing flow rate of the fuel 12 . by combining the pneumatic nozzle 90 with the pulse solenoidal valve 92 ( for fuel control ), it is possible to obtain good fuel atomization in a wide range of fuel flow rates . in order to flow the air through the plasmatron , a pressure gradient is formed across the plasmatron . one method to produce a pressure gradient is to compress the air through the use of a compressor or turbine , for example , as found in an automobile engine . another method involves using an engine - produced vacuum . although operation with hydrogen will decrease the throttling required by the engine , it is likely that there may still be some throttling . in this case , the vacuum can be used to produce the required flow . further , it is possible to adjust one or more valves or controllers upstream from the plasmatron to control the air flow rate provided to the plasmatron and the multiple decoupled gas flow apertures , independent of engine condition . fig5 is a schematic view showing the utilization of a valve system controlling decoupled air flows independent of engine condition to multiple intake apertures according to one embodiment of the invention . an engine 100 provides a pressurized air source . the pressurized air flows through a control system of valves 110 that may control delivery and decoupling of air flows 32 , 42 , 52 and 62 to the intake apertures 30 , 40 , 50 and 60 . the present invention allows for the operation of the system at a low pressure , for example at around 6 psi , which is achievable by a compressor or turbine within the engine 100 . the valve system 110 and / or the designs and dimensions of the multiple intake apertures 30 , 40 , 50 and 60 provide air flows that are decoupled from the overall operational pressure of the plasmatron , and hence provide enhanced control of the plasmatron system . in another embodiment , multiple stage ignition of the injected reactive air / fuel mixture 16 can be utilized . in the first stage , ignition of air / fuel mixtures at a first o / c ratio is followed by secondary injection of a mixture with a different o / c ratio . in a preferred embodiment , a first stage mixture has an o / c ratio substantially higher than 1 ( for stoichiometric partial oxidation ), followed by a mixture with o / c smaller or close to 1 , so that the overall o / c ratio is close to 1 . one goal of this embodiment is to create a flow rate with very high temperature reaction products that can be used to ignite the secondary mixture of air / fuel . the flow rate through the first stage could be substantially smaller than flow rates of injection downstream . in another embodiment , the first stage serves as an air preheater , by combusting a small fraction of the fuel , with o / c ratio higher than 1 , and then injecting additional air to result in elevated air temperature . additional fuel is injected into the hot gas for rapid vaporization of the fuel . the total mixture is then ignited by the plasmatron . the air in the first stage may be electrically preheated to make ignition of the fuel / air mixture in the first stage more robust . only a very small volume of air needs to be preheated , reducing the required electrical power . another embodiment is to have the o / c ratio close to pyrolysis in the first stage to minimize the peak temperatures of the product gases . additional air and fuel can then be injected downstream from the ignition by other flow injection apertures . for efficient operation of the plasmatron , following ignition in the discharge region , the fuel / air stream ignited by the plasma discharge can be introduced downstream into a reactor for the production of hydrogen - rich gas . the plasmatron reactor includes two regions , a homogeneous zone without a catalyst , and a heterogeneous region with a catalyst . in the homogeneous region , initial conversion of the fuel / air mixture occurs , with complete reduction of all oxygen . in this manner , the absence of free oxygen in the heterogeneous region avoids generation of hot spots in the catalysts and subsequent deterioration of the catalyst . the o / c ratio of the homogeneous region could be monitored through temperature measurement , as well as monitoring the air and / or fuel flow rates . for further improved efficiency , the energy consumption of the plasmatron may be decreased by using a heat exchanger to preheat the air flows , the fuel , and the fuel / air mixture . the heat exchanger allows for decreasing the temperature of the hydrogen - rich gas injected into an engine &# 39 ; s inlet manifold . also , by preheating , it is possible to decrease the power of the plasmatron necessary to reform the fuel at a given fuel flow rate . alternatively at a constant level of plasmatron power the heat exchanger makes it possible to reform a higher flow rate of fuel . additionally , to further decrease the start up time , part of the hot hydrogen rich gas reformate output from the plasmatron can be recirculated back into the plasmatron , and potentially premixed with any of the air flows . hydrogen rich gas recirculation increases the ease of the reforming operation , due to the much greater volumetric ignition rate (‘ flame speed ’) of the hydrogen . in this configuration , the equilibrium of the reformate is not changed , but the kinetics of the partial oxidation reaction could be dramatically increased . the hot recirculated hydrogen rich gas 82 can also help in quickly raising the temperature needed for start - up . it is desirable to be able to operate the plasmatron fuel converter at varying throughputs of hydrogen - rich gas . in addition , in order to obtain the highest efficiency , it is desirable to operate the plasmatron fuel converter with an oxygen to carbon ratio o / c close to 1 ( stoichiometric for partial oxidation ). in one embodiment , in order for the plasmatron fuel converter to produce hydrogen - rich gas with an o / c ratio close to 1 in a broad range of fuel flow rates , the plasmatron should operate in the following way . to obtain appropriate atomization of the liquid hydrocarbon fuel ( gasoline , diesel , etc ), a constant atomization air flow should be maintained . the wall protection air flow and tangential plasma shaping air flow are then decreased monotonically to decrease the fuel flow rate , in such a way that the total o / c ratio is maintained close to 1 . the longer residence times due to lower flow rates balance the inhomogeneous distribution of the plasma in the volume , which is a direct result of decreased plasma shaping air . with decreased velocities due to smaller flow rate , the contact time of air - fuel mixture with the discharge is still significant to provide good conditions for fuel ignition . the variation of wall protection and plasma shaping air flows and maintaining atomization air flow constant could provide production of hydrogen rich gas at o / c ˜ 1 without any soot formation . dynamic ranges have been demonstrated from 10 to 40 kw thermal power of the reformate in our experiments . in another embodiment , a voltage transformer may be incorporated into the plasmatron . this integration can be achieved by miniaturization of the transformer , possibly by the use of rf frequencies . the use of the high voltage transformer close to the plasmatron allows for increased safety by removing high voltage from everywhere except internal to the plasmatron and for decreased electromagnetic radiation ( emi ) which could interfere with other electrical systems . by operating at higher frequencies , it is possible to decrease the size of the transformer substantially , with the cross sectional area of the transformer scaling approximately inversely with the frequency , and the size of the transformer scaling strongly with the frequency . in another embodiment , a plasmatron fuel converter according to the present invention may be configured to allow for the efficient reformation of other liquid fuels , such as diesel fuel . diesel fuel is harder to reform than gasoline because of the higher viscosity and evaporation characteristics of the fuel . in this embodiment , it is possible to obtain efficient reforming of diesel and other hard - to - reform liquid fuels at an o / c ratio close to stoichiometry for partial oxidation ( o / c ˜ 1 ) without noticeable soot formation . the steps to achieve this goal are : ( 1 ) effectively atomize the liquid fuel to droplet sizes on the order of 10 - 30 microns in diameter ; and ( 2 ) provide sufficient power density in order to ignite the air / fuel mixture . the first step for effectively atomizing the fuel can be provided by proper design of a nozzle with decreased orifice diameter , for example , from 2 . 5 mm (˜ 100 mils ) used for the case of the gasoline plasmatron to 1 . 25 mm (˜ 50 mils ) for the case of hard - to - reform liquid fuels . in addition , atomization is further improved by air assist atomization including increased air pressure and associate air velocities ( from 5 - 10 psi in the case of the gasoline plasmatron to ˜ 50 psi in the case of hard - to - reform liquid fuels ). the second step is achieved by decreasing the inner diameter of the plasmatron electrodes , for example , from 21 . 8 mm ( 0 . 86 in ) for the case of the gasoline plasmatron to 10 . 2 mm ( 0 . 4 in ) for the case of hard - to - reform liquid fuels . in addition , the distance from the electrode gap and the end of the bottom electrode is decreased . since the electrical power level and the air / fuel flow rates are comparable to the gasoline plasmatron , the decreased volume results in increased power density . [ 0050 ] fig6 is a cross - sectional illustration of a plasmatron 10 adapted for operation with diesel fuel or other hard - to - reform liquid fuels . as shown , nozzle 14 has a smaller orifice diameter than that of a gasoline plasmatron . further , electrodes 20 and 24 have decreased inner diameters and the distance between the electrode gap and the bottom electrode 24 is decreased , resulting in a plasma discharge region 26 having decreased volume . ( compare , for example , fig1 ). other embodiments of the invention will be apparent to those skilled in the art from a consideration of the specification or practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with the true scope and spirit of the invention being indicated by the following claims .	1
a person of ordinary skill in the art will appreciate that the present invention may be implemented in a variety of software and hardware configurations . it is believed , however , that the invention is described best as a computer program that configures and enables one or more general - purpose computers to implement the novel aspects of the invention . “ computer hardware ” or “ hardware ,” refers to any machine or apparatus that is capable of accepting , performing logic operations on , storing , or displaying data , and includes without limitation processors , memory and other physical devices . “ computer software ” or “ software ,” refers to any set of instructions operable to cause computer hardware to perform an operation . software includes a “ computer program ” or “ program .” a “ computer program ” or “ program ” includes any software operable to cause computer hardware to accept , perform logic operations on , store , or display data . a computer program may , and often is , comprised of a plurality of smaller programming units , including without limitation subroutines , modules , functions , methods , and procedures . the functions of a computer program may be distributed among a plurality of computers and computer programs . a “ client initiator ” includes any device that requests input / output ( i / o ) operations . “ input / output ( i / o )” includes any data transfer to or from a computer . an “ input / output virtualization ( iov ) adapter ” means a hardware adapter capable of being shared by multiple system images . the hardware is a collection of virtual functions and physical functions . an iov adapter implements serial attached scsi ( sas ) for persistent storage . a “ logical unit number ( lun )” means a logical entity that converts storage into logical storage space . luns differentiate between different blocks of storage . “ persistent storage ” means the ability of a device to maintain data even when the device is turned off . a “ physical function ( pf )” is a component of iov hardware that allows connectivity to storage , but does not provide a direct method for an si to initiate an i / o request . the si communicates through a vf to the pf . a “ physical identification ( pid )” is an element of the lun table used to identify a physical data storage segment within a persistent storage device . a “ physical lun ( plun )” is an element of the lun table used to identify a physical location for a data storage logical unit within a persistent storage device . a “ root complex ” means the beginning of the connection from the i / o or i / o system to the cpu and memory . a “ system image ( si )” includes both an operating system , and an operating system in combination with applications . a “ si n ” is the n th selected system image among a plurality of system images si 0 to si n - 1 . a “ virtual function ( vf )” is a component of an iov hardware adapter that provides sufficient logical capabilities to allow an si to communicate through the pf . a “ vf n ” is the n th selected virtual function among a plurality of virtual functions vf 0 to vf n - 1 . a “ virtual identification ( vid )” is an element of the lun table used to logically identify a physical block data storage location . a “ virtual lun ( vlun )” is an element of the lun table used to logically identify a logical unit of data storage . an exemplary network of computer hardware , is depicted in fig1 a . a “ network ” comprises any number of hardware devices coupled to and in communication with each other through a communications medium , such as the internet . a “ communications medium ” includes without limitation any physical , optical , electromagnetic , or other medium through which hardware or software can transmit data . for descriptive purposes , exemplary network 100 has only a limited number of nodes , including nodes for a workstation computer 105 , a workstation computer 110 , a server computer 115 , and a persistent storage 120 . a network connection 125 comprises all hardware , software , and communications media necessary to enable communication between network nodes 105 - 120 . unless otherwise indicated in context below , all network nodes use publicly available protocols or messaging services to communicate with each other through network connection ( or “ fabric ”) 125 . the lun table 360 is typically stored in a memory 220 as schematically illustrated in fig2 a . the term “ memory ,” as used herein , includes without limitation any volatile or persistent medium , such as an electrical circuit , magnetic disk , or optical disk , in which a computer can store data or software for any duration . a single memory may encompass and be distributed across a plurality of media . further , lun table 360 may reside in more than one memory distributed across different computers , servers , logical partitions , or other hardware devices . the elements depicted in memory 220 may be located in or distributed across separate memories in any combination , and lun table 360 may be adapted to identify , locate , and access any of the elements and coordinate actions , if any , by the distributed elements . thus , fig2 a is included merely as a descriptive expedient and does not necessarily reflect any particular physical embodiment of memory 220 . as depicted in fig2 a , though , memory 220 may include additional data and programs . of particular import to the lun table 360 , memory 220 includes “ lun program 400 , “ data file ” 260 , “ mapping file ” 270 , and a “ record file ” 280 . as illustrated , lun program 400 accepts programming instructions for the lun table 360 . the lun program 400 may use and record data in a data file 260 and a record file 280 to generate lun table mapping instructions in a mapping file 270 . lun table 360 may be implemented as computer software , or it may be implemented as firmware stored in a computer hardware device , including an iov adapter as described below . fig2 b depicts another memory 230 associated with an iov adapter . memory 230 receives lun table mapping instructions through a lun interface 410 . the lun interface 410 populates the data points in the lun table 360 . fig3 a schematic flow diagram of lun table 360 deployed within an iov adapter 330 to implement sas for persistent storage 370 for multiple system images ( si n ) 310 . the iov adapter 330 may be included within a pcie manager . the masking / mapping starts ( 300 ) when initiator 305 issues an i / o request to si n 310 . si n 310 data is sent via input / output requests through input / output virtual ( iov ) adapter 330 . iov adapter 330 includes one or more virtual functions ( vf ) 340 , a physical function ( pf ) 350 , and a lun table 360 . these components communicate to ensure secure storage and retrieval for si n 310 , within storage appliance 370 . si n 310 communicates via input / output requests with vf n 340 . vf n 340 allows si n 310 to initiate communication through pf 350 . pf 350 provides a specific connection with storage appliance 370 . lun table 360 designates specific storage locations within storage appliance 370 for si n 310 . si n 310 data is stored within storage appliance 370 , in designated discrete physical and virtual logical units plun n and vlun n . in the example of fig3 , vlun 0 is associated with plun 1 and vid 1 is associated with pid 1 380 , and vlun 1 associated with plun 0 and vid 1 is associated with pid 2 390 . the designation of specific storage locations by a lun table 360 prevents interference or distortion of si n 310 data by other system images . the exemplary lun mapping / masking table 360 is reproduced from fig3 in the following table 1 : in this example the lun table represents the n th system image or si n and n th virtual function or vf n . in practice , table 1 includes data points for each virtual function vf 0 to vf n - 1 . each vf n is represented by two rows of data points as illustrated in table 1 and fig3 . the i / o requests from each si n 310 are mapped to a protected block 380 , 390 of storage device 370 . the response to the requests is returned by the same path to the si n 310 . the system enters and exits through the client initiator 305 . the association of vlun , vid , plun and pid illustrated in fig3 and table 1 is by way of example to show how lun table 360 may be populated to define associations . these associations may be hardwired , contained in firmware or “ flash ” memory , or they may be programmed by an administrator . these associations may also be adjusted by other software or hardware if necessary for fault correction or system optimization as long as the isolation of each si n is maintained . the lun table 360 may be pre - programmed as illustrated in fig4 . programming starts ( 401 ) by accessing the lun program 400 stored in memory 220 ( 400 ). lun data points are entered into the data file 260 of memory 220 ( 405 ) until the lun data points entry is complete ( 407 ). when all of the lun data points are entered , the updated lun table data is stored in a mapping file 270 on memory 220 ( 410 ). memory 220 accesses the lun interface 415 of memory 230 ( 415 ). the stored lun table 360 is populated with the stored lun table data through the lun interface 415 ( 420 ). the record file 280 on memory 220 is updated with the new lun table version 280 ( 430 ) and the lun program ends ( 403 ). the programming of the lun table may be hard wired , contained in a flash or other persistent memory , or enabled by software . the programming software may include automated steps to modify the lun table in response to changing system requirements . it will be understood from the foregoing that various modifications and change may be made in the preferred embodiment of the present invention by those skilled in the art without departing from its true spirit . it is intended that this description is for purposes of illustration only and should not be construed in a limiting sense . the scope of the invention should be limited only by the language of the following claims .	6
referring to the drawing , wherein like numerals represent like parts throughout the several views , there is generally disclosed at 10 an apparatus for unloading poultry . while it may be used for any poultry , it is useful for use with large turkeys over 30 pounds and especially for heavier turkeys which may be 40 - 45 pounds . as the average weight of turkeys is increasing yearly , it is anticipated that this invention will be even more important as the turkeys become larger . the apparatus includes a plurality of conveyors 11 - 20 shown schematically in the figures as only belts . however , the mechanical mechanisms to construct a conveyor are well known in the art and are accordingly not shown . conveyers 11 and 15 are utilized for unloading the poultry from the coops . transfer conveyors 12 , 13 , and 14 are utilized to move the poultry from conveyor 11 to conveyor 16 . the poultry from conveyor 15 are also moved to conveyor 16 where the poultry from conveyors 11 and 15 are combined . it is noted that conveyor 12 is inclined upward and conveyor 14 is inclined downward . this is to enable the conveyors to go up and over to allow clearance for the truck that is driven into the unloading bay . conveyors 16 , 17 , and 18 go through the gas stun vessel 25 and exit to a transfer conveyor 19 which brings the poultry to the shackling conveyor 20 . as can be seen in fig1 conveyors 11 - 15 are covered to provide a dark tunnel to transfer the poultry , thereby having a calming effect on the poultry . the majority of conveyor 16 is covered by the first section 26 of the stun vessel 25 . the conveyor 17 is covered by the second section 27 of the gas stun vessel 25 and finally the conveyor 18 is covered by the third section 28 of the gas stun vessel 25 , thereby also providing a dark environment for the poultry as they are rendered unconscious by co 2 . conveyor 12 is covered by a housing having sides 12a , top 12b , and side 12c . the bottom of the conveyor 12 acts as a sufficient blockage for light and a separate bottom is not necessary , although one may be utilized , if desired to further reduce the light . similarly , conveyor 14 has a housing which comprises sides 14a , top 14b , and side 14c . conveyor 13 also has a housing comprising a side 13a , top 13b , and a second side ( not shown ) similar to 12c . again , bottoms are optional for conveyors 13 and 14 . the housing for conveyors 12 , 13 and 14 act as a housing to confine the poultry and also to make the transfer of the poultry in a dark environment . the housings may be made of any suitable material which is light impervious , such as metal which includes steel . the housing around conveyors 1 and 5 is shown in fig1 and 4 . the housings around the conveyors 11 and 15 are similar and therefore only one will be described in detail . however , it is understood that the other is identical , except for being a mirror image of the other . the housing comprising an outside side 11a operatively connected to a sloping top 11b . the side 11a is constructed of a material similar to that of the housings for conveyors 12 - 14 . the top 11b is an open mesh wire that is covered by light impervious material such as cloth or belting 11c . the conveyor 11 is supported on a platform 11d . the platform 11d has an extension 11e which extends away from the inside of the conveyor toward the loading bay . a toe board 58 extends upward from the extension 11e . the extension 11e also provides a platform for the workers to stand on as they are unloading the poultry . a bottom 11f is operatively connected to the side 11a and is positioned between the conveyor belt 11 and the return roller 11g . the inner side of the conveyor housing is constructed from a flexible belt material such as a habasit belt number snb - ae . the belt 11h has slits which extend all the way to the bottom from just proximate the top 11b . with such a construction , the turkeys are able to enter the housing to the conveyor 11 by simply forcing the individual sections of the belt 11h upward , as shown in fig4 . then , as the poultry moves , the belt segments 11h are able to go back down to their vertical position forming a side which confines the poultry . while it is true that the poultry could exit the housing in a similar manner , with the darkness inside of the conveyor it has been found that the poultry do not try to escape and the belt 11h acts as a suitable confinement structure . support posts 11i are positioned at suitable intervals along the inner side to give sufficient support . a chute , generally designated 35 is operatively connected to a track which is in turn operatively connected to the inner side of the conveyor housing for conveyor 11 and 15 . since the chutes and tracks are identical , except for being mirror images thereof , only the chute and track for conveyor 11 is shown in fig4 . the chutes and track are not shown in fig1 for clarity purposes . however , it is understood that they would normally be seen in fig1 the same as shown in fig4 . a cross member 36 is operatively connected to the supports 11i across the inner portion of the conveyor 11 . the track is operatively connected to the cross member 36 by a suitable means , such as welding . the track comprises a first l - shaped member 46 and a second l - shaped member 47 . as will be discussed more fully hereafter , the l - shaped members 46 and 47 provide a guide path for guiding the chute 35 . the chute 35 comprises a first generally vertical member 37 . attached to the vertical member 37 is a ratable wheel 38 . the wheel is attached by a suitable means such as a stub axle 39 . an upper guide wheel 40 is operatively connected to the vertical member 37 by a connecting member 41 . the upper guide wheel 40 has a stub axle 40a which connects it to the connecting member 41 . a first inclined chute member 42 is operatively connected to a longer second incline chute member 43 by means of a hinge 44 . together , the incline chute members 41 and 42 form a surface on which the poultry may slide down . the chute members 42 and 43 are generally planar on their top surface . however , it is understood that other suitable surface configurations may also be utilized . the chute member is typically as wide as the door in the coops , or approximately 3 feet wide . the chute 35 is thereby adapted to be moved along the length of the conveyor 11 , which allows the chute to unload coops along the length of the trailer 70 . the chute 35 includes a hinge 44 so that as the trailer is raised up on a jack to allow the next lower level of coops to be unloaded , the second incline chute number 43 may be pivoted upwards so that there is additional clearance between the end of the chute 43 and the coops . this is necessary because the end of the chute 43 is typically positioned very close to the coops 71 . as the trailer is raised , it is necessary that the chute be moved away from the trailer so as not to interfere with the upward movement . the hinge chute allows this to easily be accomplished . the hinge also allows the chute to be moved out of the way when a worker wants to walk between the chute and coops . a spacer 57 is positioned by the track to prevent the poultry from being caught in the open space before the conveyor 11 . it is also understood that some unloading systems , such as the ride - a - track system keeps the truck stationary and indexes the shackle line . one skilled in the art would know how to utilize the present invention with such a system . the co 2 stun vessel 25 , as previously indicated , has three sections 26 - 28 . each of the sections has two sides , a top and bottom operatively connected to form a substantially gas tight enclosure . the only openings are the exit 29 and entrance 30 . as can be seen , the first section is inclined downward and the third section is inclined upward . this places the center section 28 at a lower elevation . since co 2 is heavier than air , the co 2 will tend to congregate into the lower section 27 and will a lesser tendency to go out the entrance 30 or exit 29 . however , since there would be a tendency for some of the co 2 to possibly escape , three flexible doors are positioned at both the entrance 30 and the exit 29 . the flexible doors 31 are all similarly constructed . the doors are constructed from the same material as the inner side of the conveyor housing for conveyors 11 and 15 . that is , it is a length of flexible belt that has a plurality of vertical slits extending from proximate the top to all the way to the bottom . this allows for the poultry to enter and exit while still being transported on the conveyors but still acts as a barrier to the exiting of the co 2 . the flexible doors 31 are spaced at an appropriate interval , such as one foot , to allow the outer door to close behind the poultry before the front of the poultry pushes the inner flexible door open . the controls for the co 2 are shown schematically in fig6 . a co 2 storage tank and refrigeration unit 80 is in fluid communication with a co 2 vaporizer 81 by a one inch co 2 line 82 . a pressure regulator 83 is in fluid communication with the co 2 vaporizer by means of line 84 . typically , the pressure out of the co 2 vaporizer 81 is approximately 300 psi . the pressure regulator 83 brings this pressure down to approximately 90 psi as the co 2 travels through line 85 to a co 2 control valve 86 . a blower 87 has an intake 88 with a manual damper 88a connected by a line 89 . the intake 88 allows for fresh air to be available to the blower 87 . the output of the blower 87 is in fluid communication with a line 90 . the line 90 also has a co 2 input through line 91 which is in fluid communication with the co 2 control valve 86 . the output from the blower 87 and the line 91 are then combined and travel through line 92 to a static mixer 93 . as the combination of air and co 2 goes through the static mixer 93 , the air and co 2 are mixed to provide an even distribution of the co 2 and air . this then exits the static mixer 93 through output line 94 which is in fluid communication with the stun vessel 25 . the line 94 is in fluid communication with the second section 27 at three locations . three suitable fittings ( not shown ) are connected to the middle section 27 and the line 94 connects to all three of the fittings . this allows for the gas in line 94 to enter the stun vessel 27 at any of the three locations . each fitting may be opened or closed to allow for the proper flow of co 2 and air into the stun vessel 27 . typically , the gas combination would enter the fitting closest to the first section 26 to make certain that there is a good concentration of co 2 at that point . however , if due to the configuration of the stun vessel and co 2 supply , it is advantageous to move the entrance to one of the other two fittings it may easily be done by opening the other fittings and closing the fitting closest to the section 26 . the stun vessel 25 has a plurality of doors in sections 26 - 28 . the doors are to provide access to the interior of the stun vessel 25 so that maintenance may be done . also , they allow for openings into which a sample line may be run , as will be described more fully hereafter . the doors 32 may take one of many suitable configurations as long as they provide for a gas - tight seal . as shown in fig6 the doors 32 have a front panel 33 attached to the gas stun vessel 25 by means of a hinge 34 . latches 59 are provided to secure the front panel 33 in a closed gas - tight position . a gasketing material may be positioned between the front panel 33 and the stun vessel 25 so as to ensure a gas - tight fit . proximate the exit of section 28 is located a recycle line 95 which is in fluid communication with the top of the third section 38 by a suitable means such as a fitting . the other end of the line 95 is in fluid communication with an air filter 96 . the outlet of the air filter 96 is in fluid communication with the line 89 by means of a line 97 . similarly , another recycle line 98 is in fluid communication with the first section 26 proximate the entrance . the second end of the line 98 is also in fluid communication with the air filter 96 . a plurality of sample ports ( not shown ) are positioned throughout the stun vessel 25 . the ports are releasably connected to a sample line 99 . this allows the sample line 99 to be connected to any one of the sample ports to allow various areas to be sampled . the sample line 99 is connected to a ranarex gas analyzer 100 . the co 2 mixture in the sample is then analyzed in the gas analyzer 100 and an electrical output is transmitted to the honeywell truline recorder with controller 101 by means of an electrical connection 102 . the controller 101 is electrically connected to a honeywell i / p transducer 103 by means of an electrical connection 104 . the transducer converts this to an output in psi and is operatively connected to the control valve 86 by means of connection 105 . the control mechanism for the co 2 along with the stun vessel 25 provides for an effective means to stun the poultry and render the poultry unconscious by the time poultry exit the stun vessel 25 . the co 2 is supplied to the control valve 86 . the amount of co 2 which is allowed to pass through the control valve co 2 is dependent upon the sample of the gas mixture inside of the stun vessel 25 . this input comes through sample line 99 and controls the control valve 86 to meter the correct amount of co 2 into line 91 . the co 2 gas mixture inside of the stun vessel 25 is recycled through recycle lines 95 and 98 to the blower 87 which takes this combination of recycled co 2 gas mixture and mixes it with fresh air through the intake 88 . the output from the blower 87 into line 90 is then mixed with the co 2 coming out of line 91 into line 92 . the co 2 and gas mixture coming from line 90 is thoroughly mixed within the static mixer 93 . the static mixer 93 may be a suitable mixer , such as koch model smvl , but typically the mixer 93 has a plurality of baffles to make the gas turbulent to fully mix the gas . applicant has found that a mixture of 40 % co 2 and 60 % air is best . by having a good mixture of the air in the co 2 supplied to the poultry , the poultry breath the co 2 mixture and do not struggle because they can not distinguish this from normal air . if the concentration of co 2 becomes too high or approaches 100 %, the poultry can sense that they are not breathing proper air and begin to struggle . the control valve 86 , transducer 103 , controller 101 , gas analyzer 100 are well known in the art to control the amount of co 2 . the damper 88a of the fan is manually adjusted for fresh air . a second gas analyzer ( not shown in fig6 ) may be utilized for sampling various points inside of the stun vessel 25 . the readings from this gas analyzer may be used to determine where the line 94 may be used to adjust where the line 94 enters the stun vessel 25 . when the poultry exits the stun vessel 25 they are transferred to a transfer conveyor 19 which in turn transfers the poultry to the shackle line , generally designating it as 50 . the shackle line 50 is shown in fig5 . only one turkey is shown in fig5 but it is understood that there would be a number of turkeys or poultry being transferred from conveyor 19 through conveyor 20 . a first worker ( not shown ) would stand next to the conveyor 19 and position the birds to a position as shown in fig5 . then , another worker would take the birds &# 39 ; legs and place them into shackles 51 . the shackles 51 are well known in the art and have two u - shaped members 52 and 53 which form a slot for receiving the legs of the poultry . the shackles are connected to an overhead line ( not shown ) and the shackles move in a downward direction as well as in the direction of the conveyor 20 until they are in position for receiving the legs of the poultry . then , the shackles continue on in the direction of the conveyor 20 and then begin to move upward so that the poultry is hanging by its feet . the shackled poultry then go to an electric stun device 72 and then to a killer 73 . the electrical stun 72 and killer 73 are well known in the art and may be in a suitable unit such as a simmons model sf7000 and simmons model sk5 . in operation , the trailer 70 having a plurality of coops 71 is brought into the unloading bay , as shown in fig3 . there are typically two coops across the width of the trailer . one side of the trailer is unloaded to conveyor 11 and the other side is unloaded to conveyor 15 . also , there are a plurality of levels of coops on the trailer . as shown in fig3 there are five levels of coops . the chutes are designed so that the end of the second incline chute 43 is just below the door opening in the top level of the coops . then , after the top level has been unloaded along the length of the trailer , the trailer is indexed upwards by means of jacks ( not shown ) until the end of the second incline chute member 43 is positioned proximate the opening of the doors in the second level of coops . the unloading of each side is identical and therefore the unloading onto conveyor 11 will be described in more detail as shown in fig3 and 4 . as the trailer 70 is initially brought into the loading bay , the chute 35 is rotated about hinge 44 to bring the end of the chute member 43 away from the trailer . then , once the trailer 70 is in position the chute member 33 is pivoted downward to the position as shown in fig3 and 4 . this provides for a continuous surface for the poultry to slide down . the extension platform 11e provides a platform on which the worker may stand while unloading the poultry . the worker opens the door of the coop 71 and then reaches into the coop 71 and urges or pulls the poultry onto the chute 43 . the poultry then slides down the chute 43 onto the conveyor 11 through the slit belting 11h . it is not necessary that the poultry be lifted as it is only necessary that they be slid out of the coop and onto the chute 35 where gravity then finishes the transfer onto the conveyor 11 . once the end coop 71 is unloaded , the chute 35 is pushed along the length of the track until it reaches the next coop . then the process of unloading the poultry is repeated in that coop . the chute 35 is continued to be indexed down the length of the track until it reaches the end coop . then , the chute member 43 is pivoted upwards and the trailer is indexed upwards and the same process is repeated for the second level of coops . the poultry is then in the confined housing of either conveyor 11 or 15 . from conveyor 11 , the poultry is transferred to conveyor 12 with its enclosed housing to again provide a dark environment . upon transfer to conveyor 13 the poultry is also again in a closed dark environment as it is when it is transferred to the conveyor 14 . at this time , the poultry is transferred from the conveyor 14 to conveyor 16 . at the same time , poultry is being deposited onto conveyor 16 through conveyor 15 . therefore , both sides of the trailer are unloaded and the poultry all ends up on conveyor 16 which enters the stun vessel . as the poultry enter the stun vessel 25 through the flexible doors 31 , they begin breathing the 40 % co 2 air . the speed of the conveyors 26 , 27 , and 28 is timed so that by the time the poultry exit through the flexible doors 31 at the exit 29 , the poultry are unconscious . then they are transferred onto conveyor 19 and then to conveyor 20 where the hanging in the shackles takes place , as previously described . when the worker lifts the legs of the poultry into the u - shaped members 52 and 53 of the shackle , it is not necessary that the poultry &# 39 ; s body be lifted off of the conveyor . instead , the shackles are positioned at a height from the conveyor 20 such that it is only necessary that the legs be lifted up and into the shackles while the main portion of the poultry is still on the conveyor belt 20 and supported thereby . the shackle line then takes the poultry to the electrical stun 72 and then to the killer 73 . while the poultry are unconscious after breathing the co 2 , the electrical stunning apparatus 72 allows the neck to hang loose as it goes through the head cutter or killer 73 , thereby facilitating a better kill ratio . if only co 2 has been used , the kill rate is only 20 - 25 %. by combining with electrical stunning , a 97 % kill rate is achieved . the poultry then proceed through the plant to finish all of the processing steps . the steps are conventional and need not be described further as they are well known in the art . the above specification , examples and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .	0
while the invention will be described in conjunction with the exemplary embodiment , it will be understood that this are not intended to limit the scope of the invention to this embodiment . on the contrary , the invention is intended to cover all alternatives , modifications and equivalents as may be included as defined by the appended claims . in the following description , similar features in the drawings have been given similar reference numerals and in order to lighten the figures , some elements are not referred to in some figures if they were already identified in a precedent figure . referring to fig1 , a hybrid greenhouse 10 according to a preferred embodiment of the invention is illustrated with several elements partially cut - away to increase clarity . the hybrid greenhouse comprises a rigid space frame 12 mounted on a base 14 , at least one retractable screen 16 and a netting 18 . the space frame 12 is preferably formed of circular or oval metal tubing , or indeed a combination of both . the base 14 is preferably formed of a plurality of concrete plugs set into the ground just below the surface upon which the hybrid greenhouse 10 is installed , although a solid concrete foundation or other form of foundation is also within the scope of the present invention . the space frame 12 , which is anchored to the base 14 , encloses a space above the surface within a set of side faces 20 , 22 and 24 and a top face 26 delimited by the space frame 12 . the side faces 20 and 22 are preferably a pair of opposing faces which extend longitudinally . the side face 24 extends laterally and , for the sake of clarity , the corresponding side face which is opposite the side face 24 and completes the four side faces of the space frame 12 has not been shown . it will be apparent to one of ordinary skill in the art that this non - illustrated side face is simply a mirror - image of the side face 24 . the top face 26 is preferably formed by a series of longitudinally extending portions 28 sloping towards each other in pairs . these pairs of sloping portions 28 form a substantially triangular wave - like pattern of alternating peaks and valleys , which extend laterally across the hybrid greenhouse 10 , as is known in the art . the side face 24 , which extends from the ground to the edge of the sloping portions 28 , is therefore also called a gabled face 24 as its upper edge follows the alternating peaks and valleys of the top face 26 . the retractable screens 16 are retractably mounted to the space frame in order to at least partially shield the space contained within the space frame 12 from the elements when extended . preferably , the retractable screens 16 are extendable along the sloping portions 28 such that , when extended , the screens 16 cover a substantial portion of the top face , thereby protecting the contents of the hybrid greenhouse 10 from heavy rain , hail , snow , and other natural events . as will be discussed in further detail below , the retractable screens 16 are preferably fixed to the sloping portions 28 along their upper , longitudinally extending edges at respective peaks of the top face 26 , and extended downwardly towards the valleys when so desired . preferably , the screens 16 are impermeable uv - stabilized polyethylene sheets which are extended by rolling them up and down the sloping portions 28 . in use , the lower , free end of each roll - up polyethylene sheet 16 is rolled onto itself or a longitudinally extending cylinder as it is rolled up ( retracted ) or unrolled down ( extended ) along the sloping portions 28 . preferably , the roll - up polyethylene sheet 16 is electromechanically controlled , that is a user may actuate the extension / retraction of the sheets 16 with an electrical switch or remote . for example , guided electric motors may be installed at either longitudinal extremity of the end - rolls 66 ( see fig7 ) and used to roll and unroll the sheets 16 . alternatively , the sheets 16 may be actuated manually or by purely mechanical mechanisms . as will be readily appreciated by one skilled in the art , the screens 16 are preferably provided along each of the sloping portions 28 . this is in contrast to the hybrid greenhouse 10 illustrated in fig1 , which has been partially cut - away for the sake of clarity . similarly , the netting 18 preferably extends over the entirety of the side faces 20 and 22 , the gabled faces 28 and the top face 28 so as to completely enclose the space frame 12 . in this way , it is operable to protect the contents of the hybrid greenhouse 10 from entry of insects and other , large airborne nuisances . the netting 18 also permits air to flow through the hybrid greenhouse 10 , which can be advantageous in warm climates . the netting 18 is the outermost layer covering the hybrid greenhouse 10 . advantageously , the netting 18 helps stabilize and retain the screens 16 , which could otherwise be blown away in high winds . beneath each screen 16 is at least one end skirt 30 for guiding the screens 16 during extension and retraction . preferably , a pair of end skirts 30 are fixed to the space frame 12 at either longitudinal end of each sloping portion 28 such that the longitudinal ends of the screens 16 are loosely sandwiched between the end skirts 30 and the netting 18 . the end skirts 30 are also preferably made of a transparent impermeable uv - stabilized polyethylene material . with reference to fig2 , the gabled face 24 of the hybrid greenhouse 10 of fig1 is shown . in addition to further illustrating the concrete plugs 14 into which the space frame 12 is mounted , a vent 32 is shown substantially at the peak of the top face 26 , as is commonly provided in the art . as is known in the art , and well within the scope of the present invention , vents 32 may alternatively , or additionally , be provided along one or more of the side faces 20 , 22 and 24 . fig3 shows a typical cross - section of the hybrid greenhouse 10 , while fig4 shows an equivalent cross - section directly before the gabled face 24 . this distinction will become more apparent upon description of the detailed views in fig5 and 7 - 12 and the cross - sectional view in fig6 and 13 - 16 . additionally shown are wires 33 which are used as tension members within the space frame 12 , as is common in the art , and an extendable shade 35 which can be optionally extended horizontally across the hybrid greenhouse 10 . the detail illustrated in fig5 shows a vertical frame member 34 of the space frame 12 . the vertical frame member 24 is in the form of a circular tube and set into the concrete base 14 . the netting 18 is retained proximate the base of a longitudinal face , such as end faces 20 and 22 by a connector 36 . the connector 36 is preferably a combination of wirelock and wire - plast connectors , although other connecting means and combinations of connecting means , such as clips , snaps , bolts , screws , adhesives and staples are well within the scope of the invention . each connector 36 preferably comprises a self - drilling screw 37 for fixing a wirelock 39 to the vertical member 34 and wire - plast 41 force - fit into the wirelock 39 . the connector 36 retains the netting 18 to a square tubing 38 which is bolted to the tube 34 and extends longitudinally across the space frame 12 . as such , the netting 18 is retained along the bottom edge of the hybrid greenhouse 10 . a free end 40 is illustrated hanging below the connector 36 . the cross - section illustrated in fig6 shows another connector 36 attached directly to the vertical tube 34 , with the square tube 38 shown extending longitudinally beneath it . with reference now to the details illustrated in fig9 and 10 , the netting 18 is retained with connectors 36 at two more points an end face of the space frame 12 . in fig9 , the upper end 42 of the vertical tube 34 is joined to a longitudinally extending member 44 . the netting 18 is retained to member 44 , which is a substantially ovoid tube running parallel to the aforementioned square tube 38 , by a connector 36 . in fig1 , a connector 36 is used to retain the netting 18 to an extremity of a gutter 50 , which will be discussed in further detail with reference to fig7 . as will be appreciated from fig3 , between fig1 and 11 is a first sloping portion 28 a . in fig1 , a first roll - up polyethylene sheet 16 a is shown fixed along its upper edge 46 by the same connector 36 which retains the netting 18 to a longitudinally extending ovoid tube 48 . as will be appreciated with by one of ordinary skill in the art , the upper edge 46 of the sheet 16 a may be fixed to the space frame 12 in a variety of other ways without departing from the scope of the invention . for its part , the longitudinally extending tube 48 is mounted at the end of a sloping tube 52 which extends laterally and downwardly as a rafter would in a conventional sloping roof . the first sheet 16 a is unrolled such that it extends towards the gutter 50 in fig1 along the laterally extending tube 52 . below the tube 48 is the vent 32 . consequently , while the netting 18 extends on both sides of the connector 36 , the sheet 16 a does not . continuing downward now to detail illustrated in fig1 , the uppermost edge of a second sloping portion 28 b is shown . similarly , a second roll - up polyethylene sheet 16 b is fixed along its upper edge 54 by a connector 36 which also retains the netting 18 to a longitudinally extending ovoid tube 56 . the tube 56 is itself attached to another sloping tube 58 . the second sheet 16 b is unrolled along the tube 58 which extends the length of the second sloping portion 28 b towards a gutter shown in fig7 . the detail illustrated in fig7 , for its part , shows a gutter 50 which forms a valley in the top face 26 between the second sloping portion 28 b and a third sloping portion 28 c . the gutter 50 fixes the lower ends of two sloping tubes 58 and 60 to the rest of the space frame 12 . as is known in the art , the gutter 50 is also operable to collect run - off from the sloping portions . an insert 61 is positioned in the gutter 50 and comprises a raised portion 62 between a pair of recessed portions 64 . the recessed portions 64 of the gutter 50 are operable to receive the end - rolls 66 of roll - up polyethylene sheets 16 b and 16 c when fully extended . the raised portion 62 is provides a raised position on which to fix the netting 18 , via a connector 36 . the raised and recessed portions 62 and 64 are arranged such that the netting 18 does not interfere with the extension and retraction of the roll - up polyethylene sheets 16 . preferably , each gutter 50 includes a number of the inserts 61 along its longitudinal length for retaining the netting 18 . run - off is then collected in the gutter 50 below the insert 61 and does not interfere with the end - rolls 66 when fully extended . the detail illustrated in fig8 shows substantially the same cross - section as fig7 with the addition of a gutter plate 66 which is provided at the end of the gutter 50 . the cross - section illustrated in fig1 shows the sloping tube 58 of fig7 and 12 and a similar longitudinally spaced equivalent tube 68 , which also slopes transversally . in this case , these two tubes 58 and 68 delimit a longitudinal end of a sloping portion 28 . an end skirt 30 extends between the tubes 58 and 68 and is fixed on opposite sides by connectors 36 . although not illustrated in this figure , the roll - up polyethylene sheet 16 b is disposed thereabove . in use , the sheet 16 b is rolled and unrolled on this end skirt 30 and another end skirt 30 at its opposite longitudinal end . the cross - sections illustrated in fig1 and 15 show the netting 18 fixed to tubing 70 and 58 , respectively , at the intersection of a sloping portion and a gable end , such as the longitudinally extending sloping portion 28 a and the laterally extending gabled face 24 , by connectors 36 . similar to fig5 , the cross - section illustrated in fig1 shows a vertical frame member 72 of the space frame 12 set into a concrete base 14 and restraining the netting 18 by a connector 36 along a laterally extending face , such as gabled face 24 . the tubing utilized in constructing the space frame 12 is preferably made of pre - galvanized steel with a minimum yield of 300 mpa , thus the expected life length of such structure is about 25 years in rural conditions . the moulded components of the structure are preferably made of extruded aluminium , for example 6063 - t5 , t54 or t6 grades . multi - strands steel cables are suitable for the steel wires 33 , and it is recommended to use a325 - type anti - galvanic - corrosion bolts which may be functional for over 1000 hours even in a saline mist . these technical specifications will be understood by a person skilled in the art and should not be considered as limiting the scope of the present invention . the hybrid greenhouse 10 disclosed herein allows the complete protection of plants from insects . the netting 18 further can also serve as a windbreaker in high winds . moreover , the retractable screens 16 are operable to , inter alia , protect vulnerable plants such as tomatoes and cucumbers from heavy rains , which could otherwise damage the plants and consequently reduce their yield . in addition , it should be noted that a disadvantage of mesh fabrics such as mosquito nets , and other anti - insect nets of the like , is that they gather dust . in conventional hybrid products combining a netting layer and an impermeable sheet layer , the sheet layer is generally provided outside the netting layer . in contrast , the netting 18 of the hybrid greenhouse 10 is provided as the outermost layer and as such is washed by the rain . the above description of preferred embodiments of the present invention should not be read in a limitative manner as refinements and variations are possible without departing from the spirit of the invention . the scope of the invention is defined in the appended claim and its equivalents .	0
shown in fig1 is a business system 2 having a client service center 4 that can be accessed electronically via the internet 6 by a plurality of businesses , including for example a first business site 8 and a second business site 10 . each member business may subscribe for any of the several services available from our client service center 4 . a number of such services are described in the first and second applications . one new service , described hereinafter , is the multi - casting of live content . in general , each business may select either conventional multi - casting or our new multi - tier multi - casting . as shown in fig1 , within business site 8 , each of the clients , from client_a through client_i must establish a separate point - to - point connection with the client service center 4 . in general , the path through the internet between the client service center 4 and each of our clients in business site 8 will depend upon numerous factors , including physical location , local isp access service and dynamic loading factors . in the illustrated connection scheme , both client_c and client_i are prohibited from receiving the multi - cast content because at least one of the routers in the connection path are configured to block multi - cast transactions ( for convenience of reference , these routers are shown as darkened “ dots ” within internet 6 and the downstream paths in their shadow are represented in dashed lines ). in such prior art systems , the content server , in this case our client service center 4 , will be unaware of such service blockages . the only alternative available to client_c and client_i is to request a uni - cast connection . for each such request granted , the bandwidth load on the content server is increased accordingly . in accordance with our invention , within business site 10 , it is our client server 12 that establishes the connection with the client service center 4 , usually in response to the first request that it receives from any of its clients , say client_k . initially , client server 12 will register itself with the client service center 4 as a participant in the multi - cast udp session . then , when the client service center 4 is actually ready to initiate the multi - cast session , the client service center 4 will multi - cast to all registered participants , including client server 12 , an initial datagram of information regarding the multi - cast session . in response to receiving this datagram , the client server 12 will send back to the client service center 4 an ack . preferably , our client service center 4 will maintain a register of all participants and their acknowledgements , and , if a participant , say client server 12 , fails to timely acknowledge , it can be assumed that the connection path is either blocked to multi - cast transactions or otherwise unacceptable . the client service center 4 can then cooperate with the client server 12 to establish a uni - cast tcp connection . alternatively , if desired , all participants , including the client server 12 , can be configured to simply wait a predetermined time period after the scheduled time for the start of the multi - cast session and , if no content has been received , to contact the client service center 4 and establish a suitable uni - cast tcp connection . this self - reliant procedure , since it is controlled entirely by our client server 12 , is suitable for use with content servers that are not as sophisticated as our client service center 4 . upon establishing a suitable connection path with our client service center 4 , the client server 12 then establishes a second tier , multi - cast session within business site 10 . thereafter , if another client , say client_n , requests to participate in the multi - cast session , our client server 12 will establish the necessary local connections and allow both client_k and client_n to simultaneously view the multi - cast content . as explained in the first and second applications , our client server 12 can automatically perform dynamic local data caching of content received via the internet 6 on a local storage media , such as disk 14 . in accordance with our present invention , our client server 12 is now able to dynamically cache the various components of the multi - cast itself , including both audio and video . using this capability , it is possible for a client , say client_p , to join the multi - cast late and still view the entire multi - cast content , albeit delayed by the lapse in time between the actual start of the multi - cast and the time of viewing . in point of fact , if the space allocated on the disk 14 to cache the multi - cast content is sufficient , the entire content can be saved for off - line viewing whenever convenient . if desired , any client , say client_m , can save the cached content on a local storage device ( not shown ). shown in fig2 is an embodiment of our invention that is particularly well suited for live casting . in the method of operation shown in fig3 , our client server 12 , after initiating a udp steam download , will receive each datagram , and then record that datagram in a corresponding one of a set of slots on the disk 14 where space has been allocated to store the datagrams ( step 16 ). for buffer management reasons , to be described below , the client server 12 will then set in a variable ( we call it fillslot ) to the sequence number of the datagram ( step 18 ). the client server 12 will then ascertain from the associated datagram number if the datagram is , in fact , the next sequential datagram ( step 20 ). if the datagram is determined to be not in sequence , the client server 12 will initiate a compensation process ( described below ) ( step 22 ). in any event , if additional datagrams are expected ( step 24 ), the client server 12 is now free to perform other operations while awaiting the arrival of the next datagram . in accordance with the preferred embodiment of our invention , our client server 12 will keep track of time ( step 26 ), and , at periodic intervals ( say , every 60 seconds or so ), record , in association with the then - current datagram , a time stamp indicative of the time period that has elapsed since the start of the live cast ( step 28 ). in general , such time stamps enable our client server 12 to allow a client to begin viewing of a recorded live cast at any of the stamped points in time . in general , the compensation process shown in fig4 will be performed whenever the client server 12 determines that one or more of the datagrams are missing . in each such event , the client server 12 will send a tcp request to our client service center 4 to provide the missing datagram ( step 30 ). upon receipt ( again using tcp ), the missing datagram is recorded in the corresponding slot ( step 32 ). by using tcp , we are guaranteed to receive the requested missing datagram . assuming that most of the datagrams comprising the complete live cast stream , the loading on both the client service center 4 and the client server 12 for performing compensation should be acceptable . if desired , either server may limit the use of compensation if overall system load exceeds acceptable limits . in accordance with the playback process shown in fig5 , the client server 12 waits until the number of filled slots exceeds the value of a variable ( we call it minbuf ) ( step 34 ). in general , we set minbuf so as to allow sufficient time to repair a reasonable number of datagram losses . this buffer period can be dynamically varied to accommodate greater or lesser rates of loss . our studies indicate that a buffer sized to accommodate around 40 seconds or so of the live cast stream is sufficient for quality purposes while still preserving the impression of real time presentation to our client ( s ). once the buffer is sufficiently full , the client server 12 sets a variable ( we call it playslot ) to indicate that playback is to begin with the datagram stored in slot 1 ( step 36 ). once each datagram is played ( step 38 ), the client server 12 increments playslot ( step 40 ) and then loops back so long as there are additional stored datagrams ( step 42 ). thus it is apparent that we have provided a method and system for multi - tier multi - casting over the internet . those skilled in the art will recognize that modifications and variations can be made without departing from the spirit of our invention . therefore , we intend that our invention encompass all such variations and modifications as fall within the scope of the appended claims .	7
in the illustrated embodiment a rod 1 of substantial , indefinite length , is surrounded over a portion of its length by a cylinder 2 of short length . the rod and cylinder are concentrically located about a common axis and are designed to move with a degree of force axially relative to one another . in other words the rod may be fixed and the cylinder will move along the length of the rod , or alternatively , the cylinder may be fixed and the rod will be caused to move axially through the centre of the cylinder . the cylinder is composed of a number of elements , including a cylindrical wall 3 , a back wall 4 having a port 5 extending therethrough , a set of seals 6 designed to seal the back wall to the cylindrical wall , and a set of seals 7 designed to form a seal between the back wall and the rod 1 where it passes through a central bore 8 . at the other end of the cylinder is an end piece 10 fitted in the cylindrical wall 3 and closed by means of the seals 11 having a central bore 12 through which passes the rod 1 closed by means of the seals 13 . at the far side of the end piece is a cap 14 having a central bore 15 to accommodate the rod 1 , the space between the end piece and the cap being closed by a seal 16 . between the cap and the end piece is inserted ( in a recess of the end piece ) a circular ring 17 sealed against the end piece at 18 and against the cap at 19 . the ring 17 is capable of moving within the end piece backwards ( towards the back wall ) axially , under pressure applied through the port 20 in the end of the cap . the back edge 21 of the ring is tapered , or narrowed , to provide a wedgelike shape . a spring 22 is mounted rearward of the ring 17 to force it in a forward direction when no pressure is applied through the port 20 . mounted within the central recess of the end piece , and partially within the rearward edge of the cylindrical rings 17 , is a set of ring segments 23 , each segment of which surrounds a portion of the circumference of the rod 1 so that the set substantially surrounds the entire circumference with enough tolerance to contract tightly around the rod or expand to surround it loosely . within the cylindrical wall 3 , between the back wall 4 and the end piece 10 , is located a piston assembly 30 comprising a body piece 31 which is sealed against the cylindrical wall at 32 and against the rod at 33 , and a piston cap 34 sealed against the cylindrical wall at 35 and against the rod at 36 . like the forward end of the cylinder , the piston assembly has a circular ring 37 and a segmented ring 38 which closely surround the rod 1 . the cylindrical ring of the piston 37 is sealed against the body and against the cap at 39 and 40 respectively . similarly , the cap and body portion are sealed against each other at 41 . the end piece 10 is provided with a conduit 42 which in turn is connected to a hollow tube 43 movable within the horizontal portion of the conduit 42 through a seal 44 having a central bore 45 communicating to a chamber 46 which in turn communicates to the chamber 47 on the back side of the ring 37 . the tube 43 is also movable within a longitudinal bore 48 within the body of the piston assembly but sealed therewith . the operation of the device can best be described by a sequence of steps by which the rod or the cylinder can be caused to travel longitudinally or axially relative to the other . for example , if hydraulic or pneumatic fluid from a pressurized source is administered through the port 20 of the cap 14 , pressure will be exerted on the forward face of the circular ring 17 causing it to travel rearward ( towards the back wall ) so that the tapered rearward edge thereof will press like a wedge against the outer surface of the ring segment 23 forcing them to clamp tightly around the circumference of the rod 1 . if pressure is then applied through the port 5 of the back wall 4 , it will pressurize the interior of the cylinder behind the piston assembly moving it towards the end piece 10 while any fluid in the cylinder ahead of the piston is evacuated through the port 50 . during this movement the circular ring 37 of the piston assembly is under no pressure and the segmented ring 38 is free to move along the rod . after the piston assembly has reached the position adjacent to the forward end piece 10 , pressure is applied through the conduit 42 while the pressure initially exerted through the ports 20 and 5 is relaxed . the pressurized fluid will be conveyed through the conduit 42 and the bore 45 of the tube 43 to the chamber 46 and the chamber 47 where pressure will be exerted behind the circular ring 37 moving it forward causing it to act as a wedge to clamp the segmented ring 38 tightly about the circumference of the rod 1 so as to hold the piston in a fixed longitudinal position relative to the rod . if pressure is now applied through the port 50 the piston will remain fixed on the rod while pressure in the chamber forward of the piston will cause the cylinder 2 to move forward until the cap of the piston approaches the position adjacent to the back wall 4 . thus , if the rod is fixed the cylinder will move forward . alternatively , if the cylinder is fixed the rod will move rearward . if the sequence of pressure applied to the ports 20 , 5 , 42 , and 50 is repeated , the cylinder will move relative to the rod one more distance equivalent to the travel of the piston in the cylinder . the sequence can be repeated as often as necessary and the travel of the cylinder on the rods can be extended to any practical length . to reverse the travel pressure can be applied through the port 42 to clamp the piston on the rod and then through the port 5 to move the cylinder rearward before ring 23 is clamped by pressure through the port 20 . as an auxiliary , or an alternative mechanism , a toggle lock 52 is provided in the recess surrounding the segmented ring 38 in the piston assembly so that when the circular ring 37 is moved in the forward direction , the toggle lock , which consists of two links pivoted at their adjacent ends , will be forced in a straightened direction causing the segmented ring 38 to clamp the rod . a set of two or three or more of these can be positioned radially about the assembly . it will , of course , be realized that variations and modifications of the illustrated embodiment may be employed without departing from the inventive concept herein .	1
the term “ membrane ” as used herein includes permeable and semi - permeable three dimensional structures with or without particles , having a porosity suitable for the desired application . the term “ composite structure ” as used herein includes filled membranes . in the first preferred embodiment of the present invention , those skilled in the art will recognize that many different particles can be used in the composite structures , depending upon the desired objectives of the resulting device . in the case of adsorptive devices , the ideal device will have rapid adsorption kinetics , a capacity and selectivity commensurate with the application , and allows for elution of bound analyte with an appropriate desorption agent . suitable adsorptive composite structures are polymer bound , particle laden adsorptive membrane structures , such as those comprised of chromatographic beads which have been adhered together with a binder . a suitable polymer bound particle laden adsorptive membrane is illustrated in fig4 . this membrane is comprised of about 80 % w / w silica and 20 % w / w polysulfone binder , and is produced by millipore corporation . a similar membrane is shown in fig1 a cast - in - place in a pipette tip 50 . functional composite structures comprising other micron - size ( e . g ., 1 - 30 microns ) resin particles derivatized with other functional groups are also beneficial , including styrenedivinyl - benzene - based media ( unodified or derivatized with e . g ., sulphonic acids , quaternary amines , etc . ); silica - based media ( unmodified or derivatized with c 2 , c 4 , c 6 , c 8 , or c 10 or ion exchange functionalities ), to accommodate a variety of applications for peptides , proteins , nucleic acids , and other organic compounds . those skilled in the art will recognize that other matrices with alternative selectivities ( e . g ., hydrophobic interaction , affinity , etc .) can also be used , especially for classes of molecules other than peptides . the term “ particles ” as used herein is intended to encompass particles having regular ( e . g ., spherical ) or irregular shapes , as well as shards , fibers and powders , including metal powders , plastic powders ( e . g ., powdered polystyrene ), normal phase silica , fumed silica and activated carbon . for example , the addition of fumed silica into a polysulfone polymer results in increased active surface area and is suitable for various applications . polysulfone sold under the name udel p3500 and p1700 by amoco is particularly preferred in view of the extent of the adherence of the resulting composite structure to polyolefin housing , including polypropylene , polyethylene and mixtures thereof . other suitable polymer binders include polyethersulfone , cellulose acetate , cellulose acetate butyrate , acrylonitrile pvc copolymer ( sold commercially under the name “ dynel ”), polyvinylidene fluoride ( pvdf , sold commercially under the name “ kynar ”), polystyrene and polystyrene / acrylonitrile copolymer , etc . adhesion to the housing can be enhanced or an analogous effect achieved with these composite structures by means known to those skilled in the art , including etching of the housing , such as with plasma treatment or chemical oxidation ; mechanical aids such as rims inside the housing ; and inclusion of additives into the housing material that promote such adhesion . adhesion allows uniform precipitation during casting . devices in accordance with the present invention may incorporate a plurality of composite structures having resin materials with different functional groups to fractionate analytes that vary by charge , size , affinity and / or hydrophobicity ; alternately , a plurality of devices containing different individual functional membranes may be used in combination to achieve a similar result . similarly , one or more membranes can be cast in a suitable housing and functionality can be added before or after casting . in accordance with the present invention , the structures of the present invention can be formed by a polymer phase inversion process , air casting ( evaporation ) and thermal inversion . for those systems with minimal or no adhesion , the formed structures can be separately prepared and inserted into the appropriate housing and held in place by mechanical means . in the preferred method , the formed structures are cast in situ in the desired housing . this results in the ability to include large amounts of media in the polymer matrix while still maintaining a three - dimensional porous structure . the membrane substructure serves as a support network enmeshing the particles , thus eliminating the need for frits or plugs , thereby minimizing or even eliminating dead volume ( the adsorptivity of the membrane may or may not participate in the adsorption process ). however , porous frits plugs could be added if desired . preferably the membranes or composite structures formed have an aspect ratio ( average diameter to average thickness ) of less than about 20 , more preferably less than about 10 , especially less than 1 . for example , for adsorptive pipette tips , aspect ratios of two or less , more preferably less than 1 are preferred , especially between about 0 . 005 - 0 . 5 . an aspect ratio within this range provides for suitable residence times of the sample in the composite structure during operation . in the polymer phase inversion process , the solvent for the polymer must be miscible with the quench or inversion phase . for example , n - methyl - pyrolidone is a suitable solvent for polysulfones , polyethersulfones and polystyrene . in the latter case , polystryene pellets can be dissolved in n - methyl - pyrolidone and case - in - place . the resulting structure shows good adhesion to the walls of a polyolefin - based housing , and has adsorption characteristics similar to polysulfone . dimethylsulfoxide ( dmso ), dimethylform - amide , butyrolactone , and sulfalane are also suitable solvents . n , n - dimethylacetamide ( dmac ) is a suitable solvent for pvdf . water is the preferred precipitant . the polymer phase inversion process generally results in an expansion of the structure to about two to three times its casting solution volume in the housing . in the air casting process , a volatile solvent for the polymer binder is used . for example , in the case of cellulose acetate , acetone is a suitable volatile solvent . air casting generally results in a structure which is smaller than the casting solution volume . with this method , particles in the filled structures should be at least about 30μ to allow flow through the interstitial spaces after shrinkage without having to apply higher driving force . the upper limit of particle amounts is dictated by casting solution viscosity . depending on particle type , up to 40 % ( w / w ) of particles can be added to the polymer without resulting in a casting solution too viscous to draw into the housing . higher particle loadings may be achieved using higher temperature . suitable particle sizes include particles in the range of from about 100 nanometers to about 100 microns in average diameter with or without porosity . suitable housing materials are not particularly limited , and include plastics ( such as polyethylene and polypropylene ), glass and stainless steel . polyolefins , and particularly polypropylene , are preferred housing materials in view of the chemical adhesion that is created with the composite structure when the composite containing polysulfone , and in particular udel p3500 and p1700 polysulfones available from amoco , is cast - in - place therein . fig1 b illustrates such adhesion with a polypropylene pipette tip housing having a cast - in - place membrane therein prepared with spherical silica gel and polysulfone . suitable housing configurations are also not particularly limited , and include pipette tips , wells , multi - well arrays , plastic and glass cavities , sample preparation devices such as the microcon d microconcentrator , commercially available from millipore corporation , etc . the preferred housing configuration is substantially cylindrical , as the flow vectors during operation are substantially straight , similar to chromatography , thereby minimizing or avoiding dilutional washing that might occur with non - cylindrical configurations . although housings with volumes between about 0 . 1 μl and about 5 mls . can be used for casting - in - place , volumes less than about 100 μl are preferred , with volumes of from about 0 . 1 - 50 μl , preferably from about 0 . 2 - 20 μl , are especially preferred . pipette tip geometries having volumes as small as about 5 microliters can be used . when chemical adhesion of the composite structure to the housing walls is desired but is insignificant or non - existent , mechanical means can be used to maintain the composite structure in the housing . such as crimping , press fitting , heat shrinking the housing or a portion thereof , plasma treating the housing or a portion thereof , or chemically treating , such as etching , the housing or a portion thereof to promote adhesion . an advantage of adhesion to the housing wall is the ability to “ seal ” the composite structure to the housing without mechanical means . such sealing ( by whatever method ) prevents the sample from channeling or bypassing the composite during operation . preferably the structures of the present invention have a final bed height of from about 0 . 05 to about 5 mm . this allows for good washing , good density per unit volume , and results in a uniform precipitation during formation of the plug . the structures of the present invention also can be cast - in - place in conventional multi - well arrays having suitable geometries . alternatively , as shown in fig5 a - 5d , multi - well arrays 10 can be used as the housing , such as by casting the structures 11 of the present invention in place in the well 12 . alternatively , fig5 b shows an underdrain subassembly 13 having a plurality of wells 12 ( enlarged in fig5 d ) with cast - in - place structures contained therein . the underdrain 13 can be adapted to be permanently or removably coupled to the reservoir array 10 by any suitable means , such as by snapping , so as to form removable “ boot ” assemblies containing the structures of the present invention . for convenience , each underdrain 13 can contain a polymer matrix having particles with different chemistry , so that the user chooses the appropriate underdrain 13 depending upon the application . alternatively or in addition , the particle laden polymer matrix can differ from well to well . the reservoir housing 10 can be a plurality of open bores , or can include a membrane . the composite structures and the micro sample preparation devices of the present invention containing the composite structures have a wide variety of applications , depending upon the particle selection . for example , applications include peptide and protein sample preparation prior to analysis , peptide removal from carbohydrate samples , amino acid clean - up prior to analysis , immobilized enzymes for micro - volume reactions , immobilized ligands for micro - affinity chromatography , isolation of supercoiled and cut plasmids , clean - up of pcr and dna products , immobilized oligo dt for rna isolation , dye terminator removal , sample preparation for elemental analysis , etc . those skilled in the art will be able to choose the appropriate particles , polymer binder , particle chemistry and form geometry depending upon the desired application . in some cases , a mixture of particles can be used in the same devices . alternatively or in addition , a multi - well device could have different chemistries for each separate well . in the embodiment where the structures of the present invention are not filled with particles , symmetrical or asymmetrical semi - permeable structures , or a combination of symmetrical and asymmetrical semi - permeable structures , can be formed . in this embodiment , the preferred method of formation is casting in situ in the appropriate housing to form a self - retaining , self - supporting structure suitable for separations based on size or adsorption ( depending on polymer identity ) functionality can be added to such a membrane to perform adsorption separations without the use of particles . for example , cellulose acetate can be treated with base to form cellulose , followed by an oxidant to render it reactive . in the in situ formation process ( either with filled or unfilled structures ), the preferred method of formation involves precipitation by means of solvent exchange , such as by introducing the casting solution into the housing by any suitable means , such as where pressure is the driving force , or example by capillary action or by using a vacuum source . in the embodiment in which the housing is a pipette tip , a preferred driving force is a hand - held pipettor . once the desired volume in the housing is filled with casting solution , the casting solution in the housing is contacted with a liquid in which the polymer is insoluble , preferably water , so that the polymer precipitates in the housing . this can be accomplished by immersing the housing in the liquid , and / or drawing the liquid into the housing with a driving force such as by means of a vacuum . through the exchange of water for the solvent , the structure precipitates . those skilled in the art will appreciate that the solvent used to prepare the casting solution and the non - solvent can contain a variety of additives . at the first contact of the polymer with the precipitant , there is virtually instaneous precipitation , thereby forming a semi - permeable barrier or “ skin ”. such a barrier is illustrated in fig1 as element 60 in a housing 62 . this barrier slows the rate of further precipitation of the substructure . once precipitation is complete , the initial semi - permeable barrier 60 can be removed , such as by cutting the housing at a point above the barrier at a point above the barrier or by abrading exposed polymer . the semi - permeable barrier 60 can be optionally left in place to carry out size - based separations with unfilled structures , as the barrier acts as a micro - filtration membrane . the cast in - place structure assumes the shape of the housing and results in a self - retaining homogeneous structure akin to a chromatographic column , providing a large surface area suitable for bind / elute chromatography ( e . g ., when particles are included in the polymer matrix ) or for other analytical or biochemical techniques . suitable driving forces include centrifugation , gravity , pressure or vacuum . without limitation , the following examples illustrate the objects and advantages of the present invention . in a suitable small vessel , 5 grams of a 7 % ( w / w ) pvdf solution ( pennwalt corp , kynar 761 ) was prepared in n , n - dimethyacetamide . to this , 1 gram of scx , 200 å , 15 μm ( millipore , pn 85864 ) spherical silica was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 20 μl fluted polypropylene disposable pipette tip was affixed to a common p - 20 pipetman ( gilson , ranin , etc .) and the volume adjustment was set to 20 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 0 . 5 - 1 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the pipette tip was removed and dipped into a bath of deionized water @ 60 ° c . for ca . 5 seconds . after this brief period , pressure was released on the plunger and water was drawn into the tip to precipitate the polymer . when the water level was ca . 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to occur for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , ca . 0 . 25 mm can be cut off the end wish a sharp razor blade . to ensure that all solvent was removed , ca . 5 to 20 μl of deionized water was drawn in and expelled several times . in a suitable small vessel , 5 grams of a 6 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this 2 grams of c18 , 200 å , 15 μm spherical silica ( millipore , pn 85058 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at rt ., then mixed again . a 200 μl fluted polypropylene disposable pipette tip was affixed to a common p - 200 pipetman ( gilson , ranin , etc .) and the volume adjustment was set to 200 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 - 5 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water at room temperature for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 0 . 5 - 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to occur for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was twisted off . the tip was re - affixed to the pipetter and the liquid expelled . if the flow is poor , ca . 0 . 5 mm can be cut off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 50 to 200 μl of deionized water was drawn in an expelled several times . 60 å , 10 μm normal phase silica in wide bore 1000 μl pipette tips in a suitable small vessel , 6 grams of 6 % ( w / w ) cellulose acetate solution ( eastman kodak , 398 - 60 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 1 gram of 60 å , 10 μm granular silica gel ( davison , grade 710 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a wide bore 1000 μl polypropylene pipette was affixed to a common p - 1000 pipetman ( gilson , ranin , etc .) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 10 - 25 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 200 to 1000 μl of deionized water was drawn in and expelled . in a suitable small vessel , 8 grams of a 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 0 . 5 grams of fumed silica ( degussa , aerosil 200 ) were added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 200 μl wide bore polypropylene pipette was affixed to a common p - 200 pipetman ( gilson , ranin , etc .) and the volume adjust was set to 200 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 10 - 25 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water was drawn into the tip to precipitate the polymer . when the water level was ca . 1 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 200 to 1000 μl of deionized water was drawn in and expelled . in a small vessel , 5 grams of a 6 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . to this , 2 grams of c18 , 200 å , 15 μm silica ( millipore , pn 85864 ) was added and mixed thoroughly with a spatula . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . using a pipette or eye dropper , 25 - 50 μl of casting solution was dispensed into a suitable fixture . examples of such devices include ( but are not limited to ) an millipore microcon or the wells of a 96 well filter plate . when preparing devices by this method , each chamber must contain a permeable barrier which will retain the solution ( e . g . polypropylene fabric , membrane , etc .). once added , the unit was gently tapped to ensure that the solution covered the entire barrier surface . the device was immersed in water for ca . 2 hours , and was gently stirred every 15 mins to promote solvent exchange . after this period , the units were removed and placed in either a centrifuge or vacuum manifold , as appropriate . the cast in place structure was flushed with 500 to 1000 μl of deionized water to ensure solvent removal . cast porous end plug in wide bore 1000 μl pipette tips containing loose 30 μl silica in a suitable small vessel , 5 grams of a 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) was prepared in n - methyl - 2 - pyrrolidone . the mixture was allowed to equilibrate for 2 hours at room temperature , then mixed again . a 1000 μl wide bore polypropylene pipette was affixed to a common p - 1000 pipetman ( gilson , ranin ., etc .) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 - 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , the tip was removed and dipped into a bath of deionized water for ca . 5 seconds . after this brief period , pressure on the plunger was released and water drawn into the tip to precipitate the polymer . when the water level was ca . 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange allowed to take place for ca . 5 minutes . the tip was removed from the water bath and any precipitated polymer located on the exterior was abraded off . the tip was re - affixed to the pipettor and the liquid expelled . if the flow is poor , cut ca . 0 . 5 mm off the end with a sharp razor blade . to ensure that all solvent was removed , ca . 100 to 500 μl of deionized water was drawn in and expelled . the pipette was detached and any excess water in the upper chamber was removed with a cotton swab . 5 - 10 mg of ( 250 å ) 30 μm silica gel was weighed out and carefully added to the back end of the pipette . the pipette was tapped so that the silica rested on top of the cast - in - place barrier if necessary , affix a suitable porous plug ( cotton or polypropylene ) in the upper chamber to prevent particle loss . in a suitable vessel , 5 grams of 7 . 5 % ( w / w ) polysulfone solution ( amoco , p3500 ) in n - methyl - 2 - pyrrolidone was prepared . the mixture is allowed to equilibrate for 2 hours at room temperature , and is then mixed again . a 1000 μl wide bore polypropylene pipette is affixed to a common p - 1000 pipetman pipettor ( gilson , ranin , etc .) and the volume adjust is set to 1000 μl . the plunger is depressed to the bottom and the end of the pipette is placed into the casting solution . while carefully watching , the plunger was slowly raised to fill the tip with ca . 2 - 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed , excess polymer solution was wiped off , and the tip was dipped into a bath of deionized water for about 5 seconds . after this brief period , pressure was released on the plunger and water was drawn into the tip to precipitate the polymer . when the water level was about 0 . 5 cm above the polymer height , the tip was ejected into the bath and solvent exchange was allowed to take place for about 5 minutes . the tip was re - affixed to the pipettor , the liquid expelled , and washed with 100 - 200 μl of deionized water . when cast in this manner , the precipitated polymer had a semipermeable skin at the orifice , which can be used as a filtration medium . in a suitable vessel , 5 grams of a 10 % ( w / w ) cellulose acetate solution ( eastman kodak , 398 - 60 ) in acetone was prepared . to this , 1 gram of methanol , 0 . 5 grams of deionized water and 1 gram of 250 å , 30 μm silica was added . the mixture was allowed to equilibrate for 2 hours at room temperature , and was then mixed again . a 1000 μl wide bore polypropylene pipette was affixed to a common p - 1000 pipetman pipettor ( gilson ) and the volume adjust was set to 1000 μl . the plunger was depressed to the bottom and the end of the pipette was placed into the casting solution . the plunger was then slowly raised to fill the tip with about 5 - 10 μl of casting solution . once the tip contained sufficient liquid , equal pressure was maintained , and the tip was removed , excess fluid was wiped off , and the tip was placed in a rack to allow solvent to evaporate for about 16 hours . after this period , the tip was washed with about 10 μl of distilled water . 30 μl silica end plugs in porous polyethylene prepared by thermal phase inversion in a suitable vessel , 5 grams of beaded polyethylene and 100 grams of mineral oil are added . the mixture is heated to 250 ° c . on a hot plate with agitation . when the plastic liquifies , 4 grams of 250 å , 30 μm silica is added and mixed thoroughly . using a 1 ml graduated glass pipette with filler bulb , 50 - 100 μl of the melt is drawn in . once the tip contains sufficient liquid , equal pressure is maintained , and the tip is removed , excess plastic is wiped off , the tip is allowed to cool to room temperature . the pipette is transferred to a methylene chloride bath for 1 hour to extract the mineral oil . it is then removed , and the methylene chloride is expelled and allowed to air dry . approximately 2 . 5 μg of each peptide from a mixture consisting of glytyr ( 1 ), valtyrval ( 2 ), methionine enkephalin ( 3 ), leucine enkaphalin ( 4 ) and angiotensin ii ( 5 ) ( in 100 μl 0 . 1 % tfa ) was adsorbed to a p200 pipette tip containing ca . 5 μl of cast c18 , 200 å , 15 μm spherical silica . the solution was drawn up and expelled 4 times . the tip was then washed with 200 μl of 0 . 1 % tfa . bound peptides were eluted with 80 % acetonitrile in 0 . 1 % tfa / water . the eluted peptides were diluted with 4 parts of 0 . 1 % tfa and analyzed by reverse phase hplc ( linear acetonitrile gradient 5 - 30 % over 20 min ). the resulting chromatogram was then compared to that of the original mixture . ( see fig6 and 7 ). as expected , the glytyr , valtyrval , which are small and relatively hydrophilic , did not bind to the c 18 . the recoveries of the remaining 3 ( adsorbed ) peptides subsequent to elution ranged from 70 - 85 %. approximately 2 . 5 μg of each solute from a mixture consisting of a five peptides ( see example 10 ) ( in 100 μl in 10 % glacial acetic acid ) were adsorbed to a p200 pipette tip containing ca . 5 μl of cast , styrene sulfonate coated , 300 å , 15 μm spherical silica . adsorption was performed during 4 complete uptake - withdraw cycles followed by a 100 μl flush with 20 % methanol / 10 mm hcl . bound sample was eluted with two 25 μl volumes of 1 . 4 n ammonium hydroxide / 50 % methanol . the eluted sample was analyzed by reversed phase hplc and the resulting chromatogram was compared to that of the original mixture . ( see fig6 and 8 ). the strong cation exchange tip bound all sample components , except glytyr . such performance is consistent with the selectivity of sulfonic acid ion - exchange resins . trypsin was covalently coupled to an aldehyde activated 300 å , 15 μm spherical silica and cast ( 20 μl ) into p200 tips for protein digestion in situ . trypsin activity within the tip was assessed by monitoring the digestion of cytochrome via hplc . a sample of cytochrome c ( 10 μg in 100 μl of 100 mm tris , 1 mm cacl 2 ph 8 @ 37 c .) was taken up into the tip for 15 minutes . the reaction was mixed 4 × with a expel / draw cycle into an eppendorf tube . the digest was analyzed by hplc using a linear gradient of acetonitrile from 5 - 45 % over 30 minutes ( see fig1 ). the resulting chromatogram showed that greater than 90 % of cytochrome c was digested after 15 minutes ( see fig9 for undigested cytochrome c ). recombinant protein a was coupled to precast p200 tips containing aldehyde - activated 300 å , 15 μm soherical silica for the isolation of rabbit immunoglobulin ( igg ). a 100 μl sample of 1 mg / ml igg and bsa in rip buffer ( 150 mm nacl , 1 % np - 40 , 0 . 5 % doc , 0 . 1 % sds , 50 mm tris , ph 8 . 0 ) was cycled six times through a tip containing 40 μl of cast volume containing protein a immobilized beads . the tin was then washed with 5 volumes of rip buffer prior to the elution . desorption of bound igg was performed with ( two 25 μl volumes ) of 6m urea . the desorbed sample was diluted with 50 μl of 2 × sds laemmli sample buffer and boiled for 3 min prior to electrophoretic analysis . this protocol was also performed on a blank tip containing just polysulfone without beads which served as a background control . electrophoresis was performed in a 10 - 16 % acrylamide gel shown ( see fig1 ). samples are as follows : lane 9 : ( mw marker ); lanes 1 - 4 : increasing amounts of protein a tip eluted sample ; and lanes 5 - 8 : increasing amounts of eluted igg / bsa from the blank polysulfone tip . these results indicate selective binding of igg to the protein a tip with minimal nonspecific adsorption . furthermore , the blank tip ( lanes 5 - 8 ), in the presence of detergents ( rip buffer ), did not exhibit adsorption of either igg or bsa . 60 å , 10 μm 1000 μl pipette tips for supercoiled dna escherichia coli strain jm109 containing plasmid puc19 was grown in 3 - 5 ml of luria broth containing 100 μg / ml ampicillin at 37 ° c . for 12 - 16 hours . 1 . 5 ml of the overnight culture was pelleted in a microfuge tube spun at maximum g - force for 30 sec at room temperature . residual growth medium was removed while leaving the bacterial pellet intact . plasmid dna was then isolated using a modification of the alkaline lysis procedure of birnboim and doly ( birnboim , h . c . and doly , j . ( 1979 ). nucleic acids res 7 ., 1513 ). briefly , the bacterial pellet was resuspended by vortexing in 50 μl of 50 mm glucose , 25 mm tris - hcl ( ph 8 . 0 ), 10 mm edta , and 10 μg / ml rnase a . next 100 μl of 0 . 2 n naoh , 1 % sodium dodecyl sulfate was added . the resulting suspension was incubated at room temperature for 2 min . following the addition of 100 μl of 3 m sodium acetate solution ( ph 4 . 8 ), the suspension was mixed by vortexing then spun in a microfuge at maximum g - force for 2 min . the cleared lysate was transferred to a fresh microfuge tube to which 7 m guanidine hydrochloride ( guhcl ) in 200 mm 2 -( n - morpholino ) ethane sulfonic acid ( mes ) at ph 5 . 6 was added to a final concentration and volume of 4 . 4 m and 700 μl , respectively . the resulting solution was drawn into a 1000 μl polypropylene pipette tip with ca . 60 μl of cast membrane containing ca . 60 å , 10 μm silica gel using a p - 1000 pipettor . the solution was pipetted in - and - out for 2 - 2 . 5 minutes to allow extensive interaction between the dna solution and the silica membrane matrix . the tip was then flushed once with 400 μl of 80 % reagent grade alcohol . residual alcohol is removed by repeated expulsion onto a paper towel . plasmid dna was eluted from the tip in 100 μl of 10 mm tris - hcl ( ph 8 . 0 ), 1 mm edta ( te ) by in - and - out pipetting 3 ×. eluate fractions were adjusted to a final volume of 100 μl with te . six tips were evaluated . to quantitate plasmid dna recovery , 20 % of the eluate , as well as 20 % of the unbound filtrates , were analyzed by agarose gel electrophoresis ( see fig1 ). included on the gel were samples of puc19 plasmid dna of known concentrations . ( lanes 1 - 4 ) results of these experiments indicate that on average 2 . 5 mg of supercoiled plasmid was recovered ( lanes 5 , 7 , 9 , 11 ). 60 å , 10 μm silica in wide bore 200 μl pipette tips for linear dna the ability of 200 μl polypropylene wide bore pipette tips containing ca . 20 μl of cast 60 å , 10 μm silica - laden membrane to bind linearized dna fragments ( pbr322 digested with either bstni or mspi , to generate dna fragment ladders ) or plasmid pbr322 dna restricted with psti and bamhi ( generates large linear restriction fragments ) was assessed . five μg of linearized plasmid dna was combined with guhcl , ph 5 . 6 in mes to a final concentration of 0 . 5 m and volume of 150 μl . prior to use , p - 200 tips containing the silica membrane were pre - equilibrated in ( 2 ×) 200 μl of 0 . 5 m guhcl , ph 5 . 6 in mes . the dna / guhcl solution was drawn into a pipette tip and cycled in - and - out for 1 . 5 - 2 . 0 min to allow extensive interaction between the dna binding mixture and the silica - laden membrane matrix . the tips were then washed with 125 μl of 80 % reagent grade alcohol to remove salts and other contaminants . bound dna was eluted from the tip matrix in 100 μl te , by in - and - out pipetting 3 ×. to measure dna recovery , eluates and filtrates were analyzed by agarose gel electrophoresis ( see fig1 ). in order to quantitate the amount of dna recovered , samples representing 100 %, 75 %, 50 %, and 25 % of the starting material were run in lanes 1 - 4 . lanes 5 , 7 , 9 , & amp ; 11 are the eluants . estimate of band intensities indicate recoveries in excess of 95 %. fumed silica in wide bore 200 μl pipette tips for pcr amplified dna the ability of 200 μl wide bore polypropylene pipette tips containing ca . 20 μl of fumed silica immobilized in a polysulfone matrix was assessed for the purification of pcr amplified dna ( 500 bp ). prior to use , tips were flushed 2 × with 100 μl of te buffer and then equilibrated with 500 μl of 3 m nai in 200 mm mes buffer ( ph 6 . 4 ). 50 μl samples from the pooled pcr stock ( ca . 3 μg of dna ) were then combined with 7 m nai to a final nai concentration of 3 . 0 m . the total volume following addition of the nai solution was 150 μl . the sample was drawn in and expelled from the p - 200 tips containing the cast fumed silica - laden membrane for 2 - 3 minutes allowing for extensive contact with the matrix . each tip was then washed with 125 μl of 80 % reagent grade alcohol to remove salts and other contaminants . residual alcohol was removed by expelling the tip contents onto a paper towel . bound pcr product was eluted in 50 μl te ( ph 8 . 0 ). to estimate dna recovery , eluates and filtrates were analyzed by agarose gel electrophoresis ( see fig1 ). loads representing 100 %, 75 %, 50 %, and 25 % of the starting material were run in lanes 1 - 4 as controls . note the presence of the lower band which indicates a slight primer - dimer contamination . the use of immobilized fumed silica along with nai appears to give an amplified dna recovery in excess of 90 %. in addition , there appears to be a reduction in the primer - dimer contaminant . ( see lanes 5 , 7 , 9 , 11 ). cast porous end plug with loose 30 micron silica in a 200 μl pipette tip for dna isolation 200 μl pipette tips containing ca 5 - 10 μl of cast ( 7 . 5 %) polysulfone as a porous end plug and 2 - 4 mg of loose 250 å , 30 μm silica was assayed for the ability to blind linear and supercoiled plasmid dna . regarding linear dna , approximately 5 μg of pbr322 was first digested with mspi in 45 μl te ( 10 mm tris - hcl , 1 mm edta ), ph 8 . 0 , and then combined with 100 μl of 7 m guanidine hydrochloride ( guhcl ) in 200 mm mes buffer at ph 5 . 6 . the final concentration of guhcl in the solution was 4 . 7 m . the resulting solution was drawn ( once ) into a 200 μl pipette tip and allowed to extensively contact the silica by inverting the pipetman with the affixed lip for approximately 2 min . the dna adsorbed to the lips was then washed and eluted as described in example 15 . loads representing 100 %, 75 %, 50 % and 25 % of the starting material where run in lanes 1 - 4 as controls . results from experiments using this format indicate that dna recoveries of better than 75 % can be achieved ( see fig1 , lanes 5 and 7 ).	1
the mechanical properties and dimensional stability of a molded component are influenced by various aspects of the manufacturing process . structural characteristics are influenced by the design of the mold cavity , by the location of the charge , and by the various process parameters such as molding temperatures , mold closing speed , and compression cycle time . in addition , the compound &# 39 ; s heat conductivity , fiber orientation and distribution , and the resulting caliper of the molded component affect its structural properties . when other processing parameters remain constant , we have surprisingly found that a pattern of grooves formed in the interiorly disposed surface of a door facing increases the rigidity of the facing , compared to a similarly configured door facing that does not include such grooves . we believe that a mold die having a pattern of ridges , such as achieved with a wood grain pattern , increases turbulent flow of the smc during compression . this increase in turbulent flow improves heat distribution and conductivity throughout the smc , and also results in increased random fiber orientation and distribution throughout the door facing . the fibers are less likely to align during compression because the ridges or other texturing of the mold die disrupt the flow of the smc . in addition , we believe that stresses are more evenly distributed throughout the door facing due to the turbulent flow and random fiber orientation of the smc . the increased turbulent flow also results in better mixing of the resins and other additives . for flush door facings having a substantially planar intended visible exterior surface , turbulent flow may be increased by molding a pattern of grooves ( or some other texture ) into the intended interiorly disposed interior surface of the facing using a mold die having ridges . rigidity of the door facing is increased and the tendency of the door facing to deform , particularly during door assembly , is reduced due to the random fiber orientation caused by the increased turbulent flow . the specific pattern and configuration of grooves may vary depending on the compound formulation , and the dimensions and caliper of the door facing . however , we have found that if all other manufacturing parameters remain constant aside from texturing , a door facing with a textured interior surface is substantially more rigid than a comparable door facing without a textured interior surface . as a result , we have found that by texturing the interior surface of a door facing , an smc formulation having a relatively low modulus may be used and still result in a door facing with sufficient rigidity to minimize dipping during door assembly . for example , an smc formulation having a modulus of about 1 . 8 million psi is typically used to form flush door facings without any texturing on either the visible or interior surfaces . if the modulus of the formulation is less than about 1 . 7 million psi , the resulting door facings are more prone to dipping and other defects . however , if texturing is added to the interior surface of the door facing , an smc formulation having a relatively low modulus , for example a modulus of between about 1 . 1 million psi to about 1 . 4 million psi , may be used and result in door facings which are sufficiently rigid to resist dipping during the door assembly process . thus , texturing the interior surface increases rigidity of the door facing without the need for relatively expensive polymer composite formulations , such as formulations having relatively high fiberglass content or specialized polymer blends . in addition , less material is required to form a door facing having a textured interior surface . the grooves forming the pattern on the interior surface replace material that would otherwise be needed to form the door facing . thus , material costs are reduced . furthermore , texturing of the interior surface reduces blistering . blistering results from voids formed within the smc during compression that may be the result of either trapping air or a chemical action within the compound . we believe that the grooves formed within the interior surface of the facing minimize the possibility of trapped air and / or other gases because such gases are more likely to escape through the walls of the grooves . furthermore , we believe blistering is less likely to occur due to improved heat distribution and random fiber orientation caused by the turbulent flow achieved . we also believe that the caliper of a door facing may be decreased by texturing its interior surface , when compared to the caliper of a similar door facing without a textured interior surface . for example , a flush door facing without a textured interior surface may have a caliper of between about 0 . 08 inch to about 0 . 085 inch , which will provide sufficient rigidity during the door assembly process . however , caliper may be significantly reduced if texturing is added to the interior surface of the door facing , while still maintaining the desired rigidity and strength . caliper reduction is advantageous because less material is required to form the door facing . in addition , the required cycle time during the compression process decreases as caliper decreases . alternatively , mold temperature may be decreased with a decrease in caliper . thus , manufacturing costs are decreased . as such , texturing the interior surface of a door facing is also advantageous for a contoured door facing , such as a one panel or multi - panel door facing , or a door facing having a wood grain pattern on its intended visible surface given caliper may be reduced . the exact pattern of the texture may vary depending on the smc formulation used , the caliper and configuration of the resulting door facing , and processing parameters used during compression and door assembly . in addition , the configuration of the grooves , including their length , width and depth , may vary depending on configuration and caliper of the door facing ( i . e . flush , multi - panel , etc ). the optimal layout and configuration of the grooves forming the pattern may be determined by identifying areas of relatively low strength and areas susceptible to deformation caused by thermal stress and mechanical stress during the door assembly process . thermal stress in the door facing is caused by temperature gradient ; mechanical stress is partially caused by gravity , as noted above . once such weak areas are identified , a pattern of grooves is added to the interior surface of the door facing in order to strengthen such susceptible areas . finite element analysis (“ fea ”) may be used to determine the optimal layout and design of the texture that will strengthen such areas . the texturing pattern , including the width , depth , length and direction of the grooves , may be specific to a particular door design . some advantages of the present invention may be more readily understood through reference to the following example , which is provided by way of illustration , and not intended to be limiting of the present invention : an smc formulation was provided having a viscosity of about 40 million cps . a suitable viscosity for the formulation is between about 30 million cps to about 50 million cps . the smc included glass fibers having a length of between about 0 . 5 inch to about 1 inch . a suitable smc formulation is available from interplastic corporation , molding products division of south bend , ind ., such as product name 1027181 . a mold press 10 having an upper die 12 and a lower die 14 was provided , as best shown in fig1 . the upper die 12 includes a substantially planar molding surface 16 for forming the planar surface of the intended visible surface of a flush door facing . as best shown in fig1 - 4 , lower die 14 includes a textured molding surface 18 having a series of spaced ridges 20 for forming a wood grain pattern on the interior surface of the flush door facing . the wood grain texturing was acid etched into the lower die by mold - tech , a standex company , of salem , n . h ., using pattern number mt # 978 . another suitable etching pattern for lower die 14 is available from custom etch of new castle , pa ., pattern ce341r . spaced ridges 20 extend substantially parallel to each other , as best shown in fig3 . however , ridges 20 have variable lengths and widths , and adjacent ridges 20 are spaced from each other by variable distances . ridges 20 are provided in groups or ‘ clusters ’ in order to more accurately simulate a wood grain pattern . for example , a group of ridges 20 are spaced relatively close to each other to form a first cluster c 1 . another group of ridges 20 are spaced relatively close to each other to form a second cluster c 2 . first and second clusters c 1 , c 2 are spaced from each other by a distance greater than the distance that ridges 20 within a particular cluster are spaced , thereby forming a gap g between clusters c 1 , c 2 . the pattern of ridges forming textured molding surface 18 therefore includes a plurality of clusters of ridges 20 ( such as clusters c 1 , c 2 ) and gaps g . furthermore , clusters may include a variable number of ridges 20 , having variable lengths and widths . clusters may also be variably spaced from each other . we believe this configuration increases flow turbulence because the flow of the smc is randomly hindered by ridges 20 as the smc expands during compression due to the variable orientation and configuration of ridges 20 . as best shown in fig2 , the smc charge c was positioned on textured molding surface 18 of lower die 14 within mold press 10 , and compressed to form a flush door facing using sufficient heat and pressure . the intended exterior surface of the molded door facing was substantially planar . the intended interior surface of the resulting door facing included a series of spaced grooves simulating a wood grain pattern having wood ticks as found in natural wood . the spaced grooves were formed by ridges 20 on lower die 14 . thus , the configuration of the interior surface of the resulting door facing is a negative of the configuration of textured mold surface 18 . while the pattern of ridges 20 shown in fig2 appear to be randomly oriented , they extend substantially parallel to each other , and substantially parallel to the longitudinal edges 22 , 24 of lower mold die 14 . as such , the resulting grooves formed in the door facing will extend substantially parallel to each other , and substantially parallel to the longitudinal edges of the door facing ( i . e . parallel to the stiles of the resulting door ). during compression molding , the smc charge c , which is in the shape of one or more billets , is placed onto textured molding surface 18 . planar molding surface 16 of upper die 12 is then advanced toward lower die 14 , thus contacting the smc charge ( s ) and compressing it therebetween . during compression , the smc charge c must spread over the length and width forming the resulting door facing . as such , the smc charge c must extend throughout the surface area between planar molding surface 16 and textured molding surface 18 which form the door facing before the cross - linking reaction of the smc is completed . mold press 10 exerts pressure on the smc charge c , forcing the smc to expand outwardly toward the longitudinal edges 22 , 24 of lower mold die 14 ( and upper mold die 12 ), as well as toward the ends 26 , 28 of lower mold die 14 ( and upper mold die 12 ). the flow direction of the expanding smc is shown by arrows f . as the smc expands , it is forced over ridges 20 . the flow direction f of a majority of the expanding smc is angular relative to ridges 20 , or even perpendicular to ridges 20 . this orientation of ridges 20 relative to the flow direction f is believed to contribute to increased flow turbulence because the flow of the smc is disrupted as it contacts ridges 20 . an image of a wood grain pattern is shown in fig5 , showing an interior surface 30 of a door facing with grooves 32 formed by ridges 20 . grooves 32 preferably have a depth of between about 0 . 003 inch to about 0 . 009 inch , more preferably between about 0 . 005 inch to about 0 . 007 inch . as noted above , we believe ridges 20 in lower die 14 increase turbulent flow of the smc during the compression process , which enhances heat distribution and creates a random distribution and orientation of the glass fibers in the smc . the resulting door facing has excellent rigidity and strength . during the door assembly process , first and second door facings 34 , 36 were adhesively secured to a perimeter frame 38 , forming a cavity c therebetween , as best shown in fig6 . each of facings 34 , 36 included interior surface 30 with grooves 32 , as best shown in fig5 , which are disposed within cavity c . thus , the resulting door was a flush door , even though each of interior surfaces 30 of facings 34 , 36 included a wood grain pattern . the frame 38 and secured facings 34 , 36 were disposed between a press having upper and lower heated platens . the platens were heated to a temperature of about 114 ° f . a suitable temperature range for the platens is between about 110 ° f . to about 120 ° f . the frame 38 and secured facings 34 , 36 were compressed between the upper and lower heated platens . polyurethane was then injected into cavity c . as such , upper and lower heated platens applied a sufficient amount of pressure on frame 38 and secured facings 34 , 36 so that facings 34 , 36 did not deform outwardly or detach from frame 38 . the heat from the platens improves adhesion between the injected foam and interior surfaces 30 of facings 34 , 36 . in addition , the pattern of grooves 32 on interior surfaces 30 provide a rough surface which enhances foam adhesion . rigidity of facings 34 , 36 is sufficient to avoid deformation or dipping during the door assembly process . once the foam was sufficiently cured and solidified , the finished door was removed from the press . a door facing having an interior surface with grooves was compared with a door facing having a substantially planar interior surface . both door facings were formed from the same formulation of smc ( product 1027181 from interplastic corporation , molding products division of south bend , ind .). both facings were approximately 80 inch long by 36 inches wide . in addition , the calipers of both facings were substantially the same . however , the door facing having the textured interior surface 30 with grooves 32 was significantly more rigid and stiff than the facing without such texturing . for example , the loss ratio due to dipping of door facings without texturing is about 80 %, while loss ratio due to dipping of door facings with texturing is only about 25 % it will be apparent to one of ordinary skill in the art that various modifications and variations can be made in construction or configuration of the present invention without departing from the scope or spirit of the invention . for example , the disclosed example provides for a wood grain pattern on the interior surface of the door facing . however , it should be understood that other textured patterns may be formed in the interior surface of the facing , such as a spiraled pattern , zigzag pattern , grid pattern , or random pattern of grooves . furthermore , it should be understood that the optimal pattern and groove configuration may be determined based on fea , and influenced by the precise caliper and dimensions of the component being formed , as well as the specific polymer composite formulation being used . thus , it is intended that the present invention cover all such modifications and variations , and as may be applied to the central features set forth above .	4
the steroids of formula i are physiologically active substances which possess gluococortoid and antiinflammatory activity and hence can be used in lieu of known glucocorticoids in the treatment of rheumatoid arthritis , for which purpose they can be administered in the same manner as hydrocortisone , for example , the dosage being adjusted for the relative potency of the particular steroid . in addition , the steroids of this invention can be used topically in lieu of known glucocorticoids in the treatment of skin conditions such as dermatitis , psoriasis , sunburn , neurodermatitis , eczema , and anogenital pruritus . when given orally , the compounds of this invention may be used in a daily dosage range of 0 . 1 to 200 milligrams per 70 kilograms , preferably 0 . 3 to 100 milligrams per 70 kilograms . if administered topically , the compounds of this invention may be used in the range of 0 . 01 to 5 . 0 % by weight , preferably 0 . 05 to 2 . 0 % by weight , in a conventional cream or lotion . the topical mode of administration is preferred . the steroids of formula i can be prepared using as starting materials steroids having the formula ## str6 ## and a compound having the formula ## str7 ## it is desirable to first protect the 11β - hydroxyl group of a steroid of formula ii . while many means of protecting the hydroxyl group will be apparent to a person skilled in the steroid art , one particularly desirable method is the acylation of the group . the acylation reaction can be run using an acid anhydride in the presence of a lewis catalyst , e . g ., boron trifluoride etherate , and yields a steroid having the formula ## str8 ## the symbol &# 34 ; r 1 &# 39 ;&# 34 ; is hydrogen , halogen , or acyloxy . if the starting steroid of formula ii contains a 21 - hydroxy group , this group will be acylated in addition to the 11β - hydroxy group . the cycloaddition of a compound of formula iii to an enone of formula iv is catalyzed by palladium and proceeds best in the presence of triphenylphosphine . the resulting steroid has the formula ## str9 ## treatment of a steroid of formula v with base ( e . g ., lithium hydroxide ) deprotects the 11β - hydroxy group and , if r 1 &# 39 ; is acyloxy , deacylates the 21 - hydroxy group . the resultant steroid has the formula ## str10 ## wherein the symbol &# 34 ; r 1 &# 34 ; is hydrogen , hydroxy or halogen . the 21 - esters of formula i can be readily prepared from the steroids of formula vi wherein r 1 &# 34 ; is hydroxy using conventional techniques . steroids of formula i wherein r 1 is hydrogen , acyloxy or halogen and together r 2 and r 3 are oxo can be prepared by ozonolysis of the corresponding steroid wherein together r 2 and r 3 are methylene . those products of formula i wherein r 1 is hydroxy and together r 2 and r 3 are oxo can be prepared by ozonolysis of a corresponding 21 - acyloxy steroid wherein together r 2 and r 3 are methylene . after the ozonolysis the 21 - acyloxy product can be deacylated to yield the desired 21 - hydroxy steroid . steroids of formula i wherein r 2 and r 3 are each alkylthio can be prepared by treatment of the corresponding steroid of formula i wherein together r 2 and r 3 are oxo with a thiol such as an alkyl mercaptan in the presence of a lewis acid catalyst such as boron trifluoride . steroids of formula i wherein r 2 and r 3 are each hydrogen can be prepared by treatment of the corresponding steroid of formula i wherein r 2 and r 3 are each alkylthio with raney nickel . the reaction is preferably run in ethanol . steroids of formula i wherein r 2 is hydroxyl and r 3 is alkyl can be prepared by treatment of the corresponding steroid of formula i wherein together r 2 and r 3 are oxo with an alkyl magnesium halide or an alkyl lithium . steroids of formula i wherein r 2 is hydrogen and r 3 is alkyl can be prepared by treatment of the corresponding steroid of formula i wherein r 2 is hydroxyl and r 3 is alkyl under dehydrating conditions . exemplary of the possible dehydration reactions is treatment with methanesulfonyl chloride and triethylamine in dichloromethane followed by catalytic hydrogenation ( preferably using tris ( triphenylphosphine ) rhodium chloride as catalyst ) of the resulting mixture of olefins . alternatively , those steroids of formula i wherein r 2 is hydrogen and r 3 is methyl can be prepared by catalytic hydrogenation of the corresponding steroid of formula i wherein r 2 and r 3 are methylene . the preferred catalyst is tris ( triphenylphosphine ) rhodium chloride . steroids of formula i wherein together r 2 and r 3 are --( ch 2 ) 2 -- can be prepared by treatment of the corresponding steroid of formula i wherein together r 2 and r 3 are methylene with diiodomethane in the presence of zinc - copper couple . steroids of formula i wherein r 2 and r 3 are each methyl can be prepared by catalytic hydrogenolysis of the corresponding steroid of formula i wherein together r 2 and r 3 are --( ch 2 ) 2 --. a mixture of palladium diacetate ( 150 mg , 0 . 67 mmole ), triphenyl phosphine ( 750 mg , 2 . 86 mmole ) and [ 2 -( acetyloxymethyl )- 3 - allyl ] trimethylsilane ( 135 g , 7 . 26 mmole ) in dry tetrahydrofuran ( 150 ml ) was treated with ( 11β )- 11 , 21 - di ( acetyloxy )- 9 - fluoropregna - 1 , 4 , 16 - triene - 3 , 20 - dione ( 2 . 22 g , 5 . 0 mmole ) and refluxed under argon . the reaction became homogenous after ca . 20 minutes . after 5 . 5 hours , the mixture was evaporated to dryness and the residue triturated with ethyl acetate to give 960 mg of recovered starting steroid . the residue on evaporation of the mother liquor was filtered through a pad of silica gel ( 5 g ) eluting with ethyl acetatedichloromethane ( 1 : 1 ). the eluate was evaporated and purified by flash chromatography on silica gel ( 120 g ), eluting with ethyl acetate - hexane ( 2 : 3 ) to give the title compound ( 710 mg ) as white crystals , melting point 204 °- 205 ° c . after recrystallization from ethyl acetate - hexane . a solution of ( 11β , 16β )- 11 , 21 - di ( acetyloxy )- 9 - fluoro - 4 &# 39 ;- methylenepregna - 1 , 4 - dieno [ 16 , 17 - a ] cyclopentane - 3 , 20 - dione ( 250 mg , 0 . 50 mmole ) in acetonitrile - methanol ( 2 : 1 , 15 . 0 ml ) was degassed with argon and treated with 1 n lithium hydroxide solution ( 1 . 5 ml , 1 . 5 mmole ) and stirred at room temperature under argon for 1 . 5 hours . the mixture was partitioned between ethyl acetate - 5 % potassium bisulfate , washed with saturated sodium chloride solution , dried over sodium sulfate and evaporated . the residue was purified by preparative thin - layer chromatography on two 20 × 20 × 0 . 2 cm silica plates eluting with methanol - dichloromethane ( 5 : 95 ) to give 178 mg of the title compound as a white solid . recrystallization from acetone - hexane gave pure product ( 142 mg ) as white crystals , melting point 210 °- 212 ° c . anal . calc &# 39 ; d for c 25 h 31 fo 4 : c , 72 . 44 ; h , 7 . 54 ; f , 4 . 58 . found : c , 72 . 35 ; h , 7 . 55 ; f , 4 . 70 . a solution of ( 11β , 16β )- 11 , 21 - di ( acetyloxy )- 9 - fluoro - 4 &# 39 ;- methylenepregna - 1 , 4 - dieno [ 16 , 17 - a ] cyclopentane - 3 , 20 - dione ( 0 . 750 g , 1 . 50 mmole , see example 1a ) in acetonitrile - methanol ( 2 : 1 , 45 ml ) was degassed with argon , treated with 1 n lithium hydroxide solution and stirred at room temperature under argon for 1 . 5 hours . the mixture was partitioned between ethyl acetate - 5 % potassium bisulfate , washed with saturated sodium chloride solution , dried over sodium sulfate and evaporated to give 0 . 65 g of the corresponding crude 11 , 21 - diol as a white foam . the crude diol ( 0 . 64 g ) was taken up in acetic anhydride ( 4 . 5 ml )- pyridine ( 3 . 0 ml ) and stirred at room temperature for 45 minutes . the mixture was then treated with 5 % potassium bisulfate solution ( 10 ml ), stirred vigorously for ten minutes then extracted with ethyl acetate . the ethyl acetate extract was washed with 5 % potassium bisulfate , saturated sodium bicarbonate and saturated sodium chloride , dried over sodium sulfate and evaporated . the crude product was purified by flash chromatography on silica gel eluting with ethyl acetatedichloromethane ( 1 : 9 ) to give the title compound ( 522 mg ) as a white foam . crystallization from ethyl acetate - hexane gave pure product ( 460 mg ) as white crystals , melting point 187 °- 188 ° c . analysis calc &# 39 ; d . for c 27 h 33 fo 5 : c , 71 . 03 ; h , 7 . 29 ; f , 4 . 16 . found : c , 70 . 96 ; h , 7 . 25 ; f , 3 . 8 . a solution of ( 11β , 16β )- 21 -( acetyloxy )- 9 - fluoro - 11 - hydroxy - 4 &# 39 ;- methylenepregna - 1 , 4 - dieno [ 16 . 17 - a ] cyclopentane - 3 , 20 - dione ( 150 mg , 0 . 33 mole ; see example 2 ) in a mixture of absolute ethanol ( 7 . 5 ml )- benzene ( 7 . 5 ml ) was treated with tris ( triphenylphosphine ) rhodium chloride ( 150 mg ) and stirred in an atmosphere of hydrogen at room temperature for one hour . the mixture was then evaporated to dryness and the residue filtered through a pad of neutral alumina ( activity ii , 2 - 3 g ) eluting with acetone - hexane ( 35 : 65 ). the yellow residue obtained on evaporation of the eluate was purified first by preparative thin - layer chromatography on two 20 × 20 × 0 . 2 cm silica gel plates eluting with ethyl acetate - dichloromethane ( 1 : 1 ) and finally by flash chromatography on silica ( 25 g ) eluting with acetone - hexane ( 1 : 3 ) to give the title compound ( 127 mg ) as a white foam . crystallization from ethyl acetate - hexane gave the title compound ( 113 mg ) as white crystals . recrystallization from the same solvents gave analytically pure product ( 97 mg ) as white crystals , melting point 179 °- 192 ° c . anal . calc &# 39 ; d . for c 27 h 35 fo 5 : c , 70 . 72 ; h , 7 . 69 ; f , 4 . 14 . found : c , 70 . 64 ; h , 7 . 91 ; f , 4 . 10 . a solution of ( 11β , 16β )- 21 -( acetyloxy )- 9 - fluoro - 11 - hydroxy - 4 &# 39 ;- methylenepregna - 1 , 4 - dieno [ 16 , 17 - a ] cyclopentane - 3 , 20 - dione ( 175 mg , 0 . 38 mmole ; see example 2 ) in a mixture of dichloromethane ( 10 ml ) and methanol ( 10 ml ) at - 78 ° c . ( dry ice - acetone bath ) was treated with ozone until the pale blue color of excess ozone appeared . the excess ozone was immediately discharged by passing a stream of dry nitrogen through the solution and excess dimethylsulfide ( 0 . 5 ml ) was added . after stirring at - 78 ° c . for thirty minutes , at 0 ° c . for thirty minutes and at room temperature for thirty minutes , the mixture was evaporated to dryness . the crude product was purified by preparative thin - layer chromatography on two 20 × 20 × 0 . 2 cm silica gel plates eluting with acetone - dichloromethane ( 1 : 3 ) to give the title compound ( 123 mg ) as a white crystalline solid . recrystallization from acetone - hexane gave pure product ( 101 mg ) as fluffy white crystals , melting point 314 °- 315 ° c . ( dec .). anal . calc &# 39 ; d . for c 26 h 31 fo 6 : c , 68 . 11 ; h , 6 . 82 ; f , 4 . 14 . found : c , 67 . 87 ; h , 6 . 89 ; f , 4 . 13 . a suspension of freshly prepared tris ( triphenylphosphine ) rhodium chloride ( 0 . 30 g ) in a solution of ( 11β , 16β )- 11 , 21 - di ( acetyloxy )- 9 - fluoro - 4 &# 39 ;- methylenepregna - 1 , 4 - dieno [ 16 , 17 - a ] cyclopentane - 3 , 20 - dione ( 298 mg , 0 . 50 mmole ; see example 1a ) in absolute ethanol ( 20 ml )- benzene ( 20 ml ) was stirred under an atmosphere of hydrogen for 45 minutes . the mixture was evaporated to dryness , the residue taken up in dichloromethane and filtered through a pad of neutral alumina eluting with ethyl acetate - dichloromethane ( 1 : 1 ). evaporation of the eluate and purification by flash chromatography on silica gel ( 45 g ) gave the title compound ( 249 mg ), melting point 236 °- 238 ° c . after recrystallization from ethyl acetate - hexane . a solution of ( 11β , 16β )- 11 , 21 - di ( acetyloxy )- 9 - fluoro - 4 &# 39 ;- methylpregna - 1 , 4 - dieno [ 16 , 17 - a ] cyclopentane - 3 , 20 - dione ( 238 mg , 0 . 475 mmole ) in acetonitrile ( 10 . 0 ml ) methanol ( 5 . 0 ml ) was degassed with argon and treated with 1 n lithium hydroxide solution ( 1 . 2 ml , 1 . 2 mmole ) and stirred at room temperature under argon for 2 hours . the mixture was partitioned between ethyl acetate - 5 % potassium bisulfate , the organic phase washed with saturated sodium chloride solution , dried over sodium sulfate and evaporated . the crude product was purified by preparative thin - layer chromatography on two 20 × 20 × 0 . 2 cm silica plates , eluting with methanol - dichloromethane ( 5 : 95 ) to give 166 mg of the title steroid as a white solid . recrystallization from acetone - hexane gave pure product ( 144 mg ) as off - white crystals , melting point 232 °- 236 ° c . anal . calc &# 39 ; d for c 25 h 35 o 4 f : c , 72 . 09 ; h , 7 . 99 ; f , 4 . 56 . found : c , 71 . 93 ; h , 8 . 10 ; f , 4 . 5 .	2
fig1 shows a welding torch 1 with a pipe bend and a contact nozzle fastened to the torch housing 3 . the welding torch 1 is connected to the welding device by a hose package . the protective hose 2 , guided into the welding torch 1 by the hose package , is fastened within the handle of the torch , which usually comprises two handle shells . in the protective hose 2 , the wire core 9 extends , in which the welding wire 10 is conveyed from the welding device into the welding torch 1 up to the contact tube . according to fig2 , a metal bushing 4 is arranged form - fit at the end of the protective hose 2 . the bushing 4 is basically designed cylindrically , but a central part 5 is sphere - shaped . this central part 5 is used for fastening it within the handle shell , with a rotatable and / or pivotable support being provided and twisting within the torch housing 3 and / or the handle shells being prevented due to the sphere - shaped design . a circular movement of the bushing 4 within a restricted radius is possible as well . the protective hose 2 is thus rotatably fastened to the welding torch 1 , allowing an infinite rotation . this fastening is independent from whether the welding torch 1 has a drive unit 19 or not . preferably , the fastening is performed such that in each of the handle shells of the torch housing 3 of the welding torch 1 a corresponding recess for the central part 5 of the bushing 4 is formed in the shape of a ridge 6 . after assembling the handle shells to form the torch housing 3 , the ridges 6 of the handle shells enclose the central part 5 of the bushing 4 while rotating and pivoting the bushing 4 remains possible . the protective hose 2 is thus rotatably fastened to the welding torch 1 . moreover , the protective hose 2 is fastened to the welding torch 1 in the axial direction . this is accomplished by two grooves 7 on both sides of the sphere - shaped central part 5 of the bushing 4 , which are engaged by the ridges 6 of the handle shells . in addition to this , the bushing 4 is terminated by rings 8 at its ends , which delimit the grooves 7 with respect to the outside . an axial displacement of the bushing 4 is thus impossible . in the protective hose 2 , the wire core 9 is guided , within which the welding wire 10 is conveyed . since the wire core 9 is intended to be designed replaceable in contrast to the protective hose 2 , a fastening as described below in the form of a clamping device 11 is provided . seen in the conveying direction of the welding wire 10 , the clamping device 11 is arranged downstream of the fastening of the protective hose 2 . corresponding receiving portions for mounting the clamping device 11 are provided in the handle shells of the torch housing of the welding torch 1 . in general , the clamping device 11 has the shape of a pipe 13 , wherein an axial slit 14 is provided . on both sides of the slit 14 and in the center of the pipe 13 , elevations 15 are provided , connected by a screw 16 , so when the screw 16 is tightened , the pipe 13 is compressed and the slit 14 narrows . if the wire core 9 extends through the pipe 13 , the wire core 9 may be clamped and fixed by tightening the screw 16 . this means that wire cores 9 having different diameters within certain boundaries may be fastened . preferably , the clamping device 11 is also mounted rotatably . for example , the clamping device 11 is arranged on a mounting plate 17 , which is fixed in the receiving portions of the handle shells of the welding torch 1 . the mounting plate 17 may , for example , have a receiving device 18 into which the clamping device 11 is fitted . in this case , the receiving device 18 receives the ends of the pipe 13 , with a free space being provided for the elevations 15 of the pipe 13 . this free space allows the rotating and / or pivoting of the clamping device 11 in a range of up to 180 °. however , the clamping device 11 may also be fastened in the handle shells , allowing an infinite rotation here as well . this means that no mounting plate 17 is required here . the protective hose 2 and the wire core 9 are rotatably fastened one behind the other within the housing of the welding torch 1 . the wire core 9 projects beyond the clamping device 11 so the welder can place the end of the wire core 9 correctly . regarding a welding torch 1 having a drive unit 19 , as illustrated in fig2 , the end of the wire core 9 is placed within a wire inlet nozzle 12 so the welding wire 10 may leave it under a very accurate , centered guidance and may be transferred to the drive unit 19 . if the wire inlet nozzle 12 is designed transparently , this process is made considerably easier . preferably , the wire inlet nozzle 12 is fastened in the receiving device 18 of the clamping device 11 on one side and in a pivoting axis of a tension lever for a pressing roller of the drive unit 19 on the other side . in such a construction , the welding wire 10 is conveyed through the pivoting axis of the tension lever . the design of the drive unit 19 is known in general from the prior art , so it is not described in detail . regarding a welding torch 1 without a drive unit , the end of the wire core 9 is placed within a contact tube , wherein the welding wire is contacted and then leaves the welding torch 1 ( not illustrated ) in mig / mag welding .	1
a neural network resource sizing apparatus for database applications will now be described . in the following exemplary description numerous specific details are set forth in order to provide a more thorough understanding of embodiments of the invention . it will be apparent , however , to an artisan of ordinary skill that the present invention may be practiced without incorporating all aspects of the specific details described herein . in other instances , specific features , quantities , or measurements well known to those of ordinary skill in the art have not been described in detail so as not to obscure the invention . readers should note that although examples of the invention are set forth herein , the claims , and the full scope of any equivalents , are what define the metes and bounds of the invention . fig1 shows a graphical representation of a perceptron showing inputs p 1 through pr input to the perceptron layer that yields resource utilization outputs a 1 through as . inputs p 1 through pr may be configured as follows in one embodiment of the invention : outputs from perceptron layer may be as follows in one embodiment of the invention : a 1 = amount of recommended processing power in a desired benchmark ( spec , dhrystone , etc .) each neuron in the perceptron layer is represented as a summation symbol followed by a hardlim , i . e ., hard - limit transfer function . the hardlim transfer function returns a zero or one . the perceptron neuron produces a zero if the net input into the hardlim transfer function is less than zero , or a one if the net input to the hardlim transfer function is equal to or greater than zero . the hardlim transfer function allows the perceptron neuron to split the input space into two regions . the weighting matrix w is correlates the weights of each input against each neuron . by applying multiple vectors of inputs and recommended outputs to the neural network , the neural network is trained to output recommended resource capacities for a given database application version . fig2 is an equivalent view of fig1 using different neural network notation . in this diagram input is shown as a bar to indicate that it is a vector of size r . regardless of the notation used , the inputs , outputs and training are the same . fig3 shows the perceptron learning rule formulas . the goal of training the perceptron is to minimize the error “ e ” which is the difference between the target vector “ t ” and the neuron response vector “ a ”. by altering the weights in weight vector w based on the input vector “ p ”, the new weight vector w ( new ) is calculated from w ( old ) and error “ e ” and input vector “ p ”. for example if an input vector is presented and the output is correct , then the weight vector “ w ” is not altered . if the neuron output is zero and should be one , “ a ” is zero , “ t ” is one and hence “ e ”=“ t ”−“ a ”= 1 , then input vector “ p ” is added to the weight vector “ w ”. if the neuron output is one and should be zero , then the input vector “ p ” is subtracted from the weight vector “ w ”. similarly , the bias can also be updated based on the error “ e ”. one skilled in the art of neural networks will understand that many tools or different types of calculations may be performed to produce an updated weighting matrix w . fig4 shows the weighting matrix w having row indices associated with the destination neuron and column indices associated with the given input . the weighting matrix w comprises the various weight vectors and is updated as more and more test data is used to train the system . in this manner , the neural network may be utilized to recommend resource capacities for database application implementations not yet observed . any updated training information based on existing installations may also be applied to the neural network to further improve the accuracy of the apparatus . anyhow known software package may be utilized to implement the neural network such as for example mathmatica ®. fig5 shows a flowchart detailing a method for obtaining training data . processing starts at 500 . the database is loaded with a first test schema . the order in which test schemas are loaded and utilized to obtain training data does not matter and the input of simple schemas before more complex schemas is exemplary only . a performance load is run on the database application at 502 . there are many tools that may be utilized in order to simulate a load on the database application . the resulting utilization of cpu , ram , disk and / or network resources is obtained at 503 . if there are no more tests to run as determined at 504 , then training data is returned at 508 and processing completes at 509 . if there are more tests to run as determined at 504 , then the database is loaded with the next test schema at 505 . a performance load is placed on the database application with the new test schema at 506 . the resulting utilization of cpu , ram , disk and / or network resources is obtained at 507 . if there are more tests to run at 504 , then another schema is loaded and tested otherwise the training data is returned at 508 and processing ends at 509 . by obtaining a number of resource output results for different database application parameter scenarios , accurate recommended resource output results may be provided . fig6 shows a portal interface to an embodiment of the apparatus . in this figure portlet 600 is shown that may be embedded in another webpage for example . in other embodiments of the invention , a webservice may be utilized in addition to , or in place of the graphical user interface shown in fig6 . in this embodiment of the portlet , the user inputs database application parameters such as for example the number of records , number of lookups , number of images , number of pdf files , number of blobs and number of fields in the database for the given schema in input area 601 . calculate button 602 is pressed and recommended resource output results are shown in recommended resource output results area 603 . optionally , recommended servers or hardware products that meet the required capacities may be shown . a recommended server may be shown either if the recommended resources capacities are within the bounds of the recommended server for example . webservice embodiments may be utilized for example that allow for a given database application implementation to routinely report utilization numbers that occur over time . these reports may be used over time to increase the accuracy of the neural network or to flag problems . for example if a particular installation appears to be losing ground in resource utilization with respect to the planned resources , then this may indicate that there are problems with the system such as hardware problems or over utilized resources which limit the amount of resources that a particular installation may utilize . for example , if the amount of disk for a given installation drops and the number of main data records rises , then the amount of ram utilized may result in swapping or thrashing . this information may be utilized to not only update the neural network , but also to alert support personnel that there may be a problem . fig7 shows a first test schema for generating a resource learning session . test schema 700 utilizes a main data table without lookups and with 5000 product records . the database application may make use of family based data which builds upon an existing hierarchy of manufacturer and category however this is optional . the number of pdf files in the 5000 data records is known and is used as an input for training for this test schema . a load module is run against the schema that defines the database application parameters and resource utilization is recorded such as cpu , ram , disk and / or the network as resource output results . the database application parameters and resource output results ( or resource output results rounded up to the meet hardware capable of handling the load for example ) are saved and input to the neural network for training the neural network . any factor for increasing the resource output results to add a safety margin is in keeping with the spirit of the invention . fig8 shows a second test schema for generating a resource learning session . test schema 800 also includes lookups based on attributes that are associated in the main table with a category as per category - attribute table 801 . the attribute names and types are shown in attributes table 802 . the main data table in this case utilizes 100 , 000 records and may have a variety of loads place on the database application in order to generate one or more performance points for use in training the neural network . generally , the more training that can be applied to the neural network over varying parameters , the more accurate the resulting recommended resource output results become . although the example shown in fig8 is simplified for brevity , any number of fields , blobs and field widths may be utilized for example in order to provide an array of various tests for a particular database application implementation and given hardware setup . fig9 shows an architectural diagram having a test server for training the neural net and also a portal with an html interface and a webservice interface utilizing xml . load tester load interfaces with server test server associated with database db . server test server utilizes test schemas 1 through n as inputs for a test . the apparatus obtains the database application parameters associated with each database schema , installation , implementation , version or any other database related element and along with the load test results that result from running load tester load . test server or any other computing element coupled with the apparatus then trains neural net nn with these database application parameters and resource output result parameters . when a user of the apparatus desires recommendations for a desired database application , the apparatus obtains the desired database application parameters and provides at least one recommended resource output result based on neural network nn as trained . the interface to the apparatus may include html via portal interface html or portal interface webservice . any other method of training neural network nn is in keeping with the spirit of the invention so long as database application parameters are utilized in training neural network nn to provide recommended resource output results . ( see fig6 for an html embodiment of the portal interface html ). fig1 shows an embodiment of the xml input and output used by the webservice interface . xml input message 1000 shows elements associated with database parameters residing within element designated dbparameter . the various database application parameters used follow and include numberofrecords , numberoflookups , numberofimages , numberofpdffiles , numberofblobs and numberoffields along with the associated values . xml output message from the webservice includes elements associated with recommended resource capacities residing in element recommendedcapacity . the various recommended capacity elements used follow and include cpu , ram , disk , network and server . any variation of the database application parameters and recommended resource output results is in keeping with the spirit of the invention and those shown in fig1 are exemplary . while the invention herein disclosed has been described by means of specific embodiments and applications thereof , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope of the invention set forth in the claims .	6
with initial reference to fig1 , a transition piece ( tp ) for a turbomachine , for example a gas turbine engine , is indicated generally at 2 . transition piece 2 is operatively connected between a turbine combustor portion ( not shown ) and a first turbine stage 4 . towards that end , transition piece 2 includes a main body 8 having a first end 10 that extends to a second end 12 through an intermediate portion 14 . in accordance with one aspect of the exemplary embodiment , transition piece 2 is formed from a nickel - based alloy such as , but not limited to , nimonic ® 263 . in the exemplary embodiment shown , first end 10 of transition piece 2 is supported upon the gas turbine by a forward mount 20 while second end 12 connects to first turbine stage 4 through a picture frame or seal land 40 establishing a turbine interface ( not separately labeled ). as best shown in fig2 , seal land 40 includes a first side wall 50 having a first surface 51 , a second surface 52 and a third or connecting surface 53 . seal land 40 further includes a second side wall 56 having a first surface 57 , a second surface 58 and a third or connecting surface 59 . finally , seal land 40 is shown to include a third wall 62 that connects first and second walls 50 and 56 so as to define a slot 70 . as shown , seal land 40 provides an interface between transition piece 2 and first turbine stage 4 . that is , first turbine stage 4 is provided with a seal element 80 that operatably engages seal land 40 in order to prevent hot gases passing through transition piece 2 from escaping or leaking from the turbine interface . in the exemplary embodiment shown , seal element 80 includes a first leg portion 82 , a second leg portion 83 and a retaining portion 84 . retaining portion 84 includes a clip section 86 that retains a seal cloth 90 in a desired orientation . that is , seal cloth 90 extends into slot 70 and engages with first wall 50 to establish a seal between transition piece 2 and first turbine stage 4 . seal cloth 90 is preferably formed from a cobalt based alloy , such as , but not limited to , l - 605 or l - 606 , and is flexible so as to enable movement between transition piece 2 and first turbine stage 4 while , at the same time , preventing hot gases from escaping . however , over time , and through a number of combustion intervals , seal cloth 90 will abrade first sidewall 50 creating wear which , if left unchecked , may result in leakage of hot gas from transition piece 2 . towards that end , the seal land 40 must be repaired in order to minimize wear and eliminate potential leak paths . reference will now be made to fig3 through 5 in describing an exemplary method of repairing seal land 40 . initially , transition piece 2 is removed from the gas turbine exposing seal land 40 . at this point , first surface 51 is blended to an even thickness so as to have a width of approximately 0 . 190 inches . after establishing a uniform thickness for slot 70 , a wear strip 100 is bonded to first surface 51 of first side wall 50 . wear strip 100 is preferably made from the same material as transition piece 2 , e . g ., a nickel based alloy such as , but not limited to , nimonic ® 263 , and is welded to first surface 51 . wear strip 100 , when properly positioned within slot 70 creates a thickness of between approximately 0 . 160 inches ( 4 . 064 mm ) and 0 . 190 - inches ( 4 . 826 mm ). after attaching wear strip 100 , a slot protector 104 is installed . slot protector 104 is bonded to wear strip 100 so as to restore blueprint dimensions for seal land 40 . that is , in accordance with one aspect of the exemplary embodiment , slot protector 104 has a thickness of approximately 0 . 030 - inches ( 0 . 762 mm ) so as to restore slot 70 to approximately blueprint dimensions such as , a thickness of between approximately 0 . 190 - inches ( 4 . 826 mm ) and 0 . 220 - inches ( 5 . 588 mm ). slot protector 104 in accordance with one aspect of the invention is formed from a cobalt - based alloy such as , but not limited to , l - 605 or l - 606 , and is stitch welded to wear strip 100 . by forming slot protector 104 from the same material as seal cloth 90 , e . g ., l - 605 or l - 606 , additional wear resistance is provided for seal land 40 such that abrasions or other forms of wear are substantially eliminated . reference will now be made to fig6 in describing a slot protector 114 constructed in accordance with a second embodiment of the present invention . as shown , slot protector 114 is s - shaped and secured to first surface 51 of first sidewall 50 . more specifically , slot protector 114 includes a first end 116 that extends across third wall 62 to an intermediate section 117 that runs along first surface 51 before terminating at a second end 118 that extends across a portion of third surface 53 . with this arrangement , slot protector 114 not only protects first surface 51 of seal land 40 but also outer surfaces of third wall 62 and third surface 53 . in further accordance with the exemplary embodiment shown , seal land 40 includes an outer wear insert 125 mounted to second surface 52 of first sidewall 50 . more specifically , while forming slot 70 so as to have a substantially uniform thickness , a recess 130 is formed in second surface 52 and a chamfer 132 is provided at third surface 53 . with this arrangement , outer wear insert 125 is secured to second surface 52 to provide additional wear characteristics between second leg portion 83 of seal element 80 and transition piece 2 . that is , outer wear insert 125 includes a first section 138 that extends along second surface 52 to a curved section 139 before terminating in a third section 140 that extends along third surface 53 . outer wear insert 125 is , in accordance with an exemplary embodiment herementioned , formed from a cobalt based alloy such as , but not limited to , l - 605 or l - 606 . with this arrangement , slot protector 114 and outer wear insert 125 provide additional wear resistance for seal land 40 increasing an overall service life of transition piece 2 . that is , by adding a slot protector to seal land 40 , repeated welding steps to attach the wear strip are eliminated thereby also eliminating thermal cycling which , over time , will weaken seal land 40 . the further addition of an outer wear insert serves to even further enhance the overall service life of transition piece 2 . in general , this written description uses examples to disclose the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any incorporated methods . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of exemplary embodiments of the present invention if they have structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal language of the claims .	8
the game described herein is a so - called “ smart game ” that is directed toward promoting physical activity in a socialized context as appropriate for adolescents in the range of approximately 11 - 14 years of age . the invention is described below ; exemplary games are provided below , and aspects of the inventive system and game are depicted in fig1 - 5 . the inventive physical activity - promoting game system utilizes a plurality of networked game modules . each module may include one or more lights , a touch sensor , telemetry for sending and / or receiving information to another module , and a rugged but compliant outer surface . the touch sensors may be activatable from specific marked locations on the surface of the module , or the touch sensor may be responsive to a touch anywhere on the surface of the module . the sensitivity of the sensors may be adjustable , as may be appropriate for different games or different age groups , or different game playing styles . touch sensors of any conventional type may be included within embodiments of the invention , such as sensors that are responsive to a change in capacitance or resistance , sensitive to infrared radiation , sensitive to a surface acoustic wave , or sensitive to a piezo - electric effect . the physical activity - promoting game system includes a programmable controller in the form of computer , with which the modules may be in communication directly or by way of a hub module . in some embodiments , some aspects of program control may be distributed into the hub module . the controller , either configured within a computer or a hub module , may include a user interface , in the form of a touch - screen , by way of example , for receiving or transmitting instructions and / or information . in some variations , the module controller is a module that is configured to act as the “ master ” module , and the other modules are “ slave ” or “ client ” modules that are under control of the “ master ” module . one or more modules may include a speaker , the audio output of the speaker being under the control of a programmable controller , and enabled to receive input from a digital music player , as transmitted over the internet , or as transmitted by any means . typical embodiments of the physical activity - promoting game of the present invention may include a set of several game modules . in one embodiment , a module is a hemispherical or domed , flat - bottom silicon plastic device that has one or more touch sensors and is in electronic communication with the other modules . particulars of the shape of the module , however , are not critical to the function of the modules , and they may be of any reasonable shape that allows the game to be played without hindering aspects of the game , or being hazardous to players . although electronic communication may be provided by direct electrical connections , in some typical embodiments of the invention wireless communication , such as bluetooth or other radiofrequencies , connects the modules in a network . wireless communication provides the advantage of allowing the modules to be distributed easily , without entanglement of connecting wires . a game set may include five modules , merely by way of example , but embodiments of the game may include fewer or more than five modules . in some embodiments , the connected or networked modules are configured into a system with a main module that serves as a hub for one or more slave , client , or ancillary modules . the hub module functions as a wireless router , interfacing between the client modules and a computer that handles processing and includes displays that are informative of function and control options , and further provides internet connectivity . in some embodiments of the invention , a computer operating system ( linux - based , for example ), memory , processing capability , software running ability , and display functionality may be included within the hub itself . accordingly , depending on the balance of processing , software handling , and display capabilities between a computer and a hub , the hub may serve as the primary user interface . a hub module also may serve as a charging station for the client modules . in some embodiments , the hub and client modules are stored in a connected configuration that maintains the charge in batteries within the client modules . a hub module within the game set , for example , may include a speaker that plays music that is transmitted to it from a local music player . the music player in various embodiments may be connected to the main module by wires , or it may be a music player configured for wireless communication , such as an ipod or any other suitable music player . by way of the music player , participants in the game may use any music of their choosing . in still other embodiments , the music player is not separate from the main module , but instead fully integrated within it , or alternatively , operably attached to the main module , the module acting as a port for the music player . a user interface may also be included in the system ; it may be included in the main module , or it may be separate and freestanding . the user interface provides a means by which to select the operational mode of the system ( examples provided below ), and to allow input of rules or selection of variables by which operational modes may proceed . additionally , the user interface allows users to make music selections or vary the operation of the lights on the modules . modules may be powered by any appropriate source , including battery power or direct power as provided from an external source . modules typically include a rechargeable battery . a module battery can be recharged individually , or a set of modules can be charged in a charging dock . in still other embodiments , the hub module itself may be configured as a charging station that can be electrically connected to client modules for charging the client modules . in other embodiments , the ancillary modules may also have their own speakers . in some variations , modules include lights for decorative effect or to coordinately flash with the beat of music being played . any suitable lighting system is within the scope of the invention ; one particular embodiment makes use of multi - colored light - emitting diodes ( leds ), which may be battery - powered or powered by solar - powered units built into the modules . in some embodiments , instead of , or in addition to lights , the modules may include video screens that play video or flash or project images in coordination with played music . images may also be projected within the device itself . embodiments that include a video player typically include standard programmed images , but are further configured to be able to import other images from an image file transmitting source . modules may communicate with each other and / or with the module controller by any appropriate method , including wired and wireless systems . for example , modules may be in wireless communication with each other , with the main module serving as a connectivity hub . the audio system and lights ( leds ) may be under coordinated and programmable control by a controller , and further responsive to external input by way of touch - sensitive sensors on each game module . in typical embodiments of a game , lights are displayed in a sequence , from module to module . this sequence of lights represents the path that a game player follows , touching each module as it is lit in a sequence . the touch - sensitive sensors are configured to convey signals in response to being touched , and such signals are received by the controller and feed into regulating or controlling the sequence in which lights are displayed on the modules . the modules may be durable and waterproof . in some variations , the base is sufficiently adhesive to stick to the floor or wall , or any flat surface , but also sufficiently non - adhesive that it can be pulled away when the game is done . the weakly - adhesive feature of the modules may be created through the use of approaches well - known in the art ; for example by using weak adhesives as provided by 3m corporation in their post - it notes ® or , by using hook and loop paired fastening surfaces such as velcro ®, or through suction cups located at the bottom of the units . game modules can easily be stored , for example , by hanging them on a wall . to set up the game , modules may be distributed to sites within a game play area , which can be either inside or out of doors . thus , modules may be configured to be very rugged and weatherproof , allowing a play area to be set up in almost any environment that is accessible and safe for play , such as in a park , in the snow , or on a beach . ruggedness and weatherproofing may be imparted variously by way of methods and materials well - known in the art . for example , plastics used may be rendered with appropriate levels of thickness , edges can be rounded , joints may be minimized and when necessarily present , be tightly - sealed . internal electrical components within the module can be protected from physical disturbance by being well seated , isolated from contact with other components , and provided insulation and shock absorbing features . in another embodiment , the device itself may be created from soft , flexible materials that can include silicone . the game system may also include a charging dock , separate from the hub module , which can accommodate a plurality of modules . a typical charging dock may accommodate five modules , merely by way of example , but some embodiments of the charging dock may include fewer docking connections , while other embodiments may include more . the invention may include web - based connectivity to an online application . typically , players who engage the online aspect of the game system register with the system with a game name and a password . by connecting to a web page , players can enter and track their own game - associated statistics , and such statistics can be clustered into groups or rankings for comparison . the online application can provide games and rules for players , as well as deliver software and firmware updates to the modules or a computer within the module network . the online application can also generally create an easily accessible environment that fosters community among the players collectively and supports creativity and a sense of individual presence for individual players . the games that may be played with the game system described herein may be considered “ smart games ” in that they promote physical activity of the players . physical activity is considered to be an effective means of countering childhood obesity . it is believed that habits and attitudes engendered by playing the game will help cultivate a lifestyle that embraces physical activity as a way of having fun and engenders a sense of well being . these games are characterized by various features that may encourage the incorporation of physical activity into daily activity by virtue of the accessibility of the game and the positive association between enjoyment of the game and the enjoyment of activity that comes with the game . for example , the game system is simple , thereby making the game accessible and affordable . game components are portable , and can be battery - operated so an electrical outlet is not necessary . adult supervision is not necessary because of the game &# 39 ; s basic safeness and simplicity . without adult supervision , adolescents feel freer , less inhibited , develop a greater sense of independence , and can take ownership of the game and pride in their accomplishment . as noted in the summary , embodiments of the invention provide methods of playing a physically - active game according to a set of rules of a game program , some examples of which are provided below . while the games vary in their specifics , they have a common thread which includes moving from one networked game module to next in a sequence prescribed by the game , touching the module , and moving on . in some embodiments of game play , a module may need to be touched , and then the player moves back to a home base ( typically , the hub module ), and then the player moves on to the next module in sequence . in most embodiments of game play , the moving step is a literal one ; according to the method of playing the game , modules must be placed far enough apart that game players need to physically move from one location to another . generally , modules are not placed close enough together that they can be touched without taking at least one step . these general rules , however , are not meant to exclude players with physical handicaps who nevertheless have self - mobility , and indeed , game rules are readily modifiable to suit players of any level of physical ability . for those players who may be wheelchair - bound , for example , movement means moving the wheelchair for a distance greater than an arm &# 39 ; s length , or about a full rotation of a wheel of the chair . for players who rely on crutches , canes , or a walker , movement means covering a distance of at least one stride by whatever manner the player moves . for players whose physical disabilities preclude moving any significant distance , modules may be placed within their arm &# 39 ; s reach . the underlying principle is that the game is modifiable to be appropriate for all players , while encouraging physical activity within their means . the games are also easily modified and can thus fit into a large variety of contexts , as defined either by local culture , norms of behavior , or age group . modifications and variations come from the variety of music that can be selected to fit the preferences of the players , and from variations in the rules . although the game system , as played in its various operating modes , may be played by several players , for example in a range of three to a dozen players , in some instances games may be played by a solo player or by many players , the upper limit often being constrained by the bounds of the game area . the led lights may also allow games to be played in the dim light of evening or in the dark . the game system is particularly appropriate for adolescents who are in transition individually and at various stages collectively in their social and athletic development . games played with the game system may be highly competitive or played simply for fun . as mentioned above , games may be played by a solo player playing against the clock for example , or played simply for pleasure or practice . in some types of games , teams may be formed and scoring systems applied , or relays may be formed , as for example in the game mode . the game system is well suited for parties of any occasion , birthdays , or holidays , for sleepover parties , or family events . further , while the game is generally designed to appeal to adolescents , people of any age may participate , as in the family event example . the game modules may be configured to play in various operational modes that support related games . some game parameters are common to one or more operational modes ; for example , play in various modes can progress through increasing levels of difficulty such that greater speed and agility are required . games may be played in a number of rounds , according the specifics of the game . rounds may be determined prior to initiating the game , and may be essentially repetitions of the same basic rules , rounds can be defined by the players participating in the particular round , and rounds may be used as points at which rules change , such as scoring rules , or the level of difficulty changes . degree of difficulty may be increased by quickening the rate at which the modules need to be touched by the player ( as driven by the controller ), or by increasing the distance between the modules , or by modifying the duration of light , sound or projection emanating from the next module in sequence to be touched . for example , a game rule may be introduced that a maximum of some unit of time ( 8 seconds , for example ) is allowed between module touches . if that time limit is exceeded , a score penalty may be assessed . in some game embodiments , the distance between modules can be distributed into different level of difficulty categories . strictly for example and without limitation regarding absolute distances , a low difficulty level can indicate an average distance of 8 feet between modules , a moderate difficulty level can indicate an average of 16 feet between modules , and high level of difficulty can indicate an average of 24 feet between modules . networked game modules may also be “ active ” even when they are not being actively used in a game , as exemplified in the “ at ease ” mode described below . some exemplary operational modes and particular games are described briefly in the following section . dance mode : in this mode , the modules light up so as to direct a player to touch the module with his or her feet or hands ( or any body part ) so as to be incorporated into a series of dance moves . this game embodiment may use a digital music player included in the system . musical selections may be made the players before the game is initiated . as the game progresses , the level of difficulty increases in terms of the tempo of the music , and the complexity of the sequences in which the modules light up . race mode : in this mode , a player follows a sequence of modules as they light up , with a series of physical touches to the modules that mimic the lighting sequence . the focus in this game is on speed of the player moving through the sequence . squish mode : this game focuses on a variation in the light indication of the next module to touch in that the light is on for only a short amount of time , regardless of how soon the player arrives at the module . in this mode , the goal of the player is to touch or “ squish ” the game module while it is glowing with a sufficient required level of force before the light fades away on its own time course , and then move onto the next glowing module . the level of difficulty can be increased by increasing the distance between the modules as they are placed in the game area . obstacle course : the game modules allow players to make their own rules and design their own obstacle course to race against each other . for example , one game module may be placed at the top of the stairs , one behind the couch , one in the kitchen , and one under the table . in some embodiments , game players can be handicapped with respect to each other . for example , in the first round of the game players have an even start and the results are translated into a handicap . in following rounds , players are held at the starting line for a period of time according to their handicap , so that the faster players of round one start later than the slower players . at the conclusion of a match , players can check out their scores and see the progress on a web - based activity page . bomb squad : in this game , the players are part of the bomb squad . in a first round , one player hides the pods around the house and second player has to find them before they undergo a simulated “ blow up ”, as may - be indicated by sound and light effects . in a second round , the roles can be reversed ; the second player hides the game modules and the first player tries to find them before they “ blow up ”. for game scoring purposes , a greater distance between the game modules yields a higher number of points . further , a negative scoring consequence results from a player not touching a module soon enough , such that it “ blows up ”. such blowing up , of course , is entirely figurative , and may be supported by sound and light effects emanating from the module . scores are recorded on a web - based activity page , and players can compare their scores to each other , and track their own progress from game to game . text course : in this game , the modules are configured as three - letter texting keys as on a keypad . players can type out text messages to other players by texting methods , such as taping pod 4 once for “ g ”, twice for “ h ” and three times for “ i ”. points are accumulated according to how much text is delivered in a particular time frame , and the score can be amplified according to the distance between modules . in other modes , the game is un - scored and the goal is to communicate messages to other players . remember the sequence : in this game , the correct sequence in which the modules are to be touched is played at the outset of a round , even before a player starts his sequential module touching course . this game thus adds a memory or recall challenge to the game play , as the player needs to remember the sequence while running the module course . name that tune : in this game , as already described above , as a game round progresses from module to module , an increasing number of notes of a familiar song are played , starting for example with two or three notes , and increasing the notes until the song becomes recognizable . players compete on the basis of the quickness of their progression through the module sequence as well as their skill at recognizing the song . this game , like “ remember the sequence ” includes a form of mental challenge in addition to the more physical challenge posed by navigating movement through the course of modules in sequence . free play mode : in this mode , the modules can be used to play game that emulates a traditional game , such as softball , kickball , or whiffle ball . for example , in a variation of softball , the module can be used as a base which glows when a player arrives safely at the base . return to home base mode : this is a mode that can be applied to many games as an option , or as integral to the game . in this mode , the sequential course of module to be run included a return to a home base after each new module is touched in the sequence . at ease mode : this is a mode for the modules when they are not in an active game mode . in this mode , the modules may be in the charging dock , or they may be free standing as long as they have sufficient power to operate . in this mode , the modules may be playing music , or they may be decoratively flashing their leds in a programmed pattern to provide a light show , or the lights may be put into a still or slowly moving pattern to provide ambient light . the leds may either operate independently of music , or in a manner coordinated with it , as happens in the dance mode . typically , the modules may be placed in an “ at ease ” mode when they are connected to a charging dock , as for example , while they hang on a wall in a child &# 39 ; s room . blind man &# 39 ; s bluff : in this game , a version of the traditional ‘ blind man &# 39 ; s bluff ”, a player is blindfolded and has to walk through a “ mine field ” of modules . as the player nears the modules , the modules emit sound . if you step on one it makes a loud noise . winning the round means that the player got through the field without stepping on a module . aspects of the inventive game and method of game play are depicted in exemplary fig1 - 5 . fig1 shows a game module , more particularly a hub module 21 with various features such as indicator lights 27 , a touch sensor 25 , a speaker 31 , and an image projector 33 . typical embodiments of a client module have at least indicator lights and a touch sensor , but may have other features as well . the indicator lights are typically leds which are advantageous for their low cost , low power use , robustness , and easy replacement if necessary . a module may include one or more lights ; the lights may be electrically configured to light up in unison , or they may be programmed to light up in a sequence , or they may be individually controllable by the controller , per rules of the game being run by the controller . a game module must have at least one touch sensor , but may have more than one . typically , the touch sensor is located in the central portion of the upper surface module for easy touching accessibility , but may be placed anywhere on an upper surface of the module . a client module can be very similar in appearance to the illustrated hub module , but it may have fewer features . fig2 shows a hub game module 21 and several client game modules 22 distributed for game play . the hub module is in wireless communication with a computer controller 12 , the hub module 21 is in wireless communication with each of the client modules 22 , and the computer in wireless internet 41 based communication with a remote server 43 . the wireless communication , which goes both ways , is represented by zap lines . the placement of the modules is a figurative example of many possibilities , as described above . the arrow indicates a sequence in which the modules could be activated by a notifier element , and accordingly , represents the path that a player would run during the course of a round of the game with the modules activating by this sequence . in this particular sequence , for example , a client module 22 is activated first , then the hub module 21 , and then a series of client modules 22 . fig3 shows a schematic distribution of game modules , including a hub module 21 and client modules 22 and an exemplary path that a game player would follow from one module to the next during a segment of game play . the distribution of game modules is entirely at the discretion of the players , and any location within the reach of all players is appropriate . modules may be placed on a wall , for example , if they have an attachment or adhesive feature on their lower surface , but to be fair , the modules should be placed within reach of the shortest player . any physical disabilities of players should also be taken into account when selecting game modes . the distribution pattern of the game modules is a factor in the degree of difficulty of the game , in general , a more widely distributed set of modules increases exertion in the game as do modes with potentially longer sequences of module activation ( such as the ‘ name that tune ’ mode or ‘ remember the sequence ’ mode ). distribution pattern can be coupled with time - biased scoring as well , where negative effects on scoring can be computed based on a time limit factor applied to individual legs of the sequence . fig4 a - 4b provides several views of the game modules 22 and a player 17 who may be seen touching a module by bending down ( fig4 a ), diving for a module and making a hand touch ( fig4 b ), making a hit on a module by stepping on it ( fig4 c ), and touching a wall - mounted module ( fig4 d ). this figure depicts aspects of the action of the game as well as the generally robust construction of the modules such that they can withstand hard touches , being stepped on , and being moved repeatedly in some modes . fig5 shows a set of game modules , including a including a hub module 21 and client modules 22 , that have been placed in a charging dock 35 , which is connected to a power outlet . the charging dock also generally serves as a storage container for the modules even when the dock is not connected to a power source . the configuration shown in fig5 is an example , the configuration may be of any form , but generally advantageous features include compactness and durability . the modules need not be positioned on the same level ; they may also be stacked . some embodiments of the charging station have a handle , or include a cover or a case , such components being advantageous for storage in a closet , for example , as well as being advantageous in providing a portable carrying case . still further embodiments may be adapted for mounting on a wall . the advantage of this configuration includes not using floor space . further , in some embodiments of the mode of operation , as in the “ at ease ” described above , the modules may provide a background form of entertainment or ambience if they are put into a light show or projector type of operation . further , inasmuch as they include a music player and speakers , they can be used as a music source . unless defined otherwise , all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art of game and networking technologies . specific methods , devices , and materials may be described in this application , but any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention . while embodiments of the invention have been described in some detail and by way of exemplary illustrations , such illustration is for purposes of clarity of understanding only , and is not intended to be limiting . various terms have been used in the description to convey an understanding of the invention ; it will be understood that the meaning of these various terms extends to common linguistic or grammatical variations or forms thereof . it will also be understood that when terminology referring to devices or equipment , or common names , that these terms or names are provided as contemporary examples , and the invention is not limited by such literal scope . terminology that is introduced at a later date that may be reasonably understood as a derivative of a contemporary term or designating of a hierarchal subset embraced by a contemporary term will be understood as having been described by the now contemporary terminology . further , while some theoretical considerations have been advanced in furtherance of providing an understanding of the invention , such as the therapeutic effectiveness of physical activity in countering obesity , the claims to the invention are not bound by such theory . moreover , any one or more features of any embodiment of the invention can be combined with any one or more other features of any other embodiment of the invention , without departing from the scope of the invention . still further , it should be understood that the invention is not limited to the embodiments that have been set forth for purposes of exemplification , but is to be defined only by a fair reading of claims that are appended to the patent application , including the full range of equivalency to which each element thereof is entitled .	7
a preferred embodiment of the present invention comprises a front projection system that integrates an optical engine , having modular control and power supply electronics , and a dedicated projection screen to provide a compact and light video display device . fig3 - 6 illustrate a first exemplary embodiment of an integrated front projection system 100 in accordance with the present invention . the front projection system 100 includes a dedicated high gain projection screen 102 mounted on a frame 104 . a projection head 106 is pivotally mounted by an arm 108 to a center top portion of the frame 104 at a hinge unit i 1 0 . the arm 108 may be rotated out 90 ′ allowing the projection head 106 to pivot from a closed or storage position to an opened or projection position . the screen 102 is optically coupled to the projection head . the screen 102 may be a flexible material extended over frame 104 or may be a rigid component . in an alternative embodiment , both the screen and the frame are made of an integral sheet of material . the screen 102 may include multiple - layers or special coatings , such as to allow its use as an erasable whiteboard . the frame 104 contains and supports other components of the system . the frame 104 may house additional components such , as integrated speakers 112 , input and outputjacks 113 , and a control panel 114 . in the present exemplary embodiment , the mechanical infrastructure of the projection system 100 , the arm 108 and the frame 104 , include lightweight materials such as aluminum magnesium or plastic composites . the entire projection system , accordingly , is relatively light ( 20 - 25 pounds , 9 - 11 kilograms ). in the present exemplary embodiment , the arm 108 is rigid and hollow . the arm 108 comprises die cast aluminum or magnesium , or other suitable materials , surrounded by a hard plastic shell . at the top and center of the frame 104 , the hinge unit 10 allows the projection arm 108 and head 106 to pivot between a closed ( storage ) position and an open ( use ) position . fig4 illustrates the projection system 100 in a closed or storage position . when not in use , the arm 108 may be kept in the closed position as to be substantially parallel with the frame 104 , and thus present no obstruction to objects that may be moving in the space in front of the frame 104 . although the arm is shown folded back to an audience left position , the system may be adaptable to allow storage of the arm and projection head to an audience fight position . an ability to select storage position may be valuable in avoiding obstacles present in the projection area prior to the installation of the system . the ability of the arm 108 to rotate contributes to the projection system &# 39 ; s minimal thickness , approximately 2 - 3 inches ( 5 - 7 . 5 cm . ), in the storage position . the system 100 allows for the projection head 106 to be placed in an exact pivotal registration in the operating or projection mode in relation to the optical screen 102 . in system 100 , use position is at a normal arm angle with respect to the screen and generally above the screen . however , other embodiments may be designed around other predetermined positions . movement between the two positions may be assisted manually or may be motor - driven . in the present embodiment , an electrical motor 116 residing within the hinge unit 110 controls the movement of the arm 108 . the motor 116 may be ac , dc , manually driven by détentes , over - center - cam ( spring loaded ) or any other suitable type that provides reliable repeatable positioning . the motor 116 is a precision guided gear drive motor having two limit sensor switches to accurately position the arm 108 , and accordingly , the projection head 106 , in precise and repeatable closed and open positions . the movement of the arm 108 and the functions of the projector system 100 may be controlled through the control panel 114 , a remote control ( not shown ), or other control mechanism . while the arm 108 of the projection system 100 is pivotally fixed at a single point , those skilled in the art will readily appreciate that a variety of different linkage and / or pivoting mechanisms may be implemented within the spirit of the present invention . in alternative embodiments , the head and arm may include additional hinge or telescopic movement and the arm may be coupled to other portions of the frame or to a wall or post . as explained in more detail in relation to fig1 - 17 , the system 100 optimizes the coupling of the projection engine with the exact positioning of the head 106 in relation to the screen 102 to yield high contrast , brightest enhancement , image uniformity , optimal image position , and sharp focus . since the optical parameters of the projection engine are known and selected for compatibility and the exact position of the projector head 106 in the use position is known and predetermined , the exemplary screen 102 may be designed and optimized to provide maximum illumination for the audience while reducing interference by ambient light . when active , the projection system i 00 generates a beam of light having a plurality of light rays 162 . in relation to a coordinate system wherein the screen defines a z - plane , each fight ray 162 includes components along both the horizontal x - plane and the vertical y - plane . the angle of incidence of each light beam 162 upon the screen 102 depends on the optical characteristics of the projector , such as f /#, and the position of the projection head 106 in relation to the screen 102 . fig1 is a side elevation of a vertical axis ray diagram , illustrating the reflection of tight beams 162 emitted by projection system 100 . point 60 is the known precise location of the ideal point source for projection lens 140 ( illustrated in fig6 ) when the projection head 106 is in the “ use ” position . the angles of incidence of the light beams 162 on the screen increase along the positive x - direction ( see directional axis in fig1 ). in a traditional screen , the light rays 162 would each be reflected in accordance with their angle of incidence . especially at the sharp projection angle of system 100 , the resulting light pattern would be scattered , with only a portion of the light rays reaching the audience . to compensate for the graduated increase in incidence angles , the screen 102 20 includes a vertically graduated reflection pattern oriented to receive the projected light rays 162 at the expected incidence angle for each point on the screen 102 and to reflect the rays approximately at normal angle along the vertical plane . the light beams 162 are reflected in a direction vertically close to normal because that corresponds to the expected location of the audience . in alternative embodiments where the audience is expected to be in a different position , a different reflection pattern may be implemented . fig1 illustrates a top plan view of the horizontal distribution of the light emanating from point 60 . as the audience is expected to be horizontally distributed , the horizontal reflection pattern of the screen is arranged to provide a wider illumination spread in the horizontal direction . fig1 illustrates an expanded view of a vertical cross - section of the projection screen 104 . fig1 illustrates an expanded plan view of a horizontal cross section of the screen . the projection screen comprises a multi - layer material . the screen 104 includes a first linear fresnel lens element 170 , a second linear fresnel element 172 , and a reflective component 174 . first and second spacer elements 171 and 173 may be placed between the fresnel elements 170 and 172 and between the second fresnel element 172 and the reflective element 174 respectively . the linear fresnel lens elements 170 and 172 include a planar side , 176 and 178 respectively , and a prismatic side , 180 and 182 respectively . the first fresnel element 170 includes a thin isotropic diffusing layer 184 on its planar side 176 . the diffusing layer 184 functions as an image - receiving surface . the prismatic side 180 includes a plurality of linear grooves 186 running horizontally in a graduated pattern . the grooves 186 are designed to control the vertical light spread . the lens center is positioned near the top of the projection screen . the prismatic side 182 of the second linear fresnel lens element 172 includes a plurality of vertical grooves 188 ( fig1 ) facing the plurality of grooves 186 of the first fresnel lens element 170 . the second linear fresnel lens element 172 has a lens center positioned on a vertical line extending through the center of the screen . the planar surface 178 of second fresnel element 172 faces a back reflector 174 , having a vertical linear structure reflecting the light back in the direction &# 39 ; of the audience . the grooves of the structure back reflector 174 preferably have a cylindrical shape , such as a lenticular structure , or may be a repeating groove pattern of micro facets that approximate a cylindrical shape . an incident surface 175 of the back reflector 174 may be specular or diffuse reflecting , metallic , or white coated , depending on the amount of screen gain and type of screen appearance desired . second linear fresnel element 172 , in conjunction with the structured back reflector 174 , provides control of light distribution spreading in the horizontal direction to accommodate viewers who are positioned horizontally in front of the screen . alternatively , the reflector structure 174 may be embossed into the planar surface 178 , reducing the number of screen elements . alternative embodiments of the screen may comprise 3m multi - layer film technology . as may be appreciated in fig5 the projection system 100 places the projection head 106 at an extreme angle and close distance to the screen 102 , thus minimizing the possibility of the presenter &# 39 ; s interference . placement of the optical head 106 at the end of a radically offset projection arm 108 presented unique mechanical and optical challenges . 2 o even the lightest and most compact conventional portable projectors at about 7 lb . ( 3 . 2 kg . ), may have leveraged unbalanced strain upon the structure components . optically , the throw distance necessary to even focus the image would have necessitated a long arm , further creating lever amplified stresses on the structure . even if structurally sound , the system would have projected a severely keystone distorted and relatively small image . an electronic optical engine includes imaging and electronic components . as better illustrated in fig6 in projection system 100 the arm 108 is a rigid hollow structure surrounded by an outer plastic shell 118 . the structure of arm 108 defines an arm chamber 122 and allows for the modular and separate placement of a control and power electronics module 118 and an imaging module 120 . the control and power electronics module 118 includes control boards , ballast , and other electronic components . the electronic elements are internally connected through an array of internal power and data connections . the imaging module 120 includes a light source , projection optics , color wheel and imager . by distributing components of the projection system along the arm and the frame , a lesser load is placed on the hinge and the arm . also , a smaller projector head size becomes possible . those skilled in the art will recognize that a variety of different modular arrangements may be possible within alternative embodiments of the present invention . for example , alternatively , components of the electronics module may be placed inside of frame 104 . a considerable amount emi / rfi shielding is required in traditional projector designs to reduce em crosstalk between the lamp and the electronic components and to have radio frequency containment . the separate placement of electronic components 20 within the arm 108 naturally reduces emi / rfi interference . furthermore , in the exemplary system 100 , the power supply and control electronics module 118 is enclosed by a honeycomb structure 124 including a plurality of hexagonal cells 125 . the honeycomb structure surrounds the power supply and electronics module 118 and provides both emi / rfi shielding and thermal management characteristics . fig1 and 19 illustrate details of the honeycomb structure 124 . as described in co - pending and co - assigned u . s . patent application ser . no . 08 / 883 , 446 , entitled , “ honeycomb light and heat trap for projector ”, which is hereby incorporated by reference , the shape , orientation , thickness and size of the hexagonal cells may be tuned to attenuate specific electromagnetic frequencies . in the present exemplary embodiment , the hexagonal cells 125 are aligned generally longitudinally along the arm 108 and are oriented at a predetermined specific angle φ to attenuate high electromagnetic frequencies . the honeycomb structure 124 is an aluminum hexagonal core having 0 . 25 - 0 . 0625 inch ( 0 . 635 - 0 . 159 cm .) cell size s , 0 . 002 inch (˜ 0 . 005 cm .) foil thickness t , and a corrosion resistant coating . the physical separation of the electronic components and the honeycomb structure 124 provide sufficient attenuation to reduce the need for other traditional coatings or shields . the present arrangement also offers an efficient thermal management system . an air intake 126 is located in the housing of the hinge unit 110 . a fan 130 , located in the projection head 106 , draws air through the air intake 126 , through the interior of the hollow projection arm 108 , cooling the electronic and power supply components 118 located therein . the air exits the projection head 106 through an air outlet 127 . air also may be drawn through the projection head 106 . the flow of cooling air also may be used to cool components located in the projector head 106 or a separate cooling air flow or heat management elements may be employed . the orientation of the honeycomb structure 124 also is designed to act as a convection heat sink to absorb the thermal energy generated by the electronic module 118 and transfers the heat by convection into the flow of cooling air drawn by the fan 130 . the honeycomb structure is oriented to direct airflow over sensitive components . different portions of the honeycomb structure 124 may have different inclination angles φ direct air flow to different components . the chamber 122 may also include exterior or interior fins , 127 and 128 respectively , to act as high efficient heat exchangers for both lamp and electronics cooling . the ability to direct the flow of cooling air with the honeycomb structure 124 into the interior fins 128 allows for better convection cooling , thus enabling the use of a low cfm fan 130 or even the use of naturally created convection . the cooling arrangement offered by the arm and the honeycomb structure also allows for very low overall power consumption and low audible noise . commercially available electronic front projectors are designed to project a specified screen diagonal ( d ) at a specified throw distance ( td ). the throw ratio ( tr ) of i 5 a projector is defined as the ratio of throw distance to screen diagonal . magnification is measured as screen diagonal / imager diagonal . optically , the unobtrusive arrangement of the projection head 106 of projection system 100 requires that the image simultaneously accommodate three very demanding requirements : ( 1 ) short - throw distance , ( 2 ) high magnification , and ( 3 ) large keystone correction . to minimize image shadowing , in the present exemplary embodiment , the projector head 106 is located at a projection angle & gt ; 22 ° and the arm measures about 36 in . (˜ 91 . 4 cms ). the screen 102 has a screen diagonal between 42 to 60 inches (˜ 107 - 152 cms .). accordingly , the design goals for the exemplary display system 100 included ( 1 ) a throw distance ≦ 800 mm ; ( 2 ) a magnification ≧ 50x ; and ( 3 ) keystone correction for a projection angle ≧ 22 °. referring to fig6 the projection head 106 includes a lamp unit 132 , an imager or light valve 134 , condensing optics 136 , a color wheel 138 , a condensing mirror 139 and a projection lens 140 . the projection head may also include polarization converters ( for polarization rotating imagers ), infrared and ultraviolet absorption or reflection filters , an alternative light source possibly coupled with a lamp changing mechanism , reflector mirrors , and other optical components ( not shown ). the lamp unit 132 includes a reflector 131 and a lamp 133 . the reflector 131 focuses the light produced by the lamp 133 through the color wheel 138 . the beam of light then is condensed by the condensing optics 136 and the condensing mirror 139 . the now condensed beam of light is reflected off the condensing mirror and is directed towards the reflective imager 134 , which in turn reflects the light onto the projection lenses 140 . the lamp unit 132 includes an elliptic reflector 131 and a high intensity arc discharge lamp 133 , such as the philips uhp type , from philips , eindhoven , the netherlands , or the osram vip - 270 from osram , berlin , germany . other suitable bulbs and lamp arrangements may be used , such as metal halide or tungsten halogen lamps . in the present exemplary embodiment , the imager 134 comprises a single xga digital micromirror device ( dmd ) having about a 22 mm diagonal , such as those manufactured by texas instruments , inc ., dallas , tex . the color wheel 138 is a spinning red / green / blue ( rgb ) color sequential disc producing 16 . 7 million colors in the projected image . in alternative embodiments , the color wheel and the imager 134 may be replaced by different suitable configurations , such as a liquid crystal rgb color sequential shutter and a reflective or transmissive liquid crystal display ( lcd ) imager . those skilled in the art will readily recognize that other optical components and arrangements may be possible in accordance with the spirit of the present invention . the imager 134 and the lamp 132 may be cooled by the airflow generated by the fan 130 . a further thermal advantage of the arrangement of the present embodiment is that the warmer components , such as the lamp , are located at an end portion of the cooling air flow path , thus preventing the intense heat from the lamp from affecting delicate electronic components . traditional projector lenses proved unsuitable to accomplish the simultaneous requirements of the display system 100 . accordingly , the present invention addresses this problem by the innovative conversion of 35 mm camera lenses having a small f - number and a large field of view into projection lenses . the projection lens 140 has a focal length about 14 to 20 mm , and a speed of f / 2 . 8 or less . suitable lenses include nikon 18 mm ., f / 2 . 8d nikkor from nikon , japan , or canon photo ef 14 mm . f / 2 . 8l usm from canon , japan . the focus of the lens 140 is preset for optimal resolution on screen 102 . to provide 22 ° keystone correction , the light valve center is shifted from the projection lens center by an amount equal to the projection angle . such a large degree of keystone correction is possible because the projection angle is known and is repeatable . at projection angles exceeding 22 °′, the projection lens is selected to have a full field coverage angle exceeding 90 °. in alternative embodiments , even larger keystone correction are possible , thus enabling the use of even a shorter projection arm . the keystone correction features need not be limited only to the optics . keystone corrected optics , electronic keystone correction means , and screen inclination may be combined to achieve a suitable image . in an alternative embodiment , the screen may be motor driven , to reach an inclined projection position at the time that the arm is placed in the open position . fig7 illustrates a second exemplary embodiment of the present invention . the same last two digits in the reference numerals designate similar elements in all exemplary embodiments . to decrease the size of the light engine even further and to reduce the size and weight of projector head 206 and arm 208 , lamp 232 and fan 230 are placed within hinge unit 210 or within frame 204 . power supply and electronic components 218 are located inside frame 204 and behind screen 202 . a sequential color wheel 238 , a projection lens 240 , and condensing optics 236 , including a condensing mirror 239 , remain within the projector head 206 . a flexible illumination waveguide 242 is channeled through the projection arm 208 and couples the illumination from the lamp or light source 232 to the condensing optics 236 . the lamp 232 focuses light into an entrance aperture 244 of the illumination waveguide 242 . the light is transmitted by the illumination waveguide 242 up to an exit aperture 245 , where the light is then directed through the color wheel 138 to the condensing optics 236 and 239 . in the present embodiment , the illumination waveguide 242 is a solid large core plastic optical fiber , such as spotlight type lf90fb from sumitomo 3m company , ltd ., japan , or stay - flex type sel 400 - from lumenyte international corp ., of irvine , calif . cooling in system 200 is performed in a reverse direction than in system 100 . the cooling mechanism or fan 230 draws air from the air intake 226 located in the projection head 206 and exhausts air through the air exhaust 227 located on the hinge unit 210 . fig8 illustrates a third exemplary embodiment of a projection system 300 in accordance with the present invention . the projection system 300 includes a projection head 306 mounted along the mid - span of a pivoting arm 308 . the projection head 306 is substantially similar to the projection head 106 in system 100 . the image projected by a projection lens 340 of the projection head 306 is reflected off a mirror or reflective surface 346 onto a screen 302 . the arrangement of optical system 300 allows for an increased throw distance and magnification while maintaining the same arm length or for the same throw distance and magnification with a shorter pivoting arm . fig9 illustrates a fourth exemplary embodiment of a projection system 400 in accordance with the present invention , having a screen 402 , a frame 404 , a projection head 406 , and an arm 408 . the projection head 406 of the projection system 400 includes a lamp 432 optically aligned with a transmissive color wheel 438 and condensing optics 436 . after passing through the color wheel 438 and the condensing optics 436 , a light beam is focused upon a reflective imager 434 , which , in turn , directs the light beam towards a retrofocus projection lens 440 . the projector system 400 includes modular power supply and system electronics 418 and a separate modular driver board 448 for the imager 434 . fig1 illustrates a fifth exemplary embodiment of a projection system 500 in accordance with the present invention . in the projection system 500 , the power supply electronics 519 are positioned inside of a frame 504 . a hinge 510 couples an arm 508 holding a projector head 506 to the frame 504 . electronic control boards 550 are positioned within the arm 508 . the projection head 506 includes a lamp unit 532 , a polarizer 535 , optics 536 , a transmissive lcd imager 534 , and projection lens 540 , all aligned in a straight optical path . a fan 530 provides ventilation . as illustrated in fig1 , the arm 508 may be rotated a ± 90 ° for storage on the right or the left side . fig1 and 13 illustrate the versatility of the projection system of the present invention . fig1 illustrates a digital whiteboard system 601 including a projection system 600 in accordance with the present invention and an input device , such as a stylus , 653 . the projection system 600 includes integrated electronics for an annotation system 652 , as well as ltv , k laser or other type of sensors 654 . the sensors 654 are calibrated to track the movement of the stylus 653 on the surface of the screen . the stylus 653 similarly may include transmitters and / or sensors to aid in tracking and to coordinate timing or control signals with electronics 652 . the screen 602 may be coated to allow for erasable whiteboard use . the integrated electronics 652 may include a cpu . fig1 illustrates a videoconferencing and / or dataconferencing system 701 , including a projection system 700 in accordance with the present invention . a camera 756 , such as a cmos or ccd camera , is mounted on the projection head 706 or on the frame 704 . the camera 756 may pivot to capture a presenter or to capture documents placed on the screen 702 . alternatively , additional cameras may be directed to the presenter and to the screen . again , the screen may be coated to act as an erasable whiteboard . the camera 756 is directly coupled to a cpu 758 integrally placed within the frame 704 . a microphone 760 also is placed within the frame 704 . additional electronic modules , such as a tuner , network card , sound card , video card , communication devices , and others may be placed within the frame 704 . those skilled in the art will readily appreciate that elements of the present invention may be combined , separately or in one system , to provide videoconferencing , data - conferencing , and electronic whiteboard functions , as well a any other function where a light and compact display system may be useful . as the system of the present invention is designed to optimize the projection image at the predetermined projection position , no set - up adjustments are necessary to the optics , mechanics , or electronics and optimal on - screen performance is consistently offered . the integral structure of the system 100 allows for easier storage and portability and avoids cabling and positioning associated with the use of traditional projectors . those skilled in the art will appreciate that the present invention may be used with a variety of different optical components . while the present invention has been described with a reference to exemplary preferred embodiments , the invention may be embodied in other specific forms without departing from the spirit of the invention . accordingly , it should be understood that the embodiments described and illustrated herein are only exemplary and should not be considered as limiting the scope of the present invention . other variations and modifications may be made in accordance with the spirit and scope of the present invention .	7
before explaining the embodiments of the present invention , the correspondence between the invention stated in the claims and the “ embodiments of the invention ” will be illustrated . the illustration confirms that the embodiments supporting the invention stated in the claims are described in this specification . therefore , even if there is any embodiment which is not positively described in the “ embodiments of the invention ” as a one corresponding to the invention , it does not mean that the embodiment does not correspond to the invention . inversely , even if the embodiment is described here as a one corresponding to the invention , it does not mean that the embodiment does not correspond to an invention other than the present invention . hereinafter , the embodiments of the present invention will be explained with reference to the accompanying drawings . fig1 shows the constitution of the schematic section of an image forming apparatus 1 to which the present invention is applied . the image forming apparatus 1 stores , in a housing 14 , a scanner unit 11 , an image forming unit 12 , and a paper supply unit 13 . the scanner unit 11 irradiates light to a document ( not drawn ) set on the document table , leads the reflected light from the document to the light receiving element via a plurality of optical members , converts it photo - electrically , and then outputs image data . further , the image forming unit 12 outputs the image data read from the document by the scanner unit 11 or an image based on image data inputted from an external apparatus not drawn onto a sheet of paper ( transfer material ). furthermore , the paper supply unit 13 supplies sheets of paper to the image forming unit 12 . on the housing 14 , an automatic duplex unit 15 and a manual paper supply unit 16 are mounted removably . the automatic duplex unit 15 overturns the sheet of paper on one side of which an image is formed by the image forming unit 12 , supplies it again to the image forming unit 12 , and then forms an image on the other side . the manual paper supply unit 16 supplies manually sheets of paper to the image forming unit 12 . next , the image forming unit 12 will be explained in detail . the image forming unit 12 has a photosensitive drum 17 as an image carrier having the pipe shaft extending in the longitudinal direction ( the depth direction of the drawing ) of the image forming apparatus 1 . further , the image carrier is not limited to the drum shape and it may be a photosensitive belt . around the photosensitive drum 17 , as auxiliary devices , a main charger 18 , an exposure unit 19 , a black developing device 20 , a revolver 21 as a color developing device , an intermediate transfer belt 22 as a toner image forming medium , and a drum cleaner 23 are sequentially installed in the rotational direction ( the direction of the arrow shown in the drawing ) of the photosensitive drum 17 . further , the process cartridge not drawn is composed of the photosensitive drum 17 , main charger 18 , black developing device 20 or revolver 21 , and drum cleaner 23 and those units can be installed removably in the image forming apparatus 1 . the main charger 18 charges the outer peripheral surface of the photosensitive drum 17 at a predetermined potential . the exposure unit 19 is arranged in the neighborhood of the lower end of the image forming unit 12 and exposes the surface of the photosensitive drum 17 charged at the predetermined potential and forms an electrostatic latent image based on image data . when forming a color image , the exposure unit 19 exposes the surface of the photosensitive drum 17 on the basis of color - resolved image data and forms electrostatic latent images of the respective colors . the black developing device 20 is arranged between the photosensitive drum 17 and the exposure unit 19 , that is , opposite to the photosensitive drum 17 from underneath . the black developing device 20 adheres and develops black toner to the electrostatic latent image for black which is formed on the surface of the photosensitive drum 17 by the exposure unit 19 and forms a black toner image on the surface of the photosensitive drum 17 . the black developing device 20 includes a mixer for stirring and supplying toner and a developing roller arranged opposite to it on the surface of the photosensitive drum 17 via a predetermined developing gap . the black developing device 20 is movably installed so that the developing roller separates from or makes contact with the surface of the photosensitive drum 17 . further , to the black developing device 20 , toner is supplied from a toner cartridge 20 a via a supply path not drawn . the revolver 21 is installed in the neighborhood of the photosensitive drum 17 so as to rotate clockwise . the revolver 21 includes a yellow developing device 21 y , a magenta developing device 21 m , and a cyan developing device 21 c which have the same structure as that of the black developing device 20 . the developing devices are removably stored in the revolver 21 side by side in the rotational direction of the revolver 21 . and , the developing devices 21 y , 21 m , and 21 c of the respective colors , by rotating the revolver 21 clockwise , are selectively arranged opposite to each other from the side of the photosensitive drum 17 to the surface thereof . the black developing device 20 , since the use frequency is higher than the developing devices of the other colors , is installed separately from the revolver 21 storing the developing devices of the other colors . by doing this , the toner storage amount of the developing device and toner cartridge can be made different from those of the developing devices of the other colors , thus the maintenance count such as toner supply can be reduced . the intermediate transfer belt 22 is arranged above the photosensitive drum 17 . the intermediate transfer belt 22 is wound and stretched by a driving roller 24 a having the rotary shaft extending the longitudinal direction ( the depth direction of the drawing ) of the image forming apparatus 1 , a driven roller 24 b , a driven roller 24 c , and a tension roller 24 d . the driving roller 24 a is fixedly installed on the housing 14 above the revolver 21 . the tension roller 24 d is pressed from the inside of the intermediate transfer belt 22 to the outside thereof so as to give predetermined tension to the intermediate transfer belt 22 . inside the intermediate transfer belt 22 , to allow the intermediate transfer belt 22 to make contact with the surface of the photosensitive drum 17 and transfer a toner image formed on the surface of the photosensitive drum 17 to the intermediate transfer belt 22 , a primary transfer roller 25 is installed . the primary transfer roller 25 , so as to press the intermediate transfer belt 22 to the surface of the photosensitive drum 17 at a predetermined pressure , is pressed toward the photosensitive drum 17 . further , the primary transfer unit is formed by the primary transfer roller 25 and intermediate transfer belt 22 installed around it . around the intermediate transfer belt 22 , a belt cleaner 26 and a secondary transfer roller 27 are installed removably on the belt surface . the belt cleaner 26 is installed on the outer periphery of the driving roller 24 a via the intermediate transfer belt 22 above the revolver 21 . the secondary transfer roller 27 of the image forming apparatus 1 indicated in this embodiment has a constitution that the outside diameter is several tens mm ( for example , 28 mm ), and the sponge surface made of epichloro rubber is covered with an epichloro rubber tube , and the rubber hardness is several tens degrees ( for example , 25 to 30 degrees ), and the volume resistance is 10 ω ( for example , 13 ω ). further , the secondary transfer roller 27 is installed at the position across a vertical conveying path 28 via the intermediate transfer belt 22 between itself and the driven roller 24 c and this portion forms the secondary transfer unit . further , above the secondary transfer roller 27 , a paper separation unit 29 is arranged . the drum cleaner 23 is arranged in contact with the photosensitive drum 17 . the paper supply unit 13 has two paper supply cassettes 13 a and 13 b . at the right upper ends of the paper supply cassettes 13 a and 13 b shown in the drawing , pick - up rollers 30 ( 30 a and 30 b ) for taking out the uppermost sheets of paper stored in the cassettes are installed . at the neighboring positions on the downstream side in the paper take - out directions by the pick - up rollers 30 , a feed roller 31 and a separation roller 32 are arranged opposite to each other . further , at the neighboring positions on the right of the paper supply cassettes 13 a and 13 b shown in the drawing , the vertical conveying path 28 extending almost vertically through the secondary transfer area where the intermediate transfer belt 22 and secondary transfer roller 27 are in contact with each other is installed . on the vertical conveying path 28 , a plurality of conveying roller pairs 33 for holding and rotating sheets of paper are installed . above the paper ejection unit in the secondary transfer area , the paper separation unit 29 is installed along the vertical conveying path 28 . on the vertical conveying path 28 passing the recording medium separation unit 29 and extending upward more , a fixing device 34 for heating , pressurizing , and fixing a toner image transferred onto a sheet of paper is installed . further , exit rollers 35 for ejecting a sheet of paper with an image formed to a paper receiving tray 36 are installed . furthermore , in the neighborhood of the photosensitive drum 17 , a photosensitive drum surface voltage measure 37 for measuring the surface potential of the photosensitive drum 17 is installed . further , at a predetermined position in the image forming apparatus 1 , an environment sensor 38 for detecting an environment such as temperature and relative humidity inside the image forming apparatus 1 is installed . further , in the neighborhood of the photosensitive drum 17 , a toner adherence amount measure 39 for measuring the toner adherence amount adhered to the photosensitive drum 17 is installed . next , the color image forming operation by the image forming apparatus 1 will be explained . as an initial operation , the black developing device 20 moves downward and separates from the surface of the photosensitive drum 17 , and the revolver 21 rotates clockwise , thus the yellow developing device 21 y faces the surface of the photosensitive drum 17 . further , the belt cleaner 26 rotates counterclockwise centering on the support axis thereof and separates from the intermediate transfer belt 22 , and the secondary transfer roller 27 moves in the direction ( rightward in the drawing ) separating from the vertical conveying path 28 and separates from the intermediate transfer belt 22 . and , image data is read from a document not drawn by the scanner unit 11 or image data is input from an external apparatus not drawn . furthermore , the photosensitive drum 17 rotates clockwise and the surface of the photosensitive drum 17 is uniformly charged at a predetermined potential by the main charger 18 . at this time , the intermediate transfer belt 22 rotates counterclockwise at the same speed as the peripheral speed of the photosensitive drum 17 . firstly , on the basis of color - resolved yellow image data , the exposure unit 19 operates and on the surface of the photosensitive drum 17 , an electrostatic latent image for yellow is formed . at this time , the exposure timing is synchronized by detecting a detection mark ( not drawn ) attached to the inside of the intermediate transfer belt 22 by a detector not drawn . the electrostatic latent image for yellow formed on the surface of the photosensitive drum 17 by the yellow developing device 21 y is adhered with yellow toner and developed , thus a yellow toner image is formed on the surface of the photosensitive drum 17 . the yellow toner image formed on the surface of the photosensitive drum 17 in this way is moved by rotation of the photosensitive drum 17 and passes through the primary transfer area in contact with the intermediate transfer belt 22 . at this time , to the primary transfer roller 25 , a bias voltage with reverse polarity of the charging potential of toner is given and the yellow toner image on the surface of the photosensitive drum 17 is transferred onto the intermediate transfer belt 22 . after the yellow toner image is transferred onto the intermediate transfer belt 22 , yellow toner remaining on the surface of the photosensitive drum 17 without being transferred is removed by the drum cleaner 23 . at this time , the residual electric charge on the surface of the photosensitive drum 17 is removed simultaneously . to prepare for next forming of an electrostatic latent image for magenta on the photosensitive drum 17 , the surface of the photosensitive drum 17 is uniformly charged by the main charger 18 , and the revolver 21 is rotated , thus the magenta developing device 21 m faces the surface of the photosensitive drum 17 . in this state , the aforementioned series of processes , that is , exposure , development , and primary transfer onto the intermediate transfer belt 22 are executed and a magenta toner image is superimposed and transferred onto the yellow toner image on the intermediate transfer belt 22 . after a cyan toner image is transferred similarly , the revolver 21 rotates so that the developing devices 21 y , 21 m , and 21 c do not face the surface of the photosensitive drum 17 , and the black developing device 20 moves up instead and faces the surface of the photosensitive drum 17 . in this state , the same process as the aforementioned process is executed , and the black toner image is superimposed on the yellow toner image , magenta toner image , and cyan toner image , thus those images are transferred onto the intermediate transfer belt 22 . when the toner images of all the colors are superimposed on the intermediate transfer belt 22 in this way , the secondary transfer roller 27 moves toward the driven roller 24 c and makes contact with the intermediate transfer belt 22 . further , the belt cleaner 26 also makes contact with the intermediate transfer belt 22 . in this state , the toner images of all the colors superimposed on the intermediate transfer belt 22 are moved by rotation of the intermediate transfer belt 22 and pass through the secondary transfer area where the intermediate transfer belt 22 and secondary transfer roller 27 make contact with each other . at this time , the sheets of paper taken out from the paper supply cassettes 13 a and 13 b by the pick - up rollers 30 a and 30 b are conveyed upward on the vertical conveying path 28 by conveying rollers 149 and are sent into the secondary transfer area at predetermined timing . and , via the secondary transfer roller 27 impressed with a bias voltage of reverse polarity of the potential of the toner image of each color by a power source not drawn , the toner images of the respective colors on the intermediate transfer belt 22 are transferred onto a sheet of paper . after the toner images are transferred onto the sheet of paper , the residual toner on the intermediate transfer belt 22 is removed by the belt cleaner 26 . the sheet of paper onto which the toner images of the respective colors are all transferred passes thereafter through the recording medium separation unit 29 and is heated and pressurized by the fixing device 34 , and the toner images of the respective colors are fixed on the sheet of paper , thus a color image is formed . the sheet of paper on which the color image is formed is ejected onto the paper receiving tray 36 via the exit rollers 35 installed on the downstream side of the fixing device 34 . fig2 shows the schematic and functional constitution of the control system inside the image forming apparatus 1 shown in fig1 . as shown in fig2 , to a controller device 41 , an input unit 42 , a toner adherence amount measuring unit 44 , an environment detecting unit 45 , a primary transfer voltage detecting unit 46 , and a secondary transfer voltage detecting unit 47 are connected . the controller device 41 is structured so as to connect a main control unit 51 , a print data obtaining unit 52 , a memory unit 53 , an image quality maintaining control unit 54 , a primary transfer voltage control unit 55 , and a secondary transfer voltage control unit 56 via an input / output interface 57 . the main control unit 51 is composed of a central processing unit ( cpu ) or a micro processing unit ( mpu ) and a random access memory ( ram ), and generates various control signals and collectively controls the image forming apparatus 1 . the print data obtaining unit 52 obtains print data from the input unit 42 by operating the display panel or buttons by a user or from an external apparatus ( not drawn ) via an electric cable and supplies the obtained print data to a data memory unit 58 of a memory unit 53 . the print data includes , for example , data concerning the kind and size of sheets of paper ( transfer materials ) on which images and characters are printed and print data of images and characters to be printed . the memory unit 53 is composed of the data memory unit 58 and a correcting coefficient database 59 . the data memory unit 58 obtains the print data supplied from the print data obtaining unit 52 and stores the obtained print data . further , the data memory unit 58 , according to an instruction of the main control unit 51 , supplies properly various data stored in the respective units of the image forming apparatus 1 . the correcting coefficient database 59 is composed of a primary transfer voltage correcting coefficient database and a secondary transfer voltage correcting coefficient database , and in the primary transfer voltage correcting coefficient database , with respect to the primary transfer voltage , the temperature and relative humidity and the correcting coefficients for the temperature and relative humidity are pre - registered in correspondence with each other and in the secondary transfer voltage correcting coefficient database , with respect to the secondary transfer voltage , the temperature and relative humidity and the correcting coefficients for the temperature and relative humidity are pre - registered in correspondence with each other . the image quality maintaining control unit 54 is composed of a calculation unit 60 , a comparison and determination unit 61 , and a developing voltage changing unit 62 . the calculation unit 60 , on the basis of coefficients k 1 to k 4 ( the relationship between an exposing portion potential vl and a non - exposing portion potential vo to a grid bias voltage vg ) pre - stored in the data memory unit 58 as known data , calculates a standard developing contrast voltage vc and a background voltage vbg and calculates the grid bias voltage vg and developing bias voltage vd corresponding to the calculated standard developing contrast voltage vc and background voltage vbg . the developing contrast voltage is a difference voltage between the surface potential of the photosensitive drum and the developing bias potential . as shown in fig3 , with respect to the electrostatic latent image formed on the surface of the photosensitive drum 17 , assuming the potential of the non - exposing portion as − 600 v , the potential of the exposing portion as − 50 v , and the developing bias voltage as − 300 v , + 250 v is the developing contrast voltage . further , the calculation unit 60 calculates a deviation on the basis of comparison and determination result supplied from the comparison and determination unit 61 and calculates a correcting developing contrast voltage δvc and a correcting background voltage δvbg on the basis of the calculated deviation . the calculation unit 60 , on the basis of the standard developing contrast voltage vc and background voltage vbg and the calculated correcting developing contrast voltage δvc and correcting background voltage δvbg , calculates a developing contrast voltage vc and a background voltage vbg which are impressed actually , calculates a grid bias voltage vg and a developing bias voltage vd corresponding to the calculated developing contrast voltage vc and standard background voltage vbg , and supplies calculation results to the developing voltage changing unit 62 . the comparison and determination unit 61 reads data concerning the standard value of the toner adherence amount stored in the data memory unit 58 , refers to data concerning the standard value of the toner adherence amount read , compares and determines it with the measured data of the toner adherence amount supplied from the toner adherence amount measuring unit 44 , and supplies the comparison and determination results to the calculation unit 60 . the developing voltage changing unit 62 , on the basis of the calculated results supplied from the calculation unit 60 , changes the developing contrast voltage vc , background voltage vbg , grid bias voltage vg , and developing bias voltage vd . the developing voltage changing unit 62 supplies the data concerning the developing contrast voltage vc , background voltage vbg , grid bias voltage vg , and developing bias voltage vd which are impressed actually to the data memory unit 58 . the primary transfer voltage control unit 55 is composed of a photosensitive drum surface potential setting unit 63 , a primary transfer voltage calculation unit 64 , a primary transfer voltage correcting coefficient setting unit 65 , and a primary transfer voltage changing unit 66 . the photosensitive drum surface potential setting unit 63 reads the data concerning the changed grid bias voltage vg stored in the data memory unit 58 . the photosensitive drum surface potential setting unit 63 controls the main charger 18 , impresses the grid bias voltage vg on the basis of the data concerning the read and changed grid bias voltage vg , and charges the photosensitive drum 17 at an appropriate voltage vo at time of image forming . the primary transfer voltage calculation unit 64 calculates the resistance of the primary transfer unit on the basis of a primary transfer voltage detected signal supplied from the primary transfer voltage detecting unit 46 and calculates a standard primary transfer voltage for generating a predetermined current on the basis of the calculated resistance of the primary transfer unit . the primary transfer voltage calculation unit 64 , on the basis of the calculated standard primary transfer voltage and the primary transfer voltage correcting coefficient data supplied from the primary transfer voltage correcting coefficient setting unit 65 , calculates the primary transfer voltage after correction according to the toner charge amount and supplies the calculation results to the primary transfer voltage changing unit 66 . the primary transfer voltage correcting coefficient setting unit 65 reads the database managed by the correcting coefficient database 59 of the memory unit 53 and reads the data concerning the developing contrast voltage vc stored in the data memory unit 58 . the primary transfer voltage correcting coefficient setting unit 65 refers to the primary transfer voltage correcting coefficient database managed by the read correcting coefficient database 59 , on the basis of an environment detecting signal supplied from the environment detecting unit 45 and the data concerning the read developing contrast voltage vc , sets the primary transfer voltage correcting coefficient , and supplies the primary transfer voltage correcting coefficient data which is the data of the set primary transfer voltage correcting coefficient to the primary transfer voltage calculation unit 64 . the primary transfer voltage changing unit 66 changes the primary transfer voltage on the basis of the calculation results supplied from the primary transfer voltage calculation unit 64 . the secondary transfer voltage control unit 56 is composed of a secondary transfer voltage calculation unit 67 , a relative humidity paper correcting voltage calculation unit 68 , a secondary transfer voltage correcting coefficient setting unit 69 , and a secondary transfer voltage changing unit 70 . the secondary transfer voltage calculation unit 67 calculates the resistance of the secondary transfer unit on the basis of a secondary transfer voltage detected signal supplied from the secondary transfer voltage detecting unit 47 and calculates a standard secondary transfer voltage for generating a predetermined current on the basis of the calculated resistance of the secondary transfer unit . the secondary transfer voltage calculation unit 67 , on the basis of the calculated standard secondary transfer voltage , the calculation results supplied from the relative humidity paper correcting voltage calculation unit 68 , and the secondary transfer voltage correcting coefficient data supplied from the secondary transfer voltage correcting coefficient setting unit 69 , calculates the secondary transfer voltage after correction according to the toner charge amount and supplies the calculation results to the secondary transfer voltage changing unit 70 . the relative humidity paper correcting voltage calculation unit 68 reads the data concerning the paper kind included in the print data stored in the data memory unit 58 , on the basis of the data concerning the read paper kind and the environment detecting signal supplied from the environment detecting unit 45 , calculates the relative humidity paper correcting voltage corresponding to the paper kind selected by a user and the detected relative humidity , and supplies the calculation results to the secondary transfer voltage calculation unit 67 . the secondary transfer voltage correcting coefficient setting unit 69 reads the secondary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 of the memory unit 53 and reads the data concerning the developing contrast voltage vc stored in the data memory unit 58 . the secondary transfer voltage correcting coefficient setting unit 69 refers to the secondary transfer voltage database managed by the read correcting coefficient database 59 , on the basis of the environment detecting signal supplied from the environment detecting unit 45 and the data concerning the read developing contrast voltage vc , sets the secondary transfer voltage correcting coefficient , and supplies the secondary transfer voltage correcting coefficient data which is the data of the set secondary transfer voltage correcting coefficient to the secondary transfer voltage calculation unit . the secondary transfer voltage changing unit 70 changes the secondary transfer voltage on the basis of the calculation results supplied from the secondary transfer voltage calculation unit 67 . the input unit 42 is installed on the upper part of the image forming apparatus 1 and has an input device including a display panel and buttons for inputting various instructions of a user . the toner adherence amount measuring unit 44 is composed of , for example , the toner adherence amount measure 39 shown in fig1 , measures the toner adherence amount adhered to the photosensitive drum 17 according to an instruction of the main control unit 51 , and supplies the measured data of the toner adherence amount to the image quality maintaining control unit 54 . the environment detecting unit 45 is composed of , for example , the environment sensor 38 shown in fig1 , detects an environment such as temperature and relative humidity inside the image forming apparatus 1 according to an instruction of the main control unit 51 , generates an environment detecting signal on the basis of the detected temperature and relative humidity , and supplies it to the respective units of the controller device 41 . further , the environment detecting signal includes environment data such as the temperature and relative humidity inside the image forming apparatus 1 . the primary transfer voltage detecting unit 46 detects a voltage impressed to the primary transfer unit formed by the primary transfer roller 25 and the intermediate transfer belt 22 around it , generates a primary transfer voltage detecting signal on the basis of the detected voltage , and supplies it to the primary transfer voltage calculation unit 64 . further , the primary transfer voltage detecting signal includes the data concerning the detected voltage impressed to the primary transfer unit . the secondary transfer voltage detecting unit 47 detects a voltage impressed to the secondary transfer unit formed by the secondary transfer roller 27 and the intermediate transfer belt 22 around it , generates a secondary transfer voltage detecting signal on the basis of the detected voltage , and supplies it to the secondary transfer voltage calculation unit 67 . further , the secondary transfer voltage detecting signal includes the data concerning the detected voltage impressed to the secondary transfer unit . on the other hand , the transfer voltage varies with the magnitude of the charge amount of toner , so that when calculating an appropriate transfer voltage , it is necessary to measure first the charge amount of toner , though the charge amount of toner cannot be measured directly . however , between the developing contrast voltage vc changed by the image quality maintaining control processing and the toner charge amount , there is a strong mutual relation as shown in fig4 . the mutual relation between the developing contrast voltage vc calculated by the image quality maintaining control processing and the toner charge amount will be explained below by referring to fig4 . as shown by a solid line a in fig4 , between the developing contrast voltage vc and the toner charge amount , a linear mutual relation having a predetermined width is recognized . namely , when the toner charge amount is small , a low developing contrast voltage vc is sufficient , while when the toner charge amount is large , a high developing contrast voltage vc is required . therefore , using the mutual relation between the developing contrast voltage vc and the toner charge amount shown in fig4 , it can be estimated that when the developing contrast voltage vc calculated by the image quality maintaining control processing is low , the toner charge amount is reduced , while when the developing contrast voltage vc is high , the toner charge amount is increased . therefore , when the developing contrast voltage vc calculated by the image quality maintaining control processing is shifted greatly from a predetermined value , it is decided that the toner charge amount is shifted greatly from a predetermined value range and on the basis of the decision result , the transfer voltage can be corrected . when correcting the transfer voltage from the decision result concerning the magnitude of the toner charge amount , concretely , it is corrected as indicated below . namely , when the toner charge amount is increased if a fixed voltage is impressed , generally , the toner adherence amount is reduced . therefore , to keep the toner adherence amount within a fixed range , it is necessary to increase the voltage according to the magnitude of the toner charge amount . therefore , as shown in fig4 , for example , the lower limit threshold value and upper limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range are respectively preset to 200 v and 400 v . and , the voltage range is divided into three sections ( appropriate charging area , low charging area , and high charging area ) depending on the value of the developing contrast voltage vc , and as a range ( section a - b ) of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range , a case of 200 v to 400 v is set , and as a range ( section a ) of the developing contrast voltage vc at which the toner charge amount is below the predetermined value range , a case of less than 200 v is set , and as a range ( section b ) of the developing contrast voltage vc at which the toner charge amount is above the predetermined value range , a case of more than 400 v is set . under the environment condition shown in fig4 , in the section a - b which is the appropriate charging area , the transfer voltage correcting coefficient is 1 and the transfer voltage calculated by the ordinary transfer voltage control processing is impressed straight , and in the section a which is the low charging area , the transfer voltage correcting coefficient is , for example , 0 . 9 and a value obtained by multiplying the transfer voltage calculated by the ordinary primary transfer voltage control processing by a transfer voltage correcting coefficient , for example , 0 . 9 is impressed , and in the section b which is the high charging area , the transfer voltage correcting coefficient is , for example , 1 . 1 and a value obtained by multiplying the transfer voltage calculated by the ordinary primary transfer voltage control processing by a transfer voltage correcting coefficient , for example , 1 . 1 is impressed . by doing this , even if the toner charge amount is changed , a satisfactory transfer property can be obtained . further , the transfer voltage correcting coefficient is a value varying with the environment conditions such as temperature and relative humidity . hereinafter , the primary transfer voltage control processing and secondary transfer voltage control processing using the mutual relation between the developing contrast voltage vc and the toner charge amount will be explained . the image quality maintaining control processing of the image forming apparatus 1 shown in fig2 will be explained below by referring to the flow chart shown in fig6 . further , the image quality maintaining control processing is performed when the warming - up process of the image forming apparatus 1 is finished . at step s 1 , the main control unit 51 controls a pattern generation circuit not drawn , thereby generates gradation data , thus the exposure unit 19 exposes the photosensitive drum 17 by two gradation patterns of high density and low density for toner adherence amount measurement . by referring to fig6 , the relationship between the surface potential vo of the photosensitive drum 17 ( hereinafter , referred to as non - exposing portion potential ) to an absolute value vg of the grid bias voltage ( hereinafter , referred to as grid bias voltage ) outputted from the grid electrode of the main charger 18 , the surface potential vl of the photosensitive drum 17 ( hereinafter , referred to as exposing portion potential ) which is attenuated by overall exposure at a fixed light quantity via the exposure unit 19 , and the developing bias voltage vd will be explained . further , the example shown in fig6 performs reverse development , so that the polarity of the voltage is negative . as shown in fig6 , when the grid bias voltage vg increases , the absolute values of the non - exposing portion potential vo and exposing portion potential vl reduce respectively . when linearly approximating the exposing portion potential vl and non - exposing portion potential vo to the grid bias voltage vg , they can be expressed by formula 1 and formula 2 . where symbols k 1 to k 4 indicate coefficients , and vo , vl , and vg indicate absolute values , and vo ( vg ) and vl ( vg ) indicate magnitudes of vo and vl to optional vg . generally , the toner adherence amount ( developing density ) varies with the relationship between the three values of the developing bias voltage vd , exposing portion potential vl , and non - exposing portion potential vo . here , firstly , the developing contrast voltage vc and background voltage vbg are defined as formula 3 and formula 4 . the developing contrast voltage vc participates particularly in the density of the solid portion and the background voltage vbg , in the multi - gradation system using pulse width modulation , participates mainly in the density of the low density portion . therefore , the toner adherence amount can be changed by the developing contrast voltage vc and background voltage vbg . namely , formula 5 and formula 6 can be obtained using formula 1 to formula 4 . vg ( vc , vbg )=( vc + vbg − k 2 + k 4 )/( k 1 − k 3 ) formula 5 vd ( vbg , vg )= k 1 × vg + k 2 − vbg formula 6 as mentioned above , when the relationship between the exposing portion potential vl and non - exposing portion potential vo to the grid bias voltage vg ( coefficients k 1 to k 4 ) is already known , by deciding the developing contrast voltage vc and background voltage vbg , the grid bias voltage vg and developing bias voltage vd according to them can be calculated uniquely using formula 5 and formula 6 . namely , on the basis of the relationship ( coefficients k 1 to k 4 ) between the exposing portion potential vl and non - exposing portion potential vo to the grid bias voltage vg which is stored beforehand in the data memory unit 58 as known data , the developing contrast voltage vc and background voltage vbg are decided . at step s 2 , the calculation unit 60 of the image quality maintaining control unit 54 reads the coefficients k 1 to k 4 stored beforehand in the data memory unit 58 as known data . at step s 3 , the calculation unit 60 , on the basis of the read coefficients k 1 and k 4 , calculates the standard developing contrast voltage vc and background voltage vbg and calculates the grid bias voltage vg and developing bias voltage vd corresponding to the calculated standard developing contrast voltage vc and standard background voltage vbg . the main control unit 51 controls the respective units of the image forming apparatus 1 so as to perform the developing process on the basis of the calculated standard developing contrast voltage vc , the background voltage vbg , and the grid bias voltage vg and developing bias voltage vd corresponding to them and as shown in fig8 , form a high density pattern area ( high density patch ) corresponding to gradation data of a high density pattern and a low density pattern area ( low density patch ) corresponding to a gradation pattern of low density which is lower in density than the high density pattern on the photosensitive drum 17 . at step s 4 , the toner adherence amount measuring unit 44 , after the gradation patterns of high density and low density exposed on the photosensitive drum 17 are developed by the black developing device 20 , in synchronization with movement of the toner adherence amount measuring unit 44 to a measurable position , measures the toner adherence amount on the photosensitive drum 17 and supplies the measured data of the toner adherence amount to the comparison and determination unit 61 . at step s 5 , the comparison and determination unit 61 obtains the measured data of the toner adherence amount supplied from the toner adherence amount measuring unit 44 and reads a predetermined standard value of the toner adherence amount pre - stored in the data memory unit 58 . the comparison and determination unit 61 refers to the read predetermined standard value of the toner adherence amount , compares it on the basis of the obtained measured data of the toner adherence amount , and decides whether the measured data is within the tolerance or not . when it is decided that the measured data of the toner adherence amount which is obtained at step s 5 is not within the tolerance , the comparison and determination unit 61 supplies the comparison and determination result to the calculation unit 60 . at step s 6 , the calculation unit 60 calculates a deviation on the basis of the comparison and determination result supplied from the comparison and determination unit 61 . at step s 7 , the calculation unit 60 calculates the correcting developing contrast voltage δvc and correcting background voltage δvbg on the basis of the calculated deviation . at step s 8 , the calculation unit 60 , on the basis of the standard developing contrast voltage vc and background voltage vbg and the calculated correcting developing contrast voltage δvc and correcting background voltage δvbg , calculates the developing contrast voltage vc and background voltage vbg which are impressed and calculates the grid bias voltage vg and developing bias voltage vd corresponding to them . thereafter , the process returns to step s 4 and the processes at step s 4 and subsequent steps are repeated . namely , the main control unit 51 controls the respective units of the image forming apparatus 1 so as to perform the developing process on the basis of the calculated standard developing contrast voltage vc , the background voltage vbg , and the grid bias voltage vg and developing bias voltage vd corresponding to them and form a high density pattern area ( high density patch ) and a low density pattern area ( low density patch ) on the photosensitive drum 17 , and the toner adherence amount is measured by the toner adherence amount measuring unit 44 and is compared with the predetermined standard value , and the similar process is repeated until it is decided that the measured data is within the tolerance . by doing this , an appropriate developing contrast voltage vc , the background voltage vbg , and the grid bias voltage vg and developing bias voltage vd corresponding to them can be calculated . when it is decided that the measured data of the toner adherence amount which is obtained at step s 5 is not within the tolerance , the comparison and determination unit 61 supplies the comparison and determination result to the calculation unit 60 . the calculation unit 60 , on the basis of the comparison and determination result supplied from the comparison and determination unit 61 , compares the measured data with the predetermined standard value , recognizes that it is within the tolerance , and supplies the present developing contrast voltage vc and background voltage vbg and calculation results of the grid bias voltage vg and developing bias voltage vd corresponding to them to the developing voltage changing unit 62 . at step s 9 , the developing voltage changing unit 62 , on the basis of the calculation results supplied from the calculation unit 60 , changes the developing contrast voltage vc , background voltage vbg , grid bias voltage vg , and developing bias voltage vd . the developing voltage changing unit 62 supplies the data concerning the developing contrast voltage vc , background voltage vbg , grid bias voltage vg , and developing bias voltage vd which are changed to the data memory unit 58 . the primary transfer voltage control processing of the image forming apparatus 1 shown in fig2 will be explained by referring to the flow chart shown in fig8 . at step s 11 , the photosensitive drum surface potential setting unit 63 reads the data concerning the changed grid bias voltage vg stored in the data memory unit 58 . the photosensitive drum surface potential setting unit 63 controls the main charger 18 , on the basis of the data concerning the read changed grid bias voltage vg , impresses the grid bias voltage vg to charge the photosensitive drum 17 at the appropriate voltage vo at time of image forming . at step s 12 , the primary transfer voltage detecting unit 46 impresses a predetermined current ( detecting current ) to the primary transfer unit , after a lapse of a predetermined time ( that is , after the detecting current to be impressed is stabilized ), according to an instruction of the main control unit 51 , detects a voltage applied when the detecting current is impressed to the primary transfer unit , generates a primary transfer voltage detecting signal , and supplies it to the primary transfer voltage calculation unit 64 . further , the primary transfer voltage detecting signal includes the data concerning the voltage detected when the predetermined current ( detecting current ) is impressed to the primary transfer unit . at step s 13 , the primary transfer voltage calculation unit 64 , on the basis of the predetermined current ( detecting current ) impressed to the primary transfer unit and the primary transfer voltage detecting signal supplied from the primary transfer voltage detecting unit 46 , calculates the resistance of the primary transfer unit . at step s 14 , the primary transfer voltage calculation unit 64 , on the basis of the calculated resistance of the primary transfer unit , calculates a standard primary transfer voltage for generating a predetermined transfer current . when the detecting current and predetermined transfer current are the same , the voltage detected practically becomes straight the primary transfer voltage , though actually , the resistance of toner is added , so that , generally , the primary transfer voltage is higher than the detected voltage . at step s 15 , the primary transfer voltage correcting coefficient setting unit 65 , according to an instruction of the main control unit , reads the primary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 . fig1 a shows an example of the primary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 . further , as shown in fig1 a and 10b , the correcting coefficient database 59 is composed of the primary transfer voltage correcting coefficient database and secondary transfer voltage correcting coefficient database . in the first to fifth rows of the primary transfer voltage correcting coefficient database shown in fig1 a , “ relative humidity (%)”, “ lower limit threshold value ( v )”, “ higher limit threshold value ( v )”, “∂”, and “ β ” are recorded and they indicate respectively a value of relative humidity in the image forming apparatus 1 , a lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range , a higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range , a correcting coefficient ∂ of the primary transfer voltage in the low charging area , and a correcting coefficient β of the primary transfer voltage in the high charging area . in the first line shown in fig1 a , “ relative humidity (%)” is “˜ 29 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is ˜ 29 . 9 %. “ lower limit threshold value ( v )” is “ 200 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 200 v . “ higher limit threshold value ( v )” is “ 400 v ”, indicating that the higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 400 v . “∂” is “ 0 . 95 ”, indicating that the correcting coefficient of the primary transfer voltage in the low charging area is 0 . 95 . “ β ” is “ 1 . 05 ”, indicating that the correcting coefficient of the primary transfer voltage in the high charging area is 1 . 05 . in the second line shown in fig1 a , “ relative humidity (%)” is “ 30 . 0 ˜ 49 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 30 . 0 ˜ 49 . 9 %. “ lower limit threshold value ( v )” is “ 180 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 180 v . “ higher limit threshold value ( v )” is “ 380 v ”, indicating that the higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 380 v . “∂” is “ 0 . 90 ”, indicating that the correcting coefficient of the primary transfer voltage in the low charging area is 0 . 90 . “ β ” is “ 1 . 10 ”, indicating that the correcting coefficient of the primary transfer voltage in the high charging area is 1 . 10 . in the third line shown in fig1 a , “ relative humidity (%)” is “ 45 . 0 ˜ 59 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 45 . 0 ˜ 59 . 9 %. “ lower limit threshold value ( v )” is “ 160 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 160 v . “ higher limit threshold value ( v )” is “ 360 v ”, indicating that the higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 360 v . “∂” is “ 0 . 90 ”, indicating that the correcting coefficient of the primary transfer voltage in the low charging area is 0 . 90 . “ β ” is “ 1 . 10 ”, indicating that the correcting coefficient of the primary transfer voltage in the high charging area is 1 . 10 . in the fourth line shown in fig1 a , “ relative humidity (%)” is “ 60 . 0 ˜ 74 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 60 . 0 ˜ 74 . 9 %. “ lower limit threshold value ( v )” is “ 140 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 140 v . “ higher limit threshold value ( v )” is “ 340 v ”, indicating that the higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 340 v . “∂” is “ 0 . 85 ”, indicating that the correcting coefficient of the primary transfer voltage in the low charging area is 0 . 85 . “ β ” is “ 1 . 15 ”, indicating that the correcting coefficient of the primary transfer voltage in the high charging area is 1 . 15 . in the fifth line shown in fig1 a , “ relative humidity (%)” is “ 75 . 0 %˜”, indicating that the relative humidity in the image forming apparatus 1 is 75 . 0 %˜. “ lower limit threshold value ( v )” is “ 120 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 120 v . “ higher limit threshold value ( v )” is “ 320 v ”, indicating that the higher limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 320 v . “∂” is “ 0 . 80 ”, indicating that the correcting coefficient of the primary transfer voltage in the low charging area is 0 . 80 . “ β ” is “ 1 . 20 ”, indicating that the correcting coefficient of the primary transfer voltage in the high charging area is 1 . 20 . at step s 16 , the primary transfer voltage correcting coefficient setting unit 65 reads the data concerning the developing contrast voltage vc stored in the data memory unit 58 . at step s 17 , the environment detecting unit 45 , according to an instruction of the main control unit 51 , detects the environment ( temperature , relative humidity , etc .) inside the image forming apparatus 1 , generates an environment detecting signal , and supplies it to the primary transfer voltage correcting coefficient setting unit 65 . the environment detecting signal includes the data concerning the environment inside the image forming apparatus 1 . at step s 18 , the primary transfer voltage correcting coefficient setting unit 65 refers to the primary transfer voltage correcting coefficient database managed by the read correcting coefficient database 59 and on the basis of the data concerning the read developing contrast voltage vc and the environment detecting signal supplied from the environment detecting unit 45 , sets the primary transfer voltage correcting coefficient . concretely , in the example shown in fig1 a , when the relative humidity is 35 % and the developing contrast voltage vc is 450 v , it is in the high charging area , so that the primary transfer voltage correcting coefficient is set to 1 . 10 . by doing this , the primary transfer voltage correcting coefficient according to the toner charge amount and environment can be set . the primary transfer voltage correcting coefficient setting unit 65 supplies the primary transfer voltage correcting coefficient data which is the data of the primary transfer voltage correcting coefficient to the primary transfer voltage calculation unit 64 . at step s 19 , the primary transfer voltage calculation unit 64 obtains the primary transfer voltage correcting coefficient data supplied from the primary transfer voltage correcting coefficient setting unit 65 , on the basis of the obtained primary transfer voltage correcting coefficient data and the calculated standard primary transfer voltage , calculates the primary transfer voltage after correction according to the toner charge amount ( that is , calculates a value obtained by multiplying the standard primary transfer voltage by the primary transfer voltage correcting coefficient ), and supplies the calculated results to the primary transfer voltage changing unit 66 . at step s 20 , the primary transfer voltage changing unit 66 changes the primary transfer voltage on the basis of the calculation results supplied from the primary transfer voltage calculation unit 64 . in the image forming apparatus 1 indicated in the embodiment of the present invention , the primary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 is referred to , thus on the basis of the data concerning the developing contrast voltage vc changed by the image quality maintaining control processing and the environment data ( data concerning the temperature and relative humidity ) included in the environment detecting signal supplied from the environment detecting unit 45 , the primary transfer voltage correcting coefficient can be set . by doing this , when the toner charge amount is shifted greatly from the predetermined standard value range , the primary transfer voltage can be corrected on the basis of the set primary transfer voltage correcting coefficient . therefore , even if the toner charge amount and environment are changed , a satisfactory transfer property can be obtained . next , the secondary transfer voltage control processing of the image forming apparatus 1 shown in fig2 will be explained by referring to the flow charts shown in fig1 . at step s 31 , the secondary transfer voltage detecting unit 47 impresses a predetermined current ( detecting current ) to the secondary transfer unit , after a lapse of a predetermined time ( that is , after the detecting current to be impressed is stabilized ), according to an instruction of the main control unit 51 , detects a voltage applied when the detecting current is impressed to the secondary transfer unit , generates a secondary transfer voltage detecting signal , and supplies it to the secondary transfer voltage calculation unit 67 . further , the secondary transfer voltage detecting signal includes the data concerning the voltage detected when the predetermined current ( detecting current ) is impressed to the secondary transfer unit . at step s 32 , the secondary transfer voltage calculation unit 67 , on the basis of the predetermined current ( detecting current ) impressed to the secondary transfer unit and the secondary transfer voltage detecting signal supplied from the secondary transfer voltage detecting unit 47 , calculates the resistance of the secondary transfer unit . at step s 33 , the secondary transfer voltage calculation unit 67 , on the basis of the calculated resistance of the secondary transfer unit , calculates a standard secondary transfer voltage for generating a predetermined transfer current . when the detecting current and predetermined transfer current are the same , the voltage detected practically becomes straight the secondary transfer voltage , though when the processing speed is different , the predetermined transfer current is different , so that the detected voltage may be different from the secondary transfer voltage . at step s 34 , the correcting voltage calculation unit 68 reads the print data stored in the data memory unit 58 and decides the paper kind on the basis of the data concerning the paper kind included in the read print data . at step s 35 , the environment detecting unit 45 detects the environment inside the image forming apparatus 1 , generates an environment detecting signal , and supplies it to the correcting voltage calculation unit 68 . at step s 36 , the correcting voltage calculation unit 68 , on the basis of the decision result of the paper kind and the environment detecting signal supplied from the environment detecting unit 45 , calculates a relative humidity paper correcting voltage corresponding to the paper kind and relative humidity and supplies the calculation results to the secondary transfer voltage calculation unit 67 . at step s 37 , the secondary transfer voltage correcting coefficient setting unit 69 , according to an instruction of the main control unit , reads the secondary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 . fig1 b shows an example of the secondary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 . further , “ relative humidity (%)”, “ lower limit threshold value ( v )”, and “ higher limit threshold value ( v )” in the first to fifth rows of the secondary transfer voltage correcting coefficient database shown in fig1 b are the same as “ relative humidity (%)”, “ lower limit threshold value ( v )”, and “ higher limit threshold value ( v )” in the first to fifth rows of the primary transfer voltage correcting coefficient database shown in fig1 a , so that the explanation thereof will be omitted to avoid repetition . in the fourth and fifth rows shown in fig1 b , “ γ ” and “ δ ” are recorded and they indicate respectively a secondary transfer voltage correcting coefficient in the low charging area and a secondary transfer voltage correcting coefficient in the high charging area . in the first line shown in fig1 b , “ relative humidity (%)” is “˜ 29 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is ˜ 29 . 9 %. “ lower limit threshold value ( v )” is “ 200 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 200 v . “ higher limit threshold value ( v )” is “ 400 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 400 v . “ γ ” is “ 0 . 95 ”, indicating that the secondary transfer voltage correcting coefficient in the low charging area is 0 . 95 . “ δ ” is “ 1 . 05 ”, indicating that the secondary transfer voltage correcting coefficient in the high charging area is 1 . 05 . in the second line shown in fig1 b , “ relative humidity (%)” is “ 30 . 0 ˜ 44 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 30 . 0 ˜ 44 . 9 %. “ lower limit threshold value ( v )” is “ 180 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 180 v . “ higher limit threshold value ( v )” is “ 380 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 380 v . “ γ ” is “ 0 . 90 ”, indicating that the secondary transfer voltage correcting coefficient in the low charging area is 0 . 90 . “ δ ” is “ 1 . 10 ”, indicating that the secondary transfer voltage correcting coefficient in the high charging area is 1 . 10 . in the third line shown in fig1 b , “ relative humidity (%)” is “ 45 . 0 ˜ 59 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 45 . 0 ˜ 59 . 9 %. “ lower limit threshold value ( v )” is “ 160 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 160 v . “ higher limit threshold value ( v )” is “ 360 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 360 v . “ γ ” is “ 0 . 90 ”, indicating that the secondary transfer voltage correcting coefficient in the low charging area is 0 . 90 . “ δ ” is “ 1 . 10 ”, indicating that the secondary transfer voltage correcting coefficient in the high charging area is 1 . 10 . in the fourth line shown in fig1 b , “ relative humidity (%)” is “ 60 . 0 ˜ 74 . 9 %”, indicating that the relative humidity in the image forming apparatus 1 is 60 . 0 ˜ 74 . 9 %. “ lower limit threshold value ( v )” is “ 140 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 140 v . “ higher limit threshold value ( v )” is “ 340 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 340 v . “ γ ” is “ 0 . 80 ”, indicating that the secondary transfer voltage correcting coefficient in the low charging area is 0 . 80 . “ δ ” is “ 1 . 20 ”, indicating that the secondary transfer voltage correcting coefficient in the high charging area is 1 . 20 . in the fifth line shown in fig1 b , “ relative humidity (%)” is “ 75 . 0 %˜”, indicating that the relative humidity in the image forming apparatus 1 is 75 . 0 %˜. “ lower limit threshold value ( v )” is “ 120 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 120 v . “ higher limit threshold value ( v )” is “ 320 v ”, indicating that the lower limit threshold value of the developing contrast voltage vc at which the toner charge amount can be considered to be within the predetermined value range is 320 v . “ γ ” is “ 0 . 75 ”, indicating that the secondary transfer voltage correcting coefficient in the low charging area is 0 . 75 . “ δ ” is “ 1 . 25 ”, indicating that the secondary transfer voltage correcting coefficient in the high charging area is 1 . 25 . at step s 38 , the secondary transfer voltage correcting coefficient setting unit 69 reads the data concerning the developing contrast voltage vc stored in the data memory unit 58 . at step s 39 , the environment detecting unit 45 , according to an instruction of the main control unit 51 , detects the environment ( temperature , relative humidity , etc .) inside the image forming apparatus 1 , generates an environment detecting signal , and supplies it to the secondary transfer voltage correcting coefficient setting unit 69 . the environment detecting signal includes the data concerning the environment inside the image forming apparatus 1 . at step s 40 , the secondary transfer voltage correcting coefficient setting unit 69 refers to the secondary transfer voltage correcting coefficient database managed by the read correcting coefficient database 59 and on the basis of the data concerning the read developing contrast voltage vc and the environment detecting signal supplied from the environment detecting unit 45 , sets the secondary transfer voltage correcting coefficient . concretely , in the example shown in fig1 b , when the relative humidity is 48 % and the developing contrast voltage vc is lower than v a3 v , it is in the low charging area , so that the secondary transfer voltage correcting coefficient is set to x 3 . by doing this , the secondary transfer voltage correcting coefficient according to the toner charge amount and environment can be set . the secondary transfer voltage correcting coefficient setting unit 69 supplies the secondary transfer voltage correcting coefficient data which is the data of the secondary transfer voltage correcting coefficient to the secondary transfer voltage calculation unit 67 . at step s 41 , the secondary transfer voltage calculation unit 67 obtains the secondary transfer voltage correcting coefficient data supplied from the secondary transfer voltage correcting coefficient setting unit 69 , on the basis of the obtained secondary transfer voltage correcting coefficient data , the calculated standard secondary transfer voltage , and the relative humidity paper correcting voltage , calculates the secondary transfer voltage after correction according to the toner charge amount ( that is , calculates a value obtained by multiplying the sum of the standard primary transfer voltage and relative humidity correcting voltage by the secondary transfer voltage correcting coefficient ), and supplies the calculated results to the secondary transfer voltage changing unit 70 . at step s 42 , the secondary transfer voltage changing unit 70 changes the secondary transfer voltage on the basis of the calculation results supplied from the secondary transfer voltage calculation unit 67 . in the image forming apparatus 1 indicated in the embodiment of the present invention , the secondary transfer voltage correcting coefficient database managed by the correcting coefficient database 59 is referred to , thus on the basis of the data concerning the developing contrast voltage vc changed by the image quality maintaining control processing and the environment data ( data concerning the temperature and relative humidity ) included in the environment detecting signal supplied from the environment detecting unit 45 , the secondary transfer voltage correcting coefficient can be set . by doing this , when the toner charge amount is shifted greatly from the predetermined standard value range , the secondary transfer voltage can be corrected on the basis of the set secondary transfer voltage correcting coefficient . therefore , even if the toner charge amount and environment are changed , a satisfactory transfer property can be obtained . further , in the image forming apparatus 1 indicated in the embodiment of the present invention , the primary transfer voltage or secondary transfer voltage is calculated and then the primary transfer voltage correcting coefficient or secondary transfer voltage correcting coefficient is set on the basis of the developing contrast voltage vc . however , the present invention is not limited to it and whenever the developing contrast voltage vc is changed , the primary transfer voltage correcting coefficient or secondary transfer voltage correcting coefficient may be set . further , in the image forming apparatus 1 indicated in the embodiment of the present invention , the voltage range is divided into three sections ( appropriate charging area , low charging area , and high charging area ) depending on the value of the developing contrast voltage vc and the correcting coefficients are set so as to be difference from each other between the sections . however , the present invention is not limited to it , and the voltage range may be divided into two or four or more , and an appropriate correcting coefficient may be calculated and set according to the value of the developing contrast voltage vc . in this case , at least one section is set to the appropriate charging area . furthermore , in the image forming apparatus 1 indicated in the embodiment of the present invention , the toner adherence amount on the photosensitive drum 17 is measured by the image quality maintaining control processing ( the flow chart shown in fig6 ), though the toner adherence amount on the intermediate transfer belt 22 may be measured . the present invention can be applied to an image forming apparatus of a four - each tandem type . however , particularly when applying the present invention to an image forming apparatus of a four - each tandem type as shown in fig1 , four photosensitive drums are arranged , so that when the toner adherence amount on the intermediate transfer belt is measured , the number of toner adherence amount measures can be reduced to one , thus the cost of the image forming apparatus can be decreased . fig1 shows the mechanical constitution of another schematic section of the image forming apparatus 1 to which the present invention is applied . as shown in fig1 , the image forming apparatus 1 is composed of a scanner unit 72 , an image forming unit 73 , and a paper supply unit 74 . the scanner unit 72 irradiates light to a document set on the document table , leads the reflected light from the document to the light receiving element via a plurality of optical members , converts it photoelectrically , and then supplies an image signal to the image forming unit 73 . in the image forming unit 73 , as shown in fig1 to 14 , process cartridges 81 a , 81 b , 81 c , and 81 d are installed . the process cartridges 81 a , 81 b , 81 c , and 81 d have respectively photosensitive drums 82 a , 82 b , 82 c , and 82 d which are image carriers and on the these photosensitive drums , developer images are formed . a process cartridge 81 includes a photosensitive drum 82 , a charging unit 83 , a developing device 85 , and a cleaner 86 and is installed removably on the image forming apparatus 1 . the photosensitive drum 82 a is , for example , in a cylindrical shape with a diameter of 30 mm and is installed so as to rotate in the direction of the arrow shown in the drawing . around the photosensitive drum 82 a , auxiliary facilities are arranged in the rotational direction . firstly , a main charger 83 a is installed as an auxiliary facility on the surface of the photosensitive drum 82 a opposite to it . the main charger 83 a charges negatively and uniformly the photosensitive drum 82 a . on the downstream side of the main charger 83 a , an exposure unit 84 a for exposing the charged photosensitive drum 82 a and forming an electrostatic latent image is installed . the exposure unit 84 a exposes a laser beam which is photomodulated in correspondence with the image signal supplied from the scanner unit 72 to the photosensitive drum 82 a . further , the exposure unit 84 a may use an led ( light emitting diode ) in place of the laser beam . further , on the downstream side of the exposure unit 84 a , a developing device 85 a for storing a yellow developer and reversely developing the electrostatic latent image formed by the exposure unit 84 a using the developer is installed . furthermore , an intermediate transfer belt 87 which is an image formed medium is installed so as to make contact with the photosensitive drum 82 a . on the upstream side of the contact position of the photosensitive drum 82 a with the intermediate transfer belt 87 , a cleaner 86 a is installed . the cleaner 86 a removes and stores residual toner on the photoconductor after transfer . a discharging lamp not drawn neutralizes the surface charge of the photosensitive drum 82 a by uniform light irradiation . by doing this , one cycle of image forming is completed and in the next image forming process , the main charger 83 a uniformly charges again the uncharged photosensitive drum 82 a . the intermediate transfer belt 87 has a length ( width ) almost equal to the length of the photosensitive drum 82 a in the direction perpendicular to the conveying direction ( the depth direction of the drawing ). the intermediate transfer belt 87 is in an endless shape and is stretched and suspended on a drive roller 88 for rotating the belt at a predetermined speed and a secondary transfer opposite roller 89 which is a driven roller . further , a numeral 97 indicates a tension roller for holding the intermediate transfer belt 87 at a fixed tension . the intermediate transfer belt 87 is a polyimide belt containing uniformly diffused carbon with a thickness of , for example , 100 μm . the intermediate transfer belt 87 has an electric resistance of 10 − 9 ωcm and shows a semiconductive property . as a material of the intermediate transfer belt 87 , a material having a semiconductive property of a volume resistance of 10 − 8 to 10 − 11 ωcm is acceptable . for example , in addition to polyimide containing diffused carbon , polyethylene terephthalate , polycarbonate , polytetrafluoroethylene , or polyvinylidene fluoride in which conductive particles such as carbon are diffused may be used . a polymer film whose electric resistance is regulated by composition regulation without using conductive particles may be used . furthermore , such a polymer film with an ion conductive material mixed or rubber materials such as silicone rubber and urethane rubber having a comparatively low electric resistance may be used . on the intermediate transfer belt 87 , between the drive roller 88 and the driven roller 89 , in the conveying direction of the intermediate transfer belt 87 , the process cartridge 81 a and also the process cartridges 81 b , 81 c , and 81 d are arranged sequentially . the process cartridges 81 b , 81 c , and 81 d respectively have the same constitution as that of the process cartridge 81 a . the photosensitive drums 82 b , 82 c , and 82 d are installed almost at the centers of the respective process cartridges . opposite to the surfaces of the photosensitive drums 82 b , 82 c , and 82 d , the main chargers 83 b , 83 c , and 83 d are installed respectively . on the downstream side of the main chargers 83 b , 83 c , and 83 d , exposure units 84 b , 84 c , and 84 d for exposing the charged photosensitive drums 82 b , 82 c , and 82 d and forming electrostatic latent images are installed . on the downstream side of the exposure units 84 b , 84 c , and 84 d , developing devices 85 b , 85 c , and 85 d for reversely developing the electrostatic latent images formed by the exposure units 84 b , 84 c , and 84 d are installed . on the upstream side of the contact positions of the photosensitive drums 82 b , 82 c , and 82 d with the intermediate transfer belt 87 , cleaners 86 b , 86 c , and 86 d are installed . further , the developing devices 85 b , 85 c , and 85 d respectively store a magenta developer , a cyan developer , and a black developer . the intermediate transfer belt 87 makes contact sequentially with the respective photosensitive drums 82 a to 82 d . in the neighborhood of each contact position of the intermediate transfer belt 87 with the respective photosensitive drums , primary transfer rollers 90 a , 90 b , 90 c , and 90 d are installed in correspondence with the respective photosensitive drums . namely , the primary transfer rollers 90 a to 90 d are installed so as to make contact with the rear of the intermediate transfer belt 87 above the corresponding photosensitive drums and are opposite to the process cartridges 81 a to 81 d via the intermediate transfer belt 87 . the primary transfer rollers 90 a to 90 d are connected to a positive (+) dc power source ( not drawn ) which is a voltage impression means . further , in the neighborhood of each of the primary transfer rollers 90 a to 90 d , a primary transfer roller voltage detecting unit ( not drawn ) for detecting the voltages impressed to the primary transfer rollers 90 a to 90 d is installed . further , in the neighborhood of the drive roller 88 , an intermediate transfer belt cleaner 91 for removing and storing residual toner on the intermediate transfer belt 87 is installed . on the other hand , on the lower part of the image forming unit 73 , a paper supply cassette 93 of the paper supply unit 74 for storing sheets of paper ( transfer materials ) is installed . on the paper supply unit 74 , a pick - up roller 94 for picking up sheets of paper one by one is installed . in the neighborhood of a secondary transfer roller 92 of the image forming unit 73 , an aligning roller pair 95 is installed rotatably . the aligning roller pair 95 supplies sheets of paper to the secondary transfer unit in which the secondary transfer roller 92 and the driven roller 89 stand face to face with each other across the intermediate transfer belt 87 at predetermined timing . further , above the intermediate transfer belt 87 , a fixing device 96 for fixing a developer on a sheet of paper is installed . the fixing device 96 applies predetermined heat and pressure to a sheet of paper holding a toner image and fixes the melted toner image to the sheet of paper . furthermore , at a predetermined position under the intermediate transfer belt 87 , an environment sensor 98 for detecting the environment inside the image forming apparatus 1 such as temperature and relative humidity is installed . next , the color image forming operation ( print process ) of the image forming apparatus 1 will be explained . when starting of the image forming operation is instructed ( that is , starting of printing is instructed ), the photosensitive drum 82 a receives driving force from a drive mechanism not drawn and starts rotation . the main charger 83 a charges uniformly the photosensitive drum 82 a , for example , at − 600 v . the exposure unit 84 a irradiates light according to an image ( characters ) to be printed to the photosensitive drum 82 a uniformly charged by the main charger 83 a to form an electrostatic latent image . the developing device 85 a stores a developer ( a two - component developer of y toner of yellow + ferrite carrier ), gives a bias value , for example , − 380 v to a developing sleeve ( not drawn ) from a developing bias power source not drawn to form a developing electric field between the photosensitive drum 82 a and itself . the y toner charged negatively is adhered and reversely developed in the area irradiated with light on the photosensitive drum 82 a . next , the developing device 85 b develops the electrostatic latent image by the magenta developer and forms an m toner image of magenta on the photosensitive drum 82 b . at this time , the m toner has a mean particle diameter of about several microns ( for example , 7 microns ) similarly to the y toner and is negatively charged due to frictional charging with ferrite magnetic carrier particles ( not drawn ) with a mean particle diameter of about 60 microns . the developing bias value is , for example , about − 380 v similarly to the developing device 85 b and a developing bias voltage is impressed to a developing sleeve ( not drawn ) by a bias power source not drawn . the direction of the developing electric field is directed to the developing sleeve from the surface of the photosensitive drum 82 b in the imaging unit and negatively charged m toner is adhered to the high potential portion of the latent image . the developing device 85 c develops the electrostatic latent image by the cyan developer and forms a c toner image of cyan on the photosensitive drum 82 c . at this time , the c toner has a mean particle diameter of about several microns ( for example , 7 microns ) similarly to the y toner and is negatively charged due to frictional charging with ferrite magnetic carrier particles ( not drawn ) with a mean particle diameter of about several tens microns ( 60 microns ). the developing bias value is , for example , about − 380 v similarly to the developing device 85 c and a developing bias voltage is impressed to a developing sleeve ( not drawn ) by a bias power source not drawn . the direction of the developing electric field is directed to the developing sleeve from the surface of the photosensitive drum 82 c in the imaging unit and negatively charged c toner is adhered to the high potential portion of the latent image . the developing device 85 d develops the electrostatic latent image by the black developer and forms a b toner image of black on the photosensitive drum 82 d . at this time , the b toner has a mean particle diameter of about several microns ( for example , 7 microns ) similarly to the y toner and is negatively charged due to frictional charging with ferrite magnetic carrier particles ( not drawn ) with a mean particle diameter of about several tens microns ( for example , 60 microns ). the developing bias value is , for example , about − 380 v similarly to the developing device 85 d and a developing bias voltage is impressed to a developing sleeve ( not drawn ) by a bias power source not drawn . the direction of the developing electric field is directed to the developing sleeve from the surface of the photosensitive drum 82 d in the imaging unit and negatively charged b toner is adhered to the high potential portion of the latent image . in a transfer area ta formed by the photosensitive drum 82 a , intermediate transfer belt 87 , and primary transfer roller 90 a , to the primary transfer roller 90 a , a required voltage , for example , a bias voltage of about + 1000 v is impressed . between the primary transfer roller 90 a and the photosensitive drum 82 a , a transfer electric field is formed and the y toner image on the photosensitive drum 82 a is transferred onto the intermediate transfer belt 87 according to the transfer electric field . the constitution of the primary transfer rollers 90 b , 90 c , and 90 d is basically the same as that of the primary transfer roller 90 a and the explanation thereof will be omitted to avoid repetition . an image on the intermediate transfer belt 87 to which the y toner image is transferred in the transfer area ta is conveyed toward a transfer area tb . in the transfer area tb , a required voltage , for example , a bias voltage of about + 1200 v is impressed to the primary transfer roller 90 b from the dc power source , thus the m toner image of magenta is superimposed on the y toner image . in a transfer area tc , a required voltage , for example , a bias voltage of about + 1400 v is impressed to the primary transfer roller 90 c and in a transfer area td , a required voltage , for example , a voltage of about + 1700 v is impressed to the primary transfer roller 90 d , thus on the developer images already transferred , the cyan developer image and black developer image are sequentially multitransferred . on the other hand , the pick - up roller 94 takes out a sheet of paper from the paper supply cassette 93 and the aligning roller pair 95 supplies the sheet of paper to the secondary transfer unit . in the secondary transfer unit , the required bias voltage is impressed to the driven roller 89 , and a transfer electric field is formed between the driven roller 89 and the secondary transfer roller 92 across the intermediate transfer belt 87 , and the multiple color toner images on the intermediate transfer belt 87 are transferred to a sheet of paper in a batch . the developer images of various colors transferred in a batch in this way are fixed on the sheet of paper by the fixing device 96 and a color image is formed . the fixed sheet of paper is ejected onto an intra - body paper ejection unit ( not drawn ). further , the embodiment of the present invention indicates the processing examples in which the steps of the flow charts are executed in time series in the order of recording , though it includes processes performed in parallel or individually instead of in time series . according to the present invention , even if the toner charge amount and environment are changed , a satisfactory transfer property can be obtained .	6
the below - described embodiments are merely illustrative for the principles of the present invention for improvement of high frequency reconstruction systems . it is understood that modifications and variations of the arrangements and the details described herein will be apparent to others skilled in the art . it is the intent , therefore , to be limited only by the scope of the impending patent claims and not by the specific details presented by way of description and explanation of the embodiments herein . when analysing an audio signal spectrum with sufficient frequency resolution , formants , single sinusodials etc . are clearly visible , this is hereinafter referred to as the fine structured spectral envelope . however , if a low resolution is used , no fine details can be observed , this is hereinafter referred to as the coarse structured spectral envelope . the level of the noise - floor , albeit it is not necessarily noise by definition , as used throughout the present invention , refers to the ratio between a coarse structured spectral envelope interpolated along the local minimum points in the high resolution spectrum , and a coarse structured spectral envelope interpolated along the local maximum points in the high resolution spectrum . this measurement is obtained by computing a high resolution fft for the signal segment , and applying a peak - and dip - follower , fig1 . the noise - floor level is then computed as the difference between the peak - and the dip - follower . with appropriate smoothing of this signal in time and frequency , a noise - floor level measure is obtained . the peak follower function and the dip follower function can be described according to eq . 1 and eq . 2 , y peak ⁡ ( x ⁡ ( k ) ) = max ⁡ ( y ⁡ ( x ⁡ ( k - 1 ) ) - t , x ⁡ ( k ) ) ⁢ ∀ 1 ≤ k ≤ fftsize 2 eq . ⁢ 1 y dip ⁡ ( x ⁡ ( k ) ) = min ⁡ ( y ⁡ ( x ⁡ ( k - 1 ) ) + t , x ⁡ ( k ) ) ⁢ ∀ 1 ≤ k ≤ fftsize 2 eq . ⁢ 2 where t is the decay factor , and x ( k ) is the logarithmic absolute value of the spectrum at line k . the pair is calculated for two different fft sizes , one high resolution and one medium resolution , in order to get a good estimate during vibratos and quasi - stationary sounds . the peak - and dip - followers applied to the high resolution fft are lp - filtered in order to discard extreme values . after obtaining the two noise - floor level estimates , the largest is chosen . in one implementation of the present invention the noise - floor level values are mapped to multiple frequency bands , however , other mappings could also be used e . g . curve fitting polynomials or lpc coefficients . it should be pointed out that several different approaches could be used when determining the noise contents in an audio signal . however it is , as described above , one objective of this invention , to estimate the difference between local minima and maxima in a high - resolution spectrum , albeit this is not necessarily an accurate measurement of the true noise - level . other possible methods are linear prediction , autocorrelation etc , these are commonly used in hard decision noise / no noise algorithms [“ improving audio codecs by noise substitution ” d . schultz , jaes , vol . 44 , no . 7 / 8 , 1996 ]. although these methods strive to measure the amount of true noise in a signal , they are applicable for measuring a noise - floor - level as defined in the present invention , albeit not giving equally good results as the method outlined above . it is also possible to use an analysis by synthesis approach , i . e . having a decoder in the encoder and in this manner assessing a correct value of the amount of adaptive noise required . in order to apply the adaptive noise - floor , a spectral envelope representation of the signal must be available . this can be linear pcm values for filterbank implementations or an lpc representation . the noise - floor is shaped according to this envelope prior to adjusting it to correct levels , according to the values received by the decoder . it is also possible to adjust the levels with an additional offset given in the decoder . in one decoder implementation of the present invention , the received noise - floor levels are compared to an upper limit given in the decoder , mapped to several filterbank channels and subsequently smoothed by lp filtering in both time and frequency , fig2 . the replicated highband signal is adjusted in order to obtain the correct total signal level after adding the noise - floor to the signal . the adjustment factors and noise - floor energies are calculated according to eq . 3 and eq . 4 . where k indicates the frequency line , l the time index for each sub - band sample , sfb_nrg ( k , l ) is the envelope representation , and nf ( k , l ) is the noise - floor level . when noise is generated with energy noiselevel ( k , l ) and the highband amplitude is adjusted with adjustfactor ( k , l ) the added noise - floor and highband will have energy in accordance with sfb_nrg ( k , l ). an example of the output from the algorithm is displayed in fig3 - 5 . fig3 shows the spectrum of an original signal containing a very pronounced formant structure in the low band , but much less pronounced in the highband . processing this with sbr without adaptive noise - floor addition yields a result according to fig4 . here it is evident that although the formant structure of the replicated highband is correct , the noise - floor level is too low . the noise - floor level estimated and applied according to the invention yields the result of fig5 , where the noise - floor superimposed on the replicated highband is displayed . the benefit of adaptive noise - floor addition is here very obvious both visually and audibly . an ideal replication process , utilising multiple transposition factors , produces a large number of harmonic components , providing a harmonic density similar to that of the original . a method to select appropriate amplification - factors for the different harmonics is described below . assume that the input signal is a harmonic series : clearly , every second harmonic in the transposed signal is missing . in order to increase the harmonic density , harmonics from higher order transpositions , m = 3 , 5 etc , are added to the highband . to benefit the most of multiple harmonics , it is important to appropriately adjust their levels to avoid one harmonic dominating over another within an overlapping frequency range . a problem that arises when doing so , is how to handle the differences in signal level between the source ranges of the harmonics . these differences also tend to vary between programme material , which makes it difficult to use constant gain factors for the different harmonics . a method for level adjustment of the harmonics that takes the spectral distribution in the low band into account is here explained . the outputs from the transposers are fed through gain adjusters , added and sent to the envelope - adjustment filterbank . also sent to this filterbank is the low band signal enabling spectral analysis of the same . in the present invention the signal - powers of the source ranges corresponding to the different transposition factors are assessed and the gains of the harmonics are adjusted accordingly . a more elaborate solution is to estimate the slope of the low band spectrum and compensate for this prior to the filterbank , using simple filter implementations , e . g . shelving filters . it is important to note that this procedure does not affect the equalisation functionality of the filterbank , and that the low band analysed by the filterbank is not re - synthesised by the same . according to the above ( eq . 5 and eq . 6 ), the replicated highband will occasionally contain holes in the spectrum . the envelope adjustment algorithm strives to make the spectral envelope of the regenerated highband similar to that of the original . suppose the original signal has a high energy within a frequency band , and that the transposed signal displays a spectral hole within this frequency band . this implies , provided the amplification factors are allowed to assume arbitrary values , that a very high amplification factor will be applied to this frequency band , and noise or other unwanted signal components will be adjusted to the same energy as that of the original . this is referred to as unwanted noise substitution . let p 1 =[ p 11 , . . . , p 1n ] eq . 7 be the scale factors of the original signal at a given time , and p 2 =[ p 21 , . . . , p 2n ] eq . 8 the corresponding scale factors of the transposed signal , where every element of the two vectors represents sub - band energy normalised in time and frequency . the required amplification factors for the spectral envelope adjustment filterbank is obtained as by observing g it is trivial to determine the frequency bands with unwanted noise substitution , since these exhibit much higher amplification factors than the others . the unwanted noise substitution is thus easily avoided by applying a limiter to the amplification factors , i . e . allowing them to vary freely up to a certain limit , g max . the amplification factors using the noise - limiter is obtained by g lim =[ min ( g 1 , g max ), . . . , min ( g n , g max )]. eq . 10 however , this expression only displays the basic principle of the noise - limiters . since the spectral envelope of the transposed and the original signal might differ significantly in both level and slope , it is not feasible to use constant values for g max . instead , the average gain , defined as g avg = ∑ i ⁢ p 1 ⁢ i ∑ i ⁢ p 2 ⁢ i , eq . ⁢ 11 is calculated and the amplification factors are allowed to exceed that by a certain amount . in order to take wide - band level variations into account , it is also possible to divide the two vectors p 1 and p 2 into different sub - vectors , and process them accordingly . in this manner , a very efficient noise limiter is obtained , without interfering with , or confining , the functionality of the level - adjustment of the sub - band signals containing useful information . it is common in sub - band audio coders to group the channels of the analysis filterbank , when generating scale factors . the scale factors represent an estimate of the spectral density within the frequency band containing the grouped analysis filterbank channels . in order to obtain the lowest possible bit rate it is desirable to minimise the number of scale factors transmitted , which implies the usage of as large groups of filter channels as possible . usually this is done by grouping the frequency bands according to a bark - scale , thus exploiting the logarithmic frequency resolution of the human auditory system . it is possible in an sbr - decoder envelope adjustment filterbank , to group the channels identically to the grouping used during the scale factor calculation in the encoder . however , the adjustment filterbank can still operate on a filterbank channel basis , by interpolating values from the received scale factors . the simplest interpolation method is to assign every filterbank channel within the group used for the scale factor calculation , the value of the scale factor . the transposed signal is also analysed and a scale factor per filterbank channel is calculated . these scale factors and the interpolated ones , representing the original spectral envelope , are used to calculate the amplification factors according to the above . there are two major advantages with this frequency domain interpolation scheme . the transposed signal usually has a sparser spectrum than the original . a spectral smoothing is thus beneficial and such is made more efficient when it operates on narrow frequency bands , compared to wide bands . in other words , the generated harmonics can be better isolated and controlled by the envelope adjustment filterbank . furthermore , the performance of the noise limiter is improved since spectral holes can be better estimated and controlled with higher frequency resolution . it is advantageous , after obtaining the appropriate amplification factors , to apply smoothing in time and frequency , in order to avoid aliasing and ringing in the adjusting filterbank as well as ripple in the amplification factors . fig6 displays the amplification factors to be multiplied with the corresponding subband samples . the figure displays two high - resolution blocks followed by three low - resolution blocks and one high resolution block . it also shows the decreasing frequency resolution at higher frequencies . the sharpness of fig6 is eliminated in fig7 by filtering of the amplification factors in both time and frequency , for example by employing a weighted moving average . it is important however , to maintain the transient structure for the short blocks in time in order not to reduce the transient response of the replicated frequency range . similarly , it is important not to filter the amplification factors for the high - resolution blocks excessively in order to maintain the formant structure of the replicated frequency range . in fig9 b the filtering is intentionally exaggerated for better visibility . the present invention can be implemented in both hardware chips and dsps , for various kinds of systems , for storage or transmission of signals , analogue or digital , using arbitrary codecs . fig8 and fig9 shows a possible implementation of the present invention . here the high - band reconstruction is done by means of spectral band replication , sbr . in fig8 the encoder side is displayed . the analogue input signal is fed to the a / d converter 801 , and to an arbitrary audio coder , 802 , as well as the noise - floor level estimation unit 803 , and an envelope extraction unit 804 . the coded information is multiplexed into a serial bitstream , 805 , and transmitted or stored . in fig9 a typical decoder implementation is displayed . the serial bitstream is de - multiplexed , 901 , and the envelope data is decoded , 902 , i . e . the spectral envelope of the high - band and the noise - floor level . the de - multiplexed source coded signal is decoded using an arbitrary audio decoder , 903 , and up - sampled 904 . in the present implementation sbr - transposition is applied in unit 905 . in this unit the different harmonics are amplified using the feedback information from the analysis filterbank , 908 , according to the present invention . the noise - floor level data is sent to the adaptive noise - floor addition unit , 906 , where a noise - floor is generated . the spectral envelope data is interpolated , 907 , the amplification factors are limited 909 , and smoothed 910 , according to the present invention . the reconstructed high - band is adjusted 911 and the adaptive noise is added . finally , the signal is re - synthesised 912 and added to the delayed 913 low - band . the digital output is converted back to an analogue waveform 914 .	6
throughout this description all ranges described include all values and sub - ranges therein , unless otherwise specified . additionally , the indefinite article “ a ” or “ an ” carries the meaning of “ one or more ” throughout the description , unless otherwise specified . in an ongoing study of magnetic materials and particularly nanoparticle magnetic materials , the present inventor has identified manganese bismuth alloy in a nanoparticle form as a material having potential utility as a replacement of neodymium iron borate for manufacture of permanent magnets . mnbi nanoparticles were predicted to express coercivities as high as 4 t . the invention disclosed in u . s . application ser . no . 14 / 025 , 033 , filed sep . 12 , 2013 , discloses some results of that work . the inventors are also conducting ongoing studies with soft magnetic nanoparticle materials such as disclosed in u . s . ser . no . 14 / 252 , 036 , filed apr . 14 , 2014 , wherein core - shell nanoparticles having an iron cobalt nanoparticle core of less than 200 nm with a silica shell and metal silicate interface are disclosed . in ongoing research with these and other systems , the inventors have surprisingly discovered core - shell - core nanoparticles obtained by application of a manganese bismuth nanocoating to a feco alloy core silica coating core - shell nanoparticle provides a material having highly tunable magnetic properties according to the relative size and nature of each of the core - shell - shell components . such a complex combination of soft and hard magnetic components within one nanoparticle is novel and offers many opportunities for discovery and development of new magnetic materials and devices . in a first embodiment , the present invention includes core - shell - core nanoparticle , comprising : an intermediate shell of a silicon dioxide coating the core ; an outer manganese bismuth alloy nanoparticle , also referred to as a core based on the spherical nano - scale nature of the mnbi nanoparticle on the intermediate silicon dioxide shell ; and a metal silicate interface layer between the core and the silicon dioxide shell ; wherein a diameter of the iron cobalt alloy core is 200 nm or less . the inventors have discovered that the formation of individual feco alloy nanoparticles coated with silica shells of various thicknesses may be achieved via a scalable wet chemical process . surprisingly , the inventors have discovered that formation of interfacial metal silicates may alter significantly the nanomagnetism in these ultra - high surface area feco alloy nanoparticle systems . evidence that an interfacial layer of metal silicates had formed was observed in x - ray photoelectron spectra collected over the 2p transitions of fe and co ; and as the thickness of the silica shell was increased ( by altering the duration of the silica reaction ) a thicker interfacial metal silicate layer was formed , increasing the nanoparticles &# 39 ; overall magnetic anisotropy , as evidenced by increased blocking temperatures and altered coercivities . thus the inventors have surprisingly discovered that by producing superparamagnetic iron cobalt alloy nanoparticles that are encapsulated in silica shells with varying degree of wet synthesis treatment time , core shell feco nanoparticles having differing nanomagnetic properties may be obtained . in certain embodiments the diameter of the iron cobalt alloy nanoparticle core is 100 nm or less , and in further embodiments the diameter of the iron cobalt alloy nanoparticle core is from 2 nm to 50 nm . according to the invention , the iron cobalt alloy nanoparticle grains are of or approaching the size of the single particle magnetic domain of the iron cobalt alloy and thus are superparamagnetic . while not being constrained to theory , the inventors believe control of grain size to approximately that of the particle magnetic domain is a factor which contributes to the reduced hysteresis of a magnetic core according to the present invention . moreover , the presence of insulating silica shells about the core grains is a factor which contributes to the low eddy current formation of a magnetic core according to the present invention . it is conventionally known that the range of particle size for which single domain particles exhibit superparamagnetism has an upper boundary characteristic of the particle chemical composition . the inventors have discovered that during synthesis of the silicon dioxide shell a metal silicate thin layer interface is coincidently formed . evidence that an interfacial layer of metal silicates had formed was observed in x - ray photoelectron spectra collected over the 2p transitions of fe and co ; and as the thickness of the silica shell was increased ( by altering the duration of the silica reaction ) a thicker interfacial metal silicate layer was formed , increasing the nanoparticles &# 39 ; overall magnetic anisotropy , as evidenced by increased blocking temperatures and altered coercivities . the inventors have recognized that an understanding of the effect of this interfacial metal silicate layer to control magnetic properties is a key element to effective utility of these materials in applications as low - loss transformer cores . in a study of the feco alloy core shell nanoparticles , the inventors have discovered that interfacial metal silicates formed during the silicon dioxide shell coating synthesis , alter the overall magnetic anisotropy of the nanoparticles as a higher anisotropy phase that is a combination of fe - and co - based silicates that acts to increase the ‘ magnetically active volume ’ of the nanoparticles compared to a bare feco nanoparticle . binary alloy feco single - magnetic - domain nanoparticle samples were synthesized ( see example ), with the exception of varying the duration of the sio 2 reaction times , which led to sio 2 shells of varying thickness : a 1 min reaction time produced a 3 nm thick shell , 10 minutes a 4 nm thick shell , and 20 minutes a 6 nm thick shell . the average feco nanoparticle diameter and sio 2 shell thickness were determined and for all three core / shell nanoparticle samples ( feco / sio 2 ( 3 nm ), feco / sio 2 ( 4 nm ), and feco / sio 2 ( 6 nm )), the average feco core diameter was found to be 4 ± 1 nm indicating a high degree of reproducibility in the nanoparticle core synthesis . the thicknesses of the silica shells were determined in a similar manner and found to be 3 ± 1 nm , 4 ± 1 nm , and 6 ± 1 nm for the feco / sio 2 ( 3 nm ), feco / sio 2 ( 4 nm ), and feco / sio 2 ( 6 nm ) samples , respectively . from the tem images , it was observed that the feco cores were covered completely by the silica shells . analysis of x - ray diffraction patterns indicated the presence of both fe and co silicates . however , the relative proportions appear to be variable and although not wishing to be constrained by theory , the inventors believe that metal silicate content may be related to the thermodynamic energy of formation of the metal silicate . the studies showed that fe - and co - silicates formed at the interface between the feco nanoparticle core and the sio 2 shell during the synthesis process . however , the relative integrated areas of the fe ° and co ° metallic peaks of the different core / shell nanoparticle systems indicated fe - silicates may be formed preferentially over co - silicates . nanoparticles of fe —/ sio 2 may be synthesized by the ethanolic reaction of sodium borohydride with iron dichloride and cobalt dichloride in a solution of sodium hydroxide and tetraoctylammonium bromide . the obtained nanoparticles may be treated with tetraethyl orthosilicate , in water ethanol mixture using triethylamine as the base - catalyst , to form silica shells . these particles may then be purified using an aqueous ethanol rinse . as indicated , the length of the treatment of the fe — co nanoparticles determines the width of the silicon dioxide coating and correspondingly , the width of the metal silicate layer . the longer the treatment time , the greater the amount of the coating and the greater the width of the metal silicate layer . the synthesis may be conducted for such time as necessary to prepare a metal silicate layer of 0 . 5 to 20 nm , preferably 0 . 8 to 10 nm and most preferably 1 . 0 to 8 nm . the manganese - bismuth alloy coating may be formed by a method comprising in the presence of the feco silica core shell nanoparticles , treating mn powder with a hydride reducing agent and combining by ball milling ; adding a solution of a bismuth salt of a long chain carboxylate and alkyl amine to the mn - hydride reducing agent mixture while continuing the agitation ; upon completion of the bismuth salt solution addition , the agitation is continued to form the core - shell - core feco / sio 2 / mnbi nanoparticles . the ether solvent for the hydride treatment may be any ether compatible with hydride reaction conditions . suitable ether solvents include tetrahydrofuran ( thf ), 2 - methyl - tetrahydrofuran , diethyl ether , diisopropyl ether , 1 , 4 - dioxane , dimethoxy ethane , diethylene glycol diethylether , 2 -( 2 - methoxyethoxyl ) ethanol and methyl tert - butyl ether . thf may be a preferred solvent . the hydride reducing agent may be any material capable of reacting with the manganese to form a manganese reducing agent complex and include nah , lih , cah 2 , lialh 4 and libh 4 . libh 4 may be a preferred hydride treatment agent . the manganese lithium borohydride reducing agent complex formation is accomplished by ball milling the manganese powder and hydride reducing agent at 150 to 400 rpms for up to 4 hours in a planetary ball mill . variations of this procedure may be optimized to appropriately modify the properties obtained and would be understood by one of ordinary skill in the art . additionally , the amount of hydride treatment agent may be varied to modify conditions and the properties of the nanoparticles obtained and may vary in an equivalent ratio of hydride to mn of from 1 / 1 to 100 / 1 . the bismuth may be added in any ether soluble salt form and is preferably added as a salt of a long chain carboxylic acid . in a preferred embodiment , the bi is added as bismuth neodecanoate . the mole ratio of bi to mn may vary from 0 . 8 / 1 to 1 . 2 / 1 . preferably the ratio of bi / mn is from 0 . 9 / 1 to 1 . 1 / 1 and most preferably , the ratio of bi / mn is 1 / 1 . the addition time of the bismuth compound may be varied to optimize and modify the size and properties of the mnbi . the width may be from 0 . 5 to 200 nm , preferably 1 . 0 to 100 nm and most preferably 2 to 20 nm . preferably the addition time is less than one hour and in a preferred embodiment the addition time is about 20 minutes . the alkyl amine is preferably a primary amine having a carbon chain of from 6 to 12 carbons may optionally be added to the reaction . as indicated in fig2 , when the core - shell - core nanoparticles of the invention are thermally treated in an annealing process , both the soft phase feco and hard phase mnbi anneal at temperatures characteristic of feco and mnbi respectively . having generally described this invention , a further understanding can be obtained by reference to certain specific examples which are provided herein for purposes of illustration only and are not intended to be limiting unless otherwise specified . 0 . 489 g sodium hydroxide , 12 . 892 g tetraoctylammonium bromide , 10 . 922 g iron dichloride tetrahydrate , and 12 . 042 g cobalt chloride hexahydrate were dissolved in 250 ml of ethanol and placed under argon . a solution of 12 . 258 g sodium borohydride dissolved in 450 ml ethanol was then added to the iron cobalt mixture . upon completion of the borohydride addition the reaction mixture was diluted with 100 ml of water . the product feco nanoparticles were then washed with 70 % water / 30 % ethanol . the feco nanoparticles were then suspended in a mixture of 625 ml water and 2 ml triethylamine . a solution of 0 . 5 ml of tetraethylorthosilicate in 390 ml ethanol was then added to the feco suspension and the obtained mixture allowed to react for 15 minutes to obtain silica coated nanoparticles . the coated nanoparticles were then washed with ethanol . the silica - coated feco nanoparticles ( 0 . 27 g ) were suspended in 200 ml thf . 0 . 152 g heptylcyanide , 0 . 008 g lithium borohydride , and 0 . 012 g mn ( libh 4 ) 2 were added to the feco nanoparticle suspension . a solution of 0 . 082 g of bismuth neodecanoate in 15 ml thf was then added dropwise to the stirring suspension . the product was finally washed with thf . a tem image of the prepared core - shell - core nanoparticles is shown in fig1 . the z - contrast tem image of fig3 shows how the mnbi phase has an island distribution throughout the feco / sio2 . fig2 shows dsc and m ( t ) data over the temperature ranges where the observed properties , from both data sets , show the distinct presence of the feco soft magnetic phase and mnbi hard magnetic phase , thus confirming the presence of both in the core - shell - core nanostructure .	7
referring now to fig1 there is shown an electrical connector shield case 100 formed according to the present invention so as to define a space 101 having a trapezoidal section . its parallel major sides 102 and 103 have bosses 104 and 105 , respectively , projecting outward . the major side 102 has at its center a pair of mating portions 106 each with an engaging tab 107 which is extended upward . the major side 102 has along its upper edge a pair of enclosing flanges 108 curved outward and then upward . the major side 103 has along its upper edge an enclosing flange 109 curved outward and then upward . the major side 102 has a latch claw 112 between the enclosing flange 108 and the minor side 110 and a latch claw 113 between the enclosing flange 108 and the minor side 111 , while the major side 103 has a latch claw 114 between the enclosing flange 109 and the minor side 110 and a latch claw 115 between the enclosing flange 109 and the minor side 111 . the major side 102 has a pair of stopper flanges 116 bent inward along its lower edge , while the major side 103 has an stopper flange 117 bent inward along its lower edge . referring to fig2 there is shown a plug connector 200 having an insulating housing 201 to which the shield case 100 according to the present invention is applied . the insulating housing 201 has a fitting protuberance 202 having a section similar to that of the space 101 and a base portion 203 integral with the fitting protuberance 202 and having a section greater than that of the protuberance . the base portion 203 has a pair of flanges 206 and 207 on its upper and lowr major sides 204 and 205 . the flange 206 has a pair of notches 208 and 209 with which the respective claws 112 and 113 and the flange 207 has a pair of notches ( not shown ) for the claws 114 and 115 . the fitting protuberance 202 is adapted to fit into the enclosure defined by the major sides 102 and 103 and the minor sides 110 and 111 of the shield case 100 . the front edges of the fitting protuberance 202 engage with the stop flanges 116 , 117 . the engaging tab 107 is inserted into a slot ( not shown ) opened through the flange 206 into the base 203 . an end 212 of a female contact ( not shown ) is projected from the rear side 210 of the base 203 and is connected to a core wire 301 of a shield cable 300 . a pair of metal plug case halves 213 and 214 are adapted to house the base 203 and the flange 206 in such a manner that the fitting protuberance 202 may be projected from the case . portions of the plug case inside adjacent to the flange 206 are brought into contact with the enclosing flanges 108 and 109 and the latch claws 112 to 115 thereby to secure shielding function . the case halves 213 and 214 have cutouts 215 and 216 , respectively , to allow insertion of the shield cable 300 . the insides of the cutouts 215 and 216 are brought into contact with a conductive tape 303 wrapped around a folded shield sheat 302 to secure shielding function . the above plug connector is adapted to insert into a receptacle connector 400 with a receptacle case 401 secured to a circuit board 500 with a screw 501 . the receptacle case has an opening 402 for receiving the protuberance 202 of the plug connector 200 . within the opening 402 there are provided a plurality of male contacts 403 so that they may come into contact with the female contacts placed in the holes of the other face of the protuberance 202 . the base of each male contact 403 is inserted into a hole ( not shown ) of an insulating housing 404 within the receptacle case 401 and connected to a appropriate element ( not shown ) on a circuit board 500 . when the plug connector 200 is inserted into the opening 402 , the bosses 104 and 105 of the shield case 100 are brought into contact with the inside 405 of the opening to provide shielding function . fig3 a - 3f illustrate a method of making the electrical connector shield case according to the invention . a metal sheet 10 with dimensions corresponding to those of a final product or electrical connector shield case 100 is placed on the lower die 20 with depressions 21 and other depressions ( not shown ) provided at the positions corresponding to the bosses 104 and 105 and the parts to be cut off , respectively , and the upper die 30 with projections 31 and other projections ( not shown ) provided at the positions corresponding to the bosses 104 and 105 and the parts to be cut off , respectively , is pressed against the lower die 20 ( fig3 a and 3b ) to form bosses 104 and 105 , tab 107 , enclosing flanges 108 and 109 , latch claws 112 , 113 , 114 , and 115 , and stop flanges 116 and 117 ( fig3 c ). the metal sheet 10 is then placed on the die 40 with a depression 41 , and the upper die 50 with a projection 51 having a shape corresponding to the depression 41 is pressed down ( fig3 d ). the core die 60 with a shape substantially identical with that of the space 101 is then placed on the central part of the metal sheet 10 , and the opposite ends of the sheet 10 are pressed in the directions of arrows ( fig3 e ). after the pressing , the core die 60 is removed to provide an electrical connector shield case 100 made according to the invention ( fig3 f ). the above electrical connector shield case 100 has latch claws 112 through 115 to engage the notches 208 and 209 of the insulating housing 201 , but these claws 112 through 115 and notches 208 and 209 may be eliminated as shown in fig4 . this electrical connector shield case 100a has an engaging tab 107a with an extended end 128a and an engaging tab 127a with an extended end 128a provided at the center of the enclosing flange 109a . the shield case 100a is applied to a plug connector 201a with flanges 206a and 207a each having engaging slot 217a . each of the engaging tabs 107a and 127a is snapped into the engaging slot 217a so that its extended end 128a may rest on the flange . the other structures are identical with those of fig1 through 3 , and their description will be omitted . the above electrical connector shield case 100 or 100a is fitted over the protuberance 202 of a plug connector and is brought into contact with the shield member , such as the metal case , of a receptacle connector to secure shielding function when it is inserted into the receptacle connector . this sytem , however , requires that the receptacle case be made of conductive metal , increasing the number of parts . thus , the receptacle case 401 of a receptacle connector 400 is made of insulating material , with a shield case placed within its opening 402 as described below with reference to fig5 . in fig5 a shield case 403b defines a space 406b with a trapezoidal cross section substantially identical with that of an opening 402b and has bosses 409b and 410b on the insides of its major sides 407b and 408b . the major sides 407b and 408b have engaging tabs 411b and 412b , respectively , on their rear edges . the engaging tab 411b has an extended end 413b . the major sides 407b and 408b have flanges 414b and 415b , respectively , along their front edges . the receptacle case 401b has a number of male contacts 416b arranged on its base part within the opening 402b and , at the central parts on opposite major insides , a snap slot 418b into which the snap tab 411b is snapped and a slot 419b into which the tab 412b is inserted . after inserted , the free end of the tab 412b is bent and connected to a circuit board 500b to secure shield function . the edges of the opening 402b have cutouts 421b and 422b for receiving the flanges 414b and 415b , respectively . the shield case for covering the protuberance of a plug connector to be inserted into the opening 402b of this receptacle requires no bosses on its surface to secure shielding function because of the presence of bosses 409b and 410b on the shield case 403b . alternatively , these bosses 409b and 410b may be eliminated from the shield case 403b by providing bosses on the shield case of a plug connector . the other structures of the plug connector are similar to those of fig1 through 4 , and their description will be omitted . as has been described above , according to the invention , a metal sheet may be punched out and bent to form a cylindrical electric connector shield case to eliminate the drawing press process and the metal sheet deformation in connection with the process , thus increasing the material utility . in addition , since no drawing press is used , it is unnecessary to use any extensible , soft material , thus allowing the formation of resilient bosses and eliminating the deformation caused by the excess external force otherwise required . moreover , the wall thickness is even in every section , giving high precision . the direction of a protuberance is selectable , too . although the preferred embodiments of the present invention have been described above , other embodiments and modifications which would be apparent to one having ordinary skill in the art are intended to be covered by the spirit and scope of the appended claims .	8
in the following detailed description , only the preferred embodiment of the invention has been shown and described , simply by way of illustration of the best mode contemplated by the inventor ( s ) of carrying out the invention . as will be realized , the invention is capable of modification in various obvious respects , all without departing from the invention . accordingly , the drawings and description are to be regarded as illustrative in nature , and not restrictive . fig1 is a diagram for explaining the necessity and principle of an adaptive frequency control apparatus according to the present invention . the voltage - controlled oscillator generally used for rf frequency control has the voltage / frequency characteristic shown in fig1 . for the frequency control , a linear range is actually used such that the frequency value varies linearly with respect to an input voltage value . with a large slope of the linear curve , small changes in the control voltage induce significant fluctuations in the frequency , so more precise resolution of the frequency control voltage is needed than with a smaller slope of the curve . all the rf systems do not have a same linear range , since the linear range is dependent upon the standard of each voltage control regulator . the rf frequency control range is also dependent upon the requirements of the system . when the frequency change range is greater than the frequency error that is available in digital signal compensation , all the frequency change range must be covered with frequency sweeping at an analog end , apart from digital error compensation . the frequency control voltage is generally represented by a digital value , so there is a resolution according to the number of digital bits . with the same 16 bits used , for example , the fluctuating frequency width per bit gets greater as the frequency control range becomes wider , as a result of which the frequency control resolution is reduced . it is therefore necessary in designing the frequency controller circuit to confine a required frequency change range so as to utilize all the bit resolutions and hence to regulate the voltage range controlling the frequency . for this purpose , the present invention includes a loop filter for rf frequency control capable of reconfiguration in software , a digital / analog converter for converting the measured digital rf frequency error to an analog value , a differential amplifier for changing the control range of a voltage - controlled oscillator ( voc ) for rf frequency control , and a numerically controlled oscillator ( nco ) enabling digital frequency control . fig2 is a schematic of an adaptive frequency control apparatus according to an embodiment of the present invention . the adaptive frequency control apparatus according to the embodiment of the present invention comprises , as shown in fig2 , a frequency downstreamer 100 , an analog / digital converter 110 , a frequency error measurer 120 , a loop filter 130 , a digital / analog converter 140 , a differential amplifier 150 , a voltage - controller oscillator 160 , and a cpu 170 . the frequency error measurer 120 measures a frequency error from a received signal ( e . g ., the output signal of the digital receiver ) transferred from the frequency downstreamer 100 and the analog / digital converter 110 . this frequency error measurement method depends upon the standard or structure of various systems employing the present invention , and can be any known measurement method in the related art . for a code division multiple access ( cdma ) system , for example , pilot channels are used to calculate the current frequency error . the pilot channels , which are a reference signal having a constant phase without a data signal component , are subjected to de - spreading at the receiver end , and then the changes of their phase are monitored to measure the frequency error . subsequently , the measured frequency error is fed into the loop filter 130 . the loop filter 130 smoothes the ripple component of the output signal ( i . e ., the frequency error signal ) of the frequency error measurer 120 , and outputs it to the voltage - controller oscillator 160 . the loop filter 130 according to the embodiment of the present invention can be reconfigured , so its non - static characteristics , i . e ., operational parameters such as loop filter type , loop bandwidth , loop gain , etc . are variable in software according to the system standard and the channel environment . the program for optimization of the type and parameters of the loop filter can be downloaded from the cpu 170 . the reconfigurable loop filter 130 may be embodied with a digital signal processor ( dsp ) or a field programmable gate array ( fpga ). for example , the frequency automatic tracking control apparatus and the method thereof as disclosed in korean patent application no . 2001 - 16612 use a simple integrator as a loop filter . according to the present invention , however , a proportional integral ( pi ) controller comprised of an integrator and a proportioner in software can be used when the integrator alone does not give the loop filter performance . the frequency error signal from the loop filter 130 is converted to an analog signal through the digital / analog converter 140 , and is used as an input value to control the analog voltage - controlled oscillator 160 . the signal from the digital / analog converter 140 is fed into the differential amplifier 150 so as to adjust the frequency control range as shown in fig1 . the structure of the differential amplifier 150 is specifically illustrated in fig3 . fig3 is an exemplary diagram of the differential amplifier having a variable control range in the adaptive frequency control apparatus according to the embodiment of the present invention . in the differential amplifier 150 shown in fig3 , the output voltage fed into the voltage - controller oscillator 160 can be controlled with bias resistors 410 , 420 , 430 , and 440 of the differential amplifier 150 . the resistances of these resistors are variably controllable with a modem ( not shown ) of the digital receiver to find a desired frequency control range . but , the resistance control method is not specifically limited to this method . the following equation 1 represents the output voltage of the differential amplifier circuit and shows that the output voltage is a function of input voltages and the respective resistances . according to equation 1 , the upper and lower limits of the output voltage can be determined with the two factors , i . e ., bias resistances r 1 , r 2 , r a , and r f , and input voltages v i0 and v i1 . the adjusted signal from the differential amplifier 150 is fed into the voltage - controlled oscillator 160 , which then changes the frequency of the output signal according to the input signal and outputs the frequency - controlled signal to the frequency downstreamer 100 . the frequency downstreamer 100 corrects the frequency error of the received signal based on the reference signal ( i . e ., the output signal of the voltage - controller oscillator ) adjusted according to the frequency error component of the received signal , as previously described . on the other hand , the adaptive frequency control apparatus according to the embodiment of the present invention can also be embodied into another structure . fig4 is a schematic of an adaptive frequency control apparatus according to a second embodiment of the present invention . the adaptive frequency control apparatus according to the second embodiment of the present invention comprises , as shown in fig4 , a frequency downstreamer 200 , an analog / digital converter 210 , a frequency error compensator 220 , a frequency error measurer 230 , a loop filter 240 , a numerically controlled oscillator 250 , a frequency sweeping determiner 260 , a digital / analog converter 270 , a differential amplifier 280 , a voltage - controller oscillator 290 , and a cpu 300 . the adaptive frequency control apparatus according to the second embodiment of the present invention has almost the same configuration as the embodiment shown in fig2 , excepting that the digital receiver compensates for the frequency error through the numerically controlled oscillator 250 for frequency control and controls the voltage - controlled oscillator 290 using the frequency sweeping determiner 260 for frequency sweeping . the frequency error measurer 220 measures the frequency error of the received signal from the frequency downstreamer 200 and the analog / digital converter 110 , and the loop filter 240 filters the frequency error . the frequency error is fed into the voltage - controlled oscillator 290 , which then compensates for the frequency error . regarding the frequency synchronization , there are two parameters , frequency acquisition range and frequency tracking range . the frequency tracking range , which is generally smaller than the frequency acquisition range , is defined as a range in which the actually fluctuating frequency error can be measured and eliminated . when the frequency error is compensated with the pilot channel but hardly reduced , i . e ., when the phase of the de - spread pilot channel is continuously fluctuating , the current frequency measurement range is out of the frequency tracking range and the frequency sweeping determiner 260 adjusts the frequency tracking range . the algorithm determining the frequency sweeping is dependent on the type of the communication system . here , the frequency acquisition range represents the total frequency error control range that can be controlled by frequency sweeping , and the frequency tracking range represents the frequency error range that can be controlled with the voltage - controlled oscillator nco through frequency measurements . with a continuous failure of digital frequency compensation , the frequency sweeping determiner 260 determines that the frequency control range is inadequate , and adjusts the control range . during this operation , the differential amplifier 280 determines a defined frequency value of the voltage - controlled oscillator 290 . unlike the aforementioned embodiment of fig2 , the voltage - controlled oscillator 290 outputs a constant frequency value until the frequency sweeping determiner 260 changes the frequency value . the specific operation is the same as described in the embodiment of fig2 and will not be further described in detail . while this invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . as described above , the present invention guarantees an efficient rf frequency control that is necessary for integration of rf devices of different digital communication systems and a digital signal processor . the present invention facilitates the matching and the parameter optimization of an rf frequency controller necessary for system integration and allows the loop filter and the frequency control range to be changeable in software , so it can be easily applied to the systems of different standards . furthermore , the present invention enables real - time verification of the changes in parameters and performance to reduce the development period and to guarantee optimal rf frequency control performance .	7
a network element with a self - routing cell - switched switch fabric is shown in fig1 . it contains a number of input ports and output ports . for the sake of simplicity , only one input port i and only one output port o are shown . input ports and output ports are arranged on line cards tio . line cards contain receiver function rx and transmitter functions tx . in fig1 , only one receiver function tio - rx and only one transmitter function tio - tx is shown . it should be clear however , that a network node in a real application has a number of line cards , such as for example 32 . moreover , each line card can accommodate more than one input and corresponding output ports . in an embodiment , each line card has 8 input ports for 10 gb / s tdm signals and 8 corresponding outputs ports . in total this would add up to a system capacity of 2 . 5 tb / s . the line cards are connected to a switch fabric sf , which is built from a number of switch modules se 1 - sen . these modules se 1 - sen are , in cooperation with matrix adapters ma , self - routing switch elements with full - duplex switching capacity , which support cell switching . such switch modules are commercially available on the market and are typically used for switching of ethernet traffic or other kind of packet switched traffic . such switch modules are off - the - shelf components produced in relatively large quantities . reuse of these devices for tdm applications allows to build large network elements using newest technology with the highest level of integration at moderate price . in an embodiment , the network node can have a system capacity of 2 . 5 tb / s . the switch fabric sf contains 20 switch modules arranged on 5 fabric cards plus additional 12 switch modules arranged on 3 fabric boards for equipment protection and load sharing purpose . each switch module has a switch capacity of 64 × 64 lines at 6 . 25 gb / s . it should be understood that this choice and dimensioning is just an example and could be scaled as needed and as components are available . the line cards tio contain a tdm framer 10 , a module for a segmentation and reassembly ( sar ) function 11 , and a matrix adapter ( ma ) 12 . in receive direction ( ingress side ), the tdm framer 10 terminates the transport overhead of received transport signals . additionally , the framer also performs a retiming and alignment function for the received signals . the sar module 11 extracts the multiplex units from timeslots in the received tdm signals and convert these into a cell format . the sar module also inserts into each cell a cell header that contains address information as will be described below in more detail . the matrix adapter 12 distributes the cells to the switch elements se 1 - sen of the switch fabric sf . such matrix adapters are also commercially available on the market for use in ethernet or packet switching applications . in addition , the network element contains a control system cs , via which the line cards can be configured as will be explained below in more detail . the control system cs also receives overhead information terminated in the receive side tdm framer , and provides overhead information to be inserted by the transmit side tdm framer . the transmit side ( egress side ) of a line card tio - tx is shown on the right hand side of fig1 . in transmit direction , a matrix adapter 13 receives cells from the switch matrix sm , orders these and feeds them to a sar module 14 . the sar module extracts the useful data from the received cells and reassembles these into multiplex units . a tdm framer 15 maps the multiplex units into newly generated tdm frames for onward transmission . as explained , signal flow in fig1 is from the left to the right . a tdm line signal structured into frames of same length is received at input port i . in the embodiment , the line signal may be an stm64 signal which has a capacity of 10 gbit / s . an stm64 frame contains 64 higher order multiplex units vc - 4 . alternatively , a line signal multiplexed of 4 × stm16 or 16 × stm4 or combinations thereof can be used . moreover , the sonet equivalent sts - 192 can equally be used as line signal . in any case , the switching granularity is chosen as sts - 1 , which corresponds to ⅓ stm1 . this is , however , only an internal switching entity while frame processing is done prior to the switching , so that stm1 for example can be switched as 3 independent “ pseudo ” sts - 1 . the actual frame processing is done by the tdm framer 10 , which terminates the section overhead of the stm64 frames and processes their au pointers . the same can be applied in a similar way to otn otm - m . n / otuk signals and the oduk multiplex units transported in the otuk . the output of tdm framer 10 is a continuous bitstream , still structured into frames but synchronized to a local clock and with the frame header ( section overhead ) extracted . the multiplex units will be found in fixed time slots within each frame . the sar module 11 extracts the multiplex units from the time slots and converts these into a cell format by segmenting the bitstream into 60 b payload cells . the output of sar module 11 has a cell format with 60 b payload , 4 b address overhead and an additional 8 b cell header which contains framing and crc bytes . the interface between the ma 12 , 13 and the switch fabric sf is a proprietary interface with a 9 byte cell header , which additionally contains a timestamp that takes care of the order of the cells at the transmit side ma 13 . the 4 b address field contains a 2 b fabric header and a 2 b tdm header . the fabric header is looked at by the switch fabric . it contains an address that addresses the output port to which the cell is going . since each line card carries 8 output ports , the fabric header contains 11 bits which identify the destination ma and 4 bits which identify the output port served by that destination ma . the first bit is used to distinguish unicast from multicast connections as will be explained in more detail further below . in case of unicast connections , this bit is set to ‘ 0 ’. the tdm address is looked at by the transmit side sar module and contains a 16 bit egress identifier . the least significant 8 bits indicate the time slot of the output signal to which the cell belongs . since the network element in the embodiment switches in granularity of sts - 1 ( synchronous transport signal level 1 ), there are 192 timeslots in a 10g output signal ( stm64 or sts - 192 ). hence , 8 bits are sufficient to address these ( 2 8 = 256 ). the most significant 8 bits identify the 10g signal , to which the timeslot belongs into which the cell payload will be mapped . this may seem redundant in view of the information of the fabric header h 1 , h 2 , but proves useful when multicast connections are involved , for example for protection switching , to identify the signal in the system unambiguously . for the envisaged tdm application , it is preferable to use cells of a predefined , fixed length . it should be noted , however , that available cell fabric elements can also support cells of variable length . a network node as shown in fig1 is known per se from ep2200200b1 , which is incorporated by reference herein . in this network node , the interconnection between the local control system cs and the various line cards and matrix boards is implemented through direct interconnections in the form of a local area network such as an ethernet . in summary , connectivity is provided by setting the cell addresses at ingress side . the fabric address addresses the destination ma port and the tdm address addresses the outgoing timeslot . the connectivity of the fabric sf is evaluated by the control system cs and downloaded into the segmentation and reassembly ( sar ) function of the line cards . destination headers for the whole fabric are calculated taking into account path ( sncp ) and line switching functions ( msp ) at a rate 200 times per second ( 5 ms cycle ). every 5 ms the complete connectivity is downloaded into line cards and fabric devices se 1 - sen . fabric se 1 - sen devices need to be configured for multicast connectivity only . an improved embodiment of such a network node is shown fig2 . the network node has a number of line cards lc 1 - lcn , which are connected to a switch fabric sf . switch fabric sf is a cell based , self - routing switch fabric of the type described above . each line card lc 1 - lcn has a tdm framer , a sar module , and a matrix adapter ma . a control system cs contains a fabric manager for configuring crossconnections through the network node , a performance and alarm evaluation control block and an ecc controller , which handles embedded communication channel traffic , e . g ., for control plane and management plane communication . according to an aspect of the invention , internal control and oam communication between line cards lc 1 - lcn and control system cs is routed through the switch fabric sf . for this purpose , the control system cs is equipped with an additional matrix adapter ma and any control and oam messages are encapsulated into cells , similar to those used for segmented tdm traffic signals . local addresses are used in the cell headers to route control and oam cells between the various functional entities of the line cards and the control system . it should be understood that the cell format used for internal control and oam messages is not necessarily the same that is used for tdm circuits , but can use any cell format supported by the matrix adapters and fabric elements . in particular , for certain applications , cells of variable length can be used , while the cell format for tdm circuits preferably uses fixed - length cells . the tdm framers on line cards lc 1 - lcn terminate the overhead of received line signals and forward overhead information like failures messages , protection switching protocols , detected errors , and management communication signals to control system cs . the tdm framers also receive management communication signals and other information from control system cs for insertion into the signal overhead in transmit direction . this internal signal exchange is implemented using cells with internal addresses , which are routed through switch fabric sf . for this purpose , a connection between tdm framers and corresponding matrix adapters ma exist on the line cards lc 1 - lcn , thus bypassing the segmentation and reassembly blocks sar . as has been explained above , crossconnections for tdm flows are implemented through proper addressing in the cell headers . therefore , in order to provision crossconnections , the control system configures the sar functions in the line cards to insert appropriate cell addresses into the cells of the segmented tdm flows . the control information to configure the sar functions in the line cards is also communicated in the form of cells switched from the control system through the switch farbric to the corresponding line cards . an internal address is used in such control cells to address the individual sar functional blocks . a line card lc for the network node of fig2 is shown in fig3 . it contains 8 i / o ports io 1 - io 8 for connecting optical fiber links . each i / o port io 1 - io 8 is equipped with an e / o converter ( electrical / optical ) connected to a serializer / deserializer ( serdes ), which converts data between serial and parallel interfaces in each direction . the line card lc further contains two framer circuits tfa , tfb , each framer circuit tfa , tfb serves four i / o ports and has a capacity of 4 × 10g . each of the two framer circuits tfa , tfb is connected to a sar module sara , sarb , which also has a capacity of 40g , and each of the two sar modules sara , sarb connects to a matrix adapter maa , mab . the two matrix adapters maa , mab each are connected via a 4 lane wide interface to the switch fabric sf . it should be noted that all functions of the line card lc are bidirectional and contain receive and transmit functionality . interconnections on the line card lc as well as external fiber connections are shown schematically are preferably implemented as distinct physical connections for the two directions of transmission . the line card lc further contains hub circuit t - hub , which serves as a bridge and interconnects different type if chip interfaces . hub circuit t - hub is connected to both framer circuits tfa , tfb , to both sar modules sara , sarb , and to both matrix adapters maa mab . oam and control cells can be received from cell fabric sf at either of the two matrix adapters maa , mab and forwarded though hub circuit t - hub to a sar module sara , sarb or framer circuit tfa , tfb for which these are destined . conversely , terminated overhead information and other oam signals can be encapsulated at either framer circuit tfa , tfb or any of the sar modules into cells and sent directly over hub circuit t - hub to the corresponding matrix adapter maa , mab for onward transmission to control system cs . optionally , an additional card controller cc can be provided , which is also connected to hub circuit t - hub , which manages and configures the line card under control of control system cs . it is however equally possible that control system cs manages and configures the framer and sar modules directly via hub t - hub and can hence take over the functions of the card controller cc , so that a line card can also be implemented without a separate card controller . each sar module segments the timeslots from the received tdm signals into cells and assigns the fabric and tdm addresses . these addresses are preconfigured by control system cs . the ma is a standard component for ethernet and other packet switching devices and provides in cooperation with the cell based switch fabric sf an interconnection function to the transmit side ma , which distributes received cells in accordance with the 4 destination interface bits to the appropriate output port . fig4 shows an example , how crossconnections through the self - routed cell switch sf will be provisioned . the control system cs contains a fabric manager fm , which has access to a connectivity map map . connectivity map map contains the configuration data about all established crossconnections , i . e . which timeslot from which input is connected to which timeslot of which output . crossconnections are semi - permanent connections , which exist until the connectivity map is reconfigured due to management request or execution of a protection switch event . in order to establish a crossconnection , the sar function at the respective input port needs to be configured to add an appropriate address into the header of each subsequent cell , that corresponds to the timeslot to be crossconnected . according to the embodiment , a configuration message , which has the cell format required by switch fabric sf , is sent from fabric manager fm through switch fabric sf to the sar function of the respective input to be configured . the cell with the configuration message contains in its header a local address that relates to the destined sar functional block . the configuration message cell is sent from the fabric manager fm to the matrix adapter ma_cs of the control system cs . through cell switch fabric sf , the configuration message cell is switched to the matrix adapter ma of the output line card , where the destined sar functional block resides . from the matrix adapter ma , the configuration message cell goes via hub circuit t - hub ( see fig3 ) to the destined sar function . in the embodiment of fig4 , it is assumed by way of example that a crossconnection shall be established from a timeslot a at an input port of line card lc 1 to another timeslot b at an output port of line card lcn . the connectivity map map is hence reconfigured to reflect the new crossconnection and fabric manager fm sends a configuration cm 1 message to sar function sar 1 on line card lc 1 , which contain the address information where cells with segmented data from timeslot a of the respective input shall be sent to . this address information contains a 16 bit fabric address that addresses the output port to which the cell will be switched plus an 8 bit tdm address that addresses the output timeslot . as described before , each line card carries 8 output ports . the fabric address therefore contains 11 bits which identify the destination ma and 4 bits which identify the output port served by that destination ma . the first bit is set to ‘ 0 ’ and indicates that the new crossconnection is a unicast connection . fabric manager fm additionally sends a second configuration message cell cm 2 to sar function sarn of line card lcn to inform about the new crossconnection . this is useful because if sar function sarn would receive cells of the new crossconnection without knowing that a corresponding crossconnection has been set up , it would assume that there is a connection mismatch and so it would generate a connection mismatch alarm and drop the cells belonging to this cross - connection . moreover , it is advantageous that sar functions sar 1 and sarn send back acknowledgment message cells to fabric manager to acknowledge proper receipt and execution of the configuration request . upon receipt of the acknowledgment , the status of the new crossconnection in connectivity map map is changed from pending to provisioned . further to the above explained address mechanism , which allows to switch tdm sub - signals in time and space domain from one input port to one output port , the network element of the embodiment additionally provides the ability to send an input signal to more than one output port . such connections are termed multicast connections . for this , the fabric address in the cell headers is replaced by a 15 bit multicast address and the fabric modules se 1 to sen and mas are configured to switch cells carrying a certain multicast address to the appropriate multiple output ports . such multicast connections are primarily used for protection switching , where an input signal needs to be sent over redundant links . in case of a multicast connection , the first bit of the fabric header is set to ‘ 1 ’. to implement such multicast connections , the fabric manager sends configuration message cells not only to the sar functions in the respective line cards , but also sends configuration message cells to the fabric modules se 1 - sen and the destination matrix adapters . a second embodiment of node - internal control and oam signalling using self - routed cells is shown in fig5 . as explained above , each line card has a tdm framer , which terminates overhead bytes of received tdm signals and inserts overhead bytes into tdm signals to be transmitted . one part of the overhead is referred to as the embedded communication channel ( ecc ), which uses one or more bytes in the overhead of tdm signals . the ecc is used for communication between a network management system and the nodes in the network , and for communication between network nodes . such communication includes alarm propagation , configuration of network nodes , collection of performance monitoring data , and many others . the ecc can also be used for communication within a control plane between distributed control plane controllers locally associated to the network nodes . control plane communication uses the gmpls / ason protocol suite for provisioning of connections and exchange of topology and link state information . the ecc is hence used for the communication between network elements , with the purpose to be part of the dcn ( data communication network ), supporting management and supervision of network elements . instances of an ecc are the dcc bytes in the section overhead of sdh / sonet signals ( itu - t g . 707 ) and the gcc bytes in the otuk / oduk overhead of otn signals ( itu - t g . 709 ). communication on the ecc typically uses ip - or osi - based routed packet protocols . any packet traffic on the eccs , which are terminated on the line cards , go to a routing function in the network node , which decides for each packet based on a packet addresses and a local routing table to which output ecc the packet needs to be forwarded . a more detailed overview over ecc communication can be found in ep1385296b1 , which is incorporated by reference herein . the routing function in the embodiment of fig5 is implemented the ecc controller ec , which is part of control system cs . instead of an ethernet interface and connection between each line card and the ecc controller , cell switched flows are implemented through switch fabric sf between the tdm framers that terminate the eccs , respectively , and ecc controller ec . the ecc controller ec is attached though matrix adapter ma_cs to the switch fabric sf and can communicate via the cell switch towards the line cards lc 1 - lcn of the node . separate bidirectional flows ecc 1 - eccn are provisioned for each ecc channel via the cell switch sf . those flows correspond to the properties of the respective ecc channel , e . g . implement a reserved bandwidth of 192 mbit / s for a dcc - r channel and 576 mbit / s for a dcc - m channel . the specific bandwidth for otuk / oduk gcc0 / 1 / 2 depends on the value of k . the cell flows ecc 1 - eccn between the ecc controller ec and the line cards lc 1 - lcn are instantiated as bidirectional , constant bitrate flows when the related ecc is terminated and configured to be used as a dcn link , e . g . by provisioning of the ecc termination and instantiation of a related ip or osi interface for routing and forwarding of ip / osi traffic by a network management system . this provisioning is done separately and independently for each ecc . ecc controller ec is an ip and / or osi router implementing the necessary routing protocols , e . g . ospf , is - is , and the osi reference model layer 3 forwarding ( ip and / or osi ). it may additionally have other dcn interfaces , e . g . lan interfaces . in fig5 , tdm framer tf 1 on line card lc 1 terminates a tdm signal received at line card lc 1 . the ecc bytes of the received tdm signal contain ip packets for management plane communication . for instance the ecc can carry ip packets of management messages which are destined to the local node as well as other ip packets destined to a network node that is connected to line card lcn . tdm framer tf 1 takes all ip packets from the terminated ecc , chops the packets into segments of equal length and maps these segments into cells of the cell format required by cell switch fabric sf . each of these ecc cells will have in its header the local address of ecc controller ec . via hub t - hub ( see fig3 ) these ecc cells are forwarded to matrix adapter ma 1 , thus bypassing sar module sari . matrix adapter ma 1 sends the ecc cells through switch fabric sf to matrix adapter ma_cs of control system cs . matrix adapter ma_cs forwards to cells to ecc controller ec . ecc controller ec reassembles all ecc cells received from matrix adapter ma_cs and processes the ip headers of the ip packets contained in the cells . ip packets destined for the local node will be evaluated by ecc control ec , potentially forwarded via lan interface ( fig5 ) to a node local controller , and ip packets destined for other nodes will be forwarded to respective tdm framers on the line cards . for example some of the ip packets can contain a management message from a network management system requesting to set up a new crossconnection ( as in the embodiment of fig4 ). ecc controller ec will evaluate this message and add the requested crossconnection to the configuration data of connectivity map map . ecc controller ec will then reply to the request by sending back an ip packet with an acknowledgment . ecc controller ec will chunk the ip packet with the acknowledgment message into segments and map these into cells for switching through switch fabric sf . the cells will be addressed for tdm framer tf 1 on line card lc 1 , where the ip packet is reassembled and put into the ecc of the outgoing tdm signal . ip packets destined for other nodes will be directed to the appropriate line cards for onwards transmission . for example , an ip packet can be addressed to a network node connected through an optical link to line card lcn . ecc controller ec or another node local controller will make a routing decision based on its routing table and the destination ip address and hence map the respective ip packet into cells again and address these cells to the tdm framer tfn on line card lcn . tdm framer tfn will reassemble the received cells and put these into the ecc of its transmit tdm signal . fig6 shows an embodiment for the handling of tdm meta information in the network node of fig2 . such meta information contains overhead information in the overhead bytes of the received tdm signals as well as information derived out of this overhead information and other signal characteristics . in particular , this includes defects and alarms derived from incoming tdm signals for reporting and protection switching , performance data derived from incoming tdm signals for aggregation and subsequent reporting , overhead channels used for oam purposes and protection communication for aggregation , reporting and protection switching . the tdm framers tf 1 - tfn contain functions for inserting and extracting the overhead information from / to overhead bytes of tdm signals , while the processing functions for processing the information , e . g . filtering , aggregation , protection switching , reporting , are shared between the line cards lc 1 - lcn and one or several processing instances of the control system cs . for the transport of the meta information between line cards lc 1 - lcn and the processing functions of the control system cs , use is made of the cell switch fabric sf which also implements the tdm circuits . the meta data are transported in separate flows between line cards lc 1 - lcn and control system cs , similar to tdm circuits between the line cards lc 1 - lcn . in the receive side line card , tdm framers td 1 - tfn terminate the relevant section and path overhead of received tdm signals and extract control bytes therefrom . the tdm framers detect line and section alarms as well as alarm and status information per timeslot , e . g . per vc - n in sdh , extract automatic protection switching ( aps ) bytes k 1 and k 2 , and determine primitives for performance monitoring ( pm ). these meta information are forwarded via the cell switch fabric sf to control system cs which aggregates meta information from all line cards . the protection control block prot evaluates these data and determines when in case of a failure or signal degrade , protection switching needs to be performed and configures the connectivity map map accordingly . the connectivity map map is implemented by fabric manager fm as described before : for any kind of connections ( unicast and multicast ), the fabric manager fm configures the receive side sar module with connection tags per timeslot , i . e . which addresses will be used per cell for each particular sts - 1 . for multicast connections , the fabric manager fm additionally configures the fabric elements se 1 - sen and transmit side matrix adapters . for the purpose of communicating meta information between line cards lc 1 - lcn and control system cs , the cell switch fabric implements unidirectional flows unif 1 - unifn as well as bidirectional flows bif 1 - bifn . unidirectional flows unif 1 - unifn would be needed from line cards lc 1 - lcn to a processing function pma for defects , alarms , performance data . for sdh according to itu - t g . 707 , communication includes for example alarms such as los ( loss of signal ), lof ( loss of frame ), and error monitoring bytes bx or cumulated performance monitoring information derived from bx . for otn according to itu - t g . 709 , this includes signals such as tcm ( tandem connection monitoring ), bdi ( backward defect indication ), and bei ( backward error indication ). bidirectional flows bif 1 - bifn will be used for protection communication channels , e . g . k 1 / k 2 in itu - t g . 707 , aps in itu - t g . 709 between the line cards lc 1 - lcn and the protection processing function prot in the control system cs , and synchronization status byte s 1 . the flows have constant bandwidth that allows them to transport all meta data within the required reliability and latency limits . the constant bandwidth is defined by the type of line card , and is instantiated when the line card is installed in the system . the processing function pma implements filtering , correlation and reporting of defects and alarms , triggering of consequent actions caused by defects and alarms , and collection and aggregation of performance monitoring data . the protection control function prot contains transmission protection state machines and triggers reconfiguration of tdm circuits as a result of protection switch events . the cell switch fabric inherently supports redundancy which is used to address the 1 + 1 redundancy of the processing function . the control system preferably contains a separate 1 + 1 redundant pair of controllers and may be implemented in software and / or as fpgas . further to the tdm line cards described in the various embodiments , the network node can additionally be equipped with packet line cards , thus providing a real multi - service switch . such multi - service network element allows to switch packet as well as synchronous tdm services using a single “ type - agnostic ” switch matrix . while traditionally , completely distinct networks were used for these two kind of traffic , implementation into a single node allows to have all kind of services within a single network architecture . this saves considerable costs as compared to hybrid network elements , which have both , a tdm matrix for tdm traffic and a separate cell matrix for packet traffic . the description and drawings merely illustrate the principles of the invention . it will thus be appreciated that those skilled in the art will be able to devise various arrangements that , although not explicitly described or shown herein , embody the principles of the invention and are included within its spirit and scope . furthermore , all examples recited herein are principally intended expressly to be only for pedagogical purposes to aid the reader in understanding the principles of the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles , aspects , and embodiments of the invention , as well as specific examples thereof , are intended to encompass equivalents thereof . the functions of the various elements shown in the figures , including any functional blocks referred to as controllers , may be provided through the use of dedicated hardware as well as hardware capable of executing software in association with appropriate software . when provided by a processor , the functions may be provided by a single dedicated processor , by a single shared processor , or by a plurality of individual processors , some of which may be shared . moreover , explicit use of the term “ processor ” or “ controller ” should not be construed to refer exclusively to hardware capable of executing software , and may implicitly include , without limitation , digital signal processor ( dsp ) hardware , network processor , application specific integrated circuit ( asic ), field programmable gate array ( fpga ), read only memory ( rom ) for storing software , random access memory ( ram ), and non volatile storage . other hardware , conventional and / or custom , may also be included . similarly , any switches shown in the figures are conceptual only . their function may be carried out through the operation of program logic , through dedicated logic , through the interaction of program control and dedicated logic , or even manually , the particular technique being selectable by the implementer as more specifically understood from the context . several functions shown above may or may not be combined into one dedicate hardware or hardware capable of executing software in association with appropriate software .	7
referring to fig1 the invention is illustrated in connection with a conventional pickup truck 10 having a bed 11 . the bed comprises a front wall 12 , a rear wall 14 and a pair of side walls 15 and 16 . the rear wall includes a hinged door 17 . in addition , the side walls each have a top facing surface 18 and a vertically extending side flange member 19 ( see fig5 ) presenting a downward facing undersurface 20 . provided for covering the bed 11 is a cover 20 comprising a top surface 21 and a bottom surface 22 . this cover preferably is made of aluminum or other stiff material so as to be self - supporting in a planer configuration and is dimensioned to extend over the two side walls and the two end walls of the truck bed simultaneously to enclose the bed interior . it is the purpose of the present invention to provide a simple and quickly detachable means for pivotally connecting this cover to the wall members of the truck bed . in accordance with the present invention there is provided a mounting bracket for attachment to each side wall of the truck bed . thus a mounting bracket 25 is fixed to the side wall 15 and a mounting bracket 26 is fixed to the side wall 16 . these mounting brackets are identical except that one is for the right side and the other is a mirror image of the first for mounting on the left side . each mounting bracket comprises a top flange 27 and a vertically extending side flange 28 attached at the inside edge to the top flange . in addition as shown in fig5 there is provided an outside vertically extending flange 29 to which is attached at the bottom edge a horizontally extending bottom flange 30 which is positioned to fit against the undersurface 20 the bed side wall . thus as illustrated primarily in fig5 the bracket is placed on the top edge of the side wall by tilting it about the longitudinal axis with the flange 28 at a higher elevation such that the bottom flange 30 can be slipped beneath the lip of the side wall to abut the undersurface 20 . thereafter the bracket is rotated to bring the top flange 27 down against the top wall 18 of the bed side wall . to keep the bracket from sliding forward and back , the side flange 28 and bottom flange 30 as shown primarily in fig3 include a cutout portion 31 for accomodation of the front wall 12 of the pickup bed . thus the top flange 27 extends to a perpendicular extending end flange 32 . this bracket is welded to the end of the top flange 27 so as to extend vertically along the outside of the front wall 12 of the bed on the outside thereof . the bracket can be placed in position in the manner described and will not slip along the side wall because of the end flange being locked over the end wall of the bed . thus a bracket 25 is fitted over the side wall 15 and a bracket 26 is fitted over the side wall 16 with the end flanges 32 and 32a respectively extending forward past the front wall 12 of the bed . after the brackets are placed in this position the cover 20 is laid thereon with the front edge 34 shoved forward against the end flanges 32 and 32a . the top edge 35 of the end flanges receive a front flange 36 fixed to the front edge 34 of the cover . this front flange 36 can include a cutout area for receiving the front flanges with the center portion 37 thereof extending horizontally past the end flanges . such a position provides a shoulder 38 which abuts the end flanges and prevents side movement of the cover . the upper extending ends 35 and 35a are bent slightly backwards towards the top flange 27 and 27a at an angle to prevent the cover from being lifted vertically upward once in place . to hold the cover integrally with the brackets and in either the closed or open position there is provided a coil spring 40 ( see fig1 through 3 ) having the extending ends 41 and 42 for each bracket . the end 41 is fixed by a bolt 45 to a vertically extending cover bracket 44 fixed to a side edge of the cover 20 . the bolt extends through the cover bracket flange and through the end 41 of the spring which end is bent back on itself to form an eye . the other end 42 of the coil spring is fitted over a stud 46 fixed to the downwardly extending flanges 28 and 28a on the mounting brackets . thus the spring is held in position and in turn tends to hold the mounting bracket in position on the side wall of the truck bed by preventing pivoting of the bracket such as is necessary for the brackets to be separated from the truck bed side walls . this spring tends to hold the cover in either the open position or the closed position because of its tendency to remain in either of two positions . as shown in fig2 the spring on the cover can be pivoted upward to extend the spring which in turn will hold the cover in that position . on the other hand when the cover is closed the spring is moved to the position shown in fig3 which position tends to hold the lid closed . while not shown a lock can be fixed to the trailing edge 47 of the cover to interlock the cover with the door 17 of the truck bed for preventing access to the interior of the bed . the particular manner in which the brackets and the cover 20 interlock prevent removal of the cover except in a predetermined sequence . for instance , for removal of the cover from the truck bed , the coil spring 40 must first be removed . thereafter the cover 20 is shifted rearward to disengage the flange 37 from the front flanges 35 and 35a of the brackets . the cover is then free to be lifted from the truck bed . thereafter the brackets 25 and 26 can be rotated in a direction away from the bed interior for removal from the truck side wall . of course replacement of the cover on the bed is done by reversing this sequence . a second embodiment of the invention is shown in fig6 to be used with trucks having a double side wall comprising an interior wall 50 and an exterior wall 51 . such walls generally are joined by a stop wall 52 having openings 54 therein . in this instance the bracket 25b includes at least one side flange 28b fixed to a top flange 27b , which top flange is cut out to only extend halfway across the top wall 52 of the bed side wall at this point . to the top flange is fixed a downwardly extending flange 29b which in turn is welded to a horizontally extending bottom flange 30b . for placement of this bracket 25b onto the bed side wall , the flanges 29b and 30b are inserted through the opening 54 and thereafter the bracket is rotated in the clockwise direction in fig6 until the flange 28b lies parallel to the inner surface of the side wall 50 . the bottom flange 30b locks the bracket to the bed side wall . thereafter the top is mounted onto this bracket in the same manner as described with respect to the previous embodiment .	1
the invention applies to the assembly of metal pieces constituting a container , as illustrated in fig2 . a metal can 10 , preferentially of steel , must be assembled with a metal cover 11 which can be composed of the same material or of another metallic material . according to the invention , this assembly is carried out by brazing . the production of a braze requires the presence of a brazing material comprising a metal , the melting point of which is lower than that of the metal constituting the container . for example , in the case of a container of steel , a brazing metal comprising tin is appropriate . the brazing metal 15 is deposited on at least one of the pieces to be assembled , 10 or 11 , in the form of a thin layer . the deposition of the brazing metal 15 defines a so - called brazing area . the brazing is obtained by ensuring heating of the brazing area of the pre - assembled pieces . heating causes the brazing metal 15 to melt . when the heating is stopped , the brazing metal 15 solidifies and thus firmly joins pieces 10 and 11 . brazing simply requires heating which makes it possible for the brazing metal to melt . but to guarantee reliable brazing and to conform to the constraints of industrial high output volumes , it is preferable that the heating of the brazing area is rapid , intense and localized in said area . such heating can be obtained , for example , by a laser beam focused on the brazing area or by induction around said area . heating the brazing area by induction lends itself quite particularly to the geometry of cylindrical metal containers , such as cans for example . localized heating by induction consists of heating the brazing metal 15 by the joule effect . eddy currents are induced by an alternating magnetic field generated by at least one induction coil 16 surrounding the brazing area and fed by a high - frequency alternating current . high production volumes can thus be sustained for the assembly of containers according to the invention , as heating and above all cooling are rapid in the case of localized heating . moreover , this assembly technique is easy to implement as it requires no direct contact with the container . thus , if a container comprising pieces of metal with a thickness comprised between 0 . 1 and 0 . 4 mm is considered , a brazing layer of approximately 0 . 02 mm can be deposited on the wall of at least one of the pieces to be assembled . a heating power of 10 kw for 50 to 100 ms allows the brazing of the pieces to be assembled to be carried out . the assembly method according to the invention applies to all shapes and sizes of containers . for example , as illustrated in fig3 , two cans 12 and 13 can be nested and firmly joined by the assembly technique of the invention . similarly , fig4 illustrates the production of a separation 14 in the body of metal can 10 in order to create compartments , the brazing according to the invention being carried out using a laser beam 18 focused on the brazing metal 15 . thus , the invention allows the production of complex container cans combining the different embodiments illustrated .	1
in the following discussion , numerous specific details are set forth to provide a thorough understanding of the present invention . however , those skilled in the art will appreciate that the present invention may be practiced without such specific details . in other instances , well - known elements have been illustrated in schematic or block diagram form in order not to obscure the present invention in unnecessary detail . additionally , for the most part , details concerning network communications , electromagnetic signaling techniques , and the like , have been omitted inasmuch as such details are not considered necessary to obtain a complete understanding of the present invention , and are considered to be within the understanding of persons of ordinary skill in the relevant art . it is further noted that , unless indicated otherwise , all functions described herein may be performed in either hardware or software , or some combinations thereof . in a preferred embodiment , however , the functions are performed by a processor such as a computer or an electronic data processor in accordance with code such as computer program code , software , and / or integrated circuits that are coded to perform such functions , unless indicated otherwise . referring to fig2 a of the drawings , the reference numeral 200 generally designates a modified xdram memory unit . the memory unit 200 comprises a chip 202 and xdrams 204 . commands are transmitted from the chip 202 to the xdrams 204 through a unidirectional bus 220 . serial data is transmitted from the chip 202 to the xdrams 204 through a bi - directional serial link 224 . data , however , is intercommunicated between the chip and the xdrams 204 through a bidirectional bus 222 . specifically , components on the chip 202 communicate with one another and with the xdrams 204 in order for the memory to function . the chip 202 comprises a memory interface unit 206 and an xio 208 . the xio 208 performs communication between the chip 202 and the xdrams 204 , which include the commands , data , and serial data . the memory interface unit 206 , however , transmits commands to the xio 208 through a unidirectional bus 216 , while data is transmitted between the xio 208 and the memory interface unit 206 through two unidirectional buses 218 . the difference between the memory unit 200 and more conventional memory units lies in the memory interface unit . the memory control unit comprises address and holding control 210 , an xio controller 212 , and dataflow pattern buffers 214 . more particularly , buffers are utilized in calibrations for both reads and writes , but in the modified memory an entire class of buffers specifically designated for either reads or writes is eliminated . the memory interface unit 206 instead utilizes the store path for all phases of operation . in normal operation , the memory interface unit 206 has the data and addresses for 32 cache lines ( each having 128 bytes ) or a total of 4096 bytes . in conventional memories , calibrations occur in three distinct phases . during the first phase , data loading occurs with two functions in mind . the first function being a loading of pattern data into the conventional memory interface unit ( not shown ). the second function is to have the memory control unit ( not shown ) send commands to xdrams , such as the xdrams 204 , to serially load the xdrams , such as the xdrams 204 , with data and then send writes to commit the data to memory . this calibration data can occupy some or all of the 32 cache lines . during the second and third phase , receive and transmit calibrations are performed . receive calibration is performed during the second phase where the memory control unit ( not shown ) sources the read commands and provides expected data to calibrate the xio ( not shown ). transmit calibrations occur during the third phase where the memory control unit ( not shown ) stores the data and then provides read commands with expected data . in contrast , the modified memory 200 reorders the sequences . the memory control unit 206 reorders the sequence so that serially loaded data is loaded first so that the data is committed to the xdrams by single writes . the modified memory 206 sends the serial patterns to the xdrams 204 and uses the command buses 216 and 220 to commit the data to the cores of the xdrams 204 . these commands are normal stores with an addressing width of the xdrams . once all of the data has been stored in the xdrams , stores , containing addresses and pattern data , are loaded and kept in a waiting pattern in anticipation of a receive calibration . the store addresses and datum are contained by the address and holding control 210 and the dataflow pattern buffer 214 , respectively . then , within the second phase , receive calibrations can occur . when the xio 208 wants to perform a receive iteration , xio controller 212 turns stores into reads with expects . hence , each store becomes a read . the new reads will launch the expected data to the xio 208 at the correct time . the process by the xio controller 212 of changing stores into read and launching the new reads will continue for the 32 cache lines . then , the xio 208 will start the process again until the calibration is complete . once the receive calibration is complete , phase three can be initiated to perform transmit calibrations . the xio 208 informs the xio controller 212 to perform a transmit calibration sequence . the xio controller 212 takes store addresses from the address control 210 and launches the store data from the dataflow pattern buffer 214 . once all of the pattern cache lines are stored , the xio controller 212 informs the control 210 to send the address again and changes the store addresses into reads with expects . the data from the xdrams 204 is compared with the data from the dataflow pattern buffer 214 . this is repeated as many times as necessary until the calibration is complete . to perform the changes to the command from store to read , additional logic is employed . referring to fig2 b of the drawings the reference numeral 212 generally designates the xio controller . the xio controller 212 comprises front end circuitry 252 , command addressing logic 254 , a write path 256 , a read path 258 , xio command generation logic 260 , and initialization logic 262 . operation of the xio controller is initiated with information provided to the front end circuitry 252 . the front end circuitry 252 receives information from the address and holding control 210 of fig2 a through the communication channel 264 . then , the front end circuitry 252 can change write commands into read commands and provide control signals to other components . specifically , the front end circuitry 252 provides control information to the write path 256 , the read path 258 , the command addressing logic 254 , and the generation logic 260 through the communication channels 266 , 270 , 276 , and 274 , respectively . each of the remaining components of the xio controller 212 , then , can perform a specific function during normal operations . the command addressing logic provides information to the xio 208 of fig2 a through the communication channel 278 . the initialization logic 262 receives pattern enable and type signals and sends pattern marker signal to the xio 208 of fig2 a through the communication channel 282 . the write path 256 and the read path 258 provide store and read controls to the dataflow pattern buffer 214 of fig2 a through the communication channels 284 and 286 . additionally , the generation logic 260 provides control information to the write path 256 and the read path 258 through the communication channels 268 and 272 , respectively . in cases , however , where reads with expects are utilized , the remaining components have a slightly different functionality . the write path 256 starts a write - data - out of the dataflow pattern buffer 214 of fig2 a using timing parameters for expected data . the read path 258 stores away the information but does not use it functionally . the generation logic 260 is initially told to perform a read by the front end circuitry 252 ; however , a change signal from the front end circuitry 252 informs the generation logic 260 to initiate a write at the correct time for expected data . the functionality of the front end circuitry 252 then becomes significant in the operation of the xio controller 212 . referring to fig3 of the drawings , the reference numeral 300 generally designates front end circuitry for switching writes to reads . the circuitry 300 is contained within the xio controller 212 of fig2 b and comprises a state machine 302 , eight latches 306 , 312 , 316 , 318 , 320 , 324 , 334 , and 336 , five and gates 304 , 310 , 314 , 330 , and 332 , and four operation modules 308 , 322 , 326 , and 328 . the state machine 302 is a main component within the logic 300 that assists generating the proper signal . the state machine 302 outputs a control signal to the operation module 308 through the communication channel 344 . based on the control signal , the operation module 308 can enable a read operation or a write operation . if the operation is a write operation , then a signal is output to the and gate 304 through the communication channel 340 . additionally , a signal is output from the state machine 302 to the and gate 304 through the communication channel 338 . once engaged , the and gate 304 outputs a signal to the latch 306 through the communication channel 339 . the latch 306 can then provide a data location valid signal through the communication channel 342 to start write data operations . however , if the operation is a read with expects operation , then a signal is communicated from the operation module 308 to the and gate 310 through the communication channel 346 . the state machine 302 also transmits a signal to the and gate 310 through the communication channel 348 . a change - write - to - read signal is also communicated to the and gate 310 through the communication channel 350 . based on the and gate 310 inputs , the and gate 310 can output a signal to the latch 312 through the communication channel 352 . the latch 312 , then , provides a data location valid for read with expects signal through the communication 354 . in addition to providing control for data location valid signals , the state machine 302 also relays taken commands . a command taken is output from the state machine 302 through the communication channel 341 . the and gate 314 receives the command taken signal in addition to another signal received through the communication channel 358 . a latch 316 then receives the and gate signal through the communication channel 356 to latch the command taken to inform the address and control 210 that the command has been taken . bank sequencer latches 318 also receive the command taken signal to start an operation or series of operations . in order for the state machine 302 to function , however , indications of commands are relayed to the state machine 302 . the latch 320 receives control data for the type of operation from the address control 210 of fig2 a through the communication channel 372 . the latch 320 , then , relays the control data to the operation module 322 , which is a write - to - read module , through the communication channel 370 . based on the input signals , the operation module 322 output control signals to the state machine 302 , bank sequencing latches 324 , a command counter ( not shown ), and two operations modules 326 and 328 through the communication channel 368 . based on the control signal from the operation module 322 , write or read operations can be started . if the operation module 322 indicates read operations , then the read module 328 outputs a signal through the communication channel 366 to the and gate 332 . the and gate 332 also receives a command taken signal from the communication channel 341 . the and gate 332 then can relay a signal to the latch 336 , through communication channel 360 , to provide read first - in - first - out ( fifo ) control . on the other hand , if the operation module 322 indicates write operations , different logic is employed . indications of write operations are transmitted to the write module 326 through the communication channel 368 . based on the indication , the write module 326 transmits a control signal to the and gate 330 through the communication channel 364 . the and gate 330 also receives a command taken through the communication channel 341 . a signal is then relayed from the and gate 330 to the latch 334 through the communication channel 362 . the latch 334 reflects a write start operation . referring to fig4 of the drawings , the reference numeral 400 generally designates a simplified operation of the front end circuitry 300 of fig3 . at the onset of operation , a determination is made as to the operation to be performed in step 402 . specifically , there are three types of operations that can be performed : write operations , read operations , and reads with expects . each of the respective operations has a different procedure . for write operations , specific components , paths , and procedures are employed . in step 404 , write operations from the address holding control 210 of fig2 a are utilized . normal write parameters are employed in step 406 , and normal write commands are sent in step 408 . for read operations , other components , paths , and procedures are employed . in step 410 , read operations from the address holding control 210 of fig2 a are utilized . normal read parameters are employed in step 412 , and normal read commands are sent in step 414 . for reads with expects , a combination of components , paths , and procedures from write and read operations are employed . in step 416 , reads with expects from the address holding control 210 of fig2 a are utilized . in step 418 , write operations from the address holding control 210 of fig2 a are utilized . write with expects parameters are employed in step 420 , and normal read commands are send in step 414 . referring to fig5 of the drawings , the reference numeral 500 generally designates the operation of the xio controller 212 of fig2 . the xio controller 212 begins in an idle state in step 502 . a determination is then made as to whether a receive calibration or transmission calibration is to occur in step 504 . in the case of a receive calibration , the state machine 302 waits in steps for 506 and 508 for proper timing from the xio 208 before proceeding . once all timing parameters are met the store data is converted into read with expect data and sent to the xio 208 . once ready , write - to - read signals are propagated in step 510 , where data is read from the xdrams 204 . the pattern enable signal in steps 520 and 524 transitions to logic low to indicate completion of the calibration loop . when the calibration is complete , deferred refreshes are performed in step 522 , and the xio controller 212 returns to idle in step 502 . when a transmit calibration is to be performed , no store data is converted . there is a wait period in step 512 , so that all xdram parameters are met . once the calibration is ready , in step 514 , data is written to the xdrams 204 in step 516 . next , write - to - read signals are propagated in step 518 , where data is read from the xdrams 204 and compared against data from dataflow pattern buffer 214 . the pattern enable signal in steps 520 and 524 transitions to logic low to indicate completion of the calibration loop . when the calibration is complete , deferred refreshes are performed in step 522 , and the xio 212 returns to idle in step 502 . it is understood that the present invention can take many forms and embodiments . accordingly , several variations may be made in the foregoing without departing from the spirit or the scope of the invention . the capabilities outlined herein allow for the possibility of a variety of programming models . this disclosure should not be read as preferring any particular programming model , but is instead directed to the underlying mechanisms on which these programming models can be built . having thus described the present invention by reference to certain of its preferred embodiments , it is noted that the embodiments disclosed are illustrative rather than limiting in nature and that a wide range of variations , modifications , changes , and substitutions are contemplated in the foregoing disclosure and , in some instances , some features of the present invention may be employed without a corresponding use of the other features . many such variations and modifications may be considered desirable by those skilled in the art based upon a review of the foregoing description of preferred embodiments . accordingly , it is appropriate that the appended claims be construed broadly and in a manner consistent with the scope of the invention .	6
this disclosure describes a torpedo countermeasure . specific circuitry and components that may be included therein are disclosed to provide a thorough description of the invention . however , it will be apparent that the present invention may be practiced without these specific circuits and components . well - known components of the present invention are shown in block diagram form , rather than in detail , to avoid unnecessarily obscuring the invention . as shown in fig1 a torpedo countermeasure 10 includes an electronics module 12 placed in a watertight enclosure 14 . the torpedo countermeasure 10 also includes a float 16 , a spool and tether assembly 18 , an electrical power system 20 , which may be a conventional battery package , a payload section 22 and a transducer 24 . after the torpedo countermeasure 10 is launched into water , the float 16 is released from the enclosure 14 . the float 16 rises to the surface and supports the enclosure 14 via the spool and tether assembly 18 . this invention is directed in particular to the electronics module 12 and algorithms used thereby . the torpedo countermeasure 10 might be deployed from a submarine ( not shown ) when the targeted submarine detects an inbound torpedo . the torpedo countermeasure 10 listens for the torpedo &# 39 ; s acoustic incoming sonar ping , analyzes the ping , and after obtaining information such as frequency , amplitude and pulse length , the torpedo countermeasure 10 sends out a sonar pulse similar to an actual return from a target . this false target return fools the torpedo by tricking the weapon into thinking there was a valid target in the direction of the torpedo countermeasure 10 , while the evading submarine slips away . referring now to fig1 and 2 , the transducer 24 is arranged to receive an input sonar ping when the torpedo countermeasure 10 is operating in a receive mode . the transducer 24 acts as hydrophone when receiving the input solar ping . the countermeasure 10 preferably includes a single transducer 24 that is used both for receiving and sending sonar signals . transducers suitable for use in the countermeasure 10 are typically made of piezoelectric ceramic materials . pressure variations in an input acoustic signal cause the piezoelectric crystal to produce a small time - varying voltage characteristic of the input signal . when an external time - varying voltage is applied to the piezoelectric crystal , it vibrates and produces sound waves having the same frequency as that of the applied voltage . after receiving the input sonar ping , the transducer 24 produces an analog electrical signal that is input to an analog to digital converter ( adc ) 26 that converts the analog signal into a corresponding a digital signal . the digital signal is then input to a filter circuit 28 that is arranged to determine the frequency of signals input thereto . signals output from the filter circuit 28 are buffered by a buffer circuit 30 and then input to a digital signal processor ( dsp ) 32 that analyzes the signal to determine whether it has come from a torpedo ( not shown ). the countermeasure 10 also operates in a transmit mode in which the dsp 32 provides a signal to a digital to analog signal converter ( dac ) 34 that produces corresponding analog signals . these analog signals are input to a linear amplifier 36 that is connected to the transducer 24 . upon receipt of the signals from the amplifier 36 , the transducer 24 produces an output sonar pulse . fig3 illustrates a logic flow diagram for the dsp 32 circuitry of fig1 . in the receive mode , digital signals from the buffer 30 are input to the dsp 32 . the dsp 32 executes a read buffer , read clock step 38 in which a signal value is read from the buffer 30 and stored as a variable . the dsp 32 also reads and stores a time corresponding to the signal from the buffer 30 . the dsp 32 analyzes the stored signal with a frequency determination function 40 to determine its frequency . after the frequency is determined , the dsp 32 executes a ping determination step 42 to determine whether the stored signal represents a torpedo sonar ping or merely background noise . if the signal is found to represent a torpedo sonar ping , then an update ping data step 44 is performed . the dsp 32 includes a memory ( not shown ) adequate to store ping parameters such as ping length , ping start and stop time and average frequency . if the stored signal is not found to represent a torpedo ping , then the dsp 32 evaluates whether it is time to transmit . if a torpedo sonar ping is being received , the dsp 32 executes a step 46 to determine whether the ping has ended and whether the ping was valid . at the end of a valid ping the dsp 32 performs a calculate torpedo motion estimate step 48 and also performs a calculate transmit time step 50 . the dsp 32 next performs a step 52 in which to determine whether it is time to transmit . if is time to transmit , the dsp 32 executes a calculate false target doppler step 54 in which the doppler shifted frequency for a return pulse to the torpedo is calculated . the dsp 32 then does a transmit step 56 in which it sends a signal to the dac 34 to initiate transmittal of a pulse that the incoming torpedo may interpret as being an echo from a fleeing target . while the return pulse is being transmitted the adc 26 is turned off to avoid confusion between the return pulse being transmitted and the incoming sonar ping . if it is not time to transmit , the dsp reads a new signal value from the buffer 30 and repeats the steps described above until it is time to transmit a return pulse . determining the frequency of the incoming sonar ping typically includes the step of performing a baseband frequency conversion performed on the digital signal output of the adc 26 to filter out the carrier signal . the frequency of the resulting data can be determined by using methods such as a discrete time fourier transform , a fast fourier transform , a zero - crossings algorithm , or hybrid methods that include both a zero - crossings algorithm and a fast fourier transform . all of these techniques for determining the frequency of a sonar ping signal are well - known in the art and are not described in detail herein . fig4 is a block diagram of a second embodiment of a countermeasure electronics module 58 according to the invention . the electronics module 58 includes a transducer 60 that may be substantially identical to the transducer 24 of fig1 . in the receive mode , the transducer 60 produces an analog electrical signal in response to an incident sonar ping . the analog signal is input to a front - end filter 62 . the front - end filter 62 includes a low - pass filter that preferably is designed to pass and amplify signals less than 100 khz . the front - end filter 62 matches impedance and measures voltages produced by the transducer 60 when it is receiving the external acoustic signals . signals of interest include the input sonar ping by an incoming torpedo . initial amplification raises the low - level voltages to a signal of suitable strength for further digital processing . initial hardware filtering eliminates unwanted low - frequency components and improves signal - to - noise ratio . the filtered signal is then digitized by an adc 64 . a suitable device for this application is commercially available from national semiconductor as adc model 14061 , which is a 14 - bit aid converter with a power rating of 390 mw . the conversion rate range is from 312 . 5 khz to 2 . 5 mhz , which means the signal sampling rate will also be in this range . using a zero - crossings algorithm in which the sampling rate is ten times the maximum frequency of interest gives frequency coverage of up to 250 khz . signals output from the adc 64 are input to a filter 66 that is preferably formed as a finite impulse response ( fir ) device . signals output from the filter 66 pass through a buffer 67 and are then input to a dsp 68 for processing . a general - purpose digital signal processor such as the motorola dsp56301 processor may be used as the dsp 68 . the motorola dsp56301 processor may also be used for multimedia and telecommunication applications such as videoconferencing and cellular telephony . as a general purpose device with up to 42 programmable general purpose i / o ( gpio ) pins , this processor provides a great deal of flexibility making it a good fit in the architecture for this application . the dsp56301 runs at 80 mips using an internal 80 mhz clock . it uses 3v logic and 24 - bit addressing . on - chip memory consists of 4096 × 24 program ram ( or the cache option can be selected , giving a 1024 × 24 bit instruction cache and a 3072 × 24 bit program ram ), and two data ram spaces ( x and y ) as 2048 × 24 bit data ram . when the countermeasure 10 operates in the transmit mode , the dsp 68 provides a digital signal to a dac 70 that converts the digital signals into corresponding analog signals . the dac 70 may be a model number ml2375 dac chip manufactured by micro linear corporation . chip capabilities include a 10 - bit a / d converter , a 10 - bit d / a converter , an 8 - bit d / a converter and a four channel multiplexer . signals output from the dac 70 are amplified by an amplifier 72 that is preferably a pulse width modulating ( pwm ) amplifier . the pwm amplifier 72 makes efficient use of the available power by using a digital signal to approximate the analog signal . pulse width modulation maintains longer “ high ” pulses when the signal amplitude is high and shortens the pulse when the signal amplitude is low . a suitable pwm amplifier 72 is commercially available as amplifier model number sao7 from apex microtechnology . this is a 40 volt , 500 khz pwm amplifier requiring a power source of between 10 and 16 volts . it is designed for a wide variety of applications including high fidelity audio equipment , brush type motor control and vibration canceling amplifiers . this amplifier has a full - bridge output circuit that is capable of providing a continuous 5 amp output current to a step - up transformer 74 that drives the transducer 60 . fig5 illustrates a logic flow diagram for the dsp 68 circuitry of fig4 . fig5 shows a first group of logic steps identified as a listen mode 80 and a wait - then transmit - mode 82 . the listen mode 80 includes a do loop 84 that continues until a valid ping has been received . signals from the buffer 67 are read in a read step 86 that also reads a time corresponding to the buffer signal value . the signal is then processed by a zero crossings function 87 that includes an inspect and compare step 88 that compares the incoming sample to the preceding sample . the dsp 68 then performs a zero crossing test step 90 to determine if the buffer signal crossed zero between the present sample and the preceding sample . if the signal crossed zero , the frequency of the signal is estimated . if the data point did not cross zero since the last stored point , a value of zero is returned for the frequency . the dsp 68 next executes a ping determination step 92 to determine whether the signal represents a ping . receiving a signal in the proper frequency range is not sufficient to establish that the signal represents a sonar ping . several signal samples must be processed to determine if their frequencies are similar and thus part of a sonar ping . the dsp 68 next performs a step 94 to determine whether the ping has ended and whether the ping was valid . after a ping has been verified , it is assumed to have ended when subsequent signals have frequencies that are not in the proper frequency band . after the ping ends , its length is calculated . after the end of a valid ping , the dsp 68 performs a calculate torpedo motion estimate step 96 . the dsp 68 then executes a calculate false target doppler step 98 in which the frequency of the decoy signal is calculated . the dsp 68 also executes a false target evasion time delay step 100 in which the proper time for sending the return pulse is calculated . at the appropriate time , the dsp 68 executes a transmit step 102 in which it sends a signal to the dac 70 that results in the return pulse being transmitted by the transducer 60 . the structures and methods disclosed herein illustrate the principles of the present invention . the invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects as exemplary and illustrative rather than restrictive . therefore , the appended claims rather than the foregoing description define the scope of the invention . all modifications to the embodiments described herein that come within the meaning and range of equivalence of the claims are embraced within the scope of the invention .	6
the invention is described in detail below for purposes of illustration only . modifications within the spirit and scope of the invention , set forth in the appended claims , will be readily apparent to one of skill in the art . as used herein , terminology and abbreviations have their ordinary meaning unless otherwise stated . fig1 illustrates the sequence of steps employed in a variety of bleach processes wherein starting pulp containing a mixture of chemical and high yield fibers pass through a sequence of steps . where a particular block in the flow diagram states “ add mg ( oh ) 2 ” or “ add h 2 o 2 ” or “ add taed or acetic anhydride ”, it should be understood that the indicated additive , or a precursor therefor , is incorporated into the pulp admixture in an amount which is effective when combined with the other additives indicated in the other blocks of that sequence to produce a brightening on lightening of the pulp as indicated in the body of the specification . similarly , “ mix ” indicates that the pulp admixture is thoroughly homogenized on such a scale that the individual fibers in the admixture are not unduly damaged but grosser inhomogeneities in the distribution of bleaching ingredients are reduced to such an extent that the resulting paper made from such pulp will be commercially acceptable . typically this is done by passing the admixture through a medium consistency / high shear pump although impellers in a tank can have some effectiveness . “ steam ” indicates that the pulp admixture is heated by injection of live steam to a temperature which will be effective for the intended process steps following in the sequence , typically a “ retention ” step in which the admixture is allowed to internally equilibrate to allow color bodies to be lightened . “ wash ” steps indicate that the pulp admixture is contacted with relatively “ clean ” aqueous liquid to remove unreacted reactants as well as undesired reaction products from the pulp . in this sense , “ clean ” does not usually mean clear potable water but rather some other stream containing the unreacted reactants and undesired reaction products in a lower , hopefully far lower , concentration than the pulp admixture . fig2 illustrates the flow diagram for the process summarized as option 1 , in which medium consistency pulp enters through feed line 22 , mixing therein with magnesium hydroxide entering feed line 22 prior to steam mixer 24 wherein the pulp and magnesium hydroxide admixture are heated to a temperature of between about 60 ° c . ( 140 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 71 ° c . ( 160 ° f .) and just below boiling , more preferably between 82 ° c . ( 180 ° f .) and about 93 ° c . ( 200 ° f .) while the magnesium hydroxide is thoroughly mixed with the pulp in steam mixer 24 which may be either of the type in which steam is injected into a flowing stream of pulp and mixing occurs by virtue of the shear created as the pulp flows or of the tank type where steam is injected into a stirred tank . after the pulp is thoroughly mixed with magnesium hydroxide , hydrogen peroxide is added prior to the inlet to medium consistency mixing pump 26 . molecular oxygen ( o 2 ) is added to the admixture of pulp , magnesium hydroxide and hydrogen peroxide at the suction inlet to medium consistency mixing pump 28 which impels the mixture to primary bleach tower 30 . preferably , commercially pure oxygen is used although any oxygen enriched stream or even atmospheric air is usable but the ultimate goal is most preferably to completely saturate the admixture with oxygen and this is far more easily accomplished with relatively pure gaseous oxygen . it is not necessary to achieve complete saturation to achieve substantial benefits from injection of a stream carrying oxygen . pulp flows upwardly through primary bleach tower 30 which is sized to provide a residence time of from about 30 to about 240 minutes , preferably from about 60 to about 210 minutes and more preferably from about 120 to about 180 minutes . inlet temperature to primary bleach tower 30 is suitably from about 100 ° c . ( 212 ° f .) to about 77 ° c . ( 170 ° f . ), preferably at least slightly below boiling and more preferably between about 82 ° c . ( 180 ° f .) and about 93 ° c . ( 200 ° f .) while the outlet temperature is suitably between about 60 ° c . ( 140 ° f .) and about 88 ° c . ( 190 ° f . ), preferably between about 77 ° c . ( 170 ° f .) and about 82 ° c . ( 180 ° f .). in some cases , particularly in the case where there is substantial decomposition of hydrogen peroxide or some other significant exothermic bleaching reaction , it is possible that temperature may increase during an oxidative bleach stage . typically , the amount of the increase would be minor , with an increase of 0 . 5 to about 3 ° c . (˜ 1 - 5 ° f .) not being exceptional . it is considered beneficial that usually only a small amount of heat is evolved when fibers are bleached with the combination of peroxide and magnesium hydroxide as there is a reduced tendency to damage the fibers as compared to the case where sodium hydroxide is used and the amount of heat evolved can be far more substantial . the residence time in primary bleach tower 30 is typically somewhat longer than would be the case where sodium hydroxide might be used as the source of alkalinity ; however the damage to fibers is greatly reduced resulting in greatly reduced generation of fines and anionic trash . preferably , the pulp is not washed between primary bleach tower 30 and residual bleach tower 32 as it is far more effective to leave unreacted hydrogen peroxide in place to be converted to peracetic acid in situ in residual bleach tower 32 . typically , the inlet concentration of hydrogen peroxide to primary bleach tower 30 will be between about 0 . 1 and 5 %, preferably between about 0 . 5 and 3 . 5 %, more preferably between about 1 and about 2 , while the concentration of magnesium hydroxide will be between about 0 . 1 % and about 2 %, preferably between about 0 . 2 and 1 . 5 %, more preferably between about 0 . 4 and about 0 . 8 %. desirably , inlet concentration of oxygen to primary bleach tower 30 will be between about 0 . 1 and 1 % of the weight of the pulp , preferably between about 0 . 15 and 0 . 75 %, more preferably between about 0 . 25 and about 0 . 5 %. entry ph is from about 7 to 10 , preferably from about 7 . 5 to about 9 . 7 , more preferably from about 8 . 5 to about 9 . 5 , while ph at the exit to primary bleach tower 30 is from about 7 to about 9 , preferably from about 7 . 25 to about 8 . 75 , more preferably from about 7 . 5 to about 8 . 5 . typically , the amount of peroxide consumed in primary bleach tower 30 will be somewhat lower than in the case where sodium hydroxide is used as the source of alkalinity . however , the amount of hydrogen peroxide in the inlet to primary bleach tower 30 should be carefully controlled so that the amount of hydrogen peroxide in the outlet from primary bleach tower 30 is suitably from about 0 . 1 to about 3 %, preferably from about 0 . 25 to about 2 % and more preferably from about 0 . 5 to about 1 . 0 %. prior to entry into residual bleach tower 32 , the pulp carrying a substantial amount of entrained hydrogen peroxide is mixed with peroxide activating agent as previously described in medium consistency mixing pump 34 . preferably the amount of peroxide activating agent is sufficient to ensure that the bulk , if not all , of the entrained hydrogen peroxide is converted in situ to peracetic acid which yield perhydroxyl ions which are ultimately converted to active oxygen as previously mentioned . peroxide activating agent is introduced into the stream leaving primary bleach tower 30 at medium consistency mixing pump 34 , the amount and nature being carefully matched to the residual hydrogen peroxide contained therein , the goal being to achieve substantially complete consumption of the expensive hydrogen peroxide in residual bleach tower 32 . pulp flows upwardly through residual bleach tower 32 which is sized to provide a residence time of from about 30 to about 240 minutes , preferably from about 45 to about 210 minutes and more preferably from about 60 to about 120 minutes . inlet temperature to residual bleach tower 32 is suitably from about 60 ° c . ( 140 ° f .) to about 88 ° c . ( 190 ° f . ), preferably between about 68 ° c . ( 155 ° f .) and about 85 ° c . ( 185 ° f .) and more preferably between about 77 ° c . ( 170 ° f .) and about 82 ° c . ( 180 ° f .) while the outlet temperature is suitably about the same . as mentioned previously , a rise of temperature during an oxidative bleach stage of 0 . 5 to 3 ° c . (˜ 1 - 5 ° f .) would not be exceptional . to avoid waste of expensive bleaching chemicals , the pulp stream exiting residual bleach tower 32 should be washed thoroughly in washer 36 to remove those residua of the oxidative bleaching process which would interfere with subsequent reductive bleaching . after washing , the pulp is mixed with steam in steam mixer 38 and more thoroughly mixed as it passes through medium consistency mixing pump 40 to low consistency mixing pump 42 wherein it suitably mixed with a reductive bleaching agent such as sodium hydrosulfite , the admixture entering reductive bleach tower 44 being at an entrance temperature which is suitably from about 71 ° c . ( 160 ° f .) to about 100 ° c . ( 212 ° f . ), preferably between about 77 ° c . ( 170 ° f .) and about 100 ° c . ( 212 ° f .) and more preferably between about 82 ° c . ( 180 ° f .) and about 100 ° c . ( 212 ° f .) while the outlet temperature is only very slightly , perhaps as little as 0 . 5 ° c . (˜ 1 ° f .) to 5 ° c . ( 10 ° f . ), lower . reductive bleach tower 44 is suitably sized to provide a residence time of from about 30 minutes to about 240 minutes , preferably from about 45 to about 180 minutes and more preferably from about 60 to about 120 minutes . the final pulp is usually washed at least one more time before it is passed to the paper machine . the process of the present invention is advantageously operated with a mixed chemical and high yield pulp having a brightness of between about 50 and 70 , preferably between 55 and 65 , which is rather lower than the brightness of unbleached / unbrightened recycle pulps used to make premium and near premium quality tissues and towel product which is most usually at least about 80 and often at least about 82 . the target brightness of pulp leaving residual bleach tower 32 is typically between about 70 and 80 which is also rather lower than would be expected of a typical recycle pulp for premium and near premium towel and tissue products prior to reductive bleaching . however , it is desirable to employ slightly more aggressive reductive bleaching than normal to bring the final brightness of the pulp up to from about 80 to about 85 , preferably at least about 81 , more preferably at least about 82 and most preferably at least about 83 . accordingly , it can be appreciated that considerable savings can be realized by beginning with lower brightness recycle pulp , using milder oxidative bleaching steps which do less damage to the pulp and thus introduce less trash and scale to the paper machine and then achieve final brightness in the reductive bleaching stages which will be operated at higher concentrations of bleaching chemicals , higher temperatures and longer residence times than are typical . fig3 illustrates the flow diagram for carrying out option 2 in which medium consistency pulp enters through feed line 22 , mixing therein with hydrogen peroxide entering feed line 22 prior to steam mixer 24 wherein the pulp and hydrogen peroxide admixture are heated to a temperature of between about 60 ° c . ( 140 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 71 ° c . ( 160 ° f .) and about 99 ° c . ( 210 ° f . ), more preferably between 82 ° c . ( 180 ° f .) and about 93 ° c . ( 200 ° f . ), while the hydrogen peroxide is thoroughly mixed with the pulp in steam mixer 24 which may be either of the type in which steam is injected into a flowing stream of pulp and mixing occurs by virtue of the shear created as the pulp flows or of the tank type where steam is injected into a stirred tank . after the pulp is thoroughly mixed with hydrogen peroxide , magnesium hydroxide is added prior to the inlet to medium consistency mixing pump 26 . molecular oxygen ( o 2 ) is added to the admixture of pulp , magnesium hydroxide and hydrogen peroxide at the suction inlet to medium consistency mixing pump 28 which impels the mixture to primary bleach tower 30 . preferably , commercially pure oxygen is used although any oxygen enriched stream or even atmospheric air may be used but the ultimate goal is preferably to completely saturate the admixture with oxygen and this is far more easily accomplished with relatively pure gaseous oxygen . it is not necessary to achieve complete saturation to achieve substantial benefits from injection of a stream carrying oxygen . pulp flows upwardly through primary bleach tower 30 which is sized to provide a residence time of from about 30 to about 240 minutes , preferably from about 60 to about 210 minutes and more preferably from about 120 to about 180 minutes . inlet temperature to primary bleach tower 30 is suitably from about 60 ° c . ( 140 ° f .) to about 100 ° c . ( 212 ° f . ), preferably between about 71 ° c . ( 160 ° f .) and about 99 ° c . ( 210 ° f . ), and more preferably between about 82 ° c . ( 180 ° f .) and about 93 ° c . ( 200 ° f . ), while the outlet temperature will vary from only slightly lower , perhaps as little as 3 ° c . ( 5 ° f . ), lower , than the inlet temperature down to about 60 ° c . ( 140 ° f .). as mentioned , a rise of 0 . 5 to 3 ° c . (˜ 1 - 5 ° f . ), would not be considered exceptional . the residence time in primary bleach tower 30 is typically somewhat longer than would be the case where sodium hydroxide might be used as the source of alkalinity ; however the damage to fibers is greatly reduced resulting in greatly reduced generation of fines and anionic trash . preferably , the pulp is not washed between primary bleach tower 30 and residual bleach tower 32 as it is far more effective to leave unreacted hydrogen peroxide in place to be converted to peracetic acid in situ in residual bleach tower 32 . typically , the inlet concentration of hydrogen peroxide to primary bleach tower 30 will be between about 0 . 1 % and 5 %, preferably between about 0 . 5 % and 3 . 5 %, more preferably between about 1 % and about 2 %, while the concentration of magnesium hydroxide will be between about 0 . 1 and about 2 , preferably between about 0 . 25 % and 1 %, more preferably between about 0 . 4 % and about 0 . 8 %. desirably inlet concentration of oxygen to primary bleach tower 30 will be between about 0 . 1 and 1 . 0 %, preferably between about 0 . 15 and 0 . 75 %, more preferably between about 0 . 25 and about 0 . 5 %. entry ph is from about 7 to 10 . 0 , preferably from about 8 to about 9 . 75 , more preferably from about 8 . 5 to about 9 . 5 , while ph at the exit to primary bleach tower 30 is from about 7 to about 10 , preferably from about 8 to about 9 . 75 , more preferably from about 8 . 5 to about 9 . 5 . however , the amount of hydrogen peroxide in the inlet to primary bleach tower 30 should be carefully controlled so that the amount of hydrogen peroxide in the outlet from primary bleach tower 30 is suitably from about 0 . 1 to about 3 , preferably from about 0 . 25 to about 2 . 0 and more preferably from about 0 . 5 to about 1 . 0 . prior to entry into residual bleach tower 32 , the pulp carrying a substantial amount of entrained hydrogen peroxide is mixed with peroxide activating agent as previously described in medium consistency mixing pump 34 . preferably the amount of peroxide activating agent is sufficient to ensure that the bulk , if not all , of the entrained hydrogen peroxide is converted in situ to peracetic acid which yields perhydroxyl ions which are ultimately converted to active oxygen as previously mentioned . suitably the amount of peroxide activating agent will be from about 0 . 01 % to about 1 . 0 % based on the weight of the pulp . the amount of peroxide activating agent is preferably from about 0 . 015 % to about 0 . 50 %, more preferably from about 0 . 025 % to about 0 . 25 % and most preferably from about 0 . 05 % to 0 . 10 % of the dry weight of the pulp to be treated . peroxide activating agent is introduced into the stream leaving primary bleach tower 30 at medium consistency mixing pump 34 , the amount and nature being carefully matched to the residual hydrogen peroxide contained therein , the goal being to achieve substantially complete consumption of the expensive hydrogen peroxide in residual bleach tower 32 . pulp flows upwardly through residual bleach tower 32 which is sized to provide a residence time of from about 30 to about 240 minutes , preferably from about 45 to about 210 minutes and more preferably from about 60 to about 120 minutes . inlet temperature to residual bleach tower 32 is suitably from about 60 ° c . ( 140 ° f .) to about 88 ° c . ( 190 ° f . ), preferably between about 68 ° c . ( 155 ° f .) and about 85 ° c . ( 185 ° f .) and more preferably between about 77 ° c . ( 170 ° f .) and about 82 ° c . ( 180 ° f .) while the outlet temperature varies from only slightly lower , perhaps as little as 3 ° c . ( 5 ° f .) lower , down to 60 ° c . ( 140 ° f . ), but possibly increasing slightly — sometimes by from about 0 . 5 to 3 ° c . ( 1 - 5 ° f .). to avoid waste of expensive bleaching chemicals , the pulp stream exiting residual bleach tower 32 should be washed thoroughly in washer 36 to remove those residua of the oxidative bleaching process which would interfere with subsequent reductive bleaching . after washing , the pulp is mixed with steam in steam mixer 38 and more thoroughly mixed as it passes through medium consistency mixing pump 40 to low consistency mixing pump 42 wherein it suitably mixed with a reductive bleaching agent such as sodium hydrosulfite , the admixture entering reductive bleach tower 44 being at an entrance temperature which is suitably from about 60 ° c . ( 140 ° f .) to about 88 ° c . ( 190 ° f . ), preferably between about 66 ° c . ( 150 ° f .) and about 85 ° c . ( 185 ° f .) and more preferably between about 77 ° c . ( 170 ° f .) and about 82 ° c . ( 180 ° f .) while the outlet temperature is suitably only very slightly , perhaps as little as 0 . 5 to 5 ° c . (˜ 1 - 10 ° f .) lower , but possibly from 0 . 5 to 3 ° c . (˜ 1 - 5 ° f .) higher . reductive bleach tower 44 is suitably sized to provide a residence time of from about 30 minutes to about 240 minutes , preferably from about 45 to about 180 minutes and more preferably from about 60 to about 120 minutes . the final pulp is usually washed at least one more time before it is passed to the paper machine . the process of the present invention is advantageously operated with a mixed chemical and high yield pulp having a brightness of between about 50 and 70 , preferably between about 55 and 65 which is rather lower than the brightness of unbleached / unbrightened recycle pulps used to make premium and near premium quality tissues and towel product which is most usually at least about 80 and often at least about 82 . the target brightness of pulp leaving residual bleach tower is typically between about 70 and 80 which is also rather lower than would be expected of a typical recycle pulp for premium and near premium towel and tissue products prior to reductive bleaching . however , it is desirable to employ slightly more aggressive reductive bleaching than normal to bring the final brightness of the pulp up to from about 80 to about 85 , preferably at least about 81 , more preferably at least about 82 and most preferably at least about 83 . accordingly , it can be appreciated that considerable savings can be realized by beginning with lower brightness recycle pulp , using milder oxidative bleaching steps which do less damage to the pulp and thus introduce less trash and scale to the paper machine and then achieve final brightness in the reductive bleaching stages which will be operated at higher concentrations of bleaching chemicals , higher temperatures and longer residence times than are typical . fig4 illustrates the flow diagram for option 3 , in which medium consistency pulp enters through feed line 22 , mixing therein with peroxide activating agent entering feed line 22 prior to steam mixer 24 wherein the pulp and peroxide activating agent admixture are heated to a temperature of between about 60 ° c . ( 140 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 63 ° c . ( 145 ° f .) and about 93 ° c . ( 200 ° f . ), more preferably between 66 ° c . ( 150 ° f .) and about 82 ° c . ( 180 ° f .) while the peroxide activating agent is thoroughly mixed with the pulp in steam mixer 24 which may be either of the type in which steam is injected into a flowing stream of pulp and mixing occurs by virtue of the shear created as the pulp flows or of the tank type where steam is injected into a stirred tank . after the pulp is thoroughly mixed with peroxide activating agent , hydrogen peroxide is added prior to the inlet to medium consistency mixing pump 26 . molecular oxygen ( o 2 ) and magnesium hydroxide are added to the admixture of pulp , peroxide activating agent and hydrogen peroxide at the suction inlet to medium consistency mixing pump 28 which impels the mixture to primary bleach tower 30 . preferably , commercially pure oxygen is used although any oxygen enriched stream or even atmospheric air may be used but the ultimate goal is preferably to completely saturate the admixture with oxygen and this is far more easily accomplished with relatively pure gaseous oxygen . it is not necessary to achieve complete saturation to achieve substantial benefits from injection of a stream carrying oxygen . pulp flows upwardly through primary bleach tower 30 which is sized to provide a residence time of from about 30 to about 180 minutes , preferably from about 45 to about 120 minutes and more preferably from about 30 to about 90 minutes . inlet temperature to primary bleach tower 30 is suitably from about 60 ° c . ( 140 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 63 ° c . ( 145 ° f .) and about 93 ° c . ( 200 ° f .) and more preferably between about 66 ° c . ( 150 ° f .) and about 82 ° c . ( 180 ° f .) while the outlet temperature may vary from only slightly lower than the inlet temperature , perhaps some 3 ° c . ( 5 ° f .) lower , down to about 60 ° c . ( 140 ° f . ), with a slight increase being possible . the residence time in primary bleach tower 30 is typically somewhat longer than would be the case where sodium hydroxide might be used as the source of alkalinity ; however the damage to fibers is greatly reduced resulting in greatly reduced generation of fines and anionic trash . preferably , the pulp is not washed between primary bleach tower 30 and secondary bleach tower 46 as it is far more effective to leave unreacted hydrogen peroxide in place to be converted to peracetic acid in situ in secondary bleach tower 46 . typically the inlet concentration of hydrogen peroxide to primary bleach tower 30 will be between about 0 . 1 % and 5 . 0 %, preferably between about 0 . 35 % and 2 . 5 %, more preferably between about 0 . 75 % and about 1 . 25 %, while the concentration of magnesium hydroxide will be between about 0 . 1 % and about 2 . 0 %, preferably between about 0 . 25 % and 1 . 5 %, more preferably between about 0 . 4 % and about 0 . 8 %. desirably inlet concentration of oxygen to primary bleach tower 30 will be between about 0 . 1 % and 1 . 0 %, preferably between about 0 . 15 % and 0 . 75 %, more preferably between about 0 . 25 % and about 0 . 5 %. entry ph is from about 7 to 9 , preferably from about 7 . 25 to about 8 . 75 , more preferably from about 7 . 5 to about 8 . 5 , while ph at the exit to primary bleach tower 30 is from about 7 to about 9 , preferably from about 7 . 25 to about 8 . 75 , more preferably from about 7 . 5 to about 8 . 5 . however , in the practice of option 3 , the amount of hydrogen peroxide in the inlet to primary bleach tower 30 need not be as carefully controlled as in the options 1 and 2 as additional hydrogen peroxide is introduced through mixing pump 34 so that the amount of hydrogen peroxide in the inlet to secondary bleach tower 46 is suitably from about 0 . 1 % to about 3 . 0 %, preferably from about 0 . 5 % to about 2 . 5 % and more preferably from about 1 % to about 2 %. hydrogen peroxide is introduced into the stream leaving primary bleach tower 30 at medium consistency mixing pump 34 , the goal being to achieve substantially complete consumption of the expensive hydrogen peroxide in secondary bleach tower 46 . pulp flows upwardly through secondary bleach tower 46 which is sized to provide a residence time of from about 60 to about 240 minutes , preferably from about 90 to about 210 minutes and more preferably from about 120 to about 180 minutes . inlet temperature to secondary bleach tower 46 is suitably from about 60 ° c . ( 140 ° f .) to about 93 ° c . ( 200 ° f . ), preferably between about 71 ° c . ( 160 ° f .) and about 91 ° c . ( 195 ° f .) and more preferably between about 82 ° c . ( 180 ° f .) and about 88 ° c . ( 190 ° f .) while the outlet temperature may vary between only slightly less than the inlet temperature , perhaps 3 ° c . ( 5 ° f .) less , down to 60 ° c . ( 140 ° f .) with a slight increase being possible . to avoid waste of expensive bleaching chemicals , the pulp stream exiting secondary bleach tower 46 should be washed thoroughly in washer 36 to remove those residua of the oxidative bleaching process which would interfere with subsequent reductive bleaching . after washing , the pulp is mixed with steam in steam mixer 38 and more thoroughly mixed as it passes through medium consistency mixing pump 40 to low consistency mixing pump 42 wherein it suitably mixed with a reductive bleaching agent such as sodium hydrosulfite , the admixture entering reductive bleach tower 44 being at an entrance temperature which is suitably from about 71 ° c . ( 160 ° f .) to about 100 ° c . ( 212 ° f . ), preferably between about 77 ° c . ( 170 ° f .) and about 100 ° c . ( 212 ° f .) and more preferably between about 82 ° c . ( 180 ° f .) and about 100 ° c . ( 212 ° f . ), while the outlet temperature is suitably only very slightly , perhaps as little as 0 . 5 ° c . to 5 ° c . (˜ 1 - 10 ° f . ), lower . reductive bleach tower 44 is suitably sized to provide a residence time of from about 5 seconds to about 30 minutes , preferably from about 30 seconds to about 20 minutes and more preferably from about 1 minute to about 15 minutes , the amount of time varying widely within this range depending largely upon temperature and concentration . very short residence times are often quite suitable with temperatures nearer to 100 ° c . ( 212 ° f .) at high concentration of reductive bleaches and high consistency . the final pulp is usually washed at least one more time before it is passed to the paper machine . fig5 illustrates the flow diagram for option 4 , in which medium consistency pulp enters through feed line 22 , mixing therein with mg ( oh ) 2 entering feed line 22 prior to steam mixer 24 wherein the pulp and mg ( oh ) 2 admixture are heated to a temperature of between about 60 ° c . ( 140 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 63 ° c . ( 145 ° f .) and about 96 ° c . ( 200 ° f . ), more preferably between 66 ° c . ( 150 ° f .) and about 82 ° c . ( 180 ° f .) while the mg ( oh ) 2 is thoroughly mixed with the pulp in steam mixer 24 which may be either of the type in which steam is injected into a flowing stream of pulp and mixing occurs by virtue of the shear created as the pulp flows or of the tank type where steam is injected into a stirred tank . after the pulp is thoroughly mixed with mg ( oh ) 2 , hydrogen peroxide is added prior to the inlet to medium consistency mixing pump 26 . molecular oxygen ( o 2 ) may also be added to the admixture of pulp and hydrogen peroxide at the suction inlet to medium consistency mixing pump 28 which impels the mixture to primary bleach tower 30 . preferably , commercially pure oxygen is used although any oxygen enriched stream or even atmospheric air may be used but the ultimate goal is preferably to completely saturate the admixture with oxygen and this is far more easily accomplished with relatively pure gaseous oxygen . it is not necessary to achieve complete saturation to achieve substantial benefits from injection of a stream carrying oxygen . pulp flows upwardly through primary bleach tower 30 which is sized to provide a residence time of from about 30 to about 240 minutes , preferably from about 45 to about 120 minutes and more preferably from about 30 to about 90 minutes . inlet temperature to primary bleach tower 30 is suitably from about 60 ° c . ( 140 ° f .) to about 100 ° c . ( 212 ° f . ), preferably between about 63 ° c . ( 145 ° f .) and about 96 ° c . ( 200 ° f .) and more preferably between about 68 ° c . ( 150 ° f .) and about 82 ° c . ( 180 ° f .) while the outlet temperature may vary from only slightly lower than the inlet temperature , perhaps some 3 ° c . ( 5 ° f .) lower , down to about 60 ° c . ( 140 ° f .) with a slight increase being possible . the residence time in primary bleach tower 30 is typically somewhat longer than would be the case where sodium hydroxide might be used as the source of alkalinity ; however the damage to fibers is greatly reduced resulting in greatly reduced generation of fines and anionic trash . preferably , the pulp is not washed between primary bleach tower 30 and secondary bleach tower 46 as it is far more effective to leave unreacted hydrogen peroxide in place to be converted to peracetic acid in situ in secondary bleach tower 46 . typically the inlet concentration of hydrogen peroxide to primary bleach tower 30 will be between about 0 . 1 % and 5 . 0 %, preferably between about 0 . 35 % and 2 . 5 %, more preferably between about 0 . 75 % and about 1 . 25 %, while the concentration of sodium hydroxide hydroxide will be between about 0 . 1 % and about 2 . 0 %, preferably between about 0 . 25 % and 1 . 5 %, more preferably between about 0 . 4 % and about 0 . 8 %. desirably , inlet concentration of oxygen to primary bleach tower 30 will be between about 0 . 1 % and 1 . 0 %, preferably between about 0 . 15 % and 0 . 75 %, more preferably between about 0 . 25 % and about 0 . 5 %. entry ph is from about 7 to 9 , preferably from about 7 . 25 to about 8 . 75 , more preferably from about 7 . 5 to about 8 . 5 , while ph at the exit to primary bleach tower 30 is from about 7 to about 9 , preferably from about 7 . 25 to about 8 . 75 , more preferably from about 7 . 5 to about 8 . 5 . typically , the amount of peroxide consumed in primary bleach tower 30 will be somewhat lower than in the case where sodium hydroxide is used as the source of alkalinity . however , the amount of hydrogen peroxide in the inlet to primary bleach tower 30 should be carefully controlled so that the amount of hydrogen peroxide in the outlet from primary bleach tower 30 is suitably from about 0 . 1 % to about 3 %, preferably from about 0 . 25 % to about 2 % and more preferably from about 0 . 5 % to about 1 . 0 %, all based on the weight of oven dry pulp . prior to entry into secondary bleach tower 46 , the pulp carrying a substantial amount of entrained hydrogen peroxide is mixed with a carefully controlled amount of sodium hydroxide as previously described in medium consistency mixing pump 34 . preferably the amount of sodium hydroxide is just sufficient to ensure that the bulk , if not all , of the entrained hydrogen peroxide is converted in situ to perhydroxyl ions which are ultimately converted to active oxygen as previously mentioned . sodium hydroxide is introduced into the stream leaving primary bleach tower 30 at medium consistency mixing pulp 34 , the amount being carefully matched to the residual hydrogen peroxide contained therein , the goal being to achieve substantially complete consumption of the expensive hydrogen peroxide in secondary bleach tower 46 without degrading the fiber either by generation of anionic trash or darkening the pulp due to excessive alkalinity . the ph of the stream entering secondary bleach tower 46 is suitably no lower than 8 , preferably between about 8 . 5 and 10 . 0 , more preferably between 9 and 10 . pulp flows upwardly through secondary bleach tower 46 which is sized to provide a residence time of from about 30 to about 180 minutes , preferably from about 45 to about 150 minutes and more preferably from about 60 to about 120 minutes . inlet temperature to secondary bleach tower 46 is suitably from about 60 ° c . ( 140 ° f .) and about 96 ° c . ( 200 ° f . ), preferably between about 71 ° c . ( 160 ° f .) and about 91 ° c . ( 195 ° f .) and more preferably between about 82 ° c . ( 180 ° f .) and about 88 ° c . ( 190 ° f .) while the outlet temperature may range from only slightly less than the inlet temperature , perhaps 3 ° c . ( 5 ° f .) less , down to as low as 60 ° c . ( 140 ° f . ), the possible slight temperature increase being perhaps lightly greater due to the action of sodium hydroxide . to avoid waste of expensive bleaching chemicals , the pulp stream exiting secondary bleach tower 46 should be washed thoroughly in washer 36 to remove those residua of the oxidative bleaching process which would interfere with subsequent reductive bleaching . after washing , the pulp is mixed with steam in steam mixer 38 and more thoroughly mixed as it passes through medium consistency mixing pump 40 to low consistency mixing pump 42 wherein it suitably mixed with a reductive bleaching agent such as sodium hydrosulfite , the admixture entering reductive bleach tower 44 being at an entrance temperature which is suitably from about 71 ° c . ( 160 ° f .) and about 100 ° c . ( 212 ° f . ), preferably between about 77 ° c . ( 170 ° f .) and about 100 ° c . ( 212 ° f . ), and more preferably between about 82 ° c . ( 180 ° f .) and about 100 ° c . ( 212 ° f . ), while the outlet temperature is suitably only very slightly , perhaps as little as 0 . 5 ° c . to 5 ° c . (˜ 1 - 10 ° f . ), lower . reductive bleach tower 44 is suitably sized to provide a residence time of from about 30 minutes to about 240 minutes , preferably from about 45 to about 180 minutes and more preferably from about 60 to about 120 minutes . the final pulp is usually washed at least one more time before it is passed to the paper machine . the process of the present invention is advantageously operated with a mixed chemical and high yield pulp having a brightness of between about 50 and 70 , preferably between about 55 and 65 which is rather lower than the brightness of unbleached / unbrightened recycle pulps used to make premium and near premium quality tissues and towel product which is most usually at least about 80 and often at least about 82 . the target brightness of pulp leaving residual bleach tower is typically between about 70 and 80 which is also rather lower than would be expected of a typical recycle pulp for premium and near premium towel and tissue products prior to reductive bleaching . however , it is desirable to employ slightly more aggressive reductive bleaching than normal to bring the final brightness of the pulp up to from about 80 to about 85 , preferably at least about 81 , and more preferably at least about 82 . accordingly , it can be appreciated that considerable savings can be realized by beginning with lower brightness recycle pulp , using milder oxidative bleaching steps which do less damage to the pulp and thus introduce less trash and scale to the paper machine and then achieve final brightness in the reductive bleaching stages which will be operated at higher concentrations of bleaching chemicals , higher temperatures and longer residence times than are typical . the process of the present invention can also be advantageously operated with a mixed chemical and high yield pulp having a brightness of between about 45 and 75 , preferably between 50 and 70 , more preferably between about 55 and 65 which is rather lower than the brightness of unbleached / unbrightened recycle pulps used to make premium and near premium quality tissues and towel product which is most usually at least about 80 to 82 and often at least about 85 . the target brightness of pulp leaving residual bleach tower is typically between about 70 and 80 which is also rather lower than would be expected of a typical recycle pulp for premium and near premium towel and tissue products prior to reductive bleaching . however , it is desirable to employ slightly more aggressive reductive bleaching than normal to bring the final brightness of the pulp up to from about 80 to about 82 , preferably at least about 83 , more preferably at least about 84 and most preferably at least about 85 . accordingly , it can be appreciated that considerable savings can be realized by beginning with lower brightness recycle pulp , using milder oxidative bleaching steps wherein not only is the peroxide is utilized more effectively due to the presence of the magnesium ions but which also do less damage to the pulp and thus introduce less trash and scale to the paper machine and then achieve final brightness in the reductive bleaching stages which will be operated at higher concentrations of bleaching chemicals , higher temperatures and longer residence times than are typical . in many embodiments , mg ( oh ) 2 is the only alkali source in a multi - stage bleaching sequence , the first stage using hydrogen peroxide and mg ( oh ) 2 , followed by addition of taed or another peroxide activating agent to the pulp which is believed to form peracetic acid as a result of reaction of taed with unreacted residual peroxide remaining in the pulp after the alkaline peroxide bleaching step , thereby resulting in further brightening of the pulp . it is believed that use of magnesium hydroxide in the alkaline peroxide bleaching steps often results in a higher residual peroxide level than with more aggressive hydroxides and this residual peroxide is most advantageously used to form peracetic acid in situ in the pulp admixture thereby avoiding troublesome and expensive separation of the bleach liquor from the partially bleached pulp . only after all of the oxidative bleaching stages are completed is the pulp washed to remove residual oxidative chemical and then reductively bleached at medium consistency . cellguard op ® magnesium hydroxide suspension , from martin marietta , is a preferred source of magnesium hydroxide . in some embodiments , it may be desirable that at least some quantity of the peroxide activating agent be present in the recycled fibers at the time of contact with an alkaline peroxide step . in additional embodiments , it may be desirable that at least some quantity of peroxide activating agent be present in the recycled pulp at the end of the alkaline peroxide step . in one such embodiment , at least about 10 % of the peroxide activating agent is present the recycled fibers at the end of the first alkaline peroxide step . this ensures that there is very little wastage of the expensive hydrogen peroxide , which is a major contributor to the cost of the bleaching process — at least at today &# 39 ; s pricing . while the invention has been described in connection with numerous examples and drawings , modifications to those examples and drawings within the spirit and scope of the invention will be readily apparent to those of skill in the art . in view of the foregoing discussion , relevant knowledge in the art and references discussed above in connection with the background and detailed description , the disclosures of which are all incorporated herein by reference in their entireties , further description is deemed unnecessary .	8
referring now more particularly to fig1 there is shown the distal end 12 of a first preferred embodiment of an inventive tissue retrieval or biopsy instrument 10 . the distal end 12 preferably comprises a disposable wand portion , including a distal tip 14 . the tip 14 may comprise a conventional trocar tip , or , preferably , may include an electrosurgical ( rf ) element or wire 16 which may be energized by a conventional electrosurgical generator ( not shown ) in order to facilitate tissue cutting and consequent advancement of the instrument 10 to a predetermined tissue site in the patient &# 39 ; s body . proximally of the tip 14 is a shaft 18 , preferably lying along an axis 19 ( fig1 ) of the instrument , on which is disposed a cutting element or wire 20 . this wire 20 is disposed axially along the length of the shaft 18 in its retracted position ( not shown ), but may be deployed radially outwardly , as shown in fig1 . the element 20 is preferably comprised of a wire or rectangular band fabricated of memory metal such as nitinol , though stainless steel , tungsten , or other biocompatible materials could also be employed , if desired . the cutting element 20 acts as an electrosurgical cutter , energizable by means of rf energy provided by the electrosurgical generator discussed supra . the instrument 10 may be monopolar , as illustrated in fig2 with the cutting element 20 comprising the active electrode and a return electrode spaced from the instrument 10 and most typically being disposed on the patient &# 39 ; s skin in the form of a patch electrode on the thigh or back . alternatively , the instrument 10 may preferably be bipolar , as illustrated in fig3 with the cutting element comprising the active electrode and a return electrode 22 being disposed on the instrument in close proximity to the active electrode , such as along the shaft 18 . with such an arrangement , a layer of insulation 23 is disposed between the return electrode ( comprising a major portion of the surface area of the shaft 18 ) and the portion of the shaft adjacent to the active electrode , which receives the cutting element 20 in its retracted position . the bipolar embodiment is generally preferred because of a greater safety factor and lower power requirements . a plurality of cutting wires 20 may be employed if desired , preferably spaced circumferentially about the shaft 18 . in some embodiments , it may be preferably to have webs between the cutting elements , to create a “ sail ” rather than entire distinct separate cutting elements . referring now more particularly to fig4 - 7 , a proximal reusable driver portion 24 for the distal end or disposable wand portion 12 is shown . the driver portion 24 is preferably disposed on a stereotactic rail 26 , in known fashion , for guidance of the instrument 10 to a predetermined tissue site using known imaging techniques . such stereotactic imaging systems are available , for example , from fischer , inc . or lorad , inc . alternative imaging systems , such as mammographic , ultrasonic , ct , mri guidance systems may be used in place of a stereotactic system , if desired . additionally , the instrument may be guided to the lesion site using an articulating arm system or manually , rather than on a stereotactic rail . the reusable driver portion 24 comprises a housing 28 within which is disposed a coaxial arrangement comprising an outer sheath 30 , the shaft 18 , and a rod 32 which is attached at its distal end to the cutter element 20 . a knob 34 is rotatably attached to the shaft 18 through a gearing system 35 to rotate the shaft 18 as desired , for the purpose of circumferentially orienting and rotating the cutting element 20 . three levers 36 , 38 , and 40 extend outwardly through slots 42 , 44 , and 46 , respectively , in the side of the housing 28 . the first lever 36 is actuatable to slide the sheath 30 axially both proximally and distally , for a purpose to be described hereinbelow . the second lever 38 is actuatable to move the shaft 18 axially in distal and proximal directions , as desired . the third lever 40 is actuatable to move the rod 32 axially in distal and proximal directions , as desired . since the rod 32 is attached at its distal end to the proximal end of the wire cutter 20 , movement of the rod 32 in an axial direction also causes the proximal end of the wire cutter 20 to move in an axial direction . since the distal end of the cutter 20 is anchored to the shaft 18 , movement of the proximal end of the cutter element 20 in a distal direction causes the midportion of the cutting element 20 to bow radially outwardly to a radially expanded position , as shown in any of fig1 - 3 , while movement of the proximal end of the cutter element 20 in a proximal direction causes the midportion of the cutter element 20 to retract radially to its stowed position , disposed linearly along the axial length of the shaft 18 , preferably within a recess 48 ( fig1 ). an advantageous feature of the invention is the employment of a series of stops 50 in the second slot 44 , and a series of stops 52 in the third slot 46 , as illustrated in fig5 - 7 . the stops 50 enable the second lever 38 to be actuated to a plurality of discrete axial positions , which in turn permits the shaft 18 to be actuated toga corresponding plurality of discrete axial positions for fine tuning the axial position of the electrosurgical cutting element 20 . similarly , the stops 52 enable the third lever 40 to be actuated to a plurality of discrete axial positions , which in turn permits the electrosurgical cutting element 20 to be radially extended to a corresponding plurality of radially extended positions , for a purpose to be described more fully hereinbelow . with reference now more particularly to fig8 - 10 , the operation of the first preferred embodiment of the inventive device will be explained . initially , when it is determined that either a diagnostic or therapeutic biopsy procedure is indicated , the distal disposable wand portion 12 of the instrument 10 will be moved axially to a position wherein the distal tip is adjacent to and preferably within a target lesion 54 , using the stereotactic rail 26 and associated imaging system . during this process step , wherein gross linear movement of the wand 12 is controlled by the rail system 26 , the electrosurgical cutting element 16 on the distal tip 14 is energized to pierce and cut through the patient &# 39 ; s body tissue 56 to permit distal advancement of the wand 12 to the region surrounding the lesion 54 . once the distal tip 14 is generally in the desired position adjacent to or within the target lesion 54 , using the stereotactic rail 26 , the second lever 38 is actuated to provide fine tuning of the axial position of the distal tip 14 relative to the lesion 54 , by moving the shaft 18 axially to a desired position , and securing the lever 38 in an appropriate stop 50 to maintain the desired axial position . this fine axial adjustment of the axial movement of the shaft 18 is performed using appropriate imaging equipment . the objective of this process step is to ensure that the distal end of the cutting wire 20 is disposed distally of the distal peripheral edge of the lesion 54 , while at the same time the proximal end of the cutting wire 20 is disposed proximally of the proximal peripheral edge of the lesion 54 . this will ensure the ability to isolate the entire lesion 54 during the cutting procedure , with sufficient margins to minimize the chance that any portion of the lesion inadvertently remains behind in the patient &# 39 ; s body following removal thereof . when the distal tip 14 is in the precise position desired by the practitioner , first lever 36 , which is normally disposed in a first detent 58 ( fig5 and 6 ) in the first slot 42 , is actuated proximally until it rests in a second detent 60 ( fig5 ) in the first slot 42 . this action retracts the sheath 30 proximally a sufficient distance to partially uncover the cutting element 20 . it should be noted , however , that in some circumstances it may be desirable to fully retract the sheath , so that the entire cutting element 20 is released , in order to create a different cutting geometry . in such an instance , a detent 61 ( fig7 ) is provided within the slot 42 to accommodate the lever 36 in the fully proximal position necessary to achieve full axial retraction of the sheath . additional intermediate detents 60 ( not shown ) may be provided to retract the sheath to intermediate positions corresponding to various partial radial extension positions of the cutting element . after the sheath 30 is retracted as desired , the third lever 40 may then be actuated distally along the third slot 46 to an intermediate stop 52 , thereby causing the rod 32 , and therefore the proximal end of the cutting element 20 , to move axially a distance equivalent to that traversed by the lever 40 . this , of course , results in the partial radial expansion of the cutting element 20 to an arched or bowed configuration as shown in fig8 . the extended configuration of the cutting element 20 may define , when rotated about the instrument axis , a spherical cutting volume , as shown , or it may be configured to define an elliptical or toroidal cutting volume when the cutting element is rotated about the instrument axis 19 , rather than a spherical volume . of course many other mechanisms for radially expanding the cutting element 20 may be utilized as well , within the scope of the invention . for example , since the wire 20 is preferably fabricated of a shaped memory or superelastic material , the proximal retraction of the sheath 30 , and resultant release of the wire 20 , may be sufficient to cause the cutting wire 20 to radially expand to its desired position . once the cutting element 20 is partially radially expanded as described supra , an inner portion of the target lesion 54 is isolated from surrounding tissue . to complete this step , the cutting element 20 is energized by the electrosurgical generator ( not shown ), after which the knob 34 is rotated , either manually or via a motorized drive mechanism , to rotate the cutting element 20 through a 360 degree arc . this rotational cutting action functions to completely sever the inner portion of the tissue sample from the surrounding tissue , thereby cutting off all blood supply to the inner tissue sample . alternatively , if desired , the cutting element 20 may be simultaneously rotated and moved axially , by moving the shaft 18 axially , in order to create a “ corkscrew ”- shaped tissue segment . once this initial isolation step is completed , the cutting element or wire 20 is preferably further radially extended to the position shown in fig9 . this is accomplished by sliding the lever 36 proximally to another detent 60 to further proximally retract the sheath 30 . then , the third lever 40 may be axially slid distally to another stop or detent 52 to further radially extend the cutting wire 20 . once radially positioned , the cutting element 20 is energized by the electrosurgical generator , after which the knob 34 is rotated to rotate the cutting element 20 through a 360 degree arc . this rotational cutting action functions to completely sever a second segment of the tissue sample from the surrounding tissue , thereby cutting off all blood supply to this segment as well . these steps may be repeated as many times as desired , in order to ensure that the tissue sample is segmented for efficient removal from the patient &# 39 ; s body . ultimately , however , a final cut is preferably made , by fully retracting the outer sheath 30 , using the slide lever 36 , and fully extending the cutting wire 20 , using the slide lever 40 , so that the cutting element 20 extends radially beyond the periphery of the target lesion 54 , as illustrated in fig1 . the cutting element is then energized with rf energy , in the same manner as previously , after which the knob 34 is rotated to rotate the cutting wire 20 through a complete arc about the axis 19 . at this point , the entire lesion 54 should be completely isolated from surrounding tissue , with a sufficient margin about the outer periphery thereof to ensure successful removal of the entire lesion . during the foregoing segmentation process , if the cutting element 20 remains charged by rf energy during the stepwise radial extension process , the outer tissue rings will be further segmented radially . other segmentation approaches may be advantageously utilized as well , if desired . for example , rather than segmenting the tissue sample circumferentially , from the inside out , the tissue sample may be segmented circumferentially from the outside in , i . e . by making an outer circumferential cut ( fig1 ), then partially retracting the cutting element 20 and cutting additional layers , as shown in fig8 and 9 . alternatively , the tissue may be sectioned by extending and retracting the cutting element 20 radially , akin to “ sectioning an orange ”. additional radially oriented cutting elements could be employed as well to further segment the tissue . an alternative approach to segmenting the tissue specimen to be retrieved is illustrated in the embodiment shown in fig1 - 19 . in this embodiment , wherein like elements to those in the embodiment of fig1 are designated by like reference numerals , succeeded by the letter a , there is shown a tissue retrieval or biopsy instrument 10 a , having a distal tip 14 a with an electrosurgical element or wire 16 a for cutting tissue and thereby permitting advancement of the instrument into a patient &# 39 ; s body . a shaft or cannula 18 a is disposed along an axis 19 a of the instrument . a longitudinal slot 66 is disposed axially along a portion of the length of the cannula 18 a . a cutting element or wire 20 a , which is preferably an electrosurgical cutting element , is disposed so as to be extendable from and retractable into the slot . the cutting element is shown in a retracted position in fig1 , and in an extended position in fig1 and 19 . in operation , once the instrument 10 a has been positioned so that the distal tip is adjacent to a lesion to be removed , in the manner described supra with respect to the embodiment of fig1 the cutting element 20 a is charged with rf energy from a proximally disposed electrosurgical generator ( not shown ). then , the cutting element 20 a is radially extended by the practitioner , using a proximal control mechanism ( not shown ), to a position as shown , for example , in fig1 . once extended , the cutting element is moved axially in a proximal direction along the slot 66 , as illustrated by the arrow 68 and the phantom images of the cutting element 20 a , in order to isolate a generally cylindrical tissue segment , as the cannula 18 a is rotated about its axis 19 a simultaneously . fig1 illustrates a procedure similar to that illustrated in fig1 , except that while the cutting element 20 a is being axially moved in a proximal direction as shown by arrows 70 , it is also deployed to various radial heights , in order to create a variable height cut . once segmentation of the tissue sample has been completed , whichever embodiment has been employed , each tissue segment can be withdrawn using a suitable retrieval apparatus . preferably , the tissue segments are withdrawn through a cannula , such as the sheath 30 , using such means as a suction grasper , flexible mechanical graspers , an auger conveyor , a prickly bristle or brush grasper , a wire retrieval basket , or the like . the foregoing procedure and apparatus may be used for either a diagnostic or a therapeutic purpose . it is particularly advantageous for a diagnostic procedure because the resultant incision from the procedure will not substantially exceed in length the diameter of the cannula . on the other hand , a second preferred embodiment , illustrated in fig1 - 16 , is particularly suited to a therapeutic procedure , wherein it is highly desired to ensure that the entire lesion of interest is removed in one step , without segmenting that lesion within the body . this approach emphasizes maximum safety , in that only a single procedure is necessary , assuming the tissue sample margins are clean , and the incision necessary to remove the intact tissue sample is of the minimum size necessary to remove the sample . with this procedure , there is also a somewhat reduced risk of cell migration from the specimen to the surrounding tissue , since as described below , the specimen is encapsulated as soon as it is isolated and then promptly removed . no segmentation of the specimen occurs within the patient &# 39 ; s body . referring now to fig1 - 14 , wherein like elements to those in the first embodiment are identified by like reference numerals , followed by the letter “ b ”, there is shown the distal end or disposable wand portion 12 b of an instrument 10 b . the portion 12 b includes a distal tip 14 b , which may be constructed in a manner similar to that of tip 14 in fig1 a shaft 18 b , and a sleeve 30 b . disposed in a radially retracted orientation in a recess 48 b of the shaft 18 b are a plurality of encapsulation elements or bands 72 , one of which also comprises a single electrosurgical cutting element 20 b . for the purposes of the invention it is unimportant which of the encapsulation elements 72 may be charged by means of rf energy to form an electrosurgical cutter , and in certain instances it may be advantageous to employ a plurality of cutting elements . each of the encapsulation elements 72 and the cutting element 20 b are attached at their distal ends to the distal end of the shaft 18 b , at its connection with the distal tip 14 b of the instrument 10 b , which connection is preferably accomplished by means of a keyway 74 . the proximal end of the instrument 10 b may be substantially the same as that for the instrument 10 , illustrated in fig4 - 7 , comprising a reusable driver portion having an actuator for axially moving the sheath 30 b between proximal and distal positions , a linear actuator for axially moving the shaft 18 b , an actuator for rotationally moving the shaft 18 b , and an actuator for axially moving the proximal ends of the encapsulation elements 72 and cutting element 20 b , in order to radially extend and retract each of the elements 72 and 20 b , as illustrated in fig1 - 16 . in operation , as with the first embodiment of fig1 when it is determined that either a diagnostic or therapeutic biopsy procedure is indicated , the distal disposable wand portion 12 b of the instrument 10 b will be moved axially to a position wherein the distal tip is adjacent to and distally of a target lesion , using the stereotactic rail 26 and associated imaging system . during this process step , wherein gross linear movement of the wand 12 b is controlled by the rail system 26 , the electrosurgical cutting element ( not shown ) on the distal tip 14 b is energized to pierce and cut through the patient &# 39 ; s body tissue to permit distal advancement of the wand 12 b to the region surrounding the lesion . once the distal tip 14 b is generally in the desired position adjacent to the target lesion , using the stereotactic rail 26 , the second lever 38 is actuated to provide fine tuning of the axial position of the distal tip 14 b relative to the lesion , by moving the shaft 18 b axially to a desired position , and securing the lever 38 in an appropriate stop 50 to maintain the desired axial position . this fine axial adjustment of the axial movement of the shaft 18 b is performed using appropriate imaging equipment . the objective of this process step is to ensure that the distal end of the cutting wire 20 b is disposed distally of the distal peripheral edge of the lesion , while at the same time the proximal end of the cutting wire 20 b is disposed proximally of the proximal peripheral edge of the lesion . this will ensure the ability to isolate the entire lesion during the cutting procedure , with sufficient margins to minimize the chance that any portion of the lesion inadvertently remains behind in the patient &# 39 ; s body following removal thereof . when the distal tip 14 b is in the precise position desired by the practitioner , first lever 36 , which is normally disposed in a first detent 58 ( fig5 and 6 ) in the first slot 42 , is actuated proximally until it rests in a second detent 60 ( fig7 ) in the first slot 42 . this action retracts the sheath 30 b proximally a sufficient distance to completely uncover the cutting element 20 b and associated encapsulation elements 72 . the third lever 40 may then be actuated distally along the third slot 46 to the distal - most stop 52 , thereby causing the rod 32 , and therefore the proximal ends of the cutting element 20 a and encapsulation elements 72 , to move axially a distance equivalent to that traversed by the lever 40 . this , of course , results in the radial expansion of the cutting element 20 b and encapsulation elements 72 to an arched or bowed configuration as shown in fig1 , wherein the cutting element 20 b defines a peripheral boundary which lies radially beyond the peripheral boundary of the lesion , as in the case of the first embodiment shown in fig8 . again , it should be noted that the cutting element and encapsulation elements need not be fully extended , especially if an ellipsoidal or toroidal cutting geometry is desired , in which case intermediate stop 61 is utilized . once the cutting element 20 b and associated encapsulation elements 72 are radially expanded as described supra , it is time to isolate the target lesion from surrounding tissue . advantageously , a spherical or toroidal tissue sample having a radius of at least 15 mm may be defined and isolated by rotating the cutting element 20 b about the axis of the shaft 18 b . the encapsulation elements 72 will also be rotated during this process , but their function is not yet important . to complete the isolation step , the cutting element 20 b is energized by the electrosurgical generator ( not shown ), after which the knob 34 is rotated , either manually or via a motorized drive mechanism , to rotate the shaft 18 b , and thus the cutting element 20 b through a 360 degree arc . this rotational cutting action functions to completely sever the tissue sample from the surrounding tissue , thereby cutting off all blood supply to the tissue sample ( and thus from the lesion , which should be completely contained within the tissue sample ). after the isolation step is completed , the isolated tissue sample may be retrieved from the patient &# 39 ; s body 56 . this retrieval step may be accomplished in a number of ways , but it is the objective in connection with the illustrated embodiment to encapsulate and remove the isolated tissue sample in one piece . accordingly , as is illustrated in fig1 and 16 , continued rotation of the shaft 18 b , once the isolation step has been completed , preferably with the cutting element 20 b de - energized , will twist and tighten the encapsulating elements 72 and the cutting element 20 b about the tissue sample ( not shown ). as the shaft 18 b is rotated , and the encapsulating elements 72 radially retracted and twisted , they will function to deform the tissue sample radially so that it is more compact and more securely retained within the spaced defined by the encapsulating elements 72 . once the tissue sample has been fully encapsulated , the tissue sample may be removed from the patient &# 39 ; s body . advantageously , since the tissue sample is larger in cross - section than the cross - section of the sheath 30 b , the inventors have developed an inventive approach for removal thereof which results in minimum trauma and incision size for the patient while still permitting the removal of an intact specimen . to remove the specimen , the sheath 30 b is retracted proximally , following which the cutting element 20 b is again energized by the electrosurgical generator . the shaft 18 b , with the tissue specimen encapsulated thereabout , is then proximally withdrawn by the practitioner , with the cutting element 20 b functioning to cut through the tissue necessary to create a passage for exit of the sample . once the unit , including the shaft and encapsulated tissue mass , is completely withdrawn from the body , the incision created by the cutting element 20 b upon withdrawal from the body may be adhesively closed , with minimal required follow - up care and scarring . many alternative embodiments may be used to accomplish the method outlined supra , which essentially involves isolating the tissue mass from surrounding tissue , encapsulating the tissue mass in place about a shaft , then removing the encapsulated tissue mass and shaft from the body by energizing an rf electrosurgical cutter to cut its way out , without the need for a cannula or pre - existing incision . for example , a plurality of cutting elements could be employed , or a separate cutting element could be disposed on the shaft . an important aspect of the invention , of course , is a relatively high likelihood of acquiring the entire lesion of interest in a single therapeutic procedure , without the need for follow - up surgery . while this invention has been described with respect to various specific examples and embodiments , it is to be understood that the invention is not limited thereto and that it can be variously practiced within the scope of the following claims .	0
the novel compounds of this invention are the levorotatory enantiomers of 3 - lower alkoxycyproheptadine , otherwise designated as (-)- 3 - lower alkoxycyproheptadine , or (-)- 1 - methyl - 4 -( 3 - lower alkoxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine . the term &# 34 ; lower alkoxy &# 34 ; is meant to include alkoxy groups of 1 to 4 carbon atoms . a preferred embodiment of the novel compounds of this invention is (-)- 3 - methoxycyproheptadine or pharmaceutically acceptable salt thereof . the salts contemplated to be within the scope of this invention are acid addition salts prepared from inorganic or organic acids known in the art to provide pharmaceutically accpetable salts , such as hydrochloric , phosphoric , hydrobromic , sulfuric , maleic , succinic , ethane disulfonic acid , or the like . the novel process of this invention comprises heating a mixture of (-)- 3 - iodocyproheptadine , an excess of an alkali metal lower alkoxide , preferably a sodium lower alkoxide , and an excess of copper powder in an inert organic solvent until reaction is complete . the temperature at which the reaction is conducted may be from about 50 ° c . to about 150 ° c ., but usually at or below the boiling point of the solvent , and preferably at about steam bath temperature , 100 ° c . the solvent can be any inert organic liquid capable of dissolving the alkoxide and iodocyproheptadine starting material , preferably dimethyl formamide . the reaction is completed in 1 to about 5 hours . the novel method of treatment of this invention comprises administration of a (-)- 3 - lower alkoxycyproheptadine or pharmaceutically acceptable salt thereof , to a patient in need of antiserotonin therapy at a rate of from 0 . 014 to about 0 . 07 mg / kg / day , preferably at a rate of 0 . 04 to about 0 . 06 mg / kg / day . the novel compound may be administered orally , parenterally , or rectally . the novel pharmaceutical compositions of this invention comprise an art - recognized pharmaceutical carrier and an effective amount of a (-)- 3 - lower alkoxycyproheptadine or pharmaceutically acceptable salt thereof . a unit dosage form comprises preferably from 0 . 5 mg . to about 1 . 0 mg . of active ingredient . for oral use the dosage forms may be in the form of tablets , capsules , syrups , suspensions or any art - recognized orally administrable form . for parenteral use , doses may be in the form of sterile solutions in aqueous , oily or emulsion mediums . for rectal administration , they may be in one of the usual suppository forms . the following examples illustrate the chemical syntheses of the novel compounds of this invention and the preparation of the novel pharmaceutical formulations and are not meant to limit the invention to particular reagents and conditions employed therein . 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one ( 25 g ., 0 . 088 mole ), copper turnings ( 1 . 14 g ., 0 . 018 mole ), cuprous chloride ( 0 . 94 g ., 0 . 009 mole ), and concentrated aqueous ammonia ( 50 ml .) are agitated together at 195 ° in a steel bomb for 24 hours . the cooled mixture is removed from the vessel , and the large solid mass broken up mechanically and dissolved in warm chloroform ( ca 150 ml .). the aqueous residue from the reaction is extracted once with chloroform , and the combined chloroform fractions are washed with water , dried over sodium sulfate , filtered , and evaporated in vacuo to give 18 . 9 g . of crude yellow solid . the crude product is ground in a mortar and recrystallized from ethanol ( ca 200 ml .). the solid obtained is dissolved in warm chloroform , treated with about 8 g . of silica gel , filtered , and evaporated in vacuo to give 16 g . of 3 - amino - 5h - dibenzo [ a , d ] cyclohepten - 5 - one . 3 - amino - 5h - dibenzo [ a , d ] cyclohepten - 5 - one ( 50 g ., 0 . 226 mole ) is slurried in 150 ml . of concentrated hydrochloric acid . ice ( 150 ml .) is added , and the stirred mixture cooled in an ice bath and diazotized by dropwise addition of sodium nitrite solution ( 17 g ., 0 . 248 mole in 80 ml . of water ) over 45 minutes . the temperature is held below 5 ° throughout the addition . the mixture is stirred for an additional 15 minutes and poured slowly into a stirred solution of 160 g . ( 1 mole ) of potassium iodide in 100 ml . of water . the mixture is stirred at room temperature for 1 hour , then stored overnight in the refrigerator . the resulting slurry is filtered and the filtrate is extracted once with chloroform . the solids are extracted several times with hot chloroform , and the combined chloroform fractions washed with dilute sodium bisulfite and with water , and dried over sodium sulfate . residual solid from the chloroform extraction is discarded . the chloroform solution is combined with 100 g . of silica gel , evaporated in vacuo , then stirred with 1 : 1 chloroform / hexane and added to a column of 1 kg . of silica gel . the column is packed and eluted with 1 : 1 chloroform hexane . the product fraction , which is eluted after about 3 . 5 liters of fore - run , is evaporated in vacuo to give the 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one ( 39 . 7 g ., 53 %) as a white solid , m . p . 97 . 5 °- 99 °. to an ice - cooled solution of 10 . 00 g . ( 0 . 0301 mol ) of 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one in 100 ml . of dry tetrahydrofuran is added dropwise 64 ml . of 0 . 47m 1 - methyl - 4 - piperidylmagnesium chloride in tetrahydrofuran . the solution is stirred one hour at room temperature , and then the tetrahydrofuran is removed on a rotary evaporator . the red - oily residue that remains is dissolved in benzene and water is added dropwise until a clear benzene supernatant and a gelatinous aquoeus phase is obtained . the benzene phase is decanted and the gelatinous aqueous phase is extracted with two 100 ml . portions of hot benzene . the combined benzene extracts are concentrated . the residue that remains is triturated with acetonitrile , and the crystalline product is collected by filtration , washed with cold acetonitrile and dried to give 5 . 95 gm . ( 46 %) of 1 - methyl - 4 -( 3 - iodo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine . a solution of 3 . 23 g . of 1 - methyl - 4 -( 3 - iodo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine , 30 ml . of trifluoroacetic acid and 10 ml . of trifluoroacetic anhydride is refluxed for 6 hours . the solution is concentrated on a rotary evaporator and the residue is made basic with 5 % sodium hydroxide solution . the oil that precipitates is extracted into ether , and this ether phase is washed with water , dried over magnesium sulfate , filtered , and the ether removed on a rotary evaporator . the residue is triturated with acetonitrile , collected and dried to give 2 . 36 g . of material . this material is recrystallized from ether acetate to give pure (±)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene )- piperidine , m . p . 166 °- 170 °. anal . calcd . for c 21 h 20 in : c , 61 . 03 ; h , 4 . 88 ; n , 3 . 38 , i , 30 . 70 . found : c , 61 . 35 ; h , 5 . 01 ; n , 3 . 30 ; i , 30 . 62 . to a solution of 4 . 60 g . ( 0 . 0111 mol ) of (±)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene )- piperidine in 100 ml . of hot absolute ethanol is added 4 . 30 g . ( 0 . 0111 mol ) of di - p - toluoyl - d - tartaric acid dissolved in 45 ml . of warm absolute ethanol . the solution is stirred and allowed to cool to room temperature . the crystalline precipitate that forms is removed by filtration , washed with cold absolute ethanol , and dried at 100 ° in vacuo to give 2 . 36 g . of material designated a . the clear ethanol filtrate and washings , which are combined and concentrated by boiling to 50 ml ., are designated b . the 2 . 36 g . of a is recrystallized from absolute ethanol four times to give a product that has a constant rotation , m . p . 156 °- 157 °; [ α ] 589 25 = - 129 °, [ α ] 578 25 = - 136 °, [ α ] 546 25 = - 162 °, [ α ] 436 25 = - 371 ° ( c = 0 . 00407 g ./ ml . pyridine ). this material , 0 . 35 g . is suspended in a small amount of water and is treated with sodium hydroxide solution . the free base that precipitates is extracted into ether , washed with water , and dried over magnesium sulfate . after filtering , the ether is removed on a rotary evaporator . the white solid that remains is recrystallized from acetonitrile to give 0 . 12 g . of (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , m . p . 184 °- 190 °; [ α ] 589 25 = - 141 °, [ α ] 578 25 = - 149 °, [ α ] 546 25 = - 180 °, [ α ] 436 25 = - 437 ° ( c = 0 . 00356 g ./ 10 m . chcl 3 ). anal . calcd . for c 21 h 20 in : c , 61 . 03 ; h , 4 . 88 ; n , 3 . 38 ; i , 30 . 70 . found : c , 60 . 66 ; h , 5 . 25 ; n , 3 . 28 ; i , 30 . 83 . the ethanol filtrate and washings , designated b , are concentrated on a rotary evaporator . the residue is treated with sodium carbonate solution . the free base that precipitates is extracted into ether . evaporation of the ether gives 2 . 23 g . of a solid that is dissolved in 75 ml . of hot absolute ethanol and treated with 2 . 18 g . of di - p - toluoyl - 1 - tartaric acid monohydrate in 20 ml . of hot absolute ethanol . the solution is stirred and concentrated by boiling to 45 ml . the crystalline precipitate that forms on cooling is removed by filtration , washed with cold absolute ethanol , and dried at 100 ° in vacuo to give 2 . 00 g . of material . this material is recrystallized from absolute ethanol to give a product that has a constant rotation , m . p . 155 °- 157 °; [ α ] 589 25 = + 128 °, [ α ] 578 25 = + 136 °, [ α ] 546 25 + 162 °, [ α ] 436 25 = + 372 °, ( c = 0 . 00181 g ./ ml pyridine ). this material , 0 . 53 g ., is suspended in a small amount of water and is treated with sodium hydroxide solution . the free base that precipitates is extracted into ether , washed with water , and dried over magnesium sulfate . after filtering , the ether is removed on a rotary evaporator . the residue is triturated with acetonitrile , collected by filtration , and dried to give 0 . 18 g . of (+)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , m . p . 188 °- 191 °; [ α ] 589 25 = + 139 °, [ α ] 578 25 = + 145 °, [ α ] 546 25 = + 175 °, [ α ] 436 25 = + 430 °, ( c = 0 . 00137 g ./ ml . chcl 3 ). anal . calcd . for c 21 h 20 in : c , 61 . 03 ; h , 4 . 88 ; n , 3 . 38 . found : c , 61 . 27 ; h , 5 . 21 ; n , 3 . 20 . a mixture of 3 . 74 g . ( 0 . 00905 mol ) of (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , [ α ] 589 - 142 °, 9 . 77 g . ( 0 . 181 mol ) of sodium methoxide , 5 . 56 g . of electrolytic copper dust , and 87 ml . of dmf is stirred and heated on a steam bath for 2 . 5 hours . after cooling , 150 ml . of water and 150 ml . of ether is added to the mixture , and , after stirring , the mixture is filtered through a pad of celite . the ether phase is separated , washed with water , dried over magnesium sulfate , filtered , and the ether is removed on a rotary evaporator . the residue , 2 . 67 g ., is dissolved in 50 ml . of warm acetonitrile . on standing , the solution deposits crystals . the supernatant , containing the desired product , is decanted from the crystals . evaporation of the solvent gives 2 . 0 g . of solid which is recrystallized from 40 ml . of hexane . the product then is recrystallized from 8 ml . of acetonitrile . the product is collected , washed with ice cold acetonitrile , and dried to give 1 . 0 g . of (-)- 1 - methyl - 4 -( 3 - methoxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , m . p . 115 °- 116 °; [ α ] 589 - 153 °, [ α ] 578 - 163 , [ α ] 546 - 198 °, [ α ] 436 - 515 ° ( c , 0 . 491 , chcl 3 ). anal . calcd . for c 22 h 23 no : c , 83 . 24 ; h , 7 . 30 ; n , 4 . 41 . found : c , 83 . 55 ; h , 7 . 44 ; n , 4 . 59 . employing the procedure substantially as described in example 1 , step e , but substituting for the sodium methoxide used therein , an equimolecular amount of sodium ethoxide , sodium n - propoxide , sodium isopropoxide , sodium n - butoxide , sodium sec .- butoxide , or sodium t - butoxide , there is produced respectively (-)- 3 - ethoxycyproheptadine , (-)- 3 - n - propoxycyproheptadine , (-)- 3 - isopropoxycyproheptadine , (-)- 3 - n - butoxycyproheptadine , (-)- 3 - sec .- butoxycyproheptadine , or (-)- 3 - t - butoxycyproheptadine . a mixture of 1 . 40 g . ( 0 . 00339 mol ) of (+)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene , [ α ] 589 + 142 °, 3 . 66 g . ( 0 . 0678 mole ) of sodium methoxide , 4 . 31 g . ( 0 . 0678 mol ) of electrolytic copper dust , and 33 ml . of dmf is stirred and heated on a steam bath for one hour . after cooling , the mixture is poured into water , and the precipitate that forms is extracted into ether . the mixture is filtered through a pad of celite . the ether phase is separated , washed with water , dried over magnesium sulfate , filtered , and the ether is removed on a rotary evaporator . the oily residue is triturated with ice cold acetonitrile , and the solid that forms is removed by filtration . this solid is recrystallized from 5 ml . of acetonitrile . on standing , the solution deposits crystals . the supernatant , containing the desired product , is decanted from these crystals . on further standing , this supernatant liquid deposits crystals . these crystals are collected by filtration , washed with a small amount of ice cold acetonitrile , and dried to give (+)- 1 - methyl - 4 -( 3 - methoxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , [ α ] 589 + 147 °. recrystallization from acetonitrile gives analytically pure product , m . p . 112 . 5 °- 114 . 5 °; [ α ] 589 + 147 °, [ α ] 578 + 157 °, [ α ] 546 + 191 °, [ α ] 436 + 497 ° ( c , 0 . 150 , chcl 3 ). anal . calcd . for c 22 h 23 no : c , 83 . 24 ; h , 7 . 30 ; n , 4 . 41 . found : c , 82 . 75 : h , 7 . 47 ; n , 4 . 59 . ______________________________________preparation of tablet formulation milligrams peringredient tablet______________________________________ (-)- 3 - methoxycyproheptadine 1 . 00lactose 200corn starch ( for mix ) 50corn starch ( for paste ) 50magnesium stearate 6______________________________________ the active ingredient , lactose , and corn starch ( for mix ) are blended together . the corn starch ( for paste ) is suspended in water at a ratio of 10 grams of corn starch per 80 milliliters of water and heated with stirring to form a paste . this paste is then used to granulate the mixed powders . the wet granules are passed through a no . 8 screen and dried at 120 ° f . the dry granules are passed through a no . 16 screen . the mixture is lubricated with magnesium stearate and compressed into tablets in a suitable tableting machine .	2
referring now to fig1 and 2 , the injection molding system 10 of the present invention includes a mold portion 12 and mold portion 14 . the mold portion 12 has a cavity side 16 , a left side 18 , a right side 20 , and a rear side 22 . the mold portion 14 has a cavity side 24 , a left side 26 , a right side 28 , and rear side 30 . generally , the cavity side 16 of mold portion 12 and the cavity side 24 of mold portion 14 close together along a transverse axis of separation 32 as supported by tie rods ( not shown ) according to methods well known in the art . in the present invention , the mold portion 12 may be connected to a set of push rods 34 extending from hydraulic cylinders 19 attached to the mold portion 12 ( or other stationary structure ) and extending to attach to an upper turret support bar 36 . a similar structure is positioned below the mold portion 12 to support a lower turret support bar ( not shown ). the turret support bars hold a left turret 38 rotatable about a vertical axis 39 and a right turret 40 rotatable about a vertical axis 43 as driven by hydraulic motors 44 and 46 respectively . both turrets 38 and 40 support core pins 42 extending radially from the vertical axes 39 and 40 at 90 degree intervals about the vertical axes 39 and 40 . these core pins 42 are duplicated in vertical rows at each angle extending along the axes 39 and 40 . importantly , the transverse axis of separation 32 of the mold portions 12 and 14 is perpendicular to the vertical axes of left turret 38 and right turret 40 . a control system 48 is connected by a plurality of control signal lines 50 to the push rods 34 and to the motors 44 and 46 as well as to the other components of the injection molding system 10 to coordinate movement of the turrets 38 and 40 in rotation and translation toward and away from the mold portion 12 as will be described below . referring now to fig3 , the left turret 38 and right turret 40 may be incrementally moved to any of four rotation positions 41 a , 41 b , 41 c , 41 d , each separated by 90 degrees . at each of these positions 41 , two core pins 42 ( at positions 41 a and 41 c as shown ) will be perpendicular to the transverse axis of separation 32 to lie along a part line between the stationary mold portions 16 and the mold portion 14 , while two core pins 42 ( at positions 41 b and 41 d as shown ) will extend into the mold portion 12 and mold portion 14 respectively aligned with the transverse axis of separation 32 . referring again to fig1 , in any one of these positions 41 , the first mold portion 12 and second mold portion 14 interfit around the left turret 38 and right turret 40 and with core pins 42 to form molding cavities for receiving injected plastic . a set of left first molding cavities 52 and a plurality of right first molding cavities 54 are formed completely within mold portion 14 corresponding to the core pins 42 at positions 41 a on turrets 38 and 40 respectively . a plurality of left second molding cavities 56 and a plurality of right second molding cavities 58 are formed within both mold portion 14 and stationary mold portion 12 corresponding to the core pins 42 at positions 41 c on turrets 38 and 40 respectively . referring also to fig2 , a first runner path 60 in mold portion 14 transports material from a first injector nozzle 62 positioned behind the movable mold portion and generally aligned with transverse the axis of separation 32 to left first molding cavities 52 and right first molding cavities 54 . a second runner path 64 formed at the interface of the mold portion 14 and mold portion 12 transports material from a second injector nozzle 66 to left second molding cavities 56 and right second molding cavities 58 . referring still to fig1 and 2 , a left cooling cavity 68 and a right cooling cavity 70 are formed within stationary mold portion 12 . the cooling cavities may also be formed in both of the mold portions . in one embodiment of the invention , channel ( s ) 72 formed within mold portion 12 circulate a cooling medium through the mold portion 12 to aid cooling . a cooling medium may also be circulated through the cooling cavities to aid cooling . referring again to fig3 , in one embodiment of the invention , two - shot twist - on wire connectors 74 may be produced having an inner threaded portion 76 of a relative hard plastic material intended to thread onto and twist wire conductors together and an outer grip portion 78 surrounding the inner threaded portion 76 of an elastomeric material intended to provide an improved gripping surface . for this purpose , the core pins 42 have threaded tips defining the threads on the inner threaded portion 76 the twist - on wire connectors 74 are produced in four steps corresponding to four molding stations 79 a , 79 b , 79 c , and 79 d defined when the mold portions 12 and 14 are closed along an axis of separation 31 . the first molding station 79 a is formed by core pins 42 inside of first molding cavities 52 and 54 . the inner portions 76 of the wire - twist - on wire connectors 74 are injected at the first molding station 79 a . because the core pins 42 must be able to remove the inner portions 76 of the twist - on wire connectors from the unitary molding cavities , sufficient relief must be incorporated into the outer surface of the inner portions 76 of the twist - on wire connectors to allow the molded parts to be withdrawn axially . the second molding station 79 b is formed by core pins 42 , carrying inner portions 76 , inside of molding cavities 56 and 58 . the outer portions 78 of the twist - on wire connectors 74 are formed at the second molding station 79 b . here , the molding cavities 56 and 58 are formed from separating parts of mold portions 12 and 14 so axial relief requirements are relaxed . the third molding station 79 c , does not in fact provide molding although this could optionally be performed , and is formed by core pins 42 , carrying completed twist - on wire connectors 74 , inside of cooling cavities 68 and 70 . the completed twist - on wire connectors 74 are cooled at the third molding station 79 c . the fourth molding station 79 d is formed by core pins 42 , carrying cooled - completed twist - on wire connectors 74 , exposed outside of the mold portions 12 and 14 . the cooled - completed twist - on wire connectors 74 are extracted at the fourth molding station 79 d . parts extractors 80 ( not shown ) may remove twist - on wire connector 74 from the core pins 42 by twisting them off . referring to fig3 and 4 , the molding of a given twist - on wire connector 74 associated with a given core pin 42 is completed in a four step cycle 82 , 84 , 86 , or 88 comprising the above described steps of a first molding shot step 90 a at station 79 a , a second molding shot step 90 b at station 79 b , a cooling step 90 c at station 79 c and a ejection step 90 d at station 79 c . as shown in fig4 each cycle 82 , associated with a different position 41 a - 41 c on the turrets 38 and 40 is staggered so that at any given time the first injector nozzle 62 injects material through the first runner path 60 to the molding cavities 52 and 54 to form a plurality of inner portions 76 and a second injector nozzle 66 injects material through second runner path 64 into second molding cavities 56 and 58 to form a plurality of outer portions 78 . in between each step 90 , mold portion 12 moves away from mold portion 14 and push rods 34 extend to move the turrets 38 and 40 away from mold portions 12 and 14 . this removes core pins 42 carrying inner portions 76 from first molding cavities 52 and 54 and core pins 42 carrying inner portions twist - on wire connectors 74 from molding cavities 56 and 58 . left motor 44 rotates left turret 38 ninety degrees and right turret 40 ninety degrees and push rods 34 retract to move the turrets 38 and 40 towards mold portion 12 . mold portion 12 moves towards mold portion 14 and closes the mold portions together along axis of separation 31 . in the preferred embodiment of the present invention , injection of inner portions 76 , injection of second outer portion 78 , cooling of twist - on wire connector 74 , and ejection of twist - on wire connector 74 occur simultaneously . cooling could alternatively occur between the first and second shots . additionally , a third shot of material could be provided by third molding cavities in place of the cooling cavities 68 and 70 . in another embodiment of the present invention , parts carriers may not be core pins 42 other mold elements well known in the art . the above description of an embodiment of the present invention describes two turrets but the injection molding system 10 may have only one turret . it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein , but include modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments as come within the scope of the following claims .	1
the apparatus of the present invention has been developed in association with a method for cooking food . conveyors currently used , particularly in the food industry are unable to turn and tumble products . to achieve this result current methods require the use of two seperate conveyor belts and conveyors being placed at upper and lower levels to each other . the apparatus of the present invention provides a significant alternative to this method of conveying items . the conveyor apparatus comprising the present invention is arranged such that items may be placed on a single conveyor belt arranged with a series of dips so as is in use items tumble over the dip and are , in general , turned . this has a particular benefit to food products as it enables them to be cooked more evenly and quickly . in accordance with one aspect of the present invention there is provided a conveyor comprising a conveyor belt means , first and second end parts of said conveyor , said conveyor belt means positioned between said first and second end parts , a portion of said conveyor belt means between said first and second end parts arranged to convey items , wherein said portion comprises at least one dip in said conveyor belt means such that in use , at the said dip said items fall to a lower level of said conveyor belt means . fig1 is an upper perspective view of an embodiment of a conveyor in accordance with the present invention ; fig1 a is an exploded view of the male and female drive coupling which mat form part of the end roller and drive shaft to impart drive to the conveyor . fig2 is a detail of a portion of the conveyor shown in fig1 ; fig3 is a side view of a portion of the conveyor shown in fig1 ; fig4 is a side view of the conveyor shown in fig1 ; fig5 is a side view of the conveyor shown in fig1 but with the conveyor belt in a different arrangement ; fig6 is a further side view of the conveyor shown in fig1 but with the conveyor belt in a further different arrangement ; fig7 is a sectional side view of a cooking apparatus with the conveyor shown in fig1 in operative position therein ; and , fig8 is a perspective view of the cooking apparatus shown in fig7 . the following description is given by way of example only in embodiments of the conveyor apparatus of the present invention . in fig1 to 4 , there is shown a conveyor 10 comprising a conveyor belt 12 positioned between first and second end parts 14 and 16 , respectively , of the conveyor 10 . the conveyor belt 12 is of the endless type and passes around and extends between a first end roller 18 and a second end roller 20 , in looplike manner . the first end roller 18 is positioned in the region of the first end part 14 of the conveyor 10 . the second end roller 20 is positioned in the region of the second end part 16 of the conveyor 10 . these rollers 18 & amp ; 20 may be fixed in such a way so as to provide a tensioning arrangement for the conveyor belt 12 by adjusting the position at which they are attached to the side frame members 38 . the conveyor belt 12 has an upper track portion 22 and a lower track portion 24 . this can be seen in fig4 . the upper track portion 22 of the conveyor belt 12 is able to convey items 26 , as can been seen in fig7 . the upper track portion 22 of the conveyor belt 12 is provided with one or more dips 28 . in fig1 and 4 , the conveyor belt 12 is shown as provided with three dips 28 . each dip 28 is formed by the conveyor belt 12 passing over and around a first guide roller 30 and under and around a second guide roller 32 . the guide rollers 30 are positioned immediately beneath the horizontal line 34 ( best seen in fig6 and shown partly in broken lines ) at which the upper track portion 22 of the conveyor 12 would be positioned if there were no dips 28 in the conveyor belt 12 . the guide rollers 32 are positioned below respective guide rollers 30 . at each dip 28 , the conveyor belt 12 passes over and around each guide roller 30 and extends downwardly to pass under and around a guide roller 32 . the conveyor belt 12 . extends upwardly from the guide roller 32 to the next guide roller 30 . in this way , the guide rollers 30 and 32 guide the conveyor belt 12 from a first level to a second lower level at each dip 28 . the conveyor belt 12 then extends upwardly to the next guide roller 30 , as hereinabove described , which is also at the first level . this is best seen in fig4 . further guide rollers 36 may be positioned beneath the guide rollers 32 to keep the lower track portion 24 of the conveyor belt 12 out of contact with the guide rollers 32 . the end rollers 18 and 20 and the guide rollers 30 , 32 and 36 are rotatably mounted between a pair of side frame members 38 of the conveyor 10 . for this purpose , the side frame members 38 are provided with holes or the like 40 so that the ends of the end rollers 18 and 20 and the guide rollers 30 , 32 and 36 are retained therein . provision for adjusting the tension of the conveyor belt 12 may be incorporated into the conveyor 10 . the conveyor belt tensioning arrangement may be provided by mounting the ends of the guide rollers 32 in pairs of curved slots 42 in respective side frame members 38 . in such a case , the curved slots 42 are provided in place of the holes 40 for mounting the guide rollers 32 . the curved slots 42 curve upwardly in a forward direction ( i . e . in the direction of the second end part 16 ), as best seen in fig3 . each guide roller 32 is repositionable in its respective curved slots 42 . the guide rollers 32 can be locked into position at any required position between the ends 44 of their respective curved slots 42 . the guide roller 32 shown at the right in fig3 imparts greatest tension to the conveyor belt 12 when it is in position a and least tension at position c . position b is an intermediate position . accordingly , in the above described manner the guide rollers 32 may also act as tensioning rollers for the conveyor belt 12 i . e . guide / tension rollers 32 . the conveyor 10 may also be provided with a wiper roller 46 to wipe excess fluid from the conveyor belt 12 . the conveyor 10 may be further provided with a drive mechanism . one such mechanism may use toothed wheels 48 to impart drive to the conveyor from a drive mechanism 101 ( shown in fig7 ) which does not form part of the present invention . toothed wheels 48 may be provided on the end roller 18 . the conveyor belt 12 is of a form such that fluid can pass therethrough . the conveyor belt 12 shown in the drawings is made of a grid - like mesh of interconnected wire , and readily enables fluid to pass therethrough . fig5 shows how the conveyor belt 12 may be provided with two dips 28 , while in fig6 the conveyor belt 12 has only one dip 28 . thus , any number of dips 28 may be provided depending upon the length of the conveyor 10 and the nature of the items 26 being conveyed . the conveyor 10 of the present invention may be used to convey food items 26 in a cooking apparatus 100 shown in fig7 and 8 . however , the cooking apparatus 100 in its detail does not , itself , form part of the present invention . the conveyor 10 is positioned in a housing 102 of the cooking apparatus 100 such that it conveys food through a cooking chamber 104 . spray nozzles 106 spray cooking fluid into the cooking chamber 104 to cook the food items 26 travelling on the conveyor belt 12 . if desired , only the upper or lower set of spray nozzles 106 may be operated or provided . a pump assembly 108 pumps cooking fluid from a heating cooking fluid collector arrangement 110 to the spray nozzles 106 . the sprayed cooking fluid is returned and reheated and then sprayed again . the food items 26 enter at an inlet end 112 of the housing 102 and leave at an outlet end 114 . the food items 26 may be loaded at the inlet end 112 by a loading sub - conveyor 116 and discharged at the outlet end 214 by a discharge chute 118 , which incorporates a filter 119 . toothed drive wheels or suitably fashioned sprockets 48 may be permantly attached to the end roller 18 . drive may then be imparted to the conveyor through the end roller 18 by locking one end of the end roller 18 into a suitable drive mechanism . in the present embodiment of the invention the end roller 18 has been designed so as to be easily detachable from the drive mechanism 101 by use of a male and female drive coupling 40 &# 39 ;. the drive end of the first end roller 18 is configurated so as to slide out from the drive shaft of the drive mechanism 101 so as to enable the conveyor 10 to be readily removed from the cooking chamber 104 for cleaning and servicing . once the drive is applied to the front end roller 18 , the upper track portion 22 of the conveyor belt 12 then moves in the direction shown by arrow d in fig7 . the food items 26 pass through the cooking chamber 104 on the upper track portion 22 of the conveyor belt 12 and are cooked by the cooking fluid being sprayed from the spray nozzles 108 . when the conveyor belt 12 passes over the guide roller 30 of a dip 28 , any food items 28 at that part of the conveyor belt 12 fall onto the lower level of the conveyor belt 12 adjacent the guide tensioning roller 32 of that dip 28 . the food items 26 then travel in an upwardly inclined manner to the next dip 28 and eventually to the second end part 18 of the conveyor 10 . the provision of the dips 28 means that the food items 26 undergo a tumbling like effect in their passage on the conveyor belt 12 . this causes the orientation of the food items 28 on the conveyor belt 12 to be changed by the dips 28 . this , in turn , provides more even and rapid cooking of the food items 28 since the outer surfaces of the food items are contacted from different angles by the cooking fluid being sprayed from the nozzles 106 . modifications and variations such as would be apparent to a skilled addressee are deemed within the scope of the present invention .	1
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . fig2 a to 2e are cross sectional views representing steps of an exemplary method of fabricating a liquid crystal display according to the present invention . in fig2 a , aluminum ( al ) or copper ( cu ), for example , may be deposited on a lower substrate 1 by a sputtering technique , for example , to form a metal thin film ( not shown ). the metal thin film may be patterned by photolithographic and wet etching processes , for example , to form a gate electrode 3 and a gate pad electrode 14 on the lower substrate 1 . the gate pad electrode 14 may be connected to a gate line gl ( not shown ) through a gate pad line ( described below ) and formed at an angle according to the location of the gate line gl . more specifically , the gate pad electrode 14 and the gate pad line ( described below ) may be formed with a large angle when a gate line is located at an upper or lower part of a panel , and may be formed with a small angle when a gate line is located at , or near a center part of the panel . in fig2 b , a gate insulating film 9 , an active layer , and an ohmic contact layer may be sequentially formed on the lower substrate 1 by a chemical vapor deposition process , for example , to cover the gate pad electrode 14 and the gate electrode 3 . the gate insulating film 9 may be formed by depositing an insulating material of silicon nitride or silicon oxide , for example , and the active layer may be formed of undoped amorphous silicon or polycrystalline silicon , for example . in addition , the ohmic contact layer may be formed of amorphous silicon or polycrystalline silicon , for example , to which n - type or p - type impurities are introduced at high concentration . the ohmic contact layer and the active layer may be patterned by a photolithographic and anisotropic etching processes , for example , to form an ohmic contact layer 17 and an active layer 15 on a portion of the gate insulating film 9 corresponding to the gate electrode 3 . in fig2 c , molybdenum ( mo ) or a molybdenum alloy including mow , mota , and monb , for example , may be deposited on the gate insulating film 9 to cover the ohmic contact layer 17 by chemical vapor deposition or sputtering processed , for example . the deposited metal or metal alloy makes an ohmic contact with the ohmic contact layer 17 . the metal or metal alloy may be patterned by a photolithographic process , thereby forming a source electrode 5 and a drain electrode 7 . in addition , a data pad electrode 24 may be connected to a data line dl ( not shown ) through a data pad line ( described below ), and formed at an angle in accordance with a location of the data line dl ( not shown ). while patterning the source and drain electrodes 5 and 7 , a portion of the ohmic contact layer 17 corresponding to the gate electrode 3 located between the source and drain electrodes 5 and 7 is also patterned , thereby exposing a portion of the active layer 15 that will become a channel . in fig2 d , an inorganic insulating material such as silicon nitride ( sinx ) and silicon oxide , for example , or an organic insulating material , having a small dielectric constant , such as an acrylic organic compound , teflon7 , benzocyclobutene ( bcb ), cytop7 , and perfluorocyclobutane ( pfcb ), for example , may be deposited on the gate insulating layer 9 to cover the gate pad electrode 14 , the data pad electrode 24 , and the source and drain electrodes 5 and 7 , thereby forming a protective layer 21 . the protective layer 21 may be patterned by a photolithographic process , for example , to expose portions of the drain electrode 7 , the gate pad electrode 14 , and the data pad electrode 24 , thereby forming first to third contact holes 19 a , 19 b , and 19 c . in fig2 e , transparent conductive material such as indium - tin - oxide ( ito ), indium - zinc - oxide ( izo ), and indium - tin - zinc - oxide ( itzo ), for example , may be deposited on the protective layer 21 to form a pixel electrode 23 on the protective layer 21 . the pixel electrode 23 may electrically contact the data pad electrode 24 through the first contact hole 19 a , the drain electrode 7 through the second contact hole 19 b , and the gate pad electrode 14 through the third contact hole 19 c . the data pad electrode 24 may be connected to a data line ( not shown ) of a pixel area through a data pad line ( not shown ) contacting the first contact hole 19 a . the gate pad electrode 14 may be connected to the gate line ( not shown ) of the pixel area through a gate pad line ( not shown ) contacting the third contact hole 19 c . fig3 shows an exemplary pad line of a liquid crystal display device according to the present invention for connecting the gate line gl with the gate pad electrode 14 ( in fig2 e ) and the data line dl with the data pad electrode 24 ( in fig2 e ) in the pixel area . in fig3 , a liquid crystal display device may include pixels 32 formed in a pixel area 31 , an angled gate pad part 34 connected with a gate driving circuit 37 for supplying gate signals to the pixels 32 , and an angled gate pad line 38 for connecting the gate pad part 34 to the pixels 32 . the pixels 32 display image data ( a picture ) in response to gate signals supplied from corresponding gate pad lines 38 . a plurality of gate electrode pads 39 may be formed in the gate pad part 34 for supplying the gate signals to a plurality of gate lines gl of the pixel area 31 . the gate electrode pads 39 may be disposed at an edge of the lower substrate 1 corresponding to a location of the gate line gl of the pixel area 31 . specifically , the gate pad electrode 14 and the gate pad line ( not shown ) may be formed at a relatively large angle in a case where a gate line gl is located at an upper or lower part of a display panel , and may be formed at a relatively small angle in a case wherein a gate line gl is located at , or near a center portion of the display panel . consequently , the gate pad part 34 may be connected to a gate tcp 35 through the gate electrode pads 39 . a plurality of gate signal pads ( not shown ) may be formed along a direction corresponding to the gate electrode pads 39 and may electrically contact the gate electrode pads 39 . in other words , the gate signal pads ( not shown ) may be formed at an angle equal to the angle of the gate electrode pads 39 for preventing a short circuit between adjacent gate electrode pads 39 . the gate pad lines 38 connect the gate electrode pads 39 to corresponding pixels 32 for supplying the gate signals through the gate electrode pads 39 of the gate pad part 34 . the gate pad lines 38 may be formed parallel to the direction of the gate electrode pads 39 . thus , the pixels 32 receive the gate signals from the gate driving circuit 37 . in fig3 , the liquid crystal display device may include a data pad part 44 connected to a data driving circuit 47 for supplying data signals to the pixels 32 , and an angled data pad line 48 for connecting the data pad part 44 to the pixels 32 . a plurality of data electrode pads 49 may be formed for supplying the data signals to the data lines dl that are connected to the pixels 32 . the data electrode pads 49 may be formed having different angles according to a location of the data lines dl within the pixel area 31 . specifically , the data electrode pads 49 and the data pad lines 48 may be formed at a relatively large angle in a case where the data lines dl are located at side parts of the display panel , and may be formed at a relatively small angle in a case where the data line dl are located at , or near a center portion of the display panel . accordingly , the data pad part 44 may be connected with a data tcp 45 through the data electrode pads 49 . a plurality of data signal pads ( not shown ) may be formed along a direction corresponding to the data electrode pads 49 at one side of the data tcp 45 and electrically contact the data electrode pads 49 . that is , the data signal pads ( not shown ) may be formed at an angle equal to the angle of the data electrode pads 49 for preventing a short circuit between adjacent data electrode pads 49 . the plurality of data pad lines 48 connect the data electrode pads 49 to corresponding pixels 32 for supplying data signals through the data electrode pads 49 of the data pad part 44 . the data pad lines 48 may be formed parallel to the direction of the data electrode pads 49 . thus , the pixels 32 receive the data signals from the data driving circuit 47 . it will be apparent to those skilled in the art that various modifications and variations can be made in the liquid crystal display device and a fabricating method thereof of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	6
fig2 illustrates an exemplary wireless peer to peer communications system 200 in accordance with an exemplary embodiment . exemplary wireless peer to peer communications system 200 includes a plurality of wireless communications devices ( device 1 202 , device 2 204 , device 3 206 , device 4 208 , device 5 210 , device 6 212 , device 7 214 , . . . , device n 218 . some of the wireless communications devices in system 200 , e . g ., device 5 210 , include an interface 222 , to the internet and / or other network nodes . some of the wireless communications devices in system 200 , e . g ., device 1 202 , device 2 204 , device 3 206 , device 4 208 , device 6 212 , device 7 214 , and device n 218 , are mobile wireless communications devices , e . g ., handheld mobile devices . the communications devices ( 202 , 204 , 206 , 208 , . . . , 218 ) support various signaling between peers , e . g ., peer discovery signals , pilot signals , transmission request signals , etc ., and data transmissions between peers . fig3 is a drawing 300 illustrating exemplary communications resources , e . g ., time - frequency resources , which can be used , for example , to communicate information by one or more devices in the system 200 . consider an exemplary embodiment of a frequency division multiplexing system , e . g ., an ofdm system . in one such system , information may be transmitted in a symbol - by - symbol manner . in one such embodiment during a symbol transmission period , available bandwidth ( frequency ) is divided into a number of tones , each of which can be used to carry information . in fig3 , the horizontal axis 301 represents time and the vertical axis 311 represents frequency . a vertical column represents an ofdm symbol having a duration corresponding to one symbol transmission time period . a plurality of ofdm symbols , e . g ., a first ofdm symbol 312 , second ofdm symbol 314 , and ofdm symbol 320 are shown . each of the ofdm symbols includes multiple tones ( frequencies ) corresponding to a given symbol transmission time period . the ofdm symbol transmission time period identified by reference number corresponds to the time used to transmit one ofdm symbol . in some embodiments , an ofdm symbol includes 113 tones . however different embodiments use other number of tones . each small box 360 represents a tone - symbol , which is the air link resource of a single tone over a symbol transmission time period . each of the individual tone - symbols 360 is a communications resource and has a frequency and time period associated with it as should be appreciated from the figure . communications devices communicate with each other using one or more communications resources , e . g ., the tone - symbols . in an exemplary peer to peer communications system such as system 200 , a pair of peer to peer communications devices which seeks to communicate , monitors communications resources to determine which resources the devices can use for communications purposes , e . g ., frequencies not being used by other devices . during the establishment of a communications session , the pair of communications devices agrees on one or more tone - symbols which the communications devices may use for transmitting and receiving information . thus after determining , the peer communications devices which seek to communicate are aware of the selected tone - symbols or frequencies that they will use for transmitting and / or receiving information from each other . in accordance with one aspect , a communications device 202 determines a first set of frequency pairs in a first ofdm symbol to use simultaneously for transmission purposes , the first set of frequency pairs including a first tone at a first frequency and a second tone at a second frequency which is an image frequency of said first frequency . said determination may be based on the connection identifier corresponding to the connection between the two peers or the device identifier corresponding to a peer . a pair of peer communications devices ( e . g ., devices 202 , 204 ) which seek to communicate may get the same connection identifier , and thus such a pair of communications devices would know the frequency pairs on which to transmit or receive form each other . in some other embodiments device 1 202 determines the set of frequency pairs to use simultaneously for transmission , and communicate the identification information regarding the determined set of frequency pairs to the device 2 204 so that the peer device 2 204 may know where to receive the information transmitted by peer device 1 202 . fig4 is used to explain how communications resources , e . g ., ofdm tone - symbols , form different frequency pairs . fig4 illustrates an exemplary ofdm symbol , e . g ., first ofdm symbol 400 , and distribution of communications resources therein , e . g ., distribution of individual tone - symbols , included in the exemplary ofdm symbol 400 . although in the fig4 example , ofdm symbol 400 is discussed as a first ofdm symbol , it should be appreciated that the ofdm symbol 400 can be any one of the ofdm symbols 312 , 314 , . . . , 320 , shown in fig3 . as shown in fig4 , the ofdm symbol 400 includes 113 tone - symbols , e . g ., 1 st tone - symbol 402 , . . . , 113 th tone symbol 452 . in accordance with one aspect , a frequency pair corresponds to a pair of tone - symbols or tones . a pair of tones include a first tone at first frequency , e . g ., fc + f 1 , and another tone at its image frequency , e . g ., fc − f 1 , where fc is the carrier signal frequency used to modulate a baseband tone , e . g ., f 1 , and thus producing a tone at frequency fc + f 1 . for example , the ofdm symbol 400 includes a first set of frequency pairs 460 , where the first set includes frequency pair ( fc + f 1 , and fc − f 1 ). in accordance with one feature of an exemplary embodiment , a communication device can determine a set of frequency pairs such as the first set frequency pairs 460 in the ofdm symbol 400 , to use simultaneously for transmission purposes . in fig4 cross hatching is used to indicate frequency pairs included in the first set of frequency pairs 460 . the remaining tone - symbols in the ofdm symbol 400 are not shaded / cross hatched to distinguish them from tone - symbols corresponding to the frequency pairs in the first set 460 . although in fig4 example , the first set of frequency pairs 460 is shown to include a single tone - symbol pair which forms the frequency pair ( fc + f 1 , and fc − f 1 ) for simplifying the illustration , it should however be appreciated that the first set of frequency pairs 460 may include a plurality of frequency pairs in some embodiments . fig5 shows another example illustrating an exemplary ofdm symbol 500 , e . g ., a second ofdm symbol , and arrangement of communications resources therein , in accordance with an exemplary embodiment . although in the fig5 example , ofdm symbol 500 is discussed as a second ofdm symbol , it should be appreciated that the ofdm - symbol 500 can be any one of the ofdm symbols 312 , 314 , . . . , 320 , shown in fig3 . as shown in fig5 , the exemplary second ofdm symbol 500 includes a plurality of individual tone - symbols . as illustrated , the second ofdm symbol 500 includes 113 tone - symbols , e . g ., 1 st tone - symbol 502 , . . . , 113 th tone symbol 552 . in the fig5 example , a set of frequency pairs , e . g ., second set of frequency pairs 560 , includes a plurality of tone - symbol pairs , e . g ., 3 frequency pairs . the second set of frequency pairs 560 includes a first , a second and a third frequency pair . the first frequency pair having a tone at frequency fc + f 1 and another tone at its image frequency fc − f 1 , the second frequency pair having a tone at frequency fc + f 2 and another tone at its image frequency fc − f 2 , and the third frequency pair in the second set having a third tone at a third frequency fc + f 3 and a fourth tone at a fourth frequency fc − f 3 which is an image frequency of the third frequency . thus , it should be appreciated that in some embodiments a set of frequency pairs such as second set of frequency pairs 560 can include multiple frequency pairs . it should be further appreciated that in some embodiments a single device determines the frequency pairs included in the second set of frequency pairs 560 to use simultaneously for communications purposes , e . g ., for transmitting information to or receiving from a communications peer in a peer to peer communications session . fig6 is a flowchart 600 illustrating the steps of an exemplary method of operating a wireless communications device , e . g ., a peer to peer mobile node , in accordance with various exemplary embodiments . although the exemplary wireless communications device could be , e . g ., any of the wireless communications devices of peer to peer wireless communications system 200 of fig2 , however for the purpose of illustration , it is assumed that the wireless communications device is device 1 202 . one or more of the steps in flowchart 600 , indicated by dashed lines , are optional and are performed in some embodiments , while skipped in other embodiments . the exemplary method of flowchart 600 includes determining frequency pairs in an ofdm symbol for use in communications . operation of the exemplary method starts in step 602 , where the wireless communications device is powered on and initialized . operation proceeds from start step 602 to step 604 . in step 604 the wireless communications device determines a first set of frequency pairs , e . g ., first set 460 , in a first ofdm symbol to use simultaneously for transmission purposes , said first set of frequency pairs including a first tone at a first frequency , e . g ., fc + f 1 , and a second tone at a second frequency , e . g ., fc − f 1 , which is an image frequency of said first frequency . determining the first set of communications resources , i . e ., the frequency pairs , is normally performed as part of a communications establishment session where one or more communications devices monitor communications resources and identify resources which are least affected by interference or noise , for use in communications . some interference mitigation mechanism and at some level of coordination may be employed in the system to reduce the possibility of two different transmitting devices selecting the same sets of frequencies at the same time . in some embodiments during the communications establishment session the communicating peer devices ( communications peers ) determine and agree on the frequency pairs to be used for communications purposes , e . g ., before starting to transmit or receive . in some other embodiments , the communications device 202 communicates information indicating the determined first set of frequency pairs 460 to be used by device 202 simultaneously for transmission , to a communications peer with which the device 202 seeks to communicate . the information indicating the frequency pairs may be , e . g ., resource identifiers corresponding to the determined frequency pairs . operation proceeds from step 604 to step 606 . in step 606 the wireless communications device 202 transmits information , e . g ., to a communications peer such as communications device 204 , in the first ofdm symbol 400 using only the determined first set of frequency pairs 460 . operation proceeds from step 606 to step 608 . in step 608 the communications device 202 determines a second set of frequency pairs in a second ofdm symbol , e . g ., second set 560 , to use simultaneously for transmitting to or receiving information from a communications peer in a peer to peer communications session , said second set of frequency pairs including a third tone at a third frequency and a fourth tone at a fourth frequency which is an image frequency of said third frequency . in some embodiments step 608 includes step 610 which is performed when tone hopping is implemented . in step 610 , a tone hopping function is used to determine the second set of frequency pairs 560 in the second ofdm symbol 500 . the tone hopping function is , e . g ., a predetermined pattern , known to the communications devices in the system 200 . thus when tone hopping is implemented , the devices in system 200 can determine , using the tone hopping function , how the tones are being hopped from one ofdm symbol to another ofdm symbol . in some embodiments the third tone at a third frequency is same as the first tone at the first frequency , and the fourth frequency is same as the second frequency , but in a different ofdm symbol , e . g ., the second ofdm symbol . however in some embodiments the third tone at a third frequency is different from the first tone at the first frequency , and the fourth frequency is different from the second frequency . this may occur for example , when tone hopping is implemented and the first tone in the first ofdm symbol 400 is hopped to a third tone at third frequency in the second ofdm symbol , and the second tone in the first ofdm symbol 400 is hopped to a fourth tone at the fourth frequency in the second ofdm symbol . operation proceeds from step 608 which includes step 610 , to step 612 . in step 612 the communications device 202 transmits or receives information in the second ofdm symbol . step 612 includes steps 614 , 616 and 618 , at least one of which is performed depending on the embodiment , as part of performing the step 612 . thus in some embodiments the communications device 202 , in step 614 transmits information in the second ofdm symbol , said information being communicated only on the determined second set of frequency pairs . in some embodiments when step 616 is performed , the device 202 receives information in the second ofdm symbol , said information being communicated only on the determined second set of frequency pairs , e . g ., from a peer communications device . alternatively in some embodiments step 618 is performed wherein the device 202 receives information in the second ofdm symbol , transmitted by a communications peer , the second ofdm symbol including said information only on the determined first set of frequency pairs . for example , step 618 may be performed e . g ., when tone hopping is not implemented , and the device 202 receives information on the determined first set of frequency pairs occurring in the second ofdm symbol . operation proceeds from step 612 back to step 604 . while steps 608 and step 612 are shown in the fig6 embodiment , these steps may not be used in other embodiments and can therefore be considered optional in at least some embodiments . fig7 illustrates an exemplary wireless communications device 700 , in accordance with an exemplary embodiment . exemplary wireless communications device 700 is , e . g ., one of the wireless communications devices of fig2 . exemplary communications device 700 may be , and in at least one embodiment is , a mobile wireless terminal supporting peer to peer communications and implementing a method in accordance with flowchart 600 of fig6 . wireless communications device 700 includes a processor 702 and memory 704 coupled together via a bus 709 over which the various elements ( 702 , 704 ) may exchange data and information . communications device 700 further includes an input module 706 and an output module 708 which may be coupled to processor 702 as shown . however , in some embodiments , the input module 706 and output module 708 are located internal to the processor 702 . input module 706 can receive input signals . input module 706 can , and in some embodiments does , include a wireless receiver and / or a wired or optical input interface for receiving input . output module 708 may include , and in some embodiments does include , a wireless transmitter and / or a wired or optical output interface for transmitting output . processor 702 is configured to determine a first set of frequency pairs in a first ofdm symbol to use simultaneously for transmission purposes , said first set of frequency pairs including a first tone at a first frequency and a second tone at a second frequency which is an image frequency of said first frequency , and transmit information in said first ofdm symbol using only said determined first set of frequency pairs . in various embodiments the processor 702 is further configured to receive information in a second ofdm symbol transmitted by a communications peer , said second ofdm symbol including said information only on said first set of frequency pairs . the processor 702 is further configured to determine a second set of frequency pairs in a second ofdm symbol to use simultaneously for receiving information from a communications peer in a peer to peer communications session , said second set of frequency pairs including a third tone at a third frequency and a fourth tone at a fourth frequency which is an image frequency of said third frequency , and receive information in said second ofdm symbol , said information being communicated only on said determined second set of frequency pairs . in some embodiments the processor 702 is further configured to use a tone hopping function to determine said second set of frequency pairs . the tone hopping function is , e . g ., a predetermined pattern , known to the communications devices in the system 200 . the processor 702 in various embodiments is configured to determine a second set of frequency pairs in a second ofdm symbol to use simultaneously for transmitting information to a communications peer in a peer to peer communications session , the second set of frequency pairs including a third tone at a third frequency and a fourth tone at a fourth frequency which is an image frequency of said third frequency , and transmit information in said second ofdm symbol , said information being communicated only on said determined second set of frequency pairs . in some such embodiments the processor 702 is further configured to use a tone hopping function to determine said second set of frequency pairs . fig8 illustrates an assembly of modules 800 which can , and in some embodiments is , used in the communications device 700 illustrated in fig7 . the modules in the assembly 800 can be implemented in hardware within the processor 702 of fig7 , e . g ., as individual circuits . alternatively , the modules may be implemented in software and stored in the memory 704 of the wireless terminal 700 shown in fig7 . while shown in the fig7 embodiment as a single processor , e . g ., computer , it should be appreciated that the processor 702 may be implemented as one or more processors , e . g ., computers . when implemented in software the modules include code , which when executed by the processor , configure the processor , e . g ., computer , 702 to implement the function corresponding to the module . in some embodiments , processor 702 is configured to implement each of the modules of the assembly of modules 800 . in embodiments where the assembly of modules 800 is stored in the memory 704 , the memory 704 is a computer program product comprising a computer readable medium comprising code , e . g ., individual code for each module , for causing at least one computer , e . g ., processor 702 , to implement the functions to which the modules correspond . completely hardware based or completely software based modules may be used . however , it should be appreciated that any combination of software and hardware ( e . g ., circuit implemented ) modules may be used to implement the functions . as should be appreciated , the modules illustrated in fig8 control and / or configure the wireless terminal 700 or elements therein such as the processor 702 , to perform the functions of the corresponding steps illustrated and / or described in the method of flowchart 600 of fig6 . the assembly of modules 800 includes a module corresponding to each step of the method of flowchart 600 shown in fig6 . the module in fig8 which performs or controls the processor 702 to perform a corresponding step shown in flowchart 600 is identified with a number beginning with an 8 instead of beginning with 6 . for example module 804 corresponds to step 604 and is responsible for performing the operation described with regard to step 604 . assembly of modules 800 includes a module 804 for determining a first set of frequency pairs in a first ofdm symbol , e . g ., first set 460 , to use simultaneously for transmission purposes , said first set of frequency pairs including a first tone at a first frequency and a second tone at a second frequency which is an image frequency of said first frequency , a module 806 for transmitting information in said first ofdm symbol using only said determined first set of frequency pairs . the assembly of modules 800 further includes a module 808 for determining a second set of frequency pairs in a second ofdm symbol to use simultaneously for transmitting to or receiving information from , a communications peer in a peer to peer communications session , said second set of frequency pairs including a third tone at a third frequency and a fourth tone at a fourth frequency which is an image frequency of said third frequency . in some embodiments the module 808 further includes a module 810 for using a tone hopping function to determine the second set of frequency pairs . in some embodiments the information regarding the tone hopping function may be , e . g ., stored in the memory of the communications device 700 . the assembly of modules 800 further includes a module 812 for transmitting or receiving information in the second ofdm symbol . the module 812 can be implemented , e . g ., as a transceiver module . the module 812 includes a module 814 for transmitting information in the second ofdm symbol , said information being communicated only on the determined second set of frequency pairs , a module 816 for receiving information in the second ofdm symbol , said information being communicated only on the determined second set of frequency pairs , and a module 818 for receiving information in the second ofdm symbol , transmitted by a peer communications device , said second ofdm symbol including said information only on said determined first set of frequency pairs . the modules shown in dashed line boxes , e . g ., modules 814 , 816 , 818 , are optional , and thus one or more of these modules may be present in some embodiments while not in others . the dashed boxes indicate that although these modules are included in the assembly of modules 800 in various embodiments , the processor 702 may execute such an optional module in embodiments where the step to which these modules correspond , is performed . in some embodiments , one or more modules shown in fig8 which are included within another module may be implemented as an independent module or modules . fig9 is a drawing 900 illustrating an exemplary ofdm channel represented as a time frequency grid , including time - frequency resources , where the tone hopping is implemented , in accordance with a tone hopping function . as shown horizontal axis 901 represents time and the vertical axis 911 represents frequency . each vertical column represents an ofdm symbol having a duration corresponding to one symbol transmission time period . as discussed with regard to fig3 example , during a symbol transmission period , available bandwidth ( frequency ) is divided into a number of tones ( each small box represents a tone - symbol ), each of which can be used to carry information . in accordance with various embodiments a device determines a first set of frequency pairs 950 ( tone - symbol pairs ) in a first ofdm symbol , e . g ., symbol 912 , to use simultaneously for transmission purposes , said first set of frequency pairs including a first tone at a first frequency and a second tone at a second frequency which is an image frequency of said first frequency . when frequency hopping is used in the system , in accordance with various embodiments , a determined set of frequency pairs hops with time from symbol to symbol . thus in some such embodiments , to determine a second set of frequency pairs in a second ofdm symbol , e . g ., second set 960 in ofdm symbol 916 , to use simultaneously for transmitting to or receiving information from a communications peer in a peer to peer communications session , the device uses a tone hopping function to determine said second set of frequency pairs 960 . the second set of frequency pairs 960 includes a third tone at a third frequency and a fourth tone at a fourth frequency which is an image frequency of said third frequency . in some embodiments the tone hopping function is known to the devices in the system 200 . it should be appreciated that the frequency hopping pattern shown in the fig9 is just exemplary , and various other variations of the frequency hopping pattern according to different frequency hopping functions being used , are possible . in accordance with various features , in a communications system such as system 200 where devices identify and use available frequency resources for communications purposes , the following measures , in some embodiments , are taken : 1 . when a band of frequencies are selected by a communications device for user , a tone and its image tone are selected together by the same communications device . 2 . in a frequency hopped system where the frequency is hopped with time , the image frequency is also synchronously hopped with the original tone . the techniques of various embodiments may be implemented using software , hardware and / or a combination of software and hardware . various embodiments are directed to apparatus , e . g ., mobile nodes such as mobile terminals , base stations , communications system . various embodiments are also directed to methods , e . g ., method of controlling and / or operating mobile nodes , base stations and / or communications systems , e . g ., hosts . various embodiments are also directed to machine , e . g ., computer , readable medium , e . g ., rom , ram , cds , hard discs , etc ., which include machine readable instructions for controlling a machine to implement one or more steps of a method . it is understood that the specific order or hierarchy of steps in the processes disclosed is an example of exemplary approaches . based upon design preferences , it is understood that the specific order or hierarchy of steps in the processes may be rearranged while remaining within the scope of the present disclosure . the accompanying method claims present elements of the various steps in a sample order , and are not meant to be limited to the specific order or hierarchy presented . in various embodiments nodes described herein are implemented using one or more modules to perform the steps corresponding to one or more methods , for example , frequency pair determination , signal transmission and / or reception steps . thus , in some embodiments various features are implemented using modules . such modules may be implemented using software , hardware or a combination of software and hardware . many of the above described methods or method steps can be implemented using machine executable instructions , such as software , included in a machine readable medium such as a memory device , e . g ., ram , floppy disk , etc . to control a machine , e . g ., general purpose computer with or without additional hardware , to implement all or portions of the above described methods , e . g ., in one or more nodes . accordingly , among other things , various embodiments are directed to a machine - readable medium including machine executable instructions for causing a machine , e . g ., processor and associated hardware , to perform one or more of the steps of the above - described method ( s ). some embodiments are directed to a device , e . g ., communications node , including a processor configured to implement one , multiple or all of the steps of one or more exemplary methods . in some embodiments , the processor or processors , e . g ., cpus , of one or more devices , e . g ., communications nodes such as access nodes and / or wireless terminals , are configured to perform the steps of the methods described as being performed by the communications nodes . the configuration of the processor may be achieved by using one or more modules , e . g ., software modules , to control processor configuration and / or by including hardware in the processor , e . g ., hardware modules , to perform the recited steps and / or control processor configuration . accordingly , some but not all embodiments are directed to a device , e . g ., communications node , with a processor which includes a module corresponding to each of the steps of the various described methods performed by the device in which the processor is included . in some but not all embodiments a device , e . g ., communications node , includes a module corresponding to each of the steps of the various described methods performed by the device in which the processor is included . the modules may be implemented using software and / or hardware . some embodiments are directed to a computer program product comprising a computer - readable medium , e . g ., a non - transitory computer - readable medium , comprising code for causing a computer , or multiple computers , to implement various functions , steps , acts and / or operations , e . g . one or more steps described above . depending on the embodiment , the computer program product can , and sometimes does , include different code for each step to be performed . thus , the computer program product may , and sometimes does , include code for each individual step of a method , e . g ., a method of controlling a communications device or node . the code may be in the form of machine , e . g ., computer , executable instructions stored on a computer - readable medium such as a ram ( random access memory ), rom ( read only memory ) or other type of storage device . in addition to being directed to a computer program product , some embodiments are directed to a processor configured to implement one or more of the various functions , steps , acts and / or operations of one or more methods described above . accordingly , some embodiments are directed to a processor , e . g ., cpu , configured to implement some or all of the steps of the methods described herein . the processor may be for use in , e . g ., a communications device or other device described in the present application . while described in the context of an ofdm system , at least some of the methods and apparatus of various embodiments are applicable to a wide range of communications systems including many non - ofdm and / or non - cellular systems . numerous additional variations on the methods and apparatus of the various embodiments described above will be apparent to those skilled in the art in view of the above description . such variations are to be considered within the scope . the methods and apparatus may be , and in various embodiments are , used with cdma , orthogonal frequency division multiplexing ( ofdm ), and / or various other types of communications techniques which may be used to provide wireless communications links between communications devices . in some embodiments one or more communications devices are implemented as access points which establish communications links with mobile nodes using ofdm and / or cdma and / or may provide connectivity to the internet or another network via a wired or wireless communications link . in various embodiments the mobile nodes are implemented as notebook computers , personal data assistants ( pdas ), or other portable devices including receiver / transmitter circuits and logic and / or routines , for implementing the methods .	7
an illustrative carton blank - 00 constructed in accordance with this invention is shown in plan view in fig1 . the surface of the blank shown in fig1 includes what will be the outer surface of the finished carton . blank 100 includes the following panels side by side in order : left side outer panel a , front outer panel b , right side outer panel c , rear outer panel d , left side innerframe panel e , front innerframe panel f , and right side innerframe panel g . the boundaries between these panels are as follows : between panels a and b , score line 3 ; between panels b and c , score line 8 ; between panels c and d , score line 11 ; between panels d and e , score line 13 ; between panels e and f , perforation line 14 and a small retention cut 26 ; and between panels f and g , perforation line 15 and a small retention cut 27 . panels a , b , and c are subdivided by cuts 16 , 17 , and 22 , respectively . small connections are left across these cuts so that panels a - c do not actually subdivide until the consumer intentionally breaks these connections in order to open the carton as described in more detail below . in particular , one such small connection 40a is preferably left at the extreme left - hand edge of the blank , and other such connections 40b and 40c are preferably left adjacent score lines 3 and 8 , respectively . still other such connections may be left elsewhere along lines 16 , 17 , 22 , and 23 as required and / or desired . panel d is subdivided by short cuts 23 and 24 and longer score line 13 . cuts 23 and 24 may be eliminated if desired and score line 12 extended in their stead . panel e is subdivided by cut 25 . one or more small connections are preferably left across cut 25 for the same reason described above in relation to cuts 16 , 17 , and 22 . in particular , one such small connection 40d is preferably left at the extreme right - hand end of cut 25 . it will be noted that elements 16 , 17 , 22 , 23 , 12 , 24 , and 25 form one substantially continuous ( although not straight ) line . bottom flap panels a2 and c2 extend down from side panels a and c , respectively , and top flap panels a1 and c1 similarly extend up from side panels a and c , respectively . bottom cover panel b3 and bottom cover tuck flap panel b4 extend down from front panel b , and top cover panel b2 and top cover tuck flap panel b1 similarly extend up from front panel b . the boundaries between these panels are as follows : between panels a and a1 , score line 1 ; between panels a and a2 , score line 2 ; between panels b and b2 , score line 5 ; between panels b2 and b1 , short end cuts 18 and 19 separated by longer central score line 4 ; between panels b and b3 , score line 6 ; between panels b3 and b4 , short end cuts 20 and 21 separated by longer central score line 7 ; between panels c and c1 , score line 9 ; and between panels c and c2 , score line 10 . panels al , b2 , c1 , a2 , b3 , and c2 are not directly connected to one another . score lines 1 and 2 and score lines 9 and 10 are slightly closer together than score lines 5 and 6 because flaps a1 , c1 , a2 , and c2 must be folded inside the covers b2 and b3 in the finished carton . cuts 18 and 19 are slightly farther than score line 4 from score line 5 so that when panel b1 is tucked inside the carton , the edges of panel b1 adjacent those cuts tend latch under edges 50 of panels a1 and c1 , thereby helping to hold the top cover closed . cuts 20 and 21 are similarly farther than score line 7 from score line 6 so that when panel b4 is tucked inside the carton , the edges of panel b3 adjacent those cuts tend to latch under edges 50 of panels a2 and c2 , thereby helping to hold the bottom cover closed . the top edge of panel f includes a recess so that the visible top of the innerframe in the finished carton generally resembles the visible portion of the innerframe in a conventional hinge lid cigarette box . the bottom edges of panels e - g are slightly recessed because these panels will be inside other panels in the finished carton and should not interfere with the clean folding of panels a2 , b3 , and c2 . although the blank of fig1 can be made up into a carton in other ways , a particularly preferred method is shown in fig2 . in step 202 panel g is folded ( along perforation line 15 ) against the inside surface of panel f . ( as was mentioned above , the surface of the blank shown in fig1 is the outer surface . the surface of the blank which is not visible in fig1 is the inside surface .) in step 204 panels e - g are folded ( along score line 13 ) against the inside surface of panels c and d . this places the outer surface of panel g in contact and left - right registration with panel c . in step 206 the contacting surfaces of panels c and g are secured together ( e . g ., by glue which has been previously applied to one or both of these surfaces ). this glue should not extend above line 22 . in step 208 panels c - g are folded ( along score line 8 ) against the inside surface of panels a and b . this places the outer surface of panel e in contact and left - right registration with the inside surface of panel a . in step 210 the contacting surfaces of panels a and e are secured together ( e . g ., by glue which has been previously applied to one or both of these surfaces ). this securing should be such that no part of panel e below cut 25 is secured to any part of panel a above cut 16 . however , the portion of panel e above cut 25 should be secured to the portion of panel a above cut 16 . this completes a first phase of the assembly of the carton . at the end of this phase , the carton is substantially flat , which is convenient for storage and / or shipment . the second phase of carton set up begins with step 220 . in this step the carton is opened up from its flattened condition to a hollow , right parallel - piped . because panels e and g are respectively secured to panels a and c , the innerframe automatically &# 34 ; pops up &# 34 ; into the correct location in the carton when it is opened up in step 220 ( i . e ., panels e - g remain in place in contact with panels a - c , respectively ). this facilitates loading and completion of the carton because the innerframe does not have to be separately handled at this point to ensure that it is in the proper position . in step 222 either the top or bottom of the carton is closed . this is accomplished by folding either flaps a1 and c1 or flaps a2 and c2 inwardly 90 ° relative to panels a and c , and folding panel b2 or b3 over those flaps . tuck flap b1 or b4 is then tucked inside rear wall d of the carton . the edges of the tuck flap beyond cuts 18 and 19 or 20 and 21 engage under flaps a1 and c1 or a2 and c2 adjacent their edges 50 in order to interlock with those flaps , thereby holding cover panel b2 or b3 securely closed . in step 224 the carton is filled with cigarette packs via the top or bottom , whichever was not closed in step 222 . in the depicted preferred embodiment , the carton is sized to hold five cigarette packs ( 20 cigarettes to a pack ) stacked back to front on top of one another from the bottom of the carton to the top . in step 226 the carton is finished by closing the top or bottom through which the carton was filled in step 224 . step 226 is therefore substantially the same as step 222 , but is performed on the other end of the carton . fig3 shows the finished carton 102 before it has been opened for the first time by the consumer . note that steps 222 through 226 can be performed either manually or by machine , although the carton of this invention is particularly well suited to performance of these steps by hand . the fact that the innerframe automatically pops up into the correct position in step 220 as described above facilitates manual handling of the carton at this point . similarly , the use of top and bottom covers with tuck flaps b1 and b4 facilitates manual closing , loading , and finishing of the carton . no glue is required to close and finish the carton . if desired , finishing ( and especially manual finishing ) of carton 102 can be further facilitated in accordance with the principles of this invention by modifying some or all of flaps a1 , a2 , c1 , and c2 as shown , for example , in fig4 and 5 . as shown in fig4 flap a1 has an extension 52 which extends to the left from the left - hand edge of panel a . this shifts the edge 50 of panel a1 slightly to the left as viewed in fig4 . the corresponding edge 50 of panel c1 is also shifted slightly to the left by recessing panel c1 away from the axis of score line 11 in the vicinity of edge 50 . accordingly , when the carton is made up and flaps a1 and c1 are folded in as shown in fig5 edge 50 of flap a1 tends to be substantially closer to rear panel d than edge 50 of flap c2 is to rear panel d . the relatively wide spacing between edge 50 of flap c1 and rear wall d facilitates insertion of tuck flap b1 into the carton inside rear wall d . the smaller spacing between edge 50 of flap a1 and rear wall d ensures that tuck flap b1 will be securely latched under that portion of flap a1 . the extension of flap a1 in this manner also helps to ensure that such latching will take place despite variation in where the extreme left edge of panel a occurs relative to score line 13 when the carton is made up . of course , the spacing between edge 50 of flap c1 and rear wall d is preferably not so great that tuck flap b1 does not also tend to latch under that portion of flap c1 . although only flaps a1 and c1 are shown in fig4 and 5 , it will be understood that flaps a2 and c2 can be modified in the same way if desired . similarly , although flap a1 is shown with extension 52 while flap c1 is recessed , it will be understood that these features could be reversed , with flap c1 extended to the right adjacent its edge 50 while flap a1 is recessed to the right adjacent its edge 50 . although fig2 shows a particularly preferred method of folding the blank of fig1 to form a carton , it will be understood that the carton can be made in other ways if desired . for example , the blank can be folded around a stack of cigarette packs so that it is already filled when made up . similarly , the top and bottom closure panels can be different from those shown in the drawings . for example , simple panels which are folded over and glued together can be substituted if it is not desired to use the tuck flap and latching principle . when the consumer wants to open carton 102 for the first time , he or she breaks the small connections 40 across lines 16 , 17 , and 22 . the lid portion above these lines can then be pivoted up and to the rear along score line 12 as shown in fig6 a and 6b in order to remove a cigarette pack from the carton . the portions of innerframe panels e - g which project above outer member panels a - c interfere somewhat with this pivoting of the lid , thereby helping to keep the lid closed when it is subsequently pivoted back to the closed position . the slightly outwardly projecting edges adjacent cuts 26 and 27 also help to keep the lid completely and neatly closed . these are functions similar to those performed by innerframes in known hinge lid cigarette packs . the recess in the top of panel f also helps make the innerframe in carton 102 resemble the innerframe in conventional hinge lid cigarette packs . fig7 and 8 show an alternative embodiment in which innerframe panels e - g include lower subpanels e1 , f1 , f2 , f3 , and g1 which can be folded out into the interior of the carton to take up some of the space in the carton in the event that all of that space is not needed . ( the features shown in fig4 and 5 can , of course , be included in this alternative embodiment if desired .) blank 104 ( fig7 ) can be similar to blank 100 ( fig1 ) except for the provision of these innerframe subpanels as will now be described in detail . subpanels e1 , f1 , f2 , f3 , and g1 are separated from the portions of innerframe panels e - g above them by cut 60 . subpanel e1 is connected to panel e on the left by perforation line 61 . perforation line 14 connects subpanel e1 to subpanel f1 . perforation line 63 connects subpanel f1 to subpanel f2 . perforation line 64 connects subpanel f2 to subpanel f3 . perforation line 15 connects subpanel f3 to subpanel g1 . and subpanel g1 is connected to panel g on the right by perforation line 66 . the bottom of blank 104 is recessed near the lower ends of perforation lines 63 and 64 . blank 104 can be made up into a carton 106 ( fig8 ) in substantially the same way that blank 100 is made up into carton 102 . at any convenient time , however , subpanels e1 and g1 are folded in along perforation lines 61 and 66 relative to panels e and g . this allows subpanels f1 - f3 to move well into the interior of the lower portion of the carton as shown in fig8 . perforation lines 63 and 64 allow these subpanels to fold relative to one another as necessary to traverse the bottom of the carton . when deployed into the interior of the carton in this way , subpanels e1 , f1 , f2 , f3 , and g1 fill up the space in the carton below cut 60 and support cigarette packs above the level of that cut , thereby allowing the carton to be filled with fewer cigarette packs than would otherwise be required to fill the carton if these subpanels were not so deployed . it will be understood that the foregoing is merely illustrative of the principles of this invention , and that various modifications can be made by those skilled in the art without departing from the scope and spirit of the invention . for example , the size of the carton can be modified so that it can hold any number of cigarette packs of any size . as another example , the amount of space taken up by subpanels e1 , f1 , f2 , f3 , and g1 can be altered by changing the vertical location of cut 60 . as still another example of possible modifications , the innerframe panels could extend to the left ( rather than from the right ) of the outer member panels as viewed in fig1 . ( the left - right order of the outer member panels would then also have to be reversed .) the top and bottom closure panels ( e . g ., a1 , b2 , and c1 ) do not have to be connected to panels a - c as shown in the drawings , but could be connected to others of the side by side adjacent panels if desired .	8
the following detailed description refers to the accompanying drawings that illustrate example embodiments of the present invention . however , the scope of the present invention is not limited to these embodiments , but is instead defined by the appended claims . thus , embodiments beyond those shown in the accompanying drawings , such as modified versions of the illustrated embodiments , may nevertheless be encompassed by the present invention . references in the specification to “ one embodiment ,” “ an embodiment ,” “ an example embodiment ,” or the like , indicate that the embodiment described may include a particular feature , structure , or characteristic , but every embodiment may not necessarily include the particular feature , structure , or characteristic . moreover , such phrases are not necessarily referring to the same embodiment . furthermore , when a particular feature , structure , or characteristic is described in connection with an embodiment , it is submitted that it is within the knowledge of one skilled in the art to implement such feature , structure , or characteristic in connection with other embodiments whether or not explicitly described . various approaches are described herein for , among other things , increasing efficiency of wireless power transfer . the efficiency of a wireless power transfer is defined as the magnitude of power that is consumed by a portable electronic device with respect to the wireless power transfer divided by the magnitude of power that is provided to the portable electronic device with respect to the wireless power transfer . the efficiency of the wireless power transfer therefore indicates the proportion of the power that is wirelessly transferred to the portable electronic device that is consumed by the portable electronic device . for example , a charging station may begin to wirelessly transfer power to a portable electronic device via a wireless power link . the portable electronic device may be configured to send an indicator to the charging station via a wireless communication link once the charging station begins to wirelessly transfer the power to the portable electronic device . the indicator specifies information regarding the portable electronic device , which may include but is not limited to a resonant frequency of the portable electronic device , a magnitude of power requested by the portable electronic device , a magnitude of power consumed by the portable electronic power with respect to the wireless power transfer , a maximum safe power that the portable electronic device is capable of consuming without substantial risk of damaging the portable electronic device , a position of the portable electronic device , etc . the charging station may be configured to increase the efficiency of the wireless transfer of the power based on the indicator . a method is described for increasing efficiency of wireless power transfer . in accordance with this method , a wireless power transfer is initiated from a charging station to a portable electronic device via a wireless power link . parameter ( s ) regarding the portable electronic device are received at the charging station via a wireless communication link in response to initiation of the wireless power transfer . efficiency of the wireless power transfer is increased based on the parameter ( s ). another method is described for increasing efficiency of wireless power transfer . in accordance with this method , power is wirelessly transferred to a portable electronic device via a wireless power link . parameter ( s ) received via a wireless communication link regarding the portable electronic device with respect to the wireless transfer of the power are analyzed . efficiency with respect to the wireless transfer of the power is increased based on analysis of the parameter ( s ). yet another method is described for increasing efficiency of wireless power transfer . in accordance with this method , power is wirelessly received for a first period of time at a portable electronic device from a charging station via a wireless power link having a first transmission efficiency . parameter ( s ) regarding the portable electronic device with respect to receipt of the power during the first period of time are provided to the charging station via a wireless communication link . power is wirelessly received for a second period of time at the portable electronic device from the charging station via the wireless power link having a second transmission efficiency in response to providing the parameter ( s ) to the charging station . the second transmission efficiency is greater than the first transmission efficiency . a system is described that includes a wireless power transfer module , a parameter receipt module , and an efficiency improvement module . the wireless power transfer module is configured to initiate a wireless power transfer to a portable electronic device via a wireless power link . a parameter receipt module is configured to receive parameter ( s ) regarding the portable electronic device via a wireless communication link in response to initiation of the wireless power transfer . an efficiency improvement module is configured to increase efficiency of the wireless power transfer based on the parameter ( s ). another system is described that includes a wireless power transfer module , a parameter analysis module , and an efficiency improvement module . the wireless power transfer module is configured to wirelessly transfer power to a portable electronic device via a wireless power link . the parameter analysis module is configured to analyze parameter ( s ) received via a wireless communication link regarding the portable electronic device with respect to the wireless transfer of the power . the efficiency improvement module is configured to increase efficiency with respect to the wireless transfer of the power based on analysis of the parameter ( s ). yet another system is described that includes a wireless power receipt module and a parameter module . the wireless power receipt module is configured to wirelessly receive power for a first period of time from a charging station via a wireless power link having a first transmission efficiency . the parameter module is configured to provide parameter ( s ) regarding the system with respect to receipt of the power during the first period of time to the charging station via a wireless communication link . the wireless power receipt module is further configured to wirelessly receive power for a second period of time from the charging station via the wireless power link having a second transmission efficiency in response to providing the parameter ( s ) to the charging station . the second transmission efficiency is greater than the first transmission efficiency . ii . example wireless power transfer system in accordance with an embodiment fig1 is a block diagram of an example wireless power transfer system 100 in accordance with an embodiment described herein . system 100 includes a charging station 102 and a portable electronic device 104 . as will be described in more detail herein , charging station 102 is configured to wirelessly transfer power to portable electronic device 104 responsive to receipt of payment information therefrom . charging station 102 is also configured to manage the wireless transfer of power to portable electronic device 104 based on certain parameters and / or state information received from portable electronic device 104 . as shown in fig1 , charging station 102 includes a power source 122 connected to a wireless power / communication link transceiver 124 . wireless power / communication link transceiver 124 is configured to wirelessly transfer power supplied by power source 122 to a wireless power / communication link transceiver 146 associated with portable electronic device 104 via an inductive link 106 . as will be appreciated by persons skilled in the relevant art ( s ), such wireless power transfer may be carried out over inductive link 106 in accordance with the well - known principles of inductive coupling or resonant inductive coupling as discussed in the background section above . as will be further appreciated by persons skilled in the relevant art ( s ), the manner in which wireless power / communication link transceiver 124 and wireless power / communication link transceiver 146 are implemented will depend on the type of inductive coupling used . a variety of transceiver designs based on inductive coupling and resonant inductive coupling are available in the art and thus need not be described herein . charging station 102 also includes a power link manager 126 connected between power source 122 and wireless power / communication link transceiver 124 . power link manager 126 is configured to sense when wireless power / communication link transceiver 146 associated with portable electronic device 104 is inductively coupled to wireless power / communication link transceiver 124 and is thus capable of receiving power wirelessly therefrom . power link manager 126 is further configured to transfer power wirelessly over inductive link 106 responsive to control signals from a communication link manager 128 . power link manager 126 may be further configured to monitor the amount of power that is wirelessly transferred via inductive link 106 to portable electronic device 104 . communication link manager 128 is connected both to power link manager 126 and to wireless power / communication link transceiver 124 . communication link manager 128 is configured to establish and maintain a wireless communication link with portable electronic device 104 via wireless power / communication link transceiver 124 for the purpose of obtaining payment information and other information therefrom . such other information may include , for example , device - specific parameters associated with portable electronic device 104 such as a maximum safe power that may be transferred to portable electronic device 104 . such other information may also include , for example , state information associated with portable electronic device 104 such an amount of power currently consumed or needed by portable electronic device 104 . communication link manager 128 is thus configured to use inductive link 106 for the wireless communication of data . depending upon the implementation , communication link manager 128 may be configured to carry out the wireless communication of data in accordance with any standard or proprietary induction - based data communication protocol . for example , communication link manager 128 may be configured to carry out the wireless communication of data in accordance with an nfc protocol as described in the background section above , although this example is not intended to be limiting and other standard or proprietary induction - based data communication protocols may be used . communication link manager 128 is further configured to transmit control signals to power link manager 126 to control whether and when power link manager 126 may transfer power wirelessly to portable electronic device 104 . communication link manager 128 can thus ensure that power is transferred to portable electronic device 104 only after requisite payment information has been received from portable electronic device 104 . communication link manager 128 can also control power link manager 126 to ensure that power is delivered to portable electronic device 104 in a manner that takes into account certain device - specific parameters such as a maximum safe power that may be transferred to portable electronic device 104 or state information such as an amount of power currently consumed or needed by portable electronic device 104 . portable electronic device 104 within power transfer system 100 will now be described . as shown in fig1 , portable electronic device 104 includes a battery recharging unit 144 connected to wireless power / communication link transceiver 146 . wireless power / communication link transceiver 146 is configured to transfer wireless power received over inductive link 106 to battery recharging unit 144 , which is configured to use such power to recharge a battery 142 connected thereto . battery recharging unit 144 is also connected to a load 154 associated within portable electronic device 104 , which can be powered by battery 142 in a well - known manner . portable electronic device 104 further includes a power link monitor 148 connected between wireless power / communication link transceiver 146 and battery recharging unit 144 . power link monitor 148 may be configured to monitor an amount of power that is wirelessly received via inductive link 106 and to provide this information to a communication link manager 150 . power link monitor 148 may provide other state information to communication link manager 150 including , for example , a current state of battery 142 . communication link manager 150 is connected both to power link monitor 148 and to wireless power / communication link transceiver 146 . communication link manager 150 is configured to establish and maintain a wireless communication link with charging station 102 via wireless power / communication link transceiver 146 for the purpose of providing payment information and other information thereto . as noted above , such other information may include , for example , device - specific parameters associated with portable electronic device 104 , such as a maximum safe power that may be transferred to portable electronic device 104 , or state information associated with portable electronic device 104 such an amount of power currently consumed or needed by portable electronic device 104 . this state information may be based on or derived from state information provided by power link monitor 148 . communication link manager 150 is thus configured to use inductive link 106 for the wireless communication of data . depending upon the implementation , communication link manager 150 may be configured to carry out the wireless communication of data in accordance with any standard or proprietary induction - based data communication protocol . for example , communication link manager 150 may be configured to carry out the wireless communication of data in accordance with an nfc protocol as described in the background section above , although this example is not intended to be limiting and other standard or proprietary induction - based data communication protocols may be used . fig2 depicts a flowchart 200 of a method for wirelessly transferring power from a charging station to a portable electronic device in accordance with an embodiment described herein . the method of flowchart 200 will now be described in reference to certain elements of example wireless transfer system 100 as described above in reference to fig1 . however , the method is not limited to that implementation . as shown in fig2 , the method of flowchart 200 begins at step 202 in which power link manager 126 of charging station 102 establishes a wireless power link with portable electronic device 104 . power link manager 126 performs this function by allowing power to flow from power source 122 to wireless power / communication link transceiver 124 , which has the effect of creating inductive link 106 between wireless power / communication link transceiver 124 of charging station 102 and wireless power / communication link transceiver 146 of portable electronic device 104 . as discussed above , depending upon the implementation of wireless power / communication link transceiver 124 and wireless power / communication link transceiver 146 , inductive link 106 may be created for example based on the principles of inductive coupling or resonant inductive coupling . at step 204 , communication link manager 128 of charging station 102 establishes a wireless communication link with portable electronic device 104 . communication link manager 128 performs this function by transmitting and / or receiving signals via wireless power / communication link transceiver 124 to / from wireless power / communication link transceiver 146 associated with portable electronic device 104 . the wireless communication link is thus established via inductive link 106 . as discussed above , the wireless communication link may be established in accordance with any standard or proprietary inductance - based data communication protocol . at step 206 , communication link manager 128 of charging station 102 receives payment information from portable electronic device 104 via the wireless communication link . as will be appreciated by persons skilled in the relevant art ( s ), the type of payment information that is received during step 206 may vary depending on the manner in which the wireless power transfer service is to be paid for by the user of portable electronic device 104 . for example , if the user will pay for the wireless power transfer through the subsequent billing of a credit card account , checking account , or some other account from which funds may be transferred , then the payment information may include a unique account identifier , such as an account number . alternatively , if the charge to the user will be added to a list of additional charges due from the user ( e . g ., the charge is to be added to a hotel bill for the user ), then the payment information may include a unique identifier of the user . furthermore , if the user has already paid for the wireless power transfer , then the payment information may include an electronic token indicating that such payment has occurred . alternatively , if the user has purchased prepaid credits towards the wireless power transfer , then the payment information may include an electronic funds amount that is currently available to the user / owner for obtaining the service . the electronic funds amount may be stored on portable electronic device 104 , or a card inserted or attached to portable electronic device 104 . the foregoing description of the types of payment information that may be received during step 206 are provided by way of example only and are not intended to limit the present invention . persons skilled in the relevant art ( s ) will readily appreciate that other types of payment information may be received during step 206 other than or in addition to those types described above . after the payment information has been received by communication link manager 128 during step 206 , communication link manager 128 sends one or more control signals to power link manager 126 and , responsive to receiving the control signal ( s ), power link manager 126 allows power to be transferred to portable electronic device 104 over the wireless power link . this is generally shown at step 208 . in an embodiment , communication link manager 128 validates and / or processes the payment information prior to sending the control signal ( s ) to power link manager 126 . in another embodiment , communication link manager 128 transmits the payment information to an external entity for validation and / or processing prior to sending the control signal ( s ) to power link manager 126 . for example , communication link manager 128 may provide the payment information to a network interface within charging station 102 ( not shown in fig1 ) for wired or wireless communication to a network entity , such as a server , for processing and / or validation . in a further implementation of the foregoing method , power link manager 126 monitors or meters the amount of power wirelessly transferred to portable electronic device 104 via the wireless power link . the monitored amount can then be used to charge the user of portable electronic device 104 based on the amount of power transferred . in one embodiment , the monitored amount is transmitted to an external entity so that the user of portable electronic device 104 may be charged based on the monitored amount . the external entity may be , for example , a remote network entity , such as a server , or may be portable electronic device 104 . in the foregoing method of flowchart 200 , the establishment of the wireless power link in step 202 may occur before , contemporaneously with , or after the establishment of the wireless communication link in step 204 depending upon the implementation . furthermore , the establishment of the wireless power link may occur responsive to the establishment of the wireless communication link or vice versa . with respect to the establishment of the wireless communication link , either charging station 102 or portable electronic device 104 may act as the initiator depending upon the implementation . fig3 depicts a flowchart 300 of a method for wirelessly receiving power from a charging station by a portable electronic device in accordance with an embodiment described herein . in contrast to the steps of flowchart 200 , which are performed by a charging station , the steps of flowchart 300 are performed by a portable electronic device that is configured to interact with a charging station . thus , the method of flowchart 300 may be thought of as a counterpart method to the method of flowchart 200 . the method of flowchart 300 will now be described in reference to certain elements of example wireless transfer system 100 as described above in reference to fig1 . however , the method is not limited to that implementation . as shown in fig3 , the method of flowchart 300 begins at step 302 in which a wireless power link is established between wireless power / communication link transceiver 146 of portable electronic device 104 and wireless power / communication link transceiver 124 of charging station 102 . the manner in which such a wireless power link is established was discussed above in reference to step 202 of flowchart 200 . at step 304 , communication link manager 150 of portable electronic device 104 establishes a wireless communication link with charging station 102 . communication link manager 150 performs this function by transmitting and / or receiving signals via wireless power / communication link transceiver 146 to / from wireless power / communication link transceiver 124 associated with charging station 102 . the wireless communication link is thus established via inductive link 106 . as discussed above , the wireless communication link may be established in accordance with any standard or proprietary inductance - based data communication protocol . at step 306 , communication link manager 150 of portable electronic device 104 transmits payment information to charging station 102 via the wireless communication link . as will be appreciated by persons skilled in the relevant art ( s ), the type of payment information that is transmitted during step 306 may vary depending on the manner in which the wireless power transfer service is to be paid for by the user of portable electronic device 104 . examples of various types of payment information were described above in reference to step 206 of flowchart 200 . responsive to the receipt of the payment information by charging station 102 , charging station 102 transfers power to portable electronic device 104 over the wireless power link . the transferred power is received by wireless power / communication link transceiver 146 and applied to battery recharging unit 144 . this is generally shown at step 308 . in the foregoing method of flowchart 300 , the establishment of the wireless power link in step 302 may occur before , contemporaneously with , or after the establishment of the wireless communication link in step 304 depending upon the implementation . furthermore , the establishment of the wireless power link may occur responsive to the establishment of the wireless communication link or vice versa . with respect to the establishment of the wireless communication link , either charging station 102 or portable electronic device 104 may act as the initiator depending upon the implementation . fig4 depicts a flowchart 400 of an additional method for wirelessly transferring power from a charging station to a portable electronic device in accordance with an embodiment described herein . the method of flowchart 400 will now be described in reference to certain elements of example wireless transfer system 100 as described above in reference to fig1 . however , the method is not limited to that implementation . as shown in fig4 , the method of flowchart 400 begins at step 402 in which power link manager 126 of charging station 102 establishes a wireless power link with portable electronic device 104 . power link manager 126 performs this function by allowing power to flow from power source 122 to wireless power / communication link transceiver 124 , which has the effect of creating inductive link 106 between wireless power / communication link transceiver 124 of charging station 102 and wireless power / communication link transceiver 146 of portable electronic device 104 . as discussed above , depending upon the implementation of wireless power / communication link transceiver 124 and wireless power / communication link transceiver 146 , inductive link 106 may be created based on the principles of inductive coupling or resonant inductive coupling for example . at step 404 , communication link manager 128 of charging station 102 establishes a wireless communication link with portable electronic device 104 . communication link manager 128 performs this function by transmitting and / or receiving signals via wireless power / communication link transceiver 124 to / from wireless power / communication link transceiver 146 associated with portable electronic device 104 . the wireless communication link is thus established via inductive link 106 . as discussed above , the wireless communication link may be established in accordance with any standard or proprietary inductance - based data communication protocol . at step 406 , communication link manager 128 of charging station 102 receives parameters and / or state information from portable electronic device 104 via the wireless communication link . the parameters may include , for example , a maximum safe power that may be transmitted to portable electronic device 104 . the state information may include , for example , an amount of power currently consumed or needed by portable electronic device 104 . after receiving the parameters and / or state information , communication link manager 128 sends one or more control signals to power link manager 126 and , responsive to receiving the control signal ( s ), power link manager 128 transfers power to portable electronic device 104 over the wireless power link in a manner that takes into account the received parameters and / or state information . this is generally shown at step 408 . in one embodiment , controlling the power transfer in accordance with received parameters includes controlling the wireless power link to ensure that the amount of power transferred over the link does not exceed a maximum safe power that may be transmitted to portable electronic device 104 . in another embodiment , controlling the power transfer in accordance with received state information includes controlling the wireless power link to ensure that the amount of power that is transferred over the link is sufficient to recharge portable electronic device 104 or does not exceed an amount of power that is sufficient to recharge portable electronic device 104 . in the foregoing method of flowchart 400 , the establishment of the wireless power link in step 402 may occur before , contemporaneously with , or after the establishment of the wireless communication link in step 404 depending upon the implementation . furthermore , the establishment of the wireless power link may occur responsive to the establishment of the wireless communication link or vice versa . with respect to the establishment of the wireless communication link , either charging station 102 or portable electronic device 104 may act as the initiator depending upon the implementation . fig5 depicts a flowchart 500 of a method for wirelessly receiving power from a charging station by a portable electronic device in accordance with an embodiment described herein . in contrast to the steps of flowchart 400 , which are performed by a charging station , the steps of flowchart 500 are performed by a portable electronic device that is configured to interact with a charging station . thus , the method of flowchart 500 may be thought of as a counterpart method to the method of flowchart 400 . the method of flowchart 500 will now be described in reference to certain elements of example wireless transfer system 100 as described above in reference to fig1 . however , the method is not limited to that implementation . as shown in fig5 , the method of flowchart 500 begins at step 502 in which a wireless power link is established between wireless power / communication link transceiver 146 of portable electronic device 104 and wireless power / communication link transceiver 124 of charging station 102 . the manner in which such a wireless power link is established was discussed above in reference to step 402 of flowchart 400 . at step 504 , communication link manager 150 of portable electronic device 104 establishes a wireless communication link with charging station 102 . communication link manager 150 performs this function by transmitting and / or receiving signals via wireless power / communication link transceiver 146 to / from wireless power / communication link transceiver 124 associated with charging station 102 . the wireless communication link is thus established via inductive link 106 . as discussed above , the wireless communication link may be established in accordance with any standard or proprietary inductance - based data communication protocol . at step 506 , communication link manager 150 of portable electronic device 104 transmits parameters and / or state information to charging station 102 via the wireless communication link . as noted above , the parameters may include , for example , a maximum safe power that may be transmitted to portable electronic device 104 and the state information may include , for example , an amount of power currently consumed or needed by portable electronic device 104 . in an embodiment , communication link manager 150 generates or derives the state information from information collected by power link monitor 148 . for example , power link monitor 148 may monitor the wireless power link to determine an amount of power transferred over the link . this amount of power may then be reported as state information to charging station 102 over the wireless communication link . additionally , power link monitor 148 may provide other state information to communication link manager 150 including , for example , a current state of battery 142 . responsive to the receipt of the parameters and / or state information by charging station 102 , charging station 102 transfers power to portable electronic device 104 over the wireless power link , wherein the manner in which power is transferred is controlled in accordance with the parameters and / or state information . the transferred power is received by wireless power / communication link transceiver 146 and applied to battery recharging unit 144 . this is generally shown at step 508 . in the foregoing method of flowchart 500 , the establishment of the wireless power link in step 502 may occur before , contemporaneously with , or after the establishment of the wireless communication link in step 504 depending upon the implementation . furthermore , the establishment of the wireless power link may occur responsive to the establishment of the wireless communication link or vice versa . with respect to the establishment of the wireless communication link , either charging station 102 or portable electronic device 104 may act as the initiator depending upon the implementation . alternative implementations of wireless power transfer system 100 will now be described . each of the alternative implementations is also capable of wirelessly transferring / receiving power in accordance with the methods of flowcharts 200 , 300 , 400 and 500 as described above in reference to fig2 , fig3 , fig4 and fig5 , respectively . for example , fig6 is a block diagram of a wireless power transfer system 600 that includes similar elements to those described in reference to fig1 except that the wireless power link between the charging station and the portable electronic device is implemented using a wireless power transmitter and receiver while the wireless communication link between the charging station and the portable electronic device is implemented using a separate pair of communication link transceivers . as shown in fig6 , wireless power transfer system 600 includes a charging station 602 and a portable electronic device 604 . charging station 602 includes a power source 622 , a wireless power transmitter 624 , a power link manager 626 , a communication link manager 628 , and a communication link transceiver 630 . portable electronic device 604 includes a battery 642 , a battery recharging unit 644 , a wireless power receiver 646 , a power link monitor 648 , a communication link manager 650 , a communication link transceiver 652 , and a load 654 . with the exception of certain elements discussed below , the elements of charging station 602 are configured to function in a similar manner to like - named elements of charging station 102 of fig1 . likewise , with the exception of certain elements discussed below , the elements of portable electronic device 604 are configured to function in a similar manner to like - named elements of portable electronic device 104 of fig1 . wireless power transmitter 624 is configured to operate under the control of power link manager 626 to wirelessly transfer power supplied by power source 622 to wireless power receiver 646 associated with portable electronic device 604 via an inductive link 606 . the wireless power transfer may be carried out over inductive link 606 in accordance with the well - known principles of inductive coupling or resonant inductive coupling as discussed in the background section above . the manner in which wireless power transmitter 624 and wireless power receiver 646 are implemented will depend on the type of inductive coupling used . a variety of transmitter and receiver designs based on inductive coupling and resonant inductive coupling are available in the art and thus need not be described herein . in the embodiment shown in fig6 , communication link transceivers 630 and 652 are used to establish and maintain a wireless communication link 608 between charging station 602 and portable electronic device 604 that is separate from inductive link 606 . wireless communication link 608 is established for the purpose of transferring payment information and / or device - specific parameters or state information from portable electronic device 604 to charging station 602 . charging station 602 may then use such information in a like manner to that described above with respect to charging station 102 of fig1 . as will be appreciated by persons skilled in the relevant art ( s ), the manner in which communication link transceivers 630 and 652 are implemented will depend on the type of wireless communication link to be established therebetween . in accordance with one embodiment , wireless communication link 608 may be established using nfc technology as described above in the background section . alternatively , wireless communication link 608 may be established in accordance with certain rf - based short - range communication technologies such as bluetooth ™, as described in the various standards developed and licensed by the bluetooth ™ special interest group , or technologies such as zigbee ® that are based on the ieee 802 . 15 . 4 standard for wireless personal area networks ( specifications describing zigbee are publically available from the zigbee ® alliance ). still further , wireless communication link 608 may be established in accordance with other rf - based communication technologies such as any of the well - known ieee 802 . 11 protocols . however , these examples are not intended to be limiting , and wireless communication link 608 between charging station 602 and portable electronic device 604 may be established using a variety of other standard or propriety communication protocols . fig7 is a block diagram of a wireless power transfer system 700 that includes similar elements to those described in reference to fig6 except that the wireless communication link between the portable electronic device and the charging station is unidirectional rather than bidirectional . as shown in fig7 , wireless power transfer system 700 includes a charging station 702 and a portable electronic device 704 . charging station 702 includes a power source 722 , a wireless power transmitter 724 , a power link manager 726 , a communication link manager 728 , and a communication link receiver 730 . portable electronic device 704 includes a battery 742 , a battery recharging unit 744 , a wireless power receiver 746 , a power link monitor 748 , a communication link manager 750 , a communication link transmitter 752 , and a load 754 . with the exception of certain elements discussed below , the elements of charging station 702 are configured to function in a similar manner to like - named elements of charging station 602 of fig6 . likewise , with the exception of certain elements discussed below , the elements of portable electronic device 704 are configured to function in a similar manner to like - named elements of portable electronic device 604 of fig6 . communication link manager 750 within portable electronic device 704 is configured to establish a unidirectional wireless communication link 708 with charging station 702 by transmitting signals via communication link transmitter 752 to communication link receiver 730 . this unidirectional wireless communication link may then be used to transmit payment information and / or device - specific parameters or state information from portable electronic device 704 to charging station 702 . charging station 702 may then use such information in a like manner to that described above with respect to charging station 102 of fig1 . fig8 is a block diagram of a wireless power transfer system 800 that includes similar elements to those described in reference to fig6 except that the charging station includes a plurality of different communication link transceivers to facilitate the establishment of wireless communication links with a plurality of different types of portable electronic devices . as shown in fig8 , wireless power transfer system 800 includes a charging station 802 and a portable electronic device 804 . charging station 802 includes a power source 822 , a wireless power transmitter 824 , a power link manager 826 , a communication link manager 828 , and a plurality of communication link transceivers 830 a - 830 n . portable electronic device 804 includes a battery 842 , a battery recharging unit 844 , a wireless power receiver 846 , a power link monitor 848 , a communication link manager 850 , a communication link transceiver 852 , and a load 854 . with the exception of certain elements discussed below , the elements of charging station 802 are configured to function in a similar manner to like - named elements of charging station 602 of fig6 . likewise , with the exception of certain elements discussed below , the elements of portable electronic device 804 are configured to function in a similar manner to like - named elements of portable electronic device 604 of fig6 . each of the communication link transceivers 830 a - 830 n is configured for wireless communication in accordance with a different wireless protocol . for example , first communication link transceiver 830 a may be configured for communication in accordance with nfc , second communication link transceiver 830 b may be configured for communication in accordance with bluetooth ™, and nth communication link transceiver 830 n may be configured for communication in accordance with one of the ieee 802 . 11 standards . this advantageously enables charging station 802 to receive payment information and device - specific parameters and / or state information from a plurality of different device types to facilitate the wireless transfer of power to such devices . some example embodiments are capable of increasing efficiency of wireless power transfer . the efficiency of a wireless power transfer is defined as the magnitude of power that is consumed by a portable electronic device with respect to the wireless power transfer divided by the magnitude of power that is provided to the portable electronic device with respect to the wireless power transfer . the efficiency of the wireless power transfer therefore indicates the proportion of the power that is wirelessly transferred to the portable electronic device that is consumed by the portable electronic device . in accordance with some example embodiments , a charging station ( e . g ., charging station 102 , 602 , 702 , or 802 ) begins to wirelessly transfer power to a portable electronic device ( e . g ., portable electronic device 104 , 604 , 704 , or 804 ) via a wireless power link ( e . g ., link 106 , 606 , 706 , or 806 ). the portable electronic device sends an indicator to the charging station via a wireless communication link ( e . g ., link 106 , 608 , 708 , or 808 ) once the charging station begins to wirelessly transfer the power to the portable electronic device . the indicator specifies information regarding the portable electronic device , which may include but is not limited to a resonant frequency of the portable electronic device , a magnitude of power requested by the portable electronic device , a magnitude of power consumed by the portable electronic power with respect to the wireless power transfer , a maximum safe power that the portable electronic device is capable of consuming without substantial risk of damaging the portable electronic device , a position of the portable electronic device , etc . the charging station increases the efficiency of the wireless transfer of the power based on the indicator . fig9 depicts a flowchart 900 of a method for increasing efficiency of wireless power transfer in accordance with an embodiment described herein . flowchart 900 may be performed by charging station 102 , 602 , 702 , or 802 of respective wireless power transfer system 100 , 600 , 700 , or 800 shown in respective fig1 , 6 , 7 , or 8 , for example . for illustrative purposes , flowchart 900 is described with respect to a charging system 1000 shown in fig1 , which is an example of a charging station 102 , 602 , 702 , or 802 , according to an embodiment . as shown in fig1 , charging station 1000 includes a wireless power transfer module 1002 , a parameter receipt module 1004 , and an efficiency improvement module 1006 . further structural and operational embodiments will be apparent to persons skilled in the relevant art ( s ) based on the discussion regarding flowchart 900 . flowchart 900 is described as follows . as shown in fig9 , the method of flowchart 900 begins at step 902 . in step 902 , a wireless power transfer is initiated from a charging station to a portable electronic device via a wireless power link . the wireless power transfer may be performed in accordance with an inductive coupling technique , a resonant inductive coupling technique , or any other suitable technique . in an example implementation , wireless power transfer module 1002 initiates the wireless power transfer via the wireless power link . at step 904 , at least one parameter regarding the portable electronic device is received at the charging station via a wireless communication link . for instance , the at least one parameter may be received via the wireless communication link in accordance with a near field communication ( nfc ) protocol , a bluetooth ™ protocol , a zigbee ® protocol , an ieee 802 . 11 protocol , or any other suitable protocol . the wireless power link and the wireless communication link may be implemented as separate links or as a common link . the wireless power link and the wireless communication link may be inductive links , though the scope of the example embodiments is not limited in this respect . in an example implementation , parameter receipt module 1004 receives the at least one parameter . at step 906 , efficiency of the wireless power transfer is increased based on the at least one first parameter . in an example implementation , efficiency improvement module 1006 increases the efficiency of the wireless power transfer . some example techniques for increasing the efficiency of wireless power transfer are described below with reference to fig1 a - 11d , 12 , 15 , and 16 , for example . fig1 a - 11d depict respective portions of a flowchart 1100 of a method for increasing efficiency of wireless power transfer in accordance with an embodiment described herein . flowchart 1100 may be performed by charging station 102 , 602 , 702 , or 802 of respective wireless power transfer system 100 , 600 , 700 , or 800 shown in respective fig1 , 6 , 7 , or 8 , for example . for illustrative purposes , flowchart 1100 is described with respect to a charging system 1200 shown in fig1 , which is an example of a charging station 102 , 602 , 702 , or 802 , according to an embodiment . as shown in fig1 , charging station 1200 includes a wireless power transfer module 1202 , a parameter receipt module 1204 , a parameter determination module 1206 , a frequency comparison module 1208 , an efficiency improvement module 1210 , a power comparison module 1212 , and an orientation determination module 1214 . further structural and operational embodiments will be apparent to persons skilled in the relevant art ( s ) based on the discussion regarding flowchart 1100 . flowchart 1100 is described as follows . as shown in fig1 , the method of flowchart 1100 begins at step 1102 . in step 1102 , a wireless power transfer is initiated from a charging station to a portable electronic device via a wireless power link . in an example implementation , wireless power transfer module 1202 initiates the wireless power transfer via the wireless power link . at step 1104 , a determination is made whether a frequency parameter that specifies a resonant frequency of the portable electronic device is received via a wireless communication link . in an example implementation , parameter determination module 1206 determines whether a frequency parameter that specifies the resonant frequency of the portable electronic device is received . for instance , parameter receipt module 1204 may receive the frequency parameter . if the frequency parameter that specifies the resonant frequency of the portable electronic device is received via the wireless communication link , flow continues to step 1108 . otherwise , flow continues to step 1110 . according to one example embodiment , the wireless power link and the wireless communication link are established via a common inductive link . according to another example embodiment , the wireless power link and the wireless communication link are established via respective inductive links . these example embodiments are provided for illustrative purposes and are not intended to be limiting . for instance , the wireless power link and the wireless communication link need not necessarily be inductive links . it should be noted that the frequency parameter may specify the resonant frequency of the portable electronic device in relative terms with respect to a reference frequency or in absolute terms . for example , the frequency parameter may specify a resonant frequency that is 5 megahertz ( mhz ) in relative terms by specifying the resonant frequency to be 3 mhz with respect to a reference frequency of 2 mhz . in another example , the frequency parameter may specify the same resonant frequency of 5 mhz in absolute terms to be 5 mhz , such that the resonant frequency is not specified with respect to a reference frequency . a reference frequency may be any suitable frequency . for example , a non - radiative magnetic field , which oscillates at an oscillating frequency , may mediate the wireless power transfer . for instance , the charging station may generate the non - radiative magnetic field , and power may be wirelessly transferred from the charging station to the portable electronic device through inductive coupling and / or resonant inductive coupling . in accordance with this example , the oscillating frequency at which the non - radiative magnetic field oscillates may serve as the reference frequency . at step 1106 , a determination is made whether a frequency at which a non - radiative magnetic field that mediates the wireless power transfer oscillates is substantially equal to the resonant frequency of the portable electronic device . in an example implementation , frequency comparison module 1208 determines whether the frequency at which the non - radiative magnetic field oscillates is substantially equal to the resonant frequency of the portable electronic device . if the frequency at which the non - radiative magnetic field oscillates is substantially equal to the resonant frequency of the portable electronic device , flow continues to step 1110 . otherwise , flow continues to step 1108 . at step 1108 , the frequency at which the non - radiative magnetic field oscillates is changed to be substantially equal to the resonant frequency of the portable electronic device . in an example implementation , efficiency improvement module 1210 changes the frequency at which the non - radiative magnetic field oscillates . it will be recognized that steps 1106 and 1108 may be omitted if a non - radiative field does not mediate the wireless power transfer . at step 1110 , a determination is made whether a power parameter that specifies a magnitude of power requested by the portable electronic device is received via the wireless communication link . the power parameter may specify the magnitude of power requested by the portable electronic device in relative terms with respect to a reference magnitude of power or in absolute terms . for example , the magnitude of power provided to the portable electronic device with respect to the wireless power transfer from the charging station may serve as the reference magnitude of power . in an example implementation , parameter determination module 1206 determines whether a power parameter that specifies a magnitude requested by the portable electronic device is received via the wireless communication link . for instance , parameter receipt module 1204 may receive the power parameter . if a power parameter that specifies a magnitude of power requested by the portable electronic device is received , flow continues to step 1112 shown in fig1 b . otherwise , flow continues to step 1120 shown in fig1 c . at step 1112 , a determination is made whether a magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power requested by the portable electronic device . in an example implementation , power comparison module 1212 determines whether the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power requested by the portable electronic device . if the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power requested by the portable electronic device , flow continues to step 1114 . otherwise , flow continues to step 1116 . at step 1114 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer is reduced to be substantially equal to the magnitude of power requested by the portable electronic device . in an example implementation , efficiency improvement module 1210 reduces the magnitude of power that is provided by the charging station with respect to the wireless power transfer to be substantially equal to the magnitude of power requested by the portable electronic device . upon completion of step 1114 , flow continues to step 1120 , which is shown in fig1 c . at step 1116 , a determination is made whether the magnitude of power that is provided by the charging station with respect to the wireless power transfer is less than the magnitude of power requested by the portable electronic device . in an example implementation , power comparison module 1212 determines whether the magnitude of power that is provided by the charging station with respect to the wireless power transfer is less than the magnitude of power requested by the portable electronic device . if the magnitude of power that is provided by the charging station with respect to the wireless power transfer is less than the magnitude of power requested by the portable electronic device , flow continues to step 1118 . otherwise , flow continues to step 1120 , which is shown in fig1 c . at step 1118 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer is increased to be substantially equal to the magnitude of power requested by the portable electronic device . in an example implementation , efficiency improvement module 1210 increases the magnitude of power that is provided by the charging station with respect to the wireless power transfer to be substantially equal to the magnitude of power requested by the portable electronic device . persons skilled in the relevant art ( s ) will recognize that it may not be desirable to increase the magnitude of power that is provided by the charging station with respect to the wireless power transfer even if a determination is made that such magnitude of power is less than the magnitude of power requested by the portable electronic device . for example , efficiency of the wireless power transfer may be better served by not increasing the magnitude of power that is provided by the charging station with respect to the wireless power transfer . accordingly , step 1118 need not necessarily be performed in response to an affirmative determination at step 1116 . upon completion of step 1118 , flow continues to step 1120 , which is shown in fig1 c . at step 1120 , a determination is made whether a power parameter that specifies a magnitude of power consumed by the portable electronic device with respect to the wireless power transfer is received via the wireless communication link . the power parameter may specify the magnitude of power consumed by the portable electronic device in relative terms with respect to a reference magnitude of power or in absolute terms . for example , the magnitude of power provided to the portable electronic device with respect to the wireless power transfer from the charging station may serve as the reference magnitude of power . in an example implementation , parameter determination module 1206 determines whether a power parameter that specifies the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer is received via the wireless communication link . for instance , parameter receipt module 1204 may receive the power parameter . if a power parameter that specifies the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer is received , flow continues to step 1122 . otherwise , flow continues to step 1126 . at step 1122 , a determination is made whether the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer . in an example implementation , power comparison module 1212 determines whether the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer . if the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer , flow continues to step 1124 . otherwise , flow continues to step 1126 . at step 1124 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer is reduced to be substantially equal to the magnitude of power consumed by the portable electronic device with respect to the wireless power transfer . in an example implementation , efficiency improvement module 1210 reduces the magnitude of power that is provided by the charging station with respect to the wireless power transfer . at step 1126 , a determination is made whether a power parameter that specifies a maximum safe power that the portable electronic device is capable of consuming without substantial risk of damaging the portable electronic device is received via the wireless communication link . in an example implementation , parameter determination module 1206 determines whether a power parameter that specifies the maximum safe power is received via the wireless communication link . for instance , parameter receipt module 1204 may receive the power parameter . if a power parameter that specifies the maximum safe power is received , flow continues to step 1128 , which is shown in fig1 d . otherwise , flow continues to step 1130 , which is also shown in fig1 d . the substantial risk of damage may be defined as a relatively high likelihood that performance of the portable electronic device will become substantially hindered , that the portable electronic device will become inoperable , or any other suitable definition . the power parameter may specify the maximum safe power in relative terms with respect to a reference magnitude of power or in absolute terms . for example , the magnitude of power provided to the portable electronic device with respect to the wireless power transfer from the charging station may serve as the reference magnitude of power . at step 1128 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer is controlled to be no greater than the maximum safe power . for instance , if the magnitude of power that is provided by the charging station with respect to the wireless power transfer is greater than the maximum safe power before performance of step 1128 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer may be reduced at step 1128 to be no greater than the maximum safe power . if the magnitude of power that is provided by the charging station with respect to the wireless power transfer is less than or equal to the maximum safe power before performance of step 1128 , the magnitude of power that is provided by the charging station with respect to the wireless power transfer may be maintained at step 1128 to be no greater than the maximum safe power . in an example implementation , efficiency improvement module 1210 controls the magnitude of power that is provided by the charging station with respect to the wireless power to be no greater than the maximum safe power . at step 1130 , a determination is made whether a position parameter that specifies a position of the portable electronic device is received via the wireless communication link . the position parameter may specify the position of the portable electronic device in relative terms with respect to a reference position or in absolute terms . for example , the position of the charging station may serve as the reference position . in an example implementation , parameter determination module 1206 determines whether a position parameter that specifies a position of the portable electronic device is received via the wireless communication link . if a position parameter that specifies a position of the portable electronic device is received , flow continues to step 1136 . otherwise , flowchart 1100 ends . at step 1132 a determination is made whether an orientation of a transfer element of the charging station that generates the magnetic field for performing the wireless power transfer is optimized with respect to the position of the portable electronic device . for instance , the transfer element may be a coil through which a current is provided to generate the magnetic field for performing the wireless power transfer . in an example implementation , orientation determination module 1214 determines whether the orientation of the transfer element is optimized with respect to the position of the portable electronic device . if the orientation of the transfer element is optimized with respect to the position of the portable electronic device , flowchart 1100 ends . otherwise , flow continues to step 1134 . at step 1134 , the orientation of the transfer element is changed based on the position parameter to increase inductive coupling between the transfer element of the charging station and a receiving element of the portable electronic device . for instance , changing the orientation of the transfer element may include but is not limited to moving the transfer element vertically , horizontally , or in another direction ; rotating the transfer element ; etc . in an example implementation , efficiency improvement module 1210 changes the orientation of the transfer element . it will be recognized that steps 1130 , 1132 , and 1134 may be omitted if the charging station does not generate a magnetic field for performing the wireless power transfer . in some example embodiments , one or more steps 1102 , 1104 , 1106 , 1108 , 1110 , 1112 , 1114 , 1116 , 1118 , 1120 , 1122 , 1124 , 1126 , 1128 , 1130 , 1132 , and / or 1134 of flowchart 1100 may not be performed . moreover , steps in addition to or in lieu of steps 1102 , 1104 , 1106 , 1108 , 1110 , 1112 , 1114 , 1116 , 1118 , 1120 , 1122 , 1124 , 1126 , 1128 , 1130 , 1132 , and / or 1134 may be performed . it will be recognized that charging station 1200 may not include one or more of wireless power transfer module 1202 , parameter receipt module 1204 , parameter determination module 1206 , frequency comparison module 1208 , efficiency improvement module 1210 , power comparison module 1212 , and / or orientation determination module 1214 . furthermore , charging station 1200 may include modules in addition to or in lieu of wireless power transfer module 1202 , parameter receipt module 1204 , parameter determination module 1206 , frequency comparison module 1208 , efficiency improvement module 1210 , power comparison module 1212 , and / or orientation determination module 1214 . fig1 depicts a flowchart 1300 of a method for increasing efficiency of wireless power transfer in accordance with an embodiment described herein . flowchart 1300 may be performed by charging station 102 , 602 , 702 , or 802 of respective wireless power transfer system 100 , 600 , 700 , or 800 shown in respective fig1 , 6 , 7 , or 8 , for example . for illustrative purposes , flowchart 1300 is described with respect to a charging system 1400 shown in fig1 , which is an example of a charging station 102 , 602 , 702 , or 802 , according to an embodiment . as shown in fig1 , charging station 1400 includes a wireless power transfer module 1402 , a parameter analysis module 1404 , and an efficiency improvement module 1406 . further structural and operational embodiments will be apparent to persons skilled in the relevant art ( s ) based on the discussion regarding flowchart 1300 . flowchart 1300 is described as follows . as shown in fig1 , the method of flowchart 1300 begins at step 1302 . in step 1302 , power is wirelessly transferred to a portable electronic device via a wireless power link . in an example implementation , wireless power transfer module 1402 wirelessly transfers the power to the portable electronic device via the wireless power link . at step 1304 , a parameter received via a wireless communication link regarding the portable electronic device with respect to the wireless transfer of the power is analyzed . for instance , the analysis may include but is not limited to comparing the parameter to a reference parameter to determine whether the parameter and the reference parameter are substantially same ; comparing the parameter to a range of parameters to determine whether the parameter is within the range ; comparing the parameter to a threshold to determine whether the parameter reaches the threshold ; perform a mathematical operation with respect to the parameter to estimate the efficiency with respect to the wireless transfer of power ; etc . in an example implementation , parameter analysis module 1404 analyzes the parameter received via the wireless communication link . at step 1306 , efficiency with respect to the wireless power transfer of the power is increased based on analysis of the parameter . in an example implementation , efficiency improvement module 1406 increases the efficiency with respect to the wireless transfer of the power . fig1 depicts a flowchart 1500 of a method for increasing efficiency of wireless power transfer in accordance with an embodiment described herein . flowchart 1500 may be performed by charging station 102 , 602 , 702 , or 802 of respective wireless power transfer system 100 , 600 , 700 , or 800 shown in respective fig1 , 6 , 7 , or 8 , for example . for illustrative purposes , flowchart 1500 is described with respect to a charging system 1600 shown in fig1 , which is an example of a charging station 102 , 602 , 702 , or 802 , according to an embodiment . as shown in fig1 , charging station 1600 includes a wireless power transfer module 1602 , a parameter analysis module 1604 , and an efficiency improvement module 1606 . wireless power transfer module 1602 includes a field generation module 1608 and a coupling module 1610 . efficiency improvement module 1606 includes a field manipulation module 1612 . further structural and operational embodiments will be apparent to persons skilled in the relevant art ( s ) based on the discussion regarding flowchart 1500 . flowchart 1500 is described as follows . as shown in fig1 , the method of flowchart 1500 begins at step 1502 . in step 1502 , a magnetic field is generated . in an example implementation , field generation module 1608 generates the magnetic field . for instance , field generation module 1608 may include coil through which a current is provided to generate the magnetic field . the field may be a non - radiative magnetic field , though the scope of the example embodiments is not limited in this respect . at step 1504 , power is wirelessly transferred to a portable electronic device via a wireless power link using the magnetic field . for example , the magnetic field may couple with a coil in the portable electronic device that is configured to be responsive to the magnetic field . in accordance with this example , the power may be wirelessly transferred in accordance with an inductive coupling technique , a resonant inductive coupling technique , or any other suitable technique . in an example implementation , coupling module 1610 wirelessly transfers the power to the portable electronic device . at step 1506 , a parameter received via a wireless communication link regarding the portable electronic device with respect to the wireless transfer of the power is analyzed . in an example implementation , parameter analysis module 1604 analyzes the parameter received via the wireless communication link . at step 1508 , a characteristic of the magnetic field is changed to increase efficiency with respect to the wireless transfer of the power based on analysis of the parameter . the characteristic may include but is not limited to a magnitude of the magnetic field , a directionality associated with the magnetic field , a frequency at which the magnetic field oscillates , etc . in an example implementation , field manipulation module 1612 changes the characteristic of the magnetic field to increase the efficiency with respect to the wireless transfer of the power . fig1 - 21 depict flowcharts 1700 , 1800 , 1900 , 2000 , and 2100 of methods for increasing efficiency of wireless power transfer in accordance with embodiments described herein . each of flowcharts 1700 , 1800 , 1900 , 2000 , and 2100 may be performed by portable electronic device 104 , 604 , 704 , or 804 of respective wireless power transfer system 100 , 600 , 700 , or 800 shown in respective fig1 , 6 , 7 , or 8 , for example . for illustrative purposes , flowcharts 1700 , 1800 , 1900 , 2000 , and 2100 are described with respect to portable electronic device 2200 shown in fig2 , which is an example of a portable electronic device 104 , 604 , 704 , or 804 , according to an embodiment . as shown in fig2 , portable electronic device 2200 includes a wireless power receipt module 2202 and a parameter module 2204 . further structural and operational embodiments will be apparent to persons skilled in the relevant art ( s ) based on the discussion regarding flowcharts 1700 , 1800 , 1900 , 2000 , and 2100 . flowcharts 1700 , 1800 , 1900 , 2000 , and 2100 are described in the following discussion . as shown in fig1 , the method of flowchart 1700 begins at step 1702 . in step 1702 , power is wirelessly received for a first period of time at a portable electronic device from a charging station via a wireless power link having a first transmission efficiency . wirelessly receiving power for the first period of time may be performed in accordance with an inductive coupling technique , a resonant inductive coupling technique , or any other suitable technique . in an example implementation , wireless power receipt module 2202 wirelessly receives power for the first period of time . at step 1704 , at least one parameter regarding the portable electronic device with respect to receipt of power during the first period of time is provided to the charging station via a wireless communication link . for instance , the at least one parameter may be provided to the charging station via the wireless communication link in accordance with a near field communication ( nfc ) protocol , a bluetooth ™ protocol , a zigbee ® protocol , an ieee 802 . 11 protocol , or any other suitable protocol . the wireless power link and the wireless communication link may be implemented as separate links or as a common link . the wireless power link and the wireless communication link may be inductive links , though the scope of the example embodiments is not limited in this respect . in an example implementation , parameter module 2204 provides the at least one parameter to the charging station . at step 1706 , power is wirelessly received for a second period of time at the portable electronic device from the charging station via the wireless power link having a second transmission efficiency that is greater than the first transmission efficiency in response to providing the at least one parameter to the charging station . wirelessly receiving power for the second period of time may be performed in accordance with an inductive coupling technique , a resonant inductive coupling technique , or any other suitable technique . in an example implementation , wireless power receipt module 2202 wirelessly receives power for the second period of time . as shown in fig1 , the method of flowchart 1800 begins at step 1802 . in step 1802 , power is wirelessly received for a first period of time at a portable electronic device from a charging station via a wireless power link having a first transmission efficiency . in an example implementation , wireless power receipt module 2202 wirelessly receives power for the first period of time . at step 1804 , a frequency parameter that specifies a resonant frequency of the portable electronic device is provided to charging station via a wireless communication link . the frequency parameter may specify the resonant frequency in relative terms with respect to a reference frequency or in absolute terms . in an example implementation , parameter module 2204 provides the frequency parameter to the charging station . at step 1806 , power is wirelessly received for a second period of time at the portable electronic device from the charging station via the wireless power link having a second transmission efficiency that is greater than the first transmission efficiency in response to providing the frequency parameter to the charging station . the first efficiency is based on resonant inductive coupling of a first coil in the portable electronic device with a second coil in the charging station that generates a non - radiative magnetic field oscillating at a first frequency that is not substantially same as the resonant frequency of the portable electronic device . the second efficiency is based on resonant inductive coupling of the first coil in the portable electronic device with the second coil in the charging station that generates a non - radiative magnetic field oscillating at a second frequency that is substantially same as the resonant frequency of the portable electronic device . in an example implementation , wireless power receipt module 2202 wirelessly receives power for the second period of time . as shown in fig1 , the method of flowchart 1900 begins at step 1902 . in step 1902 , a magnitude of power that is greater than a reference magnitude of power is wirelessly received for a first period of time at a portable electronic device from a charging station via a wireless power link having a first transmission efficiency . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power that is greater than the reference magnitude of power for the first period of time . at step 1904 , a power parameter is provided to the charging station via a wireless communication link . the power parameter specifies the reference magnitude of power as being requested by the portable electronic device . the power parameter may specify the reference magnitude of power in relative terms with respect to a second reference magnitude of power or in absolute terms . for example , the magnitude of power wirelessly received for the first period of time at the portable electronic device may serve as the second reference magnitude of power . in an example implementation , parameter module 2204 provides the power parameter to the charging station . at step 1906 , a magnitude of power that is substantially same as the reference magnitude of power is wirelessly received for a second period of time at the portable electronic device from the charging station via the wireless power link having a second transmission efficiency that is greater than the first transmission efficiency in response to providing the power parameter to the charging station . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power that is substantially same as the reference magnitude of power for the second period of time . as shown in fig2 , the method of flowchart 2000 begins at step 2002 . in step 2002 , a magnitude of power is wirelessly received at a portable electronic device for a first period of time from a charging station via a wireless power link having a first transmission efficiency . the magnitude of power wirelessly received for the first period of time is greater than a magnitude of power consumed by the portable electronic device for the first period of time . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power for the first period of time . at step 2004 , a power parameter that specifies the magnitude of power consumed by the portable electronic device during the first period of time is provided to the charging station via a wireless communication link . the power parameter may specify the magnitude of power consumed by the portable electronic device during the first period of time in relative terms with respect to a reference magnitude of power or in absolute terms . for example , the magnitude of power wirelessly received at the portable electronic device for the first period of time may serve as the reference magnitude of power . in an example implementation , parameter module 2204 provides the power parameter to the charging station . at step 2006 , a magnitude of power is wirelessly received at the portable electronic device for a second period of time from the charging station via the wireless power link having a second transmission efficiency that is greater than the first transmission efficiency in response to providing the power parameter to the charging station . the magnitude of power wirelessly received for the second period of time is substantially same as the magnitude of power consumed by the portable electronic device for the second period of time . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power for the second period of time . as shown in fig2 , the method of flowchart 2100 begins at step 2102 . in step 2102 , a magnitude of power that is greater than a maximum safe power , which a portable electronic device is capable of consuming without substantial risk of damaging the portable electronic device , is wirelessly received for a first period of time at the portable electronic device from a charging station via a wireless power link having a first transmission efficiency . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power for the first period of time . at step 2104 , a power parameter that specifies the maximum safe power is provided to the charging station via a wireless communication link . the power parameter may specify the maximum safe power in relative terms with respect to a reference magnitude of power or in absolute terms . for example , the magnitude of power wirelessly received for the first period of time at the portable electronic device may serve as the reference magnitude of power . in an example implementation , parameter module 2204 provides the power parameter that specifies the maximum safe power to the charging station . at step 2106 , a magnitude of power that is no greater than the maximum safe power is wirelessly received for a second period of time at the portable electronic device from the charging station via the wireless power link having a second transmission efficiency that is greater than the first transmission efficiency in response to providing the power parameter to the charging station . in an example implementation , wireless power receipt module 2202 wirelessly receives the magnitude of power for the second period of time . while various embodiments have been described above , it should be understood that they have been presented by way of example only , and not limitation . it will be understood by those skilled in the relevant art ( s ) that various changes in form and details may be made to the embodiments described herein without departing from the spirit and scope of the invention as defined in the appended claims . accordingly , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
a four lamp fluorescent fixture 10 is shown in fig1 including a modular lighting control system such as shown in u . s . patent application ser . no . 309 , 260 filed oct . 7 , 1981 . this application is assigned to the same assignee as the present application . while the fluorescent bulbs are not shown in the fixture of fig1 the base structure 12 includes dual ballasts 14 mounted therein and a control circuit 16 such as that shown in the above - identified u . s . application . base 12 is provided with a diffuser 18 mounted on a hinge at one edge ( not shown ) and having a latch at the other edge ( now shown ). a lighting level detector 20 is shown mounted within diffuser 18 of the lamp and is electrically connected to control circuit 16 , as further explained in the above - identified u . s . patent application . the details of detector 20 may be understood with the aid of fig2 wherein the major components of the light detector are shown in an exploded view . detector 20 includes a collar 26 and a body 28 . collar 26 has a cylindrical opening 30 therethrough into which body 28 fits in a sliding relationship . an external flange 32 is provided as an integral portion of collar 26 near one edge thereof and external threads 34 are provided on the surface of the collar at the end near flange 32 . as can be seen in fig4 detector 20 is mounted within a surface such as diffuser 18 by providing an opening through the surface large enough for collar 26 but not flange 32 . with the collar 26 extending through the surface , flange 32 abuts one face of the surface while a threaded nut 36 secured by threads 34 engages the other face . collar 26 further includes first and second slots 38 and 40 within the surface of the collar extending axially from the edge opposite flange 32 . the purpose of these slots will be more readily understood with the aid of material and figures to be explained hereinafter . body 28 slidingly engages the inner surface of collar 26 , and may be constructed of any one of a number of materials . plastic is the preferred material for the body due to the relative ease in working with the material as well as the electrical insulation abilities . the body has a generally cylindrical shape with concentric apertures 46 and 48 extending axially therethrough . while the apertures are in an axial direction , they need not be concentric with the center of body 28 , but only concentric with one another . a photocell 50 is positioned near the juncture of the two concentric apertures . electrical connections 52 are made between photocell 50 and a pair of electrical leads 54 near the lower end of aperture 46 . a plug 56 is inserted into aperture 46 near electrical connections 52 and the balance of aperture 46 is filled with an epoxy material 58 to seal the photocell and its connections within the body . at the lower end of body 28 a diffuser 60 , constructed of glass or plastic , closes the end of aperture 48 . diffuser 60 operates to focus light into aperture 48 and thus onto photocell 50 . an aperture 64 extends radially into body 28 and intersects aperture 48 . the surface of aperture 64 is threaded to matingly engage a set screw 66 . by turning set screw 66 either further into aperture 64 or out of the aperture , the amount of light directed into aperture 48 and at the photocell may be adjusted . in this way , the sensitivity of the photocell and thus the detector may be adjusted by appropriate movement of set screw 66 . the outer surface of body 28 includes a lug 70 , the purpose of which may be understood with the aid of fig5 a through 5c . fig5 a illustrates a first operational position for detector 20 wherein body 28 does not extend below collar 26 . this position is maintained as a result of lug 70 resting on the top edge of collar 26 . in this position , diffuser 60 is essentially flush with the outer surface of collar 26 and directs light into aperture 48 and the photocell . by allowing the body to rotate slightly thus dropping lug 70 into slot 38 , the relative positions of body 28 and collar 26 change as shown in fig5 b . in this alternate operational position , body 28 and thus diffuser 60 are at a position below the lower edge of the collar . this alternate position is the preferred operational position for the detector and allows preset light entry through diffuser 60 and onto photocell 50 . fig5 c illustrates detection device 20 in a photocell setting position wherein lug 70 has been positioned into slot 40 to allow body 28 to extend sufficiently to expose set screw 66 . in this position , the amount of light impinging upon photocell 50 is adjusted as noted above by turning the set screw until the appropriate position has been reached . once the adjustment is complete , body 28 should be returned to either the first or second operating positions shown in fig5 a and 5b , respectively . an alternate method of securing detection device 20 for operation is shown in fig6 . fluorescent lighting fixtures with which the detection device is used are generally mounted within a suspended ceiling . these suspended ceilings are supported by t - bars 74 , one of which is shown in fig6 . the design of the t - bars is relatively conventional and is manufactured by a number of concerns such as donn corporation . rather than mount detection device 20 within the diffuser of lighting fixture 10 , the device may be attached to one of the t - bars supporting the ceiling . a first mounting plate 76 has an overturned edge designed to engage the horizontal flange of t - bar 74 . the surface of plate 76 has an aperture 78 therethrough of sufficient diameter to allow passage of collar 26 of the detector . a second plate 80 likewise has an aperture 82 of sufficient size to allow passage of collar 26 therethrough . first and second plates 76 and 80 are arranged with t - bar 74 and detection device 20 as shown in fig6 and 8 . collar 26 is passed through aperture 78 of plate 76 such that flange 32 engages the face of the first plate . second plate 80 is positioned over the collar and nut 36 is threaded onto threads 34 to bind plates 76 and 80 to the t - bar . considerable emphasis has been placed on the preferred embodiments of the invention and the specific structures of the component parts thereof . while many changes can be made in the embodiments herein illustrated and described without departing from the principle of the invention , it should be distinctly understood that the foregoing descriptive matter is to be interpreted as merely illustrative of the invention and not as a limitation .	7
certain terminology will be used in the following description for convenience in reference only and will not be limiting . the words “ upwardly ”, “ downwardly ”, “ rightwardly ” and “ leftwardly ” will refer to directions in the drawings to which reference is made . the words “ inwardly ” and “ outwardly ” will refer to directions toward and away from , respectively , the geometric center of the device and associated parts thereof . said terminology will include the words above specifically mentioned , derivatives thereof and words of similar import . referring first to fig1 and 2 , the trailer hitch of the present invention is seen to comprise a post 10 that is adapted to be inserted into a hitch receiver 12 of conventional design found on many motor vehicles . the post 10 has a hole 11 formed through it from its right side to its left side and which can be aligned with holes formed through the opposed sides of the receiver 12 allowing a pin 14 to be inserted through the aligned holes to hold the post 10 in place . the post 10 is welded to an elongate channel member 16 having a top side 18 , a rear side 20 and underside 22 and an open front side . the steel channel member 16 is of a length that is greater than ¼th of width of the towing vehicle and formed through the upper side wall 18 and the lower side wall 22 proximate the leftmost end thereof when viewed in fig1 are aligned holes , allowing a hinge pin 24 to be inserted through them and through aligned apertures formed in the rightmost end of an extension bar 26 . the extension bar may be solid , but preferably comprises a tube of rectangular cross - section where the height dimension of the bar 26 allows it to be folded within the open front side of the channel member 16 , as best seen in the view of fig3 . the combined length of the channel 16 and the bar 26 are such that the left end 30 of the bar 26 extends laterally beyond the left side edge of the towing vehicle on which the hitch assembly is attached . welded to a rear surface 31 of the bar 26 proximate its left end 30 , when viewed in fig1 is a tubular receiver 32 of rectangular cross - section allowing a rectangular post 34 of lesser dimension to fit therein . welded to the top of the post 34 is a plate 36 to which a conventional hitch ball assembly 38 may be attached by means of a bolt with a nut 40 passing through an aperture 41 in the plate 36 . because the combined length of the channel member 16 and the pivotable bar 26 is greater than one - half the width dimension of the towing vehicle , the ball assembly 38 can be viewed by the vehicle &# 39 ; s driver through the driver &# 39 ; s side rear view mirror ( not shown ). the height above ground of the ball 38 is adjustable , within limits , by providing a series of aligned apertures along the length dimension of the post 34 , one of which is selected for insertion of a pin 42 that extends through aligned apertures 33 in opposed sides of the tubular receiver 32 . with special reference to fig3 , when the bar 26 is rotated into the confines of the channel member 16 , a third pin ( not shown ) may be dropped through aligned apertures 45 and 46 formed vertically through the right end portion of the channel member and apertures 47 in the outer end portion 30 of the bar 26 , respectively , thus preventing the bar 26 carrying the hitch ball 38 from swinging out from the confines of the channel 16 . in operation , when desiring to hook up to a trailer , the pin ( not shown ) will be pulled from the apertures 45 - 47 and the bar 26 swung out from the confines of the channel 16 to the position shown in fig1 . at this point , the ball 38 will be visible to the vehicle &# 39 ; s driver either through the driver &# 39 ; s side rearview mirror or by the driver leaning out the vehicle &# 39 ; s window while looking rearward . he or she may now back the vehicle to the point where the hitch ball 38 is directly beneath the socket on the tongue of the trailer to be towed . at this point , the driver will leave the vehicle and manipulate a trailer jack on the trailer &# 39 ; s tongue to lower the ball receiving socket portion of the hitch onto the ball 38 . once the socket is secured to the ball 38 , the driver may pull forward slightly resulting in the bar 26 pivoting about the pin 24 through a predetermined arc . then , by backing up slightly , the hitch will reach the disposition shown in fig3 . at this point , the pin may be re - inserted through holes 45 - 47 , holding the hitch ball 38 in direct alignment with the post 10 and the receiver 12 . at this point , the trailer is ready to be towed . referring again to fig2 , as an option , there may be included a winch assembly for effecting closure of the bar 26 within the channel 16 following the coupling of the trailer &# 39 ; s hitch socket to the hitch ball 38 . the use of the winch assembly obviates the need for performing the described driving maneuver to effect closure of the bar 26 within the channel 16 . the winch assembly comprises a c - shaped winch mounting bracket 100 secured to the channel 16 by the hinge pin 24 . bolted to the mounting plate is a commercially - available winch 102 having a d . c . motor 104 driving a spool 106 on which a steel cable 108 is wound . the free end of the cable 108 has a hook ( not shown ) that engages the edge of a slot 110 formed in the rear surface of the bar 26 . the cable also passes through a slot 112 formed through the back surface 20 of the channel 15 and about a vertically oriented guide roller 114 , only a top portion thereof can be seen in fig2 . the d . c . motor 104 is adapted to be powered by the battery of the towing vehicle . the winch has a clutch lever 116 that , when moved in a first direction . disengages the spool allowing the bar 26 to be freely manually moved to its fully extended position as in fig1 . when the clutch lever 116 is moved to a second position and the motor 104 is actuated , the cable 108 is wound onto the spool 105 as the bar 26 to which the towed vehicle is now coupled is drawn into the confines of the channel 16 . should a difficulty arise in attempting to couple the socket portion of a trailer hitch onto the ball 38 due to deflection of the channel 16 and the extended pivotal bar 26 because of the weight of the trailer tongue , there is provided a support wheel assembly 50 that is attachable to the outer end portion of the tubular bar 26 . more particularly , and with reference to fig3 , the support wheel assembly 50 is seen to comprise a caster wheel having a yoke 52 that is journaled for rotation about a vertical shaft ( not shown ). a wheel member 56 is mounted on an axel 58 supported by the yoke 52 . the vertical shaft fits into a cylindrical socket 54 surrounding a lower end of a tubular post 60 and is held in place by a pin 62 . the post 60 is inserted through a tubular receiver 64 of rectangular cross - section welded to the front side surface of bar 16 . a pin 66 extends through aligned bores in opposed walls of the receiver 64 and a selected one of the plurality of apertures 67 in post 60 to lock the wheel assembly at a desired elevation that will maintain the bar 26 level when fully extended . as can be seen from fig7 , the wheel assembly 50 engages the ground and prevents deflection of the hitch ball 38 as the trailer &# 39 ; s tongue weight is applied to the extended arm 26 . next , with reference to fig4 , the wheel assembly 50 can be stowed when not in use by simply pulling the pin 66 , removing the post 60 from the lumen of the receiver 64 , rotating the assembly by 1800 and reinserting the post 60 into the upper end of the receiver 64 , such that the wheel 56 extends upward as shown . without limitation , the channel 16 may be square and approximately 4 in . on a side . its length may be about 26 in . the bar 26 may also be of rectangular cross - section measuring about 3 . 5 in . on a side and may also be 26 in . in length . while the post 10 and the receiver 32 are preferably welded to the channel 16 and the bar 26 , respectively , it is also possible to use bolts to fasten the aforementioned parts to one another . to eliminate any play between the receiver 32 and post 34 and between receiver 64 and post 67 that might result in a rattling noise , it has been found convenient to weld a nut about an aperture drilled through the receivers and then inserting set - screws 65 and 69 that urge the posts securely against the inside wall of the receivers . fig5 illustrates an alternative embodiment of the invention . in the embodiment of fig5 , the channel 16 is made double the length of that depicted in the embodiment of fig1 - 3 and with the post 10 welded to the elongated channel 16 at its approximate midpoint . then , not only is a tubular bar 26 pivotally connected to the left end of the channel 16 , but a further tubular arm 26 r is pivotally connected to the rightmost end of the channel 26 by a hinge pin 71 that extends through aligned apertures 23 r formed through the channel 16 and the left end portion of the bar 26 r . the width dimension and height dimension of the bar 26 r are such that the bar 26 r will fold into the space between the upper sidewall 18 and the lower sidewall 22 of the channel member 16 . the tubular bar 26 r has a relatively short length of tubular bar stock 32 r welded to the rear wall 31 r proximate the right end thereof for accommodating an insert member 68 therein . a pin 70 inserted through aligned bores in the tube stock 32 r and the post of the insert member 68 is used to maintain the insert member 68 at a selectably adjustable elevation determined by a series of bores formed through the post of the insert member 68 . only one such bore 72 is visible in the view of fig5 . hitch ball 38 is preferably attached to the plate 41 so that when arm 26 is extended , it will be viewable by the driver . the other insert member 41 r may then be used as a place to affix a variety of possible attachments , e . g ., a barbeque grill for camping or for tailgating at sporting events , a bike carrier , a luggage rack , a spare trailer tire , etc . because of the manner in which the arms 26 and 26 r swing out and away from the rear of the towing vehicle , such attachments do not inhibit the ability to open rear doors of a panel truck or van nor does it interfere with the lifting of a tailgate on suv on which the trailer hitch of the present invention may be used . it has also been found advantageous to add a latch assembly 74 to the hitch of the present invention to facilitate capture of the swing arm 26 in the channel 16 during the hook - up of the trailer to the towing vehicle . as explained at page 5 , once the trailer hitch socket on the trailer is secured to the ball 38 , the driver will pull forward slightly and that results in the bar 26 pivoting about pin 24 and swinging through a predetermined arc . then , by backing up slightly , the swing bar 26 will fold into the channel and at this point the driver must leave his vehicle and insert the pin 44 through the holes 45 and 46 . however , it has been found that if the trailer is on a slight incline , it may want to coast rearward due to gravity so that the arm 26 will again swing out slightly so that the apertures 45 and 46 will no longer be aligned to permit a pin to be dropped there through . the addition of the latch assembly 74 solves this problem . as shown in fig5 , the latch assembly 74 comprises a clevis - type bracket 76 that is welded or otherwise affixed to the rear face surface of the channel 16 , and a c - shaped latch 78 is pivotally joined to the clevis by a hinge pin ( not shown ). the hook portion 80 of the latch 78 is spaced sufficiently from its hinge pin so as to straddle the top 18 of the channel 16 with the hook portion 80 residing in front of the open face of the channel 16 . it is further noted that the hook portion 80 has a tapered profile 82 on a front face surface thereof that acts as a cam . as the swing bar 26 moves against this tapered surface 82 , it causes the latch 78 to first rise and then it subsequently falls as the swing arm 26 completely enters the channel 16 clearing the hook 80 . as best seen in fig1 , the latch 78 with its depending hook portion 80 will retain the swing arm 26 within the channel until such time that the driver inserts a locking pin down through the now - aligned apertures 45 and 46 . thus , even if the trailer is on a slight incline , once the swing bar 26 is made to fully enter the channel 16 , it cannot again pull out so that the apertures 46 are no longer aligned with the apertures 45 . the addition of the hook assembly also provides added safety in the highly unlikely event that the pin used to secure the swing bar 26 in the channel 16 may be jarred free from its locking position due to ground irregularities encountered in travel . here , the latch would continue to hold the swing bar in the channel with the hitch bar 38 aligned with the post 10 . this invention has been described herein in considerable detail in order to comply with the patent statutes and to provide those skilled in the art with the information needed to apply the novel principles and to construct and use such specialized components as are required . however , it is to be understood that the invention can be carried out by specifically different equipment and devices , and that various modifications , both as to the equipment and operating procedures , can be accomplished without departing from the scope of the invention itself .	1
referring to fig1 of the appended drawings , a segmentation system 10 , according to an embodiment of the present invention , will be described . the segmentation system 10 includes a computer 12 , a storing device 14 , an output device in the form of a display monitor 16 , and an input device 18 . the storing device 14 , the display monitor 16 and the input device 18 are all connected to the computer 12 via standard connection means , such as , for example , wires . the computer 12 can be a conventional personal computer or any processing machine that includes a processor , a memory and input / output ports ( not shown ). the input / output ports may include network connectivity to transfer the images to and from the storing device 14 . the storing device 14 can be , for example , a hard drive , a cd - rom drive or other well known storing means . it can be directly connected to the computer 12 or remotely via a computer network , such as , for example the internet . according to this embodiment of the invention , the storing device 14 is used to store both the non - segmented medical images as well as the resulting segmented images as computer files . those files can be stored in any format and resolution that can be read by the computer 12 . the display monitor 16 is used to visualize the medical images both before and after the segmentation process . with the input device 18 , the display monitor 16 also allows the input of guidance points by the user as will be described hereinbelow . the display monitor 16 is finally used to display a user interface , to facilitate the interaction between the user and the computer 12 . it is believed within the reach of a person of ordinary skills in the art to provide another output device that allows for the visualization of the medical images . the input device 18 can be a conventional mouse , a keyboard or any other well known input devices or combinations thereof . of course , the computer 12 runs a software that embodies the method of the present invention thereof . other aspects and characteristics of the system 10 will become more apparent upon reading of the following description of a segmentation method according to an embodiment of the present invention . referring now to fig2 of the appended drawings , generally stated , the method of the present invention consists in performing the following steps in sequence : 114 — identifying the region of the substructure common to all images in the group ; before describing these general steps in greater details , it is to be noted that steps 110 to 116 are advantageously performed for every substructure to be identified in the images . after the segmentation process 10 has been started ( step 100 ), the step 102 consists in receiving a set of images representing cuts or slices of a structure to the computer 12 . an example of an image 150 to be segmented is shown in fig3 where the structure is a lumbar vertebra 152 . the substructure that needs to be identified by the segmentation process is , in this example , the spinal canal 154 . one can see in fig3 that the vertebra 152 and its spinal canal 154 are not perfectly defined in the images received . in other application , the substructure can be any part of a structure that can be visually isolated from the structure . the image 150 is a two dimensional array of pixels that has been previously produced by an imaging system , such as , for example a ct scanner or a mri scanner . it is to be noted that the set of images is provided sequentially in the order that they appear in the three - dimensional object . in other words , successive images come from adjacent slices of the three dimensional object . in step 104 , a thresholding operation is performed on the set of images . the tresholding step 104 consists in selecting pixels on the image that have values between a minimal and a maximal values . step 104 is performed by the user and can be viewed as a pre - segmentation step that facilitates the up - coming segmentation steps . the image range is then defined in step 106 by selecting first and last images of the range . if , for example , the set of images comprises slices of the entire spinal cord , the user can select a range of images corresponding only to the lumbar section of the spine , if it is the only section for which the user wants to segment the images . this is simply done by selecting the first and last image of the range . in step 108 , a predefined segmentation strategy can optionally be selected . if , for example , the system 10 is often used for the segmentation of lumbar vertebrae , a segmentation strategy , that takes into account the fact that such vertebrae contain a substructure consisting of a cavity ( the spinal canal ), can be selected . of course , these segmentation strategies may be stored and kept for future uses . in the following description , we will assume that the segmentation strategy for lumbar vertebra has been selected . consequently the present example relates to a structure including a single substructure , even though the invention can deal with more than one such substructure . after the segmentation strategy has been selected , the user is asked to identify the substructure 154 , i . e . the cavity of the spinal canal . step 110 consists in using the input device 18 to select a point ( pixel ) included in the representation of the substructure 154 , preferably in the first and in the last image in the range of images selected in step 106 . the method according to the present invention can also work if other images in the range are used to select the points . however , if the images are too close in the set to each other , the segmentation process , that will be describe hereinbelow , would not be as efficient . also , the method according to the present invention can also be implemented if only a single image is used to choose a point for each substructure . however , it has been found advantageous to select such pixels in the first and last image of the range to facilitate the estimation of the center position of the substructure , as will be describe hereinbelow . also , it is preferable that the guidance points be selected near the center position of the substructure , to increase the speed of the segmentation process . in step 112 , the images selected in the range of images are then divided into smaller groups . one reason to divide the images is to increase the speed of - the segmentation process by taking into account the common structural properties of the structure 152 in adjacent images . the computer 12 then searches the region of the substructure 154 common to all the images in the group ( step 114 ). the computer 12 achieves this , first by predicting the group substructure center position . it involves a linear extrapolation between the center of the substructure in the first image of the current group and the center of the previous group , and another extrapolation between the center of the previous group and the center in the last image of the group . the average of the two predicted centers is the predicted center of the substructure in the present group . the computer 12 can then search all possible candidates that may represent the common region of the group . the prediction is based on the region properties such as the size of the region , the distance of its center from the predicted center and criteria of confinement . all those values and criteria have default values that may be adjusted during the possible candidate searching process . using criteria of confinement consists in allowing more importance to pixels that are parts of a substructure in the images . the computer 12 performs iterations of the searchings of the common region and the center point . in the case of the first image of the first group of images , the starting point of this iterative process is one of the guidance point selected in step 110 . if the common region of a group can not be determined by the iterative process using the default values mentioned hereinabove , a dynamic adjustment that generally consists in reducing the number of images in the group and reducing the parameter associated to selection criteria . the adjustment is possible only if a minimal number of images in the group and the minimal size of the substructure to be identified are satisfied . if the center of the substructure can not be determined with the dynamic adjustment of the values , the computer 12 tries to find the center with less strict values . if , after that , the detection still fails , the user can be asked to enter interactively the substructure position for a given image of the group . when the identification of the group center position ( step 114 ) is successful and the pixels of the substructure common to every images of the group have been identified , the identification of the position of the substructure 154 in each images of the group ( step 116 ) can then be performed . the center position of the substructure in each image is determined by taking into account the relative position of each image inside its group and with respect to the previous group . again , an extrapolation between center position values from the group and the previous group is computed using a weight factor . the weight factor is adjusted with respect to the position of the studied image into the range . the closer to the end is the images , the more the weight factor gives importance to the current group center position . once the position of the substructure 154 in the structure 152 has been identified in each images 150 , it is possible to remove the noise in each image 150 ( step 118 ). the computer first removes noise in the region that is outside a given radius from the center determined in step 116 . afterward , it erases the noise and fills empty regions in the structure 166 , knowing the position and size of the substructure . criteria for removal of noises are based on size , connectivity and relative positioning with respect to the substructure . an example of a processed image 160 is shown in fig4 of the appended drawings . fig4 corresponds to the image 150 of fig3 after step 118 is executed . after an image in the range has been processed and the substructure is well defined , the resulting images can be stored on the storing device 14 of the system 10 in the form of a contour map or as a filled structure ( step 120 ). an example of a filled structure image 162 ( or binary map ) corresponding to the images 150 and 160 is shown in fig5 where each pixel of the image 162 is either part of the substructure 154 , or of the rest of the structure ( see region 166 , in white on fig5 ). once all the images of the range have been segmented , a person skilled in the art can build a three dimensional model of the structure , comprising the substructure , by using the segmented images 162 and a conventional three - dimensional reconstruction system . fig6 and 8 of the appended drawings illustrate the use of the method according to this invention to segment medical images 170 of the sacrum 172 comprising the two foramens 174 . in the case of such a structure , all the step from 100 to 120 are executed as described hereinabove , except for the following differences : in step 108 another predefined segmentation strategy is selected to take into account the fact that there are now two additional cavities in the structures to identify in the images : the two foramens 174 ; and in step 110 , the user must now select additional guidance points for each foramen 174 . fig7 shows the image of fig6 after the noise removing step , while fig8 shows a binary map superimposed on a grey - level background and corresponding to fig7 . although the present embodiment has been described with bones as the structure , the structure represented on the images can be any physical object having at least one substructure that can be independently identified . although the present invention has been described hereinabove by way of preferred embodiments thereof , it can be modified , without departing from the spirit and nature of the subject invention as defined in the appended claims .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.